Dissertation Entitled Neuromodulation in a Nociceptive Neuron in C

Dissertation entitled

Neuromodulation in a Nociceptive Neuron in C. elegans

Paul David Edward Williams

Submitted to the Graduate Faculty as partial fulfilment of the requirements for the Doctor

of Philosophy in Biology

Dr. Bruce Bamber, Committee Chair

Dr. David Giovannucci, Committee Member

Dr. Richard Komuniecki, Committee Member

Dr. Guofa Liu, Committee Member

Dr. Scott Molitor, Committee Member

Dr. Robert Steven, Committee Member

Dr. Amanda Bryant-Friedrich, Dean College of Graduate Studies

The University of Toledo,

May 2018

This document is copyrighted material. Under copyright law, no parts of this document

may be reproduced without the expressed permission of the author.

An Abstract of Neuromodulation in a Nociceptive Neuron in C. elegans

By Paul David Edward Williams

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy in Biology The University of Toledo May 2018

Neuromodulators have the capacity to alter neuronal excitability and synaptic strengths throughout the nervous system, allowing animals to switch between different behavioral states. The mechanisms by which neuromodulators change neuronal physiology, and the impact of those changes on circuit output and overall behavior, remain poorly understood. Neuromodulator-dependent changes in neuronal activity patterns are frequently measured using calcium reporters, since calcium imaging can easily be performed on intact functioning nervous systems. With only 302 neurons, the nematode Caenorhabditis elegans provides a relatively simple, yet powerful system to understand neuromodulation at the level of individual neurons. C. elegans is repelled by 1-octanol, and these aversive responses are modulated by monoamines and neuropeptides. Previously, we identified that serotonin (5-HT) suppresses 1-octanol Ca++ responses and potentiates depolarizations in the ASH in response to 1-octanol. This suggested that the net effect of 5-HT is disinhibitory. Here, I further dissect the pathway used by 5-HT to disinhibit the ASH and identify a Ca++-activated K+ channel known as SLO-1 acting downstream of Ca++. Furthermore, SLO-1 plays a critical role in regulating ASH Ca++ dynamics, with important consequences for aversive behavior and 5-HT modulation. Intriguingly, mutants lacking the SLO-1 accessory proteins DYB-1, BKIP-1 and ISLO-1 have similar phenotypes, suggesting that SLO-1 may need to be localized to specific Ca++ microdomains to properly modulate ASH responses. Finally, I show that other monoamines and neuropeptides effect the ASH Ca++ dynamics, suggesting that Ca++-dependent regulation of ASH signaling and excitability may be a central regulatory theme within the neuron.

iii

My dissertation is dedicated to my friends and family, specifically my mother and father

Geraldine and Keith Williams whose outstanding love and support kept me strong and made this dream a reality. I also dedicate this dissertation to all the teachers and professors who guided me towards and down this path. Finally, to Drs. Bruce Bamber and Richard Komuniecki who made me into the scientist I am today.

I thank you all.

Acknowledgements

I would like to thank Drs. Bruce Bamber and Richard Komuniecki for giving me this opportunity and their immense help, guidance and patience that was necessary for the completion of this project. Bruce, I thank you for giving me the opportunity to be a member of your lab and for your immense help, and Rick for your challenging nature to ensure I always stayed on course. I would also like to thank Amanda Korchnak for her aid in strain generation and help during my graduate career. I would also like to acknowledge members of the Bamber, Komuniecki and Steven labs: Dr. Jeff Zahratka,

Dr. Robert Layne, Matt Rodenbeck, Jason Wanamaker, Hilary Linzie, Dr. Holly Mills,

Dr. Vera Hapiak, Mitchell Oakes, Tobias Clark, Dr. Robert Steven and Alyssa Hoop for their input and help in all aspects of this project. Lastly, I would like to acknowledge my committee, Drs. Bruce Bamber, David Giovannucci, Richard Komuniecki, Guofa Liu,

Scott Molitor and Robert Steven.

Table of Contents

Abstract ...... iii Acknowledgements ...... v Table of Contents ...... vi List of Figures ...... xi List of Tables ...... xiii List of Abbreviations ...... xiv List of Symbols ...... xviii 1 Introduction ...... 1

1.1 Neuromodulation: A major Regulator of Wellbeing ...... 3

1.2 Monoamines and Neuropeptides Modulate Neuronal Activity ...... 4

1.2.1 Serotonin ...... 4

1.2.1.1 5-HT1 Receptors...... 6

1.2.1.2 5-HT2 Receptors...... 8

1.2.1.3 5-HT3, 5-HT4, 5-HT5, 5-HT6 and 5-HT7 Receptors ...... 11

1.2.2 Other Neuromodulators ...... 14

1.2.2.1 Dopamine ...... 14

1.2.2.2 Norepinephrine and Epinephrine ...... 16

1.2.2.3 Neuropeptides ...... 17

1.3 Calcium Imaging: A Powerful Technique to Measure Neuronal Activity in Intact

Nervous Systems ...... 20

1.3.1 Fluorescent Dyes: Pioneers in Measuring Neuronal Activity...... 22

1.3.2 FRET-based Ca++ Indicators ...... 24

1.3.3 GCaMP: The Best Ca++ Indicator? ...... 27

1.3.4 Voltage Sensor Proteins ...... 32

1.4 C. elegans: A Model Organism for Studying Neuromodulation ...... 35

1.4.1 The C. elegans Nervous System ...... 37

1.4.2 The ASH Sensory Neuron ...... 39

1.4.3 Monoamines Extensively Modulate ASH Mediated Behaviors in C.

elegans ...... 41

1.4.3.1 Serotonin ...... 41

1.4.3.2 Dopamine ...... 43

1.4.3.3 Octopamine ...... 44

1.4.3.4 Tyramine ...... 46

1.5 Analyzing the Neuromodulation of Ca++ Signals in C. elegans ...... 49

1.5.1 Ca++ Channels in C. elegans ...... 49

1.5.1.1 EGL-19 ...... 50

1.5.2 Modulation of ASH Ca++ Signals by Monoamines ...... 51

1.5.2.1 5-HT Modulates ASH Ca++ and Depolarization Signals

Differentially ...... 52

2 Standard Materials and Methods ...... 57

vii

2.1 Strains and Worm Maintenance ...... 57

2.2 RNA Interference ...... 59

2.3 Behavioral Assays ...... 60

2.4 Ca++-imaging ...... 61

2.5 Electrophysiology ...... 64

2.6 Statistical Analysis ...... 65

3 Development of Innovative Techniques for Pharmacology and Imaging Studies in . C.

elegans ...... 67

3.1 Results ...... 67

3.1.1 Worm Position Dictates Neuron Accessibility ...... 68

3.1.2 Plate Hydration Affects the Quality of Neuron Dissection ...... 70

3.1.3 Improvement on Stimulus Tip Placement...... 73

3.1.4 Development of a Dual-Chambered Pipette ...... 76

3.1.5 Acute Application of 5-HT Leads to Changes in the Ca++ Over Short

Timescales...... 81

3.2 Discussion...... 83

3.2.1 Improved Dissection is Dependent on Plate Hydration and Worm Position ...... 83

3.2.2 Acute Application of 5-HT Inhibits 1-octanol Responses ...... 84

4 5-HT Inhibits a Ca++-dependent Negative Feedback Loop in a C. elegans Nociceptive

Neuron...... 86

4.1 Results ...... 86

4.1.1 5-HT Acts Directly on the ASH to Inhibit 1-octanol Induced Ca++ ....87

viii

4.1.2 5-HT Acts Downstream of Depolarization to Reduce the Stimulus-

Induced Ca++ Transient in ASH ...... 90

4.1.3 5-HT Modulates ASH Function at Physiological Concentrations and

Time Scales ...... 92

4.1.4 The Calcineurin Orthologue, TAX-6, is Required to Inhibit L-type

VGCC’s...... 95

4.1.5 Ca++ Influx Through the EGL-19 VGCC Inhibits ASH

Depolarizations ...... 100

4.2 Discussion...... 104

4.2.1 Ca++ Does not Act as a Charge Carrier in ASH ...... 106

4.2.2 Regulation of L-type Ca++ Channels by GPCRs is Highly Conserved

in C. elegans...... 107

4.2.3 Acute Application of Ligands Gives Insights to Critical Neuronal

Signaling Events ...... 108

4.2.4 1-octanol Sensory Evoked Ca++ is Negatively Correlated with

Depolarization ...... 109

5 The BK Channel SLO-1 Acts Downstream of Ca++ to Regulate ASH Response

Dynamics ...... 111

5.1 Results ...... 111

5.1.1 SLO-1 Acts Downstream of 5-HT Modulation of ASH 1-octanol

Responses ...... 112

5.1.2 SLO-1 is Essential for Maintaining Proper ASH Signal Kinetics .....114

5.1.3 SLO-1 Accessory Proteins are Essential for Maintaining ASH

Response Dynamics ...... 119

5.2 Discussion...... 124

5.2.1 SLO-1 Acts Downstream of 5-HT Modulation of ASH ...... 124

5.2.2 The Relationship Between BK and L-type Channels is Conserved in C.

elegans ...... 127

5.2.3 A SLO-1 accessory protein complex ensures proper SLO-1 trafficking

and localization ...... 128

6 Modulation of ASH Ca++ by Other Monoamines and Neuropeptides ...... 131

6.1 Results ...... 131

6.1.1 Dopamine ...... 132

6.1.2 Octopamine ...... 135

6.1.3 Neuropeptides and their Receptors Modulate ASH Ca++ ...... 140

6.2 Discussion...... 145

6.2.1 Dopamine Modulates 1-octanol Induced ASH Ca++ and Behaviors

Similar to 5-HT ...... 145

6.2.2 Octopamine Modulates ASH Ca++ and Excitability ...... 147

6.2.3 Neuropeptides and their Receptors Extensively Modulate ASH ...... 149

6.3 Conclusions ...... 152

References ...... 154

List of Figures

Figure 1-1 Structure and Function of Genetically Encoded Ca++ Indicators ...... 31

Figure 1-2 5-HT Potentiates ASH in Response to 1-octanol ...... 55

Figure 3-1 Position of Glued Worm Dictates ASH Accessibility ...... 69

Figure 3-2 Plate Hydration Affects ASH Dissection Quality ...... 72

Figure 3-3 Deflection of 1-octanol Increases Cell Survival ...... 75

Figure 3-4 Dual-Chambered Pipette Effectively Protects the ASH...... 79

Figure 3-5 Direct Application of 5-HT Inhibits 1-octanol Induced Ca++ Signals ...... 82

Figure 4-1 5-HT Inhibits Ca++ in Dissected ASHs ...... 88

Figure 4-2 5-HT Inhibits ASH Downstream of Depolarization ...... 91

Figure 4-3 Low Concentrations of 5-HT Rapidly Modulate ASH Ca++ Entry via Ca++

Intracellular Stores ...... 94

Figure 4-4 5-HT Inhibition of the 1-octanol Induced Ca++ Signal is Dependent on CaN .97

Figure 4-5 CaN is Required for 5-HT Inhibition of High [K+] Evoked Ca++ Signals ...... 99

Figure 4-6 Inhibition of Ca++ Potentiates Depolarization ...... 102

Figure 4-7 Pathway for 5-HT Inhibition of Ca++ ...... 105

Figure 5-1 SLO-1 Acts Downstream of 5-HT Modulation ...... 113

Figure 5-2 SLO-1 Mediates Proper ASH Ca++ Signal Kinetics ...... 117

Figure 5-3 Loss of the SLO-1 Accessory Proteins Disrupt ASH Signaling Kinetics and

Abolishes 5-HT Modulation ...... 122

Figure 5-4 SLO-1 Functions Downstream of Ca++ to Inhibit ASH Excitability ...... 126

Figure 6-1 Dopamine Modulates ASH Ca++ Signals via the DOP-3 and DOP-4

Receptors...... 134

Figure 6-2 Octopamine Inhibits 1-octanol Mediated ASH Ca++ Transients ...... 138

xii

List of Tables

Table 1-1 Monoamines Extensively Modulate 30% 1-octanol Behaviors ...... 48

Table 6-1 ASH expressed neuropeptides and receptors extensively modulate ASH Ca++ responses to 1-octanol ...... 144

xiii

List of Abbreviations

1-oct ...... 1-octanol 5-HT ...... Serotonin

AM ...... Acetoxymethyl

BAPTA ...... 1, 2 bis(o-aminophenoxy)ethane-N,N,N’,N’-tetra acetic acid bas ...... Biogenic Amine synthesis related BK ...... Big K+ potassium Channel bkip ...... BK Channel Interacting Protein

Ca++ ...... Calcium ion CaM...... Calmodulin cAMP ...... cyclic Adenosine Monophosphate CaN ...... Calcineurin

++ Cav ...... Voltage-gated Ca channel (number indicates family) cat ...... Abnormal Catecholamine distribution CDI ...... Ca++-dependent Inactivation CFP ...... Cyan Fluorescent Protein che ...... abnormal Chemotaxis Cl- ...... Chloride ion CNS ...... Central Nervous System CRISPR ...... Clustered Regulatory Interspaced Short Palindromic Repeats CsA ...... Cyclosporin A

xiv

DA ...... Dopamine DAG ...... Diacylglycerol DAPC ...... Dystrophin-associated protein complex DHCA ...... dihydroxyhydrocinnamic acid DHP...... Dihydropyridine dop...... Dopamine Receptor DOPA ...... Dihydroxyphenylalanine dyb...... Dystrobrevin homolog dys ...... Dystrophin related eat ...... eating: abnormal pharyngeal pumping egl ...... Egg laying defective ER ...... Endoplasmic Reticulum flp ...... FMRFamide-like peptide FRET ...... Fluorescence/Förster Resonance Energy Transfer

GABA ...... γ-aminobutyric acid GECI ...... Genetically Encoded Ca++ Indicator GEVI ...... Genetically Encoded Voltage Indicator GFP ...... Green Fluorescent Protein GPCR ...... G-protein Couple Receptor ins ...... Insulin Related

IP3 ...... Inositol 1, 4, 5-triphosphate

IP3R ...... Inositol 1, 4, 5-triphosphate Receptor islo ...... Interactor with SLO-1

K+ ...... Potassium ion

L1-4 ...... Larval stages 1-4 L-DOPA ...... L-3,4-dihydroxyphenylalanine LHb ...... Lateral habenula

M13 ...... Calmodulin-binding peptide Mg++ ...... Magnesium ion mPFC ...... medial prefrontal cortex

Na+ ...... Sodium ion NAc ...... nucleus accumbens NE ...... Norepinephrine/noradrenaline NemA ...... Nemadipine A NGM ...... Nematode Growth Media nlp ...... Neuropeptide-like Protein NMJ...... Neuromuscular junction npr ...... Neuropeptide Receptor NPY...... Neuropeptide Y ntc ...... Nematocin (Vasopressin-like peptide) ntr ...... Nematocin Receptor

OA ...... Octopamine octr ...... Octopamine Receptor odr ...... Odorant Response Abnormal OGB-1 ...... Oregon Green BAPTA-1

PE ...... Polyethylene PCR ...... Polymerase Chain Reaction

PIP2 ...... Phosphatidylinositol 4,5-bisphosphate PLC ...... Phospholipase C PTFE ...... Polytetrafluoroethylene

xvi

RGS ...... Regulator of G-protein signaling RNAi ...... RNA interference ser ...... Serotonin/Octopamine/Tyramine Receptor SERT ...... Serotonin transporter slo ...... Slowpoke potassium channel family SR101 ...... Sulforhodamine 101 sra ...... Serpentine receptor, class A (alpha) SSRI ...... Selective serotonin reuptake inhibitor

TA ...... Tyramine tax ...... Abnormal Chemotaxis tbh ...... Tyramine beta hydroxylase tdc ...... Tyrosine decarboxylase TnC ...... Troponin C TN-XL...... Troponin-extra large TN-XXL ...... Troponin-extra extra large tph ...... Tryptophan hydroxylase TRP ...... Transient Receptor Potential channel TRPV ...... Transient receptor potential cation channel subfamily V tyra ...... Tyramine receptor

VGCC ...... Voltage-gated Ca++ Channel VSD...... Voltage sensing domain VTA ...... ventral tegmental area

YFP ...... Yellow Fluorescent Protein

xvii

List of Symbols

α ...... alpha subunit β ...... Beta subunit Δ ...... Change in m ...... milli (10-3) µ ...... micro (10-6) n...... nano (10-9) ° ...... Degree of angle p...... pico (10-12)

A ...... Amperes °C ...... Degrees Celsius F ...... Fluorescence

F0 ...... Baseline Fluorescence M ...... Molar mm ...... Meters s ...... seconds V ...... Volts

xviii

Chapter 1

Introduction

Neuromodulation is an important mechanism for regulating nervous system function, and generates behavioral flexibility in response to changing conditions (Marder 2012).

Although neuromodulators and their receptors have been extensively catalogued over many years, neuromodulatory signaling is still not fully understood at the cellular or network levels. Whole-brain optical recording is a promising new approach to understand neuromodulation by allowing the activity patterns to be compared in the presence and absence of neuromodulators, within intact nervous systems in freely behaving animals

(Kato et al. 2015; Lemon et al. 2015; Naumann et al. 2016; Poort et al. 2015).

Fluorescent Ca++ sensors are currently the reporters of choice, as their speed, sensitivity, and ease of expression are superior to alternatives such as fluorescent voltage indicators

(Inagaki and Nagai 2016; Vogt 2015). However, measurable Ca++ levels provide an indirect indication of neuronal activation, with Ca++ usually entering the cytoplasm through voltage-gated Ca++ channels (VGCCs) that activate upon depolarization (Badura et al. 2014; Inagaki and Nagai 2016). Therefore, over-reliance on Ca++ signals to analyze circuit function has three principal pitfalls: First, the activity of the voltage-gated Ca++

channels can be modulated by intracellular signaling cascades, so the Ca++ signal strength may reflect the functional state of the Ca++ channel rather than the amplitude of the underlying depolarization. Second, Ca++ may be released from intracellular stores independently of depolarization, leading to overestimation of neuronal activation. Third,

Ca++ itself is a potent signaling molecule with significant effects on the membrane potential, yet Ca++ signals are often interpreted simply as passive indicators of membrane potential changes. Finally, mammalian nervous systems are very large and complex, with the human brain containing up to 86 billion neurons (Azevedo et al. 2009; Lo and

Chiang 2016). Therefore, in-depth analysis of neuromodulation in mammalian systems will be very challenging and time consuming.

Caenorhabditis elegans is an excellent system to understand neuromodulation at single neuron resolution because its nervous system is relatively small and simple (only

302 neurons), stereotyped in development and structure, and fully reconstructed by serial section electron microscopy (Hobert 2010; White et al. 1986). Moreover, they are transparent, which facilitates the use of optical reporters. Importantly, neuromodulators, receptors, and downstream signaling pathways are highly conserved between C. elegans and mammals (Chase and Koelle 2007; Koelle 2016). I have focused on the modulation of aversive locomotory responses to the noxious odorant 1-octanol, especially in the presence of the monoamine serotonin (5-HT), which acts on the ASH polymodal nociceptive neurons (among others) to potentiate the aversive reaction (Chao et al. 2004;

Harris et al. 2011). I have analyzed the neuromodulation of the ASH by using the Ca++ signal as a readout of cellular excitability. Previous studies showed that 5-HT reduces the

ASH Ca++ signal in response to 1-octanol and potentiates depolarization (Zahratka et al.

2015). In this chapter, I will discuss the current research on neuromodulatory signaling cascades in mammalian systems, discuss the current optical reporters being used, including their advantages and disadvantages and summarize the current neuromodulatory research gained from using the model organism C. elegans.

1.1 Neuromodulation: A Major Regulator of Wellbeing

Neuromodulation is an important mechanism of the nervous system to ensure that an organism can properly integrate multiple signals and stimuli and respond accordingly, and maintain an overall healthy mental and physical wellbeing (Linster and Fontanini

2014; Marder 2012). Neuromodulators act on neurons throughout the nervous system via specific receptors to modulate neuronal events including; depolarization, synaptic signaling, synchrony, and network excitability to generate alternative behaviors (Linster and Fontanini 2014). The neuromodulatory neurotransmitters include the five major biogenic amines; serotonin, dopamine, norepinephrine (noradrenaline) and epinephrine

(adrenaline) (Harris-Warrick and Johnson 2010; Purves et al. 2008), as well as neuropeptides e.g. oxytocin, vasopressin, and the opioid peptides (Purves et al. 2008;

Stein and Zollner 2009; Stoop 2014). Disruption in any neuromodulatory cascade can lead to severe defects in behavior and psychiatric disorders including anxiety, depression, chronic pain, schizophrenia and drug addiction (Harris-Warrick and Johnson 2010; Stoop

2014). Unlike the small signaling molecules known as neurotransmitters (GABA, acetylcholine and glutamate), which simply convey the flow of information from one neuron to the next, neuromodulators regulate neuronal excitability and synaptic strengths

typically through G-protein signaling cascades to reconfigure neural circuits and to produce differential outputs (Gutierrez and Marder 2014; Harris-Warrick and Johnson

2010; Nadim and Bucher 2014; Swensen and Marder 2001). Additionally, disruption of neuromodulation during neural development can lead to deformities in neural structure, function and connectivity (Money and Stanwood 2013). Current drugs used to treat neuromodulatory diseases frequently act to increase or decrease neuromodulatory signaling and tend to be broad/wide spectrum, resulting in the activation of additional signaling cascades, causing numerous side effects (Chiechio 2016; McCreary and

Newman-Tancredi 2015; Yohn et al. 2017). Many studies have focused on where in the brain neuromodulators function and how they modulate neuronal activity.

1.2 Monoamines and Neuropeptides Modulate Neuronal Activity

1.2.1 Serotonin

The serotonergic signaling cascade has been implicated in a variety of different behaviors and disruption can lead to numerous different diseases (Kawashima 2017). Serotonin (5-

HT) is commonly associated with excitatory postsynaptic effects but can also inhibit neurons too (Bohm et al. 2015). 5-HT is most abundant in the dorsal and medial raphe nuclei of the pons and upper brainstem, where the neurons project into the forebrain to regulate numerous behaviors (Brill et al. 2016; Kawashima 2017; Purves et al. 2008).

During wakefulness, serotonergic neurons fire tonically but during slow wave sleep and rapid eye movement (REM) the neurons fire less frequently and become silent

respectively (Urbain et al. 2006). Alternatively, the firing states of raphe nuclei can be increased during states of reward and punishment (Jacobs and Azmitia 1992). Disruption in serotonergic signaling has been associated with numerous disorders such as depression, anxiety, schizophrenia, chronic pain and obesity (Loyd et al. 2013; Purves et al. 2008). Most current drugs that target 5-HT signaling, inhibit specific serotonin transporters (SERT) preventing the reuptake of the molecule back into nerve terminals

(Purves et al. 2008). Currently, 5-HT receptors are targets for 40% of approved medicines to help treat neuromodulatory diseases (McCorvy and Roth 2015).

5-HT signaling affects many aspects of neuronal and non-neuronal cells including; intracellular signaling pathways, ionic currents and membrane potential.

Currently there are 14 distinct receptors characterized 5-HT receptors in the mammalian system (McCorvy and Roth 2015). 13 of the known 5-HT receptors are G-protein coupled receptors (GPCR) that can be classed into six types; 5-HT1, 5-HT2, 5-HT4, 5-

HT5, 5-HT6 and 5-HT7 (McCorvy and Roth 2015). The final receptor, 5-HT3 is a ligand- gated cation channel (Ciranna 2006; Purves et al. 2008). These 14 receptors are distributed throughout the nervous system as well as other tissues including the circulatory and digestive systems (Ciranna 2006). Below is a summary on the effects on neuronal signaling by the major 5-HT receptors.

1.2.1.1 5-HT1 Receptors

The Gαi/o coupled 5-HT1 receptors are one of the most abundantly expressed 5-HT receptors in the brain (Altieri et al. 2013; Kaufman et al. 2016). There are five identified subtypes of 5-HT1 receptors; A, B, D, E & F, all of which are associated with the modulation of neurotransmitter release by reducing cAMP accumulation via the inhibition of adenylyl cyclase, the inhibition of Ca++ currents and the activation hyperpolarizing K+ channels to reduce cellular firing (McCorvy and Roth 2015; Nautiyal and Hen 2017; Polter and Li 2010). Altered expression of the 5-HT1 receptors is commonly associated with illnesses including schizophrenia, depression, anxiety and migraine (Ciranna 2006; Kaufman et al. 2016; McCorvy and Roth 2015; Raymond et al.

2001). Of the five subtypes 5-HT1A and 5-HT1B are the most well-known 5-HT1 receptors.

5-HT1A receptors hyperpolarize neurons to reduce neurotransmitter release

(McCorvy and Roth 2015). There are two distinct classes of the 5-HT1A receptor; the autoreceptors which are expressed on the serotonergic raphe nuclei and the heteroreceptors localized on non-serotonergic neurons particularly in the hippocampus and cortex (Bohm et al. 2015; McCorvy and Roth 2015; Nautiyal and Hen 2017; Polter and Li 2010). 5-HT1A receptors are considered somatodendritic as they are expressed on cell somas and dendrites (Nautiyal and Hen 2017). The 5-HT1A autoreceptor silences raphe nuclei signaling by interacting with 5-HT released by the neurons, preventing further synthesis and release of the molecule (Altieri et al. 2013; Polter and Li 2010).

Disruption of 5-HT1A receptors has been associated with psychiatric disorders including

Parkinson’s, schizophrenia, depression and anxiety (Altieri et al. 2013; Polter and Li

2010). Loss of the 5-HT1A autoreceptor leads to elevated raphe neuron firing and continuous 5-HT release causing mice to become more anxious (Richer et al. 2002).

The release of 5-HT from the raphe neurons can modulate the signaling of other neurotransmission systems via the 5-HT1A heteroreceptor (Altieri et al. 2013; Bohm et al.

2015; Leao et al. 2012), including the modulation of dopamine (DA) release in the ventral tegmental area (VTA) (Diaz-Mataix et al. 2005). This modulation involves the 5-

HT1A heteroreceptors expressed on the inhibitory GABAergic interneurons in the medial prefrontal cortex (mPFC) hyperpolarizing the neurons reducing their activity and release of GABA (Altieri et al. 2013; Diaz-Mataix et al. 2006; Diaz-Mataix et al. 2005; Santana et al. 2004). The reduced activity of the GABAergic interneurons may disinhibit the pyramidal neurons in the mPFC that stimulate VTA dopaminergic neurons promoting the release of DA affecting mood and behavioral control (Altieri et al. 2013; Diaz-Mataix et al. 2006; Diaz-Mataix et al. 2005; Santana et al. 2004).

5-HT1B is typically found on the axons of neurons including the raphe nuclei and the basal ganglia and function as autoreceptors and heteroreceptors respectively (Nautiyal and Hen 2017). Unlike 5-HT1A receptors, which inhibit neuronal signaling via hyperpolarizing the cell, 5-HT1B receptors inhibit neurons by reducing the activity of

VGCCs in the presynaptic terminal (Boschert et al. 1994; Nautiyal and Hen 2017).

Stimulation of 5-HT1B prevents further 5-HT release and promotes reuptake (Montanez et al. 2014; Trillat et al. 1997). In mice, loss of the 5-HT1B is commonly associated with increased aggression and increased risk of depression (Nautiyal and Hen 2017; Nautiyal et al. 2015). Depression has been attributed to both the 5-HT1B auto- and heteroreceptors, but because the receptors are located at presynaptic terminals, identifying the source of

the problem using brain imaging and pharmacological approaches has been difficult due to the axon terminals of both serotonergic and non-serotonergic neurons being in very close proximity to each other (Nautiyal and Hen 2017; Nautiyal et al. 2015; Sari 2004).

Additionally, 5-HT1B receptors are prevalent in the cerebral arteries and the disruption of proper signaling leads to migraines (McCorvy and Roth 2015). Current antimigraine drugs act as agonists for 5-HT1B receptors to stimulate vasoconstriction of the arteries and relieve migraines (McCorvy and Roth 2015). In summary, 5-HT1 receptors play a major role in neuromodulation of mammalian systems through the inhibition of neurotransmitter release from both serotonergic and non-serotonergic neurons to regulate signaling from other cell types. Furthermore, the disruption of 5-HT1 signaling can lead to numerous illnesses including depression, anxiety and aggression.

1.2.1.2 5-HT2 Receptors

Members of the 5-HT2 receptor family are Gαq/11-coupled and are found throughout the brain specifically in the hippocampus, cortex, basal ganglia, striatum and choroid plexus

(Di Giovanni et al. 2006). There are three identified subtypes of the 5-HT2 receptor; A, B

& C (Di Giovanni et al. 2006; Hoyer et al. 2002). 5-HT2 receptors lead to the activation of phospholipase C (PLC) via the Gαq subunit to hydrolyze phosphatidyl inositol (PIP2) generating inositol triphosphate (IP3) and diacylglycerol (DAG), leading to release of

++ intracellular Ca (Devroye et al. 2017). Disruption in 5-HT2 signaling has been commonly associated with a variety of disorders including; epilepsy, Parkinson’s,

schizophrenia, depression, drug abuse and memory impairment (Di Giovanni et al. 2006;

Gurevich et al. 2002; Palacios et al. 2017; Sodhi et al. 2001; Zhang and Stackman 2015).

5-HT2A is expressed throughout the body predominantly in smooth muscles to mediate contraction and in the central nervous system (CNS) (Hoyer et al. 2002). In the brain 5-HT2A is the most abundantly expressed 5-HT receptor in the amygdala and hippocampus, particularly on glutamatergic and GABAergic interneurons located in these two regions (Bombardi and Di Giovanni 2013). The disruption of 5-HT2A signaling in the amygdala and hippocampus leads to memory impairment, depression, anxiety and schizophrenia (Bombardi and Di Giovanni 2013; Dean 2003; Di Giovanni et al. 2006;

Zhang and Stackman 2015). Additionally, 5-HT2A is located on the midbrain dopaminergic nerve terminals and leads to the increased release of DA from these neurons (Di Giovanni et al. 2006; Miner et al. 2003; Nocjar et al. 2002). As mentioned, disruption of 5-HT2ARs is associated with psychotic disorders including schizophrenia. In patients suffering from schizophrenia, the density of 5-HT2AR expression in the prefrontal cortex has been shown to be significantly increased (Dean 2003; Zhang and

Stackman 2015). The dopamine/serotonin hypothesis of psychosis suggests that antipsychotic drugs should have high-affinity antagonism for 5-HT2AR and lower affinity for the DA-2 receptors found in the GABAergic neurons of the pre-frontal cortex to regulate schizophrenic behavior, as excessive serotonergic stimulation of dopaminergic neurons is assumed to be the major cause of schizophrenia (Dean 2003; Eggers 2013;

Huttunen 1995; Mocci et al. 2014; Zhang and Stackman 2015).

5-HT2B receptors are the most recent addition to the 5-HT2 family and as such little is known about their function in the CNS. 5-HT2B receptors have been localized to

the hippocampus, locus coeruleus and medial amygdala (Bonaventure et al. 2000;

Devroye et al. 2017). 5-HT2B activation has been associated with the phosphorylation of the 5-HT transporter SERT in the raphe nuclei to help regulate 5-HT transport efficiency

(Devroye et al. 2016; Diaz et al. 2012; Launay et al. 2006). Therefore, the disruption of

5-HT2B signaling has been linked with illnesses including depression (Devroye et al.

2016). Recent research has identified the role of 5-HT2BR in modulating the activity of ascending dopaminergic pathways in the mPFC and nucleus accumbens (NAc) and disruption of these signals may play a role in mediating schizophrenia (Devroye et al.

2016; Devroye et al. 2017). Finally, 5-HT2BRs have been implicated with the regulation of L-type voltage gated Ca++ channels to help regulate the entry of extracellular Ca++ into neurons (Cox and Cohen 1995).

The final member of the 5-HT2 family is 5-HT2C whose disruption, similar to the other receptors in this family, have been implicated in illnesses such as schizophrenia, depression and anxiety (Chagraoui et al. 2016). 5-HT2C is broadly expressed in the CNS particularly in the choroid plexus epithelial cells, amygdala, NAc and thalamus

(Chagraoui et al. 2016; Herrick-Davis et al. 2015; Li et al. 2004). Interestingly, 5-HT2CRs have been shown to undergo significant post-translational modifications, mRNA editing and splicing to generate various isoforms and polymorphisms (Chagraoui et al. 2016;

Niswender et al. 1998). The various isoforms of 5-HT2C alters G-protein coupling efficacies leading to differential modulation of signaling pathways and altered affinity for agonists (Berg et al. 2001; Niswender et al. 1998). Like 5-HT2A and 5-HT2B, 5-HT2C has been implicated in the modulation of dopaminergic signaling, by acting in the inhibitory

GABAergic neurons that synapse onto dopaminergic neurons in the VTA and NAc

(Chagraoui et al. 2016; Di Giovanni et al. 2000). Blockage of 5-HT2C prevents depressive disorders by elevating the release of DA (Chagraoui et al. 2016; Di Matteo et al. 2000).

In conclusion, disruption 5-HT2 receptors results in numerous severe illnesses. 5-HT2 receptors appear to play a major role in the stimulation or inhibition of dopaminergic systems to help modulate various behaviors. However, due to the overlapping expression and function of the 5-HT2 family members, identification of how each receptor specifically affects modulation will be very difficult.

1.2.1.3 5-HT3, 5-HT4, 5-HT5, 5-HT6 and 5-HT7 Receptors

A majority of the investigations associated with 5-HT have focused on the modulation of behaviors by the 5-HT1 and 5-HT2 receptors, but recently 5-HT3, 5-HT4, 5-HT6 and 5-

HT7 have been shown to be major players in mediating serotonergic neuromodulation.

The 5-HT3 receptor is a ligand-gated ion channel, permeable to cations (McCorvy and

Roth 2015). There are five 5-HT3 subunits identified in humans; the homopentameric channels 5-HT3A and 5-HT3B and the heterotetrametric forms 5-HT3D, 5-HT3E and 5-HT3F

(Gupta et al. 2016). Similar to the 5-HT1 and 5-HT2 receptors, 5-HT3 is widely distributed in the brain, but 5-HT3A shows higher expression in the hippocampus, amygdala and NAc (Gupta et al. 2016). 5-HT3 receptors modulate rapid membrane depolarization by allowing the entry of K+ and Na+ ions into the neuron at postsynaptic sites and to initiate the release of neurotransmitters via Ca++ entry at presynaptic sites

(Gupta et al. 2016; Reeves and Lummis 2002; Turner et al. 2004). Stimulation of 5-HT3

has been associated with the release of 5-HT from raphe nuclei via the activation of

VGCCs leading to Ca++ influx (Gupta et al. 2016; Ronde and Nichols 1998). Therefore, increased 5-HT3 signaling results in depression and antagonists against the receptor promote antidepressant effects (Gupta et al. 2016; Redrobe and Bourin 1997).

Little is known about the 5-HT5 to date, but preliminary studies suggest that the receptor does play a role in neuromodulatory signaling, particularly in psychiatric and memory disorders (Gonzalez et al. 2013; McCorvy and Roth 2015). There are two identified subtypes of 5-HT5 receptors, 5-HT5A and 5-HT5B (McCorvy and Roth 2015). 5-

HT5A has been identified in mouse, rat and human neurons, particularly in the cortical layers and cerebellum (Nelson 2004; Pasqualetti et al. 1998). However, 5-HT5B currently has only been identified in mouse and rat (Nelson 2004). In humans 5-HT5B usually forms a non-functioning protein due to interruptions by stop codons in the coding sequence (Nelson 2004; Thomas 2006). Expression studies in HEK-293 cells have identified that 5-HT5 receptors are Gαi-coupled and reduce cAMP levels (Hurley et al.

+ 1998). Additionally, 5-HT5 couple with inwardly rectifying K channels, but currently the mechanism to which these 5-HT receptors couple in vivo has not been clearly established

(Thomas 2006).

The remaining 5-HT receptors are Gs-coupled, leading to the elevation of cAMP

(McCorvy and Roth 2015). The 5-HT4 receptor is expressed broadly throughout the human system including the digestive, circulatory and urogenital systems as well as the

CNS, especially in the hippocampus and the cortical/striatal areas (Amigo et al. 2016;

Bonaventure et al. 2000). In the nervous system, 5-HT4 receptors modulate depression and anxiety (Amigo et al. 2016; Bonaventure et al. 2000; Segi-Nishida 2017). Post-

mortem studies of depressed individuals have indicated an elevated expression of 5-HT4 in the brain, and the treatment with the antidepressant fluoxetine reduces the level of expression (Amigo et al. 2016; Haahr et al. 2014). Conversely, the reduced affinity for 5-

HT by 5-HT4 also promotes increased risk of suffering from depression in vivo (Madsen et al. 2014).

Activation of 5-HT6 receptors inhibits neurotransmitter release, specifically norepinephrine, acetylcholine and glutamate in the frontal cortex and hippocampus

(Dawson et al. 2001; Karila et al. 2015). The disruption of the 5-HT6 receptors has been linked to Alzheimer’s disease, obesity, schizophrenia and depression (Karila et al. 2015).

5-HT6 antagonists are currently used as antipsychotics and to help reduce obesity.

Furthermore, antagonizing 5-HT6R has been implicated with the treatment Alzheimer’s

(Ferrero et al. 2017; Karila et al. 2015). Finally, the 5-HT7 receptors have been linked with the modulation of depression and schizophrenia as the pharmacological blockade or loss of the receptor helps treat these two illnesses (Guseva et al. 2014; Hedlund and

Sutcliffe 2004). Additionally, 5-HT7 has been attributed to schizophrenia as the level of receptor expression is significantly increased in the prefrontal cortex of schizophrenic patients (East et al. 2002; Guseva et al. 2014). In summary, the remaining members of the

5-HT receptor family appear to function in the same regions of the brain as the more well documented 5-HT1 and 5-HT2 receptors and modulate similar behaviors. Although the serotonergic system has been studied for over half a decade, the sheer size and complexity of the mammalian nervous system has hampered the ability to build a unified model for serotonergic signaling (Kawashima 2017).

1.2.2 Other Neuromodulators

1.2.2.1 Dopamine

In the nervous system, neuromodulation is also regulated by dopamine, norepinephrine, epinephrine and neuropeptides, leading to the regulation of multiple different behaviors

(Purves et al. 2008). The biogenic amine dopamine (DA), is known to play many roles in modulating various behaviors and is commonly associated with the reward system, but also motivation and reinforcement behaviors too (Purves et al. 2008). DA is produced from the precursor tyrosine using the enzyme tyrosine hydroxylase to generate dihydroxyphenylalanine (DOPA), which then undergoes decarboxylation by DOPA decarboxylase forming DA (Purves 2008). Although DA is present throughout the brain, the major DA-containing area is in the corpus striatum (Purves 2008). DA signals through five known GPCR receptors that are classed into two families; the D1-like receptors (D1 and D5) which are Gs-coupled leading to the stimulation of cAMP production and the Gi/o-coupled D2-like receptors (D2, D3 and D4) which inhibit adenylate cyclase activity, reducing cAMP levels (Boyd and Mailman 2012; Purves et al.

2008). DA plays major roles in modulating neuronal excitability, synaptic transmission, synaptic plasticity and information flow, which when disrupted can lead to defective social behaviors and drug addiction as well as anxiety, depression and autism (Johnson and Lovinger 2016; Seamans and Yang 2004).

Of the five receptors, the effects of D1 and D2 on modulating animal behavior have been extensively studied. The dopamine D1 receptor (D1R) has been linked to

mediating multiple behaviors including social interactions, depression and anxiety (Chan et al. 2017). The lateral habenula (LHb) is a link node between the fore and mid brain and plays a vital role in emotion processing, and disruption in LHb signaling leads to anxiety and depression (Chan et al. 2017; Mathis et al. 2015). The LHb is connected to the VTA, a key area of dopaminergic signaling, and increased DA release enhances LHb signaling

(Kowski et al. 2009). The D1R is expressed in the LHb and mediates the excitation of the neurons in this region (Chan et al. 2017). Interestingly, decreased D1R signaling in the

LHb has been attributed to increasing anxiety-like behaviors but reduces depression-like responses in rats (Chan et al. 2017). Furthermore, increased expression of D1R or reduction of D2 receptors in the dorsal striatum promotes autistic behaviors (Lee et al.

2017).

The dopamine D2 receptor (D2R) is a well-known modulator of drug addiction.

Imaging studies in humans and other animals have identified a reduced expression of

D2R in patients who have chronic exposure to various drugs including cocaine, alcohol, heroin and cannabis (Johnson and Lovinger 2016). Interestingly, the activation or inhibition of D2R has alternative effects on seeking or refusing various addictive substances (Johnson and Lovinger 2016). Additionally, D2Rs have been linked to regulating mental disorders that include depression, schizophrenia and Parkinson’s disease (Bonci and Hopf 2005). Disruption in D2R signaling often attenuates phenotypes associated with depression and schizophrenia and antagonistic drugs against D2Rs are a common method of treatment to help prevent these illnesses (Bonci and Hopf 2005). In summary, DA plays a key role in modulating animal behaviors and the disruption of signaling leads to serious illnesses.

1.2.2.2 Norepinephrine and Epinephrine

Norepinephrine/noradrenaline (NE) is released by sympathetic nervous system in fight- or-flight responses. However, NE also functions in the locus coeruleus, a region that has many projections into the fore brain, to regulate sleep, attention and feeding behaviors

(Purves et al. 2008). NE is produced from DA via the dopamine-β-hydroxylase and acts on the G-protein coupled α- and β-adrenergic receptors to modulate neuronal signaling

(Purves et al. 2008). NE targets a wide variety of neuronal subtypes and can have a significant impact on synaptic excitability which can lead to long-term circuit modifications (Schmidt et al. 2013). Compared to the other neuromodulators, the signaling mechanisms utilized by NE to alter neuronal excitability is less well understood

(Fitzgerald 2014; Schmidt et al. 2013). However, the disruption of noradrenergic signaling has been linked with Parkinson’s disease, with over 40% of sufferers showing reduced NE expression caused by the degeneration of the locus coeruleus (Espay et al.

2014; Fitzgerald 2014). Furthermore, disruption in NE signaling leads to bipolar disorder, depression, anxiety and sleep problems (Espay et al. 2014; Fitzgerald 2014). Current treatments for these NE mediated diseases include administration of L-DOPA to increase the synthesis of DA and NE, or inhibitors of NE reuptake (Espay et al. 2014). Although initial observations have linked disruption in NE signaling with numerous illnesses, more research is required to fully understand how the signaling pathways are impaired (Espay et al. 2014).

Epinephrine/adrenaline is only found in a few areas in the brain (Purves et al.

2008). Epinephrine containing neurons, typically referred to as adrenals, are primarily

found in the lateral tegmental system and the medulla, which project to the hypothalamus and thalamus (Purves et al. 2008). Epinephrine is synthesized by phenylethanolamine-N- methyltransferase and acts on α- and β-adrenergic receptors too (Purves et al. 2008).

Although epinephrine is used to treat anaphylactic shock, cardiac arrest and superficial bleeding, how the molecule modulates nervous systems and behaviors is less well defined. However, disruption in epinephrine signaling has been hypothesized to play a role in depression via the regulation of cytokine release from immune cells (Kim and

Won 2017). The increased release of epinephrine can result in neuroinflammation and the elevation of pro-inflammatory cytokine release throughout the brain, resulting in the accumulation of neurotoxic metabolites which may cause alterations in brain function leading to increased risk of depression (Kim and Won 2017). In conclusion, the neuromodulators epinephrine and norepinephrine have been implicated in regulating various behaviors. However, these two signaling molecules are key players in other systems outside of the CNS including the regulation of inflammatory responses and cardiac regulation (Kim and Won 2017; Ramchandra and Barrett 2015). Nevertheless, these two neuromodulators may still play important roles in regulating neuronal excitability.

1.2.2.3 Neuropeptides

The final class of neuromodulators, the neuropeptides, are a group of specialized proteins that have been associated with the modulation many behaviors, but the most well studied areas include pain sensation, stress and satiety (Purves et al. 2008). Currently over 100

neuropeptides have been identified in humans, each of which regulate a variety of different behaviors (Russo 2017). Neuropeptides are initially synthesized in the neuron as pre-propeptides and undergo various post-translation modifications in the Golgi body or in vesicles to produce an active signaling peptide (Purves et al. 2008). Each propeptide can produce more than one species of active neuropeptide (Purves et al. 2008). The activity of the neuropeptide is determined by their amino acid sequence and consequently there are five groups of neuropeptides; brain/gut, opioid, pituitary, hypothalamic releasing hormones and a non-classified category (Purves et al. 2008). Similar to the biogenic amines, neuropeptides typically bind to GPCRs at low concentrations (nM-µM) allowing postsynaptic targets to be far from the peptide release site (Purves et al. 2008).

One of the most well studied neuropeptides classes are the opioid peptides and their regulation of pain sensation. Opioid peptides are widely expressed throughout the

CNS and periphery nervous system and are often co-localized with other signaling molecules including GABA, glutamate and 5-HT (Purves et al. 2008). There are three main types of opioid receptors expressed in the nervous system the µ-, δ- and κ-receptors, and a group of additional receptors (σ-, ε-, and orphanin) which are not considered to be

‘classical’ opioid receptors (Pan et al. 2008; Stein and Zollner 2009). Opioid peptides are typically coupled to Gαo/i proteins to reduce cAMP production and have the capacity to regulate K+ and/or Ca++ channel activity (Pan et al. 2008; Stein and Zollner 2009). All three opioid receptors inhibit the N-, T- and P/Q-type VGCCs to prevent Ca++ influx and inhibit neurotransmitter release and reduce pain sensation (Stein and Zollner 2009).

Disruption of endogenous opioid peptide signaling is commonly associated with chronic pain, as loss of opioid signaling leads to continual substance P release and the persistent

sensation of pain (Pan et al. 2008; Stein and Zollner 2009). Additionally, prolonged use of synthetic opioids agonists (e.g. morphine) can lead to serious illness including depression, anxiety and addiction (Stein and Zollner 2009).

Lastly, the neuropeptides oxytocin and vasopressin play major modulatory roles in the nervous system. Oxytocin and vasopressin are predominantly synthesized in the hypothalamic regions of the brain, but function throughout the nervous system (Johnson and Young 2017). In response to pain, vasopressin potentiates pain sensation by increasing action potential generation in C-type nociceptive fibers whereas oxytocin reduces pain sensation by activating GABA release to inhibit the nociceptive fibers

(Stoop 2014). Additionally, oxytocin can regulate the release of 5-HT from the raphe nuclei to modulate social reward behavior (Dolen et al. 2013; Stoop 2014). Finally, both these peptides have been implicated in regulating other behaviors that include olfaction, social recognition, memory formation and loss of signaling has been attributed to autism

(Johnson and Young 2017; Stoop 2014). In conclusion, neuromodulators appear to regulate a vast array of different behaviors by acting throughout the CNS. Although the use of knockout mice, methods to localize receptor activity, identification of G-protein coupling and in vitro studies have aided in determining the overall effect of neuromodulatory signaling, how neuromodulators affect cell and circuit excitability is poorly defined. Therefore, newer techniques are required to gain further insight on how neuromodulators affect circuits and the flow of information.

1.3 Calcium Imaging: A Powerful Technique to Measure Neuronal Activity in

Intact Nervous Systems

To better understand how neuromodulators function, a common technique is to compare the alteration of information flow in modulated and non-modulated circuits. A major goal of the BRAIN initiative, a collaborative project to better understand the human brain, is to develop tools and methods that can measure global changes in intact nervous systems during active signaling in the presence or absence of neuromodulators (Badura et al.

2014). The challenge is the ability to understand how changes in neuronal excitability, processing and behavior are correlated. A major advancement in quantifying changes in global neuronal excitability has come through the ability to optically measure changes in neurons via microscopy using activity dependent fluorescent proteins (Badura et al. 2014;

Vogt 2015). The ability to optically measure changes in neuronal activity has several advantages over conventional electrophysiological techniques. First, unlike electrophysiology, Ca++-imaging allows the measurement of multiple different neurons simultaneously in a circuit. Second, optical imaging allows the measurement of multiple different signals including action potentials, synaptic activity and intracellular signaling.

Lastly, the length of time in which data can be acquired from a cell is increased (Badura et al. 2014; Lin and Schnitzer 2016; Vogt 2015). The two major methods used to observe optical changes in neuronal excitability include Ca++-imaging via Ca++ indicators and voltage sensors (Badura et al. 2014; Inagaki and Nagai 2016; Mank and Griesbeck 2008;

Vogt 2015).

Currently, the most successful method of recording neuronal excitability is through Ca++-imaging. This technique has been utilized in all manner of neuroscientific experiments in organisms ranging from invertebrates to awake mammals (Helmchen and

Waters 2002). Typically, Ca++ regulates a variety of different cellular functions including transcription regulation, cell division, secretion, excitability and neuronal plasticity

(Badura et al. 2014; Helmchen and Waters 2002). In neurons, presynaptic Ca++ regulates synaptic vesicle release whereas postsynaptic Ca++ controls synaptic plasticity (Badura et al. 2014). However, depolarization can lead to the influx of Ca++ into the neuron via

Voltage-Gated Ca++ Channels (VGCCs). Upon stimulation, sensory transduction pathways lead to the opening of Transient Receptor Potential (TRP) channels causing the influx of cations and depolarizing the neuron. Depolarization spreads along the neuron either as an action potential in larger nervous systems, such as the mammalian, or passively as seen in nematodes (Goodman et al. 1998; Purves et al. 2008). Regardless of how depolarization spreads, it will lead to the opening of VGCCs, and a major source of

++ the detectable Ca comes through the L-type VGCCs known as the Cav1 channels. The

L-type VGCCs provide a strong and long-lasting Ca++ signal and are activated around -

25mV (Xu and Lipscombe 2001). Additionally, release of Ca++ from internal stores can also be detected by Ca++ reporters (Ross and Manita 2012; Zahratka et al. 2015). After

Ca++ entry, >95% of the ion undergoes buffering by various mechanisms and is cleared using specialized ATPase pumps that transport Ca++ either back into the sarcoplasmic reticulum where intracellular Ca++ is stored, or out into the extracellular matrix (Abdel-

Hamid and Tymianski 1997; Purves et al. 2008).

Due to the variety of different channels and compartments of a neuron the

Ca++ signal has often been used to measure various neuronal signaling events (Badura et al. 2014; Birkner et al. 2017; Ross and Manita 2012). Since the detectable Ca++ signal primarily enters neurons via the L-type VGCCs, there is a common assumption that an increase in the detectable Ca++ signal positively correlates with an increase in depolarization (Akerboom et al. 2012; Iwabuchi et al. 2013; Kato et al. 2015; Lin and

Schnitzer 2016). The detectable Ca++ signal has often been used as a direct readout of neuronal depolarization (Akerboom et al. 2012; Lin and Schnitzer 2016). Calcium indicators can fall into two categories; the small molecule organic dyes such as BAPTA,

OGB-1, Fura-2 and calcium green-1 dextran or the genetically encoded Ca++ indicators

(GECIs) which includes the GCaMPs and cameleons (Badura et al. 2014; Gobel and

Helmchen 2007; Tsien 1989). Below I will discuss the current Ca++ indicators used and outline the advantages and disadvantages associated with each reporter.

1.3.1 Fluorescent Dyes: Pioneers for Neuronal Activity Mapping

The first Ca++ reporters generated were the synthetic organic fluorescent dyes, whose binding of Ca++ altered their absorbance or fluorescence properties, providing a detectable signal (Mank and Griesbeck 2008). Fluorescent dyes are membrane impermeable and methods to ensure cells are stained include; cell specific microinjection or targeted electroporation of a desired region which could affect 10-100 neurons (Gobel and Helmchen 2007). Commonly, microinjection or local/targeted electroporation requires the dye to be loaded as either a salt or as a dextran-conjugate (Gobel and

Helmchen 2007). However, for large scale imaging, dyes are usually loaded in the form of a membrane permeable acetoxymethyl (AM) ester (Gobel and Helmchen 2007). Once in the neuron, the ester groups are cleaved by cytosolic esterases, making the dye membrane impermeable (Gobel and Helmchen 2007; Helmchen and Waters 2002; Tsien

1981). The use of dyes to measure Ca++ signals have many advantages that include; fast binding and disassociation kinetics, allowing the detection of rapid Ca++ fluctuations, large fluorescence changes, near-linear response properties, high photostability preventing rapid bleaching and high pH-resistance (Badura et al. 2014; Mank and

Griesbeck 2008). Certain fluorescent dyes such as OGB-1 can report 14-fold relative intensity changes (Mank and Griesbeck 2008; Tsien 1989). Additionally, due to low resolution of cells, fluorescent dyes allow rapid and large-scale mapping of excitation by analyzing changes in Ca++ fluorescence in specific regions of the brain (Helmchen and

Waters 2002). However, fluorescent dyes have some major disadvantages. For example, bulk application can lead to reduced contrast of specific cell types or tissues and reduced image and signal quality (Badura et al. 2014; O'Donovan et al. 1993). The use of fluorescent dyes prevents the analysis of deeper neurons as the level of light scatter increases and inhibits the activation of the dyes (Helmchen and Waters 2002).

Furthermore, fluorescent dyes can be extruded from the cell relatively quickly compared to other Ca++ indicators, excess loading of dye can lead to cell/tissue damage, neurons of certain organisms that include C. elegans and Drosophila melanogaster cannot take up dyes due to thick cell walls or cuticulae and finally if the dye does not fully diffuse throughout the cell it will prevent the detection of compartmentalized signals (Badura et al. 2014; Mank and Griesbeck 2008; O'Donovan et al. 1993). Finally, fluorescent dyes

do not allow differential labeling of specific neuron classes (Mank and Griesbeck 2008).

Although fluorescent dyes are effective in measuring the Ca++ signal in a large group of neurons within a system, the use of other Ca++ indicators that can record the activity of individual neurons may help improve the understanding of the modulation of information flow in neural circuits.

1.3.2 FRET-based Ca++ Indicators

Due to the reduced specificity of fluorescent dyes, development of genetically encoded

Ca++ indicators (GECIs) have provided the ability to measure Ca++ signals in specific subtypes of neurons. Additionally, GECIs allowed the long-term expression of a Ca++ indicator in neurons and provide increased optical contrast (Badura et al. 2014). There are two major forms of GECIs, the Fluorescence Resonance Energy Transfer (FRET) GECIs

(Cameleon & TN-XL) and the GFP-calmodulin GECIs (GCaMP) (Badura et al. 2014;

Mank and Griesbeck 2008). The recombinant FRET-based indicators utilize two different fluorescent proteins, such as CFP/YFP that are joined together by a linker. One of the most well-known FRET GECIs is cameleon which has two fluorophores joined together via calmodulin (CaM) and the calmodulin-binding peptide of the myosin light chain kinase M13 (Miyawaki et al. 1997; Truong et al. 2001). In the absence of Ca++, CFP/YFP cameleons will fluoresce blue light, but when Ca++ is present, CaM wraps around M13 causing a conformational change of the protein which reduces the distance between the two fluorophores causing the donor CFP to activate the acceptor YFP, causing yellow light to be emitted (Figure 1-1) (Badura et al. 2014; Miyawaki et al. 1997; Truong et al.

2001). Currently the most commonly used cameleons include YC2.60 and YC3.60, which have been successfully incorporated into cortical L2/L3 pyramidal and cerebellar

Purkinje neurons (Badura et al. 2014; Lutcke et al. 2010; Yamada et al. 2011).

The second FRET-based GECI, Troponin, utilizes the vertebrate skeletal and cardiac muscle Ca++ sensitive protein Troponin C (TnC) (Badura et al. 2014). Unlike the cameleons, TnC reporters are more biocompatible, as TnC has fewer interactions with endogenous proteins or molecules in cells and has faster Ca++ binding kinetics (Badura et al. 2014; Rose et al. 2014). Similar to the cameleons, TnC reporters have undergone numerous rounds of engineering and the most common variants used are troponin extra- large (TN-XL), troponin extra, extra-large (TN-XXL) & Twitch, which show faster activation and decay compared to the cameleon Ca++ sensors, possess a 5-fold increase in fluorescence, and have been successfully incorporated in mammalian systems (Badura et al. 2014; Mank and Griesbeck 2008; Mank et al. 2006; Rose et al. 2014). Twitch is a variant of TN-XL in that it is generated by mutating TnC so only one or two Ca++ binding sites are present, which increases the sensitivity of the sensor, allows the detection of smaller Ca++ spikes and further reduces the interaction of the sensor with endogenous proteins in the neuron (Figure 1-1) (Badura et al. 2014).

Unlike the fluorescent dyes, FRET-based GECIs can be located to specific sites with cells, such as organelles or other sites to measure changes in local Ca++ concentrations (Truong et al. 2001). Other advantages of using FRET based GECIs include the ability to add the indicator via DNA transfection, a less invasive and damaging method compared to the microinjection of dyes (Mank and Griesbeck 2008).

Additionally, FRET-based GECIs can provide a readout of the Ca++ concentration within

the cell, as the level of Ca++ will affect the degree of energy transfer between the donor and acceptor fluorophores (Kerr and Schafer 2006). FRET-based GECIs have a larger dynamic range allowing the measurement of lower Ca++ changes as well as high, and grant the measurement of Ca++ signals in each individual cell without obscuring the readout of neighboring neurons (Kerr and Schafer 2006). Lastly, FRET Ca++ indicators show increased stability at body temperature (37°C) and are pH insensitive in the physiological range (Mank et al. 2006).

However, there are several disadvantages associated with FRET-based Ca++ indicators. For cameleon, the high affinity for Ca++ by CaM results in slower release and reset, causing sluggish intramolecular kinetics with a rise time of approximately one second and slow fluorescent signal decay lasting around three seconds (Badura et al.

2014; Chung et al. 2013). Similarly, TN-XXL and Twitch also show slow off-responses compared to fluorescent dyes by having increased affinity for Ca++, preventing the detection of rapid signals in neurons with fast firing (Badura et al. 2014). Additional problems involve endogenous interactions between intracellular proteins or other ions

(Mg++) with the Ca++ sensors. With regards to cameleon, endogenous CaM may interact with M13 on the fluorophore, resulting in the inactivation of the sensor (Mank and

Griesbeck 2008). Finally, the orientation of the two fluorophores in FRET-based Ca++ indicators can have a significant impact on the signal intensity and efficiency of the sensor. Finally, compared to synthetic fluorescent dyes, the signal to noise ratio is worse in FRET-based sensors (Tian et al. 2009; Truong et al. 2001). The FRET-based GECIs have provided useful insight into how Ca++ signals are modulated, but due to their slow

recovery times and difficulties with maintaining constant signal intensities, researchers have recently turned to the third type of Ca++reporters, the GCaMPs.

1.3.3 GCaMP: The Best Ca++ Indicator?

The most popular Ca++ reporter has become the GFP Calmodulin fusion proteins, commonly known as the GCaMPs. Unlike the FRET-based sensors, GCaMPs typically utilize the single fluorophore GFP, but the mutation of specific regions of GFP can generate other fluorescent proteins that include red (RCaMP) and blue (BCaMP)

(Akerboom et al. 2013; Heim et al. 1994; Mishin et al. 2008; Rose et al. 2014). The

GCaMPs are composed of a GFP protein that has been circularly permuted and fused to the linkers CaM at the C-terminus of the opening, and M13 bound to the N-terminus

(Badura et al. 2014; Nakai et al. 2001). In the presence of Ca++ CaM will bind to M13, closing the GFP, resulting in fluorescence (Figure 1-1) (Badura et al. 2014; Nakai et al.

2001). However, early versions of GCaMP were inferior to the FRET-based reporters but modifications led to the improvement of the reporter, making it become one of the most widely used Ca++ reporters in neuroscience (Badura et al. 2014).

Development of improved GCaMP indicator responses led to creation of

GCaMP3, a reporter with increased stability, larger dynamic range and higher affinity for

Ca++ (Tian et al. 2009). GCaMP3 was generated by mutating the circularly permuted GFP protein and the interface between CaM and M13 (Tian et al. 2009). This new GCaMP probe was significantly more sensitive to changes in the Ca++ signal compared to TN-

XXL and the cameleons and had increased photostability, lower baseline signals and increased peak amplitudes (3-times higher) (Badura et al. 2014; Tian et al. 2009).

GCaMP3 has been used successfully to measure the activity of neurons in many different regions of the mammalian brain and comparing the Ca++ signals with behavioral responses (Akerboom et al. 2012; Dombeck et al. 2010; Tian et al. 2009). Additionally,

GCaMP3 has been expressed in other organisms including Drosophila, C. elegans and zebrafish (Chiappe et al. 2010; Del Bene et al. 2010; Mills et al. 2012; Zahratka et al.

2015). GCaMP3 has provided valuable information in analyzing the activity of neurons in different systems. However, there are limitations with this reporter including, the inability to reliably detect changes in Ca++ with single action potential signals in vivo and dissecting the relationship between low changes in fluorescence and neuronal excitability

(Akerboom et al. 2012; Yamada and Mikoshiba 2012). Additionally, further manipulation of GCaMP3 had the potential to develop newer generations of GCaMPs with increased Ca++ sensitivity and fluorescence (Yamada and Mikoshiba 2012).

Improvements on GCaMP3 have focused on two main attributes, brightness and response times (Badura et al. 2014). The development of GCaMP5 and GCaMP6 by mutating the CaM/M13 interface to enhance Ca++ affinity, resulted in reporters that had both improved brightness and stability (Akerboom et al. 2012; Badura et al. 2014; Chen et al. 2013). Production of a family of GCaMP5 sensors from GCaMP3 improved the dynamic range sevenfold and improved the signal to noise ratio two/three-fold

(Akerboom et al. 2012). Specific subsets such as GCaMP5G showed significantly stronger signals compared to GCaMP3, but the signal-to-noise ratio was similar to its predecessor (Akerboom et al. 2012; Ohkura et al. 2012). On the other hand, the

GCaMP5K reporter is the most sensitive reporter of the GCaMP5 family, but the signal strength was weaker compared to other members of the group (Akerboom et al. 2012;

Ohkura et al. 2012). Although the GCaMP5 family members showed some improvement in detecting Ca++, none of them were superior to previous versions (Ohkura et al. 2012).

The GCaMP6 family show stronger signal amplitudes, faster kinetics and can detect single action potential spikes, providing the ability to detect smaller and subtler

Ca++ transients, an event that GCaMP3 cannot (Ohkura et al. 2012). Additionally,

GCaMP6 has increased baseline fluorescence making it a suitable reporter in dendritic spines and for postsynaptic site analysis (Ohkura et al. 2012). Similar to GCaMP5G,

GCaMP6 has similar baselines but possess a three-fold higher affinity for Ca++ and a 1.3- fold stronger signal (Chen et al. 2013). Furthermore, the response kinetics were significantly faster in GCaMP6 compared to GCaMP5 members (Chen et al. 2013).

Currently, the best GCaMP6 reporter is GCaMP6f, which has the fastest response times and strongest peak amplitudes (Chen et al. 2013). GCaMP6 has been successfully used for large scale neuronal imaging as well as individual spike analysis in different model organisms (Chen et al. 2013). Newer GCaMP reporters are still being developed that include GCaMP7 and GCaMP8, which continue to show improved response times and amplitudes (Badura et al. 2014; Muto et al. 2013; Podor et al. 2015).

Despite all the advantages associated with improving the GCaMP Ca++ sensor there are still some problems associated with using these indicators to measure neuronal excitability. First, GCaMP detects the Ca++ signaling event that is associated with changes in membrane potential (Yang and St-Pierre 2016). Additionally, Ca++ dynamics may not track or represent hyperpolarizations or subthreshold depolarizations and despite

the improvements on generating GCaMPs with faster kinetics, the speed of the detectable

Ca++ transients may not accurately represent rapid and subtle changes in membrane potential (Storace et al. 2016; Yang and St-Pierre 2016). Furthermore, the detectable signal reported by GCaMPs or any other GECI may not represent a change in membrane potential, as the release of Ca++ from intracellular stores may be the source of the detectable signal (Antic et al. 2016). However, despite these disadvantages, GCaMP has yielded many new insights to better understand neuronal signaling and the development of optical indicators capable of reporting changes in membrane potential are being developed (Broussard et al. 2014; Storace et al. 2016; Vogt 2015; Yang and St-Pierre

2016).

Figure 1-1 Structure and Function of Genetically Encoded Ca++ Indicators. A)

Illustration of cameleon in the absence of Ca++ (left) emitting blue light and in the presence of Ca++ (right) emitting yellow light due to FRET. B) In the absence of

Ca++ TN-XL emits blue light (left), but when Ca++ is present TnC undergoes a conformational change bringing CFP and YFP resulting in FRET and the emission of yellow light. C) In the absence of Ca++ GFP is circularly permuted resulting in no fluorescence (left) but when Ca++ is present CaM and M13 join completing GFP promoting fluorescence (right).

1.3.4 Voltage Sensor Proteins

As mentioned above, GECIs may not be able to reliably measure changes in membrane potential, especially if there is little to no Ca++ associated with it. Therefore, the use genetically encoded voltage indicators (GEVIs), would allow the direct recording of membrane potentials in multiple neurons simultaneously by measuring changes in fluorescence (Inagaki and Nagai 2016). Data collected from GEVIs could provide a more accurate representation of neuronal excitability (Inagaki and Nagai 2016; Kulkarni and

Miller 2017). Additionally, the use of GEVIs will prevent the need of direct electrophysiological recordings, a difficult technique, that has low throughput and limited accessibility (Vogt 2015). Therefore, the effort to develop voltage sensitive optical reporters that can detect rapid changes in membrane potential as been undertaken.

The earliest voltage sensors developed were the voltage sensitive dyes, known as electrochromic dyes, which generate fast and strong optical signals when a neuron undergoes changes in membrane potential (Miller 2016; Mutoh et al. 2012; Vogt 2015).

Similar to the Ca++-sensitive dyes, voltage dyes were applied to a large set of neurons via injection or in the form of hydrolyzable esters and changes in their light emission allowed the visualization of depolarization (Mutoh et al. 2012; Siegel and Isacoff 1997; Vogt

2015). However, voltage dyes stain all neurons resulting in diffuse and noisy signals, and the injection of the dye can lead to neuronal damage (Mutoh et al. 2012; Vogt 2015).

Additionally, if there are constant rapid changes in membrane potential, voltage sensitive dyes are unable to reliably detect every single event (Mutoh et al. 2012). Although new

and improved dyes are constantly being developed, a majority of effort is being dedicated to the creation of GEVIs (Vogt 2015).

The current generation of GEVIs use similar methods to that of the GECIs. One form of GEVI uses one or more fluorescent proteins (typically circularly permuted GFP) that are coupled to a four-pass voltage sensing domain (VSD) that include either voltage- sensitive phosphatases, potassium channels, sodium channels or proton channels (Siegel and Isacoff 1997; Xu et al. 2017; Yang and St-Pierre 2016). The benefit associated with utilizing a VSD, is that expression of the indicator on the membrane is enhanced (Inagaki and Nagai 2016). Upon depolarization, voltage-dependent structural changes in the VSD lead to the opening of GFP resulting in decreased fluorescence (Barnett et al. 2012;

Inagaki and Nagai 2016). Due to the high level of fluorescence of VSD based GEVIs at rest, the detection of strong changes in membrane potential can be easily recorded, but changes in conformation can take several milliseconds, preventing the recording of rapid single action potentials (Inagaki and Nagai 2016). As such, improvements on the response speed and dynamic range are required in order to make VSD-based GEVIs a reliable indicator of changes in membrane potential (Inagaki and Nagai 2016). The second type of GEVI uses microbial rhodopsins, and depending on the strength of the depolarization, will affect the probability of a cytoplasmic proton protonating the rhodopsin chromophore leading to fluorescence (Yang and St-Pierre 2016). Other variants of this form of GEVI include the FRET-opsins. These indicators possess a fluorescent protein that acts as a FRET-donor to the rhodopsin, and neuron depolarization effects the absorption spectra of the rhodopsin changing FRET efficiency, thus generating photon emission from the coupled fluorescent protein (Gong et al. 2014; Yang and St-

Pierre 2016; Zou et al. 2014). Compared to the VSD-based GEVIs, FRET-opsins have faster kinetics and a larger dynamic range and the signal-to-noise ratio is high enough to detect single action potential spikes (Inagaki and Nagai 2016). However, expression of

FRET-opsins on the membrane is not as prevalent compared to the VSD based GEVIs, and typically form aggregates in the soma (Yang and St-Pierre 2016). Further improvements on the FRET efficiency in the FRET-opsins will further enhance their dynamic range and expression (Inagaki and Nagai 2016).

Major advantages associated with GEVIs is that they allow the analysis of voltage signals in regions of neurons that are difficult to record via Ca++, such as small neurons and processes (Yang and St-Pierre 2016). GEVIs also abolish the need to patch onto small neurons, a difficult task, and allow faster output of electrical signals in these neurons (Yang and St-Pierre 2016). Finally, GEVIs will allow the rapid analysis of the effects on drug screens on neuronal excitability (Yang and St-Pierre 2016; Zhang et al.

2016). However, there are problems associated with the current generation of GEVIs.

First, current versions do not allow the recording of changes in membrane potential in deep tissues and so changes in the Ca++ signal is the only current method to analyze these neurons (Inagaki and Nagai 2016). Secondly, the voltage indicators need to be targeted to the membrane to allow the recording of changes in potential, but current reporters have low membrane expression (Vogt 2015; Yang and St-Pierre 2016). Therefore, the creation an indicator that can be reliably expressed on the cell surface is needed (Vogt 2015; Yang and St-Pierre 2016). Additionally, the development of GEVIs to be targeted to specific regions of neurons including dendrites, nerve terminals and somas to allow the recording of these sections remains a challenge (Storace et al. 2016). Due to the speed of action

potentials, 100-1000-fold faster than Ca++ signals, the imaging speed to measure changes in the fluorescence for GEVIs needs to be significantly faster (Inagaki and Nagai 2016;

Kulkarni and Miller 2017; Vogt 2015; Xu et al. 2017). To measure these rapid signals the illumination intensity would need to be elevated to ensure a suitable signal-to-noise ratio, but increased illumination can lead to photobleaching and phototoxicity (Kulkarni and

Miller 2017; Xu et al. 2017; Yang and St-Pierre 2016). As such, new techniques to overcome these problems with illumination intensity need to be developed (Vogt 2015;

Xu et al. 2017). Finally, GEVIs must be able to be expressed and functional in a variety of different species, like their GECI counterparts, and not be affected by differences in body temperature or cell architecture (Yang and St-Pierre 2016). Despite these disadvantages, GEVIs have the potential to enhance the ability to measure changes in neural circuits in a non-invasive manner but until the challenges associated with these indicators are overcome, Ca++-imaging remains the most suitable method to record changes in neuronal excitability.

1.4 C. elegans: A Model Organism for Studying Neuromodulation

While the role of neuromodulators has been extensively studied in mammalian systems, the large number of neurons poses as a major barrier. With a total of 86 billion neurons and trillions of synapses in human brains, the prospect of analyzing and mapping circuit activities is a difficult task (Lo and Chiang 2016). Due to the sheer size and complications associated with mammalian systems, the small, free living nematode

Caenorhabditis elegans is used to study neuromodulation. In C. elegans neuromodulation

is essential in ensuring that the proper behavior in response to a stimulus is achieved.

Furthermore, these behaviors can be easily measured and quantified. Therefore, many research groups use C. elegans to study how neuromodulators effect behavioral responses to both positive and negative stimuli, and to identify the key receptors and their sites of action within the circuit.

C. elegans comes as two sexes; male and hermaphrodite, allowing genetic crosses and the development of clones to be easily achieved (Brenner 1974). Developing embryos of C. elegans hatch 3.5 days after laying and undergo four larval stages (L1-L4) and become adults in under a week under standard lab protocols (grown on E. coli OP50 bacteria at 20°C (Brenner 1974)). Adult hermaphrodites can self-fertilize allowing the passage of genetically identical animals, providing a large source of subjects for analysis.

The C. elegans hermaphrodite nervous system consist of 302 neurons and is stereotypical, allowing quick identification of specific cells (Hobert 2010). A major advantage of the C. elegans nervous system is that the entire connectome of the animal has been fully mapped by serial electron microscopy (White et al. 1986). Furthermore, the C. elegans genome can be easily manipulated genetically through the use of various gene editing methods that include cell specific RNAi knockdown, gene rescue and

CRISPR (Esposito et al. 2007; Friedland et al. 2013; Fujiwara et al. 1999; Harris et al.

2009). Lastly the percentage of conservation between the proteins of C. elegans and mammals is relatively high (Chase and Koelle 2007; Koelle 2016). Here, C. elegans has been utilized to dissect the relationship between the Ca++ and depolarization signals in a nociceptive neuron and how various neuromodulators can manipulate the neuron.

1.4.1 The C. elegans Nervous System.

Although the number of neurons is smaller compared to mammalian systems, there is still complexity in the C. elegans nervous system. Through reconstruction by serial electron micrographs, the entire connectome of C. elegans has been mapped, with more than 7000 chemical and electrical synapses interconnecting the 302 neurons (White et al. 1986). C. elegans can perform a variety of complex behaviors that include thermotaxis, chemotaxis, aerotaxis and responses to mechanical and osmotic stimuli (Bargmann 2006;

Goodman 2006). Similar to mammals, C. elegans uses neurotransmitters such as glutamate, GABA and acetylcholine to convey signals between neurons (Brockie and

Maricq 2006; Jorgensen 2005; Rand 2007). A variety of different C. elegans behaviors can be modulated by monoamines and neuropeptides. In C. elegans the major monoamines are; serotonin (5-HT), dopamine (DA), octopamine (OA) and tyramine

(TA), the latter two being the invertebrate orthologs of norepinephrine and epinephrine respectively (Chase and Koelle 2007).

Treatment of C. elegans with exogenous 5-HT leads to the modulation of multiple behaviors including; the inhibition of locomotion and defecation and the stimulation of egg laying and pharyngeal pumping (Chase and Koelle 2007). The stimulation of egg laying by 5-HT involves the release of the monoamine from the HSN neurons, which interacts with the VC4/5 neurons and innervates the vulval muscles (Duerr et al. 1999;

Sze et al. 2000). Regarding the stimulation of pharyngeal pumping, 5-HT reduces the duration of pharyngeal action potentials and enhances the activity of the of the M3 motor neurons, an inhibitory glutamatergic neuron which terminates the action potential

(Niacaris and Avery 2003). This modulation leads to rapid contraction and relaxation cycles and the and the adaptation of pharyngeal pumping in the presence of food

(Niacaris and Avery 2003).

Animals treated with exogenous DA display modulated locomotory, learning and searching behaviors (Chase and Koelle 2007). After exhausting their current food source, animals will search the immediate area to ensure no additional food is present before exploring other areas (Chase and Koelle 2007). However, animals that are unable to synthesize endogenous DA, will exit the localized search more quickly than their wild- type counterparts (Hills et al. 2004). Furthermore, DA signaling ensures that the animal stays with the vicinity of the food source by enhancing high-angled turns when the worm leaves the bacterial lawn and slowing of forward locomotion when food has been located

(Chase and Koelle 2007). Finally, animals exposed for prolonged periods to an odorant show adaptation to the stimulus via dopaminergic signaling pathways, and will not respond when the stimulus is reapplied, a behavior that can last for several hours (Chase and Koelle 2007; Colbert and Bargmann 1995). The adaption of C. elegans to repeated stimulus application is dependent on DA signaling, as mutants that lack endogenous synthesis do not adapt, but how this is achieved has not yet been identified (Bettinger and

McIntire 2004; Chase and Koelle 2007).

Finally, the monoamines octopamine and tyramine are released during periods of prolonged starvation and modulate behaviors including; inhibition of pharyngeal pumping and egg laying and increase the distance of spontaneous reversals (Chase and

Koelle 2007). With regards to pharyngeal pumping, OA acts antagonistically to 5-HT and promotes prolonged pharyngeal depolarizations and inhibits the M3 neuron (Niacaris and

Avery 2003), whereas TA possibly acts through SER-2 directly on the pharyngeal muscle

(Tsalik et al. 2003). Both TA and OA inhibit egg laying by acting antagonistically to 5-

HT pathways, and inhibiting vulval muscles (Alkema et al. 2005; Horvitz et al. 1982).

Finally, TA inhibits the number of head oscillations during backwards locomotion to promote longer reversals by signaling through SER-2 expressed on the head muscles or through TYRA-2 on the ALM neurons (Alkema et al. 2005; Rex et al. 2005; Rex et al.

2004; Tsalik et al. 2003). In summary, C. elegans can make complex decisions and perform sophisticated behaviors to ensure that they can successfully navigate their environment.

1.4.2 The ASH Sensory Neuron

One of the best studied neurons in the C. elegans nervous system are the ASHs, a pair of polymodal nociceptive sensory neurons. The ASHs are part of the amphidal sensory apparatus, whose sensory endings are directly exposed to the external environment

(Hilliard et al. 2002; Walker et al. 2009). The ASHs can sense both mechanical and chemical stimuli including; harsh nose touch, high osmolarity and noxious chemicals and odorants (Colbert et al. 1997; Harris et al. 2011; Harris et al. 2009; Hilliard et al. 2005;

Hilliard et al. 2002). Due to the collective behavioral research in response to the noxious chemical 1-octanol, I studied the modulation of ASH signals to the stimulus. Upon stimulation via 1-octanol, activation the TRPV-like channels OCR-2/OSM-9 are activated via a yet unidentified receptor, which is coupled to the G-protein ODR-3, leading to initial depolarization of the dendrite (Roayaie et al. 1998; Tobin et al. 2002).

The neuron becomes depolarized releasing glutamate to convey the signal to the AVA command interneurons to initiate backwards locomotion (Lindsay et al. 2011; Thiele et al. 2009). Responses to 1-octanol are proportional to the stimulus intensity (Summers et al. 2015), but monoamines can alter the responses to become all or none, allowing positive or negative modulation.

Responses to dilute (30%) 1-octanol can signal via two pathways. The direct pathway involves the ASHs signaling onto the backward command neurons known as the

AVAs (Lindsay et al. 2011; Thiele et al. 2009). The second method is a disinhibitory pathway, whereby ASH signals onto the AIB interneurons, which results in the disinhibition of the RIM interneurons, thus promoting backwards locomotion (Piggott et al. 2011). The ASHs primarily signal to downstream neurons via the neurotransmitter glutamate, based on the expression of the glutamate transporter EAT-4, and the expression of glutamate gated ion channels on downstream neurons (Hills et al. 2004;

Lee et al. 1999; Mellem et al. 2002; Rose et al. 2003; Summers et al. 2015; Zheng et al.

1999). The ASHs also express four known neuropeptides, NLP-3, NLP-15, FLP-21 and

INS-1, which have been shown to act downstream of the ASH to mediate behavior

(Chalasani et al. 2010; Harris et al. 2010; Holden-Dye and Walker 2013; Mills et al.

2012; Nathoo et al. 2001; Rogers et al. 2003). Many studies have been conducted to analyze how ASH mediated behavioral responses to the noxious odorant 1-octanol are modulated, making the ASH a promising target for the study of neuromodulation.

1.4.3 Monoamines Extensively Modulate ASH Mediated Behaviors in C.

elegans

The modulation of aversive response to the noxious odorant 1-octanol is one of the most well characterized behaviors in C. elegans. ASH mediated behavioral responses to 1- octanol show bimodality. For example in response to 30% 1-octanol in the absence of food (E. coli OP50), wild-type C. elegans respond after ten seconds on average (Chao et al. 2004), whereas responses to 30% 1-octanol on food or 5-HT or to 100% 1-octanol, the behavioral response times are enhanced to five seconds (Chao et al. 2004; Mills et al.

2012; Wragg et al. 2007). The response times to various concentrations of 1-octanol can be modulated by the monoamines serotonin, octopamine, tyramine and dopamine. These four monoamines can either enhance or inhibit the response to 1-octanol.

1.4.3.1 Serotonin

Serotonin (5-HT), is synthesized in three neurons; NSM, ADF and HSN, from tryptophan via the gene tph-1 to create 5-hydroxytryptophan (5-HTP), which is converted to 5-HT by

BAS-1 (Chang et al. 2006; Chase and Koelle 2007). There are five known 5-HT receptors in C. elegans; four GPCRs; SER-1, SER-4, SER-5, SER-7, and one ion gated channel,

MOD-1 (Chase and Koelle 2007). 5-HT is commonly associated as one of the ‘food at hand’ signals leading to changes in many behaviors, including responses to 30% 1- octanol (Chao et al. 2004; Harris et al. 2009). Similar to 1-octanol responses on food, 5-

HT results in enhanced aversive times (5s) after stimulus presentation (Chao et al. 2004;

Harris et al. 2011; Harris et al. 2009). The enhancement to dilute 1-octanol behavior can be achieved by 5-HT directly interacting with the primary 1-octanol sensing neuron ASH by binding with the 5-HT6-like GPCR SER-5 (Harris et al. 2011). The specific loss of ser-5 by RNAi knockdown in the ASH prevented 5-HT enhancement of the behavior; and rescuing ser-5 specifically in the ASH restored the five second response time to 1- octanol (Harris et al. 2011).

However, the ability for 5-HT to enhance the response to 30% 1-octanol can be extended beyond the ASHs, by modulating neurons at multiple levels within the nervous system. The inhibitory Cl- gated ion channel MOD-1, functions within the interneurons

AIY and AIB (Harris et al. 2009). Rescue specifically in the AIY or AIB of mod-1 nulls restores the enhanced behavioral response time to 30% 1-octanol, suggesting that that 5-

HT modulates both AIBs and AIYs to mediate the enhanced behavior (Harris et al. 2009).

Another GPCR, the 5-HT2-like receptor SER-1, also plays a role in 5-HT mediated behavior. Loss of ser-1 by specifically knocking down expression in the RIA by RNAi prevents 5-HT from increasing response times to 1-octanol (Harris et al. 2009). Taken together, 5-HT can act at multiple levels within the C. elegans nervous system from the level of the primary sensory neuron, to interneurons via different receptors or channels to modulate the response times to 1-octanol.

1.4.3.2 Dopamine

Dopamine (DA) signaling allows the worm to respond to changes in the environment by modulating locomotory behaviors including ASH mediated responses. (Chase and

Koelle 2007). DA is synthesized in eight neurons in the hermaphrodite via the tyrosine hydroxylase CAT-2 from tyrosine to form L-DOPA, which is used by BAS-1 to create

DA (Chase and Koelle 2007; Suo et al. 2003). There are seven currently identified DA receptors in C. elegans; the D1-like GPCRs DOP-1 and DOP-4, which are Gαs-coupled and stimulate adenylyl cyclase to increase cAMP production and the D2-like GPCRs

DOP-2 and DOP-3, which inhibit adenylyl cyclase activity through Gαo/i signaling

(Chase et al. 2004; Pandey and Harbinder 2012; Sugiura et al. 2005). The final three receptors are the GPCRs DOP-5 (a mammalian melatonin type 1b homolog) and DOP-6, a D2/D3-like receptor that may act redundantly with DOP-2, and the DA gated Cl- channel LGC-53 (Carre-Pierrat et al. 2006; Keating et al. 2003; Ringstad et al. 2009).

Similar to 5-HT, DA can modulate ASH behaviors to 1-octanol. In the presence of exogenous DA animals still respond to dilute 1-octanol after ten seconds (Wragg et al.

2007). However, when endogenous DA synthesis is lost via cat-2, animals are hypersensitive to 5-30% 1-octanol in the presence of food and respond after two seconds compared to ten in wild type (Ferkey et al. 2007). The ability for endogenous DA to modulate ASH mediated behaviors is dependent on two receptors, DOP-3 and DOP-4, which affect ASH bidirectionally. In dop-3 mutants, responses to 30% 1-octanol are faster (~4s) compared to wild type suggesting that DOP-3 functions to dampen and inhibit the ASHs (Ezak and Ferkey 2010). In addition, loss of dop-3 by ASH specific

RNAi knockdown also led to hypersensitivity to dilute 1-octanol, resulting in aversive responses occurring 4s after stimulus presentation, suggesting that DOP-3 is functioning in the ASH to directly inhibit responses to 1-octanol (Ezak and Ferkey 2010).

The second ASH expressed DA receptor DOP-4 is hypothesized to elevate responses to ASH sensed noxious odorants by directly modulating the neuron (Ezcurra et al. 2011). In the presence of Cu++, another ASH sensed repellent, 80% of wild type animals displayed avoidance to the stimulus in the presence of food, whereas only 50% of dop-4 null animals responded (Ezcurra et al. 2011; Wang et al. 2014a). Furthermore, modulation of ASH responses to Cu++ by DOP-4 is a result of the receptor functioning in the neuron: as specifically rescuing DOP-4 in the ASH restored avoidance to Cu++ on food, with approximately 70% of animals avoiding the stimulus, and cell specific RNAi knockdown mimicked the null with only 50% of animals avoiding the stimulus (Ezcurra et al. 2011). In conclusion DA modulates various ASH sensed behaviors by directly acting on the neuron.

1.4.3.3 Octopamine

The ASH can be modulated by alternative monoamines such as the invertebrate orthologue of norepinephrine, octopamine (OA). OA is synthesized in the RIC neurons from tyramine by the tyramine β-hydroxylase TBH-1 (Alkema et al. 2005; Chase and

Koelle 2007). There are three known OA receptors in C. elegans; OCTR-1, SER-3 and

SER-6. OA signals nutritional state and is often elevated when the animal begins to

starve (Mills et al. 2012). OA signals directly on the ASH through the Gαo-coupled receptor OCTR-1 to modulate aversive responses, which in turn is antagonized by a second ASH expressed OA receptor SER-3 (Mills et al. 2012). OA interaction through

OCTR-1 directly on the ASH inhibits neuronal signaling, as treating C. elegans with both

4mM OA and 4mM 5-HT abolishes 5-HT mediated enhanced 5s aversive responses to

30% 1-octanol (Mills et al. 2012). However, animals treated with 4mM 5-HT and 10mM

OA no longer display inhibited responses to 30% 1-octanol (Mills et al. 2012). The rescue of the 5-HT mediated enhanced behavior in the presence of 10mM OA is dependent on the Gαq-coupled receptor SER-3, specifically in the ASH, suggesting that

SER-3 and OCTR-1 act antagonistically to each other to modulate ASH responses in the presence of various OA concentrations (Mills et al. 2012).

OA can modulate the ASH in response to higher concentrations of 1-octanol indirectly. In the presence of 100% 1-octanol, C. elegans responds after five seconds on average (Chao et al. 2004; Mills et al. 2012). In the presence of 4mM or 10mM OA the response time to 100% 1-octanol is increased to ten seconds. The ability for OA to modulate the behavior was shown to be dependent on the Gαq-coupled receptor SER-6.

However, data suggests that ser-6 does not operate in the ASH, but instead functions in the peptidergic ASIs, which may release other neuromodulatory signaling molecules, such as neuropeptides, to alter ASH mediated behavior (Mills et al. 2012). In summary, these data suggest OA can directly modulate ASH responses via two receptors, which act antagonistically to each other to generate alternate behavioral outcomes, or through a second sensory neuron which releases neuropeptides to alter ASH signaling.

1.4.3.4 Tyramine

Tyramine (TA) is a trace amine and the invertebrate equivalent of epinephrine as well as the biosynthetic precursor of OA. Similar to OA, TA is released during periods when food abundance is low resulting in decreased egg laying and reduced spontaneous reversals (Alkema et al. 2005; Rex et al. 2004). TA is generated from the pre-cursor tyrosine using the tyrosine decarboxylase TDC-1 which is expressed in the RIC, RIM and

UV1 neurons (Alkema et al. 2005; Chase and Koelle 2007). There are four identified TA receptors in the C. elegans genome; 3 GPCRs SER-2, TYRA-2 and TYRA-3 and the TA- gated Cl- channel LGC-55 (Hapiak et al. 2013; Pirri et al. 2009; Rex et al. 2005; Rex and

Komuniecki 2002; Wragg et al. 2007).

Similar to OA, TA abolishes food and 5-HT dependent increases in aversive responses to 1-octanol and functions to inhibit ASH signaling. In response to 30% 1- octanol off food tdc-1 null animals, which cannot synthesize endogenous TA and OA, have increased reversal response times (~5s), but incubating mutants on exogenous TA restores the 10s response (Wragg et al. 2007). Furthermore, TA modulates aversive responses to 100% 1-octanol too, by inhibiting response times (Wragg et al. 2007). To determine which receptors were mediating TA inhibition of 1-octanol responses, three

GPCRs were analyzed. Surprisingly, mutants for the receptor TYRA-2, a Gαo-coupled

GPCR expressed in ASH, did not restore the enhanced behavioral responses to 30% 1- octanol in the presence of 5-HT and TA (Wragg et al. 2007). Mutants for SER-2, a second Gαo-coupled GPCR expressed in the AIY and AIZ interneurons also showed no enhancement in 1-octanol responses (Wragg et al. 2007). However, a third receptor

known as TYRA-3, which is a Gαq-coupled receptor, was discovered to mediate TA modulation of aversive behaviors (Wragg et al. 2007). TYRA-3 operates in eight dopaminergic neurons, two octopaminergic neurons and two peptidergic neurons (Hapiak et al. 2013). The loss of tyra-3 specifically in the one of the peptidergic neurons, the

ASIs, prevented TA inhibition of the 5-HT aversive response and ASI::tyra-3 rescue restored the inhibition (Hapiak et al. 2013). Interestingly, the inhibition of 5-HT enhanced behavior by TA and TYRA-3 is dependent on a selection of neuropeptides released from the ASIs. Mutants for the neuropeptides nlp-1, nlp-14 and nlp-18, all showed rapid reversals in the presence of TA and 5-HT to 1-octanol (Hapiak et al. 2013).

These neuropeptides act on different neurons within the system to modulate the behavior for example, NLP-1 acts on the AIAs via NPR-11, NLP-14 interacted with NPR-10 on the ADLs and NLP-18’s site of action is unknown (Hapiak et al. 2013). In conclusion, all four major monoamines can modulate the ASH sensory neuron, either directly or indirectly to alter behavior in response to different repellents. A summary of all the receptors, sites of action and effects on 1-octanol behavior can be found in Table 1-1.

Monoamine Receptors G-protein Sites of Action Effect on 30% 1-octanol Behavior Coupling Serotonin SER-1 ASH, AVE, RIA Rescue of ser-1 in RIA restores enhanced behavioral (5-HT) responses.

SER-5 Gαq / EGL-30 ASH, AWB, AVJ Loss of ser-5 in ASH abolishes 5-HT enhanced responses.

MOD-1 Cl- gated AIA, AIB, AIY, AIZ Functions in AIB & AIY to promote enhanced channel responses. Dopamine DOP-3 Gαo / GOA-1 ASH, ASE, ASK dop-3 nulls are hypersensitive to 1-octanol. (DA) DOP-4 Gαs / GSA-1 ASH, ASG, CAN Loss of dop-4 reduces sensitivity to 1-octanol.

Octopamine OCTR-1 Gαo / GOA-1 ASH, ASI, AIY octr-1 operates in the ASH to inhibit mediate 4mM OA (OA) inhibition of 5-HT enhanced behaviors.

SER-3 Gαq / EGL-30 ASH, PVQ, SIA Acts antagonistically to OCTR-1 in the presence of 10mM OA, restoring enhanced aversive behaviors.

SER-6 Gαq / EGL-30 ASI, ADL, AWB SER-6 mediates OA inhibition of ASH responses through the release of inhibitory ASI neuropeptides. Tyramine SER-2 Gαo / GOA-1 AIY, AIZ ser-2 animals display delayed responses in the presence (TA) of 4mM TA and 5-HT.

TYRA-2 Gαo / GOA-1 ASH, ASI, ASE Loss of tyra-2 has no effect on behavior.

TYRA-3 Gαq / EGL-30 ASI, ADL, ASK Loss of TYRA-3 specifically in ASI abolished TA inhibition of 5-HT enhanced behaviors. Table 1-1 Monoamines Extensively Modulate 30% 1-octanol Behaviors. Summary of receptors and their sites of action to modulate aversive responses to 1-octanol.

1.5 Analyzing the Neuromodulation of Ca++ Signals in C. elegans

The C. elegans model is ideal for studying monoamine modulation. Its small nervous system, the fully-described connectome, and the well-developed genetic and molecular techniques facilitate the vertically-integrated analysis of neuromodulation at molecular, cellular and behavioral levels. Similar to mammalian systems, C. elegans possess voltage gated calcium channels (VGCC’s) allowing the measurement of changes in Ca++ amplitude and overall cell excitability via genetically encoded calcium indicators

(GECIs). Major advantages of measuring the Ca++ signals in C. elegans are 1) the animals are transparent, allowing an effective and non-invasive method of recording changes in neuronal Ca++ 2) the connectome has been fully mapped, and 3) genetic mutations including cell specific rescue or knockdown can be combined with drug treatments. Through the use cell specific promoters, GECIs can be expressed in specific neurons within the worm and improved imaging techniques have allowed scientists to analyze single or multiple neurons globally at the same time in restricted or freely moving animals (Kato et al. 2015; Kato et al. 2014; Shidara et al. 2013; Zahratka et al.

2015).

1.5. 1 Ca++ Channels in C. elegans

Similar to mammals, GECIs can be expressed in C. elegans to measure changes in Ca++ either through VGCCs or from internal stores (Zahratka et al. 2015). C. elegans VGCCs

are much simpler and less diverse as the mammalian counterparts. C. elegans only

++ express one homologue of each Ca channel α1 subtype; the L-type channel EGL-19

(Cav 1), P/Q-type channel UNC-2 (Cav 2) and the T-type CCA-1 (Cav3) (Lee et al. 1997;

Schafer and Kenyon 1995; Shtonda and Avery 2005). Besides forming the main pore, the

++ α1 subunits also contain the voltage sensor and provide Ca ion selectivity (Laine et al.

++ 2011). C. elegans also express two intracellular Ca channels; the IP3R channel ITR-1 and the ryanodine mediated channel UNC-68 (Baylis et al. 1999; Maryon et al. 1996).

++ Unlike mammalian Ca channels, C. elegans Cav channels have fewer additional subunits, and only express two α2δ-subunits (UNC-36 & TAG-180) and two β-subunits

(CCB-1 & CCB-2) (Lee et al. 1997). A majority of studies analyzing C. elegans Ca++ channels have focused on the L-type VGCC EGL-19 and the P/Q-type channel UNC-2.

However, only EGL-19 will be discussed in greater detail.

1.5.1.1 EGL-19

EGL-19 encodes for the sole L-type α1 VGCC expressed in C. elegans. EGL-19 is expressed broadly in the worm including body wall muscle, pharynx, head neurons and intestines (Hilliard et al. 2005; Laine et al. 2011; Shtonda and Avery 2005; Zahratka et al.

2015). EGL-19 has sequence similarity to that of the mammalian Cav 1.2 and 1.3 channels, specifically an IQ domain which plays a major role in regulating L-type channel activity in mammalian systems (Blaich et al. 2012; Kwok et al. 2008; Zuhlke et al. 1999). Similar to mammalian L-type channels, EGL-19 is sensitive to a dihydropyridine (DHP) known as Nemadipine-A, a specific inhibitor of C. elegans L-

type VGCCs (Kwok et al. 2008; Kwok et al. 2006; Zahratka et al. 2015). DHPs function to block and render L-type channels inactive by allosteric structural changes in the channel (Kwok et al. 2008; Wappl et al. 2001). The C. elegans DHP is specific against

EGL-19 and therefore does not interact with mammalian L-type VGCCs (Kwok et al.

2006). Likewise, mammalian DHPs are not very effective against EGL-19 (Kwok et al.

2008; Kwok et al. 2006), suggesting that EGl-19 is similar to mammalian L-type VGCCs but not an exact duplicate. EGL-19 has been characterized to form a heteromultimeric channel with the α2δ-subunit UNC-36 and the β-subunit CCB-1 in muscle (Laine et al.

2011). However, the relationship between EGL-19 and the additional subunits in neurons has yet to be identified.

1.5.2 Modulation of ASH Ca++ Signals by Monoamines

ASHs have been shown to exhibit robust increases in Ca++ signals in response to nose touch, high osmolarity (1M glycerol), quinine, 1-octanol, Cu++, 0.1% SDS and DHCA

(Ezcurra et al. 2011; Gourgou and Chronis 2016; Guo et al. 2015; Hilliard et al. 2005;

Kato et al. 2015; Mills et al. 2012; Zahratka et al. 2015). Similar to the behavioral studies, the effects of monoamines modulating ASH Ca++ signals to various stimuli have been analyzed. When stimulated by nose touch, the ASH Ca++ signals in untreated wild type animals show no detectable signals. However, when treated with 2.5mM 5-HT, nose touch does elicit an ASH Ca++ response, suggesting that 5-HT modulates the neuron

(Hilliard et al. 2005). Additionally, endogenous 5-HT can modulate ASH Ca++ signals in response to Cu++. Wild type animals show a robust increase in ASH Ca++ transient

amplitude when challenged with 10mM Cu++. Interestingly, ser-5 mutants show a prolonged Ca++ response to Cu++, which can be prevented by specifically rescuing SER-5 in the ASHs. This would suggest that endogenous 5-HT is modulating ASH directly via

SER-5 (Guo et al. 2015). The loss of 5-HT synthesis in the ADF, via tph-1 nulls or the blockage of ADF neurotransmission via tetanus toxin, also prolongs ASH Ca++ signals to

Cu++, which suggests that 5-HT, specifically from the ADF is inhibiting the ASH Ca++ signal (Guo et al. 2015). Finally, 5-HT can modulate ASH Ca++ responses to 1-octanol and dihydroxyhydrocinnamic acid (DHCA). In untreated animals both 1-octanol and

DHCA elicited a robust Ca++ signal, but when treated with 4mM 5-HT the Ca++ amplitude was significantly lower (Zahratka et al. 2015).

1.5.2.1 5-HT Modulates ASH Ca++ and Depolarization Signals

Differentially

As mentioned earlier, the detectable Ca++ signal has often been used as a method of determining cell excitability. The common assumption made is that the Ca++ and depolarization signals are positively correlated (Chalasani et al. 2010; Gourgou and

Chronis 2016; Guo et al. 2015; Kato et al. 2015; Kato et al. 2014). This is based on the hypothesis that increased depolarization would lead to increased opening of VGCCs

(primarily the L-types) leading to a greater influx of Ca++ and therefore a larger Ca++ signal. Previous work undertaken by Dr. Jeff Zahratka, in which I was a co-author, demonstrated that the relationship between the 1-octanol induced Ca++ and

depolarizations signals are more complex, and in fact the Ca++ signal may not be a suitable indicator of determining the level of neuronal excitation.

As stated above, animals that express GCaMP3 under the ASH specific promoter sra-6, show a robust increase in the Ca++ signal throughout the neuron in response to saturated 1-octanol (Zahratka et al. 2015). The detectable Ca++ signal is a result of 1- octanol binding to the unknown ODR-3 coupled receptor, which results in the opening of the TRP channels OSM-9/OCR-2 and the influx of positively charged ions into the neuron, leading to depolarization and the opening the L-type VGCCs EGL-19, and the influx of Ca++ which is detected by GCaMP3 (Roayaie et al. 1998; Tobin et al. 2002;

Zahratka et al. 2015). Loss of egl-19 through genetic manipulation (loss-of-function and

ASH::egl-19 RNAi), or inhibition of the channel using the specific blocker Nemadipine

A (NemA), significantly reduced somal Ca++ signals in response to 1-octanol (Zahratka et al. 2015). However, the axonal signal was not affected as the second VGCC, the P/Q- type UNC-2 channel functions predominantly in this area of the neuron (Zahratka et al.

2015).

Animals treated with 4mM 5-HT showed significantly reduced somal ASH Ca++ signals in response to 1-octanol. The ability for 5-HT to inhibit somal Ca++ entry was shown to be dependent on the Gαq-coupled receptor SER-5 as loss of SER-5 or the Gαq protein EGL-30, prevented 5-HT inhibition of the somal Ca++ in response to 1-octanol

(Zahratka et al. 2015). The relationship between the reduced Ca++ and the enhanced behavioral response in the presence of 5-HT were negatively correlated, suggesting that

ASH excitability was reduced. To determine if the relationship between the Ca++ and depolarization signals were positively or negatively correlated, animals were tested using

electrophysiology. When untreated animals were analyzed the average depolarization amplitude was approximately 18mV (Figure 1-2 B & C). However, animals treated with

4mM 5-HT showed significantly stronger depolarization signals of 30mV (Figure 1-2 B

& C) (Zahratka et al. 2015). This suggested that 5-HT was potentiating the ASH and therefore driving faster response times to 1-octanol. Furthermore, these data highlight that the relationship between the Ca++ and depolarization signals are negatively correlated in the ASH in response to 1-octanol. Taken together, the detectable Ca++ signal in response to 1-octanol may be driving an inhibitory feedback loop in the neuron to reduce excitability and signaling, thus delaying overall response times to 1-octanol. When 5-HT is present the monoamine disinhibits the neuron, possibly by blocking Ca++ entry through the L-type VGCC EGL-19, through the Gαq-coupled receptor SER-5.

Figure 1-2: 5-HT Potentiates ASH in Response to 1-octanol. A) Diagram of recording setup. Left: Pipettes are positioned prior to recording. Upper left pipette delivers 1- octanol containing Sulforhodamine-101 indicating stimulus flow (shaded plume). Lower left pipette delivers shielding stream over exposed ASH. At lower right, a recording pipette is patched onto the ASH. Middle: 1-octanol is applied to the tip of the animal’s nose via a computer controlled stepper, while avoiding contact with exposed cell, change in depolarization is recorded. Right: 1-octanol pipette is returns to original position terminating recoding. B) Representative traces of 1-octanol depolarizations in the absence (left) and presence of 4mM 5-HT (right). C) 5-HT significantly increases depolarization in response to 1-octanol. ΔVm, change in membrane potential. * significantly different from untreated, p = 0.0003, unpaired t-test Values are means

±SEM; nos. within or above bars indicate n.

Based on these observations, the measurable Ca++ signal provides an indirect indication of neuronal activation. Therefore, over-reliance on Ca++ signals to analyze circuit function has three principal pitfalls: First, the activity of the voltage-gated Ca++ channels can be modulated by intracellular signaling cascades, so the Ca++ signal strength may reflect more the functional state of Ca++ channel than the amplitude of the underlying depolarization. Second, Ca++ may be released from intracellular stores independently of depolarization, leading to overestimation of neuronal activation. Third,

Ca++ itself is a potent signaling molecule with significant effects on the membrane potential, yet Ca++ signals are often interpreted simply as passive indicators of membrane potential changes. However, in order to fully determine the how Ca++ maybe inhibiting

ASH excitability and how 5-HT is disinhibiting the neuron, new techniques had to be developed. In Chapter 3, I will describe the new techniques developed to expand the analysis of ASH modulation, including improved dissection quality of neurons to increase the yield of viable neurons for Ca++-imaging and electrophysiology and the generation of a new piece of equipment that will allow the direct application of compounds onto a neuron. In Chapter 4, I will describe how 5-HT signals to inhibit EGL-

19, and how reducing Ca++ augments depolarizations. In Chapter 5, I will discuss how a

Ca++-activated K+ channel (BK), SLO-1, is a possible downstream target of Ca++ inhibition of ASH excitability and how the relationship between L-type VGCCs and BK channels is conserved in C. elegans to mediate proper neuronal signaling. Finally, in

Chapter 6 I will discuss how other neuromodulators affect ASH Ca++.

Chapter 2

Standard Materials and Methods

In this chapter, I will explain the methods used to generate the data for my dissertation as well as all strains, PCR products and materials used. The methods described here are general techniques utilized by many different research groups, but may highlight details more specific to my needs. For more information on the development of improved materials and methods, specifically for this dissertation, please see Chapter 3.

2.1 Strains and Constructs: Strains were maintained on NGM agar plates with E. coli

OP50 bacteria per standard protocols (Brenner 1974). Strains used were; N2, FY908 grls17 [Psra-6::GCaMP3], FY928 grls17 [Psra-6::GCaMP3]; Pgpa-4::RFP, FY867 ser-5 (tm2654) I;kyEx2865 [Psra-6::GCaMP3], FY934 egl-30 (n686sd) I; grls17 [Psra-

6::GCaMP3], FY936 slo-1 (eg142) V; grls17 [Psra-6::GCaMP3], FY975 tax-6 (p675)

IV; grls17 [Psra-6::GCaMP3], FY945 dyb-1(cx36)I;grls17 [Psra-6::GCaMP3],

FY1002, 1003, 1004 and 1005 bkip-1(zw477)II; grls17 [Psra-6::GCaMP3], FY1017 islo-1 (eg978)IV; grls17 [Psra-6::GCaMP3], FY885 npr-1(ky13)X; grls17 [Psra-

6::GCaMP3], FY886 npr-1 (ad609)X; grls17 [Psra-6::GCaMP3], FY922 npr-

1(ok1447)X; grls17 [Psra-6::GCaMP3], FY888 flp-21 (ok889)V; grls17 [Psra-

6::GCaMP3], FY891 flp-18(gk3063)X; grls17 [Psra-6::GCaMP3], FY900 egl-3

(n150)V; grls17 [Psra-6::GCaMP3], FY943 nlp-3(tm3023)X; grls17 [Psra-

6::GCaMP3], FY992 and FY993 nlp-15 (ok1512)I; grls17 [Psra-6:: FY1016 cat-2

(n4547)II; grls17 [Psra-6::GCaMP3], FY991 octr-1 (ok371)X; grls17 [Psra-

6::GCaMP3], FY996, 997, 998, 999 and 1000 ser-6(tm2146)IV; grls17 [Psra-

6::GCaMP3], FY994 and 995 che-7(ok2373)V;grls17 [Psra-6::GCaMP3], FY909 ntr-

1(ok2760)I;grls17 [Psra-6::GCaMP3], FY921 npr-2(ok419)IV;grls17 [Psra-

6::GCaMP3], FY1030, 1031, 1032 and 1033 ser-3 (ad1774)I; grls17 [Psra-

6::GCaMP3], FY1025, 1026, 1027, 1028 and 1029 dop-3(ok295)X; grls17 [Psra-

6::GCaMP3], FY1023 and 1024 dop-4(tm1392)X; grls17 [Psra-6::GCaMP3], slo-

1(eg142)V; ser-5(tm2654)I; egl-30(n686sd)I; tax-6 (p675)IV; dyb-1(cx36)I; bkip-

1(zw477)II; islo-1(eg978)IV; egl-3 (n150)V; nlp-3 (tm3023)X; nlp-15 (1512)I; npr-1

(ky13)X; npr-1 (ad609)X; npr-1 (ok1447)X; flp-18 (gk3063)X; flp-21 (ok889)V; npr-2

(ok419)IV; ntr-1 (ok2760)I; cat-2 (n4547)II; octr-1 (ok371)X; ser-3 (ad1774)I, ser-6

(tm2146)IV; dop-3 (ok295)X; dop-4 (tm1392)X.

Mutant strains expressing the GCaMP3 construct were generated by crossing

FY908 or FY928 males with mutant L4 hermaphrodites. Most strains were clarified for the mutations via genotyping animals using PCR. Certain strains had to be genotyped based on a phenotype. All identified strains were regularly genotyped to ensure the mutation was still present.

2.2 RNA Interference: Neuron-specific RNAi transgenes were generated using PCR with the Phusion polymerase enzyme (Esposito et al. 2007). The transgene was generated by fusing ~3.5kB of the sra-6 promoter (expressed specifically in ASH, ASI and PVQ neurons) to a fragment of an exon from slo-1. The promoter constructs were generated from worm lysis using the promoter Psra-6PF paired with either Psra-6;slo-1PRS (sense), to generate construct B, or Psra-6;slo-1PRA (antisense), producing construct C, reverse primers. The slo-1 target construct was generated by amplifying off genomic DNA using the primers SLO-1TF (forward) and SLO-1TR (reverse), making construct A. The sense construct was generated by fusing and amplifying the constructs A and B, with the primers Psra-6PF* and SLO-1TR* (* = internal), and the antisense was generated by fusing and amplifying constructs A and C with the primers Psra-6PF* and SLO-1TF*.

Both the sense and antisense constructs were microinjected into the gonad of L4 FY928 animals at a concentration of 50ng/µL, along with Punc-122::RFP, which is expressed in the coelomocyte. Animals were analyzed within three generations of original injection.

The primers used to produce the Psra-6::slo-1 RNAi transgenes were;

Psra-6PF: 5’ - CACTGATGTACCTTTCTATCTTTCTAAAC – 3’

Psra-6PF*: 5’ – CTTTCTATCTTTCTAAACTTTGG – 3’

Psra-6::slo-1 PRS: 5’ –

CAATTTCTGGTACGGGCAAAATCTGAAATAATAAATATTAAATTCTGCG – 3’

Psra-6::slo-1 PRA: 5’ –

ATCTTAGCAGGGCAAAATCTGAAATAATAAATATTAAATTCTGCG – 3’

slo-1TF: 5’ – CGTACCAGAAATTGCCGATTTG – 3’ slo-1 TF*: 5’ – CCGATTTGATTGGAAACCGG – 3’ slo-1 TR: 5’ – CTGCTAAGATCCAGAGAATC – 3’ slo-1 TR*: 5’ – CCAGAGAATCCATGACAGTC – 3’

2.3 Behavioral Assays: Behavioral responses to 1-octanol were assayed as previously described (Chao et al. 2004; Harris et al. 2009). 20-40 L4 animals were picked the night before the assay onto fresh OP50 seeded NGM plates. Assay plates were prepared the day of the experiment two hours before. 5-HT assay plates were made by adding 4mM 5-

HT creatinine sulfate monohydrate (Sigma-Aldrich, St. Louis, MO) to molten agar

(~55°C). 1-octanol was presented to a forward moving animal via a glass capillary that was dipped in 30% 1-octanol solution (dissolved in 100% ethanol, v/v). For assays in the absence of 5-HT, animals were transferred from the stock plate to an unseeded intermediate plate for a minimum of one minute to remove any OP50. Animals were then transferred to a food-free assay plate and tested 10 minutes later. For 5-HT assays, animals were transferred from the same stock plate as the untreated animals to an unseeded intermediate plate. After a minimum of one minute animals were placed onto the 5-HT assay plate and were tested 30 minutes later. All behavioral assays were performed between 12-4PM in a temperature range of 20-24°C to control for any environmental variability.

2.4 Calcium Imaging: Calcium imaging experiments were performed as previously descried (Mills et al. 2012; Zahratka et al. 2015). Young adult animals were glued to a

15mm diameter circular coverslip coated with Sylgard (Dow Corning, Midland, MI), immersed in external solution (see below) using WormGlu cyanoacrylate glue (GluStitch,

Delta, Canada). The coverslips were placed in a laminar flow chamber (Warner RC26G,

Warner Instruments, Hamden, CT) and perfused continuously with external solution.

External solution contained 150mM NaCl, 5mM KCl, 5mM CaCl2, 1mM MgCl2, 10mM glucose, 15mM HEPES; pH7.30, 327-333 mOsm. Two different protocols were performed for calcium imaging; 1-octanol stimulated and artificial depolarization using elevated K+ external buffer.

1-octanol calcium imaging: Young adult animals that expressed the ASH

GCaMP3 construct were glued to the Sylgard pad as described. The 1-octanol solution

(~2.37µM in external solution) was prepared fresh each day of recording, and was delivered under gravity feed through solenoid valves using a perfusion pencil (AutoMate

Scientific, Berkley, CA) or homemade equivalent. All solutions contained the fluorescent tracer Sulforhodamine 101 (SR101, 1µM), which stained the animals on contact and allowed visual inspection of flow. Solutions were delivered using the perfusion pencil as described above, mounted on a Warner SF77B Perfusion Fast Step device (step size

200µM, Warner Instruments) to provide precise computer control of pipette position.

After each exposure animals were visually examined for SR101 staining to confirm successful application and flow. No response was observed in ASHs to external solution containing 1µM SR101 alone or in the ASIs (also expressing the Psra-6::GCaMP3 reporter transgene). Cyclosporin A (CsA) exposure was achieved by incubating animals

on NGM containing 50µM CsA for 45 minutes. 5-HT and NemA exposure was performed using one of two methods; incubation on NGM plates or direct application. 5-

HT incubation was performed on 4mM 5-HT containing NGM plates for 30 minutes.

NemA incubation was performed on 5µM NemA containing NGM plates for 45 minutes.

CsA, 5-HT and NemA plates were prepared fresh on each day of recording.

Direct application of 5-HT and NemA was achieved using a two-opening theta

(Θ) glass tube that had been heated and drawn to a fine point by hand. Two lengths of polyethylene tubing 10’ (0.61 ODx0.28 ID) tubing (Warner Instruments, Hamden, CT) were inserted into the back of the tubing and sealed using Sylgard. A control stream

(external solution) occupied one line and a drug containing solution occupied the second.

Solutions were delivered via a syringe pump (KD Scientific, Holliston, MA) at a rate of

0.05ml/min. Supply lines were activated or inactivated manually using nylon 3-way Luer

Lock stopcocks; only one line was active at any time. Both streams from this dual chambered pipette were able to shield the exposed ASH cell body from the 1-octanol stream perfusing the amphid (Figure 3-4 A) (See Chapter 3 for more details). Animals were inspected for SR101 staining after each 1-octanol application, and any animal whose neuron had become exposed to the 1-octanol stream was discarded. 5-HT dose-

(LogEC50-[agonist]) X n) response curves where generated using the equation; A - Amax/(1+10 ) where A is the percentage of inhibition of the Ca++ signal at a given 5-HT concentration

++ and Amax inhibition of the Ca signal at 5-HT saturation. EC50 of 5-HT is the concentration necessary to elicit a half-maximal inhibition of the 1-octanol induced

Ca++ signal, n is the slope coefficient. Curve fitting was performed using GraphPad Prism software. ASHs were exposed via partial dissection as previously described (Goodman et

al. 1998). Briefly, the cuticle was slit using a patch pipette (TW150-3, World Precision

Instruments, Sarasota, FL) that had been melted at the tip, drawn to a fine point, and broken back to create a sharp-ended ‘cutter’, using a Narishige MF-83 microforge

(Narishige, Setegaya-ku, Tokyo, Japan). Cutters were mounted on a micromanipulator

(Sutter MP285, Sutter instruments, Novato, CA) to puncture the cuticle. All exposure times for 1-octanol recordings were 50ms with 4X binning with a length of 1500 frames.

For direct ligand application, the number of frames was reduced to 650.

High K+ calcium imaging: Young adults were glued and prepared as described above. High K+ (30mM) external solution contained 120mM NaCl, 30mM KCl, 5mM

CaCl2, 1mM MgCl2, 10mM glucose, 15mM HEPES; pH7.30, 327-333 mOsm (Zahratka et al. 2015). ASHs were exposed to the bath by partial dissection described earlier. High

K+ solution and was applied via a four-barreled glass puffer (barrel cross section 300µm), mounted on a Warner SF77B Perfusion Fast Step device. Solutions were delivered using a syringe pump (KD Scientific, Holliston, MA) at a rate of 0.2ml/min. Lines 0 & 1 contained regular external buffer and lines 2 & 3 contained high-K+ solution. No response was observed in ASHs to external solution. 5-HT experiments were performed similar to 1-octanol Ca++-imaging experiments, whereby animals were incubated on 4mM

5-HT containing plates for five minutes. Exposure times were 50ms with 4x binning for a total of 1500 frames.

All calcium imaging experiments were performed on an Axioskop 2 FS Plus upright compound microscope (40X Achroplan water immersion objective, GFP filter set

#38), fitted with an Orca ER CCD camera (Hamamatsu, Skokie, IL) and an automated shutter (Uniblitz, Vincent Associates, Rochester, NY). Minimal illumination intensity

was used to prevent GCaMP3 photobleaching, and we did not observe differential photobleaching rates between different genotypes and treatment groups. Fluorescent images were acquired using MetaVue 7.6.5 (MDS Analytical Technologies, Sunnyvale,

CA), and analyzed with Jmalyze software (Rex Kerr). I routinely compared baseline fluorescence value between mutant or drug treated worms and corresponding controls.

2.5 Electrophysiology: For patch-clamp analysis, young adults were glued and placed in the recording chamber as described above. ASH cell bodies (identified by GCaMP3 expression and lack of RFP expression (ASI Pgpa-4::RFP)) were exposed for whole cell recordings by slitting the cuticle as described above. Whole cell recordings were performed using pressure-polished patch pipettes (Goodman and Lockery 2000) with 12-

25MΩ resistance containing low Cl- internal solution (15mM KCl, 115mM K gluconate,

10mM HEPES, 5mM MgCl2, 0.25mM CaCl2, 5mM EGTA, 20mM sucrose, 5mM

MgATP, 0.25mM NaGTP; pH 7.20, 315 mOsm). 1-octanol was delivered as described above via perfusion pencil mounted on Warner SF77B Perfusion Fast Step Device (step size 200µM). NemA was delivered using the dual-chambered pipette (See Chapter 3).

Cells were observed after each 1-octanol application using SR101. Any cell that had become exposed directly to the 1-octanol stream was discarded. Signals were recorded with an Axopatch 200B amplifier (Molecular Devices, Sunnyvale, CA) in current clamp mode (0 pA injected current, 10kHz sampling, 2kHz filtering), digitized with a Digidata

1440A digitizer and analyzed using pCLAMP10 software (Molecular Devices).

2.6 Experimental Design and Statistical Analysis: Sample sizes: For Ca++-imaging a minimum of six young hermaphrodite adult animals were required for each treatment/mutation on each day of recording. For electrophysiology, a minimum of five cell recordings was required for each treatment. For behavioral experiments, a minimum of 25 young hermaphrodite adult animals were needed for each treatment/mutation analyzed. All experiments were performed between 19-23°C. All reagents were made fresh on the day of the experiment.

ROI selection: Regions of interest for Ca++-imaging were achieved by centering the soma in the middle of the field of view. A surrounding area roughly equal to the size of 25 somas was used to allow any potential movement of the cell. For dual neurons, the focal plane was used to dictate the best possible plane of visibility for both neurons. For most recordings dendrites were visible but axons were often excluded.

Quantification of Ca++ imaging experiments: After each recording the soma of each ASH recorded was analyzed using Jmalyze (Rex Kerr) and the output log files were opened in

Microsoft Excel. The change in fluorescence (ΔF/F0) of each ASH was measured relative to that cells baseline using the following equation;

퐹 − 퐹0 ∆퐹⁄퐹0 = x 100 퐹0

Where F is the fluorescence value at a current frame, and F0 is the baseline fluorescence, which was the frame immediately before stimulant or drug application. Any recordings whereby the value of the frames before the stimulus application were 5% higher than the

frames during application were discarded. All ΔF/F0 values were calculated for frames that last 20 seconds.

Correlation of dual neuron recordings: The fluorescent values of each cell were taken ranging between 10 seconds before 1-octanol presentation and 20 seconds after removal

(total of 50 seconds). The fluorescent values for the left and right ASHs of the same animal were analyzed via correlation in GraphPad prism software (GraphPad, La Jolla,

CA). The resulting r value was than obtained and used to compare wildtype (FY928) to the mutant or treated strains.

Statistical analysis and graphs: All statistical analysis was performed using unpaired & paired two-tailed Students t-tests or one-way ANOVA with data presented as mean ±

SEM. Graphs were generated using GraphPad Prism software (GraphPad, La Jolla, CA).

Photographs: All photos were taken either on an Axioskop 2 FS Plus upright compound microscope (40X Achroplan water immersion objective) at a magnification of 400X or an

Olympus SZX16 Zoom Stereo Microscope at a magnification of 40X. Photos were captured using an Orca ER CCD camera (Hamamatsu, Skokie, IL) or an iPhone camera via an iDu Optics LabCam microscope adapter (10X) (iLabCam, Leonardtown, MD).

Reagents and supplies: All reagents were obtained from Fisher Scientific (Pittsburgh,

PA) or Sigma-Aldrich (St. Louis, MO), unless stated otherwise. Worm strains were obtained from the Caenorhabditis Genetics Center (University of Minnesota,

Minneapolis, MN) or National BioResource Project of Japan (Tokyo Women’s Medical

University, Shinjuku-ku, Tokyo, Japan).

Chapter 3

Development of Innovative Techniques for Pharmacology and

Imaging Studies in C. elegans

3.1 Results

In addition to the standard techniques described in Chapter 2, I also needed to develop new and innovative approaches to study the effects of direct pharmacology on a dissected neuron. To do this, I first had to increase the yield of suitable dissected ASHs for Ca++- imaging and electrophysiology experiments. Next, I needed to develop new equipment that would allow the direct application of compounds to a dissected cell while preventing

1-octanol contacting the neuron. These new techniques have the potential to abolish the problems associated with prolonged incubations. Below, the new methods developed to achieve these goals are described in greater detail.

3.1.1 Worm Position Dictates Neuron Accessibility

To ensure that the ASH could be accessed for dissection easily on most animals, I first determined the optimal glued position of the worm on the Sylgard pad. To do this, I used the worms’ vulva as a visual indicator. I started by gluing the animals to the pad with their vulvas down (0°), and observed ASH position by 90° increments via GCaMP fluorescence (Figure 3-1 A). As shown in Figure 3-1 B, animals glued vulva down (0°) or vulva up (180°) had the most accessible ASHs for dissection. Furthermore, this orientation allowed the analysis of the ASHL and ASHR simultaneously via Ca++- imaging (Figure 3-3 B). Animals that were glued with their vulva at a 90° angle to the pad only had one ASH available that could be dissected and exposed to the external bath

(Figure 3-3 A & C). Finally, animals who were glued at 270° showed poor ASH accessibility and any attempt at dissecting the neuron from the animal often led to severing the soma from the dendrite or axon (Figure 3-3 A & D). From this, any animal that was not glued vulva down or at 90° was rejected for dissection immediately.

Figure 3-1 Position of Glued Worm Dictates ASH Accessibility. A) Representation of worm position, whereby the vulva is used as a visual aid. B) Animals glued vulva down or up (left) allowed both ASHL and ASHR to be visible (right). C) Animals glued with their vulva 90° to the left (left) have one ASH available, with axon facing away from dissection site (right). D) An animal glued at 270° (left) has poor ASH approach and dissection may result in severing of axon and dendrite (right).

3.1.2 Plate Hydration Affects the Quality of Neuron Dissection

Exposure of the ASH to the external environment required the slitting of the cuticle by limited dissection (Goodman et al. 1998). However, successful dissection of the ASH was limited by the internal pressure of the animal, where if the pressure was too high dissection resulted in the shredding and/or obstruction of the neuron and too little pressure prevented the neuron exiting the animal. Therefore, to ensure that consistent, high quality dissections were achieved, I allowed NGM plates to dry for various periods of time and assessed the dissection quality. For newly made plates, I hypothesized that the dissection quality of the animal would be low, due to the increased hydration of plate which would lead to higher internal pressure inside the animal. As predicted, animals that were grown on fresher plates had high internal pressure, and when the animals were dissected the pharyngeal bulbs, intestine and other cells exited the animal and either destroyed or obstructed the ASH (Figure 3-2 A). Alternatively, worms that were dissected from older plates, which were less hydrated and therefore have lower internal pressure, did not have exposed ASHs (Figure 3-2 B). Therefore, I needed to identify the period in which the balance between the internal pressure of the animal and the hydration of the plate produced satisfactory dissections.

I dissected animals from plates of various ages and assessed the quality of ASH exposure and found that the most optimal dissections, which allowed increased accessibility to the neuron, occurred 14-16 days after the plates were poured (Figure 3-2

C). Furthermore, I discovered that if the plates were chilled to 4°C one day after seeding with OP50, the duration of the optimal dissection window was increased from 1-3 days to

7-10 days. During this period, I could successfully dissect and expose the ASHs with reduced risk of shearing, severing, obstructing or destroying the neuron. Furthermore, after a successful initial incision, a second dissection was performed further down the animal’s body (indicated by dashed lines) to relieve any residual pressure to ensure that the cell remained accessible, prevent additional neurons exiting the cut and obstructing the cell of interest and to reduce the risk of breaking the seal between the membrane and the patch pipette (Figure 3-2 D). With the cell healthily exposed to the external environment I could effectively examine the effects of direct ligand application on ASH

Ca++ and depolarization signals.

Figure 3-2 Plate Hydration Affects ASH Dissection Quality. A) Increased internal pressure kills dissected ASH: note the fragmentation of the ASH soma, which is surrounded by numerous other neuronal and non-neuronal cell bodies, indicating a killed and obstructed ASH. Dashed line indicates site of cut B) Older plates result in reduced internal pressure and the ASH soma is not exposed: note that the ASH is still inside the animal despite the cuticle being breached, indicating low pressure preventing ASH exposure. Dashed line indicates removal of the cuticle C) Exposure of the ASH for direct approach in an animal taken from a suitable plate: note the exposed ASH soma away from the other cell bodies exposed, allowing direct approach for electrophysiology.

Dashed lines highlight worm cuticle. D) Illustration depicting ideal place for second cut to promote the survival of successfully dissected ASHs.

3.1.3 Improvements on Stimulus Tip Placement:

From our initial experiments, neurons directly exposed to 1-octanol showed rapid irreversible increases in Ca++, often followed by cellular fragmentation, suggesting that direct 1-octanol contact kills exposed cells (Figure 3-3 A). To ensure that I was able to measure any changes in either Ca++ or depolarization in response to 1-octanol, I developed the two-pipette delivery system as described in Zahratka et al 2015 and shown in Figure 1-2 A. This technique allowed the application of the 1-octanol directly to the animal’s nose while protecting the exposed neuron. By adding 1µM Sulforhodamine-101

(SR101) dye into the 1-octanol solution, I could visually observe the flow of the stimulus and observe deflection of the stream (Figure 3-3 B). Furthermore, after application the cuticle was stained by the dye and if any part of the animal around the dissected neuron was stained, the animal was rejected.

For experiments that involved measuring Ca++ or depolarization signals in dissected ASHs, proper positioning of pipette was crucial, to ensure that the 1-octanol stream did not come into direct contact with the cell. However, use of the 1-octanol stream as a visual guide was not an option as this risked the animal becoming pre- exposed to the stimulus. Therefore, 100nM of SR101 was added to the external buffer solution. This allowed the pipette to be placed more accurately and further reduced the risk of exposing the neuron to 1-octanol during a recording (Figure 3-3 C). Unlike 1- octanol, external buffer containing SR101 did not generate a Ca++ signal (Figure 3-3 A).

Finally, by using a perfusion Fast Step device (step size 200µM), which is computer

controlled, I had the ability to precisely control pipette position, further ensuring that the neuron would not be subjected to 1-octanol at any time during a recording.

Figure 3-3 Deflection of 1-octanol Increases Cell Survival. A) Direct application of 1- octanol kills the dissected ASH. External containing SR101 does not stimulate a Ca++ signal. * Significantly different from 1-octanol, p = 0.0159, unpaired t-test. B)

Photograph depicting 1-octanol deflection across the worm’s nose and shielding of ASH via external buffer. Dashed line highlights worms body. C) Photograph showing deflection of external containing SR01. Dashed line highlights worms body. Numbers in/above bars indicate n; values are means ±SEM.

3.1.4 Development of a Dual-Chambered Pipette:

Current techniques to measure the effects of monoamines and other compounds in the C. elegans nervous system involve the incubation of animals on high concentrations of a compound for long periods of time, to ensure the ligand can penetrate the cuticle and enter the animal (Chao et al. 2004; Ezcurra et al. 2011; Ghosh et al. 2016). As such, the whole animal is exposed to the ligand and the observable effect may be due to the compound interacting elsewhere in the circuit. To combat this disadvantage, I improved upon our previous method as describe in Chapter 1, by designing a shielding pipetted that possessed two lines that can deliver either external buffer or various concentrations of a compound (Figure 3-4 A). Importantly, this system was configured to perfuse the worm’s nose and exposed neuronal soma independently, with no cross-contamination, so odorants can be applied to the nose while modulators are applied to the cell body (Figure

3-4 A).

The dual chambered pipette was developed and designed using basic lab equipment.

Glass theta (Θ) tubing, that has been heated over a flame and pulled by hand, is cut with a diamond tipped pencil, to produce a pipette approximately 4-5 inches in length. To ensure that the openings of the pipette are small enough, the ends of the glass are measured and anything that is not between 100-300 microns is discarded. If the openings are too large; A) the pressure of the two streams won’t be strong enough to deflect the 1- octanol, thus killing the neuron, B) the pipette cannot be placed close to the glued worm, preventing accurate application of any compounds, and C) the thickness of the glass

makes imaging difficult. Next, two lengths of PE tubing (0.61OD x 0.28ID) 3in in length, are fed into the openings at the back of the pipette. A small drop of Sylgard is applied to the back of the pipette, which moves along the end of the tubing by capillary action to form a flush seal. The pipettes are baked at 65°C for at least 60 minutes to cure the

Sylgard. Finally, a Luer-Lock from a 27G1¼ needle is placed on the shaft of the pipette and secured using dental wax to allow a secure hold but also to provide flexibility for movement of the pipette (Figure 3-4 B).

The pipette holder is generated by cutting a 5mL syringe with a Luer-Lock, which is then secured to a plastic wedge to provide an angular approach for the pipette into the recording chamber (Figure 3-4 C). The pipette holder is secured to a 10mL serological pipette which has a hole is drilled halfway along the shaft to allow the entry of the

Polytetrafluoroethylene (PTFE) feedlines (Figure 3-4 C). Two pieces of silicone laboratory tubing (ID 0.031”, OD 0.094”) are used to connect the PE and PFTE lines together. The two feedlines are attached to 3-way valve Luer-lock stopcocks via 200µL pipette tip and silicon adapters, which in turn are fastened to the 10mL syringes. The syringes are places on a syringe pump (KD Scientific, Holliston, MA) at a rate of

0.05mL/min. Finally using a micromanipulator, the apparatus is placed down from the 1- octanol stage allowing precise positioning to ensure the deflection of the 1-octanol stream is achieved. The openings of the pipette are aligned with the pharyngeal bulbs to ensure consistent application to the neuron after dissection.

I tested the dual chambered pipette to ensure that A) 1-octanol can be deflected but robust 1-octanol signals could still be acquired, and B) the exposed cell was not damaged or stimulated when switching between lines. As expected, both lines effectively shielded

the exposed ASH soma and while still allowing 1-octanol to hit the nose, generating a robust Ca++ signal (Figure 3-4 D & E). Finally, I measured the Ca++ signal of dissected

ASH in response to changing line activity. Not surprisingly, I did not observe any changes in the ASH Ca++ signal when the two lines were switched (Figure 3-4 D & E), suggesting that the streams were not damaging the cell, and any potential responses will be a result of 1-octanol application or the ligand interacting with the neuron.

Figure 3-4 Dual-Chambered Pipette Effectively Protects the ASH. A) Diagram illustrating dual-pipette perfusion system. Left panel: Upper pipette delivers saturated solution of 1-octanol (1-oct) in external. Pipette is mounted on a motorized drive, which can be moved to deliver stimuli at precise intervals. Lower pipette delivers external solution (ext), and deflects 1-oct away from the exposed ASH. Lower pipette contains a glass septum that separates two independent streams, allowing rapid switching (e.g. ext alone, or ext + 5-HT (middle, right panels). B) Diagram and photo of completed dual-

chambered pipette with secured tubing and Luer-lock. C) Diagram and photo of dual- chambered pipette holder. D) Representative traces of 1-octanol signals with external shielding ASH from either line 1 (left) or line 2 (middle). Switching between lines does not generate a Ca++ signal. Arrow indicates line switch. E) Quantification of Ca++ amplitudes. * significantly different from counterparts, p = 0.0006, ANOVA.

3.1.5 Acute Application of 5-HT Leads to Changes in Ca++ amplitudes Over

Short Timescales:

Typically, monoamine studies in C. elegans incubate worms on agar plates containing high (i.e. mM) concentrations of monoamines for 30 minutes or longer resulting in unknown internal concentrations and exposure of the entire nervous system (Chao et al.

2004; Ezcurra et al. 2011; Ghosh et al. 2016; Harris et al. 2011). Additionally, the concentration and time of incubation for each ligand will be different as compounds may have alternate rates of uptake, diffusion, and transportation/degradation dynamics within the worm. Therefore, I used or dual-chambered pipette setup to perform two experiments;

++ 1) titrate 5-HT to identify the EC50 for 1-octanol inhibition of the induced Ca signal, and 2) identify the shortest time for 5-HT application to inhibit the signal. To ensure that the exposed neuron was viable, and that all dendritic connections were still intact, I pre- screened neurons to make sure they were healthy and responsive. If an increase in Ca++ was observed, I then applied various titrated concentrations of 5-HT to the neuron for a minimum of one minute. After incubation, I applied 1-octanol a second time in the continuing presence of the shielding 5-HT stream and recorded any changes in the second

1-octanol induced Ca++ signal. As shown direct 5-HT application inhibits the second 1- octanol Ca++ signal suggesting the monoamine is interacting with the ASH (Figure 3-5

++ A). Under these conditions, the EC50 for 5-HT inhibition of 1-octanol induced Ca signal was calculated to be 6nM (Figure 3-5 B). Application of 10nM 5-HT was able to rapidly inhibit 1-octanol induced Ca++ which was reversible after a 5 min wash out period (Figure

3-5 C).

Figure 3-5: Direct Application of 5-HT Inhibits 1-octanol Induced Ca++ Signals A)

Representative traces of Ca++ signals in dissected neurons in the absence of 5-HT (left) and the presence of 100nM 5-HT (right). Grey boxes indicate 1-octanol application. B)

Titration curve for 5-HT inhibition of the 1-octanol-evoked Ca++ responses. C) 10nM 5-

HT (1 min exposure) inhibits 1-octanol induced Ca++ responses, reversible after 5min washout. * significantly different from untreated, p = 0.0065, washout did not significantly differ from untreated, ANOVA. Numbers in/above bars indicate n; for titration curve n = 3-4 for each concentration; values are means ±SEM.

3.2 Discussion

3.2.1 Improved Dissection is Dependent on Plate Hydration and Worm Position

In order to improve our success rate of achieving clean, viable and approachable dissected ASHs, I assessed the dissection quality and cell viability in various ways including; positioning of the animal when glued, position of the neuron within the worm and internal pressure. First, I observed that the position of the glued worm greatly affects access to the neuron. Animals that had the most approachable cells where either glued with their vulvas down (0°) or at 90°. In this configuration, the risk of severing the dendritic and axonal connections from the ASH soma was reduced. Alternatively, animals glued at 270°, had very poor neuronal position. Dissection of the ASHs in these animals typically resulted in the severing of ASH processes from the soma or the neuron being obscured by other cells and internal parts, reducing Ca++-imaging quality and preventing electrophysiology recording.

Additionally, I observed how differences in plate age altered the quality of ASH dissection. I found that NGM plates that had been left to dry at room temperature for a minimum of fourteen days, seeded with E. coli OP50 and left to dry at room temperature for two days and subsequently stored at 4°C, resulted in usable ASHs after dissection.

Furthermore, I identified that young adult animals that had be grown on the plates for five days and stored at 20°C provided the best and cleanest dissections, vastly improving our collection of Ca++-imaging and electrophysiology data. Using this technique, I was able

to achieve high quality dissections for a longer period (7-10 days) compared to the previous methods (1-3 days). In contrast, younger plates resulted in animals having excessive internal pressure, causing the destruction of the ASH after the initial cut in the cuticle was made, and older plates generated reduced internal pressure, preventing the

ASH from being exposed to the external environment.

3.2.2 Acute Application of 5-HT Inhibits 1-octanol Responses

As described above and in Zahratka et al, 2015, analysis of dissected ASHs requires a stream of external buffer to shield the cell from 1-octanol. Advancing on this method, I generated a two-chambered pipette which can deliver either a stream of external buffer or a stream containing various concentrations of a compound, while still shielding the neuron from 1-octanol. Here I show that inhibition of the 1-octanol Ca++ signal can be achieved with very low concentrations of 5-HT, with an EC50 of 6nM after 1 minute. By directly applying compounds to the ASH I was able to determine how various concentrations of the monoamine 5-HT modulates the ASH sensory neuron in response to

1-octanol.

Finally, the analysis of other neuromodulators such as octopamine, dopamine and neuropeptides and the identification of their optimal concentrations, sites of action and potential receptor targets can be undertaken. With regards to neuropeptides, little is known about the effects on directly modulating neurons in C. elegans. This is because neuropeptides cannot pass across the cuticle. Current techniques involve the injection of

various peptides into the animal close to the nerve ring at high concentrations (µM), exposing the ligand to a large subset of neurons (Mills et al. 2016). Furthermore, Ca++ signals in C. elegans are commonly assumed to be a direct reporter of cell excitability.

One study suggests that NLP-1 released from the AWC onto the AIAs, inhibits the neurons based on a reduction in the Ca++ signal (Chalasani et al. 2010). Our technique has the potential to determine how neuropeptides can directly modulate the relationship between Ca++ and depolarizations signals, avoiding the potential pitfalls associated with using Ca++-imaging as a readout of neuronal activity. Additionally, neuropeptide genes can produce more than one species of an active peptide, which can differentially modulate neurons and responses (Mills et al. 2016; Purves et al. 2008). Therefore, acute application of different peptide species directly onto the neuron may aid in the identification of where and how neuropeptides modulate neural circuits in C. elegans, as opposed to genetic manipulations and heterologous expression.

Chapter 4

5-HT Inhibits a Ca++-Dependent Negative Feedback Loop in a

C. elegans Nociceptive Neuron

Note: A majority of this work will be published in Williams PDE, Zahratka JA,

Rodenbeck M, Wanamaker J, Linzie H & Bamber BA. (2018) “5-HT inhibits a Ca++- dependent negative feedback loop in a C. elegans nociceptive neuron”.

4.1 Results

Previous work conducted by Dr. Jeff Zahratka, suggested that the ASH Ca++ and depolarization signals are negatively correlated in response to 1-octanol (Chapter 1

(Zahratka et al. 2015)). Furthermore, the ability for 5-HT to inhibit the Ca++ was dependent on the Gαq-coupled receptor SER-5. However, the mechanism of how 5-HT inhibited Ca++ was unknown, and if indeed Ca++ was mediating inhibition of ASH excitability. This chapter identifies a conserved pathway utilized by 5-HT to disinhibit

the ASH. Furthermore, I provide further evidence that in response to 1-octanol the relationship between Ca++ and depolarization is negatively correlated in the ASH.

4.1.1 5-HT Acts Directly on the ASH to Inhibit 1-octanol Induced Ca++

As discussed in Chapter 1, 5-HT significantly reduced the 1-octanol induced Ca++ signal and potentiated depolarization in the ASH sensory neurons (Zahratka et al. 2015).

However, the increased depolarization signal in the presence of 5-HT may have been an artefact of dissection. Therefore, I needed to ensure that the Ca++ signal was still inhibited in neurons that had been dissected, thereby supporting the notion that a negative correlation between the depolarization and Ca++ signals was still occurring. Using similar techniques as described in Chapter 1 and Zahratka et al. 2015, untreated and 4mM 5-HT treated ASHs were dissected and recorded using Ca++-imaging (Figure 4-1 A). Similar to intact animals, 5-HT significantly inhibited 1-octanol induced ASH Ca++ signals compared to untreated, supporting our hypothesis that there is a negative correlation between the Ca++ and depolarization signals (Figure 4-1 B, C & D). These data suggest

++ that 5-HT is indeed inhibiting the Ca signal in response to 1-octanol through the Gαq- coupled receptor SER-5 (Zahratka et al. 2015).

Figure 4-1 5-HT Inhibits Ca++ in Dissected ASHs. A) Diagram of recording setup for dissected Ca++-imaging. As demonstrated Figure 1-2 A. Left Pipettes are positioned prior to recording. Middle 1-octanol is applied to the tip of the animal’s nose, avoiding the exposed soma. Change in Ca++ is recorded. Right: 1-octanol pipette is returns to original position terminating recoding. B) Representative traces of 1-octanol depolarizations in the absence (left) and presence of 4mM 5-HT (right). Repeated from Figure 1-2 B C) 5-

HT significantly increases depolarization in response to 1-octanol. ΔVm, change in membrane potential. * significantly different from untreated, p = 0.0003, unpaired t-test

Repeated from Figure 1-2 C D) 5-HT reduces Ca++ in dissected ASHs which are not significantly different compared to internal responses. * significantly different from

untreated counterpart, internal p = 0.0002, external p = 0.0206, unpaired t-test. Values are means ±SEM; nos. within or above bars indicate n.

4.1.2 5-HT Acts Downstream of Depolarization to Reduce Stimulus-

Induced Ca++ Transients in ASH

5-HT is unlikely reducing the initial sensory potential since overall ASH depolarization is enhanced (Zahratka et al. 2015), and therefore, I hypothesized that 5-HT modulates Ca++ dynamics downstream of the initial 1-octanol-dependent depolarization, possibly through inhibition of the L-type VGCC EGL-19. To determine where 5-HT was acting, I exposed dissected ASHs to elevated High [K+] external buffer (30mM compared to 5mM, after partial dissection to expose the ASH soma to the bath, see Chapter 2 Materials &

Methods) to bypass the sensory transduction pathway by artificially depolarizing the neuron and determined if 5-HT could inhibit the artificially induced Ca++ signal. High

[K+] treatment led to robust Ca++ transients, which are sensitive to the L-type Ca++ channel blocker Nemadipine-A (NemA), as observed previously for 1-octanol-dependent

ASH Ca++ transients (Figure 4-2 A & B), (Zahratka et al. 2015). Similar to 1-octanol induced Ca++ signals, 5-HT treatment significantly inhibited high [K+] induced ASH Ca++ transients (Figure 4-2 A & B) (Zahratka et al. 2015). Furthermore, 5-HT modulation of

+ ++ the High [K ] Ca signals was dependent on the 5-HT receptor SER-5 and the Gαq subunit EGL-30 (Figures 4-2 C & D), (Zahratka et al. 2015). As such, these data suggest that 5-HT is acting downstream of the initial 1-octanol induced ASH depolarization and

++ reduces the EGL-19 Ca transient amplitudes via SER-5 and a Gαq-coupled pathway.

Figure 4-2 5-HT Inhibits ASH Downstream of Depolarization. A) Representative traces of High [K+] induced Ca++ signals in untreated (left), NemA treated (middle) and 5-HT treated (right) dissected ASH neurons. B) Quantification of untreated, NemA and 5-HT treated ASHs. * significantly different from untreated, p = 0.0027, ANOVA C) Loss of

++ ser-5 and egl-30 (Gαq) (D) prevents 5-HT inhibition of the Ca signal when artificially depolarized. N.S. not significantly different compared to untreated control; numbers in/above bars indicate n. Gray boxes indicate duration of high K+ exposure; values are means ±SEM.

4.1.3 5-HT Modulates ASH Function at Physiological Concentrations and

Time Scales

In the canonical Gαq pathway, phospholipase C activation leads to the production of diacylglycerol (DAG) and inositol-trisphosphate (IP3) which binds to the IP3 receptor and gates the release of Ca++ from intracellular stores (Baker et al. 2013; Miller et al. 1999;

Singer et al. 1997; Walker et al. 2009; Zahratka et al. 2015). Using methods described in

Chapter 3, I observed a rapid increase in GCaMP3 fluorescence upon 10nM 5-HT application alone (Figure 4-3 A). Interestingly, the increase in Ca++ mediated by 10nM is dependent on the Gαq-coupled 5-HT receptor SER-5, consistent with release of

++ intracellular Ca downstream of Gαq activation (Figure 4-3 B). Furthermore, NemA treatment did not significantly reduce the 5-HT-stimulated Ca++ transient (Figure 4-3 B), consistent with an intracellular origin for this Ca++, rather than extracellular through

EGL-19.

To determine if this Ca++ signal is functionally coupled to the inhibition of 1- octanol-induced Ca++ responses in ASHs, I performed limited dissection to expose an

ASH neuron, then sequentially treated the worm with 1-octanol (at the tip of the nose), 5-

HT (at the ASH soma); and finally, in the continued presence of 5-HT, 1-octanol again.

In the wild type, 1-octanol generated a robust signal, 5-HT induced a somewhat smaller

Ca++ signal, and the second 1-octanol application generated a greatly reduced signal relative to the first (Figure 4-3 C & D upper panel: white bars), consistent with 5-HT inhibiting the 1-octanol response, as previously observed (Zahratka et al. 2015). In ser-5 mutants, as expected, 5-HT did not induce a Ca++ signal, and the second 1-octanol

responses was unaffected (Figure 4-3 C & D lower panel: black bars). These results suggest that 5-HT activates a SER-5- and Gαq-dependent signaling pathway, including release of Ca++ from intracellular stores, to inhibit Ca++ transients associated with 1- octanol stimulation in ASH neurons. Furthermore, 5-HT signaling is rapid, reversible, and occurs at physiological 5-HT concentrations (i.e. comparable to 5-HT receptors in heterologous cells and neurons from other species (Adolph and Kass 1979; Bunin and

Wightman 1998).

Figure 4-3: Low Concentrations of 5-HT Rapidly Modulate ASH Ca++ entry via Ca++

Intracellular Stores A) Representative trace of 10nM 5-HT-induced Ca++ signal in ASHs

B) Ca++ transients evoked by 10nM 5-HT are NemA insensitive and ser-5-dependent. * significantly different from control, p = 0.0094, ANOVA C) Representative traces of sequential 1-octanol and 5-HT exposures. Left traces: initial 1-octanol-stimulated Ca++ response; middle traces: 10nM 5-HT-stimulated Ca++ responses; right traces: second 1- octanol-stimulated Ca++ signals. Upper traces are wild type, lower traces are ser-5. Bar below trace indicates duration of ligand exposure. D) Amplitudes of initial 1-octanol, 5-

HT, and second 1-octanol responses in wild type (white bars) and ser-5 (black bars). * significantly different from first 1-octanol application, p = 0.0125, paired t-test. 10nM induced 5-HT responses in ser-5 are reduced. † = significantly from wild-type, p =

0.0072 unpaired t-test. Numbers in/above bars indicate n; values are means ±SEM.

4.1.4 The Calcineurin Orthologue, TAX-6, is Required to Inhibit L-type

VGCC’s

In cardiomyocytes, L-type VGCCs are inhibited through the calcium dependent inhibition (CDI) pathway, where Ca++-calmodulin (CaM) binds to and activates calcineurin (CaN), which in turn dephosphorylates the channel at a conserved serine residue. CaM binding to a conserved IQ domain on the intracellular cytoplasmic tail of the channel is necessary for CaN dephosphorylation of its target serine (Blaich et al.

2012; Stevens et al. 2003; Wang et al. 2014b). In neurons, a CDI-like mechanism

++ operates downstream of Gαq-coupled GPCRs, with IP3-R-dependent Ca release activating CaM-CaN, which dephosphorylates and inactivates the L-type VGCC at the same serine residue (Day et al. 2002; Hernandez-Lopez et al. 2000; Oliveria et al. 2012).

The L-type VGCC forms a signaling complex with the IP3-R through Shank and Homer, allowing the GPCR to control the L-type VGCC at extremely short range (Olson et al.

2005). The EGL-19 L-type VGCC in C. elegans also contains the conserved IQ domain and serine residue (Figure 4-4 A), and may associate with the IP3-R directly through Ce-

SHANK (SHN-1) (Oh et al. 2011). Therefore, I hypothesized that 5-HT activates a CDI- like pathway to regulate Ca++ influx in ASH neurons, and predicted that CaN would be required for 5-HT signaling (outlined in Figure 4-4 B). Cyclosporin-A (CsA) inhibits

CaN in C. elegans (Bandyopadhyay et al. 2002; Donohoe et al. 2009). I pre-incubated worms in 50µM CsA on agar plates for 45 minutes, performed partial dissection to expose ASHs to the bath, and repeated the sequential 1-octanol and 5-HT application protocol performed earlier (Figure 4-4 C). The initial 1-octanol response and the direct

5-HT responses were unaffected by CsA treatment. However, the second 1-octanol response was equal in amplitude to the first (Figure 4-4 D). These results show that CaN inhibition blocks the 5-HT-dependent diminution of ASH Ca++ responses, suggesting that

CaN acts downstream of intracellular Ca++ in the 5-HT signaling pathway. Importantly, this result also shows that diminution of the second 1-octanol response after 5-HT application is unlikely to reflect a non-specific ceiling effect in the endoplasmic reticulum

(ER) Ca++ releasing capacity (i.e. ER Ca++ contributes to 1-octanol responses (Zahratka et al. 2015), and 5-HT-dependent Ca++ release could deplete the ER of Ca++, leading to a diminished signal). In the presence of CsA, the second 1-octanol application still evoked a robust Ca++ transient despite the earlier 5-HT-dependent Ca++ release (Figures 4-4 C,

D), which is incompatible with a ceiling effect explanation. Consistent with this interpretation, CaN is also required for 5-HT modulation of Ca++ responses evoked by high [K+] buffer. 5-HT could not inhibit these Ca++ responses in the presence of CsA

(Figure 4-5 A, B & C), or in tax-6 mutants which lack CaN (Figure 4-5 D). These results reinforce the conclusion that TAX-6/CaN acts in the 5-HT signaling pathway to inhibit

Ca++ entry into ASHs. However, I cannot rule out that other targets of TAX-6/CaN could be playing a role, as this phosphatase has a wide substrate specificity (Bandyopadhyay et al. 2002).

Figure 4-4 5-HT Inhibition of the 1-octanol Induced Ca++ Signal is Dependent on CaN

A) The IQ and the CaN phosphorylation site (serine 1562) are conserved in C. elegans

(humans CaV sequence shown for comparison). B) Hypothesized signaling pathway in 97

++ which 5-HT activates Gαq signaling leading to the release of intracellular Ca , presumably from IP3 stores to activate CaN (TAX-6), which will inhibit the L-type

VGCC EGL-19. C) Representative Ca++ traces of sequential 1-octanol and 5-HT exposures of CsA-treated worms. Left trace: initial 1-octanol-stimulated Ca++ response; middle trace: 5-HT-stimulated Ca++ responses; right trace: second 1-octanol-stimulated

Ca++ signal in continued presence of 5-HT. Bars below traces indicates ligand exposure.

D) Ca++ amplitudes of initial 1-octanol, 5-HT, and second 1-octanol responses in untreated wild type (white bars, reproduced from Figure 4-2 D; * significantly different from first 1-octanol application, p = 0. 0125 unpaired t-test) and CsA-treated wild type

ASHs (black bars). N.S. not significantly different from untreated control. CsA treatment does not significantly change 5-HT-evoked Ca++ signals. Numbers in/above bars indicate n; Values are means ± SEM.

Figure 4-5: CaN is Required for 5-HT Inhibition of High [K+] Evoked Ca++ Signals. A)

Representative traces of high K+ stimulated Ca++ transients in CsA-treated ASHs. (5-HT treatment (10nM) as indicated). B) Quantitative comparison of 5-HT inhibition (data reproduced from Figure 1B; * significantly different from control (5-HT treated vs untreated, p = 0.0030, t = 3.89, df = 10)). C) Ca++ amplitudes in CsA treated ASHs in absence and presence of 5-HT. N.S. not significant from untreated counterpart (p =

0.2790, t = 1.152, df = 9). D) 5-HT inhibition of high K+ induced Ca++ signals tax-6 mutants. N.S. = not significantly different from untreated counterpart (p = 0.3146, t =

1.065, df = 9). Number in/above bars indicate n. Values are means ±SEM.

4.1.5 Ca++ influx through the EGL-19 L-VGCC Inhibits ASH

Depolarization

As mentioned in Chapter 1 the relationship between the Ca++ and depolarization signals appeared to be negatively correlated. I hypothesized that Ca++ itself maybe acting as a second messenger to inhibit depolarization, and that the pharmacological block of L-type

Ca++ channel, using NemA will potentiate depolarization. To test this prediction, I performed direct electrophysiological recordings of ASH neurons, predicting that NemA inhibition of L-type voltage-gated Ca++ channels should increase depolarization amplitude. Interestingly, after 45-minute incubation on agar plates containing 5µM

NemA, resting membrane potentials (RMPs) in ASHs became highly unstable relative to untreated animals (Figure 4-6 A) which, unfortunately, precluded measurement of 1- octanol evoked depolarization. This observation is consistent with observations in other systems where blockade of L-type Ca++ channels disrupts normal cellular physiology, resulting in to rapid changes in ion channel expression which could presumably affect the stability of the RMP (Hogan 2007; Ransdell et al. 2012). To circumvent this difficulty, I performed partial dissection and acutely treated dissected ASHs for with NemA for 60s, before performing electrophysiological recordings. I first titrated NemA using 1-octanol evoked Ca++ signals as a readout, and determined that 10nM NemA was usually sufficient to block the channel, and highly reliable inhibition was obtained at 100nM

(Figure 4-6 B). Baseline membrane potentials of ASHs acutely treated with 100nM

NemA after 1 minute were stable. Importantly, 1-octanol evoked depolarization were significantly potentiated in neurons treated with NemA (Figure 4-6 C & D). Typically,

100

Ca++ entering through the L-type VGCCs is assumed to be a primary carrier of inward current during depolarization. To verify that another VGCC (such as UNC-2 or CCA-1) was not compensating due to the acute blockage of EGL-19, I imaged the entire length of the ASH neuron during 1-octanol stimulation in the presence of NemA. No increases in the Ca++ signals were observed in any ASH compartment (i.e. cilium, dendrite, soma or axon), and more importantly there was a significant reduction of the Ca++ amplitude in both the soma and dendrite (Figure 4-6 E). Taken together with the previous results, I conclude that ASH intracellular Ca++ exerts negative feedback on depolarization, and that

5-HT disinhibits ASHs by suppressing this feedback.

101

102

Figure 4-6 Inhibition of Ca++ Potentiates Depolarization. A) Representative trace of the resting membrane potential of an ASH neuron from an untreated worm (upper panel), and a worm incubated on an agar plate containing 5µM NemA for 45 min (lower panel). B)

Amplitudes of 1-octanol-evoked Ca++ signals from partially-dissected worms treated acutely (1 min) with the indicated concentrations of NemA. * significantly different from control (F (3, 17) = 22.89, p = <0.0001, ANOVA). C) Representative traces of voltage recordings during 1-octanol stimulation of untreated (left panel) and worms acutely treated (1 min) with 100nM NemA (right panel). Gray boxes indicate time of 1-octanol application. D) Amplitudes of 1-octanol-evoked depolarization in untreated and NemA treated worms (100nM, 1 min). * significantly different from control (100nM treated vs untreated, p = 0.0185, t = 2.761, df = 11). E) 1-octanol-evoked Ca++ amplitudes in the cilium, dendrite, soma, and axon (representing the entirety of the cell) in untreated and

NemA treated ASHs. * Significantly different from untreated counterpart; N.S. not significant from untreated counterpart (untreated cilia vs NemA treated cilia, p = 0.7024, t = 0.3882, df = 18; untreated dendrite vs NemA treated dendrite, p = 0.0277, t = 2.395, df

= 18; untreated soma vs NemA treated soma, p = <0.0001, t = 4.901, df = 21; untreated axon vs NemA treated axon, p = 0.2119, t = 1.294, df = 18. Numbers in/above bars indicate n; values are means ±SEM.

103

4.2 Discussion

Previous studies suggested that 5-HT can inhibit the L-type VGCC, EGL-19 and potentiate depolarizations (Zahratka et al. 2015). In this present chapter, I have identified a Ca++-dependent negative feedback pathway operating in ASHs. 5-HT attenuates this pathway by reducing the Ca++ transient, and thereby disinhibiting the ASH response

(Figure 4-7). This conclusion is based on three principal observations: 1) odorant or high

K+-evoked increases in ASH Ca++ are dependent primarily on an L-type calcium channel, which contains conserved residues for negative regulation by CaN downstream of canonical Gαq signaling, a well-established signaling pathway in other cell types; 2) 5-HT inhibits odorant or high K+-evoked increases in ASH Ca++ by transiently increasing the

++ release of intracellular Ca via canonical Gαq signaling and subsequent CaN activation;

3) blocking odorant-evoked ASH Ca++ transients potentiates depolarization.

104

++ Figure 4-7: Pathway for 5-HT Inhibition of Ca . 5-HT signals via the Gαq-coupled

++ GPCR SER-5 to promote the release of intracellular Ca , presumably through IP3 mediated stores to active the CaN orthologue TAX-6, which dephosphorylates EGL-19, preventing Ca++ entry. The reduction in Ca++ disinhibits the neuron leading to stronger depolarization signals to 1-octanol.

105

4.2.1 Ca++ does not Act as a Charge Carrier in ASH

It is often assumed that Ca++, entering through voltage-gated Ca++ channels, is the primary carrier of inward current during neuronal depolarization in C. elegans as there are no known Na+ channels in animal (Goodman et al. 1998). Blockade of L-type Ca++ channels resulted in no observable increase in Ca++ influx anywhere along the neuron, even though depolarization amplitude increased by 50%. This implies that the Ca++ influxes measured by Ca++ imaging are unlikely to be the primary carriers of inward current driving depolarization, at least in the ASHs. Instead, the sensory potential generated by the 1-octanol receptor and downstream transduction pathway appear to be sufficient to depolarize the entire neuron. Activation of the Na+ and Ca++ permeable

OSM-9/OCR-2 TRP channels in the cilium (Owsianik et al. 2006; Tobin et al. 2002), led to the detection of a robust Ca++ transients in the amphids in response to 1-octanol application, regardless of whether the L-type channels were blocked, representing the sensory potential. The depolarization spreads passively along the entire length of the

ASH neuron to the distal synapses, as voltage changes can travel relatively long distances with little to no attenuation in nematode neurons due to their very high membrane resistance (Davis and Stretton 1989; Goodman et al. 1998). Furthermore, the counterbalancing Ca++ and K+ conductances in C. elegans neurons have been documented, which summed to a 0 net current over a range of physiological potentials

(Goodman et al. 1998). Therefore, the L-type Ca++ channels and Ca++-activated K+ channel expressed in the ASH are the likely contributors to these currents, based on the conserved roles of these channels in other vertebrate and invertebrate neurons (Fettiplace

106

1987; Gorman et al. 1982). As a consequence, 5-HT signaling can potentially alter the balance between Ca++ and K+ conductances by inhibiting Ca++ influx through EGL-19, thereby reducing the hyperpolarizing K+ currents and augmenting overall neuronal depolarization.

4.2.2 Regulation of L-type Ca++ Channels by GPCRs is Highly Conserved

in C. elegans

Regulation of L-type Ca++ channels by GPCRs is widespread and highly conserved. For example, in cardiomyocytes, a conserved serine residue on L-type Ca++ channels are phosphorylated by PKA, and dephosphorylated by CaN, dependent on intracellular Ca++ flowing in through the L-type channel itself (i.e. autoinhibition), and Ca++ released from internal stores. PKA-dependent phosphorylation increases Ca++ currents, leading to increased cardiac output, while CaN-dependent phosphorylation reverses this effect. This mechanism allows bidirectional regulation in the heart, with β-adrenergic signaling increasing cardiac output times of stress, and CaN dephosphorylation providing negative feedback to prevent cardiac muscle overexcitation and in neurons (both vertebrate and invertebrate), L-type Ca++ channels may be inhibited by GPCRs, including muscarinic acetylcholine, 5-HT2A/C, and DA D2 receptors (Day et al. 2002; Hernandez-Lopez et al.

++ 2000). For 5-HT2 and D2 signaling, the involvement of IP3R-mediated Ca release and

CaN activation have been documented (Day et al. 2002; Hernandez-Lopez et al. 2000) similar to the results described here. In this study, I was able to connect 5-HT receptor

107

signaling, CaN-dependent regulation of L-type Ca++ channels and Ca++-dependent modulation of depolarization in a single pathway that modulates the electrical excitability of a sensory neuron, and its corresponding sensory-mediated behavior.

4.2.3 Acute Application of Ligands Gives New Insights to Critical Neuronal

Signaling Events

In this and the previous chapters, I emphasized a pharmacological method for studying

ASH physiology, in which I exposed a dissected soma, whose dendritic connection to the amphid is still intact, to a gentle shielding stream. By precisely controlling liquid flow, I could independently target the amphid openings and neuronal soma with different solutions (e.g. odorants and neurotransmitters/drugs, respectively), without cross- contamination. This approach greatly improved the accessibility of the ASH to modulatory ligands by removing the relatively impermeable cuticle as a barrier, and I achieved 5-HT modulation occurring at a more physiological concentration range

(10nM). In contrast, previous approaches, soaking intact worms on NGM plates containing high concentrations of monoamines (i.e. mM) for upwards of 30 minutes, resulted in unknown effective concentrations which are impossible to determine (Chao et al. 2004; Ezcurra et al. 2011; Ghosh et al. 2016; Horvitz et al. 1982). Additionally, our new technique allowed rapid ligand application, leading to the detection of very early rises in intracellular Ca++ downstream of SER-5 activation by 5-HT, providing the ability to define two separate ASH Ca++ pools with distinct origins and functions. Acute ligand

108

application also mitigates the potential for indirect effects to confound data interpretation.

Observed effects are less likely to be the result of secondary signaling by another cell type because of the short time frame. Moreover, the exposed cell soma and applied ligand are largely isolated from the remainder of the C. elegans nervous system, further reducing the potential for non-cell-autonomous signaling mechanisms to operate. Over longer time frames, developmental and physiological compensation can significantly confound experimental analysis. These observations demonstrate that acute direct application of agonists, antagonists, neurotransmitters and neuropeptides to dissected neural soma can produce critical insights into the biochemical basis of neural circuit function in the C. elegans model.

4.2.4 1-octanol Sensory Evoked Ca++ Negatively Correlates with

Depolarization

Our results have important implications for interpreting Ca++ imaging data in neural circuit analysis. Ca++ transients are often treated quantitatively, with the amplitude of the

Ca++ signal assumed to positively correlate with the strength of the membrane depolarization (Chalasani et al. 2010; Chen et al. 2017; Ghosh et al. 2016; Gourgou and

Chronis 2016; Guo et al. 2015; Kato et al. 2014; Shidara et al. 2013). Our results challenge this view by demonstrating that in the ASH neurons, Ca++ transient and depolarization amplitudes change in opposite directions in response to 5-HT signaling, that GPCR signaling can dramatically modulate Ca++ signal strength independently of depolarization, that GPCR signaling can elicit measurable Ca++ signals from internal

109

stores in the absence of depolarization, and that Ca++ can act as second messenger to significantly reduce membrane depolarization (this chapter; (Zahratka et al. 2015)).

These observations show that the relationship, between Ca++ signals and the membrane potential is not necessarily monotonic. Instead, Ca++ signals contain a wealth of information about a neuron’s physiological state and neuromodulatory milieu. These observations are relevant not only to C. elegans circuit analysis, where neurons rely on graded potentials rather than action potentials (Goodman et al. 1998), but also to other experimental systems, where action potential frequency must be calculated from neuronal

Ca++ signal amplitudes using computer algorithms (Sasaki et al. 2008; Vogelstein et al.

2009).

110

Chapter 5

The BK Channel SLO-1 Acts Downstream of Ca++ to Regulate

ASH Response Dynamics

5.1 Results

In the previous chapter I described how Ca++ entry through the L-type voltage gated calcium channel EGL-19 inhibits ASH excitability. I next wanted to identify the downstream target of the Ca++ signal. Based on mammalian and classical ion channel studies, I hypothesized that a Ca++-activated K+ channel was mediating the reduction in

ASH excitability. C. elegans does possess a BK channel orthologue called SLO-1. Below

I identify that the relationship between L-type VGCCs and BK channels is conserved in worms and plays a vital role in ensuring proper signaling kinetics are achieved.

Furthermore, a SLO-1 protein complex is operating in C. elegans and is necessary for the proper localization and trafficking of the channel to the membrane.

111

5.1.1 SLO-1 Acts Downstream of 5-HT Modulation of ASH 1-octanol Responses

As mentioned above, I hypothesized that Ca++ was mediating inhibition of ASH excitability through the activation of a Ca++-activated K+ channel. The SLO-1 voltage- and Ca++-activated K+ channel (homologous to the mammalian BK channel) is expressed throughout the C. elegans nervous system, and could potentially mediate Ca++-dependent inhibition of depolarization in ASHs (Chen et al. 2010; Goodman et al. 1998; Wang et al.

2001). I predicted that loss of the inhibitory K+ channel would abolish 5-HT enhanced of aversive responses to 1-octanol due to a compensatory channel, which is not regulated by

Ca++, being expressed instead, as demonstrated in other systems (Ransdell et al. 2012).

Using a combination of genetic manipulations to investigate a possible role for SLO-1 in

ASH signaling and modulation. In response to 30% 1-octanol, slo-1 loss-of-function mutants were insensitive to 5-HT and responded after 10s (Figure 5-1). However, as mentioned slo-1 is expressed throughout the animal. To ensure that the loss of 5-HT sensitivity was due to the channel no longer functioning in the ASH, I performed RNAi specific knockdown of channel using the neuron specific promoter Psra-6. Similar to the slo-1 nulls, two independent lines expressing an ASH-specific SLO-1 RNAi construct no longer displayed 5-HT potentiated aversive responses to 1-octanol, corroborating the loss-of-function mutants, and demonstrating a key role for SLO-1 in the 5-HT signaling pathway within ASHs (Figure 5-1).

112

Figure 5-1 SLO-1 Acts Downstream of 5-HT Modulation. Reversal times to 30% 1- octanol in the presence of 4mM 5-HT, for wild type worms, slo-1 mutants and ASH- specific SLO-1 RNAi knockdown worms (2 independent lines, C 3.1 & C 3.2). * significantly different from untreated wild-type, p = <0.0001, ANOVA.

113

5.1.2 SLO-1 is Essential for Regulating Proper ASH Signaling Kinetics

In vertebrate systems, the localization of BK channels near to L-type VGCCs is essential for the regulation of neuronal electrical tuning (Hudspeth and Gillespie 1994; Lewis and

Hudspeth 1983). Upon stimulation, the increase in local Ca++ through L-type VGCCs will activate nearby BK channels causing the efflux of K+ to repolarize and prime the neuron for the next cycle (Hudspeth and Gillespie 1994). To determine if SLO-1 plays a role in regulating ASH signaling, I analyzed the kinetics of the Ca++ signal in response to 1- octanol. Interestingly, loss of slo-1, globally or cell specifically, resulted in disrupted

Ca++ signals, most noticeably delayed onsets and multiple peaks (Figure 5-2 A). In order to analyze the effect of losing SLO-1 on the signaling kinetics, I simultaneously measured the Ca++ signals in the left and right ASHs. Remarkably, in wild type, ASHL and ASHR responded with nearly identical kinetics and the resulting Pearson’s coefficients (between ASHL and ASHR signals) were approaching 1.0 (Figures 5-2 B &

C). By contrast, slo-1 nulls and ASH-specific RNAi animals showed highly irregular response profiles (representative examples shown), resulting in significant asynchrony between ASHL and ASHR; with significantly reduced Pearson’s coefficients (Figure 5-2

B & C). These findings suggest that the remarkable uniformity of ASH Ca++ response kinetics is the result of intrinsic ionic mechanisms critically dependent on SLO-1, and that these mechanisms are powerful enough to produce bilaterally symmetric responses in the two ASH neurons, which is a novel insight into C. elegans sensory neurophysiology.

Furthermore, the relationship between ionic channels in mediating neuronal function appears to be conserved in C. elegans.

114

However, it is also possible that left and right ASHs are electrically coupled, and this coupling is somehow dependent on SLO-1, possibly developmentally (Alqadah et al.

2016). To distinguish these possibilities, I once again stimulated partially dissected

ASHs with high K+ buffer, comparing the bath-exposed ASH to the unexposed neuron remaining within the animal. If electrically coupled, the exposed and unexposed ASHs should respond together with minimal lag time; if not coupled, the unexposed ASH should respond much more slowly, as the cuticle remnant will pose a diffusion barrier for the high K+ buffer. I observed a 5s delay in the response times of the unexposed ASHs, suggesting a lack of electrical coupling (Figures 5-2 D & E). Moreover, the unexposed

ASH response times were unaffected by killing the exposed ASH using sharp glass probe, which further confirms the independence of the responses of the two ASH neurons

(Figure 5-2 E). In addition to disrupting ASH connections physically, I also analyzed the effects of losing one of the innexins responsible for forming the gap junction between the

ASHL and ASHR. The innexin CHE-7 forms a gap junction between the left and right

ASH axons during development, and is essential for proper signaling in response to quinine (Altun et al. 2009; Krzyzanowski et al. 2016). However, in response to 1-octanol, che-7 mutants did not show any disruption in synchrony between the ASHL and ASHR

Ca++ kinetics (Figure 5-2 G). Therefore, I do not see evidence for electrical coupling, at least under the conditions I tested. However, the gap junction may be physiologically significant under other conditions, because electrical synapses can be dynamically regulated, and therefore may be differentially active under different conditions (Pereda and Macagno 2017). Finally, the proper regulation of ASH response kinetics and/or left- right synchrony appears to be physiologically significant: ASH-specific RNAi

115

inactivation of SLO-1 led to significantly shorter reversal distances following 1-octanol stimulation (as defined as the distance travelled prior to the first omega turn and/or resumption of forward locomotion) (Figure 5-2 H). Taken together, these results demonstrate that SLO-1 in ASHs is necessary for 5-HT modulation of aversive behavior, which places SLO-1 in the 5-HT signaling pathway, most likely downstream of Ca++.

However, SLO-1 also plays a role in other important aspects of ASH physiology, including maintenance of resting membrane potential and shaping the response kinetics to aversive odorant stimuli.

116

Figure 5-2 SLO-1 Mediates Proper ASH Ca++ Signal Kinetics. A) Representative traces of Ca++ signals for WT, slo-1 and Psra-6::slo-1 RNAi animals. Grey box indicates 1-oct application B) Simultaneous Ca++ responses of ASHL and ASHR from individual worms

(representative traces). Gray boxes indicate 1-octanol application, genotypes and/or

117

pharmacological treatments indicated below trace. C) Pearson’s correlation coefficients

(r) values for ASHL and ASHR signals. * significantly different from wild-type, p =

0.0017, ANOVA. Representative traces (D) and 0-10% rise times (E) from simultaneous recordings of exposed and unexposed ASH neurons exposed to high K+ buffer. * significantly different from control (exposed vs unexposed p = 0.0123, t = 3.35, df = 7, paired t-test). F) Comparison of 0-10% rise times from unexposed ASHs in specimens where the exposed ASH was killed N.S. not significantly different to control (unexposed rise times reproduced from Figure 5-2 E) p = 0.7538, t = 0.3216, df =11, unpaired t-test.

G) Pearson’s correlation coefficients (r) values for ASHL and ASHR signals in che-7, p

= 0.0541 unpaired t-test. H) Distance travelled prior to omega turn during 1-octanol avoidance, comparing wild type and ASH-specific SLO-1 RNAi knockdown. * significantly different from control (Psra-6::slo-1 RNAi vs WT, p = 0.0107, t = 2.8, df =

21). Numbers in bars indicate n; values are means ±SEM.

118

5.1.3 SLO-1 Accessory Proteins are Essential for Maintaining ASH Response

Dynamics

In mammalian systems, the use of auxiliary proteins to help traffic and localize BK channels to the membrane have been reported (Kim and Oh 2016). Furthermore, depending on cellular context, the use of auxiliary proteins can alter the activity of the

BK channel (Kim and Oh 2016). In C. elegans, SLO-1 accessory proteins have also been identified that are predicted to help traffic and localize the channel near to EGL-19, possibly to function in a similar manner as seen in vertebrate hair cells (Chen et al. 2010;

Chen et al. 2011; Hudspeth and Gillespie 1994; Kim et al. 2009; Wang et al. 2001). There are four major accessory proteins identified in C. elegans necessary for SLO-1 trafficking and localization in both neurons and muscle; BKIP-1, DYB-1, ISLO-1 and CTN-1. The collection of these proteins forms a complex known as the dystrophin-associated protein complex (DAPC) (Kim et al. 2009).The loss of any of these four accessory proteins in slo-1(gf) animals results in the disruption of phenotypes associated with the gain-of- function mutation (Chen et al. 2010; Chen et al. 2011; Kim et al. 2009). As such, these proteins were analyzed to further support a role for SLO-1 in regulating left and right

ASH coordination.

The trafficking protein DYB-1 is required for the delivery of SLO-1 to the membrane from the nucleus (Chen et al. 2011). To further support the role for SLO-1 regulating ASH kinetics I analyzed the Ca++ signals in dyb-1 nulls. Similar to slo-1, the loss of DYB-1 resulted in disrupted Ca++ kinetics, especially delayed onsets and multiple

119

peaks (Figure 5-3 A). Additionally, dyb-1 mutants displayed asynchronous left and right

ASH Ca++ kinetics suggesting that the trafficking of SLO-1 to the membrane is essential to maintain proper ASH signaling and further implicates that DYB-1 is an important component in the SLO-1 protein complex (Figure 5-3 B & C). Interestingly, dyb-1 nulls did not show 5-HT enhancement of behavior, similar to slo-1 nulls, suggesting that a

SLO-1 complex, designed to transport and localize the BK channel to the membrane, is operating in the ASH (Figure 5-3 D).

Although dyb-1 mutants phenocopied slo-1, the protein may also responsible for the trafficking of many other channels and proteins and as such the observations may have been a collective of multiple mislocalized proteins (Gieseler et al. 1999a; Gieseler et al. 1999b; Oh et al. 2012). To ensure the observed DYB-1 phenotypes were indeed due to

SLO-1 mislocalization I analyzed mutants that lacked the small anchoring protein BKIP-

1 which specifically binds to SLO-1 (Chen et al. 2010). BKIP-1 is predicted to help anchor SLO-1 near to EGL-19, ensuring that the channel is near high Ca++ concentration microdomain to become activated (Chen et al. 2010). Mutants for bkip-1 mimicked the locomotory phenotype of slo-1 nulls and led to a significant reduction in the number of

SLO-1 puncta co-localizing near EGL-19 (Chen et al. 2010). Interestingly, bkip-1 mutants did indeed phenocopy slo-1, with regards to Ca++ amplitudes, Ca++ kinetics and behavior. Ca++ traces showed multiple peaks and reduced correlation between the left and right ASHs compared to wild-type (Figures 5-3 A, B & C). Finally, to determine if the loss of BKIP-1 led to an overall defective behavior, animal responses to 30% 1-octanol in the absence and presence of 5-HT were assayed. Interestingly, bkip-1 animals did not show enhanced behavioral responses to 30% 1-octanol in the presence of 5-HT but

120

instead were significantly slower compared to slo-1 5-HT treated animals (Figure 5-3 D).

The increase delay in behavioral response times may be due the mislocalization of SLO-1 at the NMJs preventing muscle excitation (Chen et al. 2010). This change in behavior provides additional evidence incorporating SLO-1 in the 5-HT pathway, and the ability for 5-HT enhancement of behavior appears to be dependent of proper SLO-1 localization on the membrane.

The final member of the SLO-1 complex tested was ISLO-1, the second accessory protein that directly interacts with SLO-1. ISLO-1 is the linker protein between SLO-1 and the DAPC and is hypothesized to help colocalize SLO-1 with EGL-19 (Kim et al.

2009). Like all other mutants for proteins associated with SLO-1, loss of islo-1 abolished the phenotypes associated with slo-1(gf) (Kim et al. 2009). As expected, islo-1 mutants showed severe disruption in Ca++ kinetics and reduced synchrony between the left and right ASHs (Figures 5-3 A, B & C). Finally, in response to 30% 1-octanol, islo-1 mutants showed similar response times as the bkip-1 nulls when treated with 5-HT, and performed reversals after 15s on average (Figure 5-3 D). These data support a critical role of a SLO-

1 protein complex in C. elegans to ensure that the BK channel can be properly localized to the membrane to promote proper neuronal signaling.

121

Figure 5-3 Loss of the SLO-1 Accessory Proteins Disrupt ASH Signaling Kinetics and

Abolishes 5-HT Modulation. A) Representative Ca++ traces of dyb-1, bkip-1 and islo-1 mutants. WT and slo-1 repeated from Figure 5-2. Grey boxes indicate 1-oct application.

B) Simultaneous Ca++ responses of ASHL and ASHR from individual animals

(representative traces). Gray boxes indicate 1-octanol application, genotypes indicated below trace. C) Pearson’s correlation coefficients (r) values for ASHL and ASHR signals. * significantly different from control, p = 0.0069, ANOVA D) Behavioral

122

responses to 30% 1-octanol in absence/presence of 5-HT. * Significantly faster compared untreated WT, p = 0.0001, † significantly slower compared to untreated WT, wild-type vs

5-HT treated bkip-1, p = 0.0001, wild-type vs 5-HT islo-1, p = 0.0001, ANOVA.

Numbers in or above bars indicate n; values are means ±SEM.

123

5.2 Discussion

In this chapter, I identified that the Ca++-activated K+ channel SLO-1 is a potential downstream target of 5-HT modulation of ASH excitability and that this channel plays a critical pacemaker role to regulate ASH signaling. These conclusions are based on the following observations; 1) the loss of SLO-1 prevented 5-HT enhancement of aversive behaviors to dilute 30% 1-octanol. 2) Loss of SLO-1, either globally or cell specifically, resulted in severe disruption of synchronous left and right ASH responses to 1-octanol, which results in defective escape behavior, and 3) loss of the SLO-1 accessory proteins

BKIP-1, ISLO-1 and DYB-1 lead to similar disruption in ASH Ca++ signal synchrony and loss of 5-HT modulation of aversive behavior.

5.2.1 SLO-1 Acts Downstream of 5-HT Modulation of ASH

In the previous chapter, I established that 5-HT enhances behavior via the inhibition of the L-type VGCC EGL-19 to potentiate ASH depolarization. In the inner ear, the interaction between BK and L-type channels has been shown to be essential in regulating depolarization and priming of the cell (Hudspeth and Gillespie 1994). Therefore, I hypothesized that the loss of the C. elegans Ca++-activated K+ channel SLO-1, would prevent 5-HT modulation of 1-octanol aversive responses. As demonstrated, slo-1 mutants no longer displayed 5-HT enhancement of aversive behavior to 30% 1-octanol

(Figures 5-1). Additionally, specific knockdown of slo-1 in the ASH via RNAi showed

124

similar phenotypes in behavior suggesting that SLO-1 is acting in the neuron, downstream of 5-HT modulation of the Ca++ and is a key player in the 5-HT modulation of ASH (Figure 5-4). However, one would predict that the loss of SLO-1 should have resulted in enhanced behavioral responses as the inhibitory channel against depolarization has been lost. A possible explanation for loss of 5-HT behavioral enhancement could be that the neuron is compensating the loss of SLO-1 by expressing a second K+ channel whose activity is independent of Ca++. Compensation for the loss of a BK channel has been observed in other systems, including the crab Cancer borealis, whereby inhibition of the L-type VGCC led to reduced expression of the BK channels and increased mRNA expression of a voltage-gated K+ channel (Ransdell et al. 2012). I hypothesize that I was seeing a similar mode of compensation occurring in the ASH.

125

Figure 5-4 SLO-1 Functions Downstream of Ca++ to Inhibit ASH Excitability. Complete hypothesized pathway whereby 5-HT inhibits EGL-19 via CaN to dephosphorylate EGL-

19. Reduced Ca++ entry via the L-type VGCC prevents SLO-1 activity and reduces K+ efflux from the neuron, promoting enhanced depolarizations.

126

5.2.2 The Relationship Between BK and L-type Channels is Conserved in C. elegans

The association between L-type Ca++ channels and Ca++-activated K+ channels is highly conserved and well documented throughout the mammalian nervous system (Contet et al.

2016; Hudspeth and Gillespie 1994; Issa and Hudspeth 1994; Lewis and Hudspeth 1983;

Purves et al. 2008). These channels function together in many contexts, including regulation of secretion and synaptic release, setting the membrane potential, and modulating electrical excitability (Chen et al. 2010; Contet et al. 2016; Goodman et al.

1998; Lewis and Hudspeth 1983; Steciuk et al. 2014; Vandael et al. 2010), and moreover, physically associate in signaling complexes (Chen et al. 2010; Chen et al. 2011; Kim and

Oh 2016; Kim et al. 2009). I observed an unexpected, but critical role for SLO-1 in precisely shaping the response kinetics of ASHs, a role similarly seen in mammalian systems (Hudspeth and Gillespie 1994; Lewis and Hudspeth 1983). The loss of SLO-1 in

ASHs either genetically generated 1-octanol response traces that can be characterized by delayed onsets and multiple peaks (Figure 5-2 A). To quantify the disruption in the kinetics, I analyzed both the left and right ASHs of an animal simultaneously and measured the correlations (r) between the two traces. In wild-type animals I observed remarkable correlations (>95%) suggesting that the left and right ASHs work in perfect unison with each other. However, when I disrupted SLO-1 I observed significantly reduced correlations between the two ASHs (Figures 5-2 B & C). These data suggest that

SLO-1 is playing and important role as a neuronal ‘pacemaker’ to ensure proper Ca++ kinetics are achieved.

127

Finally, I demonstrated that by disrupting SLO-1 specifically in the ASH via

RNAi, had a severe impact on the animal’s behavior. In response to 30% 1-octanol Psra-

6::slo-1 RNAi animals reversed much shorter distances from the stimulus compared to the wild-type counterparts (Figure 5-2 F). This suggests that SLO-1 is playing a key role in mediating proper ASH signaling to ensure that the correct behavior is performed to avoid the noxious stimulus. Furthermore, these data highlight the importance of proper neuronal signaling and the interaction between L-type VGCCs and BK channels.

5.2.3 A SLO-1 Accessory Protein Complex Ensures Proper SLO-1

Trafficking and Localization

In this chapter, I identified that a SLO-1 accessory protein complex is functioning in the

ASH and is essential for proper SLO-1 localization and regulation of Ca++ signal amplitudes and kinetics. In the mammalian system, localization of BK channels to L-type channels has commonly been associated in regulating channel activity, properties and localization (Kim and Oh 2016). Therefore, I analyzed three of the four proteins known to be members of the SLO-1 protein complex; the trafficking protein DYB-1 and the

SLO-1 interacting proteins BKIP-1 and ISLO-1. Interestingly, the interference of SLO-1 localization led to the disruption of the Ca++ signal, similar to phenotypes seen in slo-1 null and RNAi animals. These data further support the potential role of SLO-1 mediating proper ASH signaling, possibly through interaction with EGL-19. However, I was unable to confirm if the measurable effect is due to the mislocalization of SLO-1 or if there is

128

decreased membrane expression of the channel due to failure to traffic to the membrane.

Studies in muscle have suggested that the number of SLO-1/EGL-19 puncta is significantly reduced in bkip-1 and islo-1 mutants, but SLO-1 is still being expressed on the membrane (Chen et al. 2010; Chen et al. 2011; Kim et al. 2009). However, nothing has been reported in neurons (Chen et al. 2010; Chen et al. 2011; Kim et al. 2009). Loss of the trafficking protein DYB-1 disrupted ASH Ca++ transients in response to 1-octanol.

Although DYB-1 has been associated as a member of the SLO-1 protein complex, it is also a member of the DAPC, which is essential for ensuring proper cellular structure in muscle, and may function in neurons too (Gieseler et al. 1999a; Oh et al. 2012). As such the dramatic changes in the Ca++ kinetic profiles may be due the disruption in SLO-1 trafficking, but also the loss of other channel/protein localization. However, similar to slo-1 null and ASH RNAi strains, the loss of DYB-1 led to asynchronous responses in

ASH, further supporting the role of DYB-1 in the SLO-1 protein complex and further supports the role of the BK channel modulating ASH response properties.

An additional effect of losing the accessory proteins was severely inhibiting response times to 30% 1-octanol aversion. Mutants for bkip-1 and islo-1 showed significantly delayed 1-octanol responses in the presence of 5-HT, compared to slo-1 null and ASH specific RNAi strains. Conversely, off food, bkip-1 and islo-1 animals mimic wild-type, suggesting that 5-HT is mediating the extreme delay in behavior. The enhanced delay in responsiveness may be due to the mislocalization of SLO-1 throughout the animal, particularly in the muscle, preventing rapid depolarization in the neuron or muscle. Furthermore, 5-HT modulation of SLO-1 in other neurons may be lost and the release of alternative signaling molecules may be inhibiting locomotion. In order to

129

determine if the increased responses times are due to disrupted ASH signaling, or if 5-HT is modulating the signaling of another neuron or the muscles, cell specific RNAi and rescue constructs need to be designed. Surprisingly, loss of dyb-1 did not phenocopy bkip-1 or islo-1 in response to 30% 1-octanol on 5-HT, but animals still showed the loss of 5-HT enhancement of behavior. In conclusion, SLO-1 modulation of ASH Ca++ dynamics and behavior is dependent on a complex of accessory proteins, designed to locate SLO-1 to the membrane, possibly near to EGL-19, and disruption of the complex can lead to severe disruptions in neuronal signaling and overall animal behavior.

However, further work is required to determine if the effects observed are due to mislocalization or increased intracellular accumulation of the channel.

130

Chapter 6

Modulation of ASH Ca++ by Other Monoamines and

Neuropeptides

6.1 Results

In the previous chapters, 5-HT has been shown to modulate the relationship between Ca++ and ASH excitability in response to 1-octanol. As discussed in Chapter 1, many other modulators including monoamines and neuropeptides modulate ASH aversive responses to 1-octanol. Furthermore, the modulation of behaviors and Ca++ signals in sensory neurons by other neuromodulators have also been studied (Busch et al. 2012; Chalasani et al. 2010; Jang et al. 2012; Macosko et al. 2009; Sengupta 2013; Zahratka et al. 2015). In one particular study, the regulation of Ca++ signals in the AWCs, a pair attractive sensory neurons, was shown to be dependent on neuropeptides, either acting directly on the sensory neurons or through other neurons, including the AIA interneurons, to alter AWC mediated behaviors (Chalasani et al. 2010). Therefore, other neuromodulators were assessed to determine if they affected the ASH Ca++ signal to 1-octanol, with hopes of

131

advancing the understanding of the relationship between Ca++, neuronal excitability and behavior in C. elegans.

6.1.1 Dopamine

Dopamine has been attributed to modulating behaviors response to food availability by reducing locomotion and increasing turning (Ezcurra et al. 2011). Additionally, DA has been linked to the modulation of ASH responses to 0.5M glycerol and 2mM CuCl2

(Ezcurra et al. 2011). As such, I wanted to determine if DA can modulate the ASH in response to 1-octanol. Previous studies have shown that cat-2 mutants, which lack tyrosine hydroxylase and therefore cannot synthesize endogenous DA, are hypersensitive to 1-octanol (Ezak and Ferkey 2010). Therefore, I analyzed the Ca++ signals in these mutants. Interestingly, cat-2 nulls showed significantly reduced Ca++ signals in response to 1-octanol (Figure 6-1 A). This suggests that DA is promoting increased ASH Ca++ in response to 1-octanol to possibly reduce ASH excitability. I therefore, decided to analyze mutants for the two known ASH expressed DA receptors, the D2-like receptor DOP-3 and the D1-like receptor DOP-4 (Ezak and Ferkey 2010). The receptor DOP-3 has been associated with inhibiting response times to 1-octanol as dop-3 animals are hypersensitive (Ezak and Ferkey 2010). Remarkably, ASH Ca++ responses in dop-3 mutants are significantly reduced similar to cat-2 nulls, suggesting that DA signaling through DOP-3 promotes elevated Ca++ amplitudes to 1-octanol and potentially mediates inhibited response times (Figure 6-1 B).

132

In C. elegans loss of dop-4 resulted in animals readily crossing Cu++ barriers, whereas wild-type animals avoided the stimulus (Wang et al. 2014a). Furthermore, loss of dop-4 specifically in the ASH led to reduced aversive behaviors to the Cu++ barrier

(Ezcurra et al. 2011).This suggests DOP-4 plays a role increasing ASH sensitivity

(Ezcurra et al. 2011; Schafer 2015). Therefore, I analyzed 1-octanol responses in dop-4 nulls to determine if DOP-4 may also play a role in modulating ASH sensitivity to this stimulus. Interestingly, dop-4 mutants showed significantly slower aversive response times to 30% 1-octanol off food (Figure 6-1C). Furthermore, the 1-octanol induced Ca++ signals in dop-4 were significantly smaller than wildtype animals (Figure 6-1 D).

However, upon further analysis, this reduction in amplitude was due to a ceiling effect of

Ca++ inside the soma of the ASH. As shown, the resting Ca++ baseline in dop-4 ASHs was significantly higher compared to wild-type animals (Figure 6-1 E). This suggests that

DOP-4 may play a role in regulating ASH Ca++ amplitudes and the activity of VGCCs in the neuron. In summary, DA appears to modulating the Ca++ signal similar to 5-HT and loss of the inhibitory receptor DOP-3 promotes reduced Ca++ amplitudes and increased

ASH sensitivity (Figure 6-1 B) (Ezak and Ferkey 2010). Alternatively, loss of dop-4 results in slightly inhibited response times to 1-octanol, possibly due to elevated Ca++ in the neuron (Figures 6-1 C & E).

133

Figure 6-1 Dopamine Modulates ASH Ca++ Signals Using the DOP-3 and DOP-4

Receptors. A) Loss of endogenous DA synthesis results in significantly reduced Ca++ amplitudes. * significantly different from wild-type, p = 0.0015, unpaired t-test. B) Loss

++ of the D2-like receptor leads to reduced Ca amplitudes in response to 1-octanol. * significantly different from wild-type, p = 0.0120, unpaired t-test. C) dop-4 show slightly slower response times to dilute 30% 1-octanol. * significantly slower than wild-type, p =

++ 0.0021, unpaired t-test. D) Loss of the D1-like receptor DOP-4 generates reduced Ca amplitudes to 1-octanol. * significantly different from wild-type, p = <0.0001, unpaired t- test. E) dop-4 mutants have elevated Ca++ baselines, resulting in reduced Ca++ amplitudes. * significantly different from wild-type, p = <0.0001, unpaired t-test.

Numbers in or above bars indicate n; values are means ±SEM.

134

6.1.2 Octopamine

The monoamine octopamine can modulate the ASH directly or indirectly to affect behavioral responses to 1-octanol (see Chapter 1). In response to 100% 1-octanol, both

4mM and 10mM OA inhibit enhanced aversive responses (Mills et al. 2012) To determine if OA has any effect on 1-octanol induced ASH Ca++ signals, GCaMP3 expressing wild type animals were analyzed in the presence of 4mM and 10mM OA.

Interestingly, treatment with both 4mM and 10mM OA for 30 minutes significantly reduced ASH Ca++ amplitudes in response to 1-octanol (similar to 5-HT treated animals)

(Figure 6-2 A). This suggests that OA inhibits enhanced behavioral responses to 100% 1- octanol by reducing ASH Ca++. Additionally, 4mM OA inhibits 5-HT enhancement of aversive responses to 30% 1-octanol via the Gαo-coupled receptor OCTR-1. (Mills et al.

2012). Therefore, I analyzed wild-type and octr-1 null animals treated with both 4mM 5-

HT and OA. Interestingly, the Ca++ signal was inhibited in both backgrounds, suggesting the modulation of 5-HT enhanced behavioral responses by OA and OCTR-1 does not affect the amplitude of the detectable Ca++ but instead may modulate synaptic vesicle release or neuronal depolarizations (Figure 6-2 B).

The OA mediated inhibition of ASH Ca++ can be a result of direct interaction on the ASH or by the modulation of another neuron in the circuit. Currently there are three identified OA receptors in C. elegans; OCTR-1, SER-3 and SER-6, all of which modulate

ASH mediated aversive responses to 1-octanol (Mills et al. 2012; Wragg et al. 2007). The

Gαo-coupled receptor OCTR-1 is expressed in the ASH sensory neuron and modulates the cell directly (Mills et al. 2012; Wragg et al. 2007). Untreated octr-1 animals showed

135

no significant reduction for Ca++ amplitude (Figure 6-2 C). However, when treated with

4mM OA, octr-1 nulls no longer displayed inhibited Ca++ amplitudes, suggesting that

++ OCTR-1 is mediating the 4mM OA inhibition of ASH Ca via a Gαo-coupled pathway possibly through direct action on the neuron (Figure 6-2 D).

The second OA receptor SER-3, is a Gαq-coupled receptor which is also known to be expressed in the ASH (Mills et al. 2012). Interestingly, 10mM OA is able to inhibit 5-

HT enhanced behaviors to 1-octanol, when ser-3 is specifically knocked down by RNAi in the ASH (Mills et al. 2012). Therefore, I analyzed the Ca++ signals in untreated and

10mM treated ser-3 nulls. Surprisingly, in untreated ser-3 mutants, I saw a significant reduction in the Ca++ signal compared to wild-type (Figure 6-2 C). Furthermore, 10mM

OA was still able to significantly reduce the amplitudes in ser-3, suggesting the 10mM effect on the ASH is not mediated by this receptor (Figure 6-2 E). These data suggest that

SER-3 may play a role in increasing 1-octanol induced ASH Ca++ signals, possibly through endogenous OA signaling, but the 10mM OA effect on the Ca++ appears to be mediated via another OA receptor or by another neuron in the circuit.

The final receptor analyzed, the Gαq-coupled GPCR ser-6, is expressed in the OA synthesizing neurons known as the RICs and on the ASI neurons that synapse onto ASH

(Mills et al. 2012; Yoshida et al. 2014). When treated with 10mM OA ser-6 nulls respond to 100% 1-octanol in 5s compared to 10s in the wild-type (Mills et al. 2012).

Furthermore, the rescue of SER-6 in the ASIs of ser-6 nulls restored the inhibited behavioral defect suggesting that ASI peptides may inhibit ASH responses and possibly modulate ASH Ca++. In untreated animals ser-6 nulls showed a significant reduction in the ASH Ca++ signal compared to wild-type suggesting SER-6 increases ASH Ca++

136

amplitudes in response to 1-octanol (Figure 6-2 C). However, when treated with 4mM and 10mM ser-6 had no significant effect on the Ca++ compared to wild-type (Figures 6-2

D & E). These data suggest that endogenous OA stimulates ser-6, possibly on the ASIs or

RICs, and promotes elevated ASH Ca++ in response to 1-octanol and the 4mM OA effect is solely mediated by OCTR-1 However exogenous 10mM OA still has and effect in both ser-3 and ser-6 nulls, suggesting that excessive OA stimulates a yet unidentified OA receptor or has off-target effects.

Finally, I wanted to identify the lowest concentration of OA that can inhibit the

ASH Ca++ signal in response to 1-octanol. Using the methods described in Chapters 3 &

4, I dissected wild-type ASHs and applied various low concentrations of OA, and recorded the 1-octanol induced Ca++ before and after OA application. Surprisingly, I observed no inhibition of the second 1-octanol induced Ca++ signal when 10nM or 1µM

OA was directly applied to the ASH for one minute (Figure 6-2 F & G). These data suggest that the effect observed in animals incubated on 4mM OA may require higher concentrations of the ligand to be directly applied on the ASH or a longer application time. Furthermore, it may be possible that the effect seen may be an off-target effect and a second neuron may be activated by OA and may release other neuromodulators on to

++ ++ the ASH to alter the Ca amplitude. In summary, OA appears to modulate the ASH Ca via the two known ASH expressed receptors OCTR-1 and SER-3, and the through the third receptor SER-6 possibly via ASI released peptides.

137

Figure 6-2 Octopamine Inhibits 1-octanol Mediated ASH Ca++ Transients. A) 4mm and

10mM inhibit ASH Ca++ amplitudes. * significantly different from untreated, p =

<0.0001, ANOVA. B) 5-HT mediated Ca++ signals are still inhibited in the presence of

4mM OA and in octr-1 nulls. * significantly different from untreated, p = <0.0001,

138

ANOVA. C) Loss of ser-3 and ser-6 significantly reduces ASH Ca++ responses in untreated animals. * significantly different from wild-type, WT vs octr-1 p = 0.0708; WT vs ser-3 p = 0.003, WT vs ser-6 p = 0.115, ANOVA D) OCTR-1 mediates 4mM inhibition of Ca++. * Significantly different from wild-type, p = <0.0001, ANOVA. N.S. not significant from untreated, p = 0.2869, ANOVA. E) 10mM still inhibits Ca++ octr-1, ser-3 and ser-6 mutants. F) Acute application of 1µM or 10nM OA does not significantly inhibited the second 1-octanol responses after 1 minute. N.S. not significant from untreated 1-octanol response, paired t-test. G) Representative trace of untreated first

1ocatnol response (left) and second 1-octanol response (right) in the presence of 1µM or

10nM OA. Grey boxes indicate 1-octanol application, black bar indicates OA application.

Numbers in or above bars indicate n; values are means ±SEM.

139

6.1.3 Neuropeptide and Receptor Modulation of ASH Ca++

Similar to mammals, C. elegans expresses neuropeptides, which can modulate many different types of behavior through the interaction with specific GPCRs. Therefore, I wanted to determine if disruption in peptidergic signaling affected 1-octanol induced

Ca++ signals. To determine if loss of peptidergic signaling had any effect on ASH Ca++, I analyzed mutants for the proprotein convertase EGL-3, resulting in animals not be able to produce any neuropeptides. Interestingly, loss of global neuropeptidergic signaling significantly reduced ASH Ca++ amplitudes (Table 6-1). Therefore, I screened mutants for three ASH expressed neuropeptides; nlp-3, nlp-15 and flp-21. All observations for these mutants are described in Table 6-1.

Previous studies have shown that the loss of nlp-3 results in animals no longer being enhanced by 5-HT in response to dilute 30% 1-octanol (Harris et al. 2010; Mills et al. 2016). This behavioral defect was shown to be ASH specific, as loss of nlp-3 through neuron specific RNAi resulted in longer reversal times on 5-HT (Mills et al. 2016).

Interestingly, untreated and 4mM 5-HT treated nlp-3 animals showed significantly lower

Ca++ amplitudes compared to untreated wild-type (Table 6-1), suggesting that NLP-3 may regulate ASH Ca++ signals in response to 1-octanol. However, expression patterns for predicted NLP-3 target, NPR-17, suggest that the receptor is not expressed on the

ASH (Mills et al. 2016). As such, the observable effect on the ASH Ca++ may be due the loss of NLP-3 signaling elsewhere in the circuit, preventing the release of the modulator acting on ASH.

140

The second neuropeptide I analyzed was NLP-15. Previous behavioral studies suggested that NLP-15 plays a role in modulating behavioral response times to 30% 1- octanol (Harris et al. 2010), and in fact nlp-15 null animals displayed significantly faster responses (5s) compared to wild-type (10s) (Table 6-1). Interestingly, loss of nlp-15 resulted in a significantly reduced Ca++ amplitude and 5-HT treatment did not inhibit the signal further (Table 6-1). This suggests that NLP-15 may elevate ASH Ca++ through an autoreceptor resulting in inhibited reversal times. However, the target receptor for NLP-

15 has not yet been identified. An alternative method for NLP-15 inhibiting ASH Ca++ signal may be caused by the loss of signaling elsewhere in the circuit, preventing the release of a second neuromodulator. Regardless of how and where NLP-15 is acting, these data suggest that the peptide is modulating both the neuron and the overall behavioral output to 1-octanol.

The final ASH expressed peptide, FLP-21, has been commonly associated as the ligand for the neuropeptide GPCR, NPR-1 (Cheung et al. 2005; Davies et al. 2004;

Milward et al. 2011; Rogers et al. 2003). When analyzed flp-21 mutants showed significantly reduced Ca++ signals in untreated ASHs and no detectable signal in the presence of 5-HT (Table 6-1). Interestingly, when treated with 5-HT the Ca++ baseline in the ASHs of flp-21 were significantly higher compared to their untreated counterparts

(Table 6-1). This increase baseline could be responsible for the undetectable change in amplitude when treated with 5-HT. Furthermore, in wild-type animals, there was no significant difference between baseline Ca++ in untreated or 5-HT treated ASHs. These data suggest that in the presence of 5-HT, FLP-21 may play a role in regulating Ca++ channel activity. However, behavioral studies of 5-HT treated flp-21 null animals have

141

shown that the animals still demonstrate enhanced aversive behavior (Harris et al. 2010).

Taken together, the elevated baseline Ca++ in the ASHs of 5-HT treated flp-21 does not seem to affect ASH signaling to 1-octanol.

The predicted receptor for FLP-21, NPR-1, is expressed throughout the nervous system, including the ASH (Coates and de Bono 2002). To determine if the disrupted

Ca++ signals observed in flp-21 nulls were being mediated by NPR-1 I analyzed the Ca++ baselines in untreated and 5-HT treated npr-1 nulls. Interestingly, npr-1 null animals showed significantly increased Ca++ baselines of ASH Ca++, similar to fp-21 mutants, suggesting that the observed phenotype in 5-HT treated flp-21 animals may be mediated by NPR-1 acting directly on the ASH. Furthermore, 5-HT treated npr-1 nulls no longer displayed enhanced behavioral response to 30% 1-octanol (Table 6-1). Taken together, these data suggest that FLP-21 may signal through NPR-1 directly on the ASH to modulate Ca++ in the presence of 5-HT.

Based on the results observed in flp-21 and npr-1, I analyzed a second neuropeptide, FLP-18, which also interacts with NPR-1. FLP-18 is not expressed in the

ASH but studies have suggested that the peptide does mediate NPR-1 modulation

(Cheung et al. 2005; Davies et al. 2004; Milward et al. 2011; Rogers et al. 2003).

Notably, I did not observe any effect on the Ca++ amplitudes or resting baselines in untreated or 5-HT treated flp-18 mutants, suggesting that FLP-18 is not released onto the

ASHs (Table 6-1). However, studies have suggested that FLP-18 only interacts with the

NPR-1 variant 215V, a single point mutation altering phenylalanine to a valine, which increases NPR-1s affinity and promoting FLP-18 interaction (Rogers et al. 2003).

142

Lastly, I analyzed mutants for the remaining two receptors known to be expressed on the ASH; npr-2 and ntr-1 (Beets et al. 2012; Garrison et al. 2012; Luo et al. 2015).

NPR-2, is predicted to function cell autonomously on the ASH to increase adaptation in the absence of food and modulate avoidance and nociception (Ezcurra et al. 2016; Luo et al. 2015), and because 1-octanol sensation has been attributed with nociception (Hapiak et al. 2013; Mills et al. 2012; Srinivasan et al. 2008), I wanted to determine if NPR-2 plays are role in modulating ASHs in response to the stimulus. Surprisingly, loss of NPR-

2 had no effect on the ASH Ca++ signal in response to 1-octanol (Table 6-1). This suggests that NPR-2 does not modulate 1-octanol responses, but may modulate responses to other ASH sensed stimuli. Finally, mutants for ntr-1, the C. elegans homologue of the human vasopressin receptor type 2 were assayed (Beets et al. 2012). As described in

Chapter 1, oxytocin and vasopressin modulate mammalian nervous systems. In C. elegans the neuropeptide NTC-1, a homologue of mammalian vasopressin and oxytocin, regulates behaviors including reproduction and feeding using two receptors, NTR-1 and

NTR-2 (Beets et al. 2012; Garrison et al. 2012). ntr-1 nulls were analyzed to determine if

NTC-1 modulates ASH Ca++ responses to 1-octanol. However, loss of NTR-1 did not disrupt ASH Ca++ signal amplitude or kinetics in response to 1-octanol (Table 6-1), suggesting oxytocin/vasopressin plays no role in modulating ASH Ca++ in response to 1- octanol. However, similar to NPR-2, NTR-1 may modulate ASH responses to other stimuli or modulate the neuron in other compartments, such as the axon and vesicle release. In summary, certain ASH expressed peptides and receptors appear to play a potential role in modulating the 1-octanol Ca++ responses. However, in order to fully understand how neuropeptides alter ASH signaling requires further research.

143

Neuropeptide/ Description Phenotypes Receptor EGL-3 Proprotein convertase. ASH 1-octanol Ca++ amplitudes in egl-3 nulls are inhibited. NLP-3 ASH expressed Untreated and 5-HT treated nlp-3 nulls had reduced Ca++ amplitudes in response to 1- neuropeptide. Involved octanol. in modulating 1-octanol responses. NLP-15 ASH expressed nlp-15 nulls have rapid aversive responses (5s) to 30% 1-octanol. neuropeptide that modulates locomotion. Untreated and 5-HT treated nlp-15 animals have significantly reduced Ca++ amplitudes. FLP-21 ASH expressed FMRF- Untreated flp-21 nulls have significantly reduced Ca++ signals. amide peptide that interacts with NPR-1 to 5-HT treated mutants have no dateable Ca++ amplitudes, but show significantly increased modulate social feeding. Ca++ baselines compared to untreated flp-21 and 5-HT treated wild-type animals. FLP-18 FMRF-amide peptide Untreated and 5-HT treated animals display wild-type phenotypes in Ca++ amplitudes and that interacts with NPR- resting baseline Ca++. 1 215V. NPR-1 NPY homologue. Three npr-1 alleles; ky13, ad609 and ok1447 treated with 5-HT show inhibited (10s) Predicted receptor for aversive responses to 30% 1-octanol FLP-21 & FLP-18. npr-1 (ok1447) animals have reduced Ca++ signals in the presence of 5-HT, similar to wild-type.

Ca++ baselines in 5-HT treated npr-1 animals are significantly elevated, comparable to flp- 21. NPR-2 Receptor modulates 1-octanol induced ASH Ca++ amplitudes and kinetic profiles are wild-type in npr-2 ASH sensation. mutants. NTC-1 Vasopressin homologue ntr-1 nulls have no significant disruptions in their Ca++ signals. modulating feeding. Table 6-1 ASH expressed neuropeptides and receptors extensively modulate ASH Ca++ responses to 1-octanol.

144

6.2 Discussion

In this chapter, I briefly analyzed the effects of other neuromodulators and their predicted receptors on mediating 1-octanol induced ASH Ca++ signals. As shown, the effects on the

ASH Ca++ can be quite dramatic. The monoamine DA promotes elevated Ca++ in the

ASH through the DOP-3 receptor, and appears to inhibit Ca++ using DOP-4. Interestingly, the monoamine OA, modulates ASH Ca++ differently through three GPCRs, with ASH expressed receptor OCTR-1 mediating 4mM OA inhibition of Ca++. Finally, the three

ASH expressed neuropeptides regulate Ca++ amplitudes with FLP-21signaling through

NPR-1 to modulate resting baseline signals in the presence of 5-HT. However, the other known ASH neuropeptide receptors appear to have no effect on modulating ASH signaling in response to 1-octanol.

6.2.1 Dopamine Modulates 1-octanol Induced ASH Ca++ and Behavior

Similar to 5-HT

The first monoamine analyzed was dopamine. As described in Chapter 1, loss of endogenous DA signaling increases 1-octanol sensitivity (Ezak and Ferkey 2010).

Therefore, I analyzed cat-2 mutants which lack tyrosine hydroxylase and cannot synthesize endogenous DA. Interestingly loss of endogenous DA signaling resulted in reduced ASH Ca++ signals in response to 1-octanol. This suggested that the reduced Ca++ signal observed in the ASHs of cat-2 mutants may promote enhanced neuronal

145

excitability thus resulting in the elevated behavioral responses. To asses this assumption I analyzed mutants for the two DA receptor known to be expressed on the ASH; the D2- like receptor DOP-3 and the D1-like receptor DOP-4. Interestingly, similar to cat-2, animals lacking DOP-3 showed reduced Ca++ signals in response to 1-octanol.

Furthermore, these animals have been reported to have enhanced behavioral responses to

30% 1-octanol (Ezak and Ferkey 2010). Taken together these results suggest that DA may inhibit ASH signaling via the DOP-3 receptor to promote increased Ca++ entry in the neuron, thus reducing behavioral response times. Conversely loss of DOP-4 results in animals losing sensitivity to noxious stimuli (Ezcurra et al. 2011; Schafer 2015; Wang et al. 2014a). Surprisingly, loss of the receptor resulted in significantly reduced Ca++ signals, but upon closer inspection, dop-4 mutants had significantly elevated baseline

Ca++ signals. This suggests that reduced amplitude is caused by a ceiling effect, and upon

1-octanol application, only a small amount of Ca++ can enter the neuron. Furthermore, the elevation in Ca++ may result in reduced ASH excitability, resulting in delayed responses.

Taken together these data suggest that DA modulates the relationship between

Ca++ depolarization negatively, similarly to 5-HT, as a reduction of ASH Ca++ amplitudes enhances behavioral responses. However, electrical recordings of ASH depolarizations in both dop-3 and dop-4 mutants are required in order to fully determine if DA modulates the relationship between ASH Ca++ and depolarization in a similar manner as 5-HT.

Furthermore, cell specific RNAi known down of dop-3 and dop-4 is essential to ensure that effects observed are due to direct DA interaction on the ASH. In conclusion, DA appears to modulate the relationship between ASH Ca++ amplitude and behavioral

146

sensitivity similarly to 5-HT, suggesting that negative correlation between the Ca++ and depolarization signals is not limited to 5-HT modulation.

6.2.2 Octopamine Modulates ASH Ca++ and Excitability

Octopamine extensively modulates ASH aversive behaviors to 1-octanol by signaling throughout the nervous system (Mills et al. 2012; Wragg et al. 2007). Therefore, OA may modulate ASH Ca++ in response to 1-octanol. Both 4 and 10mM OA significantly inhibited ASH Ca++ amplitudes in response to 1-octanol, suggesting that OA may modulate the ASH Ca++ differently from 5-HT. Furthermore, animals treated with both

++ 4mM OA and 5-HT, exhibited similar reduced Ca signals as those treated with OA or 5-

HT alone, and the loss of octr-1 did not alter the Ca++ amplitude. These data suggest that

OA inhibition of 5-HT mediated enhancement of behavior is not effecting the detectable

ASH somal Ca++ signal, but instead may alter axonal Ca++ signals, synaptic vesicle release or neuronal excitability. Therefore, measurement of ASH depolarizations via electrophysiology is a necessary experiment to determine if OA treatment is ablating 5-

HT potentiation of the neuron. Additionally, I wanted to identify the lowest concentration of OA able to inhibit ASH Ca++ signals to 1-octanol. Surprisingly, direct application of

10nM and 1µM OA onto the ASH did not inhibit Ca++ responses after 1 minute, suggesting that either a higher concentration of OA is needed to inhibit Ca++ entry or a longer application time is required. Taken together these results suggest OA may be modulating the relationship between Ca++ and depolarization differently to 5-HT.

147

However, to fully understand how OA is affecting the relationship between the Ca++ and depolarization signals, 1-octanol induced depolarizations are required.

To determine which receptors are mediating the OA inhibition of ASH Ca++ signals, the three known GPCRs expressed in C. elegans; OCTR-1, SER-3 and SER-6, were analyzed. OA modulation of behavior can be achieved by the monoamine acting directly on the ASH or mediating neuronal signaling onto the sensory neuron (Mills et al.

2012). Interestingly, loss of the ASH expressed Gαo-coupled receptor OCTR-1 abolished the 4mM OA inhibition of the Ca++ signal. However, to determine if this effect is due to direct OA interaction with OCTR-1 on the ASH, cell specific RNAi knockdown or rescue constructs of octr-1, are needed. Interestingly, loss of the two Gαq-coupled receptors,

SER-3 or SER-6 did not abolish the 10mM OA inhibition of the Ca++ signals, but did result in the significant reduction of ASH Ca++ in untreated animals. With regards to

SER-6, behavioral data suggests that the receptor modulates the release of inhibitory neuropeptides from ASI, which synapses onto ASH (Mills et al. 2012). Therefore, I predict that ASI neuropeptides are released to promote increased ASH Ca++ signals and delay response times. Consequently, ASI cell-specific knockdown of SER-6 and the hypothesized inhibitory neuropeptides may help determine if reduction of ASH Ca++ is a result of neuron-neuron modulation. The effect seen in ser-3 nulls may be a result of elevated OCTR-1 signaling as behavioral data suggests that both SER-3 and OCTR-1 actively antagonize each other (Mills et al. 2012).

In conclusion, OA can effectively modulate ASH Ca++ signals in response to 1- octanol. Preliminary data suggests that OA is indeed affecting the relationship between the detectable Ca++ signal and neuronal excitability. However, further research is required

148

to determine if the modulation of the signals by OA acts in a positive or negative correlation. Additionally, the receptor OCTR-1 mediates the observable effect caused by

4mM, and the receptors SER-3 and SER-6 appear to elevate ASH Ca++ in untreated animals. Lastly, the lowest concentration of OA able to inhibit ASH Ca++ via direct application needs to be identified.

6.2.3 Neuropeptides and their Receptors Extensively Modulate ASH

The ASH is known to express four neuropeptides. Interestingly, all three peptides analyzed affected ASH Ca++ responses to 1-octanol. The first neuropeptide, NLP-3 modulates 1-octanol responses, as nlp-3 nulls no longer show enhanced behavioral responses in the presence of 5-HT (Mills et al. 2016). When analyzed via Ca++ -imaging both untreated and 5-HT treated nlp-3 nulls had reduced Ca++ amplitudes, suggesting that

NLP-3 can modulates ASH Ca++. One possible mode of NLP-3 modulation may be through the peptide interacting with the receptor NPR-17, which is expressed on the ASIs

(Mills et al. 2016). NLP-3 interaction on the ASI may stimulate the release of inhibitory peptides that interact with the ASH and promote elevated Ca++¸ similar to OA modulation, thus reducing neuronal excitability. However, the loss of enhanced behavior in 5-HT treated nlp-3 nulls may be due loss of signaling in another neuron within the 1- octanol circuit. Taken together, these data suggest that ASH may release NLP-3 to stimulate the ASIs and possibly other cells within the nervous system, to modulate 1- octanol aversive responses. In conclusion, NLP-3 signaling appears to be very complex in

149

modulating ASH Ca++ responses, and the analysis of neuronal depolarizations may help improve our understanding of how this peptide can modulate the neuron.

Loss of the second ASH neuropeptide, NLP-15, resulted in untreated animals exhibiting faster aversive response to 1-octanol and Ca++-imaging showed that untreated nlp-15 nulls had significantly reduced Ca++ amplitudes compared to wild-type. This suggests that NLP-15 may inhibit ASH signaling by directly acting on the neuron through a yet unidentified receptor, to modulate the Ca++ signal. Alternatively, NLP-15, similar to

NLP-3, may interact with the ASI or another neuron to stimulate the release of inhibitory peptides or monoamines to reduce ASH excitability. To fully understand NLP-15 signaling, the identification of the downstream receptor will help determine whether the peptide is acting directly on the ASH or elsewhere in the circuit. In summary, NLP-15 appears to negatively modulate the ASH and ASH mediated peptides, but identification of the target receptor and where it is expressed, will help determine how NLP-15 functioning.

The final ASH expressed neuropeptide analyzed was FLP-21. Interestingly, no disruptions in 1-octanol behavioral responses have been reported flp-21 nulls (Harris et al. 2010). However, Ca++-imaging showed that 5-HT treatment resulted in no detectable changes in amplitude, caused by the Ca++ baseline becoming significantly elevated. This suggests that FLP-21 is modulating resting Ca++ in the presence of 5-HT. To determine how FLP-21 is mediating ASH Ca++ baselines, mutants of the predicted FLP-21 target,

NPR-1, were analyzed. Similarly, npr-1 nulls showed significantly increased ASH Ca++ baselines in the presence of 5-HT. This suggests that FLP-21 interacts with NPR-1,

++ which is expressed on the ASH, to mediate baseline Ca , possibly through the Gαo

150

protein GOA-1, which couples to the receptor (Rogers et al. 2003). GOA-1 regulates the activity of the Gαq protein EGL-30, by activating the RGS protein EAT-16 (Bastiani and

Mendel 2006). Therefore, in the presence of 5-HT, elevated baseline Ca++ signals may be occurring due to increased SER-5 and EGL-30 signaling and the loss of regulation via

EAT-16. Interestingly, loss of the second predicted NPR-1 ligand, FLP-18, had no effect on ASH Ca++ amplitudes or resting baselines in the presence of 5-HT. However, FLP-18 only interacts with the gain-of-function variation NPR-1 215V (Rogers et al. 2003), and no known FLP-18 expressing neurons synapse directly onto the ASH (Bhatla 2009;

Rogers et al. 2003). In summary, FLP-21 modulates 5-HT mediated Ca++ signals in the

ASH via the Gαo-coupled receptor NPR-1, which may regulate SER-5/EGL-30 signaling via the activation of EAT-16.

Finally, I analyzed the other two known expressed neuropeptide receptors NTC-1 and NPR-2. When analyzed no significant changes in ASH Ca++ signals in response to 1- octanol were observed in ntr-1 and npr-2 mutants. This suggests that these two receptors play no role in modulating 1-octanol induced ASH Ca++. However, the ASH is able to sense multiple different stimuli including SDS, quinine, primaquine, glycerol and harsh nose touch and these two receptors may modulate these other sensed stimuli.

Furthermore, these two receptors have been attributed to adaptation of the ASH sensory in the presence of food and associative learning (Beets et al. 2012; Ezcurra et al. 2016).

Therefore, these receptors may modulate the neurons independent of changes in Ca++ signaling. In conclusion, neuropeptides and their receptors appear to modulate ASH responses to 1-octanol. However, further analysis is required to fully understand how these neuromodulators regulate neuronal signaling.

151

6.3 Conclusions

In conclusion, the ability for neuromodulators to affect the relationship between the detectable Ca++ signal and neuronal excitability is very complex. Furthermore, the detectable Ca++ signal is not a reliable indicator of neuronal excitability. As discussed, the reduction of the Ca++ signal by 5-HT has the capacity to potentiate depolarization, thus enhancing aversive responses to 1-octanol. The ability for 5-HT to inhibit the Ca++ is dependent on a conserved pathway that ultimately leads to the activation of the phosphatase calcineurin, and the subsequent dephosphorylation of the L-type channel.

The ability for Ca++ to inhibit depolarization appears to be mediated by the Ca++-activated

K+ channel SLO-1, as loss of the channel leads to the loss of 5-HT modulation of aversive behavior and the disruption of ASH signaling kinetics. Finally, other neuromodulators including dopamine appear to affect the relationship between Ca++ and

ASH cell excitability in a similar fashion. However, further research is required to determine if the described effects are dependent on receptor function in the ASH and how loss of the receptors alters depolarizations.

The use of acute pharmacological application on a C. elegans neuron abolished the problems associated with prolonged incubation on compounds, including developmental and physiological compensation, which significantly confounds experimental analysis.

The observations described demonstrate that acute direct application of the L-type channel antagonists Nemadipine-A and the neuromodulator 5-HT produced critical insights into the biochemical basis of neural circuit function in the C. elegans model.

Therefore, these new techniques will allow the analysis of other compounds such as

152

agonists, antagonists, neurotransmitters and neuromodulators further improving our understanding of neuromodulation in C. elegans, not only on ASH but in other neurons including attractive sensory neurons and interneurons too.

Finally, these results can have a significant impact on future neuromodulatory studies, not just in C. elegans but also other systems including Drosophila and mammals.

Due to the conserved pathways between C. elegans and higher organisms it is highly likely that the relationship between Ca++ and depolarization is operating in a similar manner. As mentioned Ca++ transients are often assumed to positively correlate with the strength of the membrane depolarization (Chen et al. 2017; Ghosh et al. 2016; Gourgou and Chronis 2016; Guo et al. 2015; Kato et al. 2014; Shidara et al. 2013). These observations show that the delectable Ca++ signals are not always reliable indicators of neuronal depolarization and instead contain a wealth of information about a neuron’s physiological state and neuromodulatory milieu. Therefore, the analysis of Ca++ signals in neuromodulatory studies, in all model organisms, need to be dissected further, to ensure that we fully understand how neuromodulator alter information flow within circuits.

153

References:

Abdel-Hamid KM, Tymianski M. 1997. Mechanisms and effects of intracellular calcium buffering on neuronal survival in organotypic hippocampal cultures exposed to anoxia/aglycemia or to excitotoxins. J Neurosci 17(10):3538-3553.

Adolph AR, Kass L. 1979. Specificity of serotoninergic inhibition in Limulus lateral eye. J Gen Physiol 74(5):549-563.

Akerboom J, Carreras Calderon N, Tian L, Wabnig S, Prigge M, Tolo J, Gordus A, Orger MB, Severi KE, Macklin JJ, Patel R, Pulver SR, Wardill TJ, Fischer E, Schuler C, Chen TW, Sarkisyan KS, Marvin JS, Bargmann CI, Kim DS, Kugler S, Lagnado L, Hegemann P, Gottschalk A, Schreiter ER, Looger LL. 2013. Genetically encoded calcium indicators for multi-color neural activity imaging and combination with optogenetics. Front Mol Neurosci 6:2.

Akerboom J, Chen TW, Wardill TJ, Tian L, Marvin JS, Mutlu S, Calderon NC, Esposti F, Borghuis BG, Sun XR, Gordus A, Orger MB, Portugues R, Engert F, Macklin JJ, Filosa A, Aggarwal A, Kerr RA, Takagi R, Kracun S, Shigetomi E, Khakh BS, Baier H, Lagnado L, Wang SS, Bargmann CI, Kimmel BE, Jayaraman V, Svoboda K, Kim DS, Schreiter ER, Looger LL. 2012. Optimization of a GCaMP calcium indicator for neural activity imaging. J Neurosci 32(40):13819-13840.

Alkema MJ, Hunter-Ensor M, Ringstad N, Horvitz HR. 2005. Tyramine Functions independently of octopamine in the Caenorhabditis elegans nervous system. Neuron 46(2):247-260.

Alqadah A, Hsieh YW, Xiong R, Chuang CF. 2016. Stochastic left-right neuronal asymmetry in Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 371(1710).

154

Altieri SC, Garcia-Garcia AL, Leonardo ED, Andrews AM. 2013. Rethinking 5-HT1A receptors: emerging modes of inhibitory feedback of relevance to emotion-related behavior. ACS Chem Neurosci 4(1):72-83.

Altun ZF, Chen B, Wang ZW, Hall DH. 2009. High resolution map of Caenorhabditis elegans gap junction proteins. Dev Dyn 238(8):1936-1950.

Amigo J, Diaz A, Pilar-Cuellar F, Vidal R, Martin A, Compan V, Pazos A, Castro E. 2016. The absence of 5-HT4 receptors modulates depression- and anxiety-like responses and influences the response of fluoxetine in olfactory bulbectomised mice: Adaptive changes in hippocampal neuroplasticity markers and 5-HT1A autoreceptor. Neuropharmacology 111:47-58.

Antic SD, Empson RM, Knopfel T. 2016. Voltage imaging to understand connections and functions of neuronal circuits. J Neurophysiol 116(1):135-152.

Azevedo FA, Carvalho LR, Grinberg LT, Farfel JM, Ferretti RE, Leite RE, Jacob Filho W, Lent R, Herculano-Houzel S. 2009. Equal numbers of neuronal and nonneuronal cells make the human brain an isometrically scaled-up primate brain. J Comp Neurol 513(5):532-541.

Badura A, Sun XR, Giovannucci A, Lynch LA, Wang SS. 2014. Fast calcium sensor proteins for monitoring neural activity. Neurophotonics 1(2):025008.

Baker KD, Edwards TM, Rickard NS. 2013. The role of intracellular calcium stores in synaptic plasticity and memory consolidation. Neurosci Biobehav Rev 37(7):1211-1239.

Bandyopadhyay J, Lee J, Lee J, Lee JI, Yu JR, Jee C, Cho JH, Jung S, Lee MH, Zannoni S, Singson A, Kim DH, Koo HS, Ahnn J. 2002. Calcineurin, a calcium/calmodulin-dependent protein phosphatase, is involved in movement, fertility, egg laying, and growth in Caenorhabditis elegans. Mol Biol Cell 13(9):3281-3293.

Bargmann CI. 2006. Chemosensation in C. elegans. WormBook:1-29.

Barnett L, Platisa J, Popovic M, Pieribone VA, Hughes T. 2012. A fluorescent, genetically-encoded voltage probe capable of resolving action potentials. PLoS One 7(9):e43454.

155

Bastiani C, Mendel J. 2006. Heterotrimeric G proteins in C. elegans. WormBook:1-25.

Baylis HA, Furuichi T, Yoshikawa F, Mikoshiba K, Sattelle DB. 1999. Inositol 1,4,5- trisphosphate receptors are strongly expressed in the nervous system, pharynx, intestine, gonad and excretory cell of Caenorhabditis elegans and are encoded by a single gene (itr-1). J Mol Biol 294(2):467-476.

Beets I, Janssen T, Meelkop E, Temmerman L, Suetens N, Rademakers S, Jansen G, Schoofs L. 2012. Vasopressin/oxytocin-related signaling regulates gustatory associative learning in C. elegans. Science 338(6106):543-545.

Berg KA, Cropper JD, Niswender CM, Sanders-Bush E, Emeson RB, Clarke WP. 2001. RNA-editing of the 5-HT(2C) receptor alters agonist-receptor-effector coupling specificity. Br J Pharmacol 134(2):386-392.

Bettinger JC, McIntire SL. 2004. State-dependency in C. elegans. Genes Brain Behav 3(5):266-272.

Bhatla N. 2009. C. elegans Neural Network. Wormatlas.org: Wormatlas.

Birkner A, Tischbirek CH, Konnerth A. 2017. Improved deep two-photon calcium imaging in vivo. Cell Calcium 64:29-35.

Blaich A, Pahlavan S, Tian Q, Oberhofer M, Poomvanicha M, Lenhardt P, Domes K, Wegener JW, Moosmang S, Ruppenthal S, Scholz A, Lipp P, Hofmann F. 2012. Mutation of the calmodulin binding motif IQ of the L-type Ca(v)1.2 Ca2+ channel to EQ induces dilated cardiomyopathy and death. J Biol Chem 287(27):22616-22625.

Bohm C, Pangalos M, Schmitz D, Winterer J. 2015. Serotonin Attenuates Feedback Excitation onto O-LM Interneurons. Cereb Cortex 25(11):4572-4583.

Bombardi C, Di Giovanni G. 2013. Functional anatomy of 5-HT2A receptors in the amygdala and hippocampal complex: relevance to memory functions. Exp Brain Res 230(4):427-439.

Bonaventure P, Hall H, Gommeren W, Cras P, Langlois X, Jurzak M, Leysen JE. 2000. Mapping of serotonin 5-HT(4) receptor mRNA and ligand binding sites in the post-mortem human brain. Synapse 36(1):35-46.

156

Bonci A, Hopf FW. 2005. The dopamine D2 receptor: new surprises from an old friend. Neuron 47(3):335-338.

Boschert U, Amara DA, Segu L, Hen R. 1994. The mouse 5-hydroxytryptamine1B receptor is localized predominantly on axon terminals. Neuroscience 58(1):167- 182.

Boyd KN, Mailman RB. 2012. Dopamine receptor signaling and current and future antipsychotic drugs. Handb Exp Pharmacol(212):53-86.

Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77(1):71-94.

Brill J, Shao Z, Puche AC, Wachowiak M, Shipley MT. 2016. Serotonin increases synaptic activity in olfactory bulb glomeruli. J Neurophysiol 115(3):1208-1219.

Brockie PJ, Maricq AV. 2006. Ionotropic glutamate receptors: genetics, behavior and electrophysiology. WormBook:1-16.

Broussard GJ, Liang R, Tian L. 2014. Monitoring activity in neural circuits with genetically encoded indicators. Front Mol Neurosci 7:97.

Bunin MA, Wightman RM. 1998. Quantitative evaluation of 5-hydroxytryptamine (serotonin) neuronal release and uptake: an investigation of extrasynaptic transmission. J Neurosci 18(13):4854-4860.

Busch KE, Laurent P, Soltesz Z, Murphy RJ, Faivre O, Hedwig B, Thomas M, Smith HL, de Bono M. 2012. Tonic signaling from O(2) sensors sets neural circuit activity and behavioral state. Nat Neurosci 15(4):581-591.

Carre-Pierrat M, Baillie D, Johnsen R, Hyde R, Hart A, Granger L, Segalat L. 2006. Characterization of the Caenorhabditis elegans G protein-coupled serotonin receptors. Invert Neurosci 6(4):189-205.

Chagraoui A, Thibaut F, Skiba M, Thuillez C, Bourin M. 2016. 5-HT2C receptors in psychiatric disorders: A review. Prog Neuropsychopharmacol Biol Psychiatry 66:120-135.

157

Chalasani SH, Kato S, Albrecht DR, Nakagawa T, Abbott LF, Bargmann CI. 2010. Neuropeptide feedback modifies odor-evoked dynamics in Caenorhabditis elegans olfactory neurons. Nat Neurosci 13(5):615-621.

Chan J, Ni Y, Zhang P, Zhang J, Chen Y. 2017. D1-like dopamine receptor dysfunction in the lateral habenula nucleus increased anxiety-like behavior in rat. Neuroscience 340:542-550.

Chang AJ, Chronis N, Karow DS, Marletta MA, Bargmann CI. 2006. A distributed chemosensory circuit for oxygen preference in C. elegans. PLoS Biol 4(9):e274.

Chao MY, Komatsu H, Fukuto HS, Dionne HM, Hart AC. 2004. Feeding status and serotonin rapidly and reversibly modulate a Caenorhabditis elegans chemosensory circuit. Proc Natl Acad Sci U S A 101(43):15512-15517.

Chase DL, Koelle MR. 2007. Biogenic amine neurotransmitters in C. elegans. WormBook:1-15.

Chase DL, Pepper JS, Koelle MR. 2004. Mechanism of extrasynaptic dopamine signaling in Caenorhabditis elegans. Nat Neurosci 7(10):1096-1103.

Chen B, Ge Q, Xia XM, Liu P, Wang SJ, Zhan H, Eipper BA, Wang ZW. 2010. A novel auxiliary subunit critical to BK channel function in Caenorhabditis elegans. J Neurosci 30(49):16651-16661.

Chen B, Liu P, Zhan H, Wang ZW. 2011. Dystrobrevin controls neurotransmitter release and muscle Ca(2+) transients by localizing BK channels in Caenorhabditis elegans. J Neurosci 31(48):17338-17347.

Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M. 2017. IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses. Nature 542(7639):43-48.

Chen TW, Wardill TJ, Sun Y, Pulver SR, Renninger SL, Baohan A, Schreiter ER, Kerr RA, Orger MB, Jayaraman V, Looger LL, Svoboda K, Kim DS. 2013. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499(7458):295-300.

158

Cheung BH, Cohen M, Rogers C, Albayram O, de Bono M. 2005. Experience-dependent modulation of C. elegans behavior by ambient oxygen. Curr Biol 15(10):905-917.

Chiappe ME, Seelig JD, Reiser MB, Jayaraman V. 2010. Walking modulates speed sensitivity in Drosophila motion vision. Curr Biol 20(16):1470-1475.

Chiechio S. 2016. Modulation of Chronic Pain by Metabotropic Glutamate Receptors. Adv Pharmacol 75:63-89.

Chung SH, Sun L, Gabel CV. 2013. In vivo neuronal calcium imaging in C. elegans. J Vis Exp(74).

Ciranna L. 2006. Serotonin as a modulator of glutamate- and GABA-mediated neurotransmission: implications in physiological functions and in pathology. Curr Neuropharmacol 4(2):101-114.

Coates JC, de Bono M. 2002. Antagonistic pathways in neurons exposed to body fluid regulate social feeding in Caenorhabditis elegans. Nature 419(6910):925-929.

Colbert HA, Bargmann CI. 1995. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14(4):803-812.

Colbert HA, Smith TL, Bargmann CI. 1997. OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J Neurosci 17(21):8259-8269.

Contet C, Goulding SP, Kuljis DA, Barth AL. 2016. BK Channels in the Central Nervous System. Int Rev Neurobiol 128:281-342.

Cox DA, Cohen ML. 1995. 5-Hydroxytryptamine2B receptor signaling in rat stomach fundus: role of voltage-dependent calcium channels, intracellular calcium release and protein kinase C. J Pharmacol Exp Ther 272(1):143-150.

Davies AG, Bettinger JC, Thiele TR, Judy ME, McIntire SL. 2004. Natural variation in the npr-1 gene modifies ethanol responses of wild strains of C. elegans. Neuron 42(5):731-743.

159

Davis RE, Stretton AO. 1989. Passive membrane properties of motorneurons and their role in long-distance signaling in the nematode Ascaris. J Neurosci 9(2):403-414.

Dawson LA, Nguyen HQ, Li P. 2001. The 5-HT(6) receptor antagonist SB-271046 selectively enhances excitatory neurotransmission in the rat frontal cortex and hippocampus. Neuropsychopharmacology 25(5):662-668.

Day M, Olson PA, Platzer J, Striessnig J, Surmeier DJ. 2002. Stimulation of 5-HT(2) receptors in prefrontal pyramidal neurons inhibits Ca(v)1.2 L type Ca(2+) currents via a PLCbeta/IP3/calcineurin signaling cascade. J Neurophysiol 87(5):2490-2504.

Dean B. 2003. The cortical serotonin2A receptor and the pathology of schizophrenia: a likely accomplice. J Neurochem 85(1):1-13.

Del Bene F, Wyart C, Robles E, Tran A, Looger L, Scott EK, Isacoff EY, Baier H. 2010. Filtering of visual information in the tectum by an identified neural circuit. Science 330(6004):669-673.

Devroye C, Cathala A, Haddjeri N, Rovera R, Vallee M, Drago F, Piazza PV, Spampinato U. 2016. Differential control of dopamine ascending pathways by serotonin2B receptor antagonists: New opportunities for the treatment of schizophrenia. Neuropharmacology 109:59-68.

Devroye C, Cathala A, Piazza PV, Spampinato U. 2017. The central serotonin2B receptor as a new pharmacological target for the treatment of dopamine-related neuropsychiatric disorders: Rationale and current status of research. Pharmacol Ther.

Di Giovanni G, Di Matteo V, Di Mascio M, Esposito E. 2000. Preferential modulation of mesolimbic vs. nigrostriatal dopaminergic function by serotonin(2C/2B) receptor agonists: a combined in vivo electrophysiological and microdialysis study. Synapse 35(1):53-61.

Di Giovanni G, Di Matteo V, Pierucci M, Benigno A, Esposito E. 2006. Central serotonin2C receptor: from physiology to pathology. Curr Top Med Chem 6(18):1909-1925.

Di Matteo V, Di Mascio M, Di Giovanni G, Esposito E. 2000. Acute administration of amitriptyline and mianserin increases dopamine release in the rat nucleus

160

accumbens: possible involvement of serotonin2C receptors. Psychopharmacology (Berl) 150(1):45-51.

Diaz-Mataix L, Artigas F, Celada P. 2006. Activation of pyramidal cells in rat medial prefrontal cortex projecting to ventral tegmental area by a 5-HT1A receptor agonist. Eur Neuropsychopharmacol 16(4):288-296.

Diaz-Mataix L, Scorza MC, Bortolozzi A, Toth M, Celada P, Artigas F. 2005. Involvement of 5-HT1A receptors in prefrontal cortex in the modulation of dopaminergic activity: role in atypical antipsychotic action. J Neurosci 25(47):10831-10843.

Diaz SL, Doly S, Narboux-Neme N, Fernandez S, Mazot P, Banas SM, Boutourlinsky K, Moutkine I, Belmer A, Roumier A, Maroteaux L. 2012. 5-HT(2B) receptors are required for serotonin-selective antidepressant actions. Mol Psychiatry 17(2):154- 163.

Dolen G, Darvishzadeh A, Huang KW, Malenka RC. 2013. Social reward requires coordinated activity of nucleus accumbens oxytocin and serotonin. Nature 501(7466):179-184.

Dombeck DA, Harvey CD, Tian L, Looger LL, Tank DW. 2010. Functional imaging of hippocampal place cells at cellular resolution during virtual navigation. Nat Neurosci 13(11):1433-1440.

Donohoe DR, Jarvis RA, Weeks K, Aamodt EJ, Dwyer DS. 2009. Behavioral adaptation in C. elegans produced by antipsychotic drugs requires serotonin and is associated with calcium signaling and calcineurin inhibition. Neurosci Res 64(3):280-289.

Duerr JS, Frisby DL, Gaskin J, Duke A, Asermely K, Huddleston D, Eiden LE, Rand JB. 1999. The cat-1 gene of Caenorhabditis elegans encodes a vesicular monoamine transporter required for specific monoamine-dependent behaviors. J Neurosci 19(1):72-84.

East SZ, Burnet PW, Kerwin RW, Harrison PJ. 2002. An RT-PCR study of 5-HT(6) and 5-HT(7) receptor mRNAs in the hippocampal formation and prefrontal cortex in schizophrenia. Schizophr Res 57(1):15-26.

Eggers AE. 2013. A serotonin hypothesis of schizophrenia. Med Hypotheses 80(6):791- 794.

161

Espay AJ, LeWitt PA, Kaufmann H. 2014. Norepinephrine deficiency in Parkinson's disease: the case for noradrenergic enhancement. Mov Disord 29(14):1710-1719.

Esposito G, Di Schiavi E, Bergamasco C, Bazzicalupo P. 2007. Efficient and cell specific knock-down of gene function in targeted C. elegans neurons. Gene 395(1-2):170- 176.

Ezak MJ, Ferkey DM. 2010. The C. elegans D2-like dopamine receptor DOP-3 decreases behavioral sensitivity to the olfactory stimulus 1-octanol. PLoS One 5(3):e9487.

Ezcurra M, Tanizawa Y, Swoboda P, Schafer WR. 2011. Food sensitizes C. elegans avoidance behaviours through acute dopamine signalling. EMBO J 30(6):1110- 1122.

Ezcurra M, Walker DS, Beets I, Swoboda P, Schafer WR. 2016. Neuropeptidergic Signaling and Active Feeding State Inhibit Nociception in Caenorhabditis elegans. J Neurosci 36(11):3157-3169.

Ferkey DM, Hyde R, Haspel G, Dionne HM, Hess HA, Suzuki H, Schafer WR, Koelle MR, Hart AC. 2007. C. elegans G protein regulator RGS-3 controls sensitivity to sensory stimuli. Neuron 53(1):39-52.

Ferrero H, Solas M, Francis PT, Ramirez MJ. 2017. Serotonin 5-HT6 Receptor Antagonists in Alzheimer's Disease: Therapeutic Rationale and Current Development Status. CNS Drugs 31(1):19-32.

Fettiplace R. 1987. Electrical tuning of hair cells in the inner ear. Trends in Neuroscience 10(10):421-425.

Fitzgerald PJ. 2014. Is elevated norepinephrine an etiological factor in some cases of Parkinson's disease? Med Hypotheses 82(4):462-469.

Friedland AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. 2013. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods 10(8):741-743.

Fujiwara M, Ishihara T, Katsura I. 1999. A novel WD40 protein, CHE-2, acts cell- autonomously in the formation of C. elegans sensory cilia. Development 126(21):4839-4848.

162

Garrison JL, Macosko EZ, Bernstein S, Pokala N, Albrecht DR, Bargmann CI. 2012. Oxytocin/vasopressin-related peptides have an ancient role in reproductive behavior. Science 338(6106):540-543.

Ghosh DD, Sanders T, Hong S, McCurdy LY, Chase DL, Cohen N, Koelle MR, Nitabach MN. 2016. Neural Architecture of Hunger-Dependent Multisensory Decision Making in C. elegans. Neuron 92(5):1049-1062.

Gieseler K, Abdel-Dayem M, Segalat L. 1999a. In vitro interactions of Caenorhabditis elegans dystrophin with dystrobrevin and syntrophin. FEBS Lett 461(1-2):59-62.

Gieseler K, Bessou C, Segalat L. 1999b. Dystrobrevin- and dystrophin-like mutants display similar phenotypes in the nematode Caenorhabditis elegans. Neurogenetics 2(2):87-90.

Gobel W, Helmchen F. 2007. In vivo calcium imaging of neural network function. Physiology (Bethesda) 22:358-365.

Gong Y, Wagner MJ, Zhong Li J, Schnitzer MJ. 2014. Imaging neural spiking in brain tissue using FRET-opsin protein voltage sensors. Nat Commun 5:3674.

Gonzalez R, Chavez-Pascacio K, Meneses A. 2013. Role of 5-HT5A receptors in the consolidation of memory. Behav Brain Res 252:246-251.

Goodman MB. 2006. Mechanosensation. WormBook:1-14.

Goodman MB, Hall DH, Avery L, Lockery SR. 1998. Active currents regulate sensitivity and dynamic range in C. elegans neurons. Neuron 20(4):763-772.

Goodman MB, Lockery SR. 2000. Pressure polishing: a method for re-shaping patch pipettes during fire polishing. J Neurosci Methods 100(1-2):13-15.

Gorman AL, Hermann A, Thomas MV. 1982. Ionic requirements for membrane oscillations and their dependence on the calcium concentration in a molluscan pace-maker neurone. J Physiol 327:185-217.

Gourgou E, Chronis N. 2016. Chemically induced oxidative stress affects ASH neuronal function and behavior in C. elegans. Sci Rep 6:38147.

163

Guo M, Wu TH, Song YX, Ge MH, Su CM, Niu WP, Li LL, Xu ZJ, Ge CL, Al-Mhanawi MT, Wu SP, Wu ZX. 2015. Reciprocal inhibition between sensory ASH and ASI neurons modulates nociception and avoidance in Caenorhabditis elegans. Nat Commun 6:5655.

Gupta D, Prabhakar V, Radhakrishnan M. 2016. 5HT3 receptors: Target for new antidepressant drugs. Neurosci Biobehav Rev 64:311-325.

Gurevich I, Tamir H, Arango V, Dwork AJ, Mann JJ, Schmauss C. 2002. Altered editing of serotonin 2C receptor pre-mRNA in the prefrontal cortex of depressed suicide victims. Neuron 34(3):349-356.

Guseva D, Wirth A, Ponimaskin E. 2014. Cellular mechanisms of the 5-HT7 receptor- mediated signaling. Front Behav Neurosci 8:306.

Gutierrez GJ, Marder E. 2014. Modulation of a Single Neuron Has State-Dependent Actions on Circuit Dynamics. eNeuro 1(1).

Haahr ME, Fisher PM, Jensen CG, Frokjaer VG, Mahon BM, Madsen K, Baare WF, Lehel S, Norremolle A, Rabiner EA, Knudsen GM. 2014. Central 5-HT4 receptor binding as biomarker of serotonergic tonus in humans: a [11C]SB207145 PET study. Mol Psychiatry 19(4):427-432.

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R. 2013. Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans. J Neurosci 33(35):14107-14116.

Harris-Warrick RM, Johnson BR. 2010. Checks and balances in neuromodulation. Front Behav Neurosci 4.

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R. 2011. Dissecting the serotonergic food signal stimulating sensory- mediated aversive behavior in C. elegans. PLoS One 6(7):e21897.

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW. 2010. The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission. J Neurosci 30(23):7889-7899.

164

Harris GP, Hapiak VM, Wragg RT, Miller SB, Hughes LJ, Hobson RJ, Steven R, Bamber B, Komuniecki RW. 2009. Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans. J Neurosci 29(5):1446-1456.

Hedlund PB, Sutcliffe JG. 2004. Functional, molecular and pharmacological advances in 5-HT7 receptor research. Trends Pharmacol Sci 25(9):481-486.

Heim R, Prasher DC, Tsien RY. 1994. Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci U S A 91(26):12501-12504.

Helmchen F, Waters J. 2002. Ca2+ imaging in the mammalian brain in vivo. Eur J Pharmacol 447(2-3):119-129.

Hernandez-Lopez S, Tkatch T, Perez-Garci E, Galarraga E, Bargas J, Hamm H, Surmeier DJ. 2000. D2 dopamine receptors in striatal medium spiny neurons reduce L-type Ca2+ currents and excitability via a novel PLC[beta]1-IP3-calcineurin-signaling cascade. J Neurosci 20(24):8987-8995.

Herrick-Davis K, Grinde E, Lindsley T, Teitler M, Mancia F, Cowan A, Mazurkiewicz JE. 2015. Native serotonin 5-HT2C receptors are expressed as homodimers on the apical surface of choroid plexus epithelial cells. Mol Pharmacol 87(4):660-673.

Hilliard MA, Apicella AJ, Kerr R, Suzuki H, Bazzicalupo P, Schafer WR. 2005. In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents. EMBO J 24(1):63-72.

Hilliard MA, Bargmann CI, Bazzicalupo P. 2002. C. elegans responds to chemical repellents by integrating sensory inputs from the head and the tail. Curr Biol 12(9):730-734.

Hills T, Brockie PJ, Maricq AV. 2004. Dopamine and glutamate control area-restricted search behavior in Caenorhabditis elegans. J Neurosci 24(5):1217-1225.

Hobert O. 2010. Neurogenesis in the nematode Caenorhabditis elegans. WormBook:1-24.

165

Hogan QH. 2007. Role of decreased sensory neuron membrane calcium currents in the genesis of neuropathic pain. Croat Med J 48(1):9-21.

Holden-Dye L, Walker RJ. 2013. The roles of neuropeptides in Caenorhabditis elegans including their importance in the regulation of feeding and metabolism. Protein Pept Lett 20(6):636-646.

Horvitz HR, Chalfie M, Trent C, Sulston JE, Evans PD. 1982. Serotonin and octopamine in the nematode Caenorhabditis elegans. Science 216(4549):1012-1014.

Hoyer D, Hannon JP, Martin GR. 2002. Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacol Biochem Behav 71(4):533-554.

Hudspeth AJ, Gillespie PG. 1994. Pulling springs to tune transduction: adaptation by hair cells. Neuron 12(1):1-9.

Hurley PT, McMahon RA, Fanning P, O'Boyle KM, Rogers M, Martin F. 1998. Functional coupling of a recombinant human 5-HT5A receptor to G-proteins in HEK-293 cells. Br J Pharmacol 124(6):1238-1244.

Huttunen M. 1995. The evolution of the serotonin-dopamine antagonist concept. J Clin Psychopharmacol 15(1 Suppl 1):4S-10S.

Inagaki S, Nagai T. 2016. Current progress in genetically encoded voltage indicators for neural activity recording. Curr Opin Chem Biol 33:95-100.

Issa NP, Hudspeth AJ. 1994. Clustering of Ca2+ channels and Ca(2+)-activated K+ channels at fluorescently labeled presynaptic active zones of hair cells. Proc Natl Acad Sci U S A 91(16):7578-7582.

Iwabuchi S, Koh JY, Wang K, Ho KW, Harata NC. 2013. Minimal Change in the cytoplasmic calcium dynamics in striatal GABAergic neurons of a DYT1 dystonia knock-in mouse model. PLoS One 8(11):e80793.

Jacobs BL, Azmitia EC. 1992. Structure and function of the brain serotonin system. Physiol Rev 72(1):165-229.

166

Jang H, Kim K, Neal SJ, Macosko E, Kim D, Butcher RA, Zeiger DM, Bargmann CI, Sengupta P. 2012. Neuromodulatory state and sex specify alternative behaviors through antagonistic synaptic pathways in C. elegans. Neuron 75(4):585-592.

Johnson KA, Lovinger DM. 2016. Presynaptic G Protein-Coupled Receptors: Gatekeepers of Addiction? Front Cell Neurosci 10:264.

Johnson ZV, Young LJ. 2017. Oxytocin and vasopressin neural networks: Implications for social behavioral diversity and translational neuroscience. Neurosci Biobehav Rev 76(Pt A):87-98.

Jorgensen EM. 2005. Gaba. WormBook:1-13.

Karila D, Freret T, Bouet V, Boulouard M, Dallemagne P, Rochais C. 2015. Therapeutic Potential of 5-HT6 Receptor Agonists. J Med Chem 58(20):7901-7912.

Kato S, Kaplan HS, Schrodel T, Skora S, Lindsay TH, Yemini E, Lockery S, Zimmer M. 2015. Global brain dynamics embed the motor command sequence of Caenorhabditis elegans. Cell 163(3):656-669.

Kato S, Xu Y, Cho CE, Abbott LF, Bargmann CI. 2014. Temporal responses of C. elegans chemosensory neurons are preserved in behavioral dynamics. Neuron 81(3):616-628.

Kaufman J, DeLorenzo C, Choudhury S, Parsey RV. 2016. The 5-HT1A receptor in Major Depressive Disorder. Eur Neuropsychopharmacol 26(3):397-410.

Kawashima T. 2017. The role of the serotonergic system in motor control. Neurosci Res.

Keating CD, Kriek N, Daniels M, Ashcroft NR, Hopper NA, Siney EJ, Holden-Dye L, Burke JF. 2003. Whole-genome analysis of 60 G protein-coupled receptors in Caenorhabditis elegans by gene knockout with RNAi. Curr Biol 13(19):1715- 1720.

Kerr RA, Schafer WR. 2006. Intracellular Ca2+ imaging in C. elegans. Methods Mol Biol 351:253-264.

167

Kim H, Oh KH. 2016. Protein Network Interacting with BK Channels. Int Rev Neurobiol 128:127-161.

Kim H, Pierce-Shimomura JT, Oh HJ, Johnson BE, Goodman MB, McIntire SL. 2009. The dystrophin complex controls bk channel localization and muscle activity in Caenorhabditis elegans. PLoS Genet 5(12):e1000780.

Kim YK, Won E. 2017. The influence of stress on neuroinflammation and alterations in brain structure and function in major depressive disorder. Behav Brain Res 329:6- 11.

Koelle MR. 2016. Neurotransmitter signaling through heterotrimeric G proteins: insights from studies in C. elegans. WormBook:1-78.

Kowski AB, Veh RW, Weiss T. 2009. Dopaminergic activation excites rat lateral habenular neurons in vivo. Neuroscience 161(4):1154-1165.

Krzyzanowski MC, Woldemariam S, Wood JF, Chaubey AH, Brueggemann C, Bowitch A, Bethke M, L'Etoile ND, Ferkey DM. 2016. Aversive Behavior in the Nematode C. elegans Is Modulated by cGMP and a Neuronal Gap Junction Network. PLoS Genet 12(7):e1006153.

Kulkarni RU, Miller EW. 2017. Voltage Imaging: Pitfalls and Potential. Biochemistry 56(39):5171-5177.

Kwok TC, Hui K, Kostelecki W, Ricker N, Selman G, Feng ZP, Roy PJ. 2008. A genetic screen for dihydropyridine (DHP)-resistant worms reveals new residues required for DHP-blockage of mammalian calcium channels. PLoS Genet 4(5):e1000067.

Kwok TC, Ricker N, Fraser R, Chan AW, Burns A, Stanley EF, McCourt P, Cutler SR, Roy PJ. 2006. A small-molecule screen in C. elegans yields a new calcium channel antagonist. Nature 441(7089):91-95.

Laine V, Frokjaer-Jensen C, Couchoux H, Jospin M. 2011. The alpha1 subunit EGL-19, the alpha2/delta subunit UNC-36, and the beta subunit CCB-1 underlie voltage- dependent calcium currents in Caenorhabditis elegans striated muscle. J Biol Chem 286(42):36180-36187.

168

Launay JM, Schneider B, Loric S, Da Prada M, Kellermann O. 2006. Serotonin transport and serotonin transporter-mediated antidepressant recognition are controlled by 5- HT2B receptor signaling in serotonergic neuronal cells. FASEB J 20(11):1843- 1854.

Leao RN, Mikulovic S, Leao KE, Munguba H, Gezelius H, Enjin A, Patra K, Eriksson A, Loew LM, Tort AB, Kullander K. 2012. OLM interneurons differentially modulate CA3 and entorhinal inputs to hippocampal CA1 neurons. Nat Neurosci 15(11):1524-1530.

Lee RY, Lobel L, Hengartner M, Horvitz HR, Avery L. 1997. Mutations in the alpha1 subunit of an L-type voltage-activated Ca2+ channel cause myotonia in Caenorhabditis elegans. EMBO J 16(20):6066-6076.

Lee RY, Sawin ER, Chalfie M, Horvitz HR, Avery L. 1999. EAT-4, a homolog of a mammalian sodium-dependent inorganic phosphate cotransporter, is necessary for glutamatergic neurotransmission in caenorhabditis elegans. J Neurosci 19(1):159- 167.

Lee Y, Kim H, Kim JE, Park JY, Choi J, Lee JE, Lee EH, Han PL. 2017. Excessive D1 Dopamine Receptor Activation in the Dorsal Striatum Promotes Autistic-Like Behaviors. Mol Neurobiol.

Lemon WC, Pulver SR, Hockendorf B, McDole K, Branson K, Freeman J, Keller PJ. 2015. Whole-central nervous system functional imaging in larval Drosophila. Nat Commun 6:7924.

Lewis RS, Hudspeth AJ. 1983. Voltage- and ion-dependent conductances in solitary vertebrate hair cells. Nature 304(5926):538-541.

Li QH, Nakadate K, Tanaka-Nakadate S, Nakatsuka D, Cui Y, Watanabe Y. 2004. Unique expression patterns of 5-HT2A and 5-HT2C receptors in the rat brain during postnatal development: Western blot and immunohistochemical analyses. J Comp Neurol 469(1):128-140.

Lin MZ, Schnitzer MJ. 2016. Genetically encoded indicators of neuronal activity. Nat Neurosci 19(9):1142-1153.

169

Lindsay TH, Thiele TR, Lockery SR. 2011. Optogenetic analysis of synaptic transmission in the central nervous system of the nematode Caenorhabditis elegans. Nat Commun 2:306.

Linster C, Fontanini A. 2014. Functional neuromodulation of chemosensation in vertebrates. Curr Opin Neurobiol 29:82-87.

Lo CC, Chiang AS. 2016. Toward Whole-Body Connectomics. J Neurosci 36(45):11375- 11383.

Loyd DR, Henry MA, Hargreaves KM. 2013. Serotonergic neuromodulation of peripheral nociceptors. Semin Cell Dev Biol 24(1):51-57.

Luo J, Xu Z, Tan Z, Zhang Z, Ma L. 2015. Neuropeptide receptors NPR-1 and NPR-2 regulate Caenorhabditis elegans avoidance response to the plant stress hormone methyl salicylate. Genetics 199(2):523-531.

Lutcke H, Murayama M, Hahn T, Margolis DJ, Astori S, Zum Alten Borgloh SM, Gobel W, Yang Y, Tang W, Kugler S, Sprengel R, Nagai T, Miyawaki A, Larkum ME, Helmchen F, Hasan MT. 2010. Optical recording of neuronal activity with a genetically-encoded calcium indicator in anesthetized and freely moving mice. Front Neural Circuits 4:9.

Macosko EZ, Pokala N, Feinberg EH, Chalasani SH, Butcher RA, Clardy J, Bargmann CI. 2009. A hub-and-spoke circuit drives pheromone attraction and social behaviour in C. elegans. Nature 458(7242):1171-1175.

Madsen K, Torstensen E, Holst KK, Haahr ME, Knorr U, Frokjaer VG, Brandt-Larsen M, Iversen P, Fisher PM, Knudsen GM. 2014. Familial risk for major depression is associated with lower striatal 5-HT(4) receptor binding. Int J Neuropsychopharmacol 18(1).

Mank M, Griesbeck O. 2008. Genetically encoded calcium indicators. Chem Rev 108(5):1550-1564.

Mank M, Reiff DF, Heim N, Friedrich MW, Borst A, Griesbeck O. 2006. A FRET-based calcium biosensor with fast signal kinetics and high fluorescence change. Biophys J 90(5):1790-1796.

170

Marder E. 2012. Neuromodulation of neuronal circuits: back to the future. Neuron 76(1):1-11.

Maryon EB, Coronado R, Anderson P. 1996. unc-68 encodes a ryanodine receptor involved in regulating C. elegans body-wall muscle contraction. J Cell Biol 134(4):885-893.

Mathis V, Cosquer B, Avallone M, Cassel JC, Lecourtier L. 2015. Excitatory Transmission to the Lateral Habenula Is Critical for Encoding and Retrieval of Spatial Memory. Neuropsychopharmacology 40(12):2843-2851.

McCorvy JD, Roth BL. 2015. Structure and function of serotonin G protein-coupled receptors. Pharmacol Ther 150:129-142.

McCreary AC, Newman-Tancredi A. 2015. Serotonin 5-HT1A Receptors and Antipsychotics - An Update in Light of New Concepts and Drugs. Curr Pharm Des 21(26):3725-3731.

Mellem JE, Brockie PJ, Zheng Y, Madsen DM, Maricq AV. 2002. Decoding of polymodal sensory stimuli by postsynaptic glutamate receptors in C. elegans. Neuron 36(5):933-944.

Miller EW. 2016. Small molecule fluorescent voltage indicators for studying membrane potential. Curr Opin Chem Biol 33:74-80.

Miller KG, Emerson MD, Rand JB. 1999. Goalpha and diacylglycerol kinase negatively regulate the Gqalpha pathway in C. elegans. Neuron 24(2):323-333.

Mills H, Ortega A, Law W, Hapiak V, Summers P, Clark T, Komuniecki R. 2016. Opiates Modulate Noxious Chemical Nociception through a Complex Monoaminergic/Peptidergic Cascade. J Neurosci 36(20):5498-5508.

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R. 2012. Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans. EMBO J 31(3):667-678.

171

Milward K, Busch KE, Murphy RJ, de Bono M, Olofsson B. 2011. Neuronal and molecular substrates for optimal foraging in Caenorhabditis elegans. Proc Natl Acad Sci U S A 108(51):20672-20677.

Miner LA, Backstrom JR, Sanders-Bush E, Sesack SR. 2003. Ultrastructural localization of serotonin2A receptors in the middle layers of the rat prelimbic prefrontal cortex. Neuroscience 116(1):107-117.

Mishin AS, Subach FV, Yampolsky IV, King W, Lukyanov KA, Verkhusha VV. 2008. The first mutant of the Aequorea victoria green fluorescent protein that forms a red chromophore. Biochemistry 47(16):4666-4673.

Miyawaki A, Llopis J, Heim R, McCaffery JM, Adams JA, Ikura M, Tsien RY. 1997. Fluorescent indicators for Ca2+ based on green fluorescent proteins and calmodulin. Nature 388(6645):882-887.

Mocci G, Jimenez-Sanchez L, Adell A, Cortes R, Artigas F. 2014. Expression of 5-HT2A receptors in prefrontal cortex pyramidal neurons projecting to nucleus accumbens. Potential relevance for atypical antipsychotic action. Neuropharmacology 79:49- 58.

Money KM, Stanwood GD. 2013. Developmental origins of brain disorders: roles for dopamine. Front Cell Neurosci 7:260.

Montanez S, Munn JL, Owens WA, Horton RE, Daws LC. 2014. 5-HT1B receptor modulation of the serotonin transporter in vivo: studies using KO mice. Neurochem Int 73:127-131.

Muto A, Ohkura M, Abe G, Nakai J, Kawakami K. 2013. Real-time visualization of neuronal activity during perception. Curr Biol 23(4):307-311.

Mutoh H, Akemann W, Knopfel T. 2012. Genetically engineered fluorescent voltage reporters. ACS Chem Neurosci 3(8):585-592.

Nadim F, Bucher D. 2014. Neuromodulation of neurons and synapses. Curr Opin Neurobiol 29:48-56.

Nakai J, Ohkura M, Imoto K. 2001. A high signal-to-noise Ca(2+) probe composed of a single green fluorescent protein. Nat Biotechnol 19(2):137-141.

172

Nathoo AN, Moeller RA, Westlund BA, Hart AC. 2001. Identification of neuropeptide- like protein gene families in Caenorhabditiselegans and other species. Proc Natl Acad Sci U S A 98(24):14000-14005.

Naumann EA, Fitzgerald JE, Dunn TW, Rihel J, Sompolinsky H, Engert F. 2016. From Whole-Brain Data to Functional Circuit Models: The Zebrafish Optomotor Response. Cell 167(4):947-960 e920.

Nautiyal KM, Hen R. 2017. Serotonin receptors in depression: from A to B. F1000Res 6:123.

Nautiyal KM, Tanaka KF, Barr MM, Tritschler L, Le Dantec Y, David DJ, Gardier AM, Blanco C, Hen R, Ahmari SE. 2015. Distinct Circuits Underlie the Effects of 5- HT1B Receptors on Aggression and Impulsivity. Neuron 86(3):813-826.

Nelson DL. 2004. 5-HT5 receptors. Curr Drug Targets CNS Neurol Disord 3(1):53-58.

Niacaris T, Avery L. 2003. Serotonin regulates repolarization of the C. elegans pharyngeal muscle. J Exp Biol 206(Pt 2):223-231.

Niswender CM, Sanders-Bush E, Emeson RB. 1998. Identification and characterization of RNA editing events within the 5-HT2C receptor. Ann N Y Acad Sci 861:38- 48.

Nocjar C, Roth BL, Pehek EA. 2002. Localization of 5-HT(2A) receptors on dopamine cells in subnuclei of the midbrain A10 cell group. Neuroscience 111(1):163-176.

O'Donovan MJ, Ho S, Sholomenko G, Yee W. 1993. Real-time imaging of neurons retrogradely and anterogradely labelled with calcium-sensitive dyes. J Neurosci Methods 46(2):91-106.

Oh HJ, Abraham LS, van Hengel J, Stove C, Proszynski TJ, Gevaert K, DiMario JX, Sanes JR, van Roy F, Kim H. 2012. Interaction of alpha-catulin with dystrobrevin contributes to integrity of dystrophin complex in muscle. J Biol Chem 287(26):21717-21728.

Oh WC, Song HO, Cho JH, Park BJ. 2011. ANK repeat-domain of SHN-1 Is indispensable for in vivo SHN-1 function in C. elegans. Mol Cells 31(1):79-84.

173

Ohkura M, Sasaki T, Sadakari J, Gengyo-Ando K, Kagawa-Nagamura Y, Kobayashi C, Ikegaya Y, Nakai J. 2012. Genetically encoded green fluorescent Ca2+ indicators with improved detectability for neuronal Ca2+ signals. PLoS One 7(12):e51286.

Oliveria SF, Dittmer PJ, Youn DH, Dell'Acqua ML, Sather WA. 2012. Localized calcineurin confers Ca2+-dependent inactivation on neuronal L-type Ca2+ channels. J Neurosci 32(44):15328-15337.

Olson PA, Tkatch T, Hernandez-Lopez S, Ulrich S, Ilijic E, Mugnaini E, Zhang H, Bezprozvanny I, Surmeier DJ. 2005. G-protein-coupled receptor modulation of striatal CaV1.3 L-type Ca2+ channels is dependent on a Shank-binding domain. J Neurosci 25(5):1050-1062.

Owsianik G, Talavera K, Voets T, Nilius B. 2006. Permeation and selectivity of TRP channels. Annu Rev Physiol 68:685-717.

Palacios JM, Pazos A, Hoyer D. 2017. A short history of the 5-HT2C receptor: from the choroid plexus to depression, obesity and addiction treatment. Psychopharmacology (Berl) 234(9-10):1395-1418.

Pan HL, Wu ZZ, Zhou HY, Chen SR, Zhang HM, Li DP. 2008. Modulation of pain transmission by G-protein-coupled receptors. Pharmacol Ther 117(1):141-161.

Pandey P, Harbinder S. 2012. The Caenorhabditis elegans D2-like dopamine receptor DOP-2 physically interacts with GPA-14, a Galphai subunit. J Mol Signal 7(1):3.

Pasqualetti M, Ori M, Nardi I, Castagna M, Cassano GB, Marazziti D. 1998. Distribution of the 5-HT5A serotonin receptor mRNA in the human brain. Brain Res Mol Brain Res 56(1-2):1-8.

Pereda AE, Macagno E. 2017. Electrical transmission: Two structures, same functions? Dev Neurobiol 77(5):517-521.

Piggott BJ, Liu J, Feng Z, Wescott SA, Xu XZ. 2011. The neural circuits and synaptic mechanisms underlying motor initiation in C. elegans. Cell 147(4):922-933.

Pirri JK, McPherson AD, Donnelly JL, Francis MM, Alkema MJ. 2009. A tyramine- gated chloride channel coordinates distinct motor programs of a Caenorhabditis elegans escape response. Neuron 62(4):526-538.

174

Podor B, Hu YL, Ohkura M, Nakai J, Croll R, Fine A. 2015. Comparison of genetically encoded calcium indicators for monitoring action potentials in mammalian brain by two-photon excitation fluorescence microscopy. Neurophotonics 2(2):021014.

Polter AM, Li X. 2010. 5-HT1A receptor-regulated signal transduction pathways in brain. Cell Signal 22(10):1406-1412.

Poort J, Khan AG, Pachitariu M, Nemri A, Orsolic I, Krupic J, Bauza M, Sahani M, Keller GB, Mrsic-Flogel TD, Hofer SB. 2015. Learning Enhances Sensory and Multiple Non-sensory Representations in Primary Visual Cortex. Neuron 86(6):1478-1490.

Purves D, Augustine G, Fitzpatrick D, Hall W, LaMantia A-S, McNamara J, White L. 2008. Neuroscience. Sunderland, Mass.: Sinauer. xvii, 857, G-816, IC-857, I-829 pages p.

Ramchandra R, Barrett CJ. 2015. Regulation of the renal sympathetic nerves in heart failure. Front Physiol 6:238.

Rand JB. 2007. Acetylcholine. WormBook:1-21.

Ransdell JL, Nair SS, Schulz DJ. 2012. Rapid homeostatic plasticity of intrinsic excitability in a central pattern generator network stabilizes functional neural network output. J Neurosci 32(28):9649-9658.

Raymond JR, Mukhin YV, Gelasco A, Turner J, Collinsworth G, Gettys TW, Grewal JS, Garnovskaya MN. 2001. Multiplicity of mechanisms of serotonin receptor signal transduction. Pharmacol Ther 92(2-3):179-212.

Redrobe JP, Bourin M. 1997. Partial role of 5-HT2 and 5-HT3 receptors in the activity of antidepressants in the mouse forced swimming test. Eur J Pharmacol 325(2- 3):129-135.

Reeves DC, Lummis SC. 2002. The molecular basis of the structure and function of the 5-HT3 receptor: a model ligand-gated ion channel (review). Mol Membr Biol 19(1):11-26.

175

Rex E, Hapiak V, Hobson R, Smith K, Xiao H, Komuniecki R. 2005. TYRA-2 (F01E11.5): a Caenorhabditis elegans tyramine receptor expressed in the MC and NSM pharyngeal neurons. J Neurochem 94(1):181-191.

Rex E, Komuniecki RW. 2002. Characterization of a tyramine receptor from Caenorhabditis elegans. J Neurochem 82(6):1352-1359.

Rex E, Molitor SC, Hapiak V, Xiao H, Henderson M, Komuniecki R. 2004. Tyramine receptor (SER-2) isoforms are involved in the regulation of pharyngeal pumping and foraging behavior in Caenorhabditis elegans. J Neurochem 91(5):1104-1115.

Richer M, Hen R, Blier P. 2002. Modification of serotonin neuron properties in mice lacking 5-HT1A receptors. Eur J Pharmacol 435(2-3):195-203.

Ringstad N, Abe N, Horvitz HR. 2009. Ligand-gated chloride channels are receptors for biogenic amines in C. elegans. Science 325(5936):96-100.

Roayaie K, Crump JG, Sagasti A, Bargmann CI. 1998. The G alpha protein ODR-3 mediates olfactory and nociceptive function and controls cilium morphogenesis in C. elegans olfactory neurons. Neuron 20(1):55-67.

Rogers C, Reale V, Kim K, Chatwin H, Li C, Evans P, de Bono M. 2003. Inhibition of Caenorhabditis elegans social feeding by FMRFamide-related peptide activation of NPR-1. Nat Neurosci 6(11):1178-1185.

Ronde P, Nichols RA. 1998. High calcium permeability of serotonin 5-HT3 receptors on presynaptic nerve terminals from rat striatum. J Neurochem 70(3):1094-1103.

Rose JK, Kaun KR, Chen SH, Rankin CH. 2003. GLR-1, a non-NMDA glutamate receptor homolog, is critical for long-term memory in Caenorhabditis elegans. J Neurosci 23(29):9595-9599.

Rose T, Goltstein PM, Portugues R, Griesbeck O. 2014. Putting a finishing touch on GECIs. Front Mol Neurosci 7:88.

Ross WN, Manita S. 2012. Imaging calcium waves and sparks in central neurons. Cold Spring Harb Protoc 2012(10):1087-1091.

176

Russo AF. 2017. Overview of Neuropeptides: Awakening the Senses? Headache 57 Suppl 2:37-46.

Santana N, Bortolozzi A, Serrats J, Mengod G, Artigas F. 2004. Expression of serotonin1A and serotonin2A receptors in pyramidal and GABAergic neurons of the rat prefrontal cortex. Cereb Cortex 14(10):1100-1109.

Sari Y. 2004. Serotonin1B receptors: from protein to physiological function and behavior. Neurosci Biobehav Rev 28(6):565-582.

Sasaki T, Takahashi N, Matsuki N, Ikegaya Y. 2008. Fast and accurate detection of action potentials from somatic calcium fluctuations. J Neurophysiol 100(3):1668- 1676.

Schafer WR. 2015. Mechanosensory molecules and circuits in C. elegans. Pflugers Arch 467(1):39-48.

Schafer WR, Kenyon CJ. 1995. A calcium-channel homologue required for adaptation to dopamine and serotonin in Caenorhabditis elegans. Nature 375(6526):73-78.

Schmidt SL, Chew EY, Bennett DV, Hammad MA, Frohlich F. 2013. Differential effects of cholinergic and noradrenergic neuromodulation on spontaneous cortical network dynamics. Neuropharmacology 72:259-273.

Seamans JK, Yang CR. 2004. The principal features and mechanisms of dopamine modulation in the prefrontal cortex. Prog Neurobiol 74(1):1-58.

Segi-Nishida E. 2017. The Effect of Serotonin-Targeting Antidepressants on Neurogenesis and Neuronal Maturation of the Hippocampus Mediated via 5- HT1A and 5-HT4 Receptors. Front Cell Neurosci 11:142.

Sengupta P. 2013. The belly rules the nose: feeding state-dependent modulation of peripheral chemosensory responses. Curr Opin Neurobiol 23(1):68-75.

Shidara H, Kobayashi J, Tanamoto R, Hotta K, Oka K. 2013. Odorant-induced membrane potential depolarization of AIY interneuron in Caenorhabditis elegans. Neurosci Lett 541:199-203.

177

Shtonda B, Avery L. 2005. CCA-1, EGL-19 and EXP-2 currents shape action potentials in the Caenorhabditis elegans pharynx. J Exp Biol 208(Pt 11):2177-2190.

Siegel MS, Isacoff EY. 1997. A genetically encoded optical probe of membrane voltage. Neuron 19(4):735-741.

Singer WD, Brown HA, Sternweis PC. 1997. Regulation of eukaryotic phosphatidylinositol-specific phospholipase C and phospholipase D. Annu Rev Biochem 66:475-509.

Sodhi MS, Burnet PW, Makoff AJ, Kerwin RW, Harrison PJ. 2001. RNA editing of the 5-HT(2C) receptor is reduced in schizophrenia. Mol Psychiatry 6(4):373-379.

Srinivasan J, Durak O, Sternberg PW. 2008. Evolution of a polymodal sensory response network. BMC Biol 6:52.

Steciuk M, Cheong M, Waite C, You YJ, Avery L. 2014. Regulation of synaptic transmission at the Caenorhabditis elegans M4 neuromuscular junction by an antagonistic relationship between two calcium channels. G3 (Bethesda) 4(12):2535-2543.

Stein C, Zollner C. 2009. Opioids and sensory nerves. Handb Exp Pharmacol(194):495- 518.

Stevens TR, Krueger SR, Fitzsimonds RM, Picciotto MR. 2003. Neuroprotection by nicotine in mouse primary cortical cultures involves activation of calcineurin and L-type calcium channel inactivation. J Neurosci 23(31):10093-10099.

Stoop R. 2014. Neuromodulation by oxytocin and vasopressin in the central nervous system as a basis for their rapid behavioral effects. Curr Opin Neurobiol 29:187- 193.

Storace D, Sepehri Rad M, Kang B, Cohen LB, Hughes T, Baker BJ. 2016. Toward Better Genetically Encoded Sensors of Membrane Potential. Trends Neurosci 39(5):277-289.

Sugiura M, Fuke S, Suo S, Sasagawa N, Van Tol HH, Ishiura S. 2005. Characterization of a novel D2-like dopamine receptor with a truncated splice variant and a D1-

178

like dopamine receptor unique to invertebrates from Caenorhabditis elegans. J Neurochem 94(4):1146-1157.

Summers PJ, Layne RM, Ortega AC, Harris GP, Bamber BA, Komuniecki RW. 2015. Multiple Sensory Inputs Are Extensively Integrated to Modulate Nociception in C. elegans. J Neurosci 35(28):10331-10342.

Suo S, Sasagawa N, Ishiura S. 2003. Cloning and characterization of a Caenorhabditis elegans D2-like dopamine receptor. J Neurochem 86(4):869-878.

Swensen AM, Marder E. 2001. Modulators with convergent cellular actions elicit distinct circuit outputs. J Neurosci 21(11):4050-4058.

Sze JY, Victor M, Loer C, Shi Y, Ruvkun G. 2000. Food and metabolic signalling defects in a Caenorhabditis elegans serotonin-synthesis mutant. Nature 403(6769):560- 564.

Thiele TR, Faumont S, Lockery SR. 2009. The neural network for chemotaxis to tastants in Caenorhabditis elegans is specialized for temporal differentiation. J Neurosci 29(38):11904-11911.

Thomas DR. 2006. 5-ht5A receptors as a therapeutic target. Pharmacol Ther 111(3):707- 714.

Tian L, Hires SA, Mao T, Huber D, Chiappe ME, Chalasani SH, Petreanu L, Akerboom J, McKinney SA, Schreiter ER, Bargmann CI, Jayaraman V, Svoboda K, Looger LL. 2009. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat Methods 6(12):875-881.

Tobin DM, Madsen DM, Kahn-Kirby A, Peckol EL, Moulder G, Barstead R, Maricq AV, Bargmann CI. 2002. Combinatorial expression of TRPV channel proteins defines their sensory functions and subcellular localization in C. elegans neurons. Neuron 35(2):307-318.

Trillat AC, Malagie I, Scearce K, Pons D, Anmella MC, Jacquot C, Hen R, Gardier AM. 1997. Regulation of serotonin release in the frontal cortex and ventral hippocampus of homozygous mice lacking 5-HT1B receptors: in vivo microdialysis studies. J Neurochem 69(5):2019-2025.

179

Truong K, Sawano A, Mizuno H, Hama H, Tong KI, Mal TK, Miyawaki A, Ikura M. 2001. FRET-based in vivo Ca2+ imaging by a new calmodulin-GFP fusion molecule. Nat Struct Biol 8(12):1069-1073.

Tsalik EL, Niacaris T, Wenick AS, Pau K, Avery L, Hobert O. 2003. LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev Biol 263(1):81-102.

Tsien RY. 1981. A non-disruptive technique for loading calcium buffers and indicators into cells. Nature 290(5806):527-528.

Tsien RY. 1989. Fluorescent indicators of ion concentrations. Methods Cell Biol 30:127- 156.

Turner TJ, Mokler DJ, Luebke JI. 2004. Calcium influx through presynaptic 5-HT3 receptors facilitates GABA release in the hippocampus: in vitro slice and synaptosome studies. Neuroscience 129(3):703-718.

Urbain N, Creamer K, Debonnel G. 2006. Electrophysiological diversity of the dorsal raphe cells across the sleep-wake cycle of the rat. J Physiol 573(Pt 3):679-695.

Vandael DH, Marcantoni A, Mahapatra S, Caro A, Ruth P, Zuccotti A, Knipper M, Carbone E. 2010. Ca(v)1.3 and BK channels for timing and regulating cell firing. Mol Neurobiol 42(3):185-198.

Vogelstein JT, Watson BO, Packer AM, Yuste R, Jedynak B, Paninski L. 2009. Spike inference from calcium imaging using sequential Monte Carlo methods. Biophys J 97(2):636-655.

Vogt N. 2015. Voltage sensors: challenging, but with potential. Nat Methods 12(10):921- 924.

Walker DS, Vazquez-Manrique RP, Gower NJ, Gregory E, Schafer WR, Baylis HA. 2009. Inositol 1,4,5-trisphosphate signalling regulates the avoidance response to nose touch in Caenorhabditis elegans. PLoS Genet 5(9):e1000636.

Wang D, Yu Y, Li Y, Wang Y, Wang D. 2014a. Dopamine receptors antagonistically regulate behavioral choice between conflicting alternatives in C. elegans. PLoS One 9(12):e115985.

180

Wang Y, Tandan S, Hill JA. 2014b. Calcineurin-dependent ion channel regulation in heart. Trends Cardiovasc Med 24(1):14-22.

Wang ZW, Saifee O, Nonet ML, Salkoff L. 2001. SLO-1 potassium channels control quantal content of neurotransmitter release at the C. elegans neuromuscular junction. Neuron 32(5):867-881.

Wappl E, Mitterdorfer J, Glossmann H, Striessnig J. 2001. Mechanism of dihydropyridine interaction with critical binding residues of L-type Ca2+ channel alpha 1 subunits. J Biol Chem 276(16):12730-12735.

White JG, Southgate E, Thomson JN, Brenner S. 1986. The structure of the nervous system of the nematode Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 314(1165):1-340.

Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW. 2007. Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors. J Neurosci 27(49):13402-13412.

Xu W, Lipscombe D. 2001. Neuronal Ca(V)1.3alpha(1) L-type channels activate at relatively hyperpolarized membrane potentials and are incompletely inhibited by dihydropyridines. J Neurosci 21(16):5944-5951.

Xu Y, Zou P, Cohen AE. 2017. Voltage imaging with genetically encoded indicators. Curr Opin Chem Biol 39:1-10.

Yamada Y, Michikawa T, Hashimoto M, Horikawa K, Nagai T, Miyawaki A, Hausser M, Mikoshiba K. 2011. Quantitative comparison of genetically encoded Ca indicators in cortical pyramidal cells and cerebellar Purkinje cells. Front Cell Neurosci 5:18.

Yamada Y, Mikoshiba K. 2012. Quantitative comparison of novel GCaMP-type genetically encoded Ca(2+) indicators in mammalian neurons. Front Cell Neurosci 6:41.

Yang HH, St-Pierre F. 2016. Genetically Encoded Voltage Indicators: Opportunities and Challenges. J Neurosci 36(39):9977-9989.

181

Yohn CN, Gergues MM, Samuels BA. 2017. The role of 5-HT receptors in depression. Mol Brain 10(1):28.

Yoshida M, Oami E, Wang M, Ishiura S, Suo S. 2014. Nonredundant function of two highly homologous octopamine receptors in food-deprivation-mediated signaling in Caenorhabditis elegans. J Neurosci Res 92(5):671-678.

Zahratka JA, Williams PD, Summers PJ, Komuniecki RW, Bamber BA. 2015. Serotonin differentially modulates Ca2+ transients and depolarization in a C. elegans nociceptor. J Neurophysiol 113(4):1041-1050.

Zhang G, Stackman RW, Jr. 2015. The role of serotonin 5-HT2A receptors in memory and cognition. Front Pharmacol 6:225.

Zhang H, Reichert E, Cohen AE. 2016. Optical electrophysiology for probing function and pharmacology of voltage-gated ion channels. Elife 5.

Zheng Y, Brockie PJ, Mellem JE, Madsen DM, Maricq AV. 1999. Neuronal control of locomotion in C. elegans is modified by a dominant mutation in the GLR-1 ionotropic glutamate receptor. Neuron 24(2):347-361.

Zou P, Zhao Y, Douglass AD, Hochbaum DR, Brinks D, Werley CA, Harrison DJ, Campbell RE, Cohen AE. 2014. Bright and fast multicoloured voltage reporters via electrochromic FRET. Nat Commun 5:4625.

Zuhlke RD, Pitt GS, Deisseroth K, Tsien RW, Reuter H. 1999. Calmodulin supports both inactivation and facilitation of L-type calcium channels. Nature 399(6732):159- 162.

182