Dopamine Desynchronizes the Retinal Clock Through a Melanopsin-Dependent Regulation of Acetylcholine Retinal Waves During Development

bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Dopamine desynchronizes the retinal clock through a melanopsin-dependent regulation of acetylcholine retinal waves during development

Chaimaa Kinane1,2, Hugo Calligaro1, Antonin Jandot1, Christine Coutanson1, Nasser Haddjeri1 Mohamed Bennis2, Ouria Dkhissi-Benyahya1*

1 Univ Lyon, Université Lyon 1, Inserm, Stem Cell and Brain Research Institute U1208, 69500 Bron, France. 2 Laboratory of Pharmacology, Neurobiology, Anthropology, and Environnement, Cadi Ayyad University, Marrakech, Morocco.

*: corresponding author

Ouria Dkhissi-Benyahya INSERM U1208, Stem Cell and Brain Institute Chronobiology and Affective Disorders 18 avenue du Doyen Lépine, 69500, Bron, France Tel: (33) 472913487 Fax: (33) 472913461 Email: [email protected]

The authors disclose any financial conflict of interest. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Abstract

2 3 Dopamine (DA) plays a critical role in retinal physiology, including resetting of the retinal 4 circadian clock that in turn regulates DA release. DA acts on major classes of retinal cells by 5 reconfiguring electrical and chemical synapses. Although a bidirectional regulation between 6 intrinsically photosensitive melanopsin ganglion cells (ipRGCs) and dopaminergic cells has 7 been demonstrated during development and adulthood, DA involvement in the ontogeny of the 8 retinal clock is still unknown. 9 Using wild-type Per2Luc and melanopsin knockout (Opn4-/-::Per2Luc) mice at different postnatal 10 stages, we found that the retina can generate self-sustained circadian rhythms from postnatal 11 day 5 that emerge in the absence of external time cues in both genotypes. Intriguingly, DA 12 lengthens the endogenous period only in wild-type retinas, suggesting that this desynchronizing 13 effect requires melanopsin. Furthermore, blockade of cholinergic retinal waves in wild-type 14 retinas induces a shortening of the period, similarly to Opn4-/-::Per2Luc explants. Altogether, 15 these data suggest that DA desynchronizes the retinal clock through a melanopsin-dependent 16 regulation of acetylcholine retinal waves, thus offering a new role of melanopsin in setting the 17 period of the retinal clock during development. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

18 Introduction

19 Dopamine (DA) is a key neurotransmitter, synthesized and released by a sparse population of 20 retinal amacrine cells. Hence, DA is implicated in daily and circadian retinal functions, 21 including phase resetting of the retinal circadian oscillator (Ruan et al., 2008), adaptation to 22 light, clock gene regulation (Jackson et al., 2012; Witkovsky, 2004; Yujnovsky et al., 2006), 23 photoreceptor, amacrine and ganglion cell coupling (Arroyo et al., 2016; Hampson et al., 1992; 24 Ribelayga et al., 2008) and eye development (Zhou et al., 2017).

25 Besides, DA triggers a wide array of intracellular changes via two classes of dopaminergic

26 receptors: the D1-type (D1R and D5R) are coupled to Gαs/olf and stimulate the production of 27 cAMP and the activity of protein kinase A, whereas the D2-type (D2R, D3R, and D4R) are

28 coupled to Gαi/o and negatively regulate cAMP, resulting in a decrease in protein kinase A 29 activity (Seeman and Van Tol, 1994). Most retinal cells, including Müller glial cells, can be 30 modulated by DA as they express at least one type of dopaminergic receptors. In rodents, rods 31 and cones express D4Rs and may express D2Rs in some species (Goyal et al., 2020; Witkovsky, 32 2004), whereas horizontal, bipolar, amacrine, and ganglion cells mainly express D1Rs 33 (Derouiche, 1999; Farshi et al., 2016; Nguyen-Legros et al., 1997; Popova, 2014; Travis et al., 34 2018; Veruki, 1997). In the adult, DA is assumed to act on the retinal circadian clock through 35 D1Rs, whereas D2Rs play a role in the induction of the Per clock gene by light (Jackson et al., 36 2012; Ribelayga and Mangel, 2003; Ribelayga et al., 2008; Yujnovsky et al., 2006).

37 Despite the description of retinal dopaminergic neurons several decades ago, their roles in the 38 development of the retinal circadian clock functioning are poorly understood. The mammalian 39 retinal clock is composed of an integrated network of cellular clocks localized throughout the 40 retina (Dkhissi-Benyahya et al., 2013; Dorenbos et al., 2007; Jaeger et al., 2015; Ruan et al., 41 2008; Schneider et al., 2010) that give rise to the rhythmic regulation of retinal physiology and 42 function in the adult. Even if clock gene expression has been recently reported at embryonic 43 stages in the mouse retina (Bagchi et al., 2020), remarkably, it is still unknown when retinal 44 cells first express circadian rhythms and how they synchronize during development. DA 45 synthesis and release are regulated by the retinal circadian clock (Buonfiglio et al., 2014; Doyle 46 et al., 2002; Felder-Schmittbuhl et al., 2018, 2017; Iuvone et al., 1978). Moreover, 47 dopaminergic cell activity has been shown to be stimulated by rods, cones, and/or melanopsin 48 intrinsically photosensitive retinal ganglion cells (ipRGCs) upon illumination (Pérez-Fernández 49 et al., 2019; Zhang et al., 2007; Zhao et al., 2017). In turn, ipRGCs stratify with dopaminergic 50 cells during development and adulthood (Renna et al., 2015; Vugler et al., 2007) to convey bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

51 retrograde signalling (Prigge et al., 2016; Wang et al., 2008). Furthermore, Munteanu and 52 colleagues suggested that melanopsin does not play a critical role in setting dopaminergic cell 53 number and DA levels in the developing mouse retina (Munteanu et al., 2018). However, we 54 have previously shown that the adult melanopsin knockout mouse (Opn4-/-) exhibits a 55 dysfunction of the retinal dopaminergic system and a shortening of the endogenous period of 56 the retinal clock (Calligaro et al., 2019; Dkhissi-Benyahya et al., 2013). Interestingly, during 57 development, a bidirectional regulation between ipRGCs and cholinergic retinal waves has been 58 suggested (Arroyo et al., 2016; Kirkby and Feller, 2013). Particularly, ipRGCs were shown to 59 modulate the circuitry of cholinergic retinal waves in the neonatal retina even in darkness 60 (Renna et al., 2011). These waves consist of spontaneous periodic bursts of ganglion cell 61 activity (Ackman et al., 2012; Wong et al., 1993), observed from postnatal day 1 (P1) to P9- 62 P11 (Blankenship and Feller, 2010; Feller et al., 1996). In turn, in the absence of cholinergic 63 waves, dopaminergic signalling modulates the extent of ipRGCs gap junction coupling in the 64 developing retina (Arroyo et al., 2016; Kirkby and Feller, 2013).

65 In the current study, we first established the onset and the fundamental features of the retinal 66 clock in the Per2Luc wild-type and the Opn4-/-::Per2Luc mice during development and then 67 determined whether DA plays a crucial role in retinal clock ontogeny. We then analyzed 68 whether the absence of melanopsin would affect the maturation of the retinal clock during 69 development.

71 Results

72 First detection of retinal PER2::Luc circadian oscillations in vitro at postnatal day 5

73 Retinal explants from embryonic day 18 (E18), different postnatal stages (P1, P5, P8, P11, P15, 74 P30), and from adult (P60-90) Per2Luc mouse were continuously recorded for at least six days

75 without medium change (Figure 1A-2A; Supplementary Figure 1). A first rhythmic expression 76 of PER2::Luc was observed at P5 after 2 days in vitro, which became more robust, with higher 77 amplitude from P8. During retinal maturation, the endogenous period was significantly 78 shortened between P8 and P11 (respectively 26.35 ± 0.12 h and 25.54 ± 0.07 h; p < 0.001), and 79 between P15 and P30 (respectively 25.71 ± 0.24 h and 24.55 ± 0.08 h; p < 0.001; Figure 1B). 80 Then, it was lengthened between P30 and adulthood (25.19 ± 0.14 h; p ≤ 0.01). The phase of 81 PER2::Luc expression was constant from P5 (CT 11.58 ± 1.83) to P11 (CT 13.05 ± 0.35; p ≥ 82 0.05), then was progressively delayed between P11 and P15 (CT 16.54 ± 0.39; p ≤ 0.001), and bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

83 from P15 to P30 (CT 20.40 ± 0.65; p ≤ 0.001). No significant difference was detected between 84 P30 and the adult (CT19.57 ± 0.61; p ≥ 0.05). The amplitude of PER2::Luc oscillations 85 increased from P5 to P30 (P5:12.27 ± 1.14 cps; P8: 30.51 ± 2.04 cps; P11: 56.34 ± 4.58 cps; 86 P15: 267.60 ± 83.42 cps; and P30: 604.80 ± 68.50 cps), followed by a significant reduction 87 between P30 and the adult (143.43 ± 23.85 cps; p ≤ 0.001).

88 Impact of the absence of melanopsin on the ontogeny of the retinal clock

89 We previously described a loss of clock gene rhythms in the photoreceptor layer of the Opn4-/- 90 mouse (Dkhissi-Benyahya et al., 2013). Hence, we decided to analyze the impact of the absence 91 of melanopsin on the retinal clock’s fundamental features. Similar to the wild-type mouse, 92 PER2::Luc oscillations started at P5 in the Opn4-/-::Per2Luc mouse and became more robust with 93 a higher amplitude from P8 (Figure 1A). The main difference between both genotypes 94 concerned the period that was significantly shortened at all developmental stages (excepting -/- Luc 95 P11) in Opn4 ::Per2 retinal explants (P8: 25.19 ± 0,41 h; P15:24.55 ± 0.19 h; adult: 24.24 ± 96 0.16 h; p≤0.01, Figure 1B). A significant delay and advance of the phase of PER2::Luc 97 oscillations were respectively observed at P8 (CT 18.80 ± 0.73; p≤0.001) and P15 (CT 13.51 ± 98 0.28; p≤0.001) in retinal explants from Opn4-/-::Per2Luc mouse compared to the wild-type 99 mouse that was not observed in the adult. The amplitude of retinal PER2::Luc oscillations is 100 mainly similar between genotypes at the different developmental stages.

101 Spontaneous PER2::Luc oscillations develop in vitro

102 As circadian oscillations were undetectable before P5, and in order to determine whether 103 rhythms could eventually develop in vitro, we cultured retinal explants from P1 Per2Luc mice 104 for 9 days without medium change (Figure 2A). These explants did not express rhythms for the 105 first days in culture, then spontaneous oscillations with low amplitude were observed after 5 106 days in vitro (5-DIV P1) in all retinal explants. We thus compared the circadian parameters of 107 5-DIV P1 retinal explants with P5 cultured retinal explants (Figure 2B). No differences were 108 observed in both the endogenous period (5-DIV P1: 27.22 ± 0.18 h, n=5; P5: 26.35 ± 0.62 h, 109 n=6; p = 0.25), and the phase (5-DIV P1: CT 10.85 ± 1.36; P5: CT 11.58 ± 1.83; p = 0.76) 110 between both conditions, whereas the amplitude was higher in P5 cultured explants (5-DIV P1: 111 4.92 ± 1.78 cps; P5: 12.27 ± 1.14 cps; p = 0.006).

112 Effect of DA on PER2::Luc retinal rhythms during development in the wild-type mouse bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

113 Despite the important role of DA in resetting the retinal circadian clock, its role in the ontogeny 114 of this oscillator remains unknown. We first examined whether DA is required for the 115 generation of PER2::Luc rhythms. Retinal explants were treated at P8, P15, and P30 with both 116 L-AMPT and Res, an inhibitor of DA synthesis and of vesicular DA uptake, respectively, and 117 compared to untreated retinas (Figure 3A). At the 3 developmental stages, PER2::Luc rhythms 118 persisted after DA depletion, with no changes in the endogenous period at P8 and P15 119 (respectively 26.45 ± 0.23 h and 25.50 ± 0.25 h; (p ≥ 0.05) whereas a slight lengthening was 120 observed at P30 (24.94 ± 0.11 h; p≤0.05) by comparison to non-depleted retinas of the same 121 stage (p ≥ 0.05). DA depletion had also no effect on the phase of PER2::Luc oscillations at P8 122 (CT 11.51 ± 0.87), induced a small advance at P15 (DA-depleted retinas: CT 14.73 ± 0.27; 123 controls: CT 16.54 ± 0.39; p≤0.05) and P30 (DA-depleted retinas: CT18.17 ± 0.50; controls: 124 CT 20.40 ± 0.65; p≤0.05) whereas the amplitude was increased at P8 (74.72 ± 32.05 cps) and 125 P15 (580.14 ± 30.50 cps). These results suggest that DA is not required for the generation of 126 PER2::Luc rhythm during the mammalian retinal clock development. We then treated retinal 127 explants from the same developmental stages (P8, P15, and P30) with DA, or Apo, a non- 128 selective DA agonist (Figure 3A). An important result was that the supplementation in DA or 129 Apo in P8 retinal explants significantly lengthened the endogenous period (DA: 27.17 ± 0.13 h; 130 Apo: 27.54 ± 0.15 h, p≤0.01), delayed the phase (DA: CT 15.69 ± 1.01; Apo: CT 16.89 ± 0.50, 131 p≤0.01) and increased the amplitude (DA: 177.98 ± 33.99 cps; Apo: 177.16 ± 25.28 cps) of 132 PER2::Luc oscillations by comparison to non-supplemented explants. Both drugs also 133 lengthened the period at P30 (DA: 25.53 ± 0.22 h; Apo: 26.76 ± 0.73 h, p≤0.01). The effect of 134 DA supplementation on the amplitude of the retinal rhythm was the more variable, with an 135 increase at P8 and P15 (p≤0.05) and a decrease at P30 (p≤0.01). We did not observe any effect 136 of DA supplementation in the period of PER2::Luc oscillation (25.67 ± 0.43 h) in the adult 137 (data not shown). We then investigated whether DA supplementation may affect the onset of 138 spontaneous oscillations of PER2::Luc in vitro. As shown in supplementary Figure 2, P1 retinal 139 explants could not express circadian oscillations in the presence of DA for the first 5 days in 140 culture (5-DIV P1 + DA). Furthermore, as observed in the non-supplemented 5-DIV P1 retinas, 141 the oscillations began to emerge after 5 days in vitro with very low amplitudes. No significant 142 differences were observed in the period and the phase between 5-DIV P1 explants 143 supplemented in DA and P5 retinal explants.

144 The effect of DA on the retinal circadian clock is mediated by both D1 and D2 145 dopaminergic receptors and gap junctions bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

146 During development, we observed that the endogenous period of PER2::Luc oscillations was 147 progressively shortened from P8 to P30 and that the application of DA lengthened this clock 148 parameter. To determine which dopaminergic receptors mediate this effect, we focused on the 149 P8 stage. Retinal explants were first treated with the D1R SCH39166 or the D2R L741626 150 antagonists to characterize their respective effects on the clock. As shown in figure 3B, the 151 application of SCH39166 or L741626 at these concentrations did not change the period 152 (respectively: 26.76 ± 0.21 h and 26.69 ± 0.34 h) and the amplitude, with a slight delay of the 153 phase only with L741626 (CT13.77 ± 0.43, p = 0.04) compared to control retinas. We further 154 combined DA treatment with SCH39166 or L741626. Both combinations blocked or reduced 155 the effect of DA on the period (p≤0.01) of PER2::Luc oscillations. In addition, the period 156 lengthening was also observed when P8 retinal explants were treated with carbenoxolone 157 (CBX, 100 µM), a general gap junction blocker (Figure 3B; p≤0.01).

-/- 158 DA does not alter the period of PER2::Luc retinal rhythms in the Opn4 mouse during 159 development

160 Since the supplementation of DA at P8 and P30 lengthened the period of PER2::Luc rhythms 161 in wild-type retinal explants, we analyzed the effect of DA in retinal explants from Opn4-/- 162 ::Per2Luc mouse at both stages. Contrary to what had been observed in the wild-type retinal 163 explants, in the melanopsin knockout explants, DA did not lengthen the period and advanced 164 the phase at P8 (Figure 4; CT 14.50 ± 0.28; p≤0.01). In both genotypes, the amplitude was 165 increased at P8 (p≤0.01). Then, we assessed whether the absence of DA effect on the period 166 could be related to the differential relative expression of D1- (D1 and D5 receptors)- and D2- 167 like (D2 and D4) receptors at P8 and P30 (Figure 5). At P8, no difference was observed in the 168 relative expression of both D1- and D2-like receptors between genotypes, whereas at P30, 169 expressions of D1R and D2R mRNAs were significantly increased in the retinas of Opn4-/- 170 mouse compared to wild-type mouse (for D1R; wild-type: 1.15 ± 0.05 and Opn4-/-: 1.65 ± 0.06, 171 p <0.01; for D2R; wild-type: 2.18 ± 0.17 and Opn4-/-: 3.90 ± 0.23, p <0.01). No differences 172 were observed for D4Rs and D5Rs at both stages. Finally, if cholinergic retinal waves are 173 involved in the setting of the retinal period through DA, blocking them in wild-type retinal 174 explants should result in a pattern similar to what we observed in Opn4-/- explants. As predicted, 175 the blockade of retinal waves by MMA, an antagonist of nicotinergic receptors, significantly 176 shortened the period and delayed the phase of PER2::Luc oscillations in P8 wild-type retinal 177 explants (Figure 6).

178 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

179 Discussion

180 In the mouse SCN, in vivo detectable fetal rhythms have been reported for Per1 mRNAs at E17 181 and E18 for PER1 and PER2 proteins (Ansari et al., 2009; Shimomura et al., 2001), whereas in 182 vitro studies detected PER2::LUC oscillations earlier at E13 (Landgraf et al., 2015) or E15 183 (Wreschnig et al., 2014). In the present study, we detected the first weak PER2::Luc retinal 184 oscillations at P5, which can be considered a critical time in the maturation of the retinal clock. 185 Per2 expression was previously described in the inner part of the neuroblastic rat retina at P1 186 (Matějů et al., 2010), and a recent transcriptomic study reported that Per2 is already expressed 187 at E13 with a peak at P0 in the mouse retina (Bagchi et al., 2020). Thus, we cannot exclude that 188 before P5, distinct cell populations may express PER2::Luc rhythms with different phases 189 (Dkhissi-Benyahya et al., 2013), resulting in low amplitude rhythmicity difficult to detect at the 190 level of the whole retina. From which retinal cells do circadian oscillations emerge? During 191 development, the rhythmic bioluminescence signal could arise from different cell populations. 192 In mice, retinal neurogenesis occurs between E11 and P10, prior to eye-opening at P14. Early 193 progenitor cells that exit mitosis ﬁrst generate ganglion and horizontal cells, along with cone 194 photoreceptors and some amacrines while later progenitor cells give rise to late-born amacrine, 195 rod, bipolar, and Müller glial cells (Bassett and Wallace, 2012; Belliveau and Cepko, 1999; 196 Young, 1985). At P5, ganglion cells and cones are already present, and the inner part of the 197 neuroblastic retina will give rise to the inner nuclear layer (INL) that becomes functional at the 198 end of the first postnatal week (Sernagor et al., 2001). Thus, we can assume that the signal first 199 arises from the inner retina since the INL was reported as the primary source of rhythmic 200 PER2::Luc signals in the adult retina (Ruan et al., 2008).

201 Another important question is when the retina is able to sustain rhythms without maternal 202 influence. This issue has been addressed by examining retinal rhythms over time in culture. 203 When retinal explants obtained from P1 Per2Luc mice are left in culture, they began to express 204 spontaneous circadian oscillations in vitro around 4-5 days after culture’s beginning. This 205 suggests an autonomous developmental program that ensues in isolated retinas without the 206 influence of external signals. Accordingly, we found that the endogenous period and the phase 207 of 5-DIV P1 and P5 retinal explants were similar, suggesting that the timing of the development 208 of PER2::Luc oscillations is roughly identical between in vivo and in vitro at least for the first 209 5 days period in culture. For the SCN, contradictory results have been observed. One study 210 reported that even if SCN explants did not initially show PER2::Luc rhythms at E14, then they 211 express them after 4-5 days in vitro (Wreschnig et al., 2014), whereas others did not find bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

212 evidence that SCN becomes circadian spontaneously in vitro (Carmona-Alcocer et al., 2018; 213 Landgraf et al., 2015).

214 The retinal clock then develops gradually, with, in particular, a shortening of the endogenous 215 period in both wild-type and Opn4-/- mouse suggesting that cellular/layer oscillators 216 progressively amplify and synchronize their genetic oscillations to drive coherent rhythms at 217 the level of the whole retina. Indeed, cultures of isolated retinal layers or dissociated cells 218 exhibit a lengthening of the period by comparison to whole retinal explants in the adult (Jaeger 219 et al., 2015). Circadian oscillations are expressed at P5, an age when few synapses are present 220 in the mouse retina. Indeed, first synapses in the IPL and the OPL appear in postnatal ages and 221 continues for several weeks, reaching their peak at P21 (Tian, 2004), suggesting that other 222 mechanisms could mediate synchrony before synapse formation. With a blocker of gap 223 junctions, our results indicate that they play a role in establishing the onset of synchrony during 224 the early stages of retinal clock development by unknown mechanisms. Besides, we have 225 recently reported that the invalidation of melanopsin in the adult mouse shortens the 226 endogenous period of the retinal clock (Calligaro et al., 2019), an alteration that was already 227 observed when the first PER2::Luc oscillations are detected in the Opn4-/- mouse. This 228 implicates that melanopsin is involved in regulating the endogenous period of the retinal clock 229 with a still non elucidated mechanism. 230 A good candidate for mediating the coupling between retinal cells during development is DA. 231 Indeed, this neurotransmitter is released by amacrine cells whose processes make contacts 232 within the inner and outer plexiform layers and has been shown to activate the transcriptional 233 activity of the clock (Yujnovsky et al., 2006). In rodent retina, dopaminergic amacrine cells 234 develop from the first days after birth, with a low DA level before P6 that rapidly increases in 235 the following days (Martin-Martinelli et al., 1989; Wulle and Schnitzer, 1989). Surprisingly, 236 while coupling within the adult mouse retinal clock did not rely on DA, the supplementation of 237 DA or CBX early during the development significantly lengthen the period of PER2::Luc 238 oscillations in the wild-type mice. This DA effect was blocked either by D1R- or D2R-like 239 antagonists. The involvement of both DA receptor families was not surprising since DA was 240 well known to modulate the phosphorylation of gap junctions by activating different 241 intracellular pathways leading to an increase or decrease of their conductance across diverse 242 neurons in the adult retina (Bloomfield and Volgyi, 2009). Thus, our result suggests that DA 243 modulates the fundamental features of the retinal clock by changing the extent of gap junction 244 coupling in the developing retina as recently suggested (Arroyo et al., 2016; Caval-Holme and bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

245 Feller, 2019). The most striking result concerns the fact that DA did not lengthen the period of 246 Opn4-/- retinal explants but only at P8, suggesting that melanopsin expression is necessary for 247 the desynchronizing effect of DA on the retinal clock at this stage. At P8, ipRGCs are the only 248 functional photoreceptors, and even in the absence of light, these cells have been shown to 249 modulate the plasticity of retinal cholinergic wave circuitry in the neonatal retina (Renna et al., 250 2011) via DA release (Arroyo et al., 2016; Kirkby et al., 2013). In turn, retinal waves regulate 251 the network of developing ipRGCs that are mainly gap junction coupled to different neurons, 252 including other ipRGCs (Arroyo et al., 2016). In the current study, the blockade of cholinergic 253 retinal waves during the first postnatal week in wild-type retinal explants induced a pattern 254 similar to the one observed in the Opn4-/- with a shortening of the period and a delayed phase 255 of the retinal clock. Accordingly, Arroyo and colleagues (2016) showed that this blockade 256 dramatically increased the extent of ipRGCs coupling. Thus, the following model can be 257 proposed (Figure 7). In wild-type C57Bl6 mouse, retinal DA is not circadian, and DA release 258 is strictly light-driven (Iuvone et al., 1978). DA supplementation functions as a chemical signal 259 for light, which in turn decreases the extent of gap junction coupling (Bloomfield and Volgyi, 260 2009; O’Brien and Bloomfield, 2018) between ipRGCs and other retinal cells, leading to a 261 lengthening of the period of the retinal clock. Upon cholinergic blockage in the wild-type 262 mouse, DA release is decreased, causing a robust electrical coupling between cells and a 263 shortening of the period. The contribution of ipRGCs to retinal wave generation and dynamic 264 is altered in the Opn4-/- (Chew et al., 2017; Renna et al., 2011), inducing a decrease in DA 265 levels, an increase in the strength of gap junction network and thus a shortening of the period 266 of the retinal clock.

267 The development of the retinal network is a gradual process beginning at postnatal ages, with 268 thefirst development of clock capacity and later development of network properties. Elucidating 269 the precise mechanisms that mediate the interplay between retinal waves, ipRGCs, DA, and 270 retinal clock networks require future studies that will provide promising avenues for future 271 research. 272

273 Materials and methods

274 Animals

275 Male and female Per2Luc (Yoo et al., 2004) and Opn4-/-::Per2Luc mice were housed in a 276 temperature-controlled room (23 ± 1°C), under 12 h light/12 h dark cycle (12L/12D, light 277 intensity around 200-300 lux) with food and water ad libitum. All animal procedures were in bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

278 strict accordance with current national and international regulations on animal care, housing, 279 breeding, and experimentation and approved by the regional ethics committee CELYNE 280 (C2EA42-13-02-0402-005). All efforts were made to minimize suffering. Animals were used 281 at embryonic day 18 (E18), postnatal days 1, 5, 8, 11, 15, 30, and in 2 month-old adults. The 282 day of birth corresponded to P1.

283 Retinal explant culture

284 For the embryonic stage 18, Per2Luc pregnant mice were killed by cervical dislocation, and the 285 embryos were isolated. Animals were sacrificed by decapitation between P1 and P8 and by 286 cervical dislocation after P11, one hour before light offset at zeitgeber time 11 (ZT11). Eyes 287 were enucleated and placed in Hank’s balanced salt medium (HBSS; Invitrogen) on ice. Retinas 288 were gently isolated from the rest of the eyecup and flattened, ganglion cell layer up, on a semi- 289 permeable (Millicell) membrane in a 35 mm culture dishes (Nunclon) containing 1.2 mL 290 Neurobasal-A (Life Technologies) with 2% B27 (Gibco), 2 mM L-Glutamine (Life 291 Technologies) and 25 U/mL antibiotics (Penicillin/Streptomycin, Sigma), incubated at 37°C in 292 5% CO2 for 24 h. From this step onwards, all manipulations of explants were performed under 293 dim red light. After 24 h, at the projected ZT12, retinas were transferred to 1.2 ml of 199 294 medium (Sigma), supplemented by 4 mM sodium bicarbonate (Sigma), 20 mM D-glucose 295 (Sigma), 2% B27, 0.7 mM L-Glutamine, 25 U/mL antibiotics (Penicillin / Streptomycin, 296 Sigma) and 0.1 mM Luciferin (Perkin). Culture dishes were sealed and then placed in a 297 Lumicycle (Actimetrics, Wilmette, IL, USA) to record the global emitted bioluminescence. All 298 medium changes were performed under dim red light.

299 Pharmacological treatments

300 For such experiments, 199 medium was supplemented with different molecules that remained 301 in the medium throughout the entire recording without further medium changes: DA (50 µM), 302 an inhibitor of DA synthesis alpha methyl-L-tyrosine (L-AMPT, 100 µM), an inhibitor of 303 vesicular DA uptake reserpine (Res, 10 µM), a non-selective DA agonist apomorphine (Apo, 304 50 µM), a DA D1R antagonist SCH39166 (50 µM), a DA D2R antagonist L741626 (25 µM), 305 a non-selective gap junction blocker CBX (100 µM) and mecamylamine, an acetylcholine 306 receptor antagonist (MMA, 100 µM).

307 Quantitative RT-PCR: 308 Two retinas of wild-type and Opn4-/- mice at P8 and P30 were dissected at ZT11, pooled, and 309 stored at -80°C until RNA extraction and quantification. Total RNAs were extracted using bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

310 Trizol reagent (Invitrogen) and reverse transcribed using random primers and MMLV Reverse 311 Transcriptase (Invitrogen). Real-time RT-PCR was then performed on a LightCycler™ system 312 (Roche Diagnostics) using the light Cycler-DNA Master SYBR Green I mix. Hypoxanthine 313 ribosyl-transferase (Hprt) was used for the internal standardization of target gene expression. 314 The efficiency and the specificity of the amplification were controlled by generating standard 315 curves and carrying out melting curves. Relative transcript levels of each gene were calculated 316 using the second derivative maximum values from the linear regression of cycle number versus 317 log concentration of the amplified gene. Primer sequences were: Hprt sens 318 ATCAGTCAACGGGGGACATA and reverse AGAGGTCCTTTTCACCAGCA; D1R sens 319 CAGCCTTCATCCTGATTAGCGTAGGCG and reverse 320 CTTATGAGGGAGGATGAAATGGCG; D2R sens CAGTGAACAGGCGGAGAATG and 321 reverse CAGGACTGTCAGGGTTGCTA; D4R sens CGTCTCTGTGACACGCTCATTA and 322 reverse CACTGACCCTGCTGGTTGTA; D5R sens CATCCATCAAGAAGGAGACCAAGG 323 and reverse CAGAAGGGAACCATACAGTTCAGG.

324 Data analysis

325 The period, the phase, and the amplitude of PER2::Luc oscillations were determined using 326 SigmaPlot 12.5 software by fitting a linearly detrended sinusoidal curve oscillating around a 327 polynomial baseline to the first three complete oscillations from each sample as previously 328 described (Calligaro et al., 2019, 2020; Jaeger et al., 2015). The equation used was:

𝑥𝜑 329 𝑦𝑥 𝑎𝑏∗𝑥 ∗sin2∗𝜋∗ 𝑐𝑑∗𝑥𝑒∗𝑥 𝑔∗𝑥 𝜏 330 Where a is the amplitude, the period, and φ the phase. Rhythm onset was defined when the 331 first complete bioluminescence oscillation was observed (first through and peak clearly 332 distinguishable). The circadian time of the peak of the first oscillation, which refers to the phase 333 in the current manuscript, was calculated based on a time reference (CT12), which corresponds

334 to the time of medium change corrected by the endogenous period (Calligaro et al., 2019, 2020).

335 Statistics

336 One-way ANOVA (Kruskal Wallis) is performed, followed by the post-hoc Mann-Whitney test 337 (Statistica Software) in order to compare the period, the phase, and the amplitude of PER2::Luc 338 signals, pharmacological treatments, and the relative expression of DARs during development. 339 Two-way ANOVA, followed by the post-hoc Mann-Whitney test, was used to compare the bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

340 period, the phase, and the amplitude between Per2Luc and Opn4-/-::Per2Luc mice during 341 development. Data are represented as mean ± SEM.

342

343 Acknowledgements:

344 CK, HC, AJ, and CC performed the experiments. CK, HC, AJ, and ODB analyzed the data. CK 345 and ODB conceived the study and designed the experimental plan. CK, NH, MB, and ODB 346 wrote the manuscript. All authors took part in the revision of the manuscript and approved the 347 final version. The authors do not have any potential conflict of interest. This research was 348 supported by Rhône-Alpes CMIRA, USIAS, ANR Light-Clock. The funders had no role in 349 study design, data collection, and analysis, decision to publish, or preparation of the manuscript.

350

351 References

352 353 Ackman JB, Burbridge TJ, Crair MC. 2012. Retinal waves coordinate patterned activity 354 throughout the developing visual system. Nature 490:219–225. doi:10.1038/nature11529 355 Ansari N, Agathagelidis M, Lee C, Korf HW, Von Gall C. 2009. Differential maturation of 356 circadian rhythms in clock gene proteins in the suprachiasmatic nucleus and the pars 357 tuberalis during mouse ontogeny. Eur J Neurosci 29:477–489. doi:10.1111/j.1460- 358 9568.2008.06605.x 359 Arroyo DA, Kirkby LA, Feller MB. 2016. Retinal waves modulate an intraretinal circuit of 360 intrinsically photosensitive retinal ganglion cells. J Neurosci 36:6892–6905. 361 doi:10.1523/JNEUROSCI.0572-16.2016 362 Bagchi U, Gegnaw ST, Milićević N, Sandu C, ten Brink JB, Jongejan A, Hicks D, Moerland 363 PD, Felder-Schmittbuhl MP, Bergen AA. 2020. Core-clock genes Period 1 and 2 regulate 364 visual cascade and cell cycle components during mouse eye development. Biochim 365 Biophys Acta - Gene Regul Mech 1863. doi:10.1016/j.bbagrm.2020.194623 366 Bassett EA, Wallace VA. 2012. Cell fate determination in the vertebrate retina. Trends Neurosci 367 35:565–573. doi:10.1016/j.tins.2012.05.004 368 Belliveau MJ, Cepko CL. 1999. Extrinsic and intrinsic factors control the genesis of amacrine 369 and cone cells in the rat retina. Development 126:555–566. 370 Blankenship AG, Feller MB. 2010. Mechanisms underlying spontaneous patterned activity in 371 developing neural circuits. Nat Rev Neurosci. doi:10.1038/nrn2759 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

372 Bloomfield SA, Volgyi B. 2009. The diverse functional roles and regulation of neuronal gap 373 junctions in the retina. Nat Rev Neurosci 10:495–506. 374 Buonfiglio DC, Malan A, Sandu C, Jaeger C, Cipolla-Neto J, Hicks D, Felder-Schmittbuhl M- 375 P. 2014. Rat retina shows robust circadian expression of clock and clock output genes in 376 explant culture. Mol Vis 20:742–752. 377 Calligaro H, Coutanson C, Najjar RPRP, Mazzaro N, Cooper HMHM, Haddjeri N, Felder- 378 Schmittbuhl M-PM-P, Dkhissi-Benyahya O. 2019. Rods contribute to the light-induced 379 phase shift of the retinal clock in mammals. PLOS Biol 17:e2006211. 380 doi:10.1371/journal.pbio.2006211 381 Calligaro H, Kinane C, Bennis M, Coutanson C, Dkhissi-Benyahya O. 2020. A standardized 382 method to assess the endogenous activity and the light–response of the retinal clock in 383 mammals. Mol Vis 26:106–116. 384 Carmona-Alcocer V, Abel JH, Sun TC, Petzold LR, Doyle FJ, Simms CL, Herzog ED. 2018. 385 Ontogeny of circadian rhythms and synchrony in the suprachiasmatic nucleus. J Neurosci 386 38:1326–1334. doi:10.1523/JNEUROSCI.2006-17.2017 387 Caval-Holme F, Feller MB. 2019. Gap Junction Coupling Shapes the Encoding of Light in the 388 Developing Retina. Curr Biol 29:4024--4035.e5. doi:10.1016/j.cub.2019.10.025 389 Chew KS, Renna JM, McNeill DS, Fernandez DC, Keenan WT, Thomsen MB, Ecker JL, 390 Loevinsohn GS, Vandunk C, Vicarel DC, Tufford A, Weng S, Gray PA, Cayouette M, 391 Herzog ED, Zhao H, Berson DM, Hattar S. 2017. A subset of iprgcs regulates both 392 maturation of the circadian clock and segregation of retinogeniculate projections in mice. 393 Elife 6:1–26. doi:10.7554/eLife.22861 394 Derouiche A. 1999. The dopamine D2 receptor subfamily in rat retina: Ultrastructural 395 immunogold and in situ hybridization studies. Eur J Neurosci 11:1391–1402. 396 doi:10.1046/j.1460-9568.1999.00557.x 397 Dkhissi-Benyahya O., Coutanson C, Knoblauch K, Lahouaoui H, Leviel V, Rey C, Bennis M, 398 Cooper HM. 2013. The absence of melanopsin alters retinal clock function and dopamine 399 regulation by light. Cell Mol Life Sci 70. doi:10.1007/s00018-013-1338-9 400 Dorenbos R, Contini M, Hirasawa H, Gustincich S, Raviola E. 2007. Expression of circadian 401 clock genes in retinal dopaminergic cells. Vis Neurosci 24:573–580. 402 doi:10.1017/S0952523807070538 403 Doyle SE, Grace MS, McIvor W, Menaker M. 2002. Circadian rhythms of dopamine in mouse 404 retina: the role of melatonin. Vis Neurosci 19:593–601. 405 Farshi P, Fyk-Kolodziej B, Krolewski DM, Walker PD, Ichinose T. 2016. Dopamine D1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

406 receptor expression is bipolar cell type-specific in the mouse retina. J Comp Neurol 407 524:2059–2079. doi:10.1002/cne.23932 408 Felder-Schmittbuhl M-P, Buhr ED, Dkhissi-Benyahya O, Hicks D, Peirson SN, Ribelayga CP, 409 Sandu C, Spessert R, Tosini G. 2018. Ocular Clocks : Adapting Mechanisms for Eye 410 Functions and Health. Invest Ophthalmol Vis Sci 59:4856–4870. doi:10.1167/iovs.18- 411 24957 412 Felder-Schmittbuhl M-P, Calligaro H, Dkhissi-Benyahya O. 2017. The retinal clock in 413 mammals: role in health and disease. ChronoPhysiology Ther Volume 7:33–45. 414 Feller MB, Wellis DP, Stellwagen D, Werblin FS, Shatz CJ. 1996. Requirement for cholinergic 415 synaptic transmission in the propagation of spontaneous retinal waves. Science (80- ) 416 272:1182–1187. doi:10.1126/science.272.5265.1182 417 Goyal V, DeVera C, Laurent V, Sellers J, Chrenek MA, Hicks D, Baba K, Iuvone PM, Tosini 418 G. 2020. Dopamine 2 receptor signaling controls the daily burst in phagocytic activity in 419 the mouse retinal pigment epithelium. Investig Ophthalmol Vis Sci 61. 420 doi:10.1167/IOVS.61.5.10 421 Hampson ECGM, Vaney DI, Weiler R. 1992. Dopaminergic modulation of gap junction 422 permeability between amacrine cells in mammalian retina. J Neurosci 12:4911–4922. 423 doi:10.1523/jneurosci.12-12-04911.1992 424 Iuvone PM, Galli CL, Garrison-Gund CK, Neff NH. 1978. Light stimulates tyrosine 425 hydroxylase activity and dopamine synthesis in retinal amacrine neurons. Science 426 202:901–902. 427 Jackson CR, Ruan G-XX, Aseem F, Abey J, Gamble K, Stanwood G, Palmiter RD, Iuvone PM, 428 Mcmahon DG. 2012. Retinal dopamine mediates multiple dimensions of light-adapted 429 vision. J Neurosci 32:9359–9368. doi:10.1523/JNEUROSCI.0711-12.2012 430 Jaeger C, Sandu C, Malan A, Mellac K, Hicks D, Felder-Schmittbuhl MP. 2015. Circadian 431 organization of the rodent retina involves strongly coupled, layer-specific oscillators. 432 FASEB J 29:1493–1504. doi:10.1096/fj.14-261214 433 Kirkby LA, Feller MB. 2013. Intrinsically photosensitive ganglion cells contribute to plasticity 434 in retinal wave circuits. Proc Natl Acad Sci U S A 110:12090–12095. 435 doi:10.1073/pnas.1222150110 436 Kirkby LA, Sack GS, Firl A, Feller MB. 2013. A role for correlated spontaneous activity in the 437 assembly of neural circuits. Neuron 80:1129–1144. doi:10.1016/j.neuron.2013.10.030 438 Landgraf D, Achten C, Dallmann F, Oster H. 2015. Embryonic development and maternal 439 regulation of murine circadian clock function. Chronobiol Int 32:416–427. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

440 doi:10.3109/07420528.2014.986576 441 Martin-Martinelli E, Simon A, Vigny A, Nguyen-Legros J. 1989. Postnatal development of 442 tyrosine-hydroxylase-immunoreactive cells in the rat retina. Morphology and distribution. 443 Dev Neurosci 11:11–25. 444 Matějů K, Sumovaná A, Bendová Z. 2010. Expression and light sensitivity of clock genes per1 445 and per2 and immediate-early gene c-fos within the retina of early postnatal wistar rats. J 446 Comp Neurol 518:3630–3644. doi:10.1002/cne.22421 447 Munteanu T, Noronha KJ, Leung AC, Pan S, Lucas JA, Schmidt TM. 2018. Light-dependent 448 pathways for dopaminergic amacrine cell development and function. Elife 7:1–10. 449 doi:10.7554/eLife.39866 450 Nguyen-Legros J, Simon A, Caillé I, Bloch B. 1997. Immunocytochemical localization of 451 dopamine D1 receptors in the retina of mammals. Vis Neurosci 14:545–551. 452 doi:10.1017/S0952523800012207 453 O’Brien J, Bloomfield SA. 2018. Plasticity of Retinal Gap Junctions: Roles in Synaptic 454 Physiology and Disease. Annu Rev Vis Sci 15:79–100. 455 Pérez-Fernández V, Milosavljevic N, Allen AE, Vessey KA, Jobling AI, Fletcher EL, Breen 456 PP, Morley JW, Cameron MA. 2019. Rod Photoreceptor Activation Alone Defines the 457 Release of Dopamine in the Retina. Curr Biol 29:763-774.e5. 458 doi:10.1016/j.cub.2019.01.042 459 Popova E. 2014. Role of dopamine in distal retina. J Comp Physiol A Neuroethol Sensory, 460 Neural, Behav Physiol 200:333–358. doi:10.1007/s00359-014-0906-2 461 Prigge CL, Yeh P-T, Liou N-F, Lee C-C, You S-F, Liu L-LL-L, McNeill DS, Chew KS, Hattar 462 S, Chen S-K, Zhang D-Q. 2016. M1 ipRGCs Influence Visual Function through 463 Retrograde Signaling in the Retina. J Neurosci 36:7184–97. 464 doi:10.1523/JNEUROSCI.3500-15.2016 465 Renna JM, Chellappa DK, Ross CL, Stabio ME, Berson DM. 2015. Melanopsin ganglion cells 466 extend dendrites into the outer retina during early postnatal development. Dev Neurobiol 467 75:935–946. doi:10.1002/dneu.22260 468 Renna JM, Weng S, Berson DM. 2011. Light acts through melanopsin to alter retinal waves 469 and segregation of retinogeniculate afferents. Nat Neurosci 14:827–829. 470 doi:10.1038/nn.2845 471 Ribelayga C, Mangel SC. 2003. Absence of Circadian Clock Regulation of Horizontal Cell Gap 472 Junctional Coupling Reveals Two Dopamine Systems in the Goldfish Retina. J Comp 473 Neurol 467:243–253. doi:10.1002/cne.10927 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

474 Ribelayga CP, Cao Y, Mangel SC. 2008. The Circadian Clock in the Retina Controls Rod-Cone 475 Coupling. Neuron 59:790–801. 476 Ruan G-X, Allen GC, Yamazaki S, McMahon DG. 2008. An autonomous circadian clock in 477 the inner mouse retina regulated by dopamine and GABA. PLoS Biol 6:e249. 478 doi:10.1371/journal.pbio.0060249 479 Schneider K, Tippmann S, Spiwoks-Becker I, Holthues H, Wolloscheck T, Spatkowski G, 480 Engel L, Frederiksen U, Spessert R. 2010. Unique clockwork in photoreceptor of rat. J 481 Neurochem 115:585–594. doi:10.1111/j.1471-4159.2010.06953.x 482 Seeman P, Van Tol HHM. 1994. Dopamine receptor pharmacology. Trends Pharmacol Sci. 483 doi:10.1016/0165-6147(94)90323-9 484 Sernagor E, Eglen SJ, Wong ROL. 2001. Development of retinal ganglion cell structure and 485 function. Prog Retin Eye Res. doi:10.1016/S1350-9462(00)00024-0 486 Shimomura H, Moriya T, Sudo M, Wakamatsu H, Akiyama M, Miyake Y, Shibata S. 2001. 487 Differential daily expression of Per1 and Per2 mRNA in the suprachiasmatic nucleus of 488 fetal and early postnatal mice. Eur J Neurosci 13:687--93. 489 Tian N. 2004. Visual experience and maturation of retinal synaptic pathways. Vision Res 490 44:3307–3316. doi:10.1016/j.visres.2004.07.041 491 Travis AM, Heflin SJ, Hirano AA, Brecha NC, Arshavsky VY. 2018. Dopamine-dependent 492 sensitization of rod bipolar cells by GABA is conveyed through wide-field amacrine cells. 493 J Neurosci 38:723–732. doi:10.1523/JNEUROSCI.1994-17.2017 494 Veruki ML. 1997. Dopaminergic neurons in the rat retina express dopamine D2/3 receptors. 495 Eur J Neurosci 9:1096–1100. doi:10.1111/j.1460-9568.1997.tb01461.x 496 Vugler AA, Redgrave P, Semo M, Lawrence J, Greenwood J, Coffey PJ. 2007. Dopamine 497 neurones form a discrete plexus with melanopsin cells in normal and degenerating retina. 498 Exp Neurol 205:26–35. 499 Wang H, Lu Q, Wang N, Liu H, Zhang L, Zhan G. 2008. Loss of melanopsin-containing retinal 500 ganglion cells in a rat glaucoma model. Chin Med J (Engl) 121:1015–1019. 501 Witkovsky P. 2004. Dopamine and retinal function. Doc Ophthalmol 108:17–40. 502 Wong ROL, Meister M, Shatz CJ. 1993. Transient period of correlated bursting activity during 503 development of the mammalian retina. Neuron 11:923–938. doi:10.1016/0896- 504 6273(93)90122-8 505 Wreschnig D, Dolatshad H, Davis FC. 2014. Embryonic development of circadian oscillations 506 in the mouse hypothalamus. J Biol Rhythms 29:299–310. doi:10.1177/0748730414545086 507 Wulle I, Schnitzer J. 1989. Distribution and morphology of tyrosine hydroxylase- bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

508 immunoreactive neurons in the developing mouse retina. Dev Brain Res 48:59–72. 509 doi:10.1016/0165-3806(89)90093-X 510 Yoo S-H, Yamazaki S, Lowrey PL, Shimomura K, Ko CH, Buhr ED, Siepka SM, Hong H-K, 511 Oh WJ, Yoo OJ, Menaker M, Takahashi JS. 2004. PERIOD2::LUCIFERASE real-time 512 reporting of circadian dynamics reveals persistent circadian oscillations in mouse 513 peripheral tissues. Proc Natl Acad Sci U S A 101:5339–5346. 514 Young RW. 1985. Cell differentiation in the retina of the mouse. Anat Rec 212:199–205. 515 doi:10.1002/ar.1092120215 516 Yujnovsky I, Hirayama J, Doi M, Borrelli E, Sassone-Corsi P. 2006. Signaling mediated by the 517 dopamine D2 receptor potentiates circadian regulation by CLOCK:BMAL1. Proc Natl 518 Acad Sci U S A 103:6386–6391. 519 Zhang D-Q, Zhou T-R, McMahon DG. 2007. Functional heterogeneity of retinal dopaminergic 520 neurons underlying their multiple roles in vision. J Neurosci 27:692–699. 521 Zhao X, Wong KY, Zhang D-Q. 2017. Mapping physiological inputs from multiple 522 photoreceptor systems to dopaminergic amacrine cells in the mouse retina. Sci Rep 7:7920. 523 Zhou X, Pardue MT, Iuvone PM, Qu J. 2017. Dopamine signaling and myopia development: 524 What are the key challenges. Prog Retin Eye Res. doi:10.1016/j.preteyeres.2017.06.003 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A 1000 1000 1000 P5 P8 P11 800 800 800

600 600 600

400 400 400

200 200 200

0 0 0 01234567 01234567 01234567

1000 1000 1000 P15 P30 Adult Bioluminescence (cps) 800 800 800

600 600 600

400 400 400

200 200 200

0 0 0 01234567 01234567 01234567 Days in culture Days in culture Days in culture B

27 ** ** 24 900 WT 26 *** Opn4‐/‐ *** *** 750 18 25 ** 600

12 450 24 Period (h) Period 300 Phase (CT) ** 23 6 (cps) Amplitude 150

P8 WT P8 KO P11 WT P11 KO P15WT P15KO P30 WT P30 KO Adult WT Adult KO 22 0 P8WT P8KO P11WT P11KO P15WT P15KO P30WT P30KO AdultWT AdultKO 0 P8WT P8KO P11WT P11KO P15WT P15KO P30WT P30KO AdultWT AdultKO P8 P11 P15 P30 Adult P8 P11 P15 P30 Adult P8 P11 P15 P30 Adult

Figure 1: Ontogenesis of PER2::Luc circadian oscillations in wild-type and Opn4-/- retinal explants. A- Representative bioluminescence recording of PER2::Luc retinal explants from Per2Luc (black line) and Opn4-/-:: Per2Luc (blue line) mice at different postnatal stages (P5, P8, P11, P15, P30) and in the adult. Retinal explants were cultured for at least 6 days without medium change. The dotted black rectangle corresponds to an enlargement of bioluminescence traces of both genotypes at P5 B- Means of the endogenous period, the circadian phase, and the amplitude in both genotypes during development. The total numbers of retinas used were respectively for wild-type mice: P8, n=10; P11, n=10; P15, n=6; P30, n=8; adult, n=10 and for Opn4-/-::Per2Luc; P8, n=6; P11, n=6; P15, n=7; P30, n=6 and adult, n=10. Bars represent the mean ± SEM (ANOVA, ** = p <0.01; *** = p <0.001). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A 1000 1000 5‐DIV P1 P5 800 800

600 600

400 400

200 200 Bioluminescence Bioluminescence (cps)

0 0 0246810 0246810 Days in culture Days in culture B 28 24 15 ** 27 13 18 26 10 25 12 8 Period (h) Period

24 Phase (CT) 5 6 (cps) Amplitude 23 3 22 0 0 5-DIV P1 P5 5-DIV P1 P5 5-DIV P1 P5

Figure 2: Spontaneous PER2::Luc oscillations develop in vitro from P1 mouse retinal explants. A- Representative bioluminescence recording of PER2::Luc from P1 and P5 retinal explants. After 5 days in vitro, P1 retinal explants (5-DIV P1) exhibit analysable PER2::Luc oscillations. B- Means of the endogenous period, the phase, and the amplitude of 5-DIV P1 and P5 PER2::Luc retinal explants. The analysis was performed on the 3 first complete oscillations for each explant. The total numbers of retinas used were: 5-DIV P1, n= 5, and P5, n=6. Bars represent the mean ± SEM (ANOVA, ** = p <0.01). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A P8 P15 P30 28 ** 28 28 ** ** 27 27 27 26 26 26 ** * 25 25 25 24 24 24 Period (h) 23 23 23 22 22 22 1 2 3 4 1 2 3 4 1 2 3 4 24 24 24 * * 18 ** 18 18 ** **

12 12 12

Phase (CT) 6 6 6

0 0 0 1 2 3 4 1 2 3 4 1 2 3 4 800 800 800 * * 600 600 600

400 400 400 ** *** 200 ** 200 200 Amplitude (cps) Amplitude * ** 0 0 0 1 2 3 4 1 2 3 4 1 2 3 4

B 29 ** 24 250 *** 28 ** 200 18 ** 27 ### ### * ** 26 * 150 12 25 100 ## Period (h) Phase (CT) ** ## 24 6 Amplitude (cps) Amplitude 50 23 22 0 0 1 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7

Figure 3: Dopamine desynchronizes the circadian retinal clock through D1 and D2 dopaminergic receptors during development. A-Means of the endogenous period, the phase and the amplitude of the retinal clock at 3 postnatal developmental stages (P8, P15 and P30). Retinal explants were supplemented with DA, Apo, or a combination of Res + L-AMPT and are compared to non- supplemented control retinas. The total numbers of retinas used were: P8: C, n=10; DA, n=7; Apo, n= 4; Res + L-AMPT, n= 8); P15: C, n=8. DA, n=6; Apo, n=3; Res + L-AMPT, n=5; P30: C,n=8;DA, n=9; Apo, n=5; Res + L-AMPT, n=6. B- Means of the endogenous period, the phase and the amplitude of P8 retinal explants, supplemented with DA (n=7), a D1R DA antagonist (SCH39166, n=6), a D2R DA antagonist (L741626, n=6), DA combined to SCH39166 (n=6) or L741626 (n=6), or a general gap junction blocker (CBX, n=4) and are compared to non-supplemented control retinas (C, n=10). Bars represent mean ± SEM (* = p <0.05; ** = p <0.01; *** = p <0.001, comparison with C group; ## =p≤0,01;### = p ≤ 0,001, comparison with DA group). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

28 Control 24 ** ** 800 DA 27 18 600 26 ** 25 12 400 Period (h) Period

24 Phase (CT)

6 (cps) Amplitude 200 ** 23

22 12345 0 12345 0 12345 P8 P30 P8 P30 P8 P30

Figure 4: Effect of dopamine on the retinal clock in the absence of melanopsin. Means of the endogenous period, the phase, and the amplitude of P8 and P30 retinal explants from Opn4-/-::Per2Luc mice, supplemented with DA and compared to non- supplemented control retinas (C). The total numbers of retinas used were: P8: C, n=6; DA, n=4; P30: C, n=5; DA, n=5. Bars represent mean ± SEM (ANOVA, ** = p <0.01). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

P8 P30 3 8

6 2

1 ** Relative quantity

Relative quantity 2

0 12345 0 12345 D1 D5 D1 D5

3 8 WT Opn4‐/‐ 6 2 **

Relative quantity Relative quantity 2

0 12345 0 12345 D2 D4 D2 D4

Figure 5: Relative expressions of D1- and D2-like dopaminergic receptors are similar between wild-type and Opn4-/- retinas at P8. Means of the relative expression of D1-like (D1, D5) and D2-like (D2, D4) receptors in the retinas of wild-type (WT, grey bars) and Opn4-/- (blue bars) mice at 2 developmental stages, P8 and P30. The total numbers of retinas used were: WT, n=6 for P8 and P30; Opn4-/-, n=7 for P8 and n=4 for P30. Bars represent mean ± SEM (ANOVA, ** = p <0.01). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

27 30 *** 26 * ** 25 *** 20 25 15 24 Period (h) Period

Phase (CT) 10 23 5 22 0 C MMA C C MMA C 1 2 3 1 2 3 WT Opn4 ‐/‐ WT Opn4 ‐/‐

Figure 6: The blockade of acetylcholinergic waves shortens the endogenous period of the retinal clock in P8 explants of Per2luc mice. Means of the endogenous period and the phase in control (C) wild-type (WT) and Opn4-/- ::Per2luc retinas and in WT retinas supplemented with mecamylamine acid (MMA). The total numbers of retinas used were: WT: C, n=10: MMA, n=6; Opn4-/-: C, n=8. Data from WT and Opn4-/-::Per2Luc control retinas are already presented in figure 1B. Bars represent mean ± SEM (ANOVA, * = p <0.05; ** = p <0.01; *** = p <0.001). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

WT Opn4‐/‐

Cholinergic waves MMA Cholinergic waves

DA release DA release X

+DA ipRGCs ipRGCsX

gap junction gap junction gap junction coupling coupling coupling

Lengthening Shortening Shortening of the period of the period of the period

Figure 7: Model of the interaction between ipRGCs, cholinergic waves, and DA in early postnatal stages of retinal clock ontogenesis. In wild-type mice, DA supplementation decreases the extent of gap junction coupling among ipRGCs and other retinal cells, leading to a lengthening of the retinal clock period. When cholinergic waves are blocked, DA release is decreased, causing a robust electrical coupling between cells and a shortening of the period. The contribution of ipRGCs to retinal wave generation and dynamic (black arrow) is altered in the Opn4-/- (right panel), leading to a decrease in DA levels, an increase in the strength of gap junction network, and thus a shortening of the period of the clock. ipRGC, intrinsically photosensitive retinal ganglion cell; MMA, mecamylamine acid. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

500

400 E18

300

200

100

0 Bioluminescence Bioluminescence (cps) 01234567 Days in culture

Supplementary figure 1: Representative bioluminescence recording of PER2::Luc retinal explants at embryonic day 18 (E18). No oscillations of PER2::Luc were detected in cultured retinal explants. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.23.441100; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1000 1000 1000 5‐DIV P1 5‐DIV P1+DA P5 800 800 800

600 600 600

400 400 400

200 200 200 Bioluminescence Bioluminescence (cps) 0 0 0 02468100246810 0246810 Days in culture Days in culture Days in culture B 28 24 15 ** 27 18 26 10 25 12

Period (h) 24 5 Phase (CT)

6 (cps) Amplitude 23

22 0 0 5-DIV P1 5-DIV P1 P5 5-DIV P1 5-DIV P1 P5 5-DIV P1 5-DIV P1 P5 1 2+ 3 1 2+ 3 1 2+ 3 DA DA DA

Supplementary figure 2: DA did not influence the onset of the spontaneous oscillations of PER2::Luc in vitro.A-Representative bioluminescence recording of PER2::Luc 5 days in vitro P1 cultured explants supplemented with DA (5-DIV P1 + DA). The dotted black rectangles correspond to the analysis windows, including the 3 first complete oscillations. B- Comparison of the means of the endogenous period, the phase, and the amplitude of 5-DIV P1, 5-DIV + DA, and P5 retinal explants. The total numbers of retinas used were: 5-DIV P1, n=5; 5-DIV + DA, n=4, and P5, n=6. Bars represent mean ± SEM(ANOVA,**= p <0.01).