Divergent Outcomes of Intrachromosomal Recombination 753 J Med Genet: First Published As 10.1136/Jmg.37.10.752 on 1 October 2000

752 J Med Genet 2000;37:752–758

Divergent outcomes of intrachromosomal J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from recombination on the human Y chromosome: male infertility and recurrent polymorphism

Patricia Blanco, Maria Shlumukova, Carole A Sargent, Mark A Jobling, Nabeel AVara, Matthew E Hurles

Abstract identity required to initiate homologous re- The Y chromosome provides a unique combination in meiosis has led to the concept opportunity to study mutational processes of a minimum eYcient processing segment within the human genome, decoupled (MEPS). In mammalian cells, the MEPS is from the confounding eVects of interchro- thought to be at least 200 bp in length.4 mosomal recombination. It has been sug- Human endogenous retroviral sequences gested that the increased density of (HERV) are a major subclass of dispersed certain dispersed repeats on the Y could repeats, accounting for about 1% of the human account for the high frequency of causa- genome.5 The remnants of ancient germ cell tive microdeletions relative to single nu- retroviral infections that have been multiply cleotide mutations in infertile males. transposed after their original integration, par- Previously we localised breakpoints of an tial and complete HERV proviral sequences are AZFa microdeletion close to two highly widely distributed throughout the genome.6 homologous complete human endogenous The degree of sequence divergence between retroviral sequences (HERV), separated superfamilies of HERV varies markedly and is by 700 kb. Here we show, by sequencing thought to correlate with the time since major across the breakpoint, that the microdele- waves of amplification.7 Until now HERV tion occurs in register within a highly sequences have not been associated with Human Molecular homologous segment between the HERVs. pathogenic illegitimate recombination. Genetics Group, Furthermore, we show that recurrent The human Y chromosome has been re- University of double crossovers have occurred between cently shown to contain certain dispersed Cambridge, the HERVs, resulting in the loss of a 1.5 kb repeats, including Alu and HERV sequences, at Department of insertion from one HERV,an event under- Pathology, Tennis a significantly higher frequency than the lying the first ever Y chromosomal poly- 8 Court Road, autosomes. It has been suggested that dele- Cambridge CB2 1QP, morphism described, the 12f2 deletion. tions mediated by this higher frequency of dis- http://jmg.bmj.com/ UK This event produces a substantially longer persed repeats may be the major mode of P Blanco segment of absolute homology and as such pathogenic mutation on the Y chromosome.9 It C A Sargent may result in increased predisposition to has also been suggested that the history of NAVara further intrachromosomal recombina- inversions on the Y chromosome that charac- Department of tion. Intrachromosomal crosstalk between terised its divergence from the X also results Genetics, University of these two HERV sequences can thus result from this higher density of repeats.10 11 Leicester, University in either homogenising sequence conver- The AZFa, AZFb, and AZFc (azoospermic Road, Leicester sion or a microdeletion causing male factor) regions on the long arm of the human Y on September 26, 2021 by guest. Protected copyright. LE1 7RH, UK infertility. This represents a major sub- chromosome have been defined by deletion M Shlumukova* class of AZFa deletions. M A Jobling intervals determined by screening azoospermic (J Med Genet 2000;37:752–758) and oligozoospermic patients with a variety of Molecular Genetics 12 Keywords: HERV; AZFa; infertility; Y chromosome probes and STSs from the Y chromosome (fig Laboratory, McDonald 1). These three loci are involved in infertility Institute for phenotypes ranging from oligozoospermia to Archaeological 12 Research, University Increasing numbers of genetic disorders are Sertoli cell only syndrome. The AZFa region of Cambridge, being shown to result from the recombinogenic (primarily associated with Sertoli cell only syn- Downing Street, eVect of flanking repeated sequences. Microde- drome) comprises around 1100 kb that have Cambridge CB2 3ER, letions, and more recently their reciprocal been fully sequenced and contain at least three UK M E Hurles recombination product, duplications, have genes, DFFRY (also known as USP9Y), DBY, been reported to cause neurofibromatosis type and UTY.13 UTY has been excluded from Correspondence to: 1,1 Smith-Magenis syndrome,2 and Charcot- involvement in the phenotype, whereas it has Dr Hurles, Marie-Tooth disease, among other diseases.3 been suggested that both DFFRY and DBY are [email protected] Unequal exchange between repeats on ho- involved in infertility, with severe impairment *Present address: School of mologous chromosomes (UCE) or sister chro- of spermatogenesis occurring when the two Biomedical Sciences, Queens matids (USCE) are the proposed mechanisms genes are defective or deleted.13 Adenovo Medical Centre, point mutation in has been described Nottingham, NG7 2UH, by which these rearrangements may occur. The DFFRY UK. pathogenic role of dispersed repeats in spon- in a single oligozoospermic patient, but micro- soring illegitimate recombination, though deletions remain by far the most common Revised version received documented, has been overshadowed by that of pathogenic lesion.14 30 June 2000 3 Accepted for publication 11 longer region specific paralogous duplications. The haploid Y chromosome does not July 2000 Investigations into the length of sequence recombine at meiosis over most of its length,

www.jmedgenet.com Divergent outcomes of intrachromosomal recombination 753 J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from

Figure 1 This ﬁgure illustrates the AZFa region of the long arm of the Y chromosome. Underneath the labelled ideogram of the human Y chromosome is an expanded view of the sequence organisation of the AZFa region including the genes and pseudogenes mapped previously13 and the HERV15 sequences identiﬁed by use of the NIX program (see Materials and methods). Beneath are positioned the previously determined AZFa deletion breakpoints from two patients (ELTOR13 and WHT299614 (see Discussion)) and the STS markers that span the breakpoints. Finally, the organisation of sequenced BAC clones covering 800 kb of the AZFa region14 is superimposed on a kilobase scale. and thus it contains within it haplotypes that chromosomal recombination mechanisms in are changed solely by mutation. Such haplo- isolation.19

types contain a simple record of our evolution- The ﬁrst Y linked polymorphism was http://jmg.bmj.com/ ary past and have been exploited to investigate discovered in 1985, by probing restriction many facets of human population prehistory.15 enzyme digests of genomic DNA with a 2.3 kb 20 Non-recombining haplotypes constructed BglII fragment from the p12f clone. From from unique mutations can be used to Southern hybridisations of Ta q I and EcoRI construct a perfect phylogeny, without reticula- digests it was hypothesised that a deletion of roughly 2 kb was the event underlying the tion. In the case of the Y chromosome, in con- polymorphism. The Y chromosomal lineage

trast to mitochondrial DNA, single nucleotide on September 26, 2021 by guest. Protected copyright. deﬁned by the 12f2 deletion is of interest for polymorphisms (SNPs) and certain insertion/ studies of prehistoric migrations and is found deletion polymorphisms (indels) can be con- at highest frequencies (greater than 25%) in sidered to be unique on the basis of their pro- Middle Eastern, southern European, North 16 ducing just such a phylogeny. Subsequently, African, and Ethiopian populations.21 putative recurrences of mutational events can Here we show that a major subclass of AZFa be investigated by mapping them onto this sin- microdeletions results from a single crossover gle most parsimonious phylogeny.17 18 In addi- between two well separated, highly homolo- tion, the Y chromosome has proven to be a gous HERV sequences. We also show that a useful model system for investigating intra- double crossover event between these two HERV copies also underlies the 12f2 deletion, Table 1 PCR primers used in this study which, contrary to previous thought, can be ° shown to be recurrent in human evolution. We Primer Sequence (5'-3') Tanneal ( C) long PCR/nested PCR hypothesise that the sequences generated by 494-130kP1 gaggaaatacggatttgggg 58 SY83F cttgaatcaaagaaggccct 58/60 these double crossovers may predispose to fur- 494-146kP2 atggcttcatcccaactgag 58 ther single crossovers. ELT2 cctgctaacagtataatgaatggg 58/60 12f2E gttcttgagctgggaagatctcag 58/65 12f2J gtgctttccaagcatttggag 65 Materials and methods 12f2L ttaattcagccctctgagcg 58 SEQUENCE ANALYSIS 12f2M tatggtctctatggaagtagg 58 The BACs containing the deletion breakpoint 12f2N aaagcctgtggtcagcctgag 58 12f2D ctgactgatcaaaatgcttacagatc See Materials and methods intervals identiﬁed previously in ELTOR 12f2F tcttctagaatttcttcacagaattg See Materials and methods (AC002992 and AC005820) were analysed 3'Sry15 cttgattttctgctagaacaag See Materials and methods using the NIX programme at the HGMP 3'Sry16 tgtcgttacataaatgggcac See Materials and methods resource centre (http://www.hgmp.mrc.ac.uk/)

www.jmedgenet.com 754 Blanco, Shlumukova, Sargent, et al

A Low stringency PCR J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from 0 2000 4000 6000 8000 10 000 Long PCR was performed on 50 ng of genomic 0 DNA either using the Dynazyme EXT kit from Flowgen or the Extensor long PCR system kit 1000 from Advanced Biotechnologies using conditions stipulated by the manufacturer. The 2000 primer pairs (MWG-Biotech) used are listed in table 1. Cycling conditions used with the 3000 Dynazyme EXT kit were 94°C for two minutes followed by 10 cycles of 94°C for 10 seconds, 4000 58°C for 30 seconds, 68°C for 1-1.5 minutes per kb, followed by 24 cycles of 94°C for 10 ° ° 5000 seconds, 58 C for 30 seconds, 68 C for 1-1.5 minutes per kb plus 20 seconds per cycle, and a ﬁnal extension step of 68°C for seven 6000 minutes. Cycling conditions for the breakpoint Proximal HERV 15 Proximal HERV PCR with ELTOR DNA using the Advanced 7000 Biotechnologies kit were 94°C for two minutes followed by 10 cycles of 94°C for 10 seconds, 8000 58°C for 30 seconds, 60°C for eight minutes, followed by 20 cycles of 94°C for 10 seconds, 9000 58°C for 30 seconds, 68°C for eight minutes plus 20 seconds per cycle, and a ﬁnal extension step of 68°C for seven minutes. Distal HERV 15 Nested PCR to generate sequencing tem- B High stringency plate was performed using the primers in table 0 2000 4000 6000 8000 10 000 1and1UofTa q polymerase (Geneo BioProd- 0 ucts). PCR was carried out in a volume of 20 µl with 1 pmol/µl of each primer, 50 mmol/l Tris-

1000 HCl (pH 9.0), 15 mmol.l (NH4)2SO4, 0.1%

(v/v) Triton X-100, 2 mmol/l of MgCl2, and 2000 360 µmol/l of each dNTP. The cycling conditions were 94°C for two minutes followed by 14-24 cycles of 94°C for 10 seconds, 3000 58-65°C for 30 seconds, 68°C for 1-1.5 minutes per kb, followed by a ﬁnal extension 4000 step of 68°C for seven minutes. Template for nested PCR was generated from long PCR

5000 products by running them on a 0.9% agarose http://jmg.bmj.com/ (Geneo BioProducts) gel, cutting out the 6000 relevant band and incubating the band in 400 Proximal HERV 15 Proximal HERV µl of water overnight at 37°C; 2 µl of the eluate 7000 were then used in each PCR.

8000 12F2 ASSAY The 12f2 deletion polymorphism was typed on September 26, 2021 by guest. Protected copyright. 9000 using a newly developed assay. The primers are listed in table 1, and were designed from partial sequence data of the cosmid M13A12, isolated using 12f2 as a probe, from the Y chromosome Distal HERV 15 specific library LL0YNC03. Primers 12f2D Figure 2 Dot plots of the proximal HERV (X axis) against the distal HERV (Y axis). and 12f2F generate a specific 500 bp amplicon The LTR15 sequences are shown in grey, HERV15 in black, and the L1 insertion in white. (A) Low stringency dot plot, (B) high stringency dot plot showing regions of greatest and primers 3'Sry15 and 3'Sry16 a 820 bp homology. control amplicon which is present in all Y chromosomes. PCR conditions were 33-35 and the ENSEMBL database of automatically cycles of 94°C for 30 seconds, 59°C for 30 sec- annotated eukaryotic sequence (http:// onds, and 72°C for 45 seconds. The concord- ensembl.ebi.ac.uk). The consensus sequence ance of the PCR assay with the original of HERV15 was obtained from the latest Rep- hybridisation assay was indicated by showing Base update (http://www.girinst.org). Align- that 23 chromosomes known from previous ments were performed using CLUSTALW analysis to carry Ta q I/8 kb alleles lacked the (http://www.ebi.ac.uk/clustalw/). Restriction 12f2 test amplicon in this assay, whereas 23 analysis was performed using TACG (http:// subjects known to carry Ta q I/10 kb alleles did genzi.virus.kyoto-u.ac.jp/tacg/tacg.form.html) not. The previously unknown recurrence of the or Webcutter (http://www.ccsi.com/ deletion polymorphism was discovered during firstmarket/cutter/cut2.html). Nucleotide se- the screening of a large panel of Y chromo- quence databases were searched with BLAST somes which had previously been typed for 2.0 (http://www.ncbi.nlm.nih.gov/BLAST). both the YAP and SRY-1532 polymorphisms Dot plots were produced by the program Dot- (Z H Rosser, M E Hurles, M A Jobling, ter at the HGMP resource centre. unpublished observations).

www.jmedgenet.com Divergent outcomes of intrachromosomal recombination 755 J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from

Figure 3 Schematic alignment of HERV15 sequences. The 18 kb sequence encompassing the proximal HERV15 sequence is shown in red, aligned to the 19 kb sequence encompassing the distal HERV15 sequence in blue. Between them, indicated by a dashed line, is the region of homology upon which intervals of identity greater than 100 bp are shown in dark blue, and intervals of identity greater than 200 bp in purple. Positions of the displayed sequences within their BACs are shown at the ends. The STS discussed in the text are shown as vertical green bars. Digestion sites for three restriction enzymes are shown as short vertical black lines. The position of the 13 bp deletion discussed in the text is also shown. Sequence encompassing this deletion is deposited in GenBank under accession number AJ278655. Diagonal lines between the sequences indicate the positions of crossovers: dashed, 12f2 deletion; solid, AZFa microdeletion. The PCR products and sequences discussed in Results are shown below. Sequence is colour coded for which HERV it is speciﬁc to and dashed lines indicate regions of identity where sequence cannot be assigned to either HERV.Sequence encompassing the distal conversion breakpoint is deposited in GenBank under accession number AJ278654 and sequence containing the AZFa deletion breakpoint is under accession number AJ278656. PCR primer sequences are indicated by small arrows and their sequences given in table 1.

CLONING distal HERV is interrupted by an insertion of Restriction digests were performed with EcoRI L1 material consisting of two smaller L1 http://jmg.bmj.com/ from Roche according to the manufacturer’s fragments lying back to back (fig 3). The pres- protocol. The ∼9 kb long range PCR fragment ence of 14 bp direct repeats flanking the entire spanning the ELTOR deletion breakpoint was insertion suggests that these fragments have gel purified and cloned into pGEM T-EASY integrated as a unit. The region of the two (Promega) before sequencing. HERV copies distal to sY83 is particularly highly homologous and we hypothesised that

SEQUENCING the breakpoint may lie within this region. To on September 26, 2021 by guest. Protected copyright. Sequencing template was generated from test this hypothesis, long range PCR was used nested PCR products using spin columns from to span the breakpoint using primers from the Qiagen. All sequencing reactions were carried retained flanking STS on either side of the out using the BigDye terminator cycle se- deletion (sY83 and 494-130k). A 9 kb quencing kit from Applied Biosystems accord- amplicon was obtained. This amplicon was ing to the manufacturer’s protocol. Sequencing digested with EcoRI to localise the breakpoint products were run on an ABI377 sequencer further. Five of the six fragments were of the (PE Biosystems). size expected from an in silico digest of the region 3' to the distal HERV. The remaining Results 3.1 kb fragment represents the proximal end of We previously localised the breakpoints of the this 9 kb amplicon and must contain the AZFa microdeletion in the patient ELTOR to breakpoint. This fragment was cloned and fully two tightly defined STS intervals within Yq, on sequenced. As hypothesised, the breakpoint is the proximal side between sY83 and 83D22T7 perfectly in register within an interval of com- and on the distal side between 494-130k and plete identity between the HERVs of 1242 bp. 494-146k (fig 1). Sequence analysis of these This interval includes the 3' portion of the two intervals shows the presence of homolo- HERV and the 5' portion of the 3' LTR (fig 3). gous copies of a human endogenous retroviral As well as removing the genes DFFRY and sequence (HERV15). The STS sY83 lies DBY, the resulting ∼700 kb deletion also towards the end of the proximal copy. The removes a single HERV15 copy, a composite of average degree of homology is 94%, but varies the two original HERVs. markedly along an alignment of the two The 12f2 polymorphism was typed using a HERVs, as shown by the dot plots in fig 2. The newly developed PCR assay, which was shown

www.jmedgenet.com 756 Blanco, Shlumukova, Sargent, et al

Root HERV.There was no conversion of sequence 3' J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from to the site of L1 excision, thus defining the distal end of the converted sequence in both lineages. Further sequencing was undertaken to SRY-1532 isolate the proximal end of the converted sequence. Alignment of the two HERV sequences showed hundreds of base substitutions and indels that diVerentiate between the two YAP HERV sequences. A total of 238 of these diVerentiating sites were assayed by sequencing: 112 were found to be proximal to, four 12f2 deletion distal to, and 122 within the converted sequence. In addition, 3' to the distal four unconverted diVerentiating sites lies 110 bp of YCC76 OXEN sequence flanking the HERV that is specific to Figure 4 A rooted Y chromosomal phylogeny indicating the distal BAC. The proximal end of the the recurrent origins of the 12f2 deletion and the lineage aYliations of the two 12f2 deleted subjects sequenced. converted sequence was localised to a 1285 bp interval of identity between the two HERV to be in complete concordance with previous copies in both of the 12f2 deleted lineages, thus hybridisation analysis.22 A screen of diverse Y defining a minimum intervening interval of 4.6 chromosomes for the 12f2 deletion using the kb of converted sequence. There was a single assay above showed that the 12f2 amplicon was diVerence between the sequences generated absent from two sets of Y chromosomes with from the two 12f2 deleted lineages, a deletion diVerent haplotype backgrounds and geo- of 13 bp within the converted region of YCC76 graphical locations (data not shown). One of (position 144024-144036 within clone these haplotype backgrounds is defined prima- 494g17). This deletion could either have rily by the presence of the YAP insertion23 and occurred after the original conversion event in the derived form of the SRY-1532 polymor- the recipient HERV or before the conversion phism (also known as SRY10381 of Whitfield event in the donor HERV. et al24), the other defined solely by the latter (fig 4). The YAP insertion has been shown to have Discussion 23 occurred once in human evolution with the AN IMPORTANT SUBCLASS OF AZFa ancestral state being the lack of an insertion. MICRODELETION The ancestral state of the 12f2 deletion can be Here we define an AZFa microdeletion break- inferred to be the undeleted form from the point at the sequence level for the first time and published unambiguous rooting of the Y chro- add Y chromosomally based infertility to a mosomal phylogeny.16 25 Therefore, the 12f2 growing list of diseases resulting from illegiti- deletion must have occurred at least twice dur- mate recombination between flanking repeats.3

ing human evolution. This information is sum- Furthermore we show that interchromosomal http://jmg.bmj.com/ marised in the phylogeny in fig 4. This recombination need not be invoked to explain observation of recurrent deletion suggested these events. We note that two recent studies that an event more complex than a simple defining AZFa breakpoints have included sam- deletion underlies the polymorphism(s). ples with remarkably similar breakpoints to The primers used in the 12f2 assay were those defined here.14 26–28 Most strikingly, the used in a BLAST search of Y chromosomal proximal breakpoint of the patient WHT299614 contigs that identified the same distal HERV15 lies between the markers sY746 and sY740 sequence identified above. Restriction analysis (figs 1 and 3). Thus, we conclude that recom- on September 26, 2021 by guest. Protected copyright. (in silico) of this sequence showed that the per- bination between these HERV copies repre- fect excision of the L1 material described above sents an important subclass of AZFa deletions. could generate the polymorphic banding pat- terns observed in Southern hybridisations of DOUBLE CROSSOVERS BETWEEN HERV SEQUENCES genomic DNA digested with three diVerent CAUSE THE 12F2 DELETION enzymes20 (C Tyler-Smith, personal communi- The region of sequence conversion present in cation). However, no mechanism has been the distal HERV copy from subjects from the described by which perfect L1 excision can 12f2 deleted lineages is far longer than gene occur recurrently. conversion events observed in any organism, to Consequently, two overlapping amplicons the best of the authors’ knowledge. Thus, we covering roughly 9 kb of the distal HERV were conclude that this sequence conversion results generated by long range PCR in two subjects, from double crossover events. This mechanism one from each of the two 12f2 deleted Y chro- is supported by the positioning of the conver- mosomal lineages (YAP+, YCC76; YAP−, sion endpoints in intervals of identity between OXEN). A primer flanking the L1 insertion the HERV sequences longer than 400 bp. In was used to generate sequence from the more common with other studies,4 the length of distal of these nested PCR products in each identity rather than degree of homology is the subject. It was found that the L1 material was more important determinant of homologous precisely excised together with one of the recombination. At first sight, the precise flanking 14 bp direct repeats in both 12f2 removal of a L1 insertion recurrently during deleted lineages. In addition, however, se- human evolution seems highly unlikely. How- quence 5' to the site of excision was converted ever, the proposed double crossover provides a to be identical to the proximal copy of the plausible mechanism by which this can occur.

www.jmedgenet.com Divergent outcomes of intrachromosomal recombination 757

Single crossover Double crossover J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from Additional crossover

Resolve products Resolve products

Deletion/duplication Conversion polymorphism AZFa deletion – male infertility 12f2 deletion – polymorphism Figure 5 A mechanistic model for the divergent outcomes of single and double crossovers between misaligned sister chromatids (USCE). Proximal HERV is shown in white, the distal HERV in black, the L1 inserted material is shown hatched, and the intervening genes are represented in grey.

A MECHANISM OF INTRACHROMOSOMAL frequency should be investigated. Neither of RECOMBINATION WITH DIVERGENT OUTCOMES the two 12f2 deleted lineages is found at Exchange of material between the two copies is reasonable frequencies (less than 5%) within non-reciprocal as evidenced by the absence of a the north western European populations on size change for the fragment from the proximal which infertility research has focused.31 HERV in Southern hybridisations of 12f2 (2) If double recombinants can recurrently deleted subjects with the 12f2 probe. Thus, homogenise sequence between two ∼10 kb recombination would seem to occur because of repeats on the Y chromosome, the likelihood is misalignment between sister chromatids that many of the pathogenic microdeletion (USCE) rather than the alignment of repeats in causing repeats on the autosomes are also cis. In light of this finding, we propose the homogenised by double recombinant events. mechanistic model for recombination between The likelihood of these homogenisations being the two HERV shown in fig 5. Crosstalk polymorphic on autosomes is higher than for between these HERV sequences can result in the Y chromosome given that the time since a two outcomes, depending on the number of most recent common ancestor of an autosome crossovers. Only a single product of each is on average four times that of the Y recombinant event shown in fig 5 is observed chromosome.15 Thus, the homogenised repeat here. Duplications are diYcult to detect using premutation (HRP) concept can readily be STS analysis alone, but we know that they exist extended to many autosomal and X chromo- 17 on Yq. As yet, the pathogenic eVect of dupli- somal microdeletions. http://jmg.bmj.com/ cating AZFa genes is unknown, though in the (3) If single crossovers occur within regions light of recent findings with autosomal previously homogenised by undetected double syndromes2 worth investigating. crossovers, all breakpoints will appear to have Counting the number of bands in high strin- occurred at one end of the homogenised tract. gency filter hybridisations using the probe 12f2 This would produce a false clustering of in both Ta q I and EcoRI digests (data not deletion breakpoints that may be misinter- shown) suggests that there are between 10 and preted. We recommend that parental repeats of 30 copies of HERV15 in the genome. Whether deleted subjects be sequenced to exclude such on September 26, 2021 by guest. Protected copyright. there is crosstalk between other copies of this possibilities when making assertions on break- family of dispersed repeats remains to be point clustering. Clearly in the case presented investigated. here the breakpoint of the AZFa microdeletion lies outside the converted region, and so this is PREMUTATIONS TO MICRODELETIONS? not an issue. We note that the two Y chromosomal lineages (4) The assumption that markers such as the defined by the double crossover events re- 12f2 deletion are neutral is required for their ported here contain HERV sequences between use in reconstructing human prehistory. This which there is a substantially longer length of assumption may be violated if these markers identity (6 kb), which could act as a better sub- represent premutations, though only if negative strate for homologous recombination and as selection outweighs drift.32 33 such may predispose to AZFa microdeletions. One of the hallmarks of the Y chromosome is If true, 12f2 deletions could be considered as the high frequency of amplified repeat se- premutations, analogous to those in triplet quences distributed throughout the euchro- repeat disorders.29 Although further work is matic and heterochromatic regions. The find- required to confirm this hypothesis this raises a ings reported in this paper illustrate the number of important considerations. importance of flanking repeat sequences that (1) Given the fact that Y chromosomal lineages may be disposed to intrachromosomal recom- exhibit greater geographical diVerentiation bination in creating deletions or insertions. It than any other locus,30 rates of AZFa deletion may be that the majority of deletions of the Y may vary substantially between diVerent ethnic chromosome can be explained by a similar groups. Consequently, populations in which model but involving diVerent repeat sequences. the two 12f2 deleted lineages occur at highest It would be profitable to examine the location

www.jmedgenet.com 758 Blanco, Shlumukova, Sargent, et al

of the common breakpoints in AZFb and AZFc 15 Jobling MA, Tyler-Smith C. Fathers and sons: the Y J Med Genet: first published as 10.1136/jmg.37.10.752 on 1 October 2000. Downloaded from chromosome and human evolution. Trends Genet 1995;11: patients to assess the involvement of flanking 449-56. repeats in these deletions. 16 Hammer MF, Karafet T, Rasanayagam A, Wood ET, Altheide TK, Jenkins T, GriYths RC, Templeton AR, Zegura SL. Out of Africa and back again: nested cladistic Sequences discussed in the text have been submitted to analysis of human Y chromosome variation. Mol Biol Evol GenBank with the accession numbers AJ278654, AJ278655, 1998;15:427-41. and AJ278656. The authors would like to thank Chris 17 Jobling MA, Samara V, Pandya A, Fretwell N, Bernasconi B, Tyler-Smith for unpublished information and DNA samples. Mitchell RJ, Gerelsaikhan T, Dashnyam B, Sajantila A, We are grateful to the Y Chromosome Consortium for the sup- Salo PJ, Nakahori Y, Disteche CM, Thangaraj K, Singh L, ply of genomic DNA and Zoe Rosser for unpublished data. We Crawford MH, Tyler-Smith C. Recurrent duplication and thank Pieter de Jong for the cosmid library LL0YNC03, deletion polymorphisms on the long arm of the Y chromo- constructed at the HGC, LLNL, Livermore, CA 94550, USA some in normal males. Hum Mol Genet 1996;5:1767-75. under the auspices of the National Laboratory Gene Library 18 Hurles ME, Irven C, Nicholson J, Taylor PG, Santos FR, Project sponsored by the United States DOE. We would like to thank Professor Tim Hargreaves and Professor Howard Cooke Loughlin J, Jobling MA, Sykes BC. European for genomic DNA from patient ELTOR. Maria Shlumukova Y-chromosomal lineages in Polynesians: a contrast to the was funded by a NuYeld Foundation Undergraduate Research population structure revealed by mtDNA. Am J Hum Genet Bursary. MAJ is a Wellcome Trust Senior Fellow in Basic Bio- 1998;63:1793-806. medical Science (grant No 057559). This work was supported 19 Bouzekri N, Taylor PG, Hammer MF, Jobling MA. Novel by the McDonald Institute for Archaeological Research and mutation processes in the evolution of a haploid minisatel- grants from the Wellcome Trust and the BBSRC. Patricia lite, MSY1: array homogenization without homogeniza- Blanco was supported by the British Council. tion. Hum Mol Genet 1998;7:655-9. 20 Casanova M, Leroy P, Boucekkine C, Weissenbach J, Bishop C, Fellous M, Purrello M, Fiori G, Siniscalco M. A human 1 Lopez Correa C, Brems H, Lazaro C, Marynen P, Legius E. Y-linked DNA polymorphism and its potential for estimat- Unequal meiotic crossover: a frequent cause of NF1 ing genetic and evolutionary distance. Science 1985;230: microdeletions. Am J Hum Genet 2000;66:1969-74. 1403-6. 2 Potocki L, Chen KS, Park SS, Osterholm DE, Withers MA, 21 Passarino G, Semino O, Quintana-Murci L, ExcoYer L, Kimonis V, Summers AM, Meschino WS, Anyane-Yeboa Hammer M, Santachiara Benerecetti AS. DiVerent genetic K, Kashork CD, ShaVer LS, Lupski JR. Molecular components in the Ethiopian population, identified by mechanism for duplication 17p11.2 - the homologous mtDNA and Y-chromosome polymorphisms. Am J Hum recombination reciprocal of the Smith-Magenis microdele- Genet 1998;62:420-34. tion. 2000;24:84-7. Nat Genet 22 Pandya A. Human Y-chromosomal DNA variation. DPhil the- 3 Lupski J. Genomic disorders: structural features of the sis, University of Oxford, 1998. genome can lead to DNA rearrangements and human dis- 23 Hammer MF. A recent insertion of an Alu element on the Y ease traits. Trends Genet 1998;14:417-22. 4 Lukacsovich T, Waldman AS. Suppression of intrachromo- chromosome is a useful marker for human population somal gene conversion in mammalian cells by small studies. Mol Biol Evol 1994;11:749-61. degrees of sequence divergence. Genetics 1999;151:1559- 24 Whitfield LS, Sulston JE, Goodfellow PN. Sequence 68. variation of the human Y chromosome. Nature 1995;378: 5 Lower R, Lower J, Kurth R. The viruses in all of us: charac- 379-80. teristics and biological significance of human endogenous 25 Vogt PH, AVara N, Davey P, Hammer M, Jobling MA, Lau retrovirus sequences. Proc Natl Acad Sci USA 1996;93: YFC, Mitchell M, Schempp W, Tyler-Smith C, Williams 5177-84. G, Yen P, Rappold GA. Report of the third international 6 Patience C, Wilkinson DA, Weiss RA. Our retroviral workshop on Y chromosome mapping 1997. Cytogenet Cell heritage. Trends Genet 1997;13:116-20. Genet 1997;79:2-16. 7 Sverdlov ED. Retroviruses and primate evolution. BioEssays 26 Foresta C, Ferlin A, Moro E. Deletion and expression 2000;22:161-71. analysis of AZFa genes on the human Y chromosome 8 Erlandsson R, Wilson JF, Paabo S. Sex chromosomal trans- revealed a major role for DBY in male infertility. Hum Mol posable element accumulation and male-driven evolution. Genet 2000;9:1161-9. Mol Biol Evol 2000;17:804-12. 27 Qureshi SJ, Ross AR, Ma K, Cooke HJ, McIntyre MA, 9 McElreavey K, Krausz C. Male infertility and the Y Chandley AC, Hargreave TB. Polymerase chain reaction chromosome. Am J Hum Genet 1999;64:928–33 screening for Y chromosome microdeletions: the first step 10 Schwartz A, Chan DC, Brown LG, Alagappan R, Pettay D, towards the diagnosis of genetically-determined sperma- Disteche C, McGillivray B, de la Chapelle A, Page DC. togenic failure in men. Mol Hum Reprod 1996;2:775-9. Reconstructing hominid Y evolution: X-homologous 28 Pryor JL, Kent-First M, Muallen A, Van Bergen AH, Nolten http://jmg.bmj.com/ block, created by X-Y transposition, was disrupted by Yp WE, Meisner L, Roberts KP. Microdeletions in the Y chro- inversion through LINE-LINE recombination. Hum Mol mosome of infertile men. N Engl J Med 1997;336:534-9. Genet 1998;7:1-11. 29 Montermini L, Andermann E, Labuda M, Richter A, 11 Lahn BT, Page DC. Four evolutionary strata on the human Pandolfo M, Cavalcanti F, Pianese L, Iodice L, Farina G, X chromosome. Science 1999;286:964-7. Monticelli A, Turano M, Filla A, de Michele G, Cocozza S. 12 Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann The Friedreich ataxia GAA triplet repeat: premutation and P, Kiesewetter F, Köhn FM, Schill WB, Farah S, Ramos C, normal alleles. 1997; :1261-6. Hartmann M, Hartschuh W, Meschede D, Behre HM, Hum Mol Genet 6 Castel A, Nieschlag E, Weidner W, Gröne HJ, Jung A, 30 Seielstad MT, Minch E, Cavalli-Sforza LL. Genetic Engel W, Haidl G. Human Y chromosome azoospermia evidence for a higher female migration rate in humans. Nat factors (AZF) mapped to diVerent subregions in Yq11. Genet 1998;20:278-80. Hum Mol Genet 1996;5:933-43. 31 Semino O, Passarino G, Brega A, Fellous M, Santachiara- on September 26, 2021 by guest. Protected copyright. 13 Sargent CA, Boucher CA, Kirsch S, Brown G, Weiss B, Benerecetti AS. A view of the Neolithic demic diVusion in Trundley A, Burgoyne P, Saut N, Durand C, Levy N, Ter- Europe through two Y chromosome-specific markers. Am J riou P, Hargreave T, Cooke H, Mitchell M, Rappold GA, Hum Genet 1996;59:964-8. AVara NA. The critical region of overlap defining the AZFa 32 Jobling MA, Williams G, Schiebel K, Pandya A, McElreavey male infertility interval of proximal Yq contains three tran- K, Salas L, Rappold GA, AVara NA, Tyler-Smith C. A scribed sequences. J Med Genet 1999;36:670-7. selective diVerence between human Y-chromosomal DNA 14 Sun C, Skaletsky H, Birren B, Devon K, Tang Z, Silber S, haplotypes. Curr Biol 1998;8:1391-4. Oates R, Page DC. An azoospermic man with a de novo 33 Jobling MA, Tyler-Smith C. New uses for new haplotypes: point mutation in the Y-chromosomal gene USP9Y. Nat the human Y chromosome, disease and selection. Trends Genet 1999;23:429-32. Genet 2000;16:356–62.