J Hum Genet (2007) 52:565–570 DOI 10.1007/s10038-007-0152-3

SHORT COMMUNICATION

Identification of a novel GPR143 mutation in a large Chinese family with congenital nystagmus as the most prominent and consistent manifestation

Jing Yu Liu Æ Xiang Ren Æ Xiufeng Yang Æ Tangying Guo Æ Qi Yao Æ Lin Li Æ Xiaohua Dai Æ Mingchang Zhang Æ Lejin Wang Æ Mugen Liu Æ Qing K. Wang

Received: 27 January 2007 / Accepted: 2 April 2007 / Published online: 22 May 2007 The Japan Society of Human Genetics and Springer 2007

Abstract Congenital nystagmus is characterized by candidate genes in the region revealed a novel p.S89F involuntary, rhythmical, repeated oscillations of one or mutation in the second transmembrane domain of both eyes. We studied a large Chinese family with nys- GPR143, a G protein-coupled receptor which causes tagmus as a prominent and consistent manifestation phe- ocular albinism when mutated. All male patients in the notype in nine patients to map and identify a disease- family were hemizygous for the mutation; the female causing gene for nystagmus. X-linked recessive inheri- carriers were heterozygous for the mutation. The p.S89F tance was observed in the family, and foveal hypoplasia mutation was not identified in 100 normal females or 100 was detected in some of the nine patients. The disease normal males. Our results indicate that a mutation in the gene was mapped to an approximately 10.6 Mb region GPR143 gene can cause a variant form of ocular albinism, flanked by DXS996 and DXS7593 on Xp22 with a with congenital nystagmus as the most prominent and only significant peak multipoint LOD score. Analysis of 21 consistent finding in all patients in this Chinese family. These results expand the spectrum of clinical phenotypes associated with GPR143 mutations. J.Y. Liu and X. Ren contributed equally to this work. Keywords Congenital nystagmus and consistent J. Y. Liu Á X. Ren Á Q. Yao Á X. Dai Á M. Liu (&) Á Q. K. Wang (&) manifestation Á GPR143 Á Mild ocular albinism Á Center for Human Genome Research and College of Life Linkage analysis Á Mutation Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, People’s Republic of China e-mail: [email protected] Introduction M. Liu e-mail: [email protected] Congenital nystagmus (CN) is a common oculomotor dis- X. Yang Á T. Guo order with a frequency of 1/1,500 live births (Patton et al. Development of Proof-Testing, Renmin Hospital of Tanghe, 1993). It is characterized by bilateral uncontrollable ocular Tanghe, Henan, People’s of Republic of China oscillations, reduced vision, and onset typically at birth or L. Li Á Q. K. Wang within the first few months of life. Patients’ oscillations can Department of Molecular Cardiology, Lerner Research Institute, be horizontal, vertical, or torsional, or any combination of Cleveland Clinic/NE40, Cleveland, OH 44195, USA these, although horizontal are the most common (Patton et al. 1993; Preising et al. 2001; Zhang et al. 2005). M. Zhang Department of Ophthalmology, Union Hospital, Reduced vision and poor depth perception are the major Huazhong University of Science and Technology, Wuhan, symptoms of patients with nystagmus. The etiology People’s Republic of China or molecular pathogenic mechanism of CN is largely unknown. L. Wang Eye Center, Peking University, Beijing, Multiple inheritance patterns have been described for People’s Republic of China CN, including X-linked dominant and X-linked recessive 123 566 J Hum Genet (2007) 52:565–570

(MIM 310700), autosomal dominant (MIM 164100), and Linkage and candidate genes mutation analysis autosomal recessive (MIM 257400) forms (Kerrison et al. 1999). Among these types, X-linked inheritance is the most Linkage analysis of the genotyping data was performed as common type, and two genetic loci for X-linked CN have described elsewhere (Wang et al. 2005). Genotyping was been mapped to Xp11.3–11.4 and Xq26–q27, respectively performed using 33 polymorphic markers covering the (Cabot et al. 1999; Guo et al. 2006; Kerrison et al. 1999; entire X chromosome. Eighteen markers that span the Zhang et al. 2005). Xq26–27, also known as NYS1, is the X-chromosome by every 10 cM were from the ABI Prism most common locus; the responsible gene has recently Linkage Mapping Set MD10 (performed as instructed by been identified as a FERM domain-containing 7 gene the manufacturer). The other markers were identified from (FRMD7) (Tarpey et al. 2006). Although three genetic loci the Marshfield Medical Genetics database (http:// for the autosomal dominant form have been mapped to research.marshfieldclinic.org/genetics/) and used for fine chromosomes 6p12, 7p11.2, and 13q31–q33 (Klein et al. mapping. The disease was specified as an X-linked reces- 1998; Kerrison et al. 1996, 1998; Ragge et al. 2003), the sive trait with penetration of 99% in males. We assumed a specific genes at these genetic loci have not yet been gene frequency of 0.00001. Pairwise logarithms of the odds identified. (LOD) scores and multi-point LOD scores were calculated Nystagmus can also occur in the setting of other retinal with the Linkage Package 5.2 software. diseases, including ocular albinism resulting from muta- Mutation analysis was conducted for all exons and tions in the GPR143 gene, also known as OA1, encoding a exon–intron boundaries of candidate genes using direct G-protein-coupled receptor, and X-linked congenital sta- DNA sequence analysis (Wang et al. 2005). tionary night blindness, caused by mutations in a calcium channel gene CACNA1F (Gottlob 2001). Restriction fragment length polymorphism (RFLP) We have identified and characterized a large six-gen- analysis eration Chinese family with X-linked recessive nystagmus. Nine individuals in the family are affected, all males. In The wild type allele contains a BslI restriction site, and addition to nystagmus some patients also suffer from mutation 266C fi T (GenBank accession number: foveal hypoplasia, myopia, amblyopia, and astigmatism. Z48804) disrupts this site. This enabled use of RFLP Linkage analysis of the family mapped the disease-causing analysis to confirm the mutation and to test whether the gene to Xp22.11–Xp22.32 with a significant multipoint mutation co-segregated with the disease in the family. LOD score of 8.89. Mutation analysis of candidate genes in Exon 2 of GPR143 containing the mutation was PCR- the region suggested that a novel mutation in the GPR143 amplified for all members of the family and for 200 (100 gene causes the disease in the family. males and 100 females) unrelated healthy Chinese indi- viduals, as described above. The 237-bp PCR product was digested with 1 unit BslI (NEB, USA) at 37C overnight, Subjects and methods and the resulting digestion products were separated on 2.5% agarose gel. The wild-type product can be cut by BslI Study subjects and isolation of human genomic DNA and yielded two bands of 144 and 93-bp. The mutant product cannot be cut by BslI, and only one 237-bp band The study participants were identified and enrolled at the was observed after electrophoresis. People’s Hospital of Nanyang County, Henan province, P.R. China. Informed consent was obtained from the par- ticipants in accordance with study protocols approved by Results the Ethics Committee of Huazhong University of Science and Technology. This study adhered to the tenets of the Clinical characterization of patients Declaration of Helsinki. The participants were clinically examined at the We identified a large, six-generation, non-consanguineous People’s Hospital of Nanyang County, the Eye Center of Chinese family with 36 living members, among whom Peking University, and the Union Hospital of Huazhong were eight living patients with nystagmus (Fig. 1A). University of Science and Technology. Ocular examina- Investigation of family history revealed one deceased tions were performed by slit lamp biomicroscopy and member had also had nystagmus. All affected individuals direct and indirect ophthalmoscopy. were males, and the inheritance pattern of the disease in the DNA was extracted from peripheral whole blood by use family was typical X-linked recessive (Fig. 1A). of a Wizard Genomic DNA Purification Kit (Promega, The proband (Fig. 1A, V-10) developed nystagmus with Madison, WI, USA). the horizontal oscillation before the age of six months. The 123 J Hum Genet (2007) 52:565–570 567

Fig. 1 A The pedigree structure of a Chinese family with CN. The proband is marked with an arrow. The family members participating in both clinical and follow-up mutation analysis are indicated by asterisks. B Iris and fundus photos from mutation carrier IV-14 (a, c) and the proband V-10 (b, d)

patient later developed astigmatism and amblyopia. The carrier IV-14 (Fig. 1B, c; Table 1). The female carriers in visual acuity of right and left eyes was 20/60 and 20/50, this family had normal visual acuity, except for carrier respectively. Examination of the iris revealed clear veins IV-14, and were free from nystagmus. and normal response to the light (Fig. 1B, b). Fundus examinations revealed the clear-cut boundary of optic disc, Genetic linkage analysis normal distribution of blood vessels, and retina pigmenta- tion (Fig. 1B, d). Foveal dysplasia was identified in the Analysis of the pairwise LOD scores identified positive proband (Fig. 1B, d) and three other patients (IV-10, linkage to marker DXS987 with a peak LOD score of 1.81 IV-16, V-9) (data not shown). In the skin and hair of these at a recombination fraction of 0 (data not shown). Addi- patients pigmentation was normal. tional markers flanking DXS987 were genotyped in the Patients IV-10, IV-16, V-7, and V-9 and obligate female family and the genotyping data were used for multipoint carrier IV-14 were also characterized clinically (Fig. 1; LOD score linkage analysis. Multipoint LOD scores Table 1). Pigmentation of skin and hair was normal. The reached a significant level and a peak multipoint LOD pigments in the macula were clear and regular in patients score of 8.89 was obtained at DXS987 (data not shown). IV-10 and carrier IV-14, but not in patients V-9 and IV-16. Our results suggest that the clinical phenotype in the family The myopia arcs were present in patients V-9, IV-16, and under study is linked to DXS987 on Xp22. The result of

123 568 J Hum Genet (2007) 52:565–570

Table 1 Clinical characteristics of five affected males (IV-10, IV-16, V-7 in Fig. 1 also carried the mutation (data not shown). V-7, V-9, V-10) and one carrier (IV-14) in a Chinese CN family with RFLP analysis also showed that the p.S89F mutation was GPR143 mutation p.S89F not present in 200 normal controls (100 males and 100 ID# Age CN Iris Fundus phenotype VA (R/L) Astigmatism females). The p.S89F mutation is located in the critical (a) bcdef transmembrane segment II of the G protein-coupled receptor (Fig. 2c). The p.S89F mutation occurs at a residue IV-10 26 + + + – + + – 20/40 + that is evolutionarily highly conserved from Xenopus and 20/60 fish to humans (Fig. 2d). These results strongly suggest that IV-16 31 + + + + – – + 20/650 + the p.S89F change is a pathogenic mutation for the disease 20/200 in the family. V-7 3 + + + – + – – 20/40 + 20/50 V-9 18 + + + + – – + 20/200 + Discussion 20/250 V-10* 18 + + + + + – – 20/60 + We have identified and characterized a six-generation 20/50 Chinese family with X-linked recessive nystagmus in all IV-14 40 – + + + + + + 20/200 – patients and foveal hypoplasia in some patients (Fig. 1A). 20/200 Linkage analysis with markers covering the entire X chromosome and follow-up haplotype analysis mapped the ID# is the patient identification number in Fig. 1A. Age is the age of diagnosis in years. CN, congenital nystagmus; VA, visual acuity. disease gene on chromosome Xp22. Mutation analysis *Patient V-10 had amblyopia identified a novel p.S89F mutation in the GPR143 gene. No a Normal iris, normal response to light and normal pigmentation (+ mutation was identified in twenty other candidate genes yes; – no) analyzed. These results strongly suggest that the p.S89F b Clear boundary of disc (+ yes; – no) mutation causes the disease in the family. c Mottling retina pigmentation (+ yes; – no) The GPR143 gene (or OA1) consists of nine exons and d Clear and neat pigmentation in macula (+ yes; – no) encodes a 439-kDa protein of 404 amino acids with e Existence of reflex light in fovea centralis (+ yes; – no) homology to seven transmembrane segments, a G protein- f Myopia arc (+ yes; – no) coupled receptor (Bassi et al. 1995). It was originally identified by positional cloning as a gene that, when mu- tated, caused ocular albinism, a disease characterized by haplotype analysis defined the boundaries of the disease absent or decreased ocular pigmentation, reduced visual locus between DXS996 and DXS7593, a region of acuity, and photophobia (Schiaffino et al. 1996). Although approximately 10.6 Mb. many mutations in GPR143 have been identified in patients (Camand et al. 2003; Schiaffino and Tacchetti 2005; Identification of a novel mutation in GPR143 Mayeur et al. 2006), the p.S89F mutation is the first GPR143 mutation found in the Chinese population. Twenty-one genes located in the disease locus were ana- The achiasma syndrome has also been observed in a lyzed as the candidate genes for nystagmus on the basis of patient with nystagmus (Korff et al. 2003). Misrouting of their potential physiological functions and their expression the optic fibers in some patients with ocular albinism has in the nervous system. Direct sequence analysis revealed been revealed by use of visually evoked magnetic fields mutation of a C to T transition at nucleotide 266 of (VEFs) (Ohde et al. 2004; Lauronen et al. 2005). Func- GPR143 (or OA1; GenBank accession # Z48804) in the tional magnetic resonance imaging (fMRI) studies of some proband and his mother (carrier) (Fig. 2a). The mutation patients with oculocutaneous albinism revealed abnormal- leads to a substitution of a highly conserved amino acid ities in the optic nerve head (Kasmann-Kellner et al. 2003; residue serine with a phenylalanine residue at codon 89 Morland et al. 2001). We performed fMRI on patient V-10 (p.S89F). Detection of mutation p.S89F was further con- but no remarkable abnormalities were identified. firmed by RFLP analysis which showed the presence of the Nystagmus has been reported in ocular albinism patients hemizygous mutant allele (237-bp band) in male patients with mutations in GPR143 (Preising et al. 2001). Genetic IV-2, V-1, V-2, and IV-6 (Fig. 2b), both wild type and and clinical analysis revealed that the Chinese family under mutant alleles (143 and 94 bps bands) in female carriers study has a variant phenotype of ocular albinism, because a (individuals III-1, III-2, IV-4 in Fig. 2b), and homozygous mutation in GPR143/OA1 was identified, and foveal and hemizygous wild type alleles in normal family mem- hypoplasia and reduced visual acuity, in addition to nys- bers (individuals IV-1, III-3, IV-3, IV-5 in Fig. 2b). Patient tagmus, were observed for some patients in the family. 123 J Hum Genet (2007) 52:565–570 569

Fig. 2 a Identification of a novel mutation c.266C > T (p.S89F) in the GPR143 receptor with seven putative transmembrane a-helices the GPR143 gene in the Chinese family with CN. DNA sequences for (TM I to VII) (modified from d’Addio et al. 2000). The GPR143 a normal family member (IV-9 in Fig. 1)(upper), the proband V-10 protein is inserted within the melanosomal membrane with the N- (middle), and female carrier IV-14 (bottom) are shown. The C to T terminus toward the melanosomal lumen and the C-terminus toward change at codon 89 results in substitution of a Ser residue by a Phe the cytoplasm. Hydrophilic lumenal and intracellular loops are residue in exon 2 of the GPR143 gene (GenBank accession number indicated by e1–3 and i1–3, respectively. The location of 24 Z48804). b RFLP analysis showing that GPR143 mutation p.S89F co- independent missense mutations and three nonsense mutations (with segregates with nystagmus in the family. The first lane shows 100 bp X) identified in GPR143 are marked (from the OA1 mutation molecular weight ladder. The p.S89F mutation abolishes a BSlI database Camand et al. 2003; Mayeur et al. 2006). The p.S89F restriction site. The PCR fragment was 237-bp. The wild type PCR mutation identified in this study is indicated by an asterisks and is at product can be cut by BSlI, yielding two shorter DNA fragments of the second putative transmembrane a-helix. d The alignment of amino 143 and 94 bp. The fragment containing mutation p.S89F cannot be acids around S89 revealed evolutionary conservation of this residue cut by the BSlI enzyme. Separate RFLP analysis showed that from Fugu, Danio, Xenopus, Gallus, and Mus to Homo. Dark shading individual V-7 in Fig. 1A also carried the mutation (data not shown). indicates residues conserved in six sequences; diamonds indicate sites The PCR primers used for RFLP analysis are 237-1/forward, 5¢- of missense mutations reported and identified in ocular alinism TTTCCAAAGCAAGAAGTCAGC-3¢ and 237-1/reverse, 5¢- patients (Schiaffino et al. 2005). The location of the p.S89F mutation TGCGATTTGAGGAGCATAAG -3¢. c The putative structure of identified in this study is marked with an arrowhead

None of the patients in the family had the complete clas- mutations, because many are deletion, frameshift, and sical phenotype of ocular albinism. nonsense mutations (Mayeur et al. 2006). Some GPR143 GPR143 is expressed mainly in pigment cells of the skin mutations had defective glycosylation and were retained in and eyes. It is located on the membrane of an intracellular the endoplasmic reticulum (Shen and Orlow 2001). A organelle—the melanosomes in pigment cells—and regu- similar phenotype to human ocular albinism patients, lates the biogenesis and maturing of melanosomes (Preis- including hypopigmentation of the ocular fundus and the ing et al. 2001; Schiaffino and Tacchetti 2005). GPR143 presence of giant melanosomes formed by abnormal mutations that cause ocular albinism are loss-of-function growth of single melanosomes, has also been observed in

123 570 J Hum Genet (2007) 52:565–570 knockout mice deficient in GPR143 (Schiaffino and nystagmus linked to chromosome 6p12. Am J Ophthal 125:64– Tacchetti 2005). 70 Kerrison JB, Vagefi MR, Barmada MM, Maumenee IH (1999) The molecular pathogenic mechanism for nystagmus is Congenital motor nystagmus linked to Xq26–q27. Am J Hum unknown. It may result from instability of the ocular motor Genet 64:600–607 system (Dell’Osso and Flynn 1974). Changes in the ultra- Klein C, Vieregge P, Heide W, Kemper B, Hagedorn-Geriwe M, structure of the extraocular muscle of congenital nystag- Hagenah J et al (1998) Exclusion of chromosome regions 6p12 and 15q11, but not chromosome region 7p11, in a German mus patients have been detected by transmission electron family with autosomal dominant congenital nystagmus. Genom- microscopy (Peng et al. 1998). It is likely that the GPR143 ics 54:176–177 mutations may disrupt a key signal-transduction pathway Korff CM, Apkarian P, Bour LJ, Meuli R, verrey JD, Roulet Perez E and cause instability in the motor system controlling the (2003) Isolated absence of optic chiasm revealed by congenital nystagmus, MRI and VEPs. Neuropediatrics 34:219–223 eye movement. The specific molecular mechanism by Lauronen L, Jalkanen R, Huttunen J, Carlsson E, Tuupanen S, Lindh which the GPR143 p.S89F mutation causes nystagmus and S et al (2005) Abnormal crossing of the optic fibres shown by foveal dysplasia is not clear, however, and future func- evoked magnetic fields in patients with ocular albinism with a tional studies may shed light on this issue. novel mutation in the OA1 gene. Br J Ophthalmal 89:820–824 Mayeur H, Roche O, Vetu C, Jaliffa C, Marchant D, Dollfus H et al (2006) Eight previously unidentified mutations found in the OA1 Acknowledgments We are grateful to the family members for their ocular albinism gene. BMC Med Genet 7:41–48 enthusiastic participation in this study, and to Xiangming Guo and Yi Morland AB, Baseler HA, Hoffmann MB, Sharpe LT, Wandell BA Xiang for advice on clinical diagnosis of CN and OA. This study was (2001) Abnormal retinotopic representations in human visual supported by the National High Technology ‘‘863’’ Programs of cortex revealed by fMRI. Acta Psychol (Amst) 107:229–47 China (no. 2002BA711A07), the ‘‘Tenth Five-Year’’ Science and Ohde H, Shinoda K, Nishiyama T, Kado H, Haruta Y, Mashima Y Technology Program (no. 2004BA720A), and a Chinese National et al (2004) New method for detecting misrouted retinofugal Natural Science Foundation grant (no. 30670736). Q.K.W. is an fibers in humans with albinism by magnetoencephalography. Vis Established Investigator of the American Heart Association Res 44:1033–1038 (0440157N). Patton MA, Jefery S, Lee N, Hogg C (1993) Congenital nystagmus cosegregating with a balanced 7;15 translocation. J Med Genet 30:526–528 References Peng GH, Zhang C, Yang JC (1998) Ultrastructural study of extraocular muscle in congenital nystagmus. Ophthalmologica d’Addio M, Pizzigoni A, Bassi MT, Baschirotto C, Valetti C, Incerti 212:1–4 B, Clementi M, De Luca M, Ballabio A, Schiaffino MV (2000) Preising M, Op de Laak JP, Lorenz B (2001) Deletion in the OA1 Defective intracellular transport and processing of OA1 is a gene in a family with congenital X linked nystagmus. Br J major cause of ocular albinism type 1. Hum Mol Genet 9:3011– Ophthalmol 85:1098–1103 3018 Ragge NK, Hartley C, Dearlove AM, Walker J, Russell-Eggitt I, Bassi MT, Schiaffino MV, Renieri A, De Nigris F, Galli L, Bruttini M Harris CM (2003) Familial vestibulocerebellar disorder maps to et al (1995) Cloning of the gene for ocular albinism type 1 from chromosome 13q31–q33: a new nystagmus locus. J Med Genet the distal short arm of the X chromosome. Nat Genet 10:13–19 40:37–41 Cabot A, Rozet JM, Gerber S, Perrault I, Ducroq D, Smahi A, Souied Schiaffino MV, Tacchetti C (2005) The ocular albinism type 1 (OA1) E, Munnich A, Kaplan J (1999) A gene for X-linked idiopathic protein and the evidence for an intracellular signal transduction congenital nystagmus (NYS1)maps to chromosome Xp11.4– system involved in melanosome biogenesis. Pigment Cell Res p11.3. Am J Hum Genet 64:1141–1146 18:227–233 Camand O, Boutboul S, Arbogast L, Roche O, Stereberg C, Schiaffino MV, Baschirotto C, Pellegrini G, Montalti S, Tacchetti C, Sutherland J et al (2003) Mutational analysis of the OA1 gene De Luca M, Ballabio A (1996) The Ocular Albinism type 1 in ocular albinism. Ophthal Genet 24:167–173 (OA1) gene product is a membrane glycoprotein localized to Dell’Osso LF, Flynn JT, Daroff RB (1974) Hereditary congenital melanosomes. Proc Natl Acad Sci USA 93:9055–9060 nystagmus: an intrafamilial study. Arch Ophthalmol 92:366–374 Shen B, Orlow SJ (2001) The ocular albinism type 1 gene product is Gottlob I (2001) Nystagmus. Curr Opin Ophthalmol 12:378–383 an N-glycoprotein but glycosylation is not required for its Guo X, Li S, Jia X, Xiao X, Wang P, Zhang Q (2006) Linkage subcellular distribution. Pigment Cell Res 14:485–490 analysis of two families with X-linked recessive congenital Tarpey P, Thomas S, Sarvananthan N, Mallya U, Lisgo S, Talbot CJ motor nystagmus. J Hum Genet 51:76–80 et al (2006) Mutations in FRMD7, a newly identified member of Kasmann-Kellner B, Schafer T, Krick CM, Ruprecht KW, Reith W, the FERM family, cause X-linked idiopathic congenital nystag- Schmitz BL (2003) Anatomical differences in optic nerve, mus. Nat Genet 38:1242–1244 chiasma and tractus opticus in human albinism as demonstrated Wang Q, Liu M, Xu C, Tang Z, Liao Y, Du R et al (2005) Novel by standardized clinical and MRI evaluation. Klin Monatsbl CACNA1S mutation causes autosomal dominant hypokalemic Augenheilkd 220:334–344 periodic paralysis in a Chinese family. J Mol Med 83:203–208 Kerrison JB, Arnould VJ, Barmada MM, Koenekoop RK, Zhang B, Xia K, Ding M, Liang D, Liu Z, Pan Q et al (2005) Schmeckpeper BJ, Maumenee IH (1996) A gene for autosomal Confirmation and refinement of a genetic locus of congenital dominant congenital nystagmus localizes to 6p12. Genomics motor nystagmus in Xq26.3–q27.1 in a Chinese family. Hum 33:523–526 Genet 116:128–131 Kerrison JB, Koenekoop RK, Arnould VJ, Zee D, Maumenee IH (1998) Clinical features of autosomal dominant congenital

123