USO09534058B2

(12) United States Patent (10) Patent No.: US 9,534,058 B2 Stull et al. (45) Date of Patent: Jan. 3, 2017

(54) ANTI-CD324 MONOCLONAL ANTIBODIES 5,811,518 A 9, 1998 Ranscht AND USES THEREOF 5,891,706 A 4/1999 Suzuki 6,146,630 A 11/2000 TSubota (71) Applicant: STEM CENTRX, INC., South San 6,300,080 B1 10/2001 Brenner Francisco, CA (US) 6,406,870 B2 6/2002 Brenner s 6,723,320 B2 4/2004 Hofler (72) Inventors: Robert A. Stull, Alameda, CA (US); 7,029,676 B2 4/2006 Brenner Monette Aujay, San Francisco, CA 2. R 3. E. (US); Orit Foord, Foster City, CA 7.553,948 B2 62009 Coin (US); Alex Bankovich, San Francisco, 760s.413 B1 10, 2009 Sh siles Hypanta 7,695,963 B2 4/2010 Agulnick ara, ; Scott J. Jylla, 8,062,859 B2 11/2011 Roux Emerald Hills, CA (US); David Liu, 8,093,011 B2 1/2012 Haley San Francisco, CA (US) 8,226,943 B2 7/2012 Gurney 2002/0165188 A1 1 1/2002 Herlyn (73) Assignee: ABBVIE STEMCENTRX LLC, North 2006/0281136 A1 12/2006 Nishikawa Chicago, IL (US) 2007/OO597.57 A1 3/2007 Domon 2008.0171047 A1 7/2008 Hadley (*) Notice: Subject to any disclaimer, the term of this 2008-0178305 A1 72008 Clarke patent is extended or adjusted under 35 2009/0233324 A1 9/2009 Kopf-Sill U.S.C. 154(b) by 0 days. 2009,0285883 A1 11/2009 Houchen 2010/0273.160 A1 10, 2010 Donahoe (21) Appl. No.: 14/377343 2011 O165698 A1 7, 2011 Brouxhon 9 2011 0191868 A1 8/2011 Gupta (22) PCT Filed: Feb. 8, 2013 2011 O2O1003 A1 8, 2011 Ono 9 2011/0236904 A1 9, 2011 Hauch 2011 O294186 A1 12, 2011 Fuchs (86). PCT No.: PCT/US2O13/O2S356 2012/0039811 A1 2/2012 Admon S 371 (c)(1).(c)(1 2013,0061340 A1 3/2013 Dvillay et al. (2) Date: Aug. 7, 2014 2013/0061342 A1 3/2013 Dylla et al. 2013, O150386 A1 6, 2013 Goodenow (87) PCT Pub. No.: WO2013/119960 (Continued) PCT Pub. Date: Aug. 15, 2013 FOREIGN PATENT DOCUMENTS (65) Prior Publication Data EP 2325310 5, 2011 US 2015/0337048 A1 Nov. 26, 2015 EP 2385370 11/2011 (Continued) Related U.S. Application Data (63) Continuation-in-part of application No. 13/369,275, OTHER PUBLICATIONS filed on Feb. 8, 2012, now abandoned. Acloque et al., “The physiology and pathology of the EMT. Meeting on the epithelial-mesenchymal transition.” EMBO Rep, vol. 9: (51) Eik so 2006.O1 a322-326 (2008). A6 IK 39/00 3. Al-Shouli et al., “Lets connect: A novel role for CD46 in tight ( .01) junction regulation.” Molecular Immunology 47. 2252-2253 C07K 6/00 (2006.01) (Abstract #240) (2010). C07K 6/28 (2006.01) Angst et al., “The cadherin Superfamily.” J. Cell Sci., 114(4):625 (52) U.S. Cl. 626 (2001). CPC ...... C07K 16/2896 (2013.01); C07K 16/2803 (Continued) (2013.01); A61K 2039/505 (2013.01); C07K 231 7/24 (2013.01); C07K 23.17/31 (2013.01); (2013.01); CO7K 57. C07K 2317/73939). (2013.01); C07K i. C07K 7/56 Primary Examiner — Maher Haddad 2317/76 (2013.01); C07K 2317/77 (2013.01); SRC's TS Firm — Womble Carlyle C07K 2317/92 (2013.01) andr1dge & K1ce, (58) Field of Classification Search None (57) ABSTRACT See application file for complete search history. (56) Ref Cited Novel modulators, including antibodies and derivatives eerees e thereof, and methods of using Such modulators to treat U.S. PATENT DOCUMENTS proliferative disorders are provided. 5,597.725 A 1, 1997 Suzuki 5,610,281 A 3, 1997 Brenner 10 Claims, 34 Drawing Sheets US 9,534,058 B2 Page 2

(56) References Cited Green et al., “Disruption of cell-cell adhesion enhances antibody dependent cellular cytotoxicity: implications for antibody-based U.S. PATENT DOCUMENTS therapeutics of cancer.” Cancer Research, 62:6891-6900 (2002). Guillemard et al., “TaxanE-antibody conjugates afford potent 2013,026.0385 A1 10/2013 Dylla et al. cytotoxicity, enhanced solubility, and tumor target selectivity.” 2013,03172O1 A1 11/2013 Ishii Cancer Research 61, 694-699 (2001). 2015,003 0636 A1 1/2015 Dylla et al. Gumbiner, “Cell Adhesion: The molecular basis of tissue architec 2016,0176964 A1* 6/2016 Arathoon ...... CO7K 16,28 ture and Morphogenesis,” Cell, 84:345-357 (1996). 424,133.1 Haegel et al., “Lack off-catenin affects mouse development at gastrulation.” Development, 121:3529-3537 (1995). FOREIGN PATENT DOCUMENTS Harrison et al., “The extracellular architecture of adherens junctions EP 2444421 4/2012 revealed by crystal structures of type I cadherins,” Structure, WO WO O2,3488O 5, 2002 19(2):244-256 (2011). WO WO 2008, 1498O3 12/2008 Hazan et al., “Cadherin Switch in tumor progression.” Ann. N.Y. WO WO 2009/070767 6, 2009 Acad. Sci., 1014:155-163 (2004). WO WO 2009/126310 10/2009 Hong et al., “Cadherin exits the junction by Switching its adhesive WO WO 2009,157623 12/2009 bond,” J. Cell Biol., 192(6): 1073-83 (2011). WO WO 2011/037643 3, 2011 Hordijk, “Inhibition of invasion of epithelial cells by tiam I-rac WO WO 2011/057034 5, 2011 signaling”, Science, vol. 278, No. 5342, 1464-1466 (1997). WO WO 2011/071541 6, 2011 Huntsman et al., “Assignment of the E-cadherin gene (CDH1) to WO WO 2011/093927 8, 2011 chromosome 16q22.1 by radiation hybrid mapping,” Cytogenet. WO WO 2011/126264 10, 2011 Cell Genet. 83:82-83 (1998). WO WO 2012/O3O854 3, 2012 WO WO 2012/03128O 3, 2012 Jamora et al., “Links between signal transduction, transcription and WO WO 2012/040226 3, 2012 adhesion in epithelial bud development,” Nature, 422(6929):317 WO WO 2012/058418 5, 2012 322 (2003). WO WO 2013,119964 8, 2013 Katayama et al., “Soluble E-cadherin fragments increased in circu WO WO 2015,031698 3, 2015 lation of cancer patients.” Br. J. Cancer, 69:580-585 (1994). WO WO 2015,1274O7 8, 2015 Kobayashi et al., “Inhibition of E-cadherin-mediated homotypic adhesion of caco-2 cells: a novel evaluation assay for peptide activities in modulating cell-cell adhesion.” JPET 317:309-316 OTHER PUBLICATIONS (2006). Angst et al., “The cadherin Superfamily: diversity in form and Kuefer et al., “Assessment of a fragment of E-cadherin as a serum function.” J. Cell Sci., 114(4):629-641 (2001). biomarker with predictive value for prostate cancer.” Br: J. Cancer, Bae et al., "E-cadherin plasticity in prostate cancer stem cell 92: 2018-23 (2005). invasion.” Am. J. Cancer Res, 1(1): 71-84 (2011). Le et al., “Recycling of E-cadherin: a potential mechanism for Berezhnaya et al., “Expression of E-cadherin in drug resistant regulating cadherin dynamics,” J. Cell Biol. 146(1):219-32 (1999). human breast cancer cells and their sensitivity to lymphokinE Lecuit et al., “A single amino acid in E-cadherin responsible for host activated lymphocytes action.” Exp. Oncol., 31(4): 242-245 (2007). specificity towards the human pathogen Listeria monocytogenes, '' Botchkina et al., “Phenotypic Subpopulations of metastatic colon EMBO.J., 18(14): 3956-3963 (1999). cancer stem cells: genomic analysis, Cancer Genomics Proteom Lee et al., “Tumor specificity and in vivo targeting of an antibody ics, 6(1): 19-29 (2009). against exon 9 deleted E-cadherin in gastric cancer, J. Cancer Res. Bussemakers et al., “Molecular cloning and characterization of the Clin. Oncol., 133: 987-994 (2007). human E-cadherin cDNA.” Mol. Biol. Reports, 17:123-128 (1993). Li et al., “A mesenchymal-to-epithelial transition initiates and is Cavard et al., “Gene expression profiling provides insights into the required for the nuclear reprogramming of mouse fibroblasts. Cell Stem Cell. 7: 51-63 (2010). pathways involved in Solid pseudopapillary neoplasm of the pan Lowry, “E-cadherin, a new mixer in the Yamanaka cocktail.” EMBO creas,” J Pathol, 218(2): 201-9 (2009). Rep., 12(7):613-614 (2011). Chen et al., “Specificity of cell-cell adhesion by classical canderins: Makagiansar et al., “Disulfide bond formation promotes the cis- and Critical role for low-affinity dimerization through B-strand Swap trans-dimerization of the E-cadherin-derived first repeat,” J. Biol. ping.” Proc. Natl. Acad. Sci. 102(24): 8531-8536 (2005). Chem., 277(18): 16002-16010 (2002). Chen et al., “E-Cadherin-mediated cell-cell contact is critical for Mansouri et al., "Characterization and chromosomal localization of induced pluripotent stem cell generation.” Stem Cells, 28: 1315 the gene encoding the human cell adhesion molecule uvomorulin.” 1325 (2010). Differentiation, 38:67-71 (1988). Day et al., “E-cadherin mediates aggregation-dependent Survival of McIntosh et al., “Pharmacokinetics and tissue distribution of prostate and mammary epithelial cells through the retinoblastoma cisplatin and conjugates of cisplatin with carboxymethyldextran and cell cycle control pathway.” The Journal of Biological Chemistry, A5B7 monoclonal antibody in CD1 mice,” Journal of Pharmaceu vol. 274, No. 14:9656-9664, Issue of Apr. 2, 1999. tical Sciences, vol. 86, No. 12, pp. 1478-1483 (2007). Devemy et al., “Identification of a novel dual E- and N-cadherin Miederer et al., "Comparison of the radiotoxicity of two alpha antagonist.” Peptides, 30: 1539-1547 (2009). particle-emitting immunoconjugates, terbium-149 and bismuth Dietrich et al., “Rottlerin induces a transformed phenotype in 213, directed against a tumor-specific, exon 9 deleted (d9) human keratinocytes,” Biochemical and Biophysical Research E-cadherin adhesion protein.” Radiation Research, 159, 612-620 Communications, vol. 282, No. 2: 575-579 (2001). (2003). Duguay et al., "Cadherin-mediated cell adhesion and tissue segre Milsom et al., “Tissue factor regulation by epidermal growth factor gation: qualitative and quantitative determinants.” Dev. Biol., 253: receptor and epithelial-to-mesenchymal transitions: effect on tumor 309-323 (2003). initiation and angiogenesis,” Cancer Res., 68(24): 10068-10076 Faull et al., “InsidE-out signaling through integrins,” J. Am. Soc. (2008). Nephrol.., 7(8): 1091-1097 (1996). Mohamet et al., “Loss of function of E-cadherin in embryonic stem Frixen et al., “E-cadherin-mediated cell-cell adhesion prevents cells and the relevance to models of tumorigenesis,” J. Oncol., invasiveness of human carcinoma cells,” J. Cell Biol., 113: 173-85 2011: Article ID 352616, pp. 1-19 (2011). (1991). Munz et al., “The emerging role of EpCAM in cancer and stem cell Green et al., “Antiadhesive antibodies targeting E-cadherin sensitize signaling.” Cancer Res., 14(69):5627-5629 (2009). multicellular tumor spheroids to chemotherapy in vitro.” Mol. Can Nagafuchi et al., “Cell binding function of E-cadherin is regulated cer Ther. 3:149-159 (2004). by the cytoplasmic domain.” EMBO.J., 7(12):3679-3684 (1988). US 9,534,058 B2 Page 3

(56) References Cited Soyuer et al., “Prognostic significance of CD9 expression in locally advanced gastric cancer treated with Surgery and adjuvant OTHER PUBLICATIONS chemoradiotherapy,” Pathol Res. Pract. 206: 607-610 (2010). Suzuki et al., “Protocadherins and diversity of the cadherin Niessen et al., “Molecular components of the adherens junction.” superfamily,” J. Cell. Sci., 109:2609-2611 (1996). Biochimica et Biophysica Acta, 1778:562-571 (2008). Takeichi. “Cadherin cell adhesion receptors as a morphogenetic Nollet et al., “Phylogenetic analysis of the cadherin Superfamily regulator.” Science, 251: 1451-1455 (1991). Tang et al., “E-cadherin is the major mediator of human melanocyte allows identification of six major subfamilies besides several soli adhesion to keratinocytes in vitro.” Journal of Cell Science, vol. tary members,” J. Mol. Biol., 299:551-572 (2000). 107, No. 4,983-992 (1994). Nose et al., “Expressed recombinant cadherins mediate cell sorting “Key molecule for stem cell pluripotency identified,” from in model systems.” Cell, 54: 993-1001 (1988). thenewKerala.com, 1 page (Jun. 3, 2011). Ozawa, "Lateral dimerization of the E-cadherin extracellular Todaro et al., "Colon cancer stem cells: promise of targeted domain is necessary but not sufficient for adhesive activity,” J. Biol. therapy.” Gastroenterology, 138(6): 2151-62 (2010). Chem., 277(22): 19600-19608 (2002). Tomschy et al., “Homophilic adhesion of E-cadherin occurs by a Patel et al., “Type II cadherin ectodomain structures: Implications co-operative two-step interaction of N-terminal domains,” EMBO for classical cadherin specificity.” Cell, 124: 1255-1268 (2006). J., 15(14): 3507-3514 (1996). Pe?ina-Slaus, "Tumor suppressor gene E-cadherin and its role in Van Roy et al., “The cell-cell adhesion molecule E-cadherin.” Cell normal and malignant cells.” Cancer Cell Int., 3(17), 1-7 (2003). Mol. Life Sci., 65: 3756-3788 (2008). Perez-Moreno et al., "Sticky business: Orchestrating cellular signals Vestweber et al., “Identification of a putative cell adhesion domain at adherens junctions,” Cell, 1.12: 535-548 (2003). of uvomorulin', EMBO.J., vol. 4, No. 13 A: 3393-3398 (1985). Plus.CellectTM Catalog No. PLS748, package insert, pp. 2-11 (2009). Vleminckx et al., “Genetic manipulation of E-cadherin expression Pokutta et al., “Structure and mechanism of cadherins and catenins by epithelial tumor cells reveals an invasion Suppressor role.” Cell. in cell-cell contacts,” Annu. Rev. Cell Dev. Biol., 23: 237-261 66:1:107-119 Abstract only (1991). (2007). Von Schlippe et al., “Functional interaction between E-cadherin and Redmer et al., “E-cadherin is crucial for embryonic stem cell Oly-containing integrins in carcinoma cells,” J. Cell. Sci., (113): pluripotency and can replace OCT4 during Somatic cell reprogram 425-437 (2000). ming.” EMBO Reports, 12(7): 720-726 (2011). Wheelock et al., “Regulation of keratinocyte intercellular junction Samavarchi-Tehrani et al., “Functional genomics reveals a BMP organization and epidermal morphogenesis by E-cadherin.” J. Cell. driven mesenchymal-to-epithelial transition in the initiation of Biol., 117(2): 415-425 (1992). somatic cell reprogramming,” Cell Stem Cell, 7:64-77 (2010). Yamane et al., “Enforced Bcl-2 expression overrides serum and Schrappe et al., "Long-term growth suppression of human glioma feeder cell requirements for mouse embryonic stem cell self Xenografts by chemoimmunoconjugates of 4-desacetylvinblastine renewal.” Proc. Natl. Acad. Sci., 102(9): 3312-3317 (2005). 3-carboxyhydrazide and monoclonal antibody. 9.2.27.” Cancer Yang et al., “Twist, a master regulator of morphogenesis, plays an Res., 52, 3838-3844 (1992). essential role in tumor metastasis,” Cell, 117: 927-939 (2004). Shapiro et al., “Structure and biochemistry of cadherins and Zhang et al., “Anti-tumorigenic effect of a K-ras ribozyme against catenins.” Cold Spring Harb. Perspect. Biol. 1:aO03053: pp. 1-21 human lung cancer cell line heterotransplants in nude mice.” Gene (2009). Ther. 7: 2041-2050 (2000). Shimoyama et al., “Cadherin cell-adhesion molecules in human International Preliminary Report on Patentability (IPRP) issued in epithelial tissues and carcinomas,” Cancer Res., 49: 2128-2133 International Application No. PCT/US2013/025356. (1989). Search Report issued in International Application No. PCT/ Shiozaki et al., “Expression of immunoreactive E-cadherin adhesion US2013/025356. molecules in human cancers,” Am. J. Path., 139(1): 17-23 (1991). Written Opinion issued in International Application No. PCT/ Shiozaki et al., “E-Cadherin mediated adhesion system in cancer US2013/025356. cells.” Cancer, 77: 1605-1613 (1996). Office Action dated Jul. 9, 2014 issued in U.S. Appl. No. Solanas et al., “Control of cell adhesion and compartmentalization 13/369,275. in the intestinal epithelium.” Exp. Cell Res., 317(19):2695-2701 (2011). * cited by examiner U.S. Patent Jan. 3, 2017 Sheet 1 of 34 US 9,534,058 B2

U.S. Patent Jan. 3, 2017 Sheet 2 of 34 US 9,534,058 B2

U.S. Patent Jan. 3, 2017 Sheet 4 of 34 US 9,534,058 B2

:

axxx-xx-axxx xxxxss. U.S. Patent Jan. 3, 2017 Sheet S of 34 US 9,534,058 B2

as O has O E o s s CO g O o f

O O. x

U.S. Patent Jan. 3, 2017 Sheet 9 of 34 US 9,534,058 B2

U.S. Patent Jan. 3, 2017 Sheet 11 of 34 US 9,534,058 B2

U.S. Patent Jan. 3, 2017 Sheet 12 of 34 US 9,534,058 B2

arraara : es s w eiss & Seiseki

U.S. Patent Jan. 3, 2017 Sheet 17 of 34 US 9,534,058 B2

ZE,“591)

Os U.S. Patent Jan. 3, 2017 Sheet 18 of 34 US 9,534,058 B2

{spuog?s)aus?

88.0cise

U.S. Patent Jan. 3, 2017 Sheet 21 of 34 US 9,534,058 B2

$9'{}{OS SETOEST T?T?GSTETES|-

Sque3wOxo?o?ogoAuðAlleqaqq3\epewSuome|npow?zego

{x : b & 4 b { } {

004 01

as a piezes.ou. U.S. Patent Jan. 3, 2017 Sheet 22 of 34 US 9,534,058 B2

*. s & %.3 *, gasS. %a

% s g is a 5 & 3 is is & & s ss is is s is , , ise Seegi essesses as seeast essess s (seegee ostest e is is goigs ,

s i

as as e 8 go is is a is sees péSessi: Eggs peerage assesses. sessess Kisei is , sease is gigs U.S. Patent Jan. 3, 2017 Sheet 23 of 34 US 9,534,058 B2

were as asse Esea 3 e S S is S.g; S. S isE was to

er N Y O % 0.03 elee on 8 pe2ee A3e a U.S. Patent Jan. 3, 2017 Sheet 24 of 34 US 9,534,058 B2

Suome|npoW7ZEGOpazqueuunH Squa3w0|xo?o?AOJoAuÐA?aqaqqeme?pºw

Lozi ... f. 282 esses

U.S. Patent Jan. 3, 2017 Sheet 25 of 34 US 9,534,058 B2

c s w: is $388,883 & 88838& 8888.88 SSS.

is 88.8888 &KR3888, 8888.88. U.S. Patent Jan. 3, 2017 Sheet 26 of 34 US 9,534,058 B2

SEQD NO. 20 SC1.6 light chain CAAAGCCACCCAGCCCAGCACTCAGCGCACCCAGGGGAGAAGGCACCAGACCGCAGGCCA GCCAAGGACGTACA GTACTGGACCAGCAGAAGCCAAGACCCCCCCAAACCCTGGACACTCACATCC AACCGGCCGGA6TCCC, GCTCGCTCAGTGGCAGGGGSCTGGGACCCACCTCCACAATCAGCAGAT GGAGGCGAAGAGCGCCACCTAACGCCAGCAGGGAGAGCACCCATCACGTCGGCCGGGGACAAA GGGAAAAAAAC SEQDNQ: 2. SCO.6 Heavy chain CGAGGCAGCCAGGAGCGCGGACCGGCCGGGAAACCTCCAGCCGCCCCACCGCACGTCAC TGGCCCAATCACCAGTGAACCGGAACGGACCGGCAGCCAGGAAACAAACGGAGGGAGGG CACAAAGCACAGGGCACACAGCACAACCCACCCGAAAGCSAACfCACACCGAGACACACCA AGAACCAGCCCGCAGTTGAACTGTGACTACGAGGACACAGCCACAATAC GTACAAGAGGGAACG GGACGGACGGGGCCAAGGGACTCTGGTCACGTCCGCA SECR D NO. 22 SC10.15 light chain GACAGTGAGTCACAGTCTCCACCCCCAGCGTGCAGTGGAGAGAAGGTACTATGAGCTGCAAGTCCA GCAGAGCCAAAGAAAACAAAAGAACTACGGCCGGACCAGCAGAAACCAGGGCAGCCCAA ACGCGAACGGGCACCACTAGGGAACGGGGCCCTGACGCTCACAGGCAGGGATCGGGACAGA if CACTCTCACCACAGCAGTGGAAGGCGAAGACCTGGCAGTAACGCACCAAATAACCCTCCG ACACGTCGGAGGGGGGACCAACCGGAAAAAAACG SER NO. 23 SC10.1.5 Heavy chain CAGGTGCAGCGAAGGAGTCAGGACCGGCCTGGTGGCACCCTCACAGAGCCGCCACACAGCACGTCC GGGCCAA CAGAAAGSACASTSGGCGCCAGCCCCAGGAAAGGGCGSAGGGCSGGAATG AAGGGGGGGGAAGCACAGACAAACAGGCCAAACCAGACGACCACAGCAAGGACAACCCAAG AGCCAAGTCAAAAAGAACAGCGCAAACGATGACACAGCCATGACCGTSCCAGAACCCAGCTA CAGGCCACGACGGGGGASCAGSACCGGGGCAAGGAACCCAGACCGCCCCA SECRED NO; 124 SC10.17 light chair gATGTIGATGACCCAAACCCACCCCCGCCGCAGCTGGAGATCAAGCCTCCACCGCAGACAG CAGAGCASACAAGGAGGAAACACCAAGAAGGACCGCGGAAACCAGGCCAGCCCAAGACC CGACACAAASCCAACCGACGGGGCCCAGACAGGCAGGGCAGGGACAGGGACAGACA CACTCAAGATCAGCAGAGTGGAGGCGAGGATCGGGASTAACGCCAAGGCACAGCTCCGGGA (CGCGGGGAGGCACAAGCSGAAACAAAC SEO ED NO. 125 SCO.17 Heavy chair GAGGCAGCTGGGGAGCTGGGGSAGGCAGGCAGCCGGAGGGTCCCGGAAACTCTCCGGCAGCCC GGACACCAGASCACGGAAGCACGGGCGCAGGCCCAGAGACGGGGCGGAGGGGCGCAAC AACACCGCAGAGACCACACAGCAGCCACAGGAAGGGCCGACACCACCCAGASACAAGCCA GGAACACCCGTCCCCAAATGACCAGTCAAGGCGAGGACACGGCCAGAACGACAGAGAACCCC AACGGATACAGCAGGACACGGGGCAAGGAACCCAGTCACCGTCCCCA

U.S. Patent Jan. 3, 2017 Sheet 27 of 34 US 9,534,058 B2

SEED NO: 25 SC19.19 light chain GACATTGTGATGCGCAGTCTCCCTCCCCCAACGGCAGGGAGAGAAGGTACAGAGCGCAAGCCA GCAGAGCCAAAGTAGCAACAAAAGAACTACGGCCTGGACCAGCAGAAACCAGGGCAGCCAA ACGCTGAACGGGCACCACAGGGAACGGGGTCCCTGATCGCT CACAGGCAGGGATCGGGACAGA TCTCTCTCACCACAGCAGTGGCGGCTGAAGACCGGCAGTATTCTGF CATCAATAATAGCTCTCCGTA CACGCGSAGSGGSGACCAAGCCSSAAAAAAACS

SEOD NC: 27 SCO.19 Heavy chair CAGGGCAGCSAACSSASCAGGACCGGCCGGGGCACCCCACAGAGCCGTCCACACAGCACGTCC GGGTCCAATCCAGATATAGTGACACGGGCGCCAGCCTCCAGGAAAGGGTCGGAGTGGCGGGAATG AAGGGGGGGGAAGTATAGACAAATCAGGCCAAATCCAGACTGAGCACAGAAGGACAACTCCAAG AGCCAAGCAAAAAGAACAGCGCAA CGAGACACGCCAGACCACGGCAGAGCCCAGA CAGGACGACGGGGGAACGCTAGGACACGGGGCAAGGAACCCAGCACCGCCCCA SEQD NO: 128 SC10.35 Light chain CAAAGCCACCCAGCTCCASCAACAGTCTGCACCCTGGGGAGAGGGTCACCTTGACCTGCAGTGCCA GCCAAGGAAGCCAGCCGACGGACCAGCAGAAGCAGGACCCCCCCAAACCGGAATAGC ACACCACCCGGCCGGAGCCCGCTCGCCAGGGCAGGGGTCTGGGACCCTTACTCTCTCACAACAG CAGCAGGAGGCGAAGAGCGCCCACGCCACAGGGAGAGACCCAGGACGCGGGGAGG CACCAAGCGGAAACAAAC SECD NO. 129 SC10.35 heavy chair TCGAGGCAGCCAGGAGCGGGACCGGCCGGTGAAACCTCCAGTCTCGTCCCCACCTGCACGTCAC GACTATCAA ACCAGAAGCCGGAACGGACCGGCAGCCAGGAAACAATCGGAGGGATGGG CAACAAGGCACAGGGGACACAGCACAACCCCCCAAAAGCGAACCACACCGAGACACACCA AGAACCAGCCCGCAGGAA's GACACGAGGACCASCCACAAACGGCAAGAAGAGC GGGGCCCGACACGGGGCCAAGGCACCGCTCCACAGCCCCA SECD NO: 130 SC10.36 light chain GACAGGAGACACAGCCCACCCCCTGGCAGCAGAGGACAGAAGGCACAGAGCGCAAGCCA GCAGAGCCAAAAGAGCACCAAAAGAAAGSCCGSACCAGCAGAAACCASGACAGCCCAA ACCGAAACGCACCACAGGGGACGGGGCCCGACGCCAAGGCAGGGACGGGACAGA CACCACCACAGCAGGGCAGACGAAGACCGGCAGAACCGCAACAACAAASCACCGs CACGCGSAGGGGSGACCAAGCGSAAAAAAACs SEQ D NO: 131 SC10.36 Heavy chair (CAGGCAGCCSCAGCAGCGGGAATGAGCGGGAGGCCTGGGCCGCAGGAAGACCGCAAGGCGC GGCAGCACAGAGACGGAGAACGGGTGAAGCAGAGGCCGGACAGGGTCGAGGGAGGACA GAACCGGAGAGAGACAAACAATGGAAAACAAGGGAAAGCCACACGACGCAGACAAATCC CCAGCCAGCCACAGCACCCAGCAGCCAACACGAGGACCGCGGTCACGGCCAGAGGGG (CTACACCTACCAGGACACTGGGGTCAAGGAACCTCAGTCACCGTCCCCA

19(Cont.) U.S. Patent Jan. 3, 2017 Sheet 28 of 34 US 9,534,058 B2

SECD NO: 132 W SC10.38 light chain GACACCAGAGAACCAGCCCACCAGCGCGCACCCGGAGACACAA ACCACACGCCAGCAG CAGAACAAAGGGAACCGGACCAGCAGAAACCAGGAAAACAAGAGCCAAAGGC CCAACGCASACAGGCGTCCCACAAGGAGGGCA6GGACGGAACAGGCACAAACCACAGCA GCCGCAGCCTGAAGACAGCCACACACGCAACAGGGCAAAGACCACACGTCGGCCGGGGAC AAAG

SEO NO: 33 0.38 heavy chain CAGGCAGCGCASCAGCGGAGCGAGGAGAAGACGGGGCCCAGAAAGAACCGCAAGGCAC GGCACACACAGAGCACGGATAGAGGGGAAAGCAGAGGCCGGACAGGCCGAGGGAGGAGA GAACCGGAAGGGAAAAACAAAAAGAGAAAAGGGCAA6GCCACACACGCAGAACACC CCAACACAGCCACAGCAACTCAGCAGCCGACACGAGGACCGCGCAACGGCAAGAAGGGGG GCCACAGGAACTGACACGGGGCCAAGGCACCA(CCCACAGCCCCA

SEC D NO: 34 SCO.75 light chain GACAGGAGCACAGCCACCCCCAGSGCAGGGAGAGAAGGAAGAGCGCAAGCCA GCAGAGCCAAAGTAACAACAAAAGAAACGGCCGGACCAGCAGAAACCAGGGCAGCGCCAA ACGCGAACGGGCACCAGAGGGAACGGGGCCCGAGCGCCACAGGCAGGGATCGGGACAGA "CACTCCACCACAGCAGTGGAAGGCTGAAGACCGGCAGTATTACTGCAGCAATATATAGCTCTCCG ACACGTCGGAGGGGGGACCAAGCGAAA

SEO NO:35 SC0.75 heavy chain CAGGGCAGCGAAGGAGCAGGACCGGCCGGGGCACCCCACAGAGCCGCCAACAGCAGCAC GSGSCCA-ACCAGAAAGGACAGGACGCCAGCCCCAGGAAAGGGGGAGGGGGGAAG ATAGGGGGGGGAAGCACAGACAAACAGCTCCAAATCCAGACGAGACAACAAGGACAACCCAAG AGCCAAGAAAAAGAACAGCGCAAACGGACACAGCCAGACACGGCCAGAACCCAGCA CAGGCACGACGGGGGGACGCAGGACACGGGGCAAGGAACCCAGCACCGTCCCTCA SEC is NO. 36 SC10.111 Light chair GACAGSAGACCCAGCCAAAAACAGCCACACAGAGGAGACAGGCAGCGCACCGCAAGGCC AGCAGAAGGGCAAAGAGCCGGAAACAGAAACAGGCCAA CCAAAGCCGAACCGG (CACCACCGGACAGGAGCCCGACGCCACAGGCAGGGACGGGACAGACACCCCCCACAG CAAGGCAGCGAAGGCGGCAGA ACGCACAAAACAACACCGACACGCGGAGGGGGG ACCAAGCGGAAAAAAACG SEO D NO. 37 SC10.1. Heavy chain GAGGCCAGCCAGCAGCAGGACCGAGCTGCGAAACCGGGGCCCAGGAAGAATCCGCAAGGCC GGAACACACAC GACACAACAGCACGGGGAAGCAGAGCCAGGAAAGAGCCGAGGGAGGAAA AACCACAAGGSGACGGCACAAAGAAGCAAGACCAAGGCCAAGACSAGACAACC CCAGCACAGCCACAGGAGCCCGCAGCCTGACACTGAGGACCGCAGTCA, ACTGTGCAATGGAACA CGGGCTCGGGGCCAAGGGACCGGCACTSCTCGCA

19(Cont.) U.S. Patent Jan. 3, 2017 Sheet 29 of 34 US 9,534,058 B2

SEO NO:38 SC10.112 Light chair CAAATGTCTCTCCCAGTCCCAGCAA CCGCGCACTCCAGGGGAGAAGGCACAATGACTTGCAGGGCCA GCCAAGGTTAGACATCACGG ACCAGCAGAAGGCAGGACCCCCCCACATCCTGGAAGCCACACC AACCGGCTCTGGAGTCCCACCGC CAGGGCAGGGGTCGGGACCCACTCCTCACAGCAACAGAG GGAGSC GAAGAGCGCCACAFACTGCCAGCAGGGAGACACCCCACCCACGCGGAGGGGGGACCA GGGGAAAAAAACG SECR D NO 39 SC10.112 Heavy chain GAGGCCASCGCAGCAGGGACCGACCGGGAASCCGSGACCAGGAAGAACCGCAAGGCC GG ACCCTCACGCCGCACAFACACTGGGGAAGCAGAGCCAGGAAAGAGCCGAGGGAGGACG if AGTCCAACAATGAAGAACACCACAACCAGAAG CAAGGACAAGGCCAAAACGAGACAAGCA CCAGACAGCCACAGGACCCCGCAGCGACACGAGGACCGCGGCAACGGCAAGAGGGGAAG AAAGCGGGACGCCTGG ACACGGGGCCAAGGGACCGGCACGTCCGCA SECD NO 140 SC10.115 Light chair GACA GTGAGACACAGCCCACCCCCGACGGACAGCAGGAGAGAAGGCACAGAGGCAAGCC AGCAGASC GAAAGAGGGAAACAAAAGAACTACGACCGGACCAGCAGAAACCGGGCAGCCCC AAACGGACACGGGCACCACAGGGAACGGGGCCCGACGCCACAGGCAGGGAGGAACA GACACTCCACCATCAGCAGGGCAGGCGAAGACCfgSCAGTA ACGTCAGAGTGATTAAAACC ACGCGGCCGGGGACAAAGG SEQID NO. 41. SC10.115. Heavy chain CAGGTAC CTGAAAGAGCTGGCCCTGGGAATGCAGCCCCCCAGACCCCAGCGACGTCCCGG GTCACGAGCAC CTGGAGGGGAGGCGGACGTCAGCCiCAGGGAAGGGTCGGAGTGGCTGGC ACACAGGTGGGAGA GTCAAGCGCAAACCCAGCCCGAAGAGCCGACGACATCTCCAAGGAACCTCC AGCAGCCAGG ACCCAAGACGCCAGGGGACACGCAGA ACGCCACAATCACGGCCGAAAGCAA CGGGCAAGGCACGGGGCCAAGGGACCTGGTCACGTCCGCA SEQD NO. 42 SC10,118 Light chain CAAATGTCTCACCCAGTCTCCAGCAATCATGTCGCATCCCAGGGGAGAAGGCACCAAACCGCAGTGCCA GCCAAGGGAGACAGCACGGCCAGCAGAACSCCAGSCACCCCAAACCGAAAGCACAC CAACCGGCECTGGAGTCCCGCCGCTCAGSGCAGGGATCGGGACCCACTCTCCACAACAGCCGAA GGAS GCGAAGAGCCACAFACCSCCAGCAAAGGAGACACCCGACACGTCGGAGGGGGGACCA AGCGSAAAAAAACG SECR D NO: 43 SC10.118 heavy chair CAGGCCAACACAACAGCCTGGGGCGAGCGGAAGCCGGGGCCAGGAAGCGCCGCAGGACC GGCACCCACCAGCACGGAACACGGGGAAGCAGAGGCCGGACGAGGCCGAGGGAGGAAG GAGFCCAAAGGGGGACAAGTACAAGAGAACCAAGAACAAGGCCACAC GACSAGACAAATCC CCAAACAGCCACAGCAGCCAGCAGCGACACTGAGGACTCGCGGCA ACTGACACGAGAGGA CCACCGCCGGAGGACACGGGGCAAGGAACCCAGCACCGCCCCA

U.S. Patent Jan. 3, 2017 Sheet 30 of 34 US 9,534,058 B2

SEC) NO. 44 0.23 light chair CAAATGTCCCCCAGTCTCCAGCAA CCTGCGCCCCCAGGGGAGAAGGCACAATGACGCAGGGCCA GCCAAGGAAG AcASCACGGACCAGCAGAAGCCA6GATCCTCCCCCAAACCCGGATTAGCCGCATC CAACCGGCCGGAGCCCGCCGCCASGCCACGGGCGGGACCCACCCCACAACAGCAGAG GGAGGCGAAGAGCGCCACAGCTGCCAGCAGGGAGAAAACCCACCAACCSCGGCGGGGGGACCA AGCGGAAAAAAACG

SEO N6:45 O.123 heavy chain GAGGCAGCGCAGCAGCGGACCGAACGGGAAGCCGGGGCCAGGAAGAACCGCAAGGCC GGACCAACGGGACAGAACGGGGAAGCAGAGCCAGGAAAGAGCGAGGGAGGACG AAACCACAAGGGAAACACAACCAGAAGTCAAGGGCAAGGCCACAGACGAGACAAATCC CAGCACAGCCCACAGGAGCTCCGAGCCGACACGAGGACCTGCAGCAAGGGAAGGGACACG GTAGAGCTACGGASGCCGAGTCGGGGCGCAGGGACCACGGCACCGTCCCCA SEC D. NC 146 0.24 Light chair GACAGACCACCCAATCCCAGCCGGCTGGCCAGGGCAGAGAGCCACCACCCGCAGAGCCAA GAAAGGGAAAAGGCACAAGAAGCAGGGACCAACAGAAACCAGGACAGCCACCCAAACCCC ACAGCGCACCAGCGAAAGCGGGGCCCGCCAGGAGGGCAGGGGCGGGACAGACCAGC CCAAATCCATCCGTGGAGGAGGATGATAFGCAAG ACTGCAGCAAAGTAGGAAGGTCCCGACG CGGGGAGGCACCAAGCGGAAACAAAC SEOD NO.147. 10.124. Heavy chain GAGGTCCAGCGCAACAGTCGGACCCGAGCTGGGAAGCCGGAGCCAATGAAGATACCGCAAGGCC GGAACACACSACCACACCAGCACGGGGAASCAGAGCCAGGAAAGAACCGAGGGAGGACG AAACCACAATGG GATACAGCACAACCAGAACT CAAGGGCAAGGCCACA AACG. AGACAAGCA CCAACACAGCCACAGGAGCCCCAGCTGACACGAGGACCGCAGCFAACGGCAAGAAGGGG TGAAACGTCC ACTATACAGGACTACTGGGGCAAGGAACCCCTCCACCGTCCCCA 3D NO 148-10.125. Light chair GACAGCCACCCAATCCCACCCGGCGGCCAGGGCAGAGAGCCACCACCCGCAGAGCCCA GAAAGGGAAAAGGCACAAGAASCAGGGACCAACAAAACCASGACAGCCACCCAAACCCC ACAGGCACCAGCGAAAGCGGGGCCCGCCAGGAGGGCAGGGGCTGGGACAGACCASC CCAAACCACCGGGAGGAGGAGAAGAAG ACGCASCAAAGASGAAGGCCCGACG CGGGGSASGCACCAAGCGGAAACAAAC SEC D. NO: 49 10.125 Heavy ghain GAGGCCAGGCAACAGCGGACCCGAGCGGGAAGCCGGAGCCAAGAAGAACCGCAAGGCC GGAACTTCACGACACACCAGCACGGGGAGGCAGAGCCAGGAAAGAACTGAGGGATGGACGT AAACCACAAGCGAACAGCACAACCAGAACTCAAGGGCAGGGCCACAAACGAGACAAs CA CAACACAGCCAAGGAGCCCCAGCTGACACTGAGGACCGCAGC AACGGCAAGAAGGGG GAACGTCC ACTATACAGGACACGGGGTCAAGGAACCTCAGTCACCGTCCCTCA

U.S. Patent Jan. 3, 2017 Sheet 31 of 34 US 9,534,058 B2

SEO NO: 50 10.26 light chain GACAGGAGACCCAGCTCCACCCCCAGC GTGTCAGGGAGAGAAGGf ACATGAGC (GCAAGTCCA GCAGAGCCTATA AGAGAACAAAAGAACTAC GGCCGGACCAGCAGAAACCAGGGCAGCTCCAA ACGCGATACTGGGCACCACAGGGAATCGGGGCCCGATCGC CACAGGCAGGGATCGGGACAGA TTCACTCCACCACAGCAGGTGAAGGCTGAAGACCGGCAGATTACGTCAGCAAATAAACTATCCCT ACACGTCGGAGGGGSGACCAAGCGGAAAAAAACG

SEC) NO is 0.26 Heavy chair CAGGGCAGCGAAGGAGTCAGGACCGGCCTGGGGCGCCCCACAGAGCCGTCCATCACAGCACGTCCT GGTCTCATAACCAGC AACfAAAGCGGGTCGCCAGCCACCAGGAAAGGGTCGGAGGGCGGAAA AATGGACTGCTGGAGCCACAAATAAACAGCTCCAAACCAGACTGAGCACAGCAAAGACAACTCCAAGA GCAAG CAAAAAGAACAGCGCAAACTAGACACAGCCAGGTACACGGCCAGATAAGAAGGA ACAGCGGGACACGGGGTCAAGGAACCCAcSCACCGCCCCA

SED NOS O.27 light chair GACATTGACCACCCAATCTCCAGCCTTGGCTGTGTCCAGGACAGAGAGCCACCATCCCTGCAGAGCCAA TGAAAAG GAAAAGGCACAAGTAATGCAGGGACCAACAGAAACCAGGACAGCCACCCAAACTCCTC ATCTAGCGCATCCAACGTAAAGTCGGGGCCCGCCAG8 TTAGGGCAGTGGGCTGGGACAGACCAGC CCAAATCCATCCTGGGAGGAGGAGAASCAAGTATTCGCAGCAAAGTAGGAAGGCC CGACG CGGGGAGGCACAAGCGAAA SEQD NO. 53 10.127 Heavy chain GAGGCCAGCGCAACAGCGGACCCGAGCGGGAAGCCGGAGCCAAGAAGAATCC GAAGGCC GGAACACAC GACACACCATSCACGGGTGAAGCAGAGCCAGGAAAGAACCGAGGGAGGACG AAATCCACAATGAGAAASCACAACCAGAACCAAGGACAAGGCCACAAA CGAGACAAGCA CCAACACAGCCACATSGAGCCCCASTCGACATCGAGCSACTCTGCAGCATACTGTGCAAGAATGGTGG GAAACGC,CACAACAGGACACGGGGCAAGGAACCCAG ACCGCCCA SEOD NO 154 10.128 Light chain GACAGGAGCACAGCCCACCCCCAGCTGGCAGGGAGAGAAGGACAGAGCGCAAGCCA GCAGAGCCTATATAGTAG CAATCAAAAGAACTACTTGGCCTGGACCAGCAGAAACCAGGGCAGCTCCAA ACGCGAACTGGGCACCACAGGSAACGGGGTCCCGACGCCACAGGCAGGGACGGGACAGA "CACTCCACCATCASGCACGGAAGGCTGAAGACCTGGCAGTATACTGTCACCAAATAAGCACCGT ACACGTCGGAGGGGGGACCAAGCTGGAAAAAAACG SEQD NO: 155 10.128 Heavy chain CAGGGCA-GEGAAGGAGAGGACCGGCCTGGGGCACCCCACAGAGCCGCCACACAGCACGCCT GGGCCAATCCAGAAAGGACACGGGTCGCCAGCCCAGGAAAGGGTCTGGAGGGCGGGAAG AAGGGGGGTGGAASCACAGACAAACAGCTCCAAACCAGACGATCATCAGCAAGGACAACCCAAG AGCCAAGT CAAAAATGAACAGTCGCAAACGAGACACAGCCAG ACTACTGGCCAGAACCCAGCT ACAGGTCACGACGGGGGGAGCTATGGACTACTGGGGTCAAGGAACCCAGCACCGTCTCCTCA

U.S. Patent Jan. 3, 2017 Sheet 32 of 34 US 9,534,058 B2

SEQED NO: S6 10.129 light chain GACATGGCTGACACAGTCCCGGTCCAGCG ACTCGGGGCAGAGGGCCACCACTCAGCAGGGCCA GCCAAASSCAGCACAGCAAGAAGCACGGACCAACAGAAACCAGGACAGCCACCCAAACCC CACAAGGCACCAACCAGAACGGGGTCCCGCCAGGT CAGTGGCAGTGGGCGGGACAGACCACC CCAA CATCCATCCGGGAGGAGGAGGATACGCAACAATACGTCAGCACAGTGGGAGATCCGC CACA CGGGCGGGACCAAGCGGAGCGAAAC SEOID NO. 57 10.129 Heavy chain CAGSACCGAAAGAGCGGCCCGGGAAs CAGCCCCCCAGACCCCAGCGACGTCCCGG GCACTGAGACCGGAGGGTGAGGCGSACGCCAGCCACAGGAAAESGGCGGAGGGCGGC ACACAGGGGGAGAGTCAAGCGCATAACCAGCCCGAAGAGCCGACGAAACCCAAGGACACCTCC AGCAGCCAGGCTCCTCAAGACGCCAGTGGGACAC GCAGAACTGCCACAACACGTGGCGAAAAAG AACCAGSCAGACACGGGGCCAAGGCACCACCCACAGCCCA SECR D NO: 158 - 10.30 Light chain GAGCCAGAAACCCAGTCCCACACGCGCATCCCGGAGAAACCACAAAGCAGGGCAAG AAGAACAAGCAAATAAGCCGGACAAGAGAAACCGGGAAAACAATAAGCTTCACACTCGGA CCACSCAACGGAACCACAGSGCASGSCAGGGATCGGACAGAT CACCCACCACAGTAG CCTGGAGCCGAAGAGCAATGAACTGTCAACAGCAGAAACCCGACACGTCGGAGGGGGGACC AAGCTGGAAAAAAACG SEQED NO: 159- 10.130 Heavy chair GAGGCAGCGCAGCAGTCGGACCGACCGGGAAGCCTGGGGCCAGGAAGAACCGCAAGGTTC GGACCAACGGCACAGAACGGGGAASCAGAGCCAGGAAAGAGCCGAGGGAGSACG AAACCACAAGGTGAACCACAACCAGAAATCAAGGGCAAGGCCACAGAC (SAGACAAATCCTC AGCACAGCCCACAGGAGCCCGAGCCGACACGAAGACCGCAGTCAAGGGAAGAGGGAAAC ACGACACGGGGCCAAGGCACCACCCACAGCCCCA SEQD NO: 160 10.132 Light chair CAAAGCCACCCAGCCCAGCAA CATGTCGCACTCGGGGGAGGAGACACCCAACCTGCAGTG (CCA CCCGAGGTGGTACACACGGTACCAGCAGACGCAGGCACCCCCAGACCGAATACCACATCC AACCGGCCGGAGCCC, CCGCCAGGGCAGGGGCTGGGACCACTCTCACAACAGCAGTG GAGGCGAAGASCGCCGAAACGCCATCAGGGAGCSACCCACSCGGAGGGGGGACCAAGC GCGAAAAAAACG SECR D NO 161 19-132 heavy chair GAGGTGCAGCGGAGCAGCAGGGGGAGACAGGAAGCCGGAGGGCCCGAAACCCCG’f GCAGCCC TGGATTCACCAGCCAGGCATGTCTGGGCGCCAGACCCAGACAAGAGGCGGAGSTGGGCGCAACC AAGAGGGGGCACAGCACACCAGACAGGGAAGGGGCGACACCACCCAGAGACAAGCCA AGAACACCCGACCGCAAATGAGCAGCTGAAGTCGAGGACACAGCCATGACGTAGGCCCCCTCTT CCTTCCTGGGGCCAAGGGACCGGCACTGTCTCTGCA

U.S. Patent Jan. 3, 2017 Sheet 33 of 34 US 9,534,058 B2

SEO NO: 62 0.133 light chain GACATCAAGAGACCCAGCCCA CTTCCACGATGCAC CTAGGAGAGAGAGCACATCACGCAAGGCGA GTCAGGACAAATACCATAACGGTCCAACAGAAACCAG6GAAACCTCCAAGACCCGATCACGTGC AAACAGAGAAGAGGGGTCCCACAAGGCAGGGCAGGGACGGGCAAGAACCCACCACAG CAGCCGGAGAGAAGAGGGAAAAGCACAGATGAfGAGCCGATACGTCGGGGAGGC ACCAAGCTGGAAATCAAAC SECD NO: 163 10.133 Heavy chain GAGGCAGCTGCAGCAGTCGGGSGCTGAGCGTGAGGCCAGGGGCCCAGCAAG GCCGCACAGCC GGC AACAAAGACGACACACGGGGAAGCAGAGGCCGAACAGGGCCGGAGGGAGGAAGG AGACCGCGAAGGAAACAAAAGGCCCGAAGCCAGGACAAGGCCACAAACTGCAGACACACA CCAACACAGCCACCGCAGTTCACCAGCCTGACATCGAGGACACGCCGTCA ACGTGCAGCGGAGGGC GGCGCTGGGGCCAAGGGACT SEC) NO 164 1.134 light chair GACA GTACCACCCAATCCCAGCCTGGCTGTGTCCTAGGGCAGAGAGCCACCACCCGCAGAGCCG AfgAAAGTGTGAATAATGGCACAAGTAATGCAGTGGTACCAACAGAAACCAGGACAGCCACCCAAACCC CACAGCGCACCAACGAAA GCGGGGTCCCGCCAGSAGGGCAGGGGCGGGACAGACCAG CCCAAACCACCGGGAGGAGGATGAAGCAA ACGCAGAAAGAGGGAGGTCCCGACG CGSTGGAGGCACCAAGCGGAAACAAAC SEP NO: 16S 0.134 heavy chain GAGGCCAGGCAACAGCGGACCCGAGGGGAAGCCGGAACCAAGAAGAATCCGCAAGGCC GGATACACACTGACACACCAGCACTGGGTGAAGCAGAGCCAGGAAAGAACCGAGGGAGGACG AAACCACACGGCACTAGCACAACCAGAACTCAAGGACAAGGCCiCAiiAACTGAGACAAGCAC CAACACAGCCACATGGACCCCCAGTCGACACTGAGGACCGCAGTCTATACTGTGCAAGAGGGGT GATAACGCTCACAACTTGSACTACTGGGGTCAAGGAACCCAGTCAGCGCCCTCA

SEC NO: 68 SC10.63 light chain GAATGGAGACGCAGGCGCACCCAATCCAGTCACCGGAACACAGCCCA CTCCGCAGGCAG AAGAGTCCCACAAGTAAGGCACACATGTATTGGTACGCAGAAGCCAGGCCAGTCCCCAGCCC TGAACAGATGTCCAACCGCCCAGGAGCCCAGACAGGTTCAGTAACAGTGGGCAGGAACGA CAC ACGAGSAACAGCAGASGGAGGGAGGATGGGGGTAACGGCCAAAACAGAACCCGGGAC GCSGGGAGGCACCAAGCGGAAACAAAC SER NO: 6 SC10.163 Heavy chain GAGGTCCAGCGCAACAGTCGGACCTGAGCGGGAAGCCTGGGGACAGTGAAGAGCCGCAAGGCC GGCAACACAGCAC AACACACAGGACfSGGGAAACAGAGCCATGGAAAGAGCCGAGGGAGGAA ATATGCTAACAATGGGGAACTAGCTATAATCAGAAGTCAAGGGCAAGGCTACATTGACTGTAGACAAGCCf CCAGCACAGCCACAGGAGACCACAGCCGACACGAGSACCSCAGCAAGGAACACAAG GTACGAGTTTGCACTGGGGCCAAGGGACCTGGTCACGTCTCGCA

U.S. Patent Jan. 3, 2017 Sheet 34 of 34 US 9,534,058 B2

SECR D NO 63 SCI0.168 light chain GACAGGAGACCCAGCCACAAACCAGCCGCACAGASGAGACAGGCAGACAC GAAGGC ASCASSAGGGSACSCGAGCGGAAACAGAAACAGGGCGACCAAACACIGAACGG GCACCAACCGGCACACGGAGCCCGACGCTCACAGGCAGTGGACGGGACAGACACCCACCAA GCAAGGCAGCGAAGACGGCAGATACGCAGCAGGGCAGCACCGACACGCGGAGGGG GGACCAAGCGGAAAAAAACG SENC. 169 SC10.168 Heavy chair CGAGGCAGCCAGGASCAGGACCGGCCGGGAAACCCCAGCCGCCGCACAGCAC SAACCCCCACCAGGGAACGGAACGGACGGCAGCCAGGAAACAAACGGAGGGASGCC ACAACACACAGGGAGCACCACACAACCCACCCAAAAGCGAACOGCACCSAGACACACCAA GAACCAGCCCGCAGGAACGGACACGAGGACACAGCCACAAACGGCAAGAGAGGGGCC TACAAGCCGGCC ACTGGGGCCAAGGGACCGGTCACGTCCGCA

SECD NO: SC.73 light chair GAATGGCTGACACAGCTCCACCCCCGCGCAGCGGAACAAGCCCCACCGCAGACAG CASASCCGACACAGAAGSAAACACA ACASGACCAAAGCCAGCCACCCAAACCC CGACCAAAGCCAACCGATCGGGGCCCAGACAGGCAGGGCAGGGACAGGGACAGACA CACCAGGACAGAGAGGGAGGCGAGGACGGGAGA CTGCCCAAACACACAGGGGACG CGGGGAGGCACCAAGCGGAAACAAAC

SEO NO: SC.73 heavy chair CAGACGGGGCAGCSGACCAGCGAAGAASCCGGAGASACACAAGACCCCAAGGC AAAACCCACAGACAGGAATGACTGGGGAAGCAGGCCCAGGAAAGGGTTAAAGGGAGGGCG GAAAACCCCAAGACGGGGGCACAAGCAGAGACCAAGGGAAGA"GCCCCGGAAACCC GCCAG8 ACGCCASCASACAAAACCCGAAAASAGGACASCAAACSSASAGA CACGGGGCCAAGCACCACCCACAGCCCCA SECD NO: 172 SC10.12 light chain GAGGGAGACCAGCCACCCCCGCCCGCACCCGGACAGCCGGCCCCACCCGCAGGCAG CAAASCACGACACAGGAGGAAACACCAC's GAAGGACASCAGAGGCCAGGCCAACCCAAGGCG CCAAAAAGGCAACCGGCCGGGGCCCAGACAGAAGGGCAGGGGCAGGCAC GAC ACACTGAAAACAGCAGGGGGAGGCGAGGAGGGGGAACSCCAAGGCACAGCCCGSG ACGCGGSGAGGCACAAGGGAAAAAA SEC NC. 173 hSC10. Heavy chair GAGGGCAGCGGTGGAGCGGGGGAGGCGSACAGCCGGGGGGCCOGAGACCCCGGCAGCCC GGACACCCAGAGCAGGAGCAGGGCCGCCAGGCCCAGGGAAGGGGCGGAGGGGGCAA CAACACAGAAGAGACCAATAACGCAGACCGGAAGGGCCGACACCACCCAGAGACAAGCC AAGAACCAGACGCAAAGAACAGCCGAACCGAGGACACGGCSGAAGAAAAACC CAACGGAACTATGCATGGACACGGGGCAAGGAACCCAGCACCGTCCCCAG

US 9,534,058 B2 1. 2 ANT-CD324 MONOCLONAL ANTIBODES Subsequently relapsed. In Such cases the failed therapeutic AND USES THEREOF regimens and resulting patient deterioration may contribute to refractory tumors which often manifest themselves as a CROSS REFERENCED APPLICATIONS relatively aggressive disease that ultimately proves to be incurable. Although there have been great improvements in This application is a 371 national phase of International the diagnosis and treatment of cancer over the years, overall Application NO. PCT/U.S.2013/025356 filed on Feb. Survival rates for many solid tumors have remained largely 8.2013, which is a continuation-in-part under 35 U.S.C. unchanged due to the failure of existing therapies to prevent S120 of U.S. application Ser. No. 13/369,275 filed on Feb. relapse, tumor recurrence and metastases. Thus, it remains a 8, 2012 (now abandoned) which is incorporated herein by 10 challenge to develop more targeted and potent therapies for reference in its entirety. proliferative disorders. FIELD OF THE INVENTION SUMMARY OF THE INVENTION This application generally relates to novel compounds, 15 compositions and methods of their use in diagnosing, pre These and other objectives are provided for by the present venting, treating or ameliorating proliferative disorders and invention which, in a broad sense, is directed to methods, any expansion, recurrence, relapse or metastasis thereof. In compounds, compositions and articles of manufacture that a broad aspect, the present invention relates to the use of may be used in the treatment of CD324 associated disorders CD324 (i.e., E-cadherin, CDH1) modulators, including anti (e.g., proliferative disorders or neoplastic disorders). To that CD324 antibodies and fusion constructs, for the treatment, end, the present invention provides novel CD324 (i.e., diagnosis or prophylaxis of neoplastic disorders. Selected E-cadherin or CDH1) modulators that effectively target embodiments of the present invention provide for the use of tumor cells and/or cancer stem cells and may be used to treat Such CD324 modulators, including antibody drug conju patients suffering from a wide variety of malignancies. gates, for the immunotherapeutic treatment of malignancies 25 Compatible modulators may comprise any compound that preferably comprising a reduction in tumor initiating cell recognizes, competes, agonizes, antagonizes, interacts, frequency. In particularly preferred embodiments the dis binds or associates with a CD324 genotypic or phenotypic closed modulators will comprise bispecific or multispecific determinant (or fragment thereof) and modulates, adjusts, constructs comprising a CD324 binding site. alters, regulates, changes or modifies the impact of the 30 CD324 protein on one or more physiological pathways BACKGROUND OF THE INVENTION and/or eliminates CD324 associated cells. Thus, in a broad sense the present invention is generally directed to isolated Stem and progenitor cell differentiation and cell prolif CD324 modulators and use thereof. In preferred embodi eration are normal ongoing processes that act in concert to ments the invention is more particularly directed to isolated Support tissue growth during organogenesis and cell replace 35 CD324 modulators comprising antibodies (i.e., antibodies or ment and repair of most tissues during the lifetime of all multispecific antibodies that immunopreferentially bind, living organisms. In the normal course of events cellular recognize, react with or associate with CD324 or an immu differentiation and proliferation is controlled by numerous noreactive fragment thereof) that, in particularly preferred factors and signals that are generally balanced to maintain embodiments, are associated or conjugated to one or more cell fate decisions and tissue architecture. Thus, to a large 40 cytotoxic agents. Moreover, as discussed extensively below, extent is it this controlled microenvironment that regulates Such modulators may be used to provide pharmaceutical cell division and tissue maturation where signals are prop compositions useful for the prophylaxis, diagnosis or treat erly generated based on the needs of the organism. In this ment of proliferative disorders including cancer. regard cell proliferation and differentiation normally occurs In selected embodiments of the invention, CD324 modu only as necessary for the replacement of damaged or dying 45 lators may comprise a CD324 polypeptide or fragments cells or for growth. Unfortunately, disruption of cell prolif thereof, either in an isolated form or fused or associated with eration and/or differentiation can result from a myriad of other moieties (e.g., Fc-CD324, PEG-CD324 or CD324 factors including, for example, the under- or overabundance associated with a targeting moiety). In other selected of various signaling chemicals, the presence of altered embodiments CD324 modulators may comprise CD324 microenvironments, genetic mutations or some combination 50 antagonists which, for the purposes of the instant applica thereof. When normal cellular proliferation and/or differen tion, shall be held to mean any construct or compound that tiation is disturbed or somehow disrupted it can lead to recognizes, competes, interacts, binds or associates with various diseases or disorders including proliferative disor CD324 and neutralizes, eliminates, reduces, sensitizes, derS Such as cancer. reprograms, inhibits or controls the growth of neoplastic Conventional treatments for cancer include chemo 55 cells including tumor initiating cells. In preferred embodi therapy, radiotherapy, Surgery, immunotherapy (e.g., bio ments the CD324 modulators of the instant invention com logical response modifiers, vaccines or targeted therapeu prise anti-CD324 antibodies (including bispecific or multi tics) or combinations thereof. Unfortunately, certain cancers specific constructs), or fragments or derivatives thereof, that are non-responsive or minimally responsive to Such treat have unexpectedly been found to silence, neutralize, reduce, ments. For example, in some patients tumors exhibit gene 60 decrease, deplete, moderate, diminish, reprogram, eliminate, mutations that render them non-responsive despite the gen or otherwise inhibit the ability of tumor initiating cells to eral effectiveness of selected therapies. Moreover, depend propagate, maintain, expand, proliferate or otherwise facili ing on the type of cancer and what form it takes some tate the Survival, recurrence, regeneration and/or metastasis available treatments, such as Surgery, may not be viable of neoplastic cells. In particularly preferred embodiments alternatives. Limitations inherent in current standard of care 65 the antibodies or immunoreactive fragments may be asso therapeutics are particularly evident when attempting to treat ciated with or conjugated to one or more anti-proliferative or patients who have undergone previous treatments and have anti-cancer agents (e.g., a cytotoxic agent). US 9,534,058 B2 3 4 With regard to such modulators it will be appreciated that ID NO: 60, SEQ ID NO: 62, SEQID NO: 64, SEQID NO: compatible antibodies may take on any one of a number of 66, SEQID NO: 68 and SEQID NO: 70 and wherein said forms including, for example, bispecific or multispecific heavy chain variable region comprises an amino acid antibodies, polyclonal or monoclonal antibodies, chimeric, sequence having at least 60% identity to an amino acid CDR grafted, humanized or human antibodies and immu sequence selected from the group consisting of amino acid noreactive fragments and/or variants of each of the forego sequences as set forth in SEQID NO: 21, SEQ ID NO: 23, ing. In selected embodiments modulators compatible with SEQID NO: 25, SEQ ID NO: 27, SEQID NO: 29, SEQ ID the instant invention may comprise bispecific or multispe NO:31, SEQID NO:33, SEQID NO:35, SEQID NO:37, cific constructs comprising a first binding site or component SEQID NO:39, SEQ ID NO:41, SEQID NO:43, SEQ ID that recognizes, associates or binds to a first phenotypic 10 NO:45, SEQID NO:47, SEQID NO:49, SEQID NO:51, determinant of CD324 (e.g., an epitope) and a second SEQID NO:53, SEQ ID NO:55, SEQID NO:57, SEQ ID binding site or component that recognizes, associates or NO:59, SEQID NO: 61, SEQID NO: 63, SEQID NO: 65, binds with a phenotypic component that is not the same as SEQ ID NO: 67, SEQ ID NO: 69 and SEQ ID NO: 71. In the first (i.e., a 'second epitope”). In any event particularly this respect preferred embodiments will comprise human referred embodiments will comprise antibodies (including 15 ized antibodies incorporating Such heavy and light chain bispecific antibodies) that are relatively non-immunogenic variable regions. In still other embodiments the modulators Such as humanized or fully human constructs. of the instant invention will comprise any antibody or Accordingly, in one aspect of the invention the modula immunoreactive fragment thereof that competes for binding tors will comprise a multispecific or bispecific antibody with any of the foregoing modulators. comprising a first binding site recognizing a first epitope on Other preferred embodiments will comprise a CD324 CD324 and a second binding site recognizing a second modulator selected or derived from the group consisting of epitope wherein said first and second epitopes are not SC10.6, SC10.15, SC10.17, SC10.19, SC10.35, SC10.36, equivalent. As will be discussed in more detail below, two SC10.38, SC10.75, SC10.111, SC10.112, SC10.115, epitopes that are “not equivalent” shall be held to mean any SC10.118, SC10.123, SC 10.124, SC10.125, SC10.126, two epitopes that are immunologically distinct and where 25 SC10.127, SC10.128, SC10.129, SC10.130, SC10.132, there is no competition between the binding sites of the SC10.133, SC10.134, SC 10.163, SC10.168, and SC10.178. multispecific constructs. With this in mind it will be appre Of course, in view of the instant disclosure those skilled ciated that the second epitope may be an non-competing in the art could readily identify CDRs associated with each epitope on CD324 (i.e., the binding sites are in different of the aforementioned heavy and light chain variable regions CD324bins) or an epitope presented by an antigen that is not 30 and use those CDRs to engineer or fabricate chimeric, CD324. humanized or CDR grafted antibodies without undue experi Of course, in view of the instant disclosure those skilled mentation. As such, in selected embodiments the present in the art could readily identify one or more complemen invention is directed to anti-CD324 antibodies comprising tarity determining regions (CDRS) associated with heavy one or more CDRs from a variable region sequence set forth and light chain variable regions of CD324 antibody modu 35 in FIG. 11A or FIG. 11B. In preferred embodiments such lators and use those CDRs to engineer or fabricate multi antibodies will comprise monoclonal antibodies and, in even specific, chimeric, humanized or CDR grafted antibodies more preferred embodiments will comprise bispecific, chi without undue experimentation. Accordingly, in certain pre meric, CDR grafted or humanized antibodies. As discussed ferred embodiments CD324 modulators comprise an anti in more detail below still other embodiments will comprise body that incorporates one or more complementarity deter 40 Such antibodies conjugated or associated with one or more mining regions (CDRs) as defined in FIGS. 11A and 11B and cytotoxic agents. derived from the light (FIG. 11A) or heavy (FIG. 11B) Accordingly, in other embodiments the instant invention contiguous chain murine variable regions (SEQ ID NOS: will comprise a humanized CD324 modulator termed 20-71) set forth therein. In preferred embodiments such hSC10.17. Still other embodiments are directed to a CD324 antibodies will comprise monoclonal antibodies and, in even 45 modulator comprising a humanized antibody wherein said more preferred embodiments, will comprise bispecific, chi humanized antibody comprises a light chain variable region meric, CDR grafted or humanized antibodies. and a heavy chain variable region wherein said light chain Exemplary nucleic acid sequences encoding each of the variable region comprises an amino acid sequence having at amino acid sequences set forth in FIGS. 11A and 11B are least 60% identity to the amino acid sequence set forth in shown in FIG. 19 and comprise SEQ ID NOS: 120 to 173. 50 SEQ ID NO: 72 and wherein said heavy chain variable In this respect it will be appreciated that the invention further region comprises an amino acid sequence having at least comprises nucleic acid molecules (and associated con 60% identity to the amino acid sequence set forth in SEQID structs, vectors and host cells) encoding disclosed antibody NO: 73. variable region amino acid sequences including those set Besides the aforementioned aspects, other preferred forth in FIG. 19. 55 embodiments of the instant invention will comprise CD324 In selected embodiments compatible CD324 modulators modulators associated or conjugated to one or more drugs to may comprise an antibody having a light chain variable provide modulator conjugates that may be particularly effec region and a heavy chain variable region wherein said light tive in treating proliferative disorders (alone or in combi chain variable region comprises an amino acid sequence nation with other pharmaceutically active agents). More having at least 60% identity to an amino acid sequence 60 generally, once the modulators of the invention have been selected from the group consisting of amino acid sequences fabricated and selected they may be linked with, fused to, as set forth in SEQID NO: 20, SEQID NO: 22, SEQID NO: conjugated to (e.g., covalently or non-covalently) or other 24, SEQID NO: 26, SEQID NO: 28, SEQID NO:30, SEQ wise associated with pharmaceutically active or diagnostic ID NO:32, SEQ ID NO:34, SEQID NO:36, SEQID NO: moieties or biocompatible modifiers. As used herein the 38, SEQID NO:40, SEQID NO: 42, SEQID NO: 44, SEQ 65 term "conjugate' or “modulator conjugate' or “antibody ID NO:46, SEQ ID NO:48, SEQID NO:50, SEQID NO: conjugate' will be used broadly and held to mean any 52, SEQID NO:54, SEQID NO:56, SEQID NO:58, SEQ biologically active or detectable molecule or drug associated US 9,534,058 B2 5 6 with the disclosed modulators regardless of the method of promised mice. Alternatively, the limiting dilution analysis association. In this respect it will be understood that such may be conducted using in vitro limiting dilution analysis conjugates may, in addition to the disclosed modulators, comprising limiting dilution deposition of live human tumor comprise peptides, polypeptides, proteins, prodrugs which cells into in vitro colony Supporting conditions. In either are metabolized to an active agent in vivo, polymers, nucleic case, the analysis, calculation or quantification of the reduc acid molecules, Small molecules, binding agents, mimetic tion in frequency will preferably comprise the use of Poisson agents, synthetic drugs, inorganic molecules, organic mol distribution statistics to provide an accurate accounting. It ecules and radioisotopes. Moreover, as indicated above the will be appreciated that, while Such quantification methods selected conjugate may be covalently or non-covalently are preferred, other, less labor intensive methodology Such associated with, or linked to, the modulator and exhibit 10 as flow cytometry or immunohistochemistry may also be various stoichiometric molar ratios depending, at least in used to provide the desired values and, accordingly, are part, on the method used to effect the conjugation. expressly contemplated as being within the scope of the Particularly preferred aspects of the instant invention will instant invention. In such cases the reduction in frequency comprise antibody modulator conjugates or antibody-drug may be determined using flow cytometric analysis or immu conjugates that may be used for the diagnosis and/or treat 15 nohistochemical detection of tumor cell Surface markers ment of proliferative disorders. Such conjugates may be known to enrich for tumor initiating cells. represented by the formula M-L-Din where M stands for a As such, in another preferred embodiment of the instant disclosed modulator or target binding moiety, L is an invention comprises a method of treating a CD324 associ optional linker or linker unit, D is a compatible drug or ated disorder comprising administering a therapeutically prodrug and n is an integer from about 1 to about 20. It will effective amount of a CD324 modulator to a subject in need be appreciated that, unless otherwise dictated by context, the thereof whereby the frequency of tumor initiating cells is terms “antibody-drug conjugate' or "ADC or the formula reduced. Preferably the CD324 associated disorder com M-L-Din shall be held to encompass conjugates comprising prises a neoplastic disorder. Again, the reduction in the both therapeutic and diagnostic moieties. In such embodi tumor initiating cell frequency will preferably be determined ments antibody-drug conjugate compounds will typically 25 using in vitro or in vivo limiting dilution analysis. comprise anti-CD324 as the modulator unit (M), a thera In this regard it will be appreciated that the present peutic or diagnostic moiety (D), and optionally a linker (L) invention is based, at least in part, upon the discovery that that joins the drug and the antigen binding agent. In a CD324 immunogens are associated with tumor perpetuating preferred embodiment, the antibody is a CD324 mAb com cells (i.e., cancer stem cells) that are involved in the etiology prising at least one CDR from the heavy and light chain 30 of various proliferative disorders including neoplasia. More variable regions as described above. specifically, the instant application unexpectedly demon As previously alluded to, certain embodiments of the strates that the administration of various exemplary CD324 invention are directed to CD324 modulators comprising modulators can mediate, reduce, deplete, inhibit or eliminate bispecific or multispecific constructs (e.g., bispecific or tumorigenic signaling by tumor initiating cells (i.e., reduce multispecific antibodies). Consistent with these art-recog 35 the frequency of tumor initiating cells). This reduced sig nized terms, and as discussed in more detail below, bispe naling, whether by depletion, neutralization, reduction, cific constructs (i.e., bispecific antibodies) shall be held to elimination, reprogramming or silencing of the tumor initi comprise any compound or molecule that specifically asso ating cells or by modifying tumor cell morphology (e.g., ciates or binds to two discrete immunogenic determinants or induced differentiation, niche disruption), in turn allows for epitopes. Similarly, multispecific constructs shall be held to 40 the more effective treatment of CD324 associated disorders comprise any compound or molecule that specifically asso by inhibiting tumorigenesis, tumor maintenance, expansion ciates or binds to two or more discrete determinants. For the and/or metastasis and recurrence. purposes of the instant disclosure the terms “multispecific Besides the aforementioned association with cancer stem construct” or multispecific antibody' shall be held to include cells, there is evidence that disregulated CD324 on abnormal bispecific constructs or bispecific antibodies unless other 45 cells may be involved in homotypic and heterotypic binding wise dictated by contextual constraints. In particularly pre that promotes unnatural cellular association that may con ferred embodiments the determinants recognized by the tribute to tumor growth or maintenance. Intervention in the binding sites of a multispecific construct will comprise proliferation of Such tumorigenic cells using the novel epitopes present on a phenotypic determinant (e.g., a gly CD324 modulators described herein, may thereby amelio coprotein). It will be appreciated that Such epitopes may 50 rate or treat a disorder by more than one mechanism (i.e., comprise proteins, carbohydrates lipids, etc. or some com tumor initiating cell reduction and disruption of oncogenic bination thereof. Moreover, the binding sites or components pathway signaling) to provide additive or synergistic effects. of the multispecific modulators may recognize epitopes on a Still other preferred embodiments may take advantage of the single protein or molecule, epitopes on two or more protein cellular internalization of disregulated cell surface CD324 to Subunits, epitopes on two or more discrete molecules or 55 deliver a modulator mediated anti-cancer agent. In this proteins or, in selected embodiments, epitopes on proteins regard it will be appreciated that the present invention is not expressed on two discrete cells. limited by any particular mechanism of action but rather Another significant aspect of the invention comprises the encompasses the broad use of the disclosed modulators to therapeutic association of CD324 polypeptides with various treat CD324 associated disorders (including various neopla cancer stem cells. Thus, in certain embodiments the inven 60 sia). tion will comprise a CD324 modulator that reduces the Thus, in other embodiments the present invention will frequency of tumor initiating cells upon administration to a comprise the use of the disclosed modulators that inhibit or subject. Preferably the reduction in frequency will be deter interfere with CD324 homotypic interactions and the use mined using in vitro or in Vivo limiting dilution analysis. In thereof to treat proliferative disorders. In still other preferred particularly preferred embodiments such analysis may be 65 embodiments the present invention is directed to modulators conducted using in vivo limiting dilution analysis compris that inhibit or interfere with CD324 heterotypic interactions ing transplant of live human tumor cells into immunocom and the use thereof to treat proliferative disorders. US 9,534,058 B2 7 8 With respect to this aspect (i.e., homotypic or heterotypic pathways and collateral benefits, may be achieved whether inhibition) of the invention those of skill in the art will the subject tumor tissue exhibits elevated levels of CD324 or appreciate that modulators may readily be generated and reduced or depressed levels of CD324 as compared with selected for that selectively inhibit homotypic binding or normal adjacent tissue. Particularly preferred embodiments heterotypic binding or that inhibit or block both types of 5 will comprise the treatment of disorders exhibiting elevated association. That is, through the selection of particular levels of CD324 on tumorigenic cells as compared to normal immunization reagents and the use of common screening tissue or non-tumorigenic cells. techniques (e.g., ELISA assays) modulators may be pro In yet another aspect the present invention will comprise duced that preferentially reduce either homotypic or hetero a method of treating a Subject Suffering from a neoplastic typic associations. Moreover, in particularly preferred 10 disorder comprising the step of administering a therapeuti embodiments modulators may be provided that can selec cally effective amount of at least one internalizing CD324 tively inhibit specific types of heterotypic interactions such modulator. Preferred embodiments will comprise the admin as, for example, those involving CD324 and EGFR or istration of internalizing antibody modulators wherein, in CD324 and CEB7. Accordingly, such modulators and their other selected embodiments, the internalizing antibody use in treating proliferative disorders are expressly contem 15 modulators are conjugated or associated with a cytotoxic plated as being within the scope of the instant invention. agent. Other facets of the instant invention may exploit the Other embodiments are directed to a method of treating a ability of the disclosed modulators to potentially disrupt subject suffering from a CD324 associated disorder com oncogenic pathways while simultaneously silencing tumor prising the step of administering a therapeutically effective initiating cells. Such multi-active CD324 modulators (e.g., amount of at least one depleting CD324 modulator. CD324 antagonists) may prove to be particularly effective In yet another embodiment the present invention provides when used in combination with standard of care anti-cancer methods of maintenance therapy wherein the disclosed agents or debulking agents. Accordingly preferred embodi effectors or modulators are administered over a period of ments of the instant invention comprise using the disclosed time following an initial procedure (e.g., chemotherapeutic, modulators as anti-metastatic agents for maintenance 25 radiation or Surgery) designed to remove at least a portion of therapy following initial treatments. In addition, two or more the tumor mass. Such therapeutic regimens may be admin CD324 antagonists (e.g. antibodies that specifically bind to istered over a period of weeks, a period of months or even two discrete epitopes on CD324) may be used in combina a period of years wherein the CD324 modulators may act tion in accordance with the present teachings. In selected prophylactically to inhibit metastasis and/or tumor recur embodiments the present invention will comprise the first 30 rence. In yet other embodiments the disclosed modulators administration of a CD324 modulator to reduce or eliminate may be administrated in concert with known debulking an antigen sink (e.g., expression of a determinant on non regimens to prevent or retard metastasis, tumor maintenance targeted cells) and the Subsequent administration of a thera O CUCC. peutically effective amount of a CD324 modulator. In such In yet other preferred embodiments the modulators will embodiments the first administered modulator may be the 35 associate or bind to a specific epitope, portion, motif or same or different than the Subsequently administered modu domain of CD324. The CD324 protein is composed of four lator. In certain preferred embodiments the first administered extracellular cadherin repeats (EC1-EC4) of approximately CD324 modulator will be non-internalizing. In other pre 110 amino acids, a membrane proximal extracellular domain ferred embodiments the first administered CD324 modulator (EC5) that is less closely related to the other cadherin will be followed by administration of an internalizing 40 repeats, a transmembrane domain, and a highly conserved CD324 antibody which, in selected embodiments is conju intracellular domain that can be further subdivided into the gated to a cytotoxic agent. As discussed in some detail juxtamembrane domain (JMD) and a highly-phosphorylated below, the CD324 modulators of the present invention may B-catenin binding domain (CBD). Accordingly, in certain generally be used in a conjugated or unconjugated State and, embodiments the modulators will bind or associate with one optionally, as a sensitizing agent in combination with a 45 of the extracellular domains: EC1, EC2, EC3, EC4 or EC5. variety of chemical or biological anti-cancer agents. Other aspects of the instant invention comprise modulators Accordingly another preferred embodiment of the instant that associate or bind to a specific epitope located in an invention comprises a method of sensitizing a tumor in a extracellular domain of CD324. Of course it will be appre Subject for treatment with an anti-cancer agent comprising ciated that each of the aforementioned domains may com the step of administering a CD324 modulator to said subject. 50 prise more than one epitope and may be associated with Other embodiments comprise a method of reducing metas more than one bin. tasis or tumor recurrence following treatment comprising With regard to modulator or antibody “bins' it will be administering a CD324 modulator to a subject in need appreciated that the CD324 antigen may be analyzed or thereof. In a particularly preferred aspect of the invention the mapped through competitive antibody binding using art CD324 modulator will specifically result in a reduction of 55 recognized techniques to define specific bins located on or tumor initiating cell frequency as determined using in vitro along the protein. While discussed in more detail herein and or in Vivo limiting dilution analysis. shown in Example 7 below, two antibodies (one of which More generally preferred embodiments of the invention may be termed a “reference antibody,” “bin delineating comprise a method of treating a CD324 associated disorder antibody' or “delineating antibody') may be considered to in a Subject in need thereof comprising the step of admin 60 be in the same bin if they compete with each other for istering a CD324 modulator to the subject. In particularly binding to the target antigen. In Such cases the Subject preferred embodiments the CD324 modulator will be asso antibody epitopes may be identical, Substantially identical or ciated (e.g., conjugated) with an anti-cancer agent. In yet close enough (either in a linear sense where they are other embodiments the CD324 modulator will internalize separated by a few amino acids or conformationally) so that following association or binding with the CD324 on or near 65 both antibodies are sterically or electrostatically inhibited or the surface of the cell. Moreover the beneficial aspects of the precluded from binding to the antigen. Such defined bins instant invention, including any disruption of signaling may be generally associated with certain CD324 domains US 9,534,058 B2 9 10 (e.g. the reference antibody will bind with an epitope embodiment comprises a method of diagnosing a hyperpro contained in a specific domain) though the correlation is not liferative disorder in a subject in need thereof comprising the always precise (e.g., there may be more than one bin in a steps of domain or the bin may be defined conformationally and a. obtaining a tissue sample from said Subject; comprise more than one domain). In any event it will be 5 b. contacting the tissue sample with at least one CD324 appreciated that those skilled in the art can readily determine modulator; and the relationship between CD324 domains and empirically c. detecting or quantifying the CD324 modulator associ determined bins. ated with the sample. With regard to the present invention competitive binding Such methods may be easily discerned in conjunction analysis using art recognized techniques (e.g., ELISA, Sur 10 face plasmon resonance or bio-layer interferometry) defined with the teachings of the instant application and may be at least six distinct bins, each of which was found to contain readily performed using generally available commercial a number of antibody modulators. For the purposes of the technology Such as automatic plate readers, dedicated instant disclosure five of the bins were termed bin A to bin reporter systems, etc. In selected embodiments the CD324 E and the sixth bin (not as well defined) was termed bin U. 15 modulator will be associated with tumor perpetuating cells More particularly bins A-E comprise unique defined bins present in the sample. In other preferred embodiments the and the antibodies contained in each of these bins compete detecting or quantifying step will comprise a reduction of with each other for binding to the SEZ6 protein. Bin U tumor initiating cell frequency and detection thereof. More contains antibodies that do not compete with antibodies in over, limiting dilution analysis may be conducted as previ Bins A-E, but may compete for binding with each other. ously alluded to above and will preferably employ the use of Thus, in selected embodiments the present invention will Poisson distribution statistics to provide an accurate comprise a modulator residing in a bin selected from the accounting as to the reduction of frequency. group consisting of bin A, bin B, bin C, bin D, bin E, and bin In a similar vein the present invention also provides kits U. or devices and associated methods that are useful in the In other selected embodiments the present invention will 25 diagnosis and monitoring of CD324 associated disorders comprise a modulator residing in a bin selected from the Such as cancer. To this end the present invention preferably group consisting of bin A, bin B, bin C, bin D, and bin E. In provides an article of manufacture useful for diagnosing or yet other embodiments the present invention comprise a treating CD324 associated disorders comprising a receptacle modulator residing in a bin defined by a reference antibody comprising a CD324 modulator and instructional materials selected from the group consisting of SC10.6, SC 10.15, 30 for using said CD324 modulator to treat or diagnose the SC10.17, SC10.19, SC10.35, SC10.36, SC10.38, SC10.75, CD324 associated disorder. In selected embodiments the SC10.111, SC10.112, SC10.115, SC10.118, SC10.123, devices and associated methods will comprise contacting at SC10.124, SC10.125, SC 10.126, SC 10.127, SC10.128, least one circulating tumor cell. SC10.129, SC10.130, SC10. 132, SC10.133, SC10.134, Other preferred embodiments of the invention also exploit SC10.163, SC 10.168, and SC10.178. In still other embodi 35 the properties of the disclosed modulators as an instrument ments the invention will comprise modulators from bin A, useful for identifying, characterizing, isolating, sectioning or modulators from bin B, modulators from bin C, modulators enriching populations or Subpopulations of tumor initiating from bin D or modulators from bin E. Yet other preferred cells through methods such as flow cytometric analysis, embodiments will comprise a reference antibody modulator fluorescence activated cell sorting (FACS) or laser mediated and any antibody that competes with the reference antibody. 40 Sectioning. The term “compete' or “competing antibody' when used As such, another preferred embodiment of the instant in the context of the disclosed modulators means binding invention is directed to a method of identifying, isolating, competition between antibodies as determined by an assay sectioning or enriching a population of tumor initiating cells in which a reference antibody or immunologically functional comprising the step of contacting said tumor initiating cells fragment prevents or inhibits or reduces (e.g., greater than 45 with a CD324 modulator. 40%) specific binding of a test antibody to a common The foregoing is a Summary and thus contains, by neces antigen. Compatible methods for determining Such compe sity, simplifications, generalizations, and omissions of tition comprise art known techniques such as, for example, detail; consequently, those skilled in the art will appreciate bio-layer interferometry, Surface plasmon resonance, flow that the Summary is illustrative only and is not intended to cytometry, competitive ELISA, etc. 50 be in any way limiting. Other aspects, features, and advan Beyond the therapeutic uses discussed above it will also tages of the methods, compositions and/or devices and/or be appreciated that the modulators of the instant invention other subject matter described herein will become apparent may be used to diagnose CD324 related disorders and, in in the teachings set forth herein. The Summary is provided particular, proliferative disorders. In some embodiments the to introduce a selection of concepts in a simplified form that modulator may be administered to the subject and detected 55 are further described below in the Detailed Description. This or monitored in vivo. Those of skill in the art will appreciate Summary is not intended to identify key features or essential that such modulators may be labeled or associated with features of the claimed subject matter, nor is it intended to markers or reporters as disclosed below and detected using be used as an aid in determining the scope of the claimed any one of a number of standard techniques (e.g., MRI. CAT Subject matter. Scope of the claimed subject matter. scan PET scan, etc.). 60 Thus, in Some embodiments the invention will comprise BRIEF DESCRIPTION OF THE FIGURES a method of diagnosing, detecting or monitoring a CD324 associated disorder in vivo in a subject in need thereof FIGS. 1A and 1B depict, respectively, the mRNA tran comprising the step of administering a CD324 modulator. Script that contains the open reading frame (underlined In other instances the modulators may be used in an in 65 nucleotides) encoding prepro human CD324 (SEQ ID NO: vitro diagnostic setting using art-recognized procedures 1), the corresponding amino acid sequence of prepro human (e.g., immunohistochemistry or IHC). As such, a preferred CD324 (SEQ ID NO: 2), with the final mature protein in US 9,534,058 B2 11 12 underlined amino acid residues, and the corresponding immunocompromised mice whereby the tumorigenicity of amino acid sequence of human CD324 signal peptide various CD46 and CD324 phenotypes are demonstrated; bolded; FIGS. 11A and 11B provide, in a tabular form, the FIGS. 2A and 2B are graphical representations of flow contiguous amino acid sequences (SEQ ID NOS: 20-73) of cytometry-based determination of CD324 protein expres heavy and light chain variable regions of a number of sion on the Surface of individual human tumor cell popula exemplary murine CD324 modulators along with a human tions derived from NTX colorectal (CR), pancreatic (PA), ized construct isolated, cloned and engineered as described breast (BR), lung (“LU) and ovarian (“OV) tumors (FIGS. in the Examples herein; 2A and 2B), or a primary human ovarian tumor (FIG. 2B), FIG. 12 provides, in a tabular representation, selected displayed as histogram plots (black line) referenced to 10 biochemical and immunological characteristics of exem fluorescence minus one (FMO) isotype-control stained plary CD324 modulators; populations (Solid gray); FIG. 13 shows comparative binding affinities of a selected FIGS. 3A and 3B depict, respectively, a scatter plot murine modulator and its humanized counterpart; demonstrating the CD46 CD324 phenotype of the parental FIGS. 14A-14D are graphical and tabular representations tumor, an enriched CD46"CD324" subpopulation trans 15 illustrating that CD324 modulators may effectively be used planted into a recipient animal, and the CD46 CD324 as targeting moieties to direct cytotoxic payloads to cells phenotype of the resultant daughter tumor (FIG. 3A) and the expressing CD324, wherein the decrease in normalized RLU tumorigenicity of the various sorted subpopulations (FIG. value is indicative of cell killing through internalized toxin, 3B) from a representative colorectal tumor (CR14); and the EC50 (e.g., half-maximal effective concentration) FIGS. 4A and 4B depict, respectively, a scatter plot was determined for selected modulators; demonstrating the CD46 CD324 phenotype of the parental FIG. 15 is a graphical representation demonstrating that tumor, an enriched CD46"CD324" subpopulation trans the disclosed CD324 modulators may effectively be used as planted into a recipient animal, and the CD46 CD324 targeting moieties to direct cytotoxic payloads to various phenotype of the resultant daughter tumor (FIG. 4A) and a patient-derived non-traditional Xenograft cells expressing graphical representation of the tumorigenicity of the various 25 CD324 wherein the decrease in normalized RLU value is sorted subpopulations (FIG. 4B) from a representative pan indicative of cell killing through internalized toxin; creatic tumor (PA4); FIG. 16 illustrates the ability of the disclosed modulators FIGS. 5A and 5B depict, respectively, a scatter plot to inhibit CD324 homotypic binding: demonstrating the CD46 CD324 phenotype of the parental FIG. 17 demonstrates that humanized CD324 modulators tumor, an enriched CD46"CD324" subpopulation trans 30 may effectively be used as targeting moieties to direct planted into a recipient animal, and the CD46 CD324 cytotoxic payloads to cells expressing CD324, wherein the phenotype of the resultant daughter tumor (FIG. 5A) and a decrease in normalized RLU value is indicative of cell graphical representation of the tumorigenicity of the various killing through internalized toxin and where the determined sorted subpopulations (FIG. 5B) from a representative non EC50 (e.g., half-maximal effective concentration) values are small cell lung cancer tumor (LU37); 35 indicative of efficient cell killing: FIGS. 6A and 6B depict, respectively, a scatter plot FIGS. 18A and 18B illustrate the in vivo efficacy of an demonstrating the ESA CD324 phenotype of the parental exemplary antagonistic CD324 modulator in reducing the tumor, an enriched ESA"CD46"CD324" subpopulation tumor size of two individual patient-derived NTX cells from transplanted into a recipient animal, and the ESA CD324 pancreatic tumors; and phenotype of the resultant daughter tumor (FIG. 6A) and a 40 FIG. 19 depicts nucleic acid sequences (SEQ ID NOS: graphical representation of the tumorigenicity of the various 120-173) encoding each of the heavy and light chain vari sorted subpopulations (FIG. 6B) from a representative breast able region amino acid sequences of CD324 modulators set tumor (BR22); forth in FIGS. 11A and 11B. FIGS. 7A and 7B depict, respectively, a scatter plot demonstrating the ESA CD324 phenotype of the parental 45 DETAILED DESCRIPTION OF THE tumor and an enriched ESA"CD46"CD324" subpopulation INVENTION (FIG. 7A) and a graphical representation of the tumorige nicity of the various sorted subpopulations (FIG. 7B) from I. Introduction a representative ovarian tumor (OV45); While the present invention may be embodied in many FIGS. 8A and 8B depict, respectively, scatter plots dem 50 different forms, disclosed herein are specific illustrative onstrating the CD324 phenotype of the parental tumor, an embodiments thereof that exemplify the principles of the enriched CD324" subpopulation transplanted into a recipi invention. It should be emphasized that the present invention ent animal, and the CD324 phenotype of the resultant is not limited to the specific embodiments illustrated. More daughter tumor (FIG. 8A) and a graphical representation of over, any section headings used herein are for organizational the tumorigenicity of the various sorted Subpopulations 55 purposes only and are not to be construed as limiting the (FIG. 8B) from a representative small-cell lung cancer tumor subject matter described. Finally, for the purposes of the (LU64); instant disclosure all identifying sequence Accession num FIGS. 9A and 9B depict, respectively, scatter plots dem bers may be found in the NCBI Reference Sequence (Ref. onstrating the CD46 CD324 phenotype of a parental tumor, Seq) database and/or the NCBI GenBank R archival and enriched CD46"CD324"CD46"CD324 subpopula 60 sequence database unless otherwise noted. tions that are then transplanted into a recipient animal (FIG. As discussed above it has surprisingly been found that 9A), and a graphical representation of the tumorigenicity of CD325 genotypic and/or phenotypic determinants are asso the various sorted subpopulations (FIG. 9B) from a repre ciated with various proliferative disorders, including neo sentative primary melanoma tumor; plasia, and that CD324 and variants thereof provide useful FIGS. 10A and 10B comprise tabular summaries of rep 65 tumor markers which may be exploited in the treatment of resentative colorectal, lung, pancreatic, breast and ovarian related diseases. Moreover, as shown in the instant applica tumor cell Subpopulations enriched and transplanted into tion it has unexpectedly been found that CD324 markers or US 9,534,058 B2 13 14 determinants such as cell surface CD324 protein are thera target such disregulated CD324 and immunospecifically peutically associated with cancer stem cells (also known as deliver cytotoxic payloads to tumorigenic cells. tumor perpetuating cells) and may be effectively exploited to To that end, and as demonstrated in the instant applica eliminate or silence the same. The ability to selectively tion, it has unexpectedly been found that the disclosed reduce or eliminate cancer stem cells (e.g., through the use 5 CD324 modulators can effectively be used to target and of conjugated CD324 modulators) is particularly Surprising eliminate or otherwise incapacitate proliferative or tumori in that such cells are known to generally be resistant to many genic cells and treat CD324 associated disorders (e.g., conventional treatments. That is, the effectiveness of tradi neoplasia). As used herein a “CD324 associated disorder tional, as well as more recent targeted treatment methods, is shall be held to mean any disorder or disease (including often limited by the existence and/or emergence of resistant 10 proliferative disorders) that is marked, diagnosed, detected cancer stem cells that are capable of perpetuating tumor or identified by a phenotypic or genotypic aberration of growth even in face of these diverse treatment methods. CD324 genetic components or expression (“CD324 deter Further, determinants associated with cancer stem cells often minant') during the course or etiology of the disease or make poor therapeutic targets due to low or inconsistent disorder. In this regard a CD324 phenotypic aberration or expression, failure to remain associated with the tumori- 15 determinant may, for example, comprise elevated or genic cell or failure to present at the cell Surface. In sharp depressed levels of CD324 protein expression, abnormal contrast to the teachings of the prior art, the instantly CD324 protein expression on certain definable cell popula disclosed compounds and methods effectively overcome this tions or abnormal CD324 protein expression at an inappro inherent resistance and to specifically eliminate, deplete, priate phase or stage of a cell lifecycle. Of course, it will be silence or promote the differentiation of such cancer stem 20 appreciated that similar expression patterns of genotypic cells thereby negating their ability to Sustain or re-induce the determinants (e.g., mRNA transcription levels) of CD324 underlying tumor growth. may also be used to classify, detect or treat CD324 disorders. Thus, it is particularly remarkable that CD324 modulators As used herein the term “determinant’ or "CD324 deter Such as those disclosed herein may advantageously be used minant' shall mean any detectable trait, property, marker or in the prognosis, diagnosis, theragnosis, treatment and/or 25 factor that is identifiably associated with, or specifically prevention of selected proliferative (e.g., neoplastic) disor found in or on a particular cell, cell population or tissue ders in subjects in need thereof. It will be appreciated that, including those identified in or on a tissue, cell or cell while preferred embodiments of the invention will be dis population affected by a CD324 associated disease or dis cussed extensively below, particularly in terms of particular order. In selected preferred embodiments the CD324 modu multispecific constructs, antigen regions or epitopes or in the 30 lators may associate, bind or react directly with the CD324 context of cancer stem cells or tumor cell populations and determinant (e.g., cell surface CD324 protein or CD324 their interactions with the disclosed modulators, those mRNA) and thereby ameliorate the disorder. More generally skilled in the art will appreciate that the scope of the instant determinants may be morphological, functional or bio invention is not limited by Such exemplary embodiments. chemical in nature and may be genotypic or phenotypic. In Rather, the most expansive embodiments of the present 35 other preferred embodiments the determinant is a cell sur invention and the appended claims are broadly and expressly face antigen or genetic component that is differentially or directed to CD324 modulators (including conjugated and preferentially expressed (or is not) by specific cell types multispecific modulators) and their use in the prognosis, (e.g., cancer stem cells) or by cells under certain conditions diagnosis, theragnosis, treatment and/or prevention of a (e.g., during specific points of the cell cycle or cells in a variety of CD324 associated or mediated disorders, includ- 40 particular niche). In still other preferred embodiments the ing neoplastic or cell proliferative disorders, regardless of determinant may comprise a gene or genetic entity that is any particular mechanism of action or specifically targeted differently regulated (up or down) in a specific cell or tumor, cellular or molecular component. discrete cell population, a gene that is differentially modified With regard to the instant invention CD324 protein is with regard to its physical structure and chemical composi known to bind other CD324 proteins, otherwise known as 45 tion or a protein or collection of proteins physically asso homotypic binding, in a calcium dependent manner. How ciated with a gene that show differential chemical modifi ever CD324 present on normal tissues may be sequestered in cations. Determinants contemplated herein are specifically tight junctions where homotypic binding domains are inac held to be positive or negative and may denote a cell, cell cessible. Conversely, in tumors CD324 is often disregulated Subpopulation or tissue (e.g., tumors) by its presence (posi and these homotypic binding domains may be accessible to 50 tive) or absence (negative). the modulators disclosed herein. Using such modulators in In a similar vein “CD324 modulators' of the invention accordance with the instant teachings that disrupt this func broadly comprise any compound that recognizes, reacts, tion may target cancer cells with disregulated CD324 while competes, antagonizes, interacts, binds, agonizes, or asso sparing the normal cells where the binding domain is ciates with a CD324 or a variant thereof (or specific masked. By inhibiting or disrupting Such homotypic inter- 55 domains, regions or epitopes thereof) or its genetic compo actions the neutralizing or antagonistic modulators of the nent. By these interactions, the CD324 modulators may instant invention may compromise, silence or otherwise advantageously eliminate, reduce or moderate the fre retard the growth or maintenance of tumorigenic cells. quency, activity, recurrence, metastasis or mobility of tum Similarly, as will be discussed in more detail below, the origenic cells (e.g., tumor perpetuating cells or cancer stem disregulated and exposed CD324 may promote heterotypic 60 cells). Exemplary modulators disclosed herein comprise interactions (i.e., where CD324 interacts with different nucleotides, oligonucleotides, polynucleotides, peptides or ligands) that may disrupt normal cell-cell interactions and polypeptides. In certain preferred embodiments the selected promote tumor growth. Again, interfering with Such hetero modulators will comprise antibodies to a CD324 protein typic interactions using the disclosed modulators may dis isoform or immunoreactive fragments or derivatives thereof. rupt abnormal cell associations and retard tumor mainte- 65 Such antibodies may be antagonistic or agonistic in nature nance or growth. In other embodiments the disclosed and may optionally be conjugated or associated with a modulators conjugated to cytotoxic agents may be used to therapeutic or diagnostic agent. Moreover, Such antibodies US 9,534,058 B2 15 16 or antibody fragments may comprise depleting, neutralizing mation and tumor invasion (Takeichi, 1990, 1991; Gum or internalizing antibodies. In other embodiments, modula biner, 1996; Nollet, 2000). Classical cadherins, a subfamily tors within the instant invention will constitute a CD324 of more than 16 cadherin molecules encoded by different construct comprising a CD324 isoform or a reactive frag genes and defined by the presence of five extracellular ment thereof. It will be appreciated that such constructs may cadherin (EC) domains and a conserved intracellular domain comprise fusion proteins and can include reactive domains that mediates interactions with catenins, make up a distinct from other polypeptides Such as immunoglobulins or bio group of phylogenetically and structurally related proteins logical response modifiers. In still other aspects, the CD324 with molecular weights of approximately 120 kDa. The modulator will comprise a nucleic acid moiety (e.g. miRNA, classic cadherins are differentially expressed during normal siRNA, shRNA, antisense constructs, etc.) that exerts the 10 embryonic development, Suggesting they have distinct func desired effects at a genomic level. Still other modulators tions related and unrelated to their adhesive capacity. compatible with the instant teachings will be discussed in CD324 (also known as E-cadherin or epithelial cadherin; detail below. gene symbol, CDH1) is a member of the classical subfamily More generally CD324 modulators of the present inven of cadherins, and as Such is a calcium-dependent cell-cell tion broadly comprise any compound that recognizes, reacts, 15 adhesion glycoprotein that mediates homotypic (i.e., epithe competes, antagonizes, interacts, binds, agonizes, or asso lial-epithelial) cell-cell adhesion. As used herein the term ciates with a CD324 determinant (genotypic or phenotypic) “CD324 or cluster of differentiation 324 (also known as including cell surface CD324 protein. Whichever form of CDH1, E-cadherin, E-cad, Cadherin-1, L-CAM, uvomor modulator is ultimately selected it will preferably be in an ulin, Arc-1 and cell-CAM 120/80) refers to naturally occur isolated and purified State prior to introduction into a subject. ring human CD324 or immunoreactive fragments or deriva In this regard the term "isolated CD324 modulator” or tives thereof unless contextually dictated otherwise. "isolated CD324 antibody” shall be construed in a broad Representative CD324 protein orthologs include, but are not sense and in accordance with standard pharmaceutical prac limited to, human (i.e. hCD324, NP 004351.1, AAI41839.1 tice to mean any preparation or composition comprising the and AAI46663.1), mouse (NP 033994.1), chimpanzee modulator in a state Substantially free of unwanted contami 25 (XM 001168150) and rat (NP 112624, BAA84920.1). nants (biological or otherwise). Moreover these preparations In humans the CD324 protein is encoded by the CDH1 may be purified and formulated as desired using various art gene (Shiozaki et al., 1996; Huntsman and Caldas, 1998) recognized techniques. Of course, it will be appreciated that consisting of 16 exons spanning 98.3 kb located on chro such "isolated preparations may be intentionally formu mosome 16q22. The CDH1 gene is transcribed and spliced lated or combined with inert or active ingredients as desired 30 into a 4815 bp mature mRNA transcript (FIG. 1A: SEQ ID to improve the commercial, manufacturing or therapeutic NO. 1), which has an open reading frame encoding a aspects of the finished product and provide pharmaceutical preproprotein of 882 amino acids (FIG. 1B: SEQID NO: 2). compositions. In a broader sense the same general consid Further, human CD324 preproproteins include a predicted erations may be applied to an "isolated CD324 protein or signal or leader sequence comprising amino acids 1-22 variant thereof or an "isolated nucleic acid encoding the 35 (bolded in FIG. 1B), which is clipped off to provide the SaC. proprotein (i.e., 860 aa, amino acids 23-882, FIG. 1B). Besides the association with tumors generally discussed Those skilled in the art will appreciate that this signal above, there are also indications of phenotypic or genotypic peptide targets the polypeptide to the cell Surface/secretory association between selected tumor initiating cells (TIC) and pathway. During its trafficking to the cell Surface, the CD324 determinants. In this regard selected TICs (e.g., 40 proprotein is glycosylated and proteolytically cleaved by a cancer stem cells) may express elevated levels of CD324 furin-like protease into the mature 728 amino acid CD324 proteins when compared to normal tissue and non-tumori protein (FIG. 1B). Comparison of the human CD324 to the genic cells (NTG), which together typically comprise much other well characterized members of the cadherin family, of a solid tumor. Thus, CD324 determinants may comprise shows a homology to human P-cadherin of 56% at the DNA a tumor associated marker (or antigen or immunogen) and 45 (ORF) level and of 60% at the (mature) protein level when the disclosed modulators may provide effective agents for compared to the mature CD324 protein. Similarly, with the detection and Suppression of TIC and associated neo regard to human N-cadherina homology of 59% at the DNA plasia due to altered levels of the proteins on cell surfaces or (ORF) level and 49% at the (mature) CD324 protein level in the tumor microenvironment. Accordingly, CD324 modu was found. Accordingly, CD324 appears well conserved lators, including immunoreactive antagonists and antibodies 50 between the different species and the sequence homology that associate, bind or react with the proteins, may effec among the various members of the cadherin family is tively reduce the frequency of tumor initiating cells and generally high. could be useful in eliminating, depleting, incapacitating, Epithelial cells are characterized by strong cell-cell adhe reducing, promoting the differentiation of, or otherwise sion interfaces. CD324 is a major protein component of the precluding or limiting the ability of these tumor-initiating 55 adherens junction, a specialized cell-cell adhesive site where cells to lie dormant and/or continue to fuel tumor growth, a variety of transmembrane glycoproteins interface with one metastasis or recurrence in a patient. In this regard those another and with the cytoskeleton (Niessen and Gottardi, skilled in the art will appreciate that the present invention 2008). The CD324 protein is composed of four extracellular further provides CD324 modulators and their use in reduc cadherin repeats (EC1 EC4) of approximately 110 amino ing the frequency of tumor initiating cells 60 acids, a membrane-proximal extracellular domain (EC5) II. CD324 Physiology that is less closely related to the other cadherin repeats, a Cadherins (Ca2+-dependent adhesion receptors) are a transmembrane domain, and a highly conserved intracellular class of type-1 transmembrane proteins involved in selective domain that can be further subdivided into the juxtamem cell-cell recognition. They play important roles in tissue brane domain (JMD) and a highly-phosphorylated B-catenin morphogenesis, cell recognition, cell adhesion and mainte 65 binding domain (CBD). Solution of the structure of an EC nance of tissue integrity in biological and pathological repeat domain revealed it to bear Striking similarity to an processes as diverse as early embryogenesis, synapse for immunoglobulin fold, although there is little sequence US 9,534,058 B2 17 18 homology between these two types of protein modules. cell-adhesion molecules also have functional roles in these Calcium ions bind at sites between the EC repeats of cell fate decisions. Samavarchi-Tehrani (2010) have shown cadherins, conferring a rigid rod-like structure to the extra that during reprogramming to induced pluripotent stem cellular portion of these proteins. cells, induction of MET by BMP (bone morphogenetic When cadherins were initially cloned and described, proteins) signaling was marked by CD324 upregulation and mixing experiments revealed that cells expressing similar adherens junction formation and occurred at the earliest cadherins associated with one another, whereas cells stages of reprogramming. Li and co-workers (2010) have expressing different cadherins segregated from one another, shown that specifically ablating CD324 expression dramati Suggesting that cadherins mediated homotypic associations cally inhibited reprogramming, while a new study by Red via homophilic (i.e., CD324-CD324) interactions (Nose et 10 mer and colleagues (2011) takes this work a step further and al. 1988). Mutagenesis and domain Swapping experiments shows that the loss of CD324 expression drives pluripotent have demonstrated that the extracellular domain of cadher stem cells to differentiate. Additionally, in Drosophila male ins mediates these interactions. Type I classical cadherins, germline cells, fly CD324 homolog expression is required like CD324 contain a conserved tryptophan residue at posi for proper orientation of the centrosome and spindles within tion 2 of the mature protein. An early model of homophilic 15 the germline stem cell during asymmetric stem cell division. interactions suggested that this tryptophan inserted into a Together these studies suggest that CD324 is not just a hydrophobic pocket on an adjacent CD324 molecule on a cis marker of fate change, but that the spatial and mechanical (same) or trans (apposing) cell surface (Nose et al. 1988: input provided by CD324 has an important role in altering Chen et al. 2005; Patel et al. 2006). This model implies that cell fate and is linked to fundamental stem cell biology. the cadherin molecule acquires competence for homophilic With respect to the development of cancer, disturbance of interactions, with prerequisites including processing of the the expression of CD324 is one of the main events in the prodomain and conformational changes in the protein during early and late steps of tumorigenesis and metastasis. Inac the formation of homophilic interactions. The specific tivating germline mutations of CDH1 that result in structur details of the nature of molecular interactions mediating the ally altered CD324 proteins or complete loss of CD324 homotypic binding remain debated, for instance if cis-dimer 25 expression have been correlated with gastric, breast, col formation is a prerequisite to trans-dimer formation, orectal, thyroid, and ovarian cancers. To date, 69 Somatic although the requirement for the conserved tryptophan in the mutations have been reported comprising, in addition to homotypic process is clear (Mohamet, 2011). mis-sense mutations, splice site mutations and truncation Besides the aforementioned homophilic adhesion mode of mutations caused by insertions, deletions, and nonsense CD324, the ectodomain of CD324 binds in a heterophilic 30 mutations. More generally, well-differentiated tumors have way (i.e., the binding of different types of cadherin to one long been known to exhibit a strong staining pattern of another) or with other specific molecules, such as EGFR or CD324/catenin compared to poorly differentiated ones. integrin C.E.B.7. Various studies have suggested that the Accordingly CD324 has been used by pathologists as a overall homo- or heterotypic cell association and sorting significant prognostic marker to diagnose different kinds of may be determined by the expression levels of the particular 35 cancer by immunohistochemistry. cadherins on each cell, as well as the shear forces the cells A characteristic of epithelial cancers is an apparent acti are subjected to during the mixing and segregation processes Vation of an EMT program leading to Subsequent invasion of (Duguay et al., 2003). Certain pairs of heterotypic interac the underlying mesenchyme. In these malignancy-associ tions were permitted at low shear forces, whereas high shear ated EMTs, CD324 and/or its adhesion partners are forces tended to favor homotypic interactions. Therefore the 40 degraded, allowing for the physical separation of cells from kinetics of the cadherin homo- or heterophilic interactions their epithelial sheet into the underlying mesenchyme may be more relevant than the thermodynamics of the (Acloque et al., 2009). Furthermore, blocking the degrada interaction with respect to the ultimate homo- or heterotypic tion of proteins like CD324 prevents invasion. Specific cell association. downregulation of CD324 function has been shown to occur The intracellular portions of CD324 interact with various 45 via several mechanisms: transcriptional repression of proteins inside the cell, including C-catenin, B-catenin and CD324 expression by E-box binding proteins such as Snail p120, which themselves interact with the actin filaments of and Slug, cleavage of CD324 protein from the cell surface the cytoskeleton (Perez-Moreno et al., 2003). Therefore, by metallomatrix proteases (e.g., MMP7, MMP13) overex CD324 is thought to act as a bridge between the cell pressed by tumors, and internalization of CD324 via HGF adhesion machinery and the cytoskeleton, and provide cells 50 induced c-met receptor activation. Together these reports with a compass that orients them in tissues such as stratified about the functional role of CD324 in providing mechanical epithelia. Cells expressing cytoplasmic deletion mutants of Support for cells, regulating cell localization and motility CD324, in which the binding to catenins is disturbed, fail to phenotypes, and its links to differentiation status of the cell form stable cell-cell contacts, indicating that proper inter make CD324 a very intriguing target for the development of actions with the cytoskeleton are required to mediate proper 55 anti-cancer therapeutics. interactions between CD324 on adjacent cells. In addition to the aforementioned characteristics the pres The critical importance of CD324 to normal development ent disclosure demonstrates that the expression of CD324 is and tissue function is demonstrated by the lethality of CDH1 elevated in various cancer stem cell populations. While not gene knockouts in mice at a very early stage in embryogen wishing to be bound by any particular theory it is believed esis (Haegel et al., 1996). Cells are morphologically defined 60 that the CD324 modulators of the present invention (par in vivo by their epithelial or mesenchymal nature. During ticularly those that are antagonistic or neutralizing with development, some cells undergo epithelial-to-mesenchy regard to homotypic and/or heterotypic interactions) act, at mal transitions (EMTs) or mesenchymal-to-epithelial tran least in part, by either reducing or eliminating tumor initi sitions (METs) as a natural step in the adoption of particular ating cell frequency thereby interfering with tumor propa cell fates. CD324 is commonly used as marker of the 65 gation or Survival in a different manner than traditional epithelial state, and is known to be down regulated during an standard of care therapeutic regimens (e.g. irinotecan), or EMT. But recent evidence suggests that CD324 and other through immunotherapeutic signaling or delivering a pay US 9,534,058 B2 19 20 load able to kill CD324 expressing cells. For example, isolated and transplanted. Thus, those skilled in the art will elimination of TPC by antagonizing CD324 may include recognize that a definitive difference between TPC and simply promoting cell proliferation in the face of chemo TProg, though both may be tumor generating in primary therapeutic regimens that eliminate proliferating cells, or transplants, is the unique ability of TPC to perpetually fuel promote differentiation of TPC such that their self-renewal 5 heterogeneous tumor growth upon serial transplantation at (i.e. unlimited proliferation and maintenance of multipo low cell numbers. Other common approaches to characterize tency) capacity is lost. Alternatively, in preferred embodi TPC involve morphology and examination of cell surface ments the recruitment of cytotoxic T-cells to attack CDH1 markers, transcriptional profile, and drug response although expressing cells, or delivery of a potent toxin conjugated to marker expression may change with culture conditions and an anti-CDH1 antibody that is able to internalize, may 10 with cell line passage in vitro. selectively kill or otherwise incapacitate TPC. Additionally, Accordingly, for the purposes of the instant invention the CD324 conformational changes that underlie formation tumor perpetuating cells, like normal stem cells that Support of homotypic interactions in normal adherens junctions may cellular hierarchies in normal tissue, are preferably defined be reversed or disregulated during the disorganization of by their ability to self-renew indefinitely while maintaining epithelium associated with cancer progression, and therefore 15 the capacity for multilineage differentiation. Tumor perpetu offer opportunities for development of modulators specifi ating cells are thus capable of generating both tumorigenic cally recognizing CD324 on cancerous tissues. progeny (i.e., tumor initiating cells: TPC and TProg) and III Cancer Stem Cells non-tumorigenic (NTG) progeny. As used herein a “non As alluded to above it has surprisingly been discovered tumorigenic cell” (NTG) refers to a tumor cell that arises that CD324 expression (genotypic and/or phenotypic) is from tumor initiating cells, but does not itself have the therapeutically associated with various tumorigenic cell capacity to self-renew or generate the heterogeneous lin Subpopulations. In this respect the present invention pro eages of tumor cells that comprise a tumor. Experimentally, vides CD324 modulators that may be particularly useful for NTG cells are incapable of reproducibly forming tumors in targeting such tumor initiating cells, and especially tumor mice, even when transplanted in excess cell numbers. perpetuating cells, thereby facilitating the treatment, man 25 As indicated, TProg are also categorized as tumor initi agement or prevention of neoplastic disorders. More spe ating cells (or TIC) due to their limited ability to generate cifically, as previously indicated it has surprisingly been tumors in mice. TProg are progeny of TPC and are typically found that specific tumor cell subpopulations aberrantly capable of a finite number of non-self-renewing cell divi express CD324 and may modify cellular adhesion or cyto sions. Moreover, TProg cells may further be divided into skeleton interactions important to cancer stem cell self 30 early tumor progenitor cells (ETP) and late tumor progenitor renewal and/or tumor cell survival. Thus, in preferred cells (LTP), each of which may be distinguished by pheno embodiments modulators of CD324 determinants (pheno type (e.g., cell surface markers) and different capacities to typic or genotypic) may be advantageously be used to recapitulate tumor cell architecture. In spite of Such techni reduce tumor initiating cell frequency in accordance with the cal differences, both ETP and LTP differ functionally from present teachings and thereby facilitate the treatment or 35 TPC in that they are generally less capable of serially management of proliferative disorders. reconstituting tumors when transplanted at low cell numbers For the purposes of the instant application the term and typically do not reflect the heterogeneity of the parental “tumor initiating cell (TIC) encompasses both "tumor tumor. Notwithstanding the foregoing distinctions, it has perpetuating cells” (TPC; i.e., cancer stem cells or CSC) and also been shown that various TProg populations can, on rare highly proliferative "tumor progenitor cells” (termed 40 occasion, gain self-renewal capabilities normally attributed TProg), which together generally comprise a unique Sub to stem cells and themselves become TPC (or CSC). In any population (i.e. 0.1-40%) of a bulk tumor or mass. For the event both types of tumor-initiating cells are likely repre purposes of the instant disclosure the Willis “tumor perpetu sented in the typical tumor mass of a single patient and are ating cells' and “cancer stem cells” or “neoplastic stem subject to treatment with the modulators as disclosed herein. cells' are equivalent and may be used interchangeably 45 That is, the disclosed compositions are generally effective in herein. TPC differ from TProg in that TPC can completely reducing the frequency or altering the chemosensitivity of recapitulate the composition of tumor cells existing within a such CD324 positive tumor initiating cells regardless of the tumor and have unlimited self-renewal capacity as demon particular embodiment or mix represented in a tumor. strated by serial transplantation (two or more passages In the context of the instant invention, TPC are more through mice) of low numbers of isolated cells, whereas 50 tumorigenic, relatively more quiescent and often more TProg will not display unlimited self-renewal capacity. chemoresistant than the TProg (both ETP and LTP), NTG Those skilled in the art will appreciate that fluorescence cells and the tumor-infiltrating non-TPC derived cells (e.g., activated cell sorting (FACS) using appropriate cell Surface fibroblasts/stroma, endothelial & hematopoietic cells) that markers is a reliable method to isolate highly enriched comprise the bulk of a tumor. Given that conventional cancer stem cell Subpopulations (e.g., >99.5% purity) due, at 55 therapies and regimens have, in large part, been designed to least in part, to its ability to discriminate between single cells both debulk tumors and attack rapidly proliferating cells, and clumps of cells (i.e. doublets, etc.). Using Such tech TPC are likely to be more resistant to conventional therapies niques it has been shown that when low cell numbers of and regimens than the faster proliferating TProg and other highly purified TProg cells are transplanted into immuno bulk tumor cell populations. Further, TPC often express compromised mice they can fuel tumor growth in a primary 60 other characteristics that make them relatively chemoresis transplant. However, unlike purified TPC subpopulations the tant to conventional therapies, such as increased expression TProg generated tumors do not completely reflect the paren of multi-drug resistance transporters, enhanced DNA repair tal tumor in phenotypic cell heterogeneity and are demon mechanisms and anti-apoptotic proteins. These properties, Strably inefficient at reinitiating serial tumorigenesis in Sub each of which contribute to drug tolerance by TPC, consti sequent transplants. In contrast, TPC Subpopulations 65 tute a key reason for the failure of standard oncology completely reconstitute the cellular heterogeneity of paren treatment regimens to ensure long-term benefit for most tal tumors and can efficiently initiate tumors when serially patients with advanced Stage neoplasia; i.e. the failure to US 9,534,058 B2 21 22 adequately target and eradicate those cells that fuel contin As to other methods compatible with the instant invention ued tumor growth and recurrence (i.e. TPC or CSC). that may be used to calculate tumor initiating cell frequency, Unlike many prior art treatments, the novel compositions the most common comprise quantifiable flow cytometric of the present invention preferably reduce the frequency of techniques and immunohistochemical staining procedures. tumor initiating cells upon administration to a subject 5 Though not as precise as the limiting dilution analysis regardless of the form or specific target (e.g., genetic mate techniques described immediately above, these procedures rial, CD324 antibody or ligand fusion construct) of the are much less labor intensive and provide reasonable values selected modulator. As noted above, the reduction in tumor in a relatively short time frame. Thus, it will be appreciated initiating cell frequency may occur as a result of a) elimi that a skilled artisan may use flow cytometric cell Surface nation, depletion, sensitization, silencing or inhibition of 10 marker profile determination employing one or more anti tumor initiating cells; b) controlling the growth, expansion bodies or reagents that bind art recognized cell Surface or recurrence of tumor initiating cells; c) interrupting the proteins known to enrich for tumor initiating cells (see initiation, propagation, maintenance, or proliferation of Example 1 below and PCT application 2012/031280, which tumor initiating cells; or d) by otherwise hindering the is incorporated herein in its entirety) and thereby measure Survival, regeneration and/or metastasis of the tumorigenic 15 TIC levels from various samples. In still another compatible cells. In some embodiments, the reduction in the frequency method one skilled in the art might enumerate TIC fre of tumor initiating cells occurs as a result of a change in one quency in situ (e.g., in a tissue section) by immunohisto or more physiological pathways. The change in the pathway, chemistry using one or more antibodies or reagents that are whether by reduction or elimination of the tumor initiating able to bind cell surface proteins thought to demarcate these cells or by modifying their potential (e.g., induced differ cells. entiation, niche disruption) or otherwise interfering with Those skilled in the art will recognize that numerous their ability to exert affects on the tumor environment or markers (or their absence) have been associated with various other cells, in turn allows for the more effective treatment of populations of cancer stem cells and used to isolate or CD324 associated disorders by inhibiting tumorigenesis, characterize tumor cell Subpopulations. In this respect exem tumor maintenance and/or metastasis and recurrence. 25 plary cancer stem cell markers comprise OCT4, Nanog, Among art-recognized methods that can be used to assess STAT3, EPCAM, CD24, CD34, NB84, TrkA, GD2, CD133, Such a reduction in the frequency of tumor initiating cells is CD20, CD56, CD29, B7H3, CD46, transferrin receptor, limiting dilution analysis either in vitro or in vivo, preferably JAM3, carboxypeptidase M, oncostatin M, Lgr5, Lgró, followed by enumeration using Poisson distribution statis CD325, nestin, Sox1, Bmi-1, eed, easyhl, easyh2, mf2, yy 1, tics or assessing the frequency of predefined definitive 30 smarcA3, Smarck A5, smarcD3, Smarch 1, millt3, FZD1, events such as the ability to generate tumors in vivo or not. FZD2, FZD3, FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, While such limiting dilution analysis comprise preferred WNT2, WNT2B, WNT3, WNTSA, WNT10B, WNT16, methods of calculating reduction of tumor initiating cell AXIN1, BCL9, MYC, (TCF4) SLC7A8, IL1RAP, TEM8, frequency other, less demanding methods, may also be used TMPRSS4, MUC16, GPRC5B, SLC6A14, SLC4A11, to effectively determine the desired values, albeit slightly 35 PPAP2C, CAV1, CAV2, PTPN3, EPHA1, EPHA2, less accurately, and are entirely compatible with the teach SLC1A1, CX3CL1, ADORA2A, MPZL.1, FLJ10052, ings herein. Thus, as will be appreciated by those skilled in C4.4A, EDG3, RARRES1, TMEPAI, PTS, CEACAM6, the art, it is also possible to determine reduction of fre NID2, STEAP, ABCA3, CRIM1, IL1R1, OPN3, DAF, quency values through well-known flow cytometric or MUC1, CPD, NMA, ADAM9, GJA1 SLC19A2, ABCA1, immunohistochemical means. As to all the aforementioned 40 PCDH7, ADCY9, SLC39A1, NPC1, ENPP1, N33, methods see, for example, Dylla et al. 2008, PMID: GPNMB, LY6E, CELSR1, LRP3, C20orf52, TMEPAI, 18560594 & Hoey et al. 2009, PMID: 19664991; each of FLVCR, PCDHA10, GPR54, TGFBR3, SEMA4B, which is incorporated herein by reference in its entirety. PCDHB2, ABCG2, CD166, AFP, BMP-4, B-catenin, CD2, With respect to limiting dilution analysis, in vitro enu CD3, CD9, CD14, CD31, CD38, CD44, CD45, CD74, meration of tumor initiating cell frequency may be accom 45 CD90, CXCR4, decorin, EGFR, CD105, CD64, CD16, plished by depositing either fractionated or unfractionated CD16a, CD16b, GLI1, GLI2, CD49b, and CD49f. See, for human tumor cells (e.g. from treated and untreated tumors, example, Schulenburg et al., 2010, PMID: 20185329, U.S. respectively) into in vitro growth conditions that foster Pat. No. 7,632,678 and U.S.PNs. 2007/0292414, 2008/ colony formation. In this manner, colony forming cells 0175870, 2010/0275280, 2010/0162416 and 2011/0020221 might be enumerated by simple counting and characteriza 50 each of which is incorporated herein by reference. It will tion of colonies, or by analysis consisting of, for example, further be appreciated that each of the aforementioned the deposition of human tumor cells into plates in serial markers may also be used as a secondary target antigen in dilutions and scoring each well as either positive or negative the context of the bispecific or multispecific antibodies of for colony formation at least 10 days after plating. In vivo the instant invention. limiting dilution experiments or analyses, which are gener 55 Similarly, non-limiting examples of cell Surface pheno ally more accurate in their ability to determine tumor types associated with cancer stem cells of certain tumor initiating cell frequency encompass the transplantation of types include CD44'CD24'", ALDH, CD133", CD123", human tumor cells, from either untreated control or treated CD34"CD38, CD44"CD24, CD46'CD324"CD66c, populations, for example, into immunocompromised mice in CD133*CD34+CD10CD19, CD138-CD34CD19", serial dilutions and Subsequently scoring each mouse as 60 CD133'RC2", CD44"o, B, CD133+, CD44"CD24"ESA", either positive or negative for tumor formation at least 60 CD271, ABCB5" as well as other cancer stem cell surface days after transplant. The derivation of cell frequency values phenotypes that are known in the art. See, for example, by limiting dilution analysis in vitro or in vivo is preferably Schulenburg et al., 2010, supra, Visvader et al., 2008, PMID: done by applying Poisson distribution statistics to the known 18784658 and U.S.P.N. 2008/0138313, each of which is frequency of positive and negative events, thereby providing 65 incorporated herein in its entirety by reference. Those skilled a frequency for events fulfilling the definition of a positive in the art will appreciate that marker phenotypes such as event; in this case, colony or tumor formation, respectively. those exemplified immediately above may be used in con US 9,534,058 B2 23 24 junction with standard flow cytometric analysis and cell thereof. Moreover, as with the aforementioned fusion con sorting techniques to characterize, isolate, purify or enrich structs, these antibody modulators may be conjugated, TIC and/or TPC cells or cell populations for further analysis. linked or otherwise associated with selected cytotoxic Of interest with regard to the instant invention CD46, agents, polymers, biological response modifiers (BRMs) or CD324 and, optionally, CD66c are either highly or hetero the like to provide directed immunotherapies with various geneously expressed on the Surface of many human colorec (and optionally multiple) mechanisms of action. In yet other tal (“CR), breast (“BR), non-small cell lung (NSCLC), embodiments the modulators may operate on the genetic small cell lung (SCLC), pancreatic (“PA), melanoma level and may comprise compounds as antisense constructs, (“Mel”), ovarian (“OV), and head and neck cancer (“HN) siRNA, miRNA and the like that interact or associate with tumor cells, regardless of whether the tumor specimens 10 being analyzed were primary patient tumor specimens or the genotypic component of a CD324 determinant. patient-derived NTX tumors. It will further be appreciated that the disclosed CD324 Using any of the above-referenced methods it is then modulators may deplete, silence, neutralize, eliminate or possible to quantify the reduction in frequency of TIC (or the inhibit growth, propagation or Survival of tumor cells, TPC therein) provided by the disclosed CD324 modulators 15 including TPC, and/or associated neoplasia through a vari (including those conjugated to cytotoxic agents) in accor ety of mechanisms, including agonizing or antagonizing dance with the teachings herein. In some instances, the selected pathways, interfering with cell interactions or elimi compounds of the instant invention may reduce the fre nating specific cells depending, for example, on the form of quency of TIC (by a variety of mechanisms noted above, CD324 modulator, any associated payload or dosing and including elimination, induced differentiation, niche disrup method of delivery. Accordingly, while preferred embodi tion, silencing, etc.) by 10%, 15%, 20%, 25%, 30% or even ments disclosed herein are directed to the depletion, inhibi by 35%. In other embodiments, the reduction in frequency tion or silencing of specific tumor cell Subpopulations such of TIC may be on the order of 40%, 45%, 50%, 55%, 60% as tumor perpetuating cells, it must be emphasized that Such or 65%. In certain embodiments, the disclosed compounds embodiments are merely illustrative and not limiting in any my reduce the frequency of TIC by 70%, 75%, 80%, 85%, 25 sense. Rather, as set forth in the appended claims, the present 90% or even 95%. Of course it will be appreciated that any invention is broadly directed to CD324 modulators or to reduction of the frequency of the TIC likely results in a modulators that interact with a specific epitope or domain, corresponding reduction in the tumorigenicity, persistence, and their use in the treatment, management or prophylaxis of recurrence and aggressiveness of the neoplasia. various CD324 associated hyperproliferative disorders irre IV. CD324 Modulators 30 spective of any particular mechanism or target tumor cell In any event, the present invention is directed to the use population. of CD324 modulators, including CD324 antagonists, for the Regardless of the form of the modulator selected it will be diagnosis, theragnosis, treatment and/or prophylaxis of vari appreciated that the chosen compound may be antagonistic ous disorders including any one of a number of CD324 in nature. As used herein an “antagonist” refers to a mol associated malignancies. The disclosed modulators may be 35 ecule capable of neutralizing, blocking, inhibiting, abrogat used alone or in conjunction with a wide variety of anti ing, reducing or interfering with the activities of a particular cancer compounds Such as chemotherapeutic or immuno or specified target (e.g., CD324), including the binding of therapeutic agents (e.g., therapeutic antibodies) or biological receptors to ligands or the interactions of enzymes with response modifiers. In other selected embodiments, two or substrates. In this respect it will be appreciated that CD324 more discrete CD324 modulators may be used in combina 40 antagonists of the instant invention may comprise any tion to provide enhanced anti-neoplastic effects or may be ligand, polypeptide, peptide, fusion protein, antibody or used to fabricate multispecific constructs. immunologically active fragment or derivative thereof that In certain embodiments, the CD324 modulators of the recognizes, reacts, binds, combines, competes, associates or present invention will comprise nucleotides, oligonucle otherwise interacts with the CD324 protein or fragment otides, polynucleotides, peptides or polypeptides. More par 45 thereof and eliminates, silences, reduces, inhibits, hinders, ticularly, exemplary modulators of the invention may com restrains or controls the growth of tumor initiating cells or prise antibodies and antigen-binding fragments or other neoplastic cells including bulk tumor or NTG cells. derivatives thereof, multispecific antibodies, proteins, pep Compatible antagonists may further include Small molecule tides, glycoproteins, glycopeptides, glycolipids, polysaccha inhibitors, aptamers, antisense constructs, siRNA, miRNA rides, oligosaccharides, nucleic acids, antisense constructs, 50 and the like, receptor or ligand molecules and derivatives siRNA, miRNA, bioorganic molecules, peptidomimetics, thereof which recognize or associate with a CD324 geno pharmacological agents and their metabolites, transcrip typic or phenotypic determinant thereby altering expression tional and translation control sequences, and the like. In patterns or sequestering its binding or interaction with a certain embodiments the modulators will comprise soluble Substrate, receptor or ligand. CD324 (SCD324) or a form, variant, derivative or fragment 55 As used herein and applied to two or more molecules or thereof including, for example, CD324 fusion constructs compounds, the terms “recognizes” or “associates' shall be (e.g., CD324-Fc. CD324-targeting moiety, etc.) or CD324 held to mean the reaction, binding, specific binding, com conjugates (e.g., CD324-PEG, CD324-cytotoxic agent, bination, interaction, connection, linkage, uniting, coales CD324-brm, etc.). It will also be appreciated that, in other cence, merger or joining, covalently or non-covalently, of embodiments, the CD324 modulators comprise antibodies 60 the molecules whereby one molecule exerts an effect on the or immunoreactive fragments or derivatives thereof. In other molecule. particularly preferred embodiments the modulators of the Moreover, as demonstrated in the examples herein, some instant invention will comprise neutralizing antibodies or modulators of human CD324 may, in certain cases, cross derivatives or fragments thereof. In other embodiments the react with CD324 from a species other than human (e.g., CD324 modulators may comprise internalizing antibodies or 65 murine or cyno). In other cases exemplary modulators may fragments thereof. In still other embodiments the CD324 be specific for human CD324 and will not exhibit cross modulators may comprise depleting antibodies or fragments reactivity with CD324 orthologs. US 9,534,058 B2 25 26 In any event, and as will be discussed in more detail The “variable' region includes hypervariable sites that below, those skilled in the art will appreciate that the manifest themselves in three segments commonly termed disclosed modulators may be used in a conjugated or uncon complementarity determining regions (CDRS), in both the jugated form. That is, the modulator may be associated with light-chain and the heavy-chain variable domains. The more or conjugated to (e.g. covalently or non-covalently) phar highly conserved portions of variable domains flanking the maceutically active compounds, biological response modi CDRs are termed framework regions (FRs). For example, in fiers, anti-cancer agents, cytotoxic or cytostatic agents, diag naturally occurring monomeric immunoglobulin G (IgG) nostic moieties or biocompatible modifiers. In this respect it antibodies, the six CDRs present on each arm of the “Y” are will be understood that Such conjugates may comprise short, non-contiguous sequences of amino acids that are peptides, polypeptides, proteins, fusion proteins, nucleic 10 specifically positioned to form the antigenbinding site as the acid molecules, Small molecules, mimetic agents, synthetic drugs, inorganic molecules, organic molecules and radioiso antibody assumes its three dimensional configuration in an topes. Moreover, as indicated herein the selected conjugate aqueous environment. Thus, each naturally occurring IgG may be covalently or non-covalently linked to the CD324 antibody comprises two identical binding sites proximal to the amino-terminus of each arm of the Y. modulator in various molar ratios depending, at least in part, 15 on the method used to effect the conjugation. It will be appreciated that the position of CDRs can be V. Modulator Fabrication and Supply readily identified by one of ordinary skill in the art using A. Antibody Modulators standard techniques. Also familiar to those in the art is the a. Overview numbering system described in Kabat et al. (1991, NIH As previously alluded to particularly preferred embodi Publication 91-3242, National Technical Information Ser ments of the instant invention comprise CD324 modulators in the form of antibodies that preferentially associate with vice, Springfield, Va.). In this regard Kabat et al. defined a CD324 or fragments thereof. Those of ordinary skill in the numbering system for variable domain sequences that is art will appreciate the well developed knowledge base on applicable to any antibody. One of ordinary skill in the art antibodies such as set forth, for example, in Abbas et al., 25 can unambiguously assign this system of "Kabat number Cellular and Molecular Immunology, 6" ed., W.B. Saunders ing to any variable domain sequence, without reliance on Company (2010) or Murphey et al., Janeway's Immunobi any experimental data beyond the sequence itself. Unless ology, 8" ed., Garland Science (2011), each of which is otherwise specified, references to the numbering of specific incorporated herein by reference in its entirety. amino acid residue positions in an antibody are according to The term “antibody' is intended to cover polyclonal 30 antibodies, multiclonal antibodies, monoclonal antibodies, the Kabat numbering system. chimeric antibodies, humanized and primatized antibodies, Thus, according to Kabat, in the V, residues 31-35 human antibodies, recombinantly produced antibodies, comprise CDR1, residues 50-65 make up CDR2, and 95-102 intrabodies, multispecific antibodies, bispecific antibodies, comprise CDR3, while in the V, residues 24-34 are CDR1, monovalent antibodies, multivalent antibodies, anti-idio 35 50-56 comprise CDR2, and 89-97 make up CDR3. For typic antibodies, synthetic antibodies, including muteins and variants thereof antibody fragments such as Fab fragments, context, in a V, FR1 corresponds to the domain of the F(ab') fragments, single-chain FvFcs, single-chain FVs; and variable region encompassing amino acids 1-30; FR2 cor derivatives thereof including Fc fusions and other modifi responds to the domain of the variable region encompassing cations, and any other immunologically active molecule so 40 amino acids 36-49; FR3 corresponds to the domain of the long as they exhibit the desired biological activity (i.e., variable region encompassing amino acids 66-94, and FR4 antigen association or binding). Moreover, the term further corresponds to the domain of the variable region from amino comprises all classes of antibodies (i.e. IgA, Ig|D, IgE, IgG, acids 103 to the end of the variable region. The FRs for the and IgM) and all isotypes (i.e., IgG1, IgG2, IgG3, IgG4. light chain are similarly separated by each of the light chain IgA1, and IgA2), as well as variations thereof unless oth 45 erwise dictated by context. Heavy-chain constant domains variable region CDRs. that correspond to the different classes of antibodies are Note that CDRs vary considerably from antibody to denoted by the corresponding lower case Greek letter C, 6. antibody (and by definition will not exhibit homology with e, Y, and L, respectively. Light chains of the antibodies from the Kabat consensus sequences). In addition, the identity of any vertebrate species can be assigned to one of two clearly 50 certain individual residues at any given Kabat site number distinct types, called kappa (K) and lambda (W), based on the may vary from antibody chain to antibody chain due to amino acid sequences of their constant domains. While all such antibodies are within the scope of the interspecies or allelic divergence. Alternative numbering is present invention, preferred embodiments comprising the set forth in Chothia et al., J. Mol. Biol. 196:901-917 (1987) IgG class of immunoglobulin will be discussed in some 55 and MacCallum et al., J. Mol. Biol. 262:732-745 (1996), detail herein solely for the purposes of illustration. It will be although as in Kabat, the FR boundaries are separated by the understood that such disclosure is, however, merely demon respective CDR termini as described above. See also strative of exemplary compositions and methods of practic Chothia et al., Nature 342, pp. 877-883 (1989) and S. Dubel, ing the present invention and not in any way limiting of the ed., Handbook of Therapeutic Antibodies, 3" ed., WILEY Scope of the invention or the claims appended hereto. 60 As is well known, the variable domains of both the light VCH Verlag GmbH and Co. (2007), where the definitions (V) and heavy (V) chain portions determine antigen include overlapping or Subsets of amino acid residues when recognition and specificity and the constant domains of the compared against each other. Each of the aforementioned light chain (C) and the heavy chain (C1, C2 or C3) references is incorporated herein by reference in its entirety confer and regulate important biological properties such as 65 and the amino acid residues which comprise binding regions secretion, transplacental mobility, circulation half-life, or CDRs as defined by each of the above cited references complement binding, and the like. and are set forth for comparison below. US 9,534,058 B2 27 28 CDR Definitions peptides, or live cells or cell preparations expressing CD324 or immunoreactive fragments thereof. Art known adjuvants that may be used to increase the immunological response, depending on the inoculated species include, but are not Kabat Chothia? MacCallum limited to, Freund's (complete and incomplete), mineral gels V. CDR1 31-35 26-32 30-35 Such as aluminum hydroxide, Surface active substances Such V. CDR2 SO-65 SO-58 47-58 as lysolecithin, pluronic polyols, polyanions, peptides, oil V. CDR3 95-102 95-102 93-101 emulsions, keyhole limpet hemocyanins, dinitrophenol, and V, CDR1 24-34 23-34 30-36 potentially useful human adjuvants such as BCG (bacille V, CDR2 SO-56 SO-56 46-5S 10 Calmette-Guerin) and corynebacterium parvum. Such adju V, CDR3 89-97 89-97 89-96 vants may protect the antigen from rapid dispersal by 'Residue numbering follows the nomenclature of Kabat et al., Supra sequestering it in a local deposit, or they may contain *Residue numbering follows the nomenclature of Chothia et al., supra substances that stimulate the host to secrete factors that are Residue numbering follows the nomenclature of MacCallum et al., Supra chemotactic for macrophages and other components of the In the context of the instant invention it will be appreci 15 immune system. Preferably the immunization schedule will involve two or more administrations of the selected immu ated that any of the disclosed light and heavy chain CDRs nogen spread out over a predetermined period of time. derived from the murine variable region amino acid The amino acid sequence of a CD324 protein as shown in sequences set forth in FIG. 11A or FIG. 11B may be FIG. 1C or 1D can be analyzed to select specific regions of combined or rearranged to provide optimized anti-CD324 the CD324 protein for generating antibodies. For example, (e.g. anti-hCD324) antibodies in accordance with the instant hydrophobicity and hydrophilicity analyses of a CD324 teachings. That is, one or more of the CDRs derived from the amino acid sequence are used to identify hydrophilic regions contiguous light chain variable region amino acid sequences in the CD324 structure. Regions of a CD324 protein that set forth in FIG. 11A (SEQ ID NOS: 20-70, even numbers) show immunogenic structure, as well as other regions and or the contiguous heavy chain variable region amino acid 25 domains, can readily be identified using various other meth sequences set forth in FIG. 11B (SEQED NOS: 21-71, odd ods known in the art, such as Chou-Fasman, Garnier numbers) may be incorporated in a CD324 modulator and, Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or in particularly preferred embodiments, in a CDR grafted or Jameson-Wolf analysis. Average Flexibility profiles can be humanized antibody that immunospecifically associates generated using the method of Bhaskaran R., Ponnuswamy with one or more CD324 isoforms. An example of light 30 P. K., 1988, Int. J. Pept. Protein Res. 32:242-255. Beta-turn (SEQ ID NO: 72) and heavy (SEQ ID NO: 73) chain profiles can be generated using the method of Deleage, G., variable region amino acid sequences of such a humanized Roux B., 1987, Protein Engineering 1:289-294. Thus, each modulator is also set forth in FIGS. 11A and 11B. Taken CD324 region, domain or motif identified by any of these together these novel amino acid sequences depict twenty-six programs or methods is within the scope of the present murine exemplary modulators and a single humanized con 35 invention and may be isolated or engineered to provide struct in accordance with the instant invention. Moreover, immunogens giving rise to modulators comprising desired corresponding nucleic acid sequences of each of the twenty properties. Preferred methods for the generation of CD324 six murine modulators and the exemplary humanized con antibodies are further illustrated by way of the Examples Struct set forth in FIGS. 11A and 11B are included in FIG. provided herein. Methods for preparing a protein or poly 19 appended to the instant application (SEQ ID NOS: 40 peptide for use as an immunogen are well known in the art. 120-173). Also well known in the art are methods for preparing As discussed herein and demonstrated in the Examples immunogenic conjugates of a protein with a carrier, such as below, one skilled in the art could readily define, identify BSA, KLH or other carrier protein. In some circumstances, derive and/or enumerate the CDRs as defined by Kabat et al., direct conjugation using, for example, carbodiimide Chothia et al. or MacCallum et al. for each respective heavy 45 reagents are used; in other instances linking reagents are and light chain sequence set forth in FIG. 11A or FIG. 11B. effective. Administration of a CD324 immunogen is often Accordingly, each of the subject CDRs and antibodies conducted by injection over a suitable time period and with comprising CDRs defined by all such nomenclature are use of a suitable adjuvant, as is understood in the art. During expressly included within the scope of the instant invention. the immunization schedule, titers of antibodies can be taken More broadly, the term “variable region CDR amino acid 50 as described in the Examples below to determine adequacy residue” or more simply "CDR' includes amino acids in a of antibody formation. CDR as identified using any sequence or structure based b. Monoclonal Antibodies method as set forth above. In addition, the invention contemplates use of monoclonal 2. Antibody Modulator Generation antibodies. As known in the art, the term "monoclonal a. Polyclonal Antibodies 55 antibody’ (or mAb) refers to an antibody obtained from a The production of polyclonal antibodies in various host population of Substantially homogeneous antibodies, i.e., the animals, including rabbits, mice, rats, etc. is well known in individual antibodies comprising the population are identi the art. In some embodiments, polyclonal anti-CD324 anti cal except for possible mutations (e.g., naturally occurring body-containing serum is obtained by bleeding or sacrificing mutations), that may be present in minor amounts. In certain the animal. The serum may be used for research purposes in 60 embodiments, such a monoclonal antibody includes an the form obtained from the animal or, in the alternative, the antibody comprising a polypeptide sequence that binds or anti-CD324 antibodies may be partially or fully purified to associates with an antigen wherein the antigen-binding provide immunoglobulin fractions or homogeneous anti polypeptide sequence was obtained by a process that body preparations includes the selection of a single target binding polypeptide Briefly the selected animal is immunized with a CD324 65 sequence from a plurality of polypeptide sequences. immunogen (e.g., soluble CD324 or SCD324) which may, More generally, and as exemplified in Example 3 herein, for example, comprise selected isoforms, domains and/or monoclonal antibodies can be prepared using a wide variety US 9,534,058 B2 29 30 of techniques known in the art including hybridoma, recom immunoglobulins. In one embodiment, a humanized anti binant techniques, phage display technologies, transgenic body is a human immunoglobulin (recipient or acceptor animals (e.g., a XenoMouse(R) or some combination thereof. antibody) in which residues from a CDR of the recipient are For example, monoclonal antibodies can be produced using replaced by residues from a CDR of a non-human species hybridoma and art-recognized biochemical and genetic (donor antibody) Such as mouse, rat, rabbit, or nonhuman engineering techniques such as described in more detail in primate having the desired specificity, affinity, and/or capac Al-Rubeai, Antibody Expression and Production (Cell Engi ity. In certain preferred embodiments, residues in one or neering) Springer Science+Business Media LLC, 1 ed. more FRS in the variable domain of the human immuno 2011; An, Zhigiang (ed.) Therapeutic Monoclonal Antibod globulin are replaced by corresponding non-human residues ies. From Bench to Clinic, John Wiley and Sons, 1 ed. 10 from the donor antibody to help maintain the appropriate 2009; Shire et. Al. (eds.) Current Trends in Monoclonal three-dimensional configuration of the grafted CDR(s) and Antibody Development and Manufacturing, Springer Sci thereby improve affinity. Furthermore, humanized antibod ence Business Media LLC, 1 ed. 2010; Harlow et al., ies may comprise residues that are not found in the recipient Antibodies: A Laboratory Manual, Cold Spring Harbor antibody or in the donor antibody to, for example, further Laboratory Press, 2nd ed. 1988; Hammerling, et al., in: 15 refine antibody performance. Monoclonal Antibodies and T-Cell Hybridomas 563-681 CDR grafting and humanized antibodies are described, (Elsevier, N.Y., 1981) each of which is incorporated herein for example, in U.S. Pat. Nos. 6,180.370 and 5,693,762. The in its entirety by reference. It should be understood that a humanized antibody optionally may also comprise at least a selected binding sequence can be further altered, for portion of an immunoglobulin Fe, typically that of a human example, to improve affinity for the target, to humanize the immunoglobulin. For further details, see, e.g., Jones et al., target binding sequence, to improve its production in cell Nature 321:522-525 (1986); and U.S. Pat. Nos. 6,982,321 culture, to reduce its immunogenicity in Vivo, to create a and 7,087,409. Still another method is termed "humaneer multispecific antibody, etc., and that an antibody comprising ing” which is described, for example, in U.S.P.N. 2005/ the altered target binding sequence is also an antibody of this 0008.625. Additionally, a non-human antibody may also be invention. 25 modified by specific deletion of human T-cell epitopes or c. Chimeric Antibodies “deimmunization’ by the methods disclosed in WO In another embodiment, the antibody of the invention may 98/52976 and WO 00/34317. Each of the aforementioned comprise chimeric antibodies derived from covalently references are incorporated herein in their entirety. joined protein segments from at least two different species or Humanized antibodies may also be bioengineered using types of antibodies. As known in the art, the term "chimeric' 30 common molecular biology techniques, such as isolating, antibodies is directed to constructs in which a portion of the manipulating, and expressing nucleic acid sequences that heavy and/or light chain is identical with or homologous to encode all or part of immunoglobulin variable regions from corresponding sequences in antibodies derived from a par at least one of a heavy or light chain. In addition to the ticular species or belonging to a particular antibody class or Sources of Such nucleic acid noted above, human germline subclass, while the remainder of the chain(s) is identical 35 sequences are available as disclosed, for example, in Tom with or homologous to corresponding sequences in antibod linson, L. A. et al. (1992).J. Mol. Biol. 227:776-798; Cook, ies derived from another species or belonging to another G. P. et al. (1995) Immunol. Today 16:237-242: Chothia, D. antibody class or Subclass, as well as fragments of Such et al. (1992).J. Mol. Biol. 227:799-817; and Tomlinson et al. antibodies, so long as they exhibit the desired biological (1995) EMBO J 14:4628-4638. The V-BASE directory activity (U.S. Pat. No. 4,816,567; Morrison et al., Proc. Natl. 40 (VBASE2 Retter et al., Nucleic Acid Res. 33: 671-674, Acad. Sci. USA, 81:6851-6855 (1984)). 2005) provides a comprehensive directory of human immu In one embodiment, a chimeric antibody in accordance noglobulin variable region sequences (compiled by Tomlin with the teachings herein may comprise murine V and V. son, I. A. et al. MRC Centre for Protein Engineering, amino acid sequences and constant regions derived from Cambridge, UK). Consensus human Fits can also be used, human sources. In other compatible embodiments a chime 45 e.g., as described in U.S. Pat. No. 6,300,064. ric antibody of the present invention may comprise a human In selected embodiments, and as detailed in Example 8 ized antibody as described below. In another embodiment, below, at least 60%, 65%, 70%, 75%, or 80% of the the so-called “CDR-grafted antibody, the antibody com humanized antibody heavy or light chain variable region prises one or more CDRS from a particular species or amino acid residues will correspond to those of the recipient belonging to a particular antibody class or Subclass, while 50 FR and CDR sequences. In other embodiments at least 85% the remainder of the antibody chain(s) is/are identical with or 90% of the humanized antibody variable region residues or homologous to a corresponding sequence in antibodies will correspond to those of the recipient FR and CDR derived from another species or belonging to another anti sequences. In a further preferred embodiment, greater than body class or Subclass. For use in humans, selected rodent 95% of the humanized antibody variable region residues will CDRS may be grafted into a human antibody, replacing one 55 correspond to those of the recipient FR and CDR sequences. or more of the naturally occurring variable regions or CDRs e. Human Antibodies of the human antibody. These constructs generally have the In another embodiment, the antibodies may comprise advantages of providing full strength modulator functions fully human antibodies. The term “human antibody” refers (e.g., CDC (complement dependent cytotoxicity), ADCC to an antibody which possesses an amino acid sequence that (antibody-dependent cell-mediated cytotoxicity), etc.) while 60 corresponds to that of an antibody produced by a human reducing unwanted immune responses to the antibody by the and/or has been made using any of the techniques for Subject. making human antibodies. d. Humanized Antibodies Human antibodies can be produced using various tech Similar to the CDR-grafted antibody is a “humanized niques known in the art. One technique is phage display in antibody. As used herein, “humanized forms of non-human 65 which a library of (preferably human) antibodies is synthe (e.g., murine) antibodies are chimericantibodies that contain sized on phages, the library is screened with the antigen of a minimal sequence derived from one or more non-human interest or an antibody-binding portion thereof, and the US 9,534,058 B2 31 32 phage that binds the antigen is isolated, from which one may 016, and 6,075,181 and 6,150,584 regarding XenoMouse(R) obtain the immunoreactive fragments. Methods for prepar technology; and Lonberg and Huszar, Intern. Rev. Immunol. ing and screening Such libraries are well known in the art 13:65-93 (1995). Alternatively, the human antibody may be and kits for generating phage display libraries are commer prepared via immortalization of human B lymphocytes cially available (e.g., the Pharmacia Recombinant Phage producing an antibody directed against a target antigen (Such Antibody System, catalog no. 27-94.00-01; and the Strata B lymphocytes may be recovered from an individual suf gene SurfAAPTM phage display kit, catalog no. 240612). fering from a neoplastic disorder or may have been immu There also are other methods and reagents that can be used nized in vitro). See, e.g., Cole et al., Monoclonal Antibodies in generating and Screening antibody display libraries (see, and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boemer et e.g., U.S. Pat. No. 5,223,409; PCT Publication Nos. WO 10 al., J. Immunol, 147 (1):86-95 (1991); and U.S. Pat. No. 92/18619, WO 91/17271, WO 92/20791, WO 92/15679, 5,750,373. WO 93/O1288, WO92/01047, WO92/09690; and Barbas et 3. Further Processing al., Proc. Natl. Acad. Sci. USA 88:7978-7982 (1991)). No matter how obtained, modulator-producing cells (e.g., In one embodiment, recombinant human antibodies may hybridomas, yeast colonies, etc.) may be selected, cloned be isolated by Screening a recombinant combinatorial anti 15 and further screened for desirable characteristics including, body library prepared as above. In one embodiment, the for example, robust growth, high antibody production and, library is a ScPV phage display library, generated using as discussed in more detail below, desirable antibody char human V, and V. cDNAs prepared from mRNA isolated acteristics. Hybridomas can be expanded in vivo in Synge from B-cells. neic animals, in animals that lack an immune system, e.g., The antibodies produced by naive libraries (either natural nude mice, or in cell culture in vitro. Methods of selecting, or synthetic) can be of moderate affinity (K, of about 10° to cloning and expanding hybridomas and/or colonies, each of 107 M'), but affinity maturation can also be mimicked in which produces a discrete antibody species, are well known vitro by constructing and reselecting from secondary librar to those of ordinary skill in the art. ies as described in the art. For example, mutation can be B. Recombinant Modulator Production introduced at random in vitro by using error-prone poly 25 1. Overview merase (reported in Leung et al., Technique, 1: 11-15 Once the source is perfected DNA encoding the desired (1989)). Additionally, affinity maturation can be performed CD324 modulators may be readily isolated and sequenced by randomly mutating one or more CDRs, e.g. using PCR using conventional procedures (e.g., by using oligonucle with primers carrying random sequence spanning the CDR otide probes that are capable of binding specifically to genes of interest, in selected individual Fv clones and screening for 30 encoding antibody heavy and light chains). Isolated and higher-affinity clones. WO9607754 described a method for Subcloned hybridoma cells (or phage or yeast derived colo inducing mutagenesis in a CDR of an immunoglobulin light nies) may serve as a preferred source of such DNA if the chain to create a library of light chain genes. Another modulator is an antibody. If desired, the nucleic acid can effective approach is to recombine the V or V, domains further be manipulated as described herein to create agents selected by phage display with repertoires of naturally 35 including fusion proteins, or chimeric, humanized or fully occurring V domain variants obtained from unimmunized human antibodies. More particularly, isolated DNA (which donors and to screen for higher affinity in several rounds of may be modified) can be used to clone constant and variable chain reshuffling as described in Marks et al., Biotechnol., region sequences for the manufacture antibodies. 10: 779-783 (1992). This technique allows the production of Accordingly, in exemplary embodiments antibodies may antibodies and antibody fragments with a dissociation con 40 be produced recombinantly, using conventional procedures stant K, (k. k.) of about 10 M or less. (such as those set forth in Al-Rubeai An, and Shire et. al. all In other embodiments, similar procedures may be supra, and Sambrook J. & Russell D. Molecular Cloning: A employed using libraries comprising eukaryotic cells (e.g., Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory yeast) that express binding pairs on their Surface. See, for Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short example, U.S. Pat. No. 7,700,302 and U.S. Ser. No. 12/404, 45 Protocols in Molecular Biology: A Compendium of Methods 059. In one embodiment, the human antibody is selected from Current Protocols in Molecular Biology, Wiley, John & from a phage library, where that phage library expresses Sons, Inc. (2002)) in which the isolated and subcloned human antibodies (Vaughan et al. Nature Biotechnology hybridoma cells (or phage or yeast derived colonies) serve 14:309-314 (1996): Sheets et al. Proc. Natl. Acad. Sci. USA as a preferred source of nucleic acid molecules. 95:6157-6162 (1998)). In other embodiments, human bind 50 The term “nucleic acid molecule', as used herein, is ing pairs may be isolated from combinatorial antibody intended to include DNA molecules and RNA molecules and libraries generated in eukaryotic cells such as yeast. See e.g., artificial variants thereof (e.g., peptide nucleic acids), U.S. Pat. No. 7,700,302. Such techniques advantageously whether single-stranded or double-stranded. The nucleic allow for the screening of large numbers of candidate acids may encode one or both chains of an antibody of the modulators and provide for relatively easy manipulation of 55 invention, or a fragment or derivative thereof. The nucleic candidate sequences (e.g., by affinity maturation or recom acid molecules of the invention also include polynucleotides binant shuffling). sufficient for use as hybridization probes, PCR primers or Human antibodies can also be made by introducing sequencing primers for identifying, analyzing, mutating or human immunoglobulin loci into transgenic animals, e.g., amplifying a polynucleotide encoding a polypeptide; anti mice in which the endogenous immunoglobulin genes have 60 sense nucleic acids for inhibiting expression of a polynucle been partially or completely inactivated and human immu otide, and as well as complementary sequences. The nucleic noglobulin genes have been introduced. Upon challenge, acids can be any length. They can be, for example, 5, 10, 15. human antibody production is observed, which closely 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, resembles that seen in humans in all respects, including gene 300, 350, 400, 450, 500, 750, 1,000, 1,500, 3,000, 5,000 or rearrangement, assembly, and antibody repertoire. This 65 more nucleotides in length, and/or can comprise one or more approach is described, for example, in U.S. Pat. Nos. 5,545, additional sequences, for example, regulatory sequences, 807: 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661, and/or be part of a larger nucleic acid, for example, a vector. US 9,534,058 B2 33 34 It will be appreciated that Such nucleic acid sequences can those having ordinary skill in the art based on, for example, further be manipulated to create modulators including chi the length and/or base composition of the nucleic acid. meric, humanized or fully human antibodies. More particu Sequence similarity for polypeptides, which is also larly, isolated nucleic acid molecules (which may be modi referred to as sequence identity, is typically measured using fied) can be used to clone constant and variable region sequence analysis Software. Protein analysis software sequences for the manufacture antibodies as described in matches similar sequences using measures of similarity U.S. Pat. No. 7,709,611. assigned to various Substitutions, deletions and other modi The term "isolated nucleic acid' means a that the nucleic fications, including conservative amino acid Substitutions. acid was (i) amplified in vitro, for example by polymerase For instance, the sequence analysis tool GCG (Accelrys chain reaction (PCR), (ii) recombinantly produced by clon 10 ing, (iii) purified, for example by cleavage and gel-electro Software Inc.) contains programs such as “GAP and phoretic fractionation, or (iv) synthesized, for example by “BEST-FIT which can be used with default parameters to chemical synthesis. An isolated nucleic acid is a nucleic acid determine sequence homology or sequence identity between that is available for manipulation by recombinant DNA closely related polypeptides, such as homologous polypep techniques. 15 tides from different species of organisms or between a wild Whether the source of the nucleic acid encoding the type protein and a mutein thereof. (See, e.g., GCG Version desired immunoreactive portion of the antibody is obtained 6.1 or Durbinet. Al... Biological Sequence Analysis. Proba or derived from phage display technology, yeast libraries, bilistic models of proteins and nucleic acids. Cambridge hybridoma-based technology or synthetically, it is to be Press (1998)). understood that the present invention encompasses the Polypeptide sequences can also be compared using nucleic acid molecules and sequences encoding the antibod FASTA using default or recommended parameters, a pro ies or antigen-binding fragments or derivatives thereof. gram in GCG Version 6.1. FASTA (e.g., FASTA2 and Further, the instant invention is directed to vectors and host FASTA3) provides alignments and percent sequence identity cells comprising Such nucleic acid molecules. of the regions of the best overlap between the query and 2. Hybridization and Sequence Identity 25 search sequences (Pearson (2000) supra). Another preferred As indicated, the invention further provides nucleic acids algorithm when comparing a sequence of the invention to a that hybridize to other nucleic acids under particular hybrid database containing a large number of sequences from ization conditions. More specifically the invention encom different organisms is the computer program BLAST, espe passes nucleic acids molecules that hybridize under moder cially blastp or thlastin, using default parameters. See, e.g., ate or high stringency hybridization conditions (e.g., as 30 defined below), to the nucleic acid molecules of the inven Altschul et al. (1990) J. Mol. Biol. 215: 403 410 and tion. Methods for hybridizing nucleic acids are well-known Altschulet al. (1997) Nucleic Acids Res. 25:3389 402, each in the art. As is well known, a moderately stringent hybrid of which is herein incorporated by reference. ization conditions comprise a prewashing solution contain In this regard the invention also includes nucleic acid ing 5x sodium chloride/sodium citrate (SSC), 0.5% SDS, 1.0 35 molecules that encode polypeptides that are “substantially mM EDTA (pH 8.0), hybridization buffer of about 50% identical with respect to an antibody variable region poly formamide, 6xSSC, and a hybridization temperature of 55° peptide sequence (e.g., either the donor light or heavy chain C. (or other similar hybridization Solutions, such as one variable region or the acceptor light or heavy chain variable containing about 50% formamide, with a hybridization region. As applied to Such polypeptides, the term 'substan temperature of 42°C.), and washing conditions of 60° C., in 40 tial identity” or “substantially identical means that two 0.5xSSC, 0.1% SDS. By way of comparison hybridization peptide sequences, when optimally aligned. Such as by the under highly stringent hybridization conditions comprise programs GAP or BEST-FIT using default gap weights, washing with 6xSSC at 45° C., followed by one or more share at least 65% sequence identity, preferably at least 70%, washes in 0.1xSSC, 0.2% SDS at 68° C. Furthermore, one 75%, 80%, 85%, or 90% sequence identity, even more of skill in the art can manipulate the hybridization and/or 45 preferably at least 93%. 95%, 98% or 99% sequence iden washing conditions to increase or decrease the stringency of tity. Preferably, residue positions which are not identical hybridization Such that nucleic acids comprising nucleotide differ by conservative amino acid substitutions. A “conser sequences that are at least 65%, 70%, 75%, 80%, 85%, 90%, Vative amino acid substitution' is one in which an amino 95%, 98% or 99% identical to each other typically remain acid residue is substituted by another amino acid residue hybridized to each other. 50 having a side chain (R group) with similar chemical prop The invention also includes nucleic acid molecules that erties (e.g., charge or hydrophobicity). In general, a conser are “substantially identical to the described nucleic acid Vative amino acid substitution will not substantially change molecules. In one embodiment, the term Substantially iden the functional properties of a protein. In cases where two or tical with regard to a nucleic acid sequence means may be more amino acid sequences differ from each other by construed as a sequence of nucleic acid molecules exhibiting 55 conservative substitutions, the percent sequence identity or at least about 65%, 70%, 75%, 80%, 85%, or 90% sequence degree of similarity may be adjusted upwards to correct for identity. In other embodiments, the nucleic acid molecules the conservative nature of the substitution. exhibit 95% or 98% sequence identity to the reference 3. Expression nucleic acid sequence. The varied processes of recombinant expression, i.e., the The basic parameters affecting the choice of hybridization 60 production of RNA or of RNA and protein/peptide, are well conditions and guidance for devising Suitable conditions are known as set forth, for example, in Berger and Kimmel, set forth by, for example, Sambrook, Fritsch, and Maniatis Guide to Molecular Cloning Techniques, Methods in Enzy (1989, Molecular Cloning: A Laboratory Manual, Cold mology Volume 152 Academic Press, Inc., San Diego, Calif.; Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., Sambrook et al., Molecular Cloning-A Laboratory Manual chapters 9 and 11; and Current Protocols in Molecular 65 (3rd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Biology, 1995, Ausubel et al., eds., John Wiley & Sons, Inc., Spring Harbor, N.Y., (2000); and Current Protocols in sections 2.10 and 6.3-6.4), and can be readily determined by Molecular Biology, F. M. Ausubel et al., eds. Current US 9,534,058 B2 35 36 Protocols, a joint venture between Greene Publishing Asso is an antibody, antibody fragment, or fusion protein. In ciates, Inc. and John Wiley & Sons, Inc., (Supplemented certain embodiments, the host cells have been further through 2006). manipulated to express increased levels of one or more Certain terms of interest include “expression control polypeptides having N-acetylglucosaminyltransferase III sequence' which comprises promoters, ribosome binding (GnTI11) activity. Compatible host cells include cultured sites, enhancers and other control elements which regulate cells, e.g., mammalian cultured cells, such as CHO cells, transcription of a gene or translation of mRNA. As is well BHK cells, NSO cells, SP2/0 cells, YO myeloma cells, known, a “promoter” or “promoter region” relates to a P3X63 mouse myeloma cells, PER cells, PER.C6 cells or nucleic acid sequence which generally is located upstream hybridoma cells, yeast cells, insect cells, and plant cells, to (5') to the nucleic acid sequence being expressed and con 10 name only a few, but also cells comprised within a trans trols expression of the sequence by providing a recognition genic animal, transgenic plant or cultured plant or animal and binding site for RNA-polymerase. tissue. Exemplary promoters which are compatible according to For long-term, high-yield production of recombinant pro the invention include promoters for SP6, T3 and T7 poly teins stable expression is preferred. Accordingly, cell lines merase, human U6 RNA promoter, CMV promoter, and 15 that stably express the selected modulator may be engi artificial hybrid promoters thereof (e.g. CMV) where a part neered using standard art recognized techniques. Rather than or parts are fused to a part or parts of promoters of genes of using expression vectors that contain viral origins of repli other cellular proteins such as e.g. human GAPDH (glycer cation, host cells can be transformed with DNA controlled aldehyde-3-phosphate dehydrogenase), and including or not by appropriate expression control elements (e.g., promoter, including (an) additional intron(s). enhancer, sequences, transcription terminators, polyade In certain embodiments, the nucleic acid molecule may be nylation sites, etc.), and a selectable marker. Any of the present in a vector, where appropriate with a promoter, selection systems well known in the art may be used, which controls expression of the nucleic acid. The well including the glutamine synthetase gene expression system known term “vector” comprises any intermediary vehicle for (the GS system) which provides an efficient approach for a nucleic acid which enables said nucleic acid, for example, 25 enhancing expression under certain conditions. The GS to be introduced into prokaryotic and/or eukaryotic cells system is discussed in whole or part in connection with EP and, where appropriate, to be integrated into a genome. patents 0216846,0256 055, 0323 997 and 0 338 841 and Methods of transforming mammalian cells are well known U.S. Pat. Nos. 5,591,639 and 5,879,936 each of which is in the art. See, for example, U.S. Pat. Nos. 4.399.216, incorporated herein by reference. Another preferred expres 4.912,040, 4,740,461, and 4,959,455. The vectors may 30 sion system, the FreedomTM CHO-S Kit is commercially include a nucleotide sequence encoding an antibody of the provided by Life Technologies (Catalog Number A13696 invention (e.g., a whole antibody, a heavy or light chain of 01) also allows for the development of stable cell lines that an antibody, a V or V, of an antibody, or a portion thereof, may be used for modulator production. or a heavy- or light-chain CDR, a single chain Fv, or Such host-expression systems represent vehicles by fragments or variants thereof), operably linked to a promoter 35 which the coding sequences of interest may be produced and (see, e.g., PCT Publication WO 86/05807; PCT Publication Subsequently purified, but also represent cells which may, WO 89/01036; and U.S. Pat. No. 5,122.464). when transformed or transfected with the appropriate A variety of host-expression vector systems are commer nucleotide coding sequences, express a molecule of the cially available, and many are compatible with the teachings invention in situ. The host cell may be co-transfected with herein and may be used to express the modulators of the 40 two expression vectors of the invention, for example, the invention. Such systems include, but are not limited to, first vector encoding a heavy chain derived polypeptide and microorganisms such as bacteria (e.g., E. coli, B. subtilis, the second vector encoding a light chain derived polypep streptomyces) transformed with recombinant bacteriophage tide. DNA, plasmid DNA or cosmid DNA expression vectors Thus, in certain embodiments, the present invention pro containing modulator coding sequences; yeast (e.g., Saccha 45 vides recombinant host cells allowing for the expression of romyces, Pichia) transfected with recombinant yeast expres antibodies or portions thereof. Antibodies produced by sion vectors containing modulator coding sequences; insect expression in Such recombinant host cells are referred to cell systems infected with recombinant virus expression hereinas recombinant antibodies. The present invention also vectors (e.g., baculovirus) containing modulator coding provides progeny cells of Such host cells, and antibodies sequences; plant cell systems (e.g., Nicotiana, Arabidopsis, 50 produced by the same. duckweed, corn, wheat, potato, etc.) infected with recom C. Chemical Synthesis binant viral expression vectors (e.g., cauliflower mosaic In addition, the modulators may be chemically synthe virus; tobacco mosaic virus) or transfected with recombinant sized using techniques known in the art (e.g., see Creighton, plasmid expression vectors (e.g., Ti plasmid) containing 1983, Proteins: Structures and Molecular Principles, W.H. modulator coding sequences; or mammalian cell systems 55 Freeman & Co., N.Y., and Hunkapiller, M., et al., 1984, (e.g., COS, CHO, BHK, 293, 3T3 cells, etc.) harboring Nature 310:105-111). Furthermore, if desired, nonclassical recombinant expression constructs containing promoters amino acids or chemical amino acid analogs (such as derived from the genome of mammalian cells (e.g., metal D-isomers of the common amino acids, 2,4-diaminobutyric lothionein promoter) or from mammalian viruses (e.g., the acid, a-amino isobutyric acid, 4-aminobutyric acid, and the adenovirus late promoter; the vaccinia virus 7.5K promoter). 60 like) can be introduced as a Substitution or addition into a As used herein, the term “host cell’ covers any kind of polypeptide sequence. cellular system which can be engineered to generate the D. Transgenic Systems polypeptides and antigen-binding molecules of the present In other embodiments modulators may be produced trans invention. In one embodiment, the host cell is engineered to genically through the generation of a mammal or plant that allow the production of an antigen binding molecule with 65 is transgenic for recombinant molecules such as the immu modified glycoforms. In a preferred embodiment, the anti noglobulin heavy and light chain sequences and that pro gen binding molecule, or variant antigen binding molecule, duces the desired compounds in a recoverable form. This US 9,534,058 B2 37 38 includes, for example, the production of protein modulators VI. CD324 Modulator Fragments and Derivatives (e.g., antibodies) in, and recovery from, the milk of goats, Whatever generation and production methodology is cows, or other mammals. See, e.g., U.S. Pat. Nos. 5,827,690, selected, modulators of the instant invention will recognize, 5,756,687, 5,750,172, and 5,741,957. In some embodiments, react, bind, combine, complex, connect, attach, join, interact non-human transgenic animals that comprise human immu or otherwise associate with a target determinant (e.g., an noglobulin loci are immunized to produce antibodies. epitope on an antigen) and thereby provide the desired Other transgenic techniques are set forth in Hogan et al., results. Where the modulator comprises an antibody or Manipulating the Mouse Embryo: A Laboratory Manual 2nd fragment, construct or derivative thereof Such associations ed., Cold Spring Harbor Press (1999); Jackson et al., Mouse may be through one or more “antigen-binding sites.” “bind Genetics and Transgenics: A Practical Approach, Oxford 10 ing sites’ or “binding components' comprising the CDRS University Press (2000); and Pinkert, Transgenic Animal and expressed on the antibody, where a binding site com Technology: A Laboratory Handbook, Academic Press prises a region of a polypeptide that is responsible for (1999) and U.S. Pat. No. 6,417,429. In some embodiments, selectively binding to a target molecule orantigen epitope of the non-human animals are mice, rats, sheep, pigs, goats, 15 interest. Binding domains comprise at least one binding site cattle or horses, and the desired product is produced in (e.g., an intact IgG antibody will have two binding domains blood, milk, urine, saliva, tears, mucus and other bodily and two binding sites). Exemplary binding domains include fluids from which it is readily obtainable using art recog an antibody variable domain, a receptor-binding domain of nized purification techniques. a ligand, a ligand-binding domain of a receptor or an Other compatible production systems include methods for enzymatic domain. making antibodies in plants such as described, for example, A. Antibodies in U.S. Pat. Nos. 6,046,037 and 5,959,177 which are incor As noted above, the term “antibody' is intended to cover porated herein with respect to Such techniques. polyclonal antibodies, multiclonal antibodies, chimeric anti E. Isolation/Purification bodies, CDR grafted antibodies, humanized and primatized Once a modulator of the invention has been produced by 25 antibodies, human antibodies, recombinantly produced anti recombinant expression or any other of the disclosed tech bodies, intrabodies, antibody fragments, multispecific anti niques, it may be purified by any method known in the art bodies, bispecific antibodies, monovalent antibodies, multi for purification of immunoglobulins or proteins. In this Valent antibodies, anti-idiotypic antibodies, as well as respect the modulator may be "isolated” which means that it synthetic antibodies. 30 The terms “antigen-binding site.” “binding site' or “bind has been identified and separated and/or recovered from a ing component' when used herein refer to the amino acid component of its natural environment. Contaminant com residues of an antibody which are responsible for epitope ponents of its natural environment are materials that would recognition and antigen-binding. As discussed above the interfere with diagnostic or therapeutic uses for the poly antigen-binding site of an antibody comprises amino acid peptide and may include enzymes, hormones, and other 35 residues from the complementary determining regions or proteinaceous or nonproteinaceous Solutes. Isolated modu CDRS. lators include a modulator in situ within recombinant cells B. Fragments because at least one component of the polypeptide's natural Regardless of which form of the modulator (e.g. chimeric, environment will not be present. humanized, etc.) is selected to practice the invention it will If the desired molecule is produced intracellularly, as a 40 be appreciated that immunoreactive fragments of the same first step, the particulate debris, either host cells or lysed may be used in accordance with the teachings herein. An fragments, may be removed, for example, by centrifugation 'antibody fragment comprises at least a portion of an intact or ultrafiltration. Where the modulator is secreted into the antibody. As used herein, the term “fragment of an antibody medium, Supernatants from Such expression systems are molecule includes antigen-binding fragments of antibodies, generally first concentrated using a commercially available 45 and the term “antigen-binding fragment” refers to a poly protein concentration filter, for example, an Amicon or peptide fragment of an immunoglobulin or antibody that Pelicon ultrafiltration unit (Millipore Corp.). Once the immunospecifically binds or reacts with a selected antigen insoluble contaminants are removed the modulator prepa or immunogenic determinant thereof or competes with the ration may be further purified using standard techniques intact antibody from which the fragments were derived for Such as, for example, hydroxylapatite chromatography, gel 50 specific antigen binding. electrophoresis, dialysis, and affinity chromatography, with Exemplary fragments include: V, V, ScPV, F(ab')2 affinity chromatography of particular interest. In this regard fragment, Fab fragment, Fd fragment, Fv fragment, single protein A can be used to purify antibodies that are based on domain antibody fragments, diabodies, linear antibodies, human IgG1, IgG2 or IgG4 heavy chains (Lindmark, et al., single-chain antibody molecules and multispecific antibod J Immunol Meth 62:1 (1983)) while protein G is recom 55 ies formed from antibody fragments. In addition, an active mended for all mouse isotypes and for human IgG3 (Guss, fragment comprises a portion of the antibody that retains its et al., EMBOJ 5:1567 (1986)). Other techniques for protein ability to interact with the antigen/substrates or receptors purification Such as fractionation on an ion-exchange col and modify them in a manner similar to that of an intact umn, ethanol precipitation, reverse phase HPLC, chroma antibody (though maybe with somewhat less efficiency). tography on silica, chromatography on heparin, Sepharose 60 In other embodiments, an antibody fragment is one that chromatography on an anion or cation exchange resin (Such comprises the Fc region and that retains at least one of the as a polyaspartic acid column), chromatofocusing, SDS biological functions normally associated with the Fc region PAGE and ammonium sulfate precipitation are also avail when present in an intact antibody, Such as FcRn binding, able depending on the antibody to be recovered. In particu antibody half-life modulation, ADCC function and comple larly preferred embodiments the modulators of the instant 65 ment binding. In one embodiment, an antibody fragment is invention will be purified, at least in part, using Protein A or a monovalent antibody that has an in vivo half-life substan Protein G affinity chromatography. tially similar to an intact antibody. For example, Such an US 9,534,058 B2 39 40 antibody fragment may comprise an antigen binding arm That is, for the purposes of the instant invention, the linked to an Fc sequence capable of conferring in vivo subject antibodies will preferably have at least one binding stability to the fragment. site specific for an epitope presented by human CD324. In As would be well recognized by those skilled in the art, one embodiment the antibodies of the instant invention will fragments can be obtained via chemical or enzymatic treat be monovalent in that each binding site of the molecule will ment (Such as papain or pepsin) of an intact or complete specifically bind to a single CD324 position or epitope. In antibody or antibody chain or by recombinant means. See, other embodiments, the antibodies will be multivalent in that e.g., Fundamental Immunology, W. E. Paul, ed., Raven they comprise more than one binding site and the different Press, N.Y. (1999), for a more detailed description of anti binding sites specifically associate with more than a single body fragments. In this regard, while various antibody 10 position or epitope. In Such cases the multiple epitopes may fragments are defined in terms of the digestion of an intact be present on the selected CD324 polypeptide or variant or antibody, one of skill will appreciate that Such fragments a single epitope may be present on CD324 while a second, may be synthesized de novo either chemically or by using different epitope may be present on another molecule or recombinant DNA methodology. Surface. In either case the multispecific antibodies recognize C. Derivatives 15 at least two distinct epitopes that are not equivalent as The invention further includes immunoreactive modulator defined by competitive binding assays. That is, epitopes will derivatives and antigen binding molecules comprising one be held to be distinct and not equivalent if the binding sites or more modifications. of the multispecific are able to recognize each respective 1. Multivalent Antibodies epitope without interference or competition from one of the In one embodiment, the modulators of the invention may other binding sites. Such interference or competition (or lack comprise monovalent or multivalent (e.g., bivalent, triva thereof) may be determined using the same art-recognized lent, etc.) antibodies. As used herein, the term “valency’ competitive assays employed to define antibody bins. refers to the number of potential antigen binding sites In the context of the instant invention any art-recognized associated with an antibody. Each antigen binding site or bispecific or multispecific construct comprising a binding binding component specifically binds one target molecule or 25 site recognizing a first epitope present on CD324 and at least specific position or locus on a target molecule. When an a second binding site that recognizes a second epitope which antibody is monovalent, each binding site of the molecule is distinct from the first epitope is compatible and may be will specifically bind to a single antigen position or epitope. used in conjunction with the teachings herein. In preferred When an antibody comprises more than one antigen-binding embodiments the invention provides for bispecific antibod site (multivalent), each antigen-binding site may specifically 30 ies in which two different antigen-binding sites are incor bind the same or different molecules (e.g., may bind to porated into a single molecule. Bispecific antibodies may be different ligands or different antigens, or different epitopes prepared by chemical cross-linking (Brennan, et al., Science or positions on the same antigen). 229, 81 (1985); Raso, et al., J. Biol. Chem. 272, 27623 As discussed the term “antibody' herein is used in the (1997)), disulfide exchange, production of hybrid-hybrido broadest sense and specifically covers monoclonal antibod 35 mas (quadromas), by transcription and translation to pro ies, polyclonal antibodies, multispecific antibodies, and anti duce a single polypeptide chain embodying a bispecific body fragments so long as they exhibit the desired biological antibody, or by transcription and translation to produce more activity. Further, the term “multispecific antibody' is used in than one polypeptide chain that can associate covalently to the broadest sense and specifically covers an antibody produce a bispecific antibody. The contemplated bispecific comprising an antigen-binding domain that has polyepitopic 40 antibody can also be made entirely by chemical synthesis. specificity (i.e., is capable of specifically binding to two, or The bispecific antibody may comprise two different variable more, different epitopes on one biological molecule or is regions, two different constant regions, a variable region and capable of specifically binding to epitopes on two, or more, a constant region, or other variations. different biological molecules). One specific example of an In one selected embodiment, the modulators are bispecific antigen-binding domain is a VV unit comprised of a heavy 45 antibodies in which the two chains have different specifici chain variable domain (V) and a light chain variable ties, as described in Millstein et al., 1983, Nature, 305:537 domain (V). Such multispecific antibodies include, but are 539. Other embodiments include antibodies with additional not limited to, full length antibodies, antibodies having two specificities such as trispecific antibodies. Other compatible or more VL and VH domains, antibody fragments such as multispecific constructs and methods of their fabrication are Fab, Fv, dsEv, sclv, diabodies, bispecific diabodies and 50 set forth in U.S.PNs. 2009/01552.55 and 2011/0301331, WO triabodies, antibody fragments that have been linked cova 94/04690 and WO 96/27011; Suresh et al., 1986, Methods in lently or non-covalently. A “bispecific antibody' is a mul Enzymology, 121:210; Coloma, M. J., et al., Nature Biotech tispecific antibody comprising antigen-binding domains that 15 (1997) 159-163; WO 2001/077342; and Morrison, S. L., are capable of specifically recognizing or binding to two Nature Biotech 25 (2007) 1233-1234) each of which is different epitopes on one molecule or is capable of specifi 55 incorporated herein by reference. cally recognizing or binding to epitopes on two different In yet other embodiments, antibody variable domains molecules. The bispecific antibody is also referred to herein with the desired binding specificities (antibody-antigen as having “dual specificity” or as being “dual specific'. See, combining sites) are fused to immunoglobulin constant for example, U.S.PNs. 2009/0130105 and 2012/0121596. In domain sequences. The fusion preferably is with an immu each case at least one of the binding sites will comprise an 60 noglobulin heavy chain constant domain, comprising at least epitope, motif or domain associated with CD324 or an part of the hinge, C2, and/or C3 regions. In one example, immunoreactive fragment thereof. Other compatible con the first heavy-chain constant region (C1) containing the structs may be found in U.S.P.N.'s 2013/0017200, 2013/ site necessary for light chain binding is present in at least O004416 and 2012/031 6324 as well as U.S. Pat. Nos. one of the fusions. DNAs encoding the immunoglobulin 8,349,332 and 7,521,056 as well as WO 2012/162583 and 65 heavy chain fusions and, if desired, the immunoglobulin WO 2013/005194 each of which is incorporated herein by light chain, are inserted into separate expression vectors, and reference. are co-transfected into a suitable host organism. This pro US 9,534,058 B2 41 42 vides for great flexibility in adjusting the mutual proportions momab, bevacizumab, bivatuZumab, blinatumomab, of the three polypeptide fragments in embodiments when brentuximab, cantuzumab, catumaXomab, cetuximab, unequal ratios of the three polypeptide chains used in the citatuZumab, cixutumumab, clivatuZumab, conatumumab, construction provide the optimum yields. It is, however, daratumumab, drozitumab, duligotumab, dusigitumab, detu possible to insert the coding sequences for two or all three momab, dacetuZumab, dalotuZumab, ecromeximab, elotu polypeptide chains in one expression vector when, the Zumab, ensituximab, ertumaxomab, etaracizumab, farletu expression of at least two polypeptide chains in equal ratios Zumab, ficlatuZumab, figitumumab, flanVotumab, results in high yields or when the ratios are of no particular futuximab, ganitumab, gemtuzumab, girentuximab, glemba significance. tumumab, ibritumomab, igovomab, imgatuZumab, indatuX In one embodiment of this approach, the bispecific anti 10 bodies are composed of a hybrid immunoglobulin heavy imab, inotuZumab, intetumumab, ipilimumab, iratumumab, chain with a first binding specificity in one arm (e.g., labetuZumab, lexatumumab, lintuZumab, lorVotuZumab, CD324), and a hybrid immunoglobulin heavy chain-light lucatumumab, mapatumumab, matuZumab, milatuZumab, chain pair (providing a second binding specificity) in the minretumomab, mitumomab, moxetumomab, narnatumab, other arm. It was found that this asymmetric structure 15 naptumomab, necitumumab, nimotuzumab, nofetumomabn, facilitates the separation of the desired bispecific compound ocaratuZumab. ofatumumab, olaratumab, onartuzumab, from unwanted immunoglobulin chain combinations, as the oportuZumab, oregovomab, panitumumab, parsatuZumab, presence of an immunoglobulin light chain in only one half patritumab, pemtumomab, pertuzumab, pintumomab, pritu of the bispecific molecule provides for a facile way of mumab, racotumomab, radretumab, rillotumumab, rituX separation. This approach is disclosed in WO94/04690. For imab, robatumumab, Satumomab, sibrotuZumab, siltuximab, further details of generating bispecific antibodies see, for simtuzumab, Solitomab, tacatuZumab, taplitumomab, tena example, Suresh et al., 1986, Methods in Enzymology, tumomab, teprotumumab, tigatuZumab, toSitumomab, tras 121:210. According to another approach described in tuZumab, tucotuzumab, ublituximab, VeltuZumab, Vorsetu WO96/27011, a pair of antibody molecules can be engi Zumab, votumumab, Zalutumumab, CC49 and 3F8. Given neered to maximize the percentage of heterodimers that are 25 that the constituent amino acid sequences are known for recovered from recombinant cell culture. The preferred each of these antibodies it is well within the skill of the art interface comprises at least a part of the C3 domain of an to select one of the variable regions and incorporate them in antibody constant domain. In this method, one or more Small compatible multispecific constructs. amino acid side chains from the interface of the first anti In addition to incorporating known antibody binding body molecule are replaced with larger side chains (e.g. 30 domains it is well within the art to generate antibodies to a tyrosine or tryptophan). Compensatory cavities of identical known antigen and engineer the resulting antigen-binding or similar size to the large side chain(s) are created on the sites or derivatives thereof into compatible multispecific interface of the second antibody molecule by replacing large sequences. Particularly preferred embodiments will com amino acid side chains with Smaller ones (e.g. alanine or prise an antigen-binding site that recognizes (e.g., binds or threonine). This provides a mechanism for increasing the 35 associates with) an antigen selected from the group consist yield of the heterodimer over other unwanted end-products ing of OCT4, Nanog, STAT3, EPCAM, CD24, CD34, Such as homodimers. NB84, TrkA, GD2, CD133, CD20, CD56, CD29, B7113, Yet other compatible constructs are set forth in Example CD46, transferrin receptor, JAM3, carboxypeptidase M. 13 below where selected amino acids in the human IgG1 and oncostatin M, Lgr5, Lgró, CD325, nectin-4, nestin, Sox1, kappa light chain were mutated to alter the charge distribu 40 Bmi-1, eed, easyhl, easyh2, mf2, yy1, SmarcA3, Smarck A5. tion of the chains and improve assembly and stability of the smarcD3, Smarch 1, millt3, DLL1, DLL4, FZD1, FZD2, multispecific modulators. More particularly several IgG-like FZD3, FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, WNT2, anti-CD324/Nectin-4 bispecific antibody variants were con WNT2B, WNT3, WNT5A, WNT10B, WNT16, AXIN1, structed with human constant regions using the human IgG1 BCL9, MYC, (TCF4) SLC7A8, SLC44A4, IL1RAPTEM8, and kappa light chain background (Table 1). Mutations to 45 TMPRSS4, MUC16, GPRC5B, SLC6A14, SLC4A11, the constant regions of each of the variants were introduced PPAP2C, CAV1, CAV2, PTPN3, EPHA1 EPHA2, EPHA3, for the purpose of either: (i) preferentially pairing heavy EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, chains of different specificity in heteromeric rather than EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6, homomeric fashion (asymmetric heavy chain pairing) or (ii) EFNA1, EFNA2, EFNA3, EFNA5, EFNA6, EFNB1, preferentially pairing each heavy chain with the correspond 50 EFNB2, EFNB3, SLC1A1, CX3CL1, ADORA2A, MPZL1, ing light chain (heavy chain/light chain pairing). As seen in FLJ10052, C4.4A, EDG3, RARRES1, TMEPAI, PTS, the Examples below these constructs are particularly effec CEACAM5, CEACAM6, NID2, STEAP, ABCA3, CRIM1, tive in mediating cell killing. IL1R1, OPN3, DAF, MUC1, CPD, NMA, ADAM9, GJA1, Whatever multispecific framework or structure is selected SLC19A2, ABCA1, PCDH7, ADCY9, SLC39A1, NPC1, to fabricate the construct it will be appreciated that the 55 ENPP1, N33, GPNMB, LY6E, CELSR1, LRP3, C20orf52, non-CD324 antigen-binding site may be chosen to bind or TMEPAI, FLVCR, PCDHA10, GPR54, TGFBR3, associate with any one of numerous target antigens and may SEMA4B, PCDHB2, ABCG2, CD166, AFP, BMP-4, be derived from available (commercially or otherwise) anti |B-catenin, CD2, CD3, CD9, CD14, CD31, CD38, CD44, bodies. That is, using standard molecular engineering tech CD45, CD74, CD90, CXCR4, decorin, APCDD1, PTK7, niques the constructs may be fabricated to incorporate the 60 EGFR, CD105, CD64, CD16, CD16a, CD16b, GLI1, GLI2, antigen-binding regions or CDRS from any antibody or CD49b, CD49e and CD49f. While the aforementioned anti reactive fragment for which the sequence is known. In this gens may comprise selected target embodiments of the regard the non-CD324 antigen-binding site may, in preferred instant invention it will be appreciated that one skilled in the embodiments, be obtained or derived from an antibody art could readily incorporate any antigen-binding region selected from the group consisting of abagovomab, adeca 65 from an antibody made to any particular antigen. tumumab, afutuZumab, alemtuzumab, altumomab, amatuX In accordance with the teachings herein it will further be imab, anatumomab, arcitumomab, bavituximab, bectu appreciated that the disclosed bispecific and multispecific US 9,534,058 B2 43 44 constructs may be used in a conjugated (e.g., with a cyto cytotoxicity in which secreted Ig bound onto FcRs present toxic agent) or unconjugated State. on certain cytotoxic cells (e.g., Natural Killer cells, neutro 2. Fc Region Modifications phils, and macrophages) enables these cytotoxic effector In addition to the various modifications, Substitutions, cells to bind specifically to an antigen-bearing target cell and additions or deletions to the variable or binding region of the subsequently kill the target cell with cytotoxins. In the disclosed modulators (e.g., Fc-CD324 or anti-CD324 anti context of the instant invention antibody variants are pro bodies) set forth above, those skilled in the art will appre vided with “altered FcR binding affinity, which is either ciate that selected embodiments of the present invention enhanced or diminished binding as compared to a parent or may also comprise Substitutions or modifications of the unmodified antibody or to an antibody comprising a native constant region (i.e. the Fc region). More particularly, it is 10 sequence FcR. Such variants which display decreased bind contemplated that the CD324 modulators of the invention ing may possess little or no appreciable binding, e.g., 0-20% may contain inter alia one or more additional amino acid binding to the FcR compared to a native sequence, e.g. as residue Substitutions, mutations and/or modifications which determined by techniques well known in the art. In other result in a compound with preferred characteristics includ embodiments the variant will exhibit enhanced binding as ing, but not limited to: altered pharmacokinetics, increased 15 compared to the native immunoglobulin Fc domain. It will serum half life, increase binding affinity, reduced immuno be appreciated that these types of Fc variants may advan genicity, increased production, altered Fc ligand binding to tageously be used to enhance the effective anti-neoplastic an Fc receptor (FcR), enhanced or reduced “ADCC (anti properties of the disclosed antibodies. In yet other embodi body-dependent cell mediated cytotoxicity) or “CDC ments, such alterations lead to increased binding affinity, (complement-dependent cytotoxicity) activity, altered gly reduced immunogenicity, increased production, altered gly cosylation and/or disulfide bonds and modified binding cosylation and/or disulfide bonds (e.g., for conjugation specificity. In this regard it will be appreciated that these Fe sites), modified binding specificity, increased phagocytosis: variants may advantageously be used to enhance the effec and/or down regulation of cell Surface receptors (e.g. B cell tive anti-neoplastic properties of the disclosed modulators. receptor, BCR), etc. To this end certain embodiments of the invention may 25 3. Altered Glycosylation comprise Substitutions or modifications of the Fe region, for Still other embodiments comprise one or more engineered example the addition of one or more amino acid residue, glycoforms, i.e., a CD324 modulator comprising an altered Substitutions, mutations and/or modifications to produce a glycosylation pattern or altered carbohydrate composition compound with enhanced or preferred Fe effector functions. that is covalently attached to the protein (e.g., in the Fe For example, changes in amino acid residues involved in the 30 domain). See, for example, Shields, R. L. et al. (2002) J. interaction between the Fc domain and an Fc receptor (e.g., Biol. Chem. 277:26733-26740. Engineered glycoforms may FcyRI, FcyRIIA and B, FcyRIII and FcRn) may lead to be useful for a variety of purposes, including but not limited increased cytotoxicity and/or altered pharmacokinetics. Such to enhancing or reducing effector function, increasing the as increased serum half-life (see, for example, Ravetch and affinity of the modulator for a target or facilitating produc Kinet, Annu. Rev. Immunol 9:457-92 (1991); Capel et al., 35 tion of the modulator. In certain embodiments where Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab. reduced effector function is desired, the molecule may be Clin. Med. 126:330-41 (1995) each of which is incorporated engineered to express an aglycosylated form. Substitutions herein by reference). that may result in elimination of one or more variable region In selected embodiments, antibodies with increased in framework glycosylation sites to thereby eliminate glyco Vivo half-lives can be generated by modifying (e.g., Substi 40 sylation at that site are well known (see e.g. U.S. Pat. Nos. tuting, deleting or adding) amino acid residues identified as 5,714,350 and 6,350,861). Conversely, enhanced effector involved in the interaction between the Fe domain and the functions or improved binding may be imparted to the Fc FcRn receptor (see, e.g., International Publication Nos. WO containing molecule by engineering in one or more addi 97/34631; WO 04/029207; U.S. Pat. No. 6,737,056 and tional glycosylation sites. U.S.P.N. 2003/0190311. With regard to such embodiments, 45 Other embodiments include an Fc variant that has an Fe variants may provide half-lives in a mammal, preferably altered glycosylation composition, such as a hypofucosy a human, of greater than 5 days, greater than 10 days, greater lated antibody having reduced amounts of fucosyl residues than 15 days, preferably greater than 20 days, greater than 25 or an antibody having increased bisecting GlcNAc struc days, greater than 30 days, greater than 35 days, greater than tures. Such altered glycosylation patterns have been dem 40 days, greater than 45 days, greater than 2 months, greater 50 onstrated to increase the ADCC ability of antibodies. Engi than 3 months, greater than 4 months, or greater than 5 neered glycoforms may be generated by any method known months. The increased half-life results in a higher serum titer to one skilled in the art, for example by using engineered or which thus reduces the frequency of the administration of variant expression strains, by co-expression with one or the antibodies and/or reduces the concentration of the anti more enzymes (for example N-acetylglucosaminyltrans bodies to be administered. Binding to human FcRn in vivo 55 ferase III (GnTI11)), by expressing a molecule comprising and serum half life of human FcRn high affinity binding an Fc region in various organisms or cell lines from various polypeptides can be assayed, e.g., in transgenic mice or organisms or by modifying carbohydrate(s) after the mol transfected human cell lines expressing human FcRn, or in ecule comprising Fc region has been expressed (see, for primates to which the polypeptides with a variant Fc region example, WO 2012/117002). are administered. WO 2000/42072 describes antibody vari 60 4. Additional Processing ants with improved or diminished binding to FcRns. See The modulators may be differentially modified during or also, e.g., Shields et al. J. Biol. Chem. 9(2):6591-6604 after production, e.g., by glycosylation, acetylation, phos (2001). phorylation, amidation, derivatization by known protecting/ In other embodiments, Fc alterations may lead to blocking groups, proteolytic cleavage, linkage to an anti enhanced or reduced ADCC or CDC activity. As in known 65 body molecule or other cellular ligand, etc. Any of numerous in the art, CDC refers to the lysing of a target cell in the chemical modifications may be carried out by known tech presence of complement, and ADCC refers to a form of niques, including but not limited, to specific chemical cleav US 9,534,058 B2 45 46 age by cyanogen bromide, trypsin, chymotrypsin, papain, antibody or antagonist will preferably diminish CD324 V8 protease, NaBH, acetylation, formylation, oxidation, homotypic or heterotypic binding by at least about 20%, reduction, metabolic synthesis in the presence of tunicamy 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, cin, etc. 99% or more. Various post-translational modifications also encom 5 B. Internalizing Modulators passed by the invention include, for example, N-linked or There is evidence that a substantial portion of expressed O-linked carbohydrate chains, processing of N-terminal or CD324 protein remains associated with the tumorigenic cell C-terminal ends, attachment of chemical moieties to the Surface, thereby allowing for localization and internalization amino acid backbone, chemical modifications of N-linked or of the disclosed modulators. In preferred embodiments such O-linked carbohydrate chains, and addition or deletion of an 10 modulators may be associated with, or conjugated to, anti N-terminal methionine residue as a result of prokaryotic host cancer agents such as cytotoxic moieties that kill the cell cell expression. Moreover, the modulators may also be upon internalization. In particularly preferred embodiments modified with a detectable label. Such as an enzymatic, the modulator will comprise an internalizing antibody drug fluorescent, radioisotopic or affinity label to allow for detec conjugate. tion and isolation of the modulator. 15 As used herein, a modulator that “internalizes” is one that VII. Modulator Characteristics is taken up (along with any payload) by the cell upon No matter how obtained or which of the aforementioned binding to an associated antigen or receptor. As will be forms the modulator takes, various embodiments of the appreciated, the internalizing modulator may, in preferred disclosed modulators may exhibit certain characteristics. In embodiments, comprise an antibody including antibody selected embodiments, antibody-producing cells (e.g., fragments and derivatives thereof, as well as antibody con hybridomas or yeast colonies) may be selected, cloned and jugates. Internalization may occur in vitro or in vivo. For further screened for favorable properties including, for therapeutic applications, internalization will preferably example, robust growth, high modulator production and, as occur in vivo in a subject in need thereof. The number of discussed in more detail below, desirable modulator char antibody molecules internalized may be sufficient or acteristics. In other cases characteristics of the modulator 25 adequate to kill an antigen-expressing cell, especially an may be imparted or influenced by selecting a particular antigen-expressing cancer stem cell. Depending on the antigen (e.g., a specific CD324 isoform) or immunoreactive potency of the antibody or antibody conjugate, in some fragment of the target antigen for inoculation of the animal. instances, the uptake of a single antibody molecule into the In still other embodiments the selected modulators may be cell is sufficient to kill the target cell to which the antibody engineered as described above to enhance or refine immu 30 binds. For example, certain toxins are so highly potent that nochemical characteristics such as affinity or pharmacoki the internalization of a few molecules of the toxin conju netics. gated to the antibody is sufficient to kill the tumor cell. A. Neutralizing Modulators Whether an antibody internalizes upon binding to a mam In certain embodiments, the modulators will comprise malian cell can be determined by various assays including “neutralizing antibodies or derivatives or fragments 35 those described in the Examples below. Methods of detect thereof. That is, the present invention may comprise anti ing whether an antibody internalizes into a cell are also body molecules that bind specific domains, motifs or described in U.S. Pat. No. 7,619,068 which is incorporated epitopes and are capable of blocking or inhibiting the herein by reference in its entirety. biological activity of CD324. More generally, the term C. Depleting Modulators “neutralizing antibody' refers to an antibody that binds to or 40 In other embodiments the antibodies will comprise deplet interacts with a target molecule or ligand and prevents ing antibodies or derivatives or fragments thereof. The term binding or association of the target antigen to a binding “depleting antibody refers to an antibody that preferably partner Such as a receptor or Substrate, thereby interrupting binds to or associates with an antigen on or near the cell the biological response that otherwise would result from the Surface and induces, promotes or causes the death or elimi interaction of the molecules. In the case of the instant 45 nation of the cell (e.g., by CDC, ADCC or introduction of a invention the neutralizing modulator would associate with cytotoxic agent). In some embodiments, the selected deplet CD324 and preferably interfere or reduce homotypic or ing antibodies will be associated or conjugated to a cytotoxic heterotypic association of the molecule thereby interrupting agent. biological processes such as cell-cell adhesion that other Preferably a depleting antibody will be able to remove, wise would result from the interaction of the molecules. 50 incapacitate, eliminate or kill at least 20%, 30%, 40%, 50%, It will be appreciated that competitive binding assays 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% of CD324 known in the art may be used to assess the binding and tumorigenic cells in a defined cell population. In some specificity of an antibody or immunologically functional embodiments the cell population may comprise enriched, fragment or derivative thereof. With regard to the instant sectioned, purified or isolated tumor perpetuating cells. In invention an antibody or fragment will be held to inhibit or 55 other embodiments the cell population may comprise whole reduce binding of CD324 to a binding partner or substrate tumor samples or heterogeneous tumor extracts that com (e.g., CD324, EGFR, CEB7) when an excess of antibody prise tumor perpetuating cells. Those skilled in the art will reduces the quantity of binding partner bound to CD324 by appreciate that standard biochemical techniques as at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, described in the Examples below may be used to monitor 90%. 95%, 97%, 99% or more as measured, for example, by 60 and quantify the depletion of tumorigenic cells or tumor disruption of the homotypic cell-cell contacts leading to cell perpetuating cells in accordance with the teachings herein. death (e.g., apoptosis or anoikis) or, more directly, in art D. Binning and Epitope Binding recognized in vitro competitive binding assays such as the It will further be appreciated the disclosed anti-CD324 one described in Example 10 below. Similarly, inhibition of antibody modulators will associate with, or bind to, discrete heterotypic binding may be readily assessed using analogous 65 epitopes or immunogenic determinants presented by the assays comprising a binding partner other than CD324. In selected target or fragment thereof. In certain embodiments, the case of antibodies to CD324 for example, a neutralizing epitope or immunogenic determinants include chemically US 9,534,058 B2 47 48 active Surface groupings of molecules such as amino acids, another, i.e. the antibodies compete for binding to the Sugar side chains, phosphoryl groups, or Sulfonyl groups, antigen. A high throughput process for binning antibodies and, in certain embodiments, may have specific three based upon their cross-competition is described in WO dimensional structural characteristics, and/or specific charge 03/48731. Other methods of binning or domain level or characteristics. Thus, as used herein the term “epitope' epitope mapping comprising modulator competition or anti includes any protein determinant capable of specific binding gen fragment expression on yeast. to an immunoglobulin or T-cell receptor or otherwise inter As used herein, the term “binning refers to methods used acting with a molecule. In certain embodiments, an antibody to group or classify antibodies based on their antigen bind is said to specifically bind (or immunospecifically bind or ing characteristics and competition. While the techniques react) an antigen when it preferentially recognizes its target 10 are useful for defining and categorizing modulators of the antigen in a complex mixture of proteins and/or macromol instant invention, the bins do not always directly correlate ecules. In selected embodiments, an antibody is said to with epitopes and Such initial determinations of epitope recognize or specifically bind an antigen (i.e., an epitope) binding may be further refined and confirmed by other art when the equilibrium dissociation constant (K) is less than recognized methodology as described herein. However, as or equal to 10M or more preferably when it is less than or 15 discussed and shown in the Examples below (e.g., Example equal to 107M. In particularly preferred aspects the anti 7), empirical assignment of antibody modulators to indi body will recognize or specifically bind an epitope when the vidual bins provides information that may be indicative of equilibrium dissociation constant is less than or equal to the therapeutic potential of the disclosed modulators. 10M, and most preferably when the dissociation constant More specifically, one can determine whether a selected is less than or equal to 10'M. reference antibody (or fragment thereof) binds to the same For the instant disclosure the term “epitope” refers to that epitope or cross competes for binding with a second test portion of the target antigen capable of being recognized and antibody (i.e., is in the same bin) by using methods known specifically bound by a particular antibody modulator. When in the art and set forth in the Examples herein. In one the antigen is a polypeptide Such as CD324, epitopes may embodiment, a reference antibody modulator is associated generally be formed from both contiguous amino acids and 25 with CD324 antigen under Saturating conditions and then the noncontiguous amino acids juxtaposed by tertiary folding of ability of a secondary or test antibody modulator to bind to a protein ("conformational epitopes'). In such conforma CD324 is determined using standard immunochemical tech tional epitopes the points of interaction occur across amino niques. If the test antibody is able to substantially bind to acid residues on the protein that are linearly separated from CD324 at the same time as the reference anti-CD324 anti one another. Epitopes formed from contiguous amino acids 30 body, then the secondary or test antibody binds to a different (sometimes referred to as “linear or “continuous’ epitopes) epitope than the primary or reference antibody. However, if are typically retained upon protein denaturing, whereas the test antibody is not able to substantially bind to CD324 epitopes formed by tertiary folding are typically lost upon at the same time, then the test antibody binds to the same protein denaturing. In any event an epitope typically epitope, an overlapping epitope, or an epitope that is in close includes at least 3, and more usually, at least 5 or 8-10 amino 35 proximity (at least sterically) to the epitope bound by the acids in a unique spatial conformation. primary antibody. That is, the test antibody competes for In this respect it will be appreciated that, in certain antigen binding and is in the same bin as the reference embodiments, an epitope may be associated with, or reside antibody. in, one or more regions, domains or motifs of the CD324 The term “compete' or “competing antibody' when used protein. As discussed in more detail herein the extracellular 40 in the context of the disclosed modulators means competi region of the CD324 protein comprises a series of generally tion between antibodies as determined by an assay in which recognized domains including five ECA domains. For the a test antibody or immunologically functional fragment purposes of the instant disclosure the term “domain” will be under test prevents or inhibits specific binding of a reference used in accordance with its generally accepted meaning and antibody to a common antigen. Typically, such an assay will be held to refer to an identifiable or definable conserved 45 involves the use of purified antigen (e.g., CD324 or a structural entity within a protein that exhibits a distinctive domain or fragment thereof) bound to a solid surface or cells secondary structure content. In many cases homologous bearing either of these, an unlabeled test immunoglobulin domains with common functions will usually show and a labeled reference immunoglobulin. Competitive inhi sequence similarities and be found in a number of disparate bition is measured by determining the amount of label bound proteins. Similarly, the art recognized term “motif will be 50 to the solid surface or cells in the presence of the test used in accordance with its common meaning and shall immunoglobulin. Usually the test immunoglobulin is pres generally refer to a short, conserved region of a protein that ent in excess. Antibodies identified by competition assay is typically ten to twenty contiguous amino acid residues. As (competing antibodies) include antibodies binding to the discussed throughout, selected embodiments comprise same epitope as the reference antibody and antibodies modulators that associate with or bind to an epitope within 55 binding to an adjacent epitope Sufficiently proximal to the specific regions, domains or motifs of CD324. epitope bound by the reference antibody for steric hindrance In any event once a desired epitope on an antigen is to occur. Additional details regarding methods for determin determined, it is possible to generate antibodies to that ing competitive binding are provided in the Examples epitope, e.g., by immunizing with a peptide comprising the herein. Usually, when a competing antibody is present in epitope using techniques described in the present invention. 60 excess, it will inhibit specific binding of a reference antibody Alternatively, during the discovery process, the generation to a common antigen by at least 40%, 45%, 50%, 55%, 60%, and characterization of antibodies may elucidate informa 65%, 70% or 75%. In some instance, binding is inhibited by tion about desirable epitopes located in specific domains or at least 80%, 85%, 90%, 95%, or 97% or more. motifs. From this information, it is then possible to com With regard to the instant invention, and as set forth in the petitively screen antibodies for binding to the same epitope. 65 Example 7 below, it has been determined that the extracel An approach to achieve this is to conduct competition lular domain of CD324 defines at least five bins termed “bin studies to find antibodies that competitively bind with one A to “bin E. herein. US 9,534,058 B2 49 50 More generally, and as known in the art and detailed in the The antigen protein may be immobilized on either bio Examples below, the desired binning or competitive binding sensor chip Surfaces or polystyrene beads. The latter can be data can be obtained using Solid phase direct or indirect processed with, for example, an assay Such as multiplex radioimmunoassay (RIA), Solid phase direct or indirect LUMINEXTM detection assay (Luminex Corp.). Because of enzyme immunoassay (EIA or ELISA), sandwich competi the capacity of LUMINEX to handle multiplex analysis with tion assay, a BiacoreTM 2000 system (i.e., surface plasmon up to 100 different types of beads, LUMINEX provides resonance GE Healthcare), a ForteBio R. Analyzer (i.e., almost unlimited antigen Surfaces with various modifica bio-layer interferometry ForteBio, Inc.) or flow cytometric tions, resulting in improved resolution in antibody epitope methodology. The term "surface plasmon resonance,” as profiling over a biosensor assay. 10 E. Modulator Binding Characteristics used herein, refers to an optical phenomenon that allows for Besides epitope specificity the disclosed antibodies may the analysis of real-time specific interactions by detection of be characterized using physical characteristics such as, for alterations in protein concentrations within a biosensor example, binding affinities. In this regard the present inven matrix. The term “bio-layer interferometry” refers to an tion further encompasses the use of antibodies that have a optical analytical technique that analyzes the interference 15 high binding affinity for one or more CD324 variants or pattern of white light reflected from two surfaces: a layer of immunoreactive fragments thereof. immobilized protein on a biosensor tip, and an internal The term “K, as used herein, is intended to refer to the reference layer. Any change in the number of molecules dissociation constant of a particular antibody-antigen inter bound to the biosensor tip causes a shift in the interference action. An antibody of the invention is said to immunospe pattern that can be measured in real-time. In particularly cifically bind or recognize its target antigen when the preferred embodiments the analysis (whether surface plas dissociation constant K, (k/k) is s10M. The antibody mon resonance, bio-layer interferometry or flow cytometry) specifically binds antigen with high affinity when the K is is performed using a Biacore or ForteBio instrument or a s5x10M, and with very high affinity when the K, is flow cytometer (e.g., FACSAria II) as demonstrated in the s5x10"M. In one embodiment of the invention, the anti Examples below. 25 body has a K of s 10M and an off-rate of about 1x10"/ In order to further characterize the epitopes that the sec. In one embodiment of the invention, the off-rate is disclosed CD324 antibody modulators associate with or <1x10/sec. In other embodiments of the invention, the bind to, domain-level epitope mapping could be performed antibodies will bind to CD324 with a K, of between about using a modification of the protocol described by Cochranet 107M and 10'M, and in yet another embodiment it will al. (JImmunol Methods. 287 (1-2): 147-158 (2004) which is 30 bind with a Ks2x10'M. Still other selected embodiments incorporated herein by reference). Briefly, individual of the present invention comprise antibodies that have a domains of CD324 comprising specific amino acid disassociation constant or K, (k/k.) of less than 10°M, sequences could be expressed on the Surface of yeast and less than 5x10M, less than 10M, less than 5x10M, less binding by each CD324 antibody could be determined than 10M, less than 5x10M, less than 10M, less than through flow cytometry. 35 5x10M, less than 10M, less than 5x10M, less than Other compatible epitope mapping techniques include 107M, less than 5x107M, less than 10M, less than alanine Scanning mutants, peptide blots (Reineke (2004) 5x10M, less than 10M, less than 5x10M, less than Methods Mol Biol 248:443-63) (herein specifically incor 10'M, less than 5x10'M, less than 10'M, less than porated by reference in its entirety), or peptide cleavage 5x10'M, less than 10'M, less than 5x10'M, less than analysis. In addition, methods such as epitope excision, 40 10M, less than 5x10'M, less than 10M, less than epitope extraction and chemical modification of antigens can 5x10'M, less than 10M or less than 5x10'M. be employed (Tomer (2000) Protein Science 9: 487-496) In specific embodiments, an antibody of the invention that (herein specifically incorporated by reference in its entirety). immunospecifically binds to CD324 has an association rate In other embodiments Modification-Assisted Profiling constant or k (or k) rate (CD324 (Ab)+antigen (MAP), also known as Antigen Structure-based Antibody 45 (Ag).<-Ab-Ag) of at least 10M's', at least 2x10 Profiling (ASAP) provides a method that categorizes large M's', at least 5x10M's', at least 10M's', at least numbers of monoclonal antibodies (mAbs) directed against 5x1OM's', at least 107M's', at least 5x107M's', or the same antigen according to the similarities of the binding at least 10M's'. profile of each antibody to chemically or enzymatically In another embodiment, an antibody of the invention that modified antigen surfaces (U.S.P.N. 2004/0101920, herein 50 immunospecifically binds to CD324 has a disassociation specifically incorporated by reference in its entirety). Each rate constant or k (or k.) rate (CD324 (Ab)+antigen category may reflect a unique epitope either distinctly dif (Ag)-Ab-Ag) of less than 10's", less than 5x10's", ferent from or partially overlapping with epitope represented less than 10°s', less than 5x10's", less than 10s', less by another category. This technology allows rapid filtering than 5x10s', less than 10's", less than 5x10's", less of genetically identical antibodies, such that characterization 55 than 10s', less than 5x10s, less than 10's", less can be focused on genetically distinct antibodies. It will be than 5x10's less than 10's", less than 5x10's", less appreciated that MAP may be used to sort the hCD324 than 10s', less than 5x10s, less than 10's", less antibody modulators of the invention into groups of anti than 5x10's or less than 10's". bodies binding different epitopes In other selected embodiments of the present invention Agents useful for altering the structure of the immobilized 60 anti-CD324 antibodies will have an affinity constant or K, antigen include enzymes Such as proteolytic enzymes (e.g., (g(of) of at least 10'M', at least 5x10'M', at least trypsin, endoproteinase Glu-C, endoproteinase Asp-N, chy 10M', at least 5x10M, at least 10'M', at least motrypsin, etc.). Agents useful for altering the structure of 5x1O'M', at least 10M, at least 5x1OM', at least the immobilized antigen may also be chemical agents. Such 10'M', at least 5x10'M', at least 107M, at least as, succinimidyl esters and their derivatives, primary amine 65 5x10'M', at least 10M, at least 5x10'M', at least containing compounds, hydrazines and carbohydrazines, 10M, at least 5x10M, at least 10 'M', at least free amino acids, etc. 5x10'M', at least 10''M', at least 5x10'M', at least US 9,534,058 B2 51 52 10'M', at least 5x10'M', at least 10'M', at least agents is the Schiff base reaction. This method involves the 5x10'M', at least 10'M', at least 5x10'M', at least periodate oxidation of a drug that contains glycol or hydroxy 10 'M' or at least 5x1O'M'. groups, thus forming an aldehyde which is then reacted with Besides the aforementioned modulator characteristics the binding agent. Attachment occurs via formation of a antibodies of the instant invention may further be charac Schiff base with amino groups of the binding agent. Isoth terized using additional physical characteristics including, iocyanates and azlactones can also be used as coupling for example, thermal stability (i.e. melting temperature; agents for covalently attaching drugs to binding agents. Tm), and isoelectric points. (See, e.g., Bjelldvist et al., 1993, In other embodiments the disclosed modulators of the Electrophoresis 14:1023; Vermeer et al., 2000, Biophys. J. invention may be conjugated or associated with proteins, 78:394-404; Vermeer et al., 2000, Biophys.J.79:2150-2154 10 polypeptides or peptides that impart selected characteristics each of which is incorporated herein by reference). (e.g., biotoxins, biomarkers, purification tags, etc.). In cer VIII. Conjugated Modulators tain preferred embodiments the present invention encom A. Overview passes the use of modulators or fragments thereof recombi Once the modulators of the invention have been generated nantly fused or chemically conjugated (including both and/or fabricated and selected according to the teachings 15 covalent and non-covalent conjugations) to a heterologous herein they may be linked with, fused to, conjugated to (e.g., protein or peptide wherein the protein or peptide comprises covalently or non-covalently) or otherwise associated with at least 10, at least 20, at least 30, at least 40, at least 50, at pharmaceutically active or diagnostic moieties or biocom least 60, at least 70, at least 80, at least 90 or at least 100 patible modifiers. As used herein the term “conjugate' or amino acids. The construct does not necessarily need to be “modulator conjugate' or “antibody conjugate' will be used directly linked, but may occur through amino acid linker broadly and held to mean any biologically active or detect sequences. For example, antibodies may be used to target able molecule or drug associated with the disclosed modu heterologous polypeptides to particular cell types expressing lators regardless of the method of association. In this respect CD324, either in vitro or in Vivo, by fusing or conjugating it will be understood that Such conjugates may, in addition the modulators of the present invention to antibodies specific to the disclosed modulators, comprise peptides, polypep 25 for particular cell surface receptors to provide bispecific tides, proteins, prodrugs which are metabolized to an active constructs. Moreover, modulators fused or conjugated to agent in Vivo, polymers, nucleic acid molecules, Small heterologous polypeptides may also be used in in vitro molecules, binding agents, mimetic agents, synthetic drugs, immunoassays and may be particularly compatible with inorganic molecules, organic molecules and radioisotopes. purification methodology (e.g., his-tags) as is known in the Moreover, as indicated above the selected conjugate may be 30 art. See e.g., International publication No. WO 93/21232; covalently or non-covalently associated with, or linked to, European Patent No. EP 439,095; Naramura et al., 1994, the modulator and exhibit various stoichiometric molar Immunol. Lett. 39:91-99; U.S. Pat. No. 5,474,981; Gillies et ratios depending, at least in part, on the method used to al., 1992, PNAS 89:1428-1432; and Fell et al., 1991, J. effect the conjugation. Immunol. 146:2446-2452. Particularly preferred aspects of the instant invention will 35 B. Linkers comprise antibody modulator conjugates or antibody-drug Besides the aforementioned peptide linkers or spacers, it conjugates that may be used for the diagnosis and/or treat will be appreciated that several other varieties or types of ment of proliferative disorders. It will be appreciated that, linker may be used to associate the disclosed modulators unless otherwise dictated by context, the term “antibody with pharmaceutically active or diagnostic moieties or bio drug conjugate' or "ADC or the formula M-L-Din shall be 40 compatible modifiers. In some embodiments, the linker is held to encompass conjugates comprising both therapeutic cleavable under intracellular conditions, such that cleavage and diagnostic moieties. In Such embodiments antibody of the linker releases the drug unit from the antibody in the drug conjugate compounds will comprise a CD324 modu intracellular environment. In yet other embodiments, the lator (typically an anti-CD324 antibody) as the modulator or linker unit is not cleavable and the drug is released, for binding unit (M), a therapeutic or diagnostic moiety (D), and 45 example, by antibody degradation. optionally a linker (L) that joins the drug and the antigen To this end certain embodiments of the invention com binding agent. For the purposes of the instant disclosure “n” prise the use a linker that is cleavable by a cleaving agent shall be held to mean an integer from 1 to 20. In a preferred that is present in the intracellular environment (e.g., within embodiment, the modulator is a CD324 mAb comprising at a lysosome or endoSome or caveolae). The linker can be, for least one CDR from the heavy and light chain variable 50 example, a peptidyl linker that is cleaved by an intracellular regions as described above. peptidase or protease enzyme, including, but not limited to, Those skilled in the art will appreciate that a number of a lysosomal or endosomal protease. In some embodiments, different reactions are available for the attachment or asso the peptidyl linker is at least two amino acids long or at least ciation of therapeutic or diagnostic moieties and/or linkers to three amino acids long. Cleaving agents can include cathe binding agents. In selected embodiments this may be accom 55 psins B and D and plasmin, each of which is known to plished by reaction of the amino acid residues of the binding hydrolyze dipeptide drug derivatives resulting in the release agent, e.g., antibody molecule, including the amine groups of active drug inside target cells. Exemplary peptidyl linkers of lysine, the free carboxylic acid groups of glutamic and that are cleavable by the thiol-dependent protease Cathep aspartic acid, the Sulfhydryl groups of cysteine and the sin-B are peptides comprising Phe-Leu since Cathepsin-B various moieties of the aromatic amino acids. One of the 60 has been found to be highly expressed in cancerous tissue. most commonly used non-specific methods of covalent Other examples of such linkers are described, for example, attachment is the carbodiimide reaction to link a carboxy (or in U.S. Pat. No. 6,214,345 and U.S.P.N. 2012/0078028 each amino) group of a compound to amino (or carboxy) groups of which incorporated herein by reference in its entirety. In of the antibody. Additionally, bifunctional agents such as a specific preferred embodiment, the peptidyl linker cleav dialdehydes or imidoesters have been used to link the amino 65 able by an intracellular protease is a Val-Cit linker, an group of a compound to amino groups of an antibody Ala-Val linker or a Phe-Lys linker such as is described in molecule. Also available for attachment of drugs to binding U.S. Pat. No. 6,214.345. One advantage of using intracel US 9,534,058 B2 53 54 lular proteolytic release of the therapeutic agent is that the Clinical Applications, Pinchera et al. (eds.), pp. 475-506 agent is typically attenuated when conjugated and the serum (1985): “Analysis, Results, And Future Prospective Of The stabilities of the conjugates are typically high. Therapeutic Use Of Radiolabeled Antibody In Cancer In other embodiments, the cleavable linker is pH-sensi Therapy”, in Monoclonal Antibodies For Cancer Detection tive, i.e., sensitive to hydrolysis at certain pH values. Typi 5 And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic cally, the pH-sensitive linker hydrolyzable under acidic Press 1985), and Thorpe et al., 1982, Immunol. Rev. 62:119. conditions. For example, an acid-labile linker that is hydro In preferred embodiments a CD324 modulator that is con ly Zable in the lysosome (e.g., a hydraZone, Oxime, semicar jugated to a therapeutic moiety or cytotoxic agent may be baZone, thiosemicarbazone, cis-aconitic amide, orthoester, internalized by a cell upon binding to a CD324 molecule acetal, ketal, or the like) can be used (See, e.g., U.S. Pat. 10 associated with the cell surface thereby delivering the thera Nos. 5,122,368; 5,824.805; 5,622,929). Such linkers are peutic payload. relatively stable under neutral pH conditions, such as those C. Biocompatible Modifiers in the blood, but are unstable at below pH 5.5 or 5.0, the In selected embodiments the modulators of the invention approximate pH of the lysosome. may be conjugated or otherwise associated with biocompat In yet other embodiments, the linker is cleavable under 15 ible modifiers that may be used to adjust, alter, improve or reducing conditions (e.g., a disulfide linker). A variety of moderate modulator characteristics as desired. For example, disulfide linkers are known in the art, including, for antibodies or fusion constructs with increased in vivo half example, those that can be formed using SATA (N-succin lives can be generated by attaching relatively high molecular imidyl-S-acetylthioacetate). SPDP (N-succinimidyl-3-(2- weight polymer molecules Such as commercially available pyridyldithio)propionate). SPDB (N-succinimidyl-3-(2- polyethylene glycol (PEG) or similar biocompatible poly pyridyldithio) butyrate) and SMPT (N-succinimidyl mers. Those skilled in the art will appreciate that PEG may oxycarbonyl-alpha-methyl-alpha-(2-pyridyldithio)toluene). be obtained in many different molecular weight and molecu In yet other specific embodiments, the linker is a malonate lar configurations that can be selected to impart specific linker (Johnson et al., 1995, Anticancer Res. 15:1387-93), a properties to the antibody (e.g. the half-life may be tailored). maleimidobenzoyl linker (Lau et al., 1995, Bioorg-Med 25 PEG can be attached to modulators or antibody fragments or Chem. 3 (10): 1299-1304), or a 3'-N-amide analog (Lau et al., derivatives with or without a multifunctional linker either 1995, Bioorg-Med-Chem, 3(10): 1305-12). In yet other through site-specific conjugation of the PEG to the N- or embodiments, the linker unit is not cleavable and the drug is C-terminus of said antibodies or antibody fragments or via released by antibody degradation. (See U.S. Publication No. epsilon-amino groups present on lysine residues. Linear or 2005/0238649 incorporated by reference herein in its 30 branched polymer derivatization that results in minimal loss entirety and for all purposes). of biological activity may be used. The degree of conjuga In another preferred embodiment the modulators of the tion can be closely monitored by SDS-PAGE and mass instant, invention may be associated with biocompatible spectrometry to ensure optimal conjugation of PEG mol polymers comprising drug linker units. In this respect one ecules to antibody molecules. Unreacted PEG can be sepa such type of compatible polymer comprises Fleximer(R) 35 rated from antibody-PEG conjugates by, e.g., size exclusion polymers (Mersana Therapeutics). Such polymers are or ion-exchange chromatography. In a similar manner, the reportedly biodegradable, well tolerated and have been disclosed modulators can be conjugated to albumin in order clinically validated. Moreover, Such polymers are compat to make the antibody or antibody fragment more stable in ible with a number of customizable linker technologies and vivo or have a longer half life in vivo. The techniques are chemistries allowing for control of pharmacokinetics, local 40 well known in the art, see e.g., International Publication ization of drug release and improved biodistribution. Nos. WO 93/15199, WO 93/15200, and WO 01/77137; and The selected modulators can also be directly conjugated European Patent No. 0413, 622. Other biocompatible con radioisotopes or may comprise macrocyclic chelators useful jugates are evident to those of ordinary skill and may readily for conjugating radiometal ions (as described herein). In be identified in accordance with the teachings herein. certain embodiments, the macrocyclic chelator is 1,4,7,10 45 D. Diagnostic or Detection Agents tetraazacyclododecane-N,N',N',N'-tetraacetic acid (DOTA) In other preferred embodiments, modulators of the pres which can be attached to the antibody via a linker molecule. ent invention, or fragments or derivatives thereof, are con Such linker molecules are commonly known in the art and jugated to a diagnostic or detectable agent, marker or described in Denardo et al., 1998, Clin Cancer Res. 4:2483; reporter which may be, for example, a biological molecule Peterson et al., 1999, Bioconjug. Chem. 10:553; and Zim 50 (e.g., a peptide or nucleotide), a Small molecule, fluoro merman et. al., 1999, Nucl. Med. Biol. 26:943. phore, or radioisotope. Labeled modulators can be useful for More generally, techniques for conjugating therapeutic monitoring the development or progression of a hyperpro moieties or cytotoxic agents to modulators are well known. liferative disorder or as part of a clinical testing procedure to As discussed above moieties can be conjugated to modula determine the efficacy of a particular therapy including the tors by any art-recognized method, including, but not limited 55 disclosed modulators (i.e. theragnostics) or to determine a to aldehyde/Schiff linkage, sulphydryl linkage, acid-labile future course of treatment. Such markers or reporters may linkage, cis-aconityl linkage, hydrazone linkage, enzymati also be useful in purifying the selected modulator, modulator cally degradable linkage (see generally Garnett, 2002, Adv analytics (e.g., epitope binding or antibody binning), sepa Drug Deliv Rev 53:171). Also see, e.g., Amon et al., rating or isolating TIC or in preclinical procedures or "Monoclonal Antibodies For Immunotargeting Of Drugs In 60 toxicology studies. Cancer Therapy”, in Monoclonal Antibodies And Cancer Such diagnosis analysis and/or detection can be accom Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. plished by coupling the modulator to detectable Substances 1985); Hellstrom et al., “Antibodies For Drug Delivery”, in including, but not limited to, various enzymes comprising Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), for example horseradish peroxidase, alkaline phosphatase, pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, “Antibody 65 beta-galactosidase, or acetylcholinesterase; prosthetic Carriers Of Cytotoxic Agents In Cancer Therapy: A groups, such as but not limited to streptavidin/biotin and Review', in Monoclonal Antibodies 84: Biological And avidin/biotin; fluorescent materials, such as but not limited US 9,534,058 B2 55 56 to, umbelliferone, fluorescein, fluorescein isothiocynate, the instant invention may be associated with anti-CD3 rhodamine, dichlorotriazinylamine fluorescein, dansyl chlo binding molecules to recruit cytotoxic T-cells and have them ride or phycoerythrin; luminescent materials, such as but not target the tumor initiating cells (BiTE technology; see e.g., limited to, luminol; bioluminescent materials, such as but Fuhrmann, S. et. al. Annual Meeting of AACRAbstract No. not limited to, luciferase, luciferin, and aequorin; radioactive 5625 (2010) which is incorporated herein by reference). materials, such as but not limited to iodine (''I, ‘I, 'I, As indicated above selected embodiments of the instant '*'I), carbon (C), sulfur (S), tritium (H), indium ('In, invention are directed to conjugated CD324 modulators such 'In, '''In, '''In), and technetium ('Tc), thallium ('Ti), as anti-CD324 antibody drug conjugates that comprise pyr gallium (Ga, Ga), palladium ('Pd), molybdenum rolobenzodiazepine (PBD) as a cytotoxic agent. It will be (Mo), xenon (Xe), fluorine (F), 'Sim, '77Lu, ''Gd, 10 appreciated that PBDS are alkylating agents that exert anti 149Pm, 140La, 175Yb. 16Ho, 90Y, 7Sc, 186Re, 188Re, 142 Pr. tumor activity by covalently binding to DNA in the minor 105Rh, 97Ru,68Ge, 57Co,65Zn,85Sr., 32P 158Gd, 169Yb. 5 Cr, groove and inhibiting nucleic acid synthesis. In this respect Mn, Se, 'Sn, and ''Tin: positron emitting metals PBDs have been shown to have potent antitumor properties using various positron emission tomographies, noradioac while exhibiting minimal bone marrow depression. PBDs tive paramagnetic metal ions, and molecules that are radio 15 compatible with the present invention may be linked to the labeled or conjugated to specific radioisotopes. In Such CD324 modulator using any one of several types of linker embodiments appropriate detection methodology is well (e.g., a peptidyl linker comprising a maleimido moiety with known in the art and readily available from numerous a free sulfhydryl) and, in certain embodiments are dimeric in commercial sources. faint (i.e., PBD dimers). Compatible PBDs (and optional As indicated above, in other embodiments the modulators linkers) that may be conjugated to the disclosed modulators or fragments thereof can be fused or conjugated to marker are described, for example, in U.S. Pat. Nos. 6,362.331, sequences or compounds, such as a peptide or fluorophore to 7,049,311, 7,189,710, 7,429,658, 7,407,951, 7,741,319, facilitate purification or diagnostic or analytic procedures 7,557,099, 8,034,808, 8,163,736 U.S.P.N. 2011/0256157 Such as immunohistochemistry, bio-layer interferometry, and PCT filings WO2011/130613, WO2011/128650 and Surface plasmon resonance, flow cytometry, competitive 25 WO2011/130616 each of which is incorporated herein by ELISA, FACs, etc. In preferred embodiments, the marker reference. Accordingly, in particularly preferred embodi comprises a his-tag such as that provided by the pGE vector ments the modulator will comprise an anti CD324 antibody (Qiagen GmbH), among others, many of which are com conjugated or associated with one or more PBD dimers (i.e., mercially available. Other peptide tags useful for purifica a CD324-PBD ADC). tion include, but are not limited to, the hemagglutinin “HA’ 30 Still additional compatible anti-cancer agents include, but tag, which corresponds to an epitope derived from the are not limited to, antimetabolites (e.g., methotrexate, influenza hemagglutinin protein (Wilson et al., 1984, Cell 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil 37:767) and the “flag” tag (U.S. Pat. No. 4,703,004). decarbazine), alkylating agents (e.g., mechlorethamine, E. Therapeutic Moieties thioepa chlorambucil, melphalan, carmustine (BCNU) and As previously alluded to the modulators or fragments or 35 lomustine (CCNU), busulfan, dibromomannitol, streptozo derivatives thereof may also be conjugated, linked or fused tocin, and cisdichlorodiamine platinum (II) (DDP) cispla to or otherwise associated with a “therapeutic moiety” or tin), anthracyclines (e.g., daunorubicin (formerly daunomy 'drug” such as an anti-proliferative or anti-cancer agent cin) and doxorubicin), antibiotics (e.g., dactinomycin including, but not limited to, cytotoxic agents, cytostatic (formerly actinomycin), bleomycin, and anthramycin agents, anti-angiogenic agents, debulking agents, chemo 40 (AMC)), and anti-mitotic agents (e.g., Vincristine and Vin therapeutic agents, radiotherapy and radiotherapeutic blastine). A more extensive list of therapeutic moieties can agents, targeted anti-cancer agents, BRMs, therapeutic anti be found in PCT publication WO 03/075957 and U.S.P.N. bodies, cancer vaccines, cytokines, hormone therapies, 2009/0155255 each of which is incorporated herein by radiation therapy and anti-metastatic agents and immuno reference. therapeutic agents. 45 Another aspect of the invention includes ADCs compris Preferred exemplary anti-cancer agents include cytocha ing radioisotopes. Exemplary radioisotopes that may be lasin B, gramicidin D, ethidium bromide, emetime, mitomy compatible with such embodiments include, but are not cin, etoposide, tenoposide, Vincristine, vinblastine, colchi limited to, iodine (''I, ‘I,’’I, 'I), carbon (''C), copper cin, doxorubicin, daunorubicin, dihydroxy anthracin, (°Cu, Cu, 7Cu), sulfur (S), tritium (H), indium ('In, maytansinoids such as DM-1 and DM-4 (Immunogen, Inc.), 50 'In, In, '''In), bismuth ('Bi, 'Bi), technetium dione, mitoxantrone, mithramycin, actinomycin D, 1-dehy (Tc), thallium ('Ti), gallium (Ga, Ga), palladium drotestosterone, glucocorticoids, procaine, tetracaine, lido ('Pd), molybdenum (Mo), xenon (Xe), fluorine (F), caine, propranolol, puromycin, epirubicin, and cyclophos Sm, 77Lu, 15°Gd, 149Pm, 140La, 175Yb, 16Ho, 90Y, 7Sc, phamide and analogs or homologs thereof. Additional 186Re, 188Re, 142Pr, 105 Rh, 97Ru,68Ge, 57Co,65Zn,85Sr., 32P compatible cytotoxins comprise dolastatins and auristatins, 55 153Gd, 169Yb, 5 Cr, Mn, 7Se, Sn, and 7Sn, 225Ac, including monomethyl auristatin E (MMAE) and monom Br, and ''At. Other radionuclides are also available as ethyl auristatin F (MMAF) (Seattle Genetics, Inc.), aman diagnostic and therapeutic agents, especially those in the itins such as alpha-amanitin, beta-amanitin, gamma-aman energy range of 60 to 4,000 keV. Depending on the condition itin or epsilon-amanitin (Heidelberg Pharma AG), DNA to be treated and the desired therapeutic profile, those skilled minor groove binding agents such as duocarmycin deriva 60 in the art may readily select the appropriate radioisotope for tives (Syntarga, B.V.) and modified pyrrolobenzodiazepine use with the disclosed modulators. dimers (Spirogen, Ltd.), splicing inhibitors such as CD324 modulators of the present invention may also be meayamycin analogs or derivatives (e.g., FR901464 as set conjugated to a therapeutic moiety or drug that modifies a forth in U.S. Pat. No. 7.825,267), tubular binding agents given biological response (e.g., biological response modifi Such as epothilone analogs and paclitaxel and DNA dam 65 ers or BRMs). That is, therapeutic agents or moieties com aging agents such as calicheamicins and esperamicins. Fur patible with the instant invention are not to be construed as thermore, in certain embodiments the CD324 modulators of limited to classical chemical therapeutic agents. For US 9,534,058 B2 57 58 example, in particularly preferred embodiments the drug prise art recognized imaging or monitoring techniques such moiety may be a protein or polypeptide or fragment thereof as magnetic resonance imaging, computerized tomography possessing a desired biological activity. Such proteins may (e.g. CAT scan), positron tomography (e.g., PET scan) include, for example, a toxin such as abrin, ricin A. Onco radiography, ultrasound, etc., as would be known by those nase (or another cytotoxic RNase), pseudomonas eXotoxin, 5 skilled in the art. cholera toxin, or diphtheria toxin; a protein Such as tumor In another embodiment, the invention provides a method necrosis factor, C.-interferon, B-interferon, nerve growth of analyzing cancer progression and/or pathogenesis in vivo. factor, platelet derived growth factor, tissue plasminogen In another embodiment, analysis of cancer progression and/ activator, an apoptotic agent, e.g., TNF-C, TNF-B, AIM I or pathogenesis in vivo comprises determining the extent of (see, International Publication No. WO 97/33899), AIM II 10 tumor progression. In another embodiment, analysis com (see, International Publication No. WO 97/34911), Fas Ligand (Takahashi et al., 1994, J. Immunol. 6:1567), and prises the identification of the tumor. In another embodi VEGI (see, International Publication No. WO 99/23105), a ment, analysis of tumor progression is performed on the thrombotic agent or an anti-angiogenic agent, e.g., angiosta primary tumor. In another embodiment, analysis is per tin or endostatin; or, a biological response modifier Such as, 15 formed over time depending on the type of cancer as known for example, a lymphokine (e.g., interleukin-1 (IL-1). to one skilled in the art. In another embodiment, further interleukin-2 (IL-2), interleukin-6 (IL-6”), granulocyte analysis of secondary tumors originating from metastasizing macrophage colony stimulating factor (“GM-CSF), and cells of the primary tumor is analyzed in-vivo. In another granulocyte colony stimulating factor (“G-CSF)), or a embodiment, the size and shape of secondary tumors are growth factor (e.g., growth hormone (“GH)). As set forth analyzed. In some embodiments, further ex vivo analysis is above, methods for fusing or conjugating modulators to performed. polypeptide moieties are known in the art. In addition to the In another embodiment, the invention provides a method previously disclosed subject references see, e.g., U.S. Pat. of analyzing cancer progression and/or pathogenesis in vivo Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053: 5,447, including determining cell metastasis or detecting and quan 851, and 5,112,946; EP 307,434; EP 367,166; PCT Publi 25 tifying the level of circulating tumor cells. In yet another cations WO 96/04388 and WO 91/06570; Ashkenazi et al., embodiment, analysis of cell metastasis comprises determi 1991, PNAS USA 88:10535; Zheng et al., 1995, J Immunol nation of progressive growth of cells at a site that is 154:5590; and Vii et al., 1992, PNAS USA 89:11337 each of discontinuous from the primary tumor. In another embodi which is incorporated herein by reference. Moreover, as set ment, the site of cell metastasis analysis comprises the route forth above the association of a modulator with such moi 30 eties does not necessarily need to be direct, but may occur of neoplastic spread. In some embodiment, cells can dis through linker sequences. As previously alluded to, such perse via blood vasculature, lymphatics, within body cavi linker molecules are commonly known in the art and ties or combinations thereof. In another embodiment, cell described in Denardo et al., 1998, Clin Cancer Res 4:2483; metastasis analysis is performed in view of cell migration, Peterson et al., 1999, Bioconjug Chem 10:553; Zimmerman 35 dissemination, extravasation, proliferation or combinations et al., 1999, Nucl Med Biol 26:943; Garnett, 2002, Adv. Drug thereof. Deliv Rev 53:17.1 each of which is incorporated herein. Accordingly, in a particularly preferred embodiment the IX. Diagnostics and Screening modulators of the instant invention may be used to detect A. Diagnostics and quantify CD324 levels in a patient sample (e.g., plasma In yet other embodiments, the invention provides in vitro 40 or blood) which may, in turn, be used to detect, diagnose or or in vivo methods for detecting, diagnosing or monitoring monitor CD324 associated disorders including proliferative proliferative disorders and methods of screening cells from disorders. In related embodiments the modulators of the a patient to identify tumorigenic cells including CSCs. Such instant invention may be used to detect, monitor and/or methods include identifying an individual having cancer for quantify circulating tumor cells either in Vivo or in vitro treatment or monitoring progression of a cancer comprising 45 (see, for example, WO 2012/0128801 which is incorporated contacting the patient or a sample obtained from a patient herein by reference). In still other preferred embodiments (i.e. either in vivo or in vitro) with a modulator as described the circulating tumor cells may comprise cancer stem cells. herein and detecting presence or absence, or level of asso In certain examples, the tumorigenic cells in a subject or ciation, of the modulator to bound or free target molecules a sample from a Subject may be assessed or characterized in the sample. In particularly preferred embodiments the 50 using the disclosed modulators prior to therapy or regimen modulator will comprise a detectable label or reporter mol to establish a baseline. In other examples the sample is ecule as described herein. derived from a subject that was treated. In some examples In some embodiments, the association of the modulator, the sample is taken from the Subject at least about 1, 2, 4, 6, Such as an antibody, with particular cells in the sample likely 7, 8, 10, 12, 14, 15, 16, 18, 20, 30, 60, 90 days, 6 months, denotes that the sample may contain CSCs, thereby indicat 55 9 months, 12 months, or >12 months after the subject begins ing that the individual having cancer may be effectively or terminates treatment. In certain examples, the tumori treated with a modulator as described herein. The methods genic cells are assessed or characterized after a certain may further comprise a step of comparing the level of number of doses (e.g., after 2, 5, 10, 20, 30 or more doses binding to a control. Conversely, when the modulator is a of a therapy). In other examples, the tumorigenic cells are Fc-construct, the binding properties may be exploited and 60 characterized or assessed after 1 week, 2 weeks, 1 month, 2 monitored (directly or indirectly, in vivo or in vitro) when in months, 1 year, 2 years, 3 years, 4 years or more after contact with the sample to provide the desired information. receiving one or more therapies. Exemplary compatible assay methods include radioim In another aspect, and as discussed in more detail below, munoassays, enzyme immunoassays, competitive-binding the present invention provides kits for detecting, monitoring assays, fluorescent immunoassay, immunoblot assays, West 65 or diagnosing a hyperproliferative disorder, identifying indi ern Blot analysis, flow cytometry assays, and ELISA assays. vidual having Such a disorder for possible treatment or Compatible in vivo theragnostics or diagnostics may com monitoring progression (or regression) of the disorder in a US 9,534,058 B2 59 60 patient, wherein the kit comprises a modulator as described antibody yeast display libraries (Adimab, LLC), siRNA herein, and reagents for detecting the impact of the modu libraries, and adenoviral transfection vectors. lator on a sample. X. Pharmaceutical Preparations and Therapeutic Uses Yet another aspect of the instant invention comprises the A. Formulations and Routes of Administration use of labeled CD324 for immunohistochemistry (IHC). In Depending on the form of the modulator along with any this respect CD324 IHC may be used as a diagnostic tool to optional conjugate, the mode of intended delivery, the aid in the diagnosis of various proliferative disorders and to disease being treated or monitored and numerous other monitor the potential response to treatments including variables, compositions of the invention may be formulated CD324 modulator therapy. Compatible diagnostic assays as desired using art recognized techniques. In some embodi may be performed on tissues that have been chemically fixed 10 ments, the therapeutic compositions of the invention may be (including but not limited to: formaldehyde, gluteraldehyde, administered neat or with a minimum of additional compo osmium tetroxide, potassium dichromate, acetic acid, alco nents while others may optionally be formulated to contain hols, Zinc salts, mercuric chloride, chromium tetroxide and Suitable pharmaceutically acceptable carriers comprising picric acid) and embedded (including but not limited to: excipients and auxiliaries that are well known in the art (see, glycol methacrylate, paraffin and resins) or preserved via 15 e.g., Gennaro, Remington. The Science and Practice of freezing. As discussed in more detail below Such assays Pharmacy with Facts and Comparisons. Drug/acts Plus, could be used to guide treatment decisions and determine 20th ed. (2003); Ansel et al., Pharmaceutical Dosage Forms dosing regimens and timing. and Drug Delivery Systems, 7" ed., Lippencott Williams and B. Screening Wilkins (2004); Kibbe et al., Handbook of Pharmaceutical In certain embodiments, the modulators can also be used Excipients, 3" ed., Pharmaceutical Press (2000)). Various to Screen for or identify compounds or agents (e.g., drugs) pharmaceutically acceptable carriers, which include that alter a function or activity of tumorigenic cells or vehicles, adjuvants, and diluents, are readily available from progeny thereof by interacting with an antigen (e.g., geno numerous commercial sources. Moreover, an assortment of typic or phenotypic components thereof). Such compounds pharmaceutically acceptable auxiliary Substances, such as and agents can be drug candidates that are screened for the 25 pH adjusting and buffering agents, tonicity adjusting agents, treatment of a proliferative disorder, for example. In one stabilizers, wetting agents and the like, are also available. embodiment, a system or method includes tumorigenic cells Certain non-limiting exemplary carriers include Saline, buff comprising CD324 and a compound or agent (e.g., drug), ered saline, dextrose, water, glycerol, ethanol, and combi wherein the cells and compound or agent are in contact with nations thereof. each other. In such embodiments the subject cells may have 30 More particularly it will be appreciated that, in some been identified, monitored and/or enriched using the dis embodiments, the therapeutic compositions of the invention closed modulators. may be administered neat or with a minimum of additional In yet another embodiment, a method includes contacting, components. Conversely the CD324 modulators of the pres directly or indirectly, tumorigenic cells or progeny thereof ent invention may optionally be formulated to contain with a test agent or compound and determining if the test 35 Suitable pharmaceutically acceptable carriers comprising agent or compound modulates an activity or function of the excipients and auxiliaries that are well known in the art and antigen-associated tumorigenic cells. One example of a are relatively inert substances that facilitate administration direct interaction is physical interaction, while an indirect of the modulator or which aid processing of the active interaction includes the action of a composition upon an compounds into preparations that are pharmaceutically opti intermediary molecule that, in turn, acts upon the referenced 40 mized for delivery to the site of action. For example, an entity (e.g., cell or cell culture). Exemplary activities or excipient can give form or consistency or act as a diluent to functions that can be modulated include changes in cell improve the pharmacokinetics or stability of the modulator. morphology or viability, expression of a marker, differen Suitable excipients or additives include, but are not limited tiation or de-differentiation, cell respiration, mitochondrial to, stabilizing agents, wetting and emulsifying agents, salts activity, membrane integrity, maturation, proliferation, 45 for varying osmolarity, encapsulating agents, buffers, and viability, apoptosis or cell death. skin penetration enhancers. In certain preferred embodi Methods of screening and identifying agents and com ments the pharmaceutical compositions may be provided in pounds include those Suitable for high throughput Screening, a lyophilized form and reconstituted in, for example, buff which include arrays of cells (e.g., microarrays) positioned ered saline prior to administration. or placed, optionally at pre-determined locations or 50 Disclosed modulators for systemic administration may be addresses. For example, cells can be positioned or placed formulated for enteral, parenteral or topical administration. (pre-seeded) on a culture dish, tube, flask, roller bottle or Indeed, all three types of formulation may be used simul plate (e.g., a single multi-well plate or dish Such as an 8, 16. taneously to achieve systemic administration of the active 32, 64, 96, 384 and 1536 multi-well plate or dish). High ingredient. Excipients as well as formulations for parenteral throughput robotic or manual handling methods can probe 55 and nonparenteral drug delivery are set forth in Remington, chemical interactions and determine levels of expression of The Science and Practice of Pharmacy 20th Ed. Mack many genes in a short period of time. Techniques have been Publishing (2000). Suitable formulations for parenteral developed that utilize molecular signals (e.g., via fluoro administration include aqueous solutions of the active com phores) and automated analyses that process information at pounds in water-soluble form, for example, water-soluble a very rapid rate (see, e.g., Pinhasov et al., Comb. Chem. 60 salts. In addition, Suspensions of the active compounds as High Throughput Screen. 7:133 (2004)). For example, appropriate for oily injection Suspensions may be adminis microarray technology has been extensively used to probe tered. Suitable lipophilic solvents or vehicles include fatty the interactions of thousands of genes at once, while pro oils, for example, hexylsubstituted poly(lactide), Sesame oil, viding information for specific genes (see, e.g., Mocellin and or synthetic fatty acid esters, for example, ethyl oleate or Rossi, Adv. Exp. Med. Biol. 593:19 (2007)). 65 triglycerides. Aqueous injection Suspensions may contain Libraries that can be screened include, for example, Small Substances that increase the Viscosity of the Suspension and molecule libraries, phage display libraries, fully human include, for example, Sodium carboxymethyl cellulose, Sor US 9,534,058 B2 61 62 bitol, and/or dextran. Optionally, the Suspension may also like. Generally, an effective dose of the CD324 modulator is contain stabilizers. Liposomes can also be used to encapsu administered to a subject one or more times. More particu late the agent for delivery into the cell. larly, an effective dose of the modulator is administered to Suitable formulations for enteral administration include the Subject once a month, more than once a month, or less hard or soft gelatin capsules, pills, tablets, including coated 5 than once a month. In certain embodiments, the effective tablets, elixirs, Suspensions, syrups or inhalations and con dose of the CD324 modulator may be administered multiple trolled release forms thereof. times, including for periods of at least a month, at least six In general the compounds and compositions of the inven months, at least a year, at least two years or a period of tion, comprising CD324 modulators may be administered in several years. In yet other embodiments, several days (2, 3, Vivo, to a subject in need thereof, by various routes, includ 10 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or 8) or several ing, but not limited to, oral, intravenous, intra-arterial, months (1, 2, 3, 4, 5, 6, 7 or 8) or even a year or several years Subcutaneous, parenteral, intranasal, intramuscular, intrac may lapse between administration of the disclosed modula ranial, intracardiac, intraventricular, intratracheal, buccal, tOrS. rectal, intraperitoneal, intradermal, topical, transdermal, and Dosages and regimens may also be determined empiri intrathecal, or otherwise by implantation or inhalation. The 15 cally for the disclosed therapeutic compositions in individu Subject compositions may be formulated into preparations in als who have been given one or more administration(s). For Solid, semi-solid, liquid, or gaseous forms; including, but not example, individuals may be given incremental dosages of limited to, tablets, capsules, powders, granules, ointments, a therapeutic composition produced as described herein. In Solutions, suppositories, enemas, injections, inhalants, and selected embodiments the dosage may be gradually aerosols. The appropriate formulation and route of admin increased or reduced or attenuated based respectively on istration may be selected according to the intended applica empirically determined or observed side effects or toxicity. tion and therapeutic regimen. To assess efficacy of the selected composition, a marker of B. Dosages the specific disease, disorder or condition can be followed as Similarly, the particular dosage regimen, i.e., dose, timing described previously. In embodiments where the individual and repetition, will depend on the particular individual and 25 has cancer, these include direct measurements of tumor size that individuals medical history, as well as empirical con via palpation or visual observation, indirect measurement of siderations such as pharmacokinetics (e.g., half-life, clear tumor size by X-ray or other imaging techniques; an ance rate, etc.). Frequency of administration may be deter improvement as assessed by direct tumor biopsy and micro mined and adjusted over the course of therapy, and is based scopic examination of the tumor sample; the measurement on reducing the number of proliferative or tumorigenic cells, 30 of an indirect tumor marker (e.g., PSA for prostate cancer) maintaining the reduction of Such neoplastic cells, reducing or an antigen identified according to the methods described the proliferation of neoplastic cells, or delaying the devel herein, a decrease in pain or paralysis; improved speech, opment of metastasis. In other embodiments the dosage vision, breathing or other disability associated with the administered may be adjusted or attenuated to manage tumor, increased appetite; or an increase in quality of life as potential side effects and/or toxicity. Alternatively, sustained 35 measured by accepted tests or prolongation of Survival. It continuous release formulations of a subject therapeutic will be apparent to one of skill in the art that the dosage will composition may be appropriate. vary depending on the individual, the type of neoplastic In general, the modulators of the invention may be condition, the stage of neoplastic condition, whether the administered in various ranges. These include about 10 neoplastic condition has begun to metastasize to other ug/kg body weight to about 100 mg/kg body weight per 40 location in the individual, and the past and concurrent dose; about 50 ug/kg body weight to about 5 mg/kg body treatments being used. weight per dose; about 100 ug/kg body weight to about 10 In addition to the aforementioned dosing regimens it will mg/kg body weight per dose. Other ranges include about 100 be appreciated that the present invention comprise the ug/kg body weight to about 20 mg/kg body weight per dose administration of an amount of a CD324 modulator in an and about 0.5 mg/kg body weight to about 20 mg/kg body 45 amount necessary to reduce or eliminate any modulator weight per dose. In certain embodiments, the dosage is at “sink' prior to administering a therapeutic dose of the least about 100 g/kg body weight, at least about 250 ug/kg disclosed modulator. As discussed above the first adminis body weight, at least about 750 ug/kg body weight, at least tered CD324 modulator will preferably be non-internalizing about 3 mg/kg body weight, at least about 5 mg/kg body and/or non-depleting. In other preferred embodiments the weight, at least about 10 mg/kg body weight. 50 subsequently administered CD324 modulator will be inter Other dosing regimens may be predicated on Body Sur nalizing and/or depleting and will optionally be conjugated face Area (BSA) calculations as disclosed in U.S. Pat. No. to a cytotoxic agent. Preferably the pre-administration of the 7,744,877. As is well known, the BSA is calculated using the modulator will take place long enough before the adminis patient’s height and weight and provides a measure of a tration of the therapeutic modulator dose to allow partial or subjects size as represented by the surface area of his or her 55 complete saturation of the antigen present in normal tissue. body. In certain embodiments, the modulators may be In this regard one skilled in the art could readily determine administered in dosages from 10 mg/m to 800 mg/m, from the amount of modulator necessary to effectively reduce the 50 mg/m to 500 mg/m and at dosages of 100 mg/m, 150 modulator sink through empirical observation or standard mg/m, 200 mg/m, 250 mg/m, 300 mg/m, 350 mg/m. clinical methodology. Preferably the sink reduction dose 400 mg/m or 450 mg/m. 60 will be 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times the subsequent In any event, CD324 modulators are preferably adminis therapeutic dose. In other embodiments the sink reduction tered as needed to subjects in need thereof. Determination of dose will be 12, 14, 16, 18 or 20 times the therapeutic dose. the frequency of administration may be made by persons Similarly, the timing of the pre-dosing could readily be skilled in the art, such as an attending physician based on determined by a clinician skilled in the art and, in preferred considerations of the condition being treated, age of the 65 embodiments, will be 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 days prior Subject being treated, severity of the condition being treated, to the administration of a therapeutic dose. Again, the results general state of health of the subject being treated and the of the initial dosing may readily be monitored and Subse US 9,534,058 B2 63 64 quent doses administered as determined to optimize the be administered via any route, as noted previously. The effectiveness of the treatment. combination therapy may be administered at a site distant C. Combination Therapies from the site of the tumor. Combination therapies may be particularly useful in In one embodiment a modulator is administered in com decreasing or inhibiting unwanted neoplastic cell prolifera bination with one or more anti-cancer agents for a short tion, decreasing the occurrence of cancer, decreasing or treatment cycle to a subject in need thereof. The invention preventing the recurrence of cancer, or decreasing or pre also contemplates discontinuous administration or daily venting the spread or metastasis of cancer. In Such cases the doses divided into several partial administrations. The modulators of the instant invention may function as sensi modulator and anti-cancer agent may be administered inter tizing or chemosensitizing agents by removing the CSCs 10 changeably, on alternate days or weeks; or a sequence of that would otherwise prop up and perpetuate the tumor mass antibody treatments may be given, followed by one or more and thereby allow for more effective use of current standard treatments of anti-cancer agent therapy. In any event, as will of care debulking or anti-cancer agents. That is, the dis be understood by those of ordinary skill in the art, the closed modulators may, in certain embodiments provide an 15 appropriate doses of chemotherapeutic agents will be gen enhanced effect (e.g., additive or synergistic in nature) that erally around those already employed in clinical therapies potentiate the mode of action of another administered thera wherein the chemotherapeutics are administered alone or in peutic agent. In the context of the instant invention "com combination with other chemotherapeutics. bination therapy” shall be interpreted broadly and merely In another preferred embodiment the CD324 modulators refers to the administration of a modulator and one or more of the instant invention may be used in maintenance therapy anti-cancer agents that include, but are not limited to, to reduce or eliminate the chance of tumor recurrence cytotoxic agents, cytostatic agents, anti-angiogenic agents, following the initial presentation of the disease. Preferably debulking agents, chemotherapeutic agents, radiotherapy the disorder will have been treated and the initial tumor mass and radiotherapeutic agents, targeted anti-cancer agents (in eliminated, reduced or otherwise ameliorated so the patient cluding both monoclonal antibodies and Small molecule 25 is asymptomatic or in remission. At Such time the Subject entities), BRMs, therapeutic antibodies, cancer vaccines, may be administered pharmaceutically effective amounts of cytokines, hormone therapies, radiation therapy and anti the disclosed modulators one or more times even though metastatic agents and immunotherapeutic agents, including there is little or no indication of disease using standard both specific and non-specific approaches. diagnostic procedures. In some embodiments, the modula 30 tors will be administered on a regular schedule over a period There is no requirement for the combined results to be of time, such as weekly, every two weeks, monthly, every six additive of the effects observed when each treatment (e.g., weeks, every two months, every three months every six antibody and anti-cancer agent) is conducted separately. months or annually. Given the teachings herein, one skilled Although at least additive effects are generally desirable, any in the art could readily determine favorable dosages and increased anti-tumor effect above one of the single therapies 35 dosing regimens to reduce the potential of disease recur is beneficial. Furthermore, the invention does not require the rence. Moreover such treatments could be continued for a combined treatment to exhibit synergistic effects. However, period of weeks, months, years or even indefinitely depend those skilled in the art will appreciate that with certain ing on the patient response and clinical and diagnostic selected combinations that comprise preferred embodi parameters. ments, synergism may be observed. 40 In yet another preferred embodiment the modulators of In practicing combination therapy, the modulator and the present invention may be used to prophylactically or as anti-cancer agent may be administered to the Subject simul an adjuvant therapy to prevent or reduce the possibility of taneously, either in a single composition, or as two or more tumor metastasis following a debulking procedure. As used distinct compositions using the same or different adminis in the instant disclosure a “debulking procedure' is defined tration routes. Alternatively, the modulator may precede, or 45 broadly and shall mean any procedure, technique or method follow, the anti-cancer agent treatment by, e.g., intervals that eliminates, reduces, treats or ameliorates a tumor or ranging from minutes to weeks. The time period between tumor proliferation. Exemplary debulking procedures each delivery is such that the anti-cancer agent and modu include, but are not limited to, Surgery, radiation treatments lator are able to exert a combined effect on the tumor. In at (i.e., beam radiation), chemotherapy, immunotherapy or least one embodiment, both the anti-cancer agent and the 50 ablation. At appropriate times readily determined by one modulator are administered within about 5 minutes to about skilled in the art in view of the instant disclosure the two weeks of each other. In yet other embodiments, several disclosed modulators may be administered as Suggested by days (2, 3, 4, 5, 6 or 7), several weeks (1, 2, 3, 4, 5, 6, 7 or clinical, diagnostic or theragnostic procedures to reduce 8) or several months (1, 2, 3, 4, 5, 6, 7 or 8) may lapse tumor metastasis. The modulators may be administered one between administration of the modulator and the anti-cancer 55 or more times at pharmaceutically effective dosages as agent. determined using standard techniques. Preferably the dosing The combination therapy may be administered once, regimen will be accompanied by appropriate diagnostic or twice or at least for a period of time until the condition is monitoring techniques that allow it to be modified. treated, palliated or cured. In some embodiments, the com Yet other embodiments of the invention comprise admin bination therapy is administered multiple times, for 60 istering the disclosed modulators to subjects that are asymp example, from three times daily to once every six months. tomatic but at risk of developing a proliferative disorder. The administering may be on a schedule Such as three tunes That is, the modulators of the instant invention may be used daily, twice daily, once daily, once every two days, once in a truly preventative sense and given to patients that have every three days, once weekly, once every two weeks, once been examined or tested and have one or more noted risk every month, once every two months, once every three 65 factors (e.g., genomic indications, family history, in vivo or months, once every six months or may be administered in vitro test results, etc.) but have not developed neoplasia. continuously via a minipump. The combination therapy may In such cases those skilled in the art would be able to US 9,534,058 B2 65 66 determine an effective dosing regimen through empirical norleucine. ADRIAMYCINR doxorubicin, epirubicin, eso observation or through accepted clinical practices. rubicin, idarubicin, marcellomycin, mitomycins, mycophe D. Anti-Cancer Agents nolic acid, nogalamycin, olivomycins, peplomycin, The term “anti-cancer agent' or “anti-proliferative agent” potfiromycin, puromycin, quelamycin, rodorubicin, Strep means any agent that can be used to treat a cell proliferative tonigrin, Streptozocin, tubercidin, ubenimex, Zinostatin, disorder Such as cancer, and includes, but not limited to, Zorubicin; anti-metabolites, folic acid analogues, purine cytotoxic agents, cytostatic agents, anti-angiogenic agents, analogs, androgens, anti-adrenals, folic acid replenisher debulking agents, chemotherapeutic agents, radiotherapy Such as frolinic acid, aceglatone, aldophosphamide glyco and radiotherapeutic agents, targeted anti-cancer agents, side, aminolevulinic acid, eniluracil, amsacrine, bestrabucil, BRMs, therapeutic antibodies, cancer vaccines, cytokines, 10 bisantrene, edatraxate, defofamine, demecolcine, diazi hormone therapies, radiation therapy and anti-metastatic quone, elfomithine, elliptinium acetate, an epothilone, eto agents and immunotherapeutic agents. It will be appreciated glucid, gallium nitrate, hydroxyurea, lentinan, lonidainine, that, in selected embodiments as discussed above, Such maytansinoids, mitoguaZone, mitoxantrone, mopidanmol, anti-cancer agents may comprise conjugates and may be nitraerine, pentostatin, phenamet, pirarubicin, losoxantrone, associated with modulators prior to administration. In cer 15 podophyllinic acid, 2-ethylhydrazide, procarbazine, PSKR) tain embodiments the disclosed anti-cancer agent will be polysaccharide complex (JHS Natural Products, Eugene, linked to a CD324 modulator to provide an ADC as set forth Oreg.), raZOxane; rhizoxin; sizofiran; Spirogermanium; tenu herein. aZonic acid; triaziquone; 2.2.2"-trichlorotriethyl amine; tri As used herein the term “cytotoxic agent’ means a chothecenes (especially T-2 toxin, Verracurin A, roridin A substance that is toxic to the cells and decreases or inhibits and anguidine); urethan; vindesine; dacarbazine; manno the function of cells and/or causes destruction of cells. mustine; mitobronitol; mitolactol; pipobroman, gacytosine; Typically, the Substance is a naturally occurring molecule arabinoside (“Ara-C); cyclophosphamide; thiotepa; tax derived from a living organism. Examples of cytotoxic oids, chloranbucil; GEMZAR(R) gemcitabine; 6-thioguanine: agents include, but are not limited to, Small molecule toxins mercaptopurine; methotrexate; platinum analogs, vinblas or enzymatically active toxins of bacteria (e.g., Diptheria 25 tine; platinum: etoposide (VP-16); ifosfamide; mitoxan toxin, Pseudomonas endotoxin and eXotoxin, Staphylococ trone; Vincristine; NAVELBINE(R) vinorelbine; novantrone; cal enterotoxin A), fungal (e.g., C.-sarcin, restrictocin), teniposide; ediatrexate, daunomycin; aminopterin: Xeloda; plants (e.g., abrin, ricin, modeccin, Viscumin, pokeweed ibandronate: irinotecan (Camptosar, CPT-11), topoi anti-viral protein, saporin, gelonin, momoridin, trichosan somerase inhibitor RFS 2000; difiuorometlhylornithine; ret thin, barley toxin, Aleurites fordii proteins, dianthin pro 30 inoids; capecitabine; combretastatin; leucovorin, oxalipla teins, Phytolacca mericana proteins (PAPI, PAPII, and tin; inhibitors of PKC-alpha, Raf, H-Ras, EGFR and PAP-S), Momordica charantia inhibitor, curcin, crotin, VEGF-A that reduce cell proliferation and pharmaceutically saponaria officinalis inhibitor, gelonin, mitegellin, restric acceptable salts, acids or derivatives of any of the above. tocin, phenomycin, neomycin, and the tricothecenes) or Also included in this definition are anti-hormonal agents that animals, (e.g., cytotoxic RNases, such as extracellular pan 35 act to regulate or inhibit hormone action on tumors such as creatic RNases; DNase I, including fragments and/or vari anti-estrogens and selective estrogen receptor modulators, ants thereof). aromatase inhibitors that inhibit the enzyme aromatase, For the purposes of the instant invention a “chemothera which regulates estrogen production in the adrenal glands, peutic agent comprises a chemical compound that non and anti-androgens; as well as troxacitabine (a 1,3-dioxolane specifically decreases or inhibits the growth, proliferation, 40 nucleoside cytosine analog); antisense oligonucleotides, and/or Survival of cancer cells (e.g., cytotoxic or cytostatic ribozymes such as a VEGF expression inhibitor and a HER2 agents). Such chemical agents are often directed to intrac expression inhibitor; vaccines, PROLEUKINR rIL-2: LUR ellular processes necessary for cell growth or division, and TOTECANR) topoisomerase 1 inhibitor; ABARELIX(R) are thus particularly effective against cancerous cells, which rmRH; Vinorelbine and Esperamicins and pharmaceutically generally grow and divide rapidly. For example, Vincristine 45 acceptable salts, acids or derivatives of any of the above. depolymerizes microtubules, and thus inhibits cells from In yet other embodiments the modulators of the instant entering mitosis. In general, chemotherapeutic agents can invention may be used in conjunction with antibodies in include any chemical agent that inhibits, or is designed to clinical development. To that end the disclosed 324 modu inhibit, a cancerous cell or a cell likely to become cancerous lators may be used in conjunction with one or more anti or generate tumorigenic progeny (e.g., TIC). Such agents are 50 bodies selected from the group consisting of abagovomab, often administered, and are often most effective, in combi adecatumumab, afutuzumab, alemtuzumab, altumomab, nation, e.g., in regimens such as CHOP or FOLFIRI. Again, amatuximab, anatumomab, arcitumomab, bavituximab, bec in selected embodiments such chemotherapeutic agents may tumomab, bevacizumab, bivatuZumab, blinatumomab, bren be conjugated to the disclosed modulators. tuximab, cantuzumab, catumaxomab, cetuximab, citatu Examples of anti-cancer agents that may be used in 55 Zumab, cixutumumab, clivatuZumab, conatumumab, combination with (or conjugated to) the modulators of the daratumumab, drozitumab, duligotumab, dusigitumab, detu present invention include, but are not limited to, alkylating momab, dacetuZumab, dalotuZumab, ecromeximab, elotu agents, alkyl Sulfonates, aziridines, ethylenimines and meth Zumab, ensituximab, ertumaxomab, etaracizumab, farletu ylamelamines, acetogenins, a camptothecin, bryostatin, Zumab, ficlatuZumab, figitumumab, flanVotumab, cally statin, CC-1065, cryptophycins, dolastatin, duocarmy 60 futuximab, ganitumab, gemtuzumab, girentuximab, glemba cin, eleutherobin, pancratistatin, a sarcodictyin, spongista tumumab, ibritumomab, igovomab, imgatuZumab, indatuX tin, nitrogen mustards, antibiotics, enediyne antibiotics, imab, inotuZumab, intetumumab, ipilimumab, iratumumab, dynemicin, bisphosphonates, esperamicin, chromoprotein labetuZumab, lexatumumab, lintuZumab, lorVotuZumab, enediyne antiobiotic chromophores, aclacinomysins, actino lucatumumab, mapatumumab, matuZumab, milatuZumab, mycin, authramycin, azaserine, bleomycins, cactinomycin, 65 minretumomab, mitumomab, moxetumomab, narnatumab, carabicin, carminomycin, carzinophilin, chromomycinis, naptumomab, necitumumab, nimotuzumab, nofetumomabn, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- ocaratuZumab. ofatumumab, olaratumab, onartuzumab, US 9,534,058 B2 67 68 oportuZumab oregovomab, panitumumab, parsatuZumab, tic Small round cell tumors, ependymomas, Ewings tumors, patritumab, pemtumomab, pertuzumab, pintumomab, pritu extraskeletal myxoid chondrosarcoma, fibrogenesis imper mumab, racotumomab, radretumab, rillotumumab, rituX fecta ossium, fibrous dysplasia of the bone, gallbladder and imab, robatumumab, Satumomab, sibrotuzumab, siltuximab, bile duct cancers, gestational trophoblastic disease, germ simtuzumab, Solitomab, tacatuZumab, taplitumomab, tena cell tumors, head and neck cancers, islet cell tumors, Kapo tumomab, teprotumumab, tigatuZumab, to situmomab, tras si’s Sarcoma, kidney cancer (nephroblastoma, papillary tuZumab, tucotuZumab, ublituximab, VeltuZumab, Vorsetu renal cell carcinoma), leukemias, lipoma/benign lipomatous Zumab, votumumab, Zalutumumab, CC49 and 3F8. In tumors, liposarcoma/malignant lipomatous tumors, liver particularly preferred embodiments the invention will com cancer (hepatoblastoma, hepatocellular carcinoma), lym prise the use of CD324 modulators with antibodies approved 10 phomas, lung cancers (Small cell carcinoma, adenocarci for cancer therapy including, but not limited to, rituximab, noma, squamous cell carcinoma, large cell carcinoma etc.), trastuzumab, gemtuzumab ozogamcin, alemtuzumab, ibri medulloblastoma, melanoma, meningiomas, multiple endo tumomab tiuxetan, to situmomab, bevacizumab, cetuximab, crine neoplasia, multiple myeloma, myelodysplastic Syn panitumumab. ofatumumab, ipilimumab and brentuximab drome, neuroblastoma, neuroendocrine tumors, ovarian can vedotin. Those skilled in the art will be able to readily 15 cer, pancreatic cancers, papillary thyroid carcinomas, identify additional anti-cancer agents that are compatible parathyroid tumors, pediatric cancers, peripheral nerve with the teachings herein. sheath tumors, phaeochromocytoma, pituitary tumors, pros E. Radiotherapy tate cancer, posterious unveal melanoma, rare hematologic The present invention also provides for the combination disorders, renal metastatic cancer, rhabdoid tumor, rhab of modulators with radiotherapy (i.e., any mechanism for domysarcoma, sarcomas, skin cancer, Soft-tissue sarcomas, inducing DNA damage locally within tumor cells such as squamous cell cancer, stomach cancer, synovial sarcoma, gamma-irradiation, X-rays, UV-irradiation, microwaves, testicular cancer, thymic carcinoma, thymoma, thyroid electronic emissions and the like). Combination therapy metastatic cancer, and uterine cancers (carcinoma of the using the directed delivery of radioisotopes to tumor cells is cervix, endometrial carcinoma, and leiomyoma). also contemplated, and may be used in connection with a 25 In certain preferred embodiments the proliferative disor targeted anti-cancer agent or other targeting means. Typi der will comprise a solid tumor including, but not limited to, cally, radiation therapy is administered in pulses over a adrenal, liver, kidney, bladder, breast, gastric, ovarian, cer period of time from about 1 to about 2 weeks. The radiation Vical, uterine, esophageal, colorectal, prostate, pancreatic, therapy may be administered to Subjects having head and lung (both Small cell and non-Small cell), thyroid, carcino neck cancer for about 6 to 7 weeks. Optionally, the radiation 30 mas, sarcomas, glioblastomas and various head and neck therapy may be administered as a single dose or as multiple, tumors. In other preferred embodiments, and as shown in the sequential doses. Examples below, the disclosed modulators are especially XI. Indications effective at treating small cell lung cancer (SCLC) and It will be appreciated that the modulators of the instant non-Small cell lung cancer (NSCLC) (e.g., squamous cell invention may be used to diagnose, treat or inhibit the 35 non-Small cell lung cancer or squamous cell Small cell lung occurrence or recurrence of any CD324 associated disorder. cancer). In one embodiment, the lung cancer is refractory, Accordingly, whether administered alone or in combination relapsed or resistant to a platinum based agent (e.g., carbo with an anti-cancer agent or radiotherapy, the modulators of platin, cisplatin, oxaliplatin) and/or a taxane (e.g., docetaxel, the invention are particularly useful for generally treating paclitaxel, larotaxel or cabazitaxel). Further, in particularly neoplastic conditions in patients or Subjects which may 40 preferred embodiments the disclosed modulators may be include benign or malignant tumors (e.g., adrenal, liver, used in a conjugated form to treat Small cell lung cancer. kidney, bladder, breast, gastric, ovarian, colorectal, prostate, With regard to hematologic malignancies it will be further pancreatic, lung, thyroid, hepatic, cervical, endometrial, be appreciated that the compounds and methods of the esophageal and uterine carcinomas; sarcomas; glioblasto present invention may be particularly effective in treating a mas; and various head and neck tumors); leukemias and 45 variety of B-cell lymphomas, including low grade/NHL lymphoid malignancies; other disorders such as neuronal, follicular cell lymphoma (FCC), mantle cell lymphoma glial, astrocytal, hypothalamic and other glandular, macro (MCL), diffuse large cell lymphoma (DLCL), small lym phagal, epithelial, Stromal and blastocoelic disorders; and phocytic (SL) NHL, intermediate grade/follicular NHL, inflammatory, angiogenic, immunologic disorders and dis intermediate grade diffuse NHL, high grade immunoblastic orders caused by pathogens. Particularly, key targets for 50 NHL, high grade lymphoblastic NHL, high grade small treatment are neoplastic conditions comprising Solid tumors, non-cleaved cell NHL, bulky disease NHL, Waldenstrom's although hematologic malignancies are within the scope of Macroglobulinemia, lymphoplasmacytoid lymphoma the invention. Preferably the “subject” or “patient” to be (LPL), mantle cell lymphoma (MCL), follicular lymphoma treated will be human although, as used herein, the terms are (FL), diffuse large cell lymphoma (DLCL), Burkitt's lym expressly held to comprise any mammalian species. 55 phoma (BL), AIDS-related lymphomas, monocytic B cell More specifically, neoplastic conditions subject to treat lymphoma, angioimmunoblastic lymphoadenopathy, Small ment in accordance with the instant invention may be lymphocytic, follicular, diffuse large cell, diffuse small selected from the group including, but not limited to, adrenal cleaved cell, large cell immunoblastic lymphoblastoma, gland tumors, AIDS-associated cancers, alveolar soft part small, non-cleaved, Burkitt's and non-Burkitt's, follicular, sarcoma, astrocytic tumors, bladder cancer (squamous cell 60 predominantly large cell; follicular, predominantly small carcinoma and transitional cell carcinoma), bone cancer cleaved cell; and follicular, mixed Small cleaved and large (adamantinoma, aneurismal bone cysts, osteochondroma, cell lymphomas. See, Gaidono et al., “Lymphomas’, IN osteosarcoma), brain and spinal cord cancers, metastatic CANCER: PRINCIPLES & PRACTICE OF ONCOLOGY, brain tumors, breast cancer, carotid body tumors, cervical Vol. 2: 2131-2145 (DeVita et al., eds., 5.sup.thed. 1997). It cancer, chondrosarcoma, chordoma, chromophobe renal cell 65 should be clear to those of skill in the art that these carcinoma, clear cell carcinoma, colon cancer, colorectal lymphomas will often have different names due to changing cancer, cutaneous benign fibrous histiocytomas, desmoplas systems of classification, and that patients having lympho US 9,534,058 B2 69 70 mas classified under different names may also benefit from in excess of the other. Alternatively, the CD324 modulator the combined therapeutic regimens of the present invention. and any optional anti-cancer agent of the kit may be main The present invention also provides for a preventative or tained separately within distinct containers prior to admin prophylactic treatment of Subjects who present with benign istration to a patient. The kits may also comprise a second/ or precancerous tumors. Beyond being a CD324 associated third container means for containing a sterile, disorder It is not believed that any particular type of tumor pharmaceutically acceptable buffer or other diluent such as or proliferative disorder should be excluded from treatment bacteriostatic water for injection (BWFI), phosphate-buff using the present invention. However, the type of tumor cells ered saline (PBS), Ringer's solution and dextrose solution. may be relevant to the use of the invention in combination When the components of the kit are provided in one or with secondary therapeutic agents, particularly chemothera 10 more liquid solutions, the liquid solution is preferably an peutic agents and targeted anti-cancer agents. aqueous solution, with a sterile aqueous Solution being XII. Articles of Manufacture particularly preferred. However, the components of the kit Pharmaceutical packs and kits comprising one or more may be provided as dried powder(s). When reagents or containers, comprising one or more doses of a CD324 components are provided as a dry powder, the powder can modulator are also provided. In certain embodiments, a unit 15 be reconstituted by the addition of a suitable solvent. It is dosage is provided wherein the unit dosage contains a envisioned that the solvent may also be provided in another predetermined amount of a composition comprising, for container. example, an anti-CD324 antibody, with or without one or As indicated briefly above the kits may also contain a more additional agents. For other embodiments, such a unit means by which to administer the antibody and any optional dosage is Supplied in single-use prefilled Syringe for injec components to an animal or patient, e.g., one or more tion. In still other embodiments, the composition contained needles or syringes, or even an eye dropper, pipette, or other in the unit dosage may comprise saline, Sucrose, or the like; Such like apparatus, from which the formulation may be a buffer, such as phosphate, or the like; and/or be formulated injected or introduced into the animal or applied to a within a stable and effective pH range. Alternatively, in diseased area of the body. The kits of the present invention certain embodiments, the composition may be provided as a 25 will also typically include a means for containing the vials, lyophilized powder that may be reconstituted upon addition or Such like, and other component in close confinement for of an appropriate liquid, for example, Sterile water. In certain commercial sale, such as, e.g., injection or blow-molded preferred embodiments, the composition comprises one or plastic containers into which the desired vials and other more Substances that inhibit protein aggregation, including, apparatus are placed and retained. Any label or package but not limited to, Sucrose and arginine. Any label on, or 30 insert indicates that the CD324 modulator composition is associated with, the container(s) indicates that the enclosed used for treating cancer, for example Small cell lung cancer. composition is used for diagnosing or treating the disease In other preferred embodiments the modulators of the condition of choice. instant invention may be used in conjunction with, or The present invention also provides kits for producing comprise, diagnostic or therapeutic devices useful in the single-dose or multi-dose administration units of a CD324 35 diagnosis or treatment of proliferative disorders. For modulator and, optionally, one or more anti-cancer agents. example, in on preferred embodiment the compounds and The kit comprises a container and a label or package insert compositions of the instant invention may be combined with on or associated with the container. Suitable containers certain diagnostic devices or instruments that may be used to include, for example, bottles, vials, Syringes, etc. The con detect, monitor, quantify or profile cells or marker com tainers may be formed from a variety of materials such as 40 pounds involved in the etiology or manifestation of prolif glass or plastic and contain a pharmaceutically effective erative disorders. For selected embodiments the marker amount of the disclosed modulators in a conjugated or compounds may comprise NSE, CD56, synaptophysin, unconjugated form. In other preferred embodiments the chromogranin A, and PGP9.5. container(s) comprise a sterile access port (for example the In particularly preferred embodiments the devices may be container may be an intravenous Solution bag or a vial 45 used to detect, monitor and/or quantify circulating tumor having a stopper pierceable by a hypodermic injection cells either in vivo or in vitro (see, for example, WO needle). Such kits will generally contain in a Suitable con 2012/0128801 which is incorporated herein by reference). In tainer a pharmaceutically acceptable formulation of the still other preferred embodiments, and as discussed above, CD324 modulator and, optionally, one or more anti-cancer the circulating tumor cells may comprise cancer stem cells. agents in the same or different containers. The kits may also 50 XIII. Research Reagents contain other pharmaceutically acceptable formulations, Other preferred embodiments of the invention also exploit either for diagnosis or combined therapy. For example, in the properties of the disclosed modulators as an instrument addition to the CD324 modulator of the invention such kits useful for identifying, monitoring, isolating, sectioning or may contain any one or more of a range of anti-cancer agents enriching populations or Subpopulations of tumor initiating Such as chemotherapeutic or radiotherapeutic drugs; anti 55 cells through methods such as flow cytometry, fluorescent angiogenic agents; anti-metastatic agents; targeted anti-can activated cell sorting (FACS), magnetic activated cell sort cer agents; cytotoxic agents; and/or other anti-cancer agents. ing (MACS) or laser mediated sectioning. Those skilled in Such kits may also provide appropriate reagents to conjugate the art will appreciate that the modulators may be used in the CD324 modulator with an anti-cancer agent or diagnos several compatible techniques for the characterization and tic agent (e.g., see U.S. Pat. No. 7,422,739 which is incor 60 manipulation of TIC including cancer stem cells (e.g., see porated herein by reference in its entirety). U.S. Ser. Nos. 12/686,359, 12/669,136 and 12/757,649 each More specifically the kits may have a single container that of which is incorporated herein by reference in its entirety). contains the CD324 modulator, with or without additional XIV. Miscellaneous components, or they may have distinct containers for each Unless otherwise defined herein, scientific and technical desired agent. Where combined therapeutics are provided 65 terms used in connection with the present invention shall for conjugation, a single solution may be pre-mixed, either have the meanings that are commonly understood by those in a molar equivalent combination, or with one component of ordinary skill in the art. Further, unless otherwise required US 9,534,058 B2 71 72 by context, singular terms shall include pluralities and plural 8. Nose, A., Nagafuchi, A., and Takeichi, M. Expressed terms shall include the singular. More specifically, as used in recombinant cadherins mediate cell sorting in model this specification and the appended claims, the singular systems. Cell 54: 993-1001 (1998). forms “a,” “an and “the include plural referents unless the 9. Chen, C. Petal. Critical role for low-affinity dimeriza context clearly dictates otherwise. Thus, for example, ref 5 tion through-strand Swapping. Proc. Natl. Acad. Sci. erence to “a protein’ includes a plurality of proteins; refer 102: 8531-8536 (2005) ence to “a cell includes mixtures of cells, and the like. In 10. Patel, S. D. et al. Type H cadherin ectodomain addition, ranges provided in the specification and appended structures: Implications for classical cadherin specific claims include both end points and all points between the ity. Cell 124: 1255-1268 (2006). end points. Therefore, a range of 2.0 to 3.0 includes 2.0, 3.0, 10 11. Mohamet L, Hawkins K, and Ward C. M. Loss of and all points between 2.0 and 3.0. function of e-cadherin in embryonic stem cells and the Generally, nomenclature used in connection with, and relevance to models of tumorigenesis. J Oncol. 2011: techniques of cell and tissue culture, molecular biology, 352616 (2011). immunology, microbiology, genetics and protein and nucleic 12. Duguay D, Foty R A, and Steinberg MS. Cadherin acid chemistry and hybridization described herein are those 15 mediated cell adhesion and tissue segregation: qualita well known and commonly used in the art. The methods and tive and quantitative determinants. Dev Biol. 253(2): techniques of the present invention are generally performed 309-23 (2003). according to conventional methods well known in the art 13, Perez-Moreno M. Jamora C, and Fuchs E. Sticky and as described in various general and more specific business: orchestrating cellular signals at adherens references that are cited and discussed throughout the pres junctions. Cell 112:535-548 (2003). ent specification unless otherwise indicated. See, e.g., Abbas 14. Haegel H. et al. Lack of beta-catenin affects mouse et al., Cellular and Molecular Immunology, 6" ed., W.B. development at gastrulation. Development. 121 (11): Saunders Company (2010); Sambrook J. & Russell D. 3529-37 (1995). Molecular Cloning: A Laboratory Manual, 3rd ed., Cold 15. Samavarchi-Tehrani P. et al. Functional genomics Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 25 reveals a BMP-driven mesenchymal-to-epithelial tran (2000); Ausubel et al., Short Protocols in Molecular Biol sition in the initiation of Somatic cell reprogramming. ogy: A Compendium of Methods from Current Protocols in Cell Stem Cell. 7:64-77 (2010). Molecular Biology, Wiley, John & Sons, Inc. (2002); Har 16. Li R et al. A Mesenchymal-to-Epithelial Transition low and Lane Using Antibodies. A Laboratory Manual, Cold Initiates and Is Required for the Nuclear Reprogram Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 30 ming of Mouse Fibroblasts. Cell Stem Cell 7: 51-63 (1998); and Coligan et al., Short Protocols in Protein (2010). Science, Wiley, John & Sons, Inc. (2003). Enzymatic reac 17. Redmer et al. E-cadherin is crucial for embryonic tions and purification techniques are performed according to stem cell pluripotency and can replace OCT4 during manufacturer's specifications, as commonly accomplished somatic cell reprogramming. EMBO Reports 12:719 in the art or as described herein. The nomenclature used in 35 (2011). connection with, and the laboratory procedures and tech 18. Acloque H, Thiery J P and Nieto MA. The physiology niques of analytical chemistry, synthetic organic chemistry, and pathology of the EMT. Meeting on the epithelial and medicinal and pharmaceutical chemistry described mesenchymal transition. EMBO Rep. 9:322-6 (2008). herein are those well known and commonly used in the art. All references or documents disclosed or cited within this XV. CD324 References 40 specification are, without limitation, incorporated herein by All references or documents disclosed or cited within this reference in their entirety. Moreover, any section headings specification are, without limitation, incorporated herein by used herein are for organizational purposes only and are not reference in their entirety. Moreover, any section headings to be construed as limiting the subject matter described. used herein are for organizational purposes only and are not XVI. Selected Embodiments of the Invention to be construed as limiting the subject matter described. 45 In addition to the disclosure and Examples herein, the 1. Takeichi M. Cadherins: a molecular family important in present invention is directed to selected embodiments spe selective cell-cell adhesion. Annu Rev Biochem. cifically set forth in this section. 59:237-52. (1990). Putative Claims 2. Takeichi M. Cadherin cell adhesion receptors as a 1. An isolated CD324 modulator. morphogenetic regulator. Science 251: 1451-1455 50 2. The isolated CD324 modulator of claim 1, wherein the (1991). CD324 modulator comprises a CD324 antagonist. 3. Gumbiner B M. Cell adhesion: the molecular basis of 3. The isolated CD324 modulator of claim 1, wherein the tissue architecture and morphogenesis. Cell. 84:345-57 CD324 modulator comprises an antibody or immunore (1996). active fragment thereof. 4. Nollet F. Kools P. van Roy F. Phylogenetic analysis of 55 4. The isolated CD324 modulator of claim 3 wherein the the cadherin superfamily allows identification of six antibody or immunoreactive fragment thereof comprises a major subfamilies besides several solitary members. J monoclonal antibody. Mol Biol. 299:551-72 (2000). 5. The isolated CD324 modulator of claim 4 wherein the 5. Huntsman D G, Caldas C. Assignment of the E-cad monoclonal antibody is selected from the group consist herin gene (CDH1) to chromosome 16q22.1 by radia 60 ing of chimeric antibodies, humanized antibodies and tion hybrid mapping. Cytogenet Cell Genet. 83:82-3 human antibodies. (1998). 6. The isolated CD324 modulator of claim 4 wherein said 6. Shiozaki H. et al. E-Cadherin mediated adhesion sys monoclonal antibody comprises a neutralizing antibody. tem in cancer cells. Cancer 77: 1605-1613 (1996). 7. The isolated CD324 modulator of claim 4 wherein said 7. Niessen C M. Gottardi C.J. Molecular components of 65 monoclonal antibody comprises a depleting antibody. the adherens junction. Biochim Biophys Acta. 1778: 8. The isolated CD324 modulator of claim 4 wherein said 562-71 (2008). monoclonal antibody comprises an internalizing antibody. US 9,534,058 B2 73 74 9. The isolated CD324 modulator of claim 8 wherein said 23. A pharmaceutical composition comprising the isolated monoclonal antibody further comprises a cytotoxic agent. CD324 modulator of claim 1. 10. The isolated CD324 modulator of claim 4 wherein said 24. The pharmaceutical composition of claim 23 wherein monoclonal antibody or immunoreactive fragment thereof said isolated CD324 modulator comprises a monoclonal comprises a light chain variable region having three 5 antibody. complementarity determining regions and a heavy chain 25. The pharmaceutical composition of claim 24 wherein variable region having three complementarity determin said monoclonal antibody comprises a humanized anti ing regions wherein the heavy and light chain comple body. mentarity determining regions comprise at least one 26. The pharmaceutical composition of claim 25 wherein complementarity determining region set forth in FIG. 11A 10 said humanized antibody comprises a cytotoxic agent. and FIG. 11B. 27. The isolated CD324 modulator of claim 26 wherein said 11. The isolated CD324 modulator of claim 4 wherein said cytotoxic agent comprises a pyrrolobenzodiazepine. monoclonal antibody or immunoreactive fragment thereof 28. A method of treating a CD324 associated disorder comprises a light chain variable region and a heavy chain comprising administering a therapeutically effective variable region wherein said light chain variable region 15 amount of a CD324 modulator to a subject in need comprises an amino acid sequence having at least 60% thereof. identity to an amino acid sequence selected from the 29. The method of claim 28 wherein said CD324 modulator group consisting of amino acid sequences as set forth in comprises a CD324 antagonist. SEQ ID NO: 20, SEQID NO: 22, SEQ ID NO: 24, SEQ 30. The method of claim 28 wherein said CD324 modulator ID NO: 26, SEQ ID NO: 28, SEQ ID NO:30, SEQ ID comprises an antibody or immunoreactive fragment NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQID NO: thereof. 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO:44, 31. The method of claim 30 wherein the antibody or SEQ ID NO:46, SEQ ID NO:48, SEQID NO:50, SEQ immunoreactive fragment thereof comprises a monoclo ID NO: 52, SEQ ID NO: 54, SEQ ID NO:56, SEQ ID nal antibody. NO:58, SEQ ID NO: 60, SEQ ID NO: 62, SEQID NO: 25 32. The method of claim 31 wherein the monoclonal anti 64, SEQID NO: 66, SEQID NO: 68 and SEQID NO: 70 body is selected from the group consisting of chimeric and wherein said heavy chain variable region comprises antibodies, humanized antibodies and human antibodies. an amino acid sequence having at least 60% identity to an 33. The method of claim 32 wherein said monoclonal amino acid sequence selected from the group consisting antibody comprises a light chain variable region and a of amino acid sequences as set forth in SEQ ID NO: 21, 30 heavy chain variable region wherein said light chain SEQ ID NO. 23, SEQ ID NO: 25, SEQID NO: 27, SEQ variable region comprises an amino acid sequence having ID NO: 29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID at least 60% identity to an amino acid sequence selected NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQID NO: from the group consisting of amino acid sequences as set 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO:47, forth in SEQID NO: 20, SEQ ID NO: 22, SEQID NO: SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO:53, SEQ 35 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO:30, ID NO:55, SEQ ID NO:57, SEQ ID NO. 59, SEQ ID SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQID NO: ID NO:38, SEQ ID NO:40, SEQ ID NO: 42, SEQ ID 67, SEQ ID NO: 69 and SEQ ID NO: 71. NO: 44, SEQID NO: 46, SEQID NO: 48, SEQ ID NO: 12. The isolated CD324 modulator of claim 10 or 11 further 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO:56, comprising a cytotoxic agent. 40 SEQ ID NO:58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ 13. An isolated CD324 modulator comprising a competing ID NO: 64, SEQID NO: 66, SEQID NO: 68 and SEQID antibody wherein said competing antibody inhibits the NO: 70 and wherein said heavy chain variable region binding of an isolated CD324 modulator of claim 10 or 11 comprises an amino acid sequence having at least 60% to CD324 by at least about 40%. identity to an amino acid sequence selected from the 14. A nucleic acid encoding an amino acid heavy chain 45 group consisting of amino acid sequences as set forth in variable region or an amino acid light chain variable SEQ ID NO: 21, SEQ ID NO. 23, SEQ ID NO: 25, SEQ region of claim 11. ID NO: 27, SEQ ID NO: 29, SEQ ID NO:31, SEQ ID 15. A vector comprising the nucleic acid of claim 14. NO:33, SEQ ID NO:35, SEQID NO:37, SEQID NO: 16. The isolated CD324 modulator of claim 1 wherein the 39, SEQ ID NO:41, SEQ ID NO: 43, SEQID NO: 45, modulator comprises a multispecific antibody. 50 SEQ ID NO:47, SEQ ID NO: 49, SEQ ID NO:51, SEQ 17. The isolated CD324 modulator of claim 16 wherein the ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID multispecific antibody comprises a bispecific antibody. NO:59, SEQ ID NO: 61, SEQID NO: 63, SEQID NO: 18. The isolated CD324 modulator of claim 1 wherein said 65, SEQID NO: 67, SEQID NO: 69 and SEQID NO: 71. modulator reduces the frequency of tumor initiating cells 34. The method of claim 33 wherein said monoclonal upon administration to a subject in need thereof. 55 antibody is a humanized antibody. 19. The isolated CD324 modulator of claim 18 wherein the 35. The method of claim 31 wherein said monoclonal reduction in frequency is determined using flow cytomet antibody comprises a neutralizing antibody. ric analysis of tumor cell Surface markers known to enrich 36. The method of claim 31 wherein said monoclonal for tumor initiating cells. antibody comprises an internalizing antibody. 20. The isolated CD324 modulator of claim 18 wherein the 60 37. The method of claim 36 wherein said internalizing reduction in frequency is determined using immunohis antibody comprises a cytotoxic agent. tochemical detection of tumor cell Surface markers known 38. The method of claim 28 wherein said CD324 modulator to enrich for tumor initiating cells. comprises a multispecific antibody. 21. The isolated CD324 modulator of claim 18 wherein said 39. The method of claim 38 wherein said multispecific tumor initiating cells comprise tumor perpetuating cells. 65 antibody comprises a bispecific antibody. 22. The isolated CD324 modulator of claim 1 further com 40. The method of claim 28 wherein said CD324 associated prising a cytotoxic agent. disorder comprises a neoplastic disorder. US 9,534,058 B2 75 76 41. The method of claim 40 wherein said neoplastic disorder cancer, ovarian cancer, colorectal cancer, pancreatic can comprises selected from the group consisting of adrenal cer, prostate cancer and breast cancer. cancer, bladder cancer, cervical cancer, endometrial can 62. The method of claim 55 wherein the frequency of tumor cer, kidney cancer, liver cancer, lung cancer, ovarian initiating cells is reduced by at least 10%. cancer, colorectal cancer, pancreatic cancer, prostate can- 5 63. The method of claim 55 wherein the reduction in cer and breast cancer. frequency is determined using flow cytometric analysis of 42. The method of claim 40 wherein said solid tumor tumor cell Surface markers known to enrich for tumor comprises a hematologic malignancy. initiating cells or immunohistochemical detection of 43. The method of claim 42 wherein said hematologic tumor cell Surface markers known to enrich for tumor 10 initiating cells. malignancy comprises leukemia or lymphoma. 64. A method of treating a Subject Suffering from a hema 44. The method of claim 40 wherein the subject suffering tologic malignancy comprising the step of administering said neoplastic disorder exhibits tumors comprising tumor a CD324 modulator to said subject. initiating cells. 65. The method of claim 64 wherein said CD324 modulator 45. The method of claim 44 further comprising the step of is comprises a monoclonal antibody. reducing the frequency of tumor initiating cells in said 66. A method of sensitizing a tumor in a subject for treatment Subject. with an anti-cancer agent comprising the step of admin 46. The method of claim 45 wherein the reduction in istering a CD324 modulator to said subject. frequency is determined using flow cytometric analysis of 67. The method of claim 66 wherein said CD324 modulator tumor cell Surface markers known to enrich for tumor 20 comprises an antibody. initiating cells or immunohistochemical detection of 68. The method of claim 66 wherein said tumor is a solid tumor cell Surface markers known to enrich for tumor tumor. initiating cells. 69. The method of claim 66 wherein said anti-cancer agent 47. The method of claim 45 wherein the reduction in comprises a chemotherapeutic agent. frequency is determined using in vitro or in Vivo limiting 25 70. The method of claim 66 wherein said anti-cancer agent dilution analysis. comprises an immunotherapeutic agent. 48. The method of claim 47 wherein the reduction in 71. A method of diagnosing a proliferative disorder in a frequency is determined using in vivo limiting dilution Subject in need thereof comprising the steps of: analysis comprising transplant of live human tumor cells a. obtaining a tissue sample from said Subject; into immunocompromised mice. 30 b. contacting the tissue sample with at least one CD324 49. The method of claim 48 wherein the reduction of modulator; and frequency determined using in vivo limiting dilution c. detecting or quantifying the CD324 modulator associ analysis comprises quantification of tumor initiating cell ated with the sample. frequency using Poisson distribution statistics. 72. The method of claim 71 wherein the CD324 modulator 50. The method of claim 47 wherein the reduction of 35 comprises a monoclonal antibody. frequency is determined using in vitro limiting dilution 73. The method of claim 72 wherein the antibody is operably analysis comprising limiting dilution deposition of live associated with a reporter. human tumor cells into in vitro colony Supporting con 74. An article of manufacture useful for diagnosing or ditions. monitoring CD324 associated disorders comprising a 51. The method of claim 50 wherein the reduction of 40 receptacle comprising a CD324 modulator and instruc frequency determined using in vitro limiting dilution tional materials for using said CD324 modulator to diag analysis comprises quantification of tumor initiating cell nose or monitor the CD324 associated disorder. frequency using Poisson distribution statistics. 75. The article of manufacture of claim 74 wherein said 52. The method of claim 28 further comprising the step of CD324 modulator is a monoclonal antibody. administering an anti-cancer agent. 45 76. The article of manufacture of claim 74 wherein the 53. The method of claim 28 further comprising the subse receptacle comprises a readable plate. quent administration of a CD324 modulator. 77. A method of treating a subject suffering from neoplastic 54. The method of claim 53 wherein the subsequently disorder comprising the step of administering a therapeu administered CD324 modulator comprises an internaliz tically effective amount of at least one internalizing ing CD324 modulator. 50 CD324 modulator. 55. A method of reducing the frequency of tumor initiating 78. The method of claim 77 wherein said CD324 modulator cells in a Subject in need thereof comprising the step of comprises an antibody. administering a CD324 modulator to said subject. 79. The method of claim 78 wherein said antibody com 56. The method of claim 55 wherein the tumor initiating prises a monoclonal antibody. cells comprise tumor perpetuating cells. 55 80. The method of claim 79 wherein the monoclonal anti 57. The method of claim 56 wherein said tumor perpetuating body further comprises a cytotoxic agent. cells are CD46" cells. 81. The method of claim 80 further comprising the step of 58. The method of claim 55 wherein said CD324 modulator administering a non-internalizing CD324 modulator prior comprises an antibody. to administering the internalizing CD324 modulator. 59. The method of claim 58 wherein said antibody com 60 82. A method of treating a Subject Suffering from neoplastic prises a monoclonal antibody. disorder comprising the step of administering a therapeu 60. The method of claim 59 wherein said monoclonal tically effective amount of at least one neutralizing antibody further comprises a cytotoxic agent. CD324 modulator. 61. The method of claim 55 wherein the subject is suffering 83. The method of claim 82 wherein said CD324 modulator from a neoplastic disorder selected from the group con- 65 comprises an antibody. sisting of adrenal cancer, bladder cancer, cervical cancer, 84. The method of claim 83 wherein said antibody com endometrial cancer, kidney cancer, liver cancer, lung prises a monoclonal antibody. US 9,534,058 B2 77 78 85. The method of claim 84 wherein said monoclonal SC10.129, SC10. 130, SC10.132, SC10.133, SC10.134, antibody comprises a humanized antibody. SC10.163, SC10.168, and SC10.178. 86. The method of claim 85 wherein said humanized anti 104. An isolated CD324 modulator that binds to an epitope body further comprises a cytotoxic agent. associated with the EC1 domain of CD324. 87. The method of claim 82 wherein administration of the 105. The CD324 modulator of claim 104 wherein said neutralizing CD324 modulator is followed by the admin CD324 modulator comprises an antibody or immunore istration of an internalizing CD324 modulator. active fragment thereof. 88. A method of identifying, isolating, sectioning or enrich 106. The CD324 modulator of claim 105 wherein said ing a population of tumor initiating cells comprising the antibody or immunoreactive fragment thereof comprises a step of contacting said tumor initiating cells with a CD324 10 monoclonal antibody. modulator. 107. The CD324 modulator of claim 106 wherein said 89. The method of claim 88 wherein said CD324 modulator CD324 modulator comprises an ADC. comprises an antibody. 108. The CD324 modulator of claim 106 wherein said 90. A CD324 modulator comprising a humanized antibody 15 CD324 modulator comprises a multispecific antibody. wherein said humanized antibody comprises a light chain 109. The CD324 modulator of claim 108 wherein said variable region and a heavy chain variable region wherein multispecific antibody comprises a bispecific antibody. said light chain variable region comprises an amino acid 110. An isolated CD324 modulator that binds to an epitope sequence having at least 60% identity to the amino acid associated with the EC2 domain of CD324. sequence set forth in SEQ ID NO: 72 and wherein said 111. The CD324 modulator of claim 110 wherein said heavy chain variable region comprises an amino acid CD324 modulator comprises an antibody or immunore sequence having at least 60% identity to an amino acid active fragment thereof. sequence selected from the group consisting of amino 112. The CD324 modulator of claim 111 wherein said acid sequences as set forth in SEQ ID NO: 73. antibody or immunoreactive fragment thereof comprises a 91. A method inhibiting or preventing metastasis in a subject 25 monoclonal antibody. in need thereof comprising the step of administering a 113. The CD324 modulator of claim 112 wherein said pharmaceutically effective amount of a CD324 modulator. CD324 modulator comprises an ADC. 92. The method of claim 91 wherein the subject undergoes 114. The CD324 modulator of claim 112 wherein said a debulking procedure before or after the administration CD324 modulator comprises a multispecific antibody. of the CD324 modulator. 30 115. The CD324 modulator of claim 114 wherein said 93. The method of claim 92 wherein said debulking proce multispecific antibody comprises a bispecific antibody. dure comprises the administration of at least one anti 116. An isolated CD324 modulator that binds to an epitope cancer agent. associated with the EC3 domain of CD324. 94. A method of performing maintenance therapy on a 117. The CD324 modulator of claim 116 wherein said Subject in need thereof comprising the step of adminis 35 CD324 modulator comprises an antibody or immunore tering a pharmaceutically effective amount of a CD324 active fragment thereof. modulator. 118. The CD324 modulator of claim 117 wherein said 95. The method of claim 94 wherein said subject is treated antibody or immunoreactive fragment thereof comprises a for a neoplastic disorder prior to the administration of the monoclonal antibody. CD324 modulator. 40 119. The CD324 modulator of claim 118 wherein said 96. A method of depleting tumor initiating cells in a subject CD324 modulator comprises an ADC. Suffering from a proliferative disorder comprising the step 120. The CD324 modulator of claim 118 wherein said of administering a CD324 modulator. CD324 modulator comprises a multispecific antibody. 97. A method of diagnosing, detecting or monitoring a 121. The CD324 modulator of claim 120 wherein said CD324 associated disorder in vivo in a subject in need 45 multispecific antibody comprises a bispecific antibody. thereof comprising the step of administering a CD324 122. An isolated CD324 modulator that binds to an epitope modulator. associated with the EC4 domain of CD324. 98. A method of diagnosing, detecting or monitoring a 123. The CD324 modulator of claim 122 wherein said CD324 associated disorder in a subject in need thereof CD324 modulator comprises an antibody or immunore comprising the step contacting circulating tumor cells 50 active fragment thereof. with a CD324 modulator. 124. The CD324 modulator of claim 123 wherein said 99. The method of claim 98 wherein said contacting step antibody or immunoreactive fragment thereof comprises a occurs in vivo. monoclonal antibody. 100. The method of claim 98 wherein said contacting step 125. The CD324 modulator of claim 124 wherein said occurs in vitro. 55 CD324 modulator comprises an ADC. 101. A method of treating a tumor in a patient in need thereof 126. The CD324 modulator of claim 124 wherein said comprising the step of administering a therapeutically CD324 modulator comprises a multispecific antibody. effective amount of a CD324 modulator conjugated to a 127. The CD324 modulator of claim 126 wherein said cytotoxic agent. multispecific antibody comprises a bispecific antibody. 102. The method of claim 101 wherein the conjugated 60 128. An isolated CD324 modulator that binds to an epitope CD324 modulator comprises an internalizing CD324 anti associated with the EC5 domain of CD324. body. 129. The CD324 modulator of claim 128 wherein said 103. A CD324 modulator derived from an antibody selected CD324 modulator comprises an antibody or immunore from the group consisting of SC10.6, SC10.15, SC10.17, active fragment thereof. SC10.19, SC10.35, SC10.36, SC10.38, SC10.75, 65 130. The CD324 modulator of claim 129 wherein said SC10.111, SC 10.112, SC10.115, SC10.118, SC 10.123, antibody or immunoreactive fragment thereof comprises a SC10.124, SC 10.125, SC10.126, SC10.127, SC 10.128, monoclonal antibody. US 9,534,058 B2 79 80 131. The CD324 modulator of claim 130 wherein said CD133, CD20, CD56, CD29, B7H3, CD46, transferrin CD324 modulator comprises an ADC. receptor, JAM3, carboxypeptidase M, oncostatin M, 132. The CD324 modulator of claim 130 wherein said LgriS, Lgró, CD325, nectin-4, nestin, Sox1, Bmi-1, eed, CD324 modulator comprises a multispecific antibody. easyhl, easyh2, mf2, yy1, SmarcA3, Smarck A5, SmarcD3. 133. The CD324 modulator of claim 132 wherein said smarch 1, millt3, DLL1, DLL4, FZD1, FZD2, FZD3, multispecific antibody comprises a bispecific antibody. FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, WNT2, 134. An isolated CD324 modulator residing in a bin selected WNT2B, WNT3, WNT5A, WNT1OB, WNT16, AXIN1, from the group consisting of bin A, bin B, bin C, bin D BCL9, MYC, (TCF4) SLC7A8, SLC44A4, IL1RAP, and bin E. TEM8, TMPRSS4, MUC16, GPRC5B, SLC6A14, 135. An isolated CD324 modulator residing in a bin defined 10 SLC4A11, PPAP2C, CAV1, CAV2, PTPN3, EPHA1, by a reference antibody selected from the group consist EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, ing of SC10.6, SC10.15, SC10.17, SC10.19, SC10.35, EPHA8, EPHA9, EPHB1, EPHB2, EPHB3, EPHB4, SC10.36, SC10.38, SC10.75, SC10.111, SC10.112, EPHB5, EPHB6, EFNA1 EFNA2, EFNA3, EFNA5, SC10.115, SC10.118, SC10.123, SC10.124, SC10.125, EFNA6, EFNB1, EFNB2, EFNB3, SLC1A1, CX3CL1, SC10.126, SC10.127, SC10.128, SC10.129, SC10.130, 15 ADORA2A, MPZL.1, FLJ10052, C4.4A, EDG3, SC10.132, SC 10.133, SC10.134, SC10.163, SC 10.168, RARRES1, TMEPAI, PTS, CEACAM5, CEACAM6, and SC 10.178. NID2, STEAP, ABCA3, CRIM1, ILIR1, OPN3, DAF, 136. An antibody drug conjugate of the formula: MUC1, CPD, NMA, ADAM9, GJA1, SLC19A2, ABCA1, PCD117, ADCY9, SLC39A1, NPC1, ENPP1, M-L-Din N33, GPNMB, LY6E, CELSR1, LRP3, C20orf52, TME or a pharmaceutically acceptable salt thereof wherein PAI, FLVCR, PCDHA10, GPR54, TGFBR3, SEMA4B, a) M comprises a CD324 modulator; PCDHB2, ABCG2, CD166, AFP, BMP-4, B-catenin, b) L comprises an optional linker; CD2, CD3, CD9, CD14, CD31, CD38, CD44, CD45, c) D is a anti-proliferative agent; and CD74, CD90, CXCR4, decorin, APCDD1, PTK7, EGFR, d) n is an integer from about 1 to about 20. 25 CD105, CD64, CD16, CD16a, CD16b, GLI1, GLI2, 137. The antibody drug conjugate of claim 136 wherein said CD49b, CD49e and CD49f. CD324 modulator comprises an antibody or immunore 151. The multispecific CD324 modulator of claim 147 active fragment thereof. wherein said modulator comprises a bispecific antibody. 138. The antibody drug conjugate of claim 137 wherein said 152. A bispecific antibody comprising a first binding site antibody comprises a monoclonal antibody. 30 recognizing a first epitope on CD324 and a second 139. The antibody drug conjugate of claim 138 wherein said binding site recognizing a second epitope wherein said antibody is derived from an antibody selected from the first and second epitopes are not equivalent. group consisting of SC10.6, SC10.15, SC10.17, SC10.19, 153. The bispecific antibody of claim 152 wherein the SC10.35, SC10.36, SC10.38, SC10.75, SC10.111, second epitope is present on CD324. SC10.112, SC 10.115, SC10.118, SC 10.123, SC 10.124, 35 154. The bispecific antibody of claim 152 wherein the SC10.125, SC10.126, SC10.127, SC10.128, SC10.129, second epitope is present on an antigen other than CD324. SC10.130, SC10.132, SC10.133, SC10.134, SC10.163, 155. A multispecific CD324 modulator comprising a first SC10.168, and SC10.178. binding site derived from an antibody that recognizes a 140. The antibody drug conjugate of claim 138 wherein said first epitope on CD324 and a second binding site derived antibody is humanized. 40 from an antibody that recognizes a second epitope 141. The antibody drug conjugate of claim 136 wherein the wherein said first and second epitopes are not equivalent. optional linker is present and the linker comprises a 156. The multispecific CD324 modulator of claim 155 cleavable linker, wherein the first binding site is derived from an antibody 142. The antibody drug conjugate of claim 141 wherein said selected from the group consisting of SC 10.6, SC10.15, cleavable linker comprises a peptidyl linker. 45 SC10.17, SC10.19, SC10.35, SC10.36, SC10.38, 143. The antibody drug conjugate of claim 136 wherein said SC10.75, SC10.111, SC10.112, SC10.115, SC10.118, anti-proliferative agent comprises a cytotoxic agent. SC10.123, SC10.124, SC10.125, SC10.126, SC 10.127, 144. The antibody drug conjugate of claim 143 wherein said SC10.128, SC10.129, SC10.130, SC10.132, SC10.133, cytotoxic agent comprises a pyrrolobenzodiazepine. SC10.134, SC10.163, SC10.168, and SC10, 178. 145. The antibody drug conjugate of claim 144 wherein said 50 157. The multispecific CD324 modulator of claim 155 pyrrolobenzodiazepine comprises a pyrrolobenzodiaz wherein the second binding site is derived from an epine dimer, antibody selected from the group consisting of abagov 146. A multispecific CD324 modulator. omab, adecatumumab, afutuZumab, alemtuzumab, altu 147. The multispecific CD324 modulator of claim 146 momab, amatuximab, anatumomab, arcitumomab, bavi wherein said modulator comprises a first binding site 55 tuximab, bectumomab, bevacizumab, bivatuZumab, recognizing a first epitope on CD324 and a second blinatumomab, brentuximab, cantuzumab, catumaXomab, binding site recognizing a second epitope wherein said cetuximab, citatuZumab, cixutumumab, clivatuZumab, first and second epitopes are not equivalent. conatumumab, daratumumab, drozitumab, duligotumab, 148. The multispecific CD324 modulator of claim 147 dusigitumab, detumomab, dacetuZumab, dalotuZumab, wherein the second epitope is present on CD324. 60 ecromeximab, elotuZumab, ensituximab, ertumaXomab, 149. The multispecific CD324 modulator of claim 147 etaracizumab, farletuZumab, ficlatuZumab, figitumumab, wherein the second epitope is present on an antigen other flanVotumab, futuximab, ganitumab, gemtuzumab, giren than CD324. tuximab, glembatumumab, ibritumomab, igovomab, img 150. The multispecific CD324 modulator of claim 149 atuZumab, indatuximab, inotuzumab, intetumumab, ipili wherein the second epitope is present on an antigen 65 mumab, iratumumab, labetuZumab, lexatumumab, Selected from the group consisting of OCT4, Nanog, lintuZumab, lorVotuzumab, lucatumumab, mapatu STAT3, EPCAM, CD24, CD34, NB84, TrkA, GD2, mumab, matuZumab, milatuZumab, minretumomab, mitu US 9,534,058 B2 81 82 momab, moxetumomab, narnatumab, naptumomab, neci Small populations of isolated cells to generate fully hetero tumumab, nimotuZumab, nofetumomabn, ocaratuZumab, geneous tumors in mice is strongly indicative of the fact that ofatumumab, olaratumab, onartuzumab, oportuzumab the isolated cells comprise TPC. In such work the use of oregovomab, panitumumab, parsatuZumab, patritumab, minimally passaged NTX cell lines greatly simplifies in vivo pemtumomab, pertuzumab, pintumomab, pritumumab, experimentation and provides readily verifiable results. racotumomab, radretumab, rillotumumab, rituximab, Moreover, early passage NTX tumors also respond to thera robatumumab, Satumomab, sibrotuzumab, siltuximab, peutic agents such as irinotecan (i.e. Camptosar R), which simtuzumab, Solitomab, tacatuZumab, taplitumomab, provides clinically relevant insights into underlying mecha tenatumomab, teprotumumab. tigatuZumab, to situ nisms driving tumor growth, resistance to current therapies momab, trastuzumab, tucotuZumab, ublituximab, Veltu 10 and tumor recurrence. Zumab, Vorsetuzumab, votumumab, Zalutumumab, CC49 As the NTX tumor cell lines were established the con and 3F8. stituent tumor cell phenotypes were analyzed using flow 158. The multispecific CD324 modulator of claim 157 cytometry to identify discrete markers that might be used to wherein the modulator comprises a bispecific antibody. characterize, isolate, purify or enrich tumor initiating cells 159. The multispecific CD324 modulator of claim 158 15 (TIC) and separate or analyze TPC and TProg cells within further comprising a conjugated anti-cancer agent. Such populations. In this regard the inventors employed a 160. A pharmaceutical composition comprising a multispe proprietary proteomic based platform (i.e. PhenoPrintTM cific CD324 modulator. Array) that provided for the rapid characterization of cells 161. A method of treating a patient suffering from a CD324 based on protein expression and the concomitant identifica associated disorder comprising the step of administering tion of potentially useful markers. The PhenoPrint Array is a multispecific CD324 modulator. a proprietary proteomic platform comprising hundreds of 162. A method of treating a patient suffering from a CD324 discrete binding molecules, many obtained from commercial associated disorder comprising the step of administering sources, arrayed in 96 well plates wherein each well contains a neutralizing CD324 modulator and Subsequently admin a distinct antibody in the phycoerythrin fluorescent channel istering an internalizing CD324 modulator. 25 and multiple additional antibodies in different fluoro 163. The method of claim 162 wherein said internalizing chromes arrayed in every well across the plate. This allows CD324 modulator is conjugated to a cytotoxic agent. for the determination of expression levels of the antigen of interest in a Subpopulation of selected tumor cells through EXAMPLES rapid inclusion of relevant cells or elimination of non 30 relevant cells via non-phycoerythrin channels. When the The present invention, thus generally described above, PhenoPrint Array was used in combination with tissue will be understood more readily by reference to the follow dissociation, transplantation and stem cell techniques well ing examples, which are provided by way of illustration and known in the art (Al-Hajj et al., 2004, Dalerba et al., 2007 are not intended to be limiting of the instant invention. The and Dylla et al., 2008, all supra, each of which is incorpo examples are not intended to represent that the experiments 35 rated herein by reference in its entirety), it was possible to below are all or the only experiments performed. Unless effectively identify relevant markers and subsequently iso indicated otherwise, parts are parts by weight, molecular late and transplant specific human tumor cell Subpopulations weight is weight average molecular weight, temperature is with great efficiency. in degrees Centigrade, and pressure is at or near atmo In the instant case various NTX tumor lines comprising spheric. 40 human tumors were established in severely immunocom promised mice using art recognized techniques. Upon reach Example 1 ing 800-2,000 mm, tumors were resected from mice and dissociated into single cell Suspensions using art recognized Characterization of CD324 Expression on Human mechanical and enzymatic dissociation techniques involving Solid Tumors 45 the use of collagenase, hyaluronidase and DNAse I (See for example U.S.P.N. 2007/0292414 which is incorporated To characterize the cellular heterogeneity of solid tumors herein). Data obtained from these Suspensions using the as they exist in cancer patients, elucidate the identity of PhenoPrint Array provided both absolute (per cell) and tumor perpetuating cells (TPC; i.e. cancer stem cells: CSC) relative (vs. other cells in the population) surface protein using particular phenotypic markers and identify clinically 50 expression on a cell-by-cell basis, leading to more complex relevant therapeutic targets, a large non-traditional Xenograft characterization and stratification of cell populations. More (NTX) tumor bank was developed and maintained using art specifically, use of the PhenoPrint Array allowed for the recognized techniques. The NTX tumor bank, comprising a rapid identification of proteins or markers that prospectively number of discrete tumor cell lines, was propagated in distinguished TIC or TPC from NTG bulk tumor cells and immunocompromised mice through multiple passages of 55 tumor stroma and, when isolated from NTX tumor models, heterogeneous tumor cells originally obtained from numer provided for the relatively rapid characterization of tumor ous cancer patients afflicted by a variety of solid tumor cell Subpopulations expressing differing levels of specific malignancies. The continued availability of a large number cell Surface proteins. In particular, proteins with heteroge of discrete early passage NTX tumor cell lines having well neous expression across the tumor cell population allow for defined lineages greatly facilitate the identification and 60 the isolation and transplantation of distinct, and highly isolation of TPC as they allow for the reproducible and purified, tumor cell Subpopulations expressing either high repeated characterization of cells purified from the cell lines. and low levels of a particular determinant or marker into More particularly, isolated or purified TPC are most accu immune-compromised mice, thereby facilitating the assess rately defined retrospectively according to their ability to ment of whether TPC were enriched in one subpopulation or generate phenotypically and morphologically heterogeneous 65 another. tumors in mice that recapitulate the patient tumor sample The term “enriching is used synonymously with isolat from which the cells originated. Thus, the ability to use ing cells and means that the yield (fraction) of cells of one US 9,534,058 B2 83 84 type is increased over the fraction of other types of cells as PPAP2C, CAV1, CAV2, PTPN3, EPHA1, EPHA2, compared to the starting or initial cell population. Prefer SLC1A1, CX3CL1, ADORA2A, MPZL.1, FLJ10052, ably, enriching refers to increasing the percentage by about C4.4A, EDG3, RARRES1, TMEPAI, PTS, CEACAM6, 10%, by about 20%, by about 30%, by about 40%, by about NID2, STEAP, ABCA3, CRIM1, ILIR1, OPN3, DAF, 50% or greater than 50% of one type of cell in a population 5 MUC1, CPD, NMA, ADAM9, GJA1 SLC19A2, ABCA1, of cells as compared to the starting population of cells. PCDH7, ADCY9, SLC39A1, NPC1, ENPP1, N33, As used herein a “marker, in the context of a cell or GPNMB, LY6E, CELSR1, LRP3, C20orf52, TMEPAI, tissue, means any characteristic in the form of a chemical or FLVCR, PCDHA10, GPR54, TGFBR3, SEMA4B, biological entity that is identifiably associated with, or PCDHB2, ABCG2, CD166, AFP, BMP-4, B-catenin, CD2, specifically found in or on a particular cell, cell population 10 CD3, CD9, CD14, CD31, CD38, CD44, CD45, CD74, or tissue including those identified in or on a tissue or cell CD90, CXCR4, decorin, EGFR, CD105, CD64, CD16, population affected by a disease or disorder. As manifested, CD16a, CD16b, GLI1, GLI2, CD49b, and CD49f. See, for markers may be morphological, functional or biochemical in example, Schulenburg et al., 2010, PMID: 20185329, U.S. nature. In preferred embodiments the marker is a cell surface Pat. No. 7,632,678 and U.S.PNs. 2007/0292414, 2008/ antigen that is differentially or preferentially expressed by 15 0175870, 2010/0275280, 2010/0162416 and 2011/0020221 specific cell types (e.g., TPC) or by cells under certain each of which is incorporated herein by reference. It will be conditions (e.g., during specific points of the cell life cycle appreciated that a number of these markers were included in or cells in a particular niche). Preferably, such markers are the PhenoPrint Array described above. proteins, and more preferably, possess an epitope for anti Similarly, non-limiting examples of cell Surface pheno bodies, aptamers or other binding molecules as known in the types associated with cancer stem cells of certain tumor art. However, a marker may consist of any molecule found types include CD44'CD24'", ALDH, CD133", CD123, on the surface or within a cell including, but not limited to, CD34"CD38, CD44"CD24, CD46'CD324"CD66c, proteins (peptides and polypeptides), lipids, polysaccha CD133*CD34+CD10CD19, CD138-CD34CD19", rides, nucleic acids and steroids. Examples of morphological CD133'RC2", CD44"o, B, CD133", CD44"CD24"ESA", marker characteristics or traits include, but are not limited 25 CD271, ABCB5 as well as other cancer stem cell surface to, shape, size, and nuclear to cytoplasmic ratio. Examples phenotypes that are known in the art. See, for example, of functional marker characteristics or traits include, but are Schulenburg et al., 2010, supra, Visvader et al., 2008, PMID: not limited to, the ability to adhere to particular substrates, 18784658 and U.S.P.N. 2008/0138313, each of which is ability to incorporate or exclude particular dyes, for example incorporated herein in its entirety by reference. Those skilled but not limited to exclusions of lipophilic dyes, ability to 30 in the art will appreciate that marker phenotypes such as migrate under particular conditions and the ability to differ those exemplified immediately above may be used in con entiate along particular lineages. Markers can also be a junction with standard flow cytometric analysis and cell protein expressed from a reporter gene, for example a sorting techniques to characterize, isolate, purify or enrich reporter gene expressed by the cell as a result of introduction TIC and/or TPC cells or cell populations for further analysis. of the nucleic acid sequence encoding the reporter gene into 35 Of interest with regard to the instant invention CD46, the cell and its transcription resulting in the production of the CD324 and, optionally, CD66c are either highly or hetero reporter protein that can be used as a marker. Such reporter geneously expressed on the Surface of many human colorec genes that can be used as markers are, for example but not tal (“CR), breast (“BR), non-small cell lung (NSCLC), limited to fluorescent proteins enzymes, chromomeric pro small cell lung (SCLC), pancreatic (VA"), melanoma teins, resistance genes and the like. 40 (“Mel”), ovarian (“OV), and head and neck cancer (“FIN) In a related sense the term marker phenotype in the tumor cells, regardless of whether the tumor specimens context of a tissue, cell or cell population (e.g., a stable TPC being analyzed were primary patient tumor specimens or phenotype) means any marker or combination of markers patient-derived NTX tumors. that may be used to characterize, identify, separate, isolate or Cells with negative expression (i.e."-) are herein defined enrich a particular cell or cell population (e.g., by flow 45 as those cells expressing less than, or equal to, the 95" cytometry or FACS). In specific embodiments, the marker percentile of expression observed with an isotype control phenotype is a cell Surface phenotype that may be deter antibody in the channel of fluorescence in the presence of the mined by detecting or identifying the expression of a com complete antibody staining cocktail labeling for other pro bination of cell surface markers. teins of interest in additional channels of fluorescence emis In this regard it will be appreciated that, in addition to 50 sion. Those skilled in the art will appreciate that this unexpectedly providing a therapeutic target, CD324 also procedure for defining negative events is referred to as comprises a marker that may be used to identify and “fluorescence minus one', or “FMO', staining. Cells with characterize tumor perpetuating cells. More generally those expression greater than the 95" percentile of expression skilled in the art will recognize that numerous markers (or observed with an isotype control antibody using the FMO their absence) have been associated with various populations 55 staining procedure described above are herein defined as of cancer stem cells and used to isolate or characterize “positive' (i.e."+"). As defined herein there are various selected tumor cell Subpopulations. In this respect exem populations of cells broadly defined as “positive.’ First, cells plary cancer stem cell markers comprise OCT4, Nanog, with low expression (i.e. “lo') are generally defined as those STAT3, EPCAM, CD24, CD34, NB84, TrkA, GD2, CD133, cells with observed expression above the 95" percentile CD20, CD56, CD29, B7H3, CD46, transferrin receptor, 60 determined using FMO staining with an isotype control JAM3, carboxypeptidase M, oncostatin M, Lgr5, Lgró, antibody and within one standard deviation of the 95" CD325, nestin, Sox1, Bmi-1, eed, easyhl, easyh2, mf2, yy 1, percentile of expression observed with an isotype control smarcA3, Smarck A5, smarcD3, Smarch 1, millt3, FZD1, antibody using the FMO staining procedure described FZD2, FZD3, FZD4, FZD6, FZD7, FZD8, FZD9, FZD10, above. Cells with “high expression (i.e. “hi') may be WNT2, WNT2B, WNT3, WNT5A, WNT10B, WNT16, 65 defined as those cells with observed expression above the AXIN1, BCL9, MYC, (TCF4) SLC7A8, IL1RAP, TEM8, 95" percentile determined using FMO staining with an TMPRSS4, MUC16, GPRC5B, SLC6A14, SLC4A11, isotype control antibody and greater than one standard US 9,534,058 B2 85 86 deviation above the 95" percentile of expression observed indicates that it is likely associated with certain tumor cell with an isotype control antibody using the FMO staining subpopulations and may therefore be used to enrich cell procedure described above. In other embodiments the 99" populations for tumorigenic cells and provide an effective percentile may preferably be used as a demarcation point therapeutic target for anti-proliferative agents. between negative and positive FMO staining and in particu larly preferred embodiments the percentile may be greater Example 2 than 99%. Using techniques such as those described above to Identification, Enrichment and Isolation of Tumor quickly identify and rank colorectal tumor antigens based on Initiating Cell Populations. Using CD324 expression intensity and heterogeneity across several NTX 10 Modulators tumors from colorectal cancer patients, candidate TPC anti gens were further assessed by comparison of tumor versus In tumors exhibiting heterogeneous expression of a par normal adjacent tissue and then selected based, at least in ticular protein or proteins of interest (e.g., CD324), cells part, on the up- or down-regulation of the particular antigen were enriched or isolated based on Such markers and then in malignant cells. Moreover, systematic analysis of a vari 15 transplanted into immunocompromised mice. More particu ety of cell surface markers for their ability to enrich for the larly, to determine whether high or low levels of surface ability to transplant fully heterogeneous tumors into mice CD324 expression could be correlated with enhanced tum (i.e. tumorigenic ability), and Subsequent combination of origenicity, NTX tumor samples were disassociated using these markers substantially improved the resolution of the state of the art techniques as described above and isolated method and improved the ability to tailor fluorescence using a FACSAriaTM Flow Cytometer (BD Biosciences) to activated cell sorting (FACS) techniques to identify and provide distinct marker enriched subpopulations that were characterize distinct, highly enriched tumor cell Subpopula Subsequently transplanted into immunocompromised mice. tions that exclusively contained all tumor generating ability In this respect cells were injected subcutaneously into the upon transplantation (i.e. tumor initiating cells). mammary fat pad of recipient female immunocompromised In the instant case, using standard flow cytometric tech 25 NOD/SCID mice at doses typically ranging between 1,000 niques, individual tumor cells were characterized on a BD to 50 cells per mouse. When tumors arising from these FACSCantoTM II flow cytometer (BD Biosciences) for the transplants reached 800-2,000 mm, mice were euthanized expression of hundreds of cell Surface proteins. In contrast and the tumors were removed and dissociated by enzymatic to most cell Surface proteins that were uniformly expressed digestion to a single cell Suspension for the purpose of or absent, selected proteins including CD324 were, to a 30 phenotypic characterization to assess whether the constitu greater or lesser extent, positively and/or heterogeneously tion of cells was representative of the parental tumor from expressed on the surface of numerous primary human col which the transplanted cells were originally isolated. orectal, pancreatic, breast, lung, and ovarian tumor cells. FIGS. 3-8 illustrate the results of such experiments con Such expression patterns are indicative of a marker that may ducted using representative NTX cell lines derived from be used to selectively isolate, enrich and/or target tumori 35 colorectal (FIGS. 3A and 3B), pancreatic (FIGS. 4A and genic cell Subpopulations. 4B), non-small cell lung (FIGS.5A and 5B), breast (FIGS. In this regard representative heterogeneous expression of 6A and 6B), ovarian (FIGS. 7A and 7B), and small cell lung CD324 is illustrated in FIGS 2A and 2B for different NTX cancer (FIGS. 8A and 8B) tumors obtained from patients. derived tumor types and one primary ovarian tumor (FIG. FIGS. 9A and 9B depict the results of a similar analysis 2B). More particularly, FIGS. 2A and 2B depict flow cytom 40 performed on a primary melanoma tumor resected from a etry-based protein expression data for individual tumor cells patient. In each respective set FIG. A comprises scatter plots displayed as histogram plots wherein fluorescence minus (gated using CD324 and another putative marker) showing one (FMO) staining using isotype control antibodies is the distribution of the parent tumor, sorted putative tumori shown in the gray, filled histograms and target antigen genic cells and the resulting heterogeneous daughter tumor expression (i.e. CD324) as determined using commercially 45 arising from implanting those sorted cells. Note that, in available antigen-specific, PE-conjugated antibodies (Bi Some instances, the second marker was uniformly high and oLegend Inc.), is displayed using bold, black lines. therefore another property of the cells such as forward As evidenced by FIGS. 2A and 2B, and in accordance scatter (FSC) or marker (ESA) was used for display pur with the instant invention, heterogeneous CD324 expression poses. FIG. B in each set graphically shows the measured was generally observed in various types of Solid tumors. 50 tumor Volume arising from the implantation of Sorted cell Specifically, a review of the plots generated using tumor subpopulations gated on CD324 and CD46 into immuno cells from freshly isolated tumors reveals that CD324 compromised mice. Values in parenthesis indicate the num expression was heterogeneous in tumors derived from col ber of tumors generated per mice implanted. orectal, pancreatic, lung, breast (FIG. 2A), and lung and In a similar vein the results of numerous transplantation ovarian cancer patients (FIG. 2B), indicative of various 55 experiments to determine the tumorigenicity of cell Sub Subpopulations demonstrating negative/b or positive expres populations expressing differing combinations of CD46 and sion. Moreover, cells positively expressing CD324 often had CD324 expression, as well as the efficiency of tumor for staining ranging from low levels to high levels as quantified mation with limiting numbers of transplanted cells, are using isotype control/FMO staining and standard flow cyto presented in a tabular format in FIGS. 10A and 10B. Note metric methodology. 60 that empty spaces in FIGS. 10A and 10B denote that the The combined use of NTX tumor models that accurately indicated experimental condition was not tested. recapitulate tumor physiology with the PhenoPrint Array Significantly, the data from FIGS. 3-10 show that tum analysis of tumor cells as described above, demonstrate the origenicity was consistently associated with the Subpopula possibility identifying putative therapeutic targets by char tion of cells expressing CD324 in combination with high acterizing cell Surface expression levels of tumor antigens, 65 levels of CD46, and the tumors generated by cells with the including CD324. That is, unlike markers exhibiting homo CD46"CD324" phenotype were analogous in composition geneous expression, the heterogeneous expression of CD324 to their parental tumors. As described above and repeated US 9,534,058 B2 87 88 using NTX lines derived from many breast, colorectal, were then grown in 200 uL of culture medium containing pancreatic, non-Small cell lung, ovarian and Small cell lung 15% Fetal Clone I serum (Hyclone), 10% BM-Condimed cancer patients, CD46"CD324" cells consistently generated (Roche Applied Sciences), 1 mM sodium pyruvate, 4 mM heterogeneous tumors when transplanted into mice, thereby L-glutamine, 100 IU Penecillin-Streptamycin, 50 uM 2-mer indicating that this isolated Subpopulation of cells is signifi captoethanol, and 100 LM hypoxanthine. Any remaining cantly enriched for TICs. Conversely, these same data dem unused hybridoma library cells were frozen for future library onstrate that tumor cells expressing either no, or low levels testing. After ten to eleven days of growth Supernatants from of CD324 were much less tumorigenic than their high or each well of the plated cells were assayed for antibodies positive counterparts, respectively. Based on the generated reactive for CD324 by ELISA and FACS assays. data it was surprisingly found that Subpopulations of tumor 10 For the ELISA assay, 96 well plates (VWR, 610744) were cells expressing the CD46" CD324" phenotype generally coated with 0.5 lug/mL CD324-His in sodium carbonate contain the vast majority of tumorigenic capability and buffer overnight at 4° C. The plates were washed and suggest that CD324 may provide an effective therapeutic blocked with 3% BSA in PBS/Tween for one hour at 37° C. target for tumorigenic cell modulation. and used immediately or kept at 4°C. Undiluted hybridoma 15 supernatants were incubated on the plates for one hour at RT. Example 3 The plates are washed and probed with HRP labeled goat anti-mouse IgG diluted 1:10,000 in 1% BSA-PBS for one Generation of CD324 Modulators hour at RT. Following incubation with substrate solution as described above the plates were read at OD 450. Wells CD324 modulators in the form of murine antibodies were containing immunoglobulin that bound the CD324 protein produced in accordance with the teachings herein by inocu were transferred and expanded. lating mice with human CD324-His recombinant protein Growth positive hybridoma wells secreting murine immu (Sino Biological, Inc.). In this respect three strains of female noglobulin were also screened for human CD324 specificity mice (3 each: Balb/c, CD-1, FVB) were immunized via the using a flow cytometry based assay with BR22 CD324+ footpad route with 10 ug of CD324-His immunogen emul 25 cells. Briefly 1x10 BR22 cells per well were incubated for sified with an equal volume of TitermaxTM or alum adjuvant. 30 minutes with 25-100 uL hybridoma Supernatant. Cells Solid-phase ELISA assays were used to Screen mouse sera were washed PBS/2% FCS twice and then incubated with 50 for mouse IgG antibodies specific for human CD324. A LL per sample DyeLight 649 labeled goat-anti-mouse IgG, positive signal above background was indicative of antibod Fe fragment specific secondary diluted 1:200 in PBS/2% ies specific for CD324. Briefly, 96 well plates (VWR Inter 30 FCS. After a 15 minute incubation, cells were washed twice national, Cat. #610744) were coated with recombinant with PBS/2% FCS and re-suspended in PBS/2% FCS with CD324-His at 0.5 g/ml in ELISA coating buffer overnight. DAPI (Life Technologies) and analyzed by flow cytometry After washing with PBS containing 0.02% (v/v) Tween 20, using a FACSCanto II as per the manufacturers instructions. the wells were blocked with 3% (w/v) BSA in PBS, 200 Wells containing immunoglobulin that bound the BR22 with uL/well for 1 hour at room temperature (RT). Mouse serum 35 a similar profile to the commercial CD324-APC antibody was titrated (1:100, 1:200, 1:400, and 1:800) and added to (BioLegend Inc.) were transferred and expanded. The result the CD324 coated plates at 50 uL/well and incubated at RT ing hCD324 specific clonal hybridomas were cryopreserved for 1 hour. The plates are washed and then incubated with 50 in CS-10 freezing medium (Biolife Solutions) and stored in uL/well HRP-labeled goat anti-mouse IgG diluted 1:10,000 liquid nitrogen. in 3% BSA-PBS or 2% FCS in PBS for 1 hour at RT. Again 40 ELISA and flow cytometry analysis confirmed that puri the plates were washed and 40 uL/well of a TMB substrate fied antibody from most or all of these hybridomas bound solution (Thermo Scientific 34028) was added for 15 min CD324 in a concentration-dependent manner. Two fusions utes at RT. After developing, an equal volume of 2N HSO were performed and seeded in 48 plates (4608x2 wells at was added to stop Substrate development and the plates were approximately 65% cloning efficiency) providing hundreds analyzed by spectrophotometer at OD 450. 45 of hits. Selected clones provided on the order of 170 Sera-positive immunized mice were sacrificed and drain antibodies that were immunospecific for human CD324, a ing lymph nodes (popliteal and inguinal, and medial iliac if number of which also cross-reacted with murine CD324. enlarged) were dissected out and used as a source for antibody producing cells. A single cell Suspension of B cells Example 4 (228.9x10° cells) was fused with non-secreting 50 P3x63Ag8.653 myeloma cells (ATCC #CRL-1580) at a ratio Sequencing of CD324 Modulators of 1:1 by electrofusion. Electrofusion was performed using the BTX HybrimmuneTM System, (BTX Harvard Apparatus) Based on the foregoing, a number of exemplary distinct as per the manufacturer's direction. After the fusion proce monoclonal antibodies that bind immobilized human CD324 dure the cells were resuspended in hybridoma selection 55 or BR22 cells with apparently high affinity were selected for medium supplemented with AZaserine (Sigma #A9666), sequencing and further analysis. As shown in a tabular high glucose DMEM medium with sodium pyruvate (Cell fashion in FIGS. 11A and 11B, sequence analysis of the light gro cathi 15-017-CM) containing, 15% Fetal Clone I serum chain variable regions (FIG. 11A) and heavy chain variable (Hyclone), 10% BM Condimed (Roche Applied Sciences), 4 regions (FIG. 11B) from selected monoclonal antibodies mM L-glutamine, 100 IU Penicillin-Streptomycin and 50 60 generated in Example 3 confirmed that many had novel uM 2-mercaptoethanol and then plated in three T225 flasks complementarity determining regions and often displayed in 90 mL selection medium per flask. The flasks were then novel VDJ arrangements. Note that the complementarity placed in a humidified 37°C. incubator containing 5% CO, determining regions set forth in FIGS. 11A and 11B are and 95% air for 6-7 days. After six to seven days of growth defined as per Chothia et al., Supra. the library consisting of the cells grown in bulk in the T225s 65 As a first step in sequencing exemplary modulators, the was plated at 1 cell per well in Falcon 96 well U-bottom selected hybridoma cells were lysed in Trizol R reagent plates using the Aria I cell sorter. The selected hybridomas (Trizol Plus RNA Purification System, Life Technologies) to US 9,534,058 B2 89 90 prepare the RNA. In this regard between 10 and 10 cells amino acid sequences of twenty-six novel murine heavy were resuspended in 1 mL Trizol and shaken vigorously chain variable regions (SEQ ID NOS: 21-71, odd numbers) after addition of 200 uL of chloroform. Samples were then from the same anti-CD324 antibodies and a humanized centrifuged at 4° C. for 10 minutes and the aqueous phase heavy chain variable region (SEQID NO: 73) from the same was transferred to a fresh microfuge tube where an equal murine antibody providing the humanized light chain. Thus, Volume of isopropanol was added. The tubes were again taken together FIGS. 11A and 11B provide the annotated shaken vigorously and allowed to incubate at RT for 10 sequences of twenty-six murine anti-CD324 antibodies minutes before being centrifuged at 4° C. for 10 minutes. (termed SC10.6, SC10.1.5, SC10.17, SC10.19, SC10.35, The resulting RNA pellets were washed once with 1 mL of SC10.36, SC10.38, SC10.75, SC10.111, SC10.112, 70% ethanol and dried briefly at RT before being resus 10 SC10A15, SC10.118, SC 10.123, SC10.124, SC10.125, pended in 40 u, of DEPC-treated water. The quality of the SC10.126, SC10.127, SC10.128, SC10.129, SC10.130, RNA preparations was determined by fractionating 3 uI in SC10.132, SC10.133, SC 10.134, SC10.163, SC10.168, and a 1% agarose gel before being stored at -80° C. until used. SC10.178.) and a humanized antibody (termed hSC10.17). The variable region of the Ig heavy chain of each For the purposes of the instant application the SEQ ID hybridoma was amplified using a 5' primer mix comprising 15 NOS of each particular antibody are sequential. Thus mab thirty-two mouse specific leader sequence primers, designed SC10.6 comprises SEQ ID NOS: 20 and 21 for the heavy to target the complete mouse V repertoire, in combination and light chain variable regions respectively. In this regard with a 3 mouse Cyprimer specific for all mouse Ig isotypes. SC10.15 comprises SEQ ID NOS: 22 and 23, SC10.17 A 400 bp PCR fragment of the V was sequenced from both comprises SEQ ID NOS: 24 and 25, and so on. Moreover, ends using the same PCR primers. Similarly a mix of corresponding nucleic acid sequences for each antibody thirty-two 5' V leader sequence primers designed to amino acid sequence in FIGS. 11A and 11B are included in amplify each of the V mouse families combined with a the instant application as set forth in FIG. 19. In FIG. 19 the single reverse primer specific to the mouse kappa constant included nucleic acid sequences comprise SEQID NOS that region were used to amplify and sequence the kappa light are one hundred greater than the corresponding amino acid chain. The V and V, transcripts were amplified from 100 25 sequence (heavy or light chain). Thus, nucleic acid ng total RNA using reverse transcriptase polymerase chain sequences encoding the heavy and light chain variable reaction (RT-PCR). region amino acid sequences of mAb SC10.6 (i.e., SEQ ID A total of eight RT-PCR reactions were run for each NOS: 20 and 21) comprise SEQ ID NOS: 120 and 121 in hybridoma: four for the V light chain and four for the V FIG. 19. The other antibody nucleic acid sequences, includ gamma heavy chain (y1). The One Step RT-PCR kit was 30 ing those encoding the humanized construct, are numbered used for amplification (Qiagen GmbH). This kit provides a similarly. blend of Sensiscript and Omniscript Reverse Transcriptases, HotStarTaq DNA Polymerase, dNTP mix, buffer and Q-So Example 5 lution, a novel additive that enables efficient amplification of “difficult” (e.g., GC-rich) templates. Reaction mixtures were 35 Humanization of CD324 Modulators prepared that included 3 ul of RNA, 0.5 of 100 uM of either heavy chain or kappa light chain primers (custom synthe An exemplary murine antibody from Example 4 was sized by IDT), 5uL of 5xRT-PCR buffer, 1 uL dNTPs, 1 uL humanized using complementarity determining region of enzyme mix containing reverse transcriptase and DNA (CDR) grafting. Human frameworks for heavy and light polymerase, and 0.4 uL of ribonuclease inhibitor RNasin (1 40 chains were selected based on sequence and structure simi unit). The reaction mixture contains all of the reagents larity with respect to functional human germline genes. In required for both reverse transcription and PCR. The thermal this regard structural similarity was evaluated by comparing cycler program was set for an RT step 50° C. for 30 minutes, the mouse canonical CDR structure to human candidates 95° C. for 15 minutes, followed by 30 cycles of PCR (95° with the same canonical structures as described in Chothia C. for 30 seconds, 48° C. for 30 seconds, 72° C. for one 45 et al. (Supra). minute). There was then a final incubation at 72° C. for 10 More particularly murine antibody SC10. 17 was human minutes. ized using a computer-aided CDR-grafting method (Abysis To prepare the PCR products for direct DNA sequencing, Database, UCL Business Plc.) and standard molecular engi they were purified using the QIAquickTM PCR Purification neering techniques to provide the hSC10.17 modulator. The Kit (Qiagen GmbH) according to the manufacturer's proto 50 human framework regions of the variable regions were col. The DNA was eluted from the spin column using 50 uL selected based on their highest sequence homology to the of sterile water and then sequenced directly from both mouse framework sequence and its canonical structure. For strands. The extracted PCR products were directly the purposes of the analysis the assignment of amino acids sequenced using specific V region primers. Nucleotide to each of the CDR domains is in accordance with the Kabat sequences were analyzed using IMGT to identify germline 55 et al. numbering. A single humanized antibody was made in V. D and J gene members with the highest sequence homol order to demonstrate that relatively non-immunogenic con ogy. The derived sequences were compared to known ger structs could be fabricated comprising the antigen-binding mline DNA sequences of the Ig V- and J-regions using complementarity-determining regions (CDRS) from the V-BASE2 (Retter et al., Supra) and by alignment of V and mouse hybridoma in association with human framework V, genes to the mouse germline database to provide the 60 regions. Ultimately it was found that the humanized annotated sequences set forth in FIGS. 11A and 11B. SC10.17 mAb binds to CD324 antigen with similar affinity More specifically, FIG. 11A depicts the contiguous amino to the murine counterpart with a similar affinity as measured acid sequences of twenty-six novel murine light chain using the Biacore system (e.g., as per Example 6). variable regions from anti-CD324 antibodies (SEQID NOS: Molecular engineering procedures were conducted using 20-70, even numbers) and a humanized light chain variable 65 art-recognized techniques. Using the protocol for determin region (SEQID NO: 72) derived from representative murine ing the sequences of the CD324 modulators as detailed in light chains. Similarly, FIG. 11B depicts the contiguous Example 4 above, the nucleotide sequence information for US 9,534,058 B2 91 92 the V. D and J gene segments of the heavy and light chains For transient transfections cells were grown to 80% of SC10. 17 were obtained. Based on these sequence data, confluency. Equal amounts of IgE and corresponding Ig new primer sets specific to the leader sequence of the IgVH chain vector DNA (12.5ug of each vector DNA) was added and VK chains of SC 10.17 were designed for cloning of the to 1.5 mL Opti-MEM mixed with 50 HEK 293 transfection recombinant monoclonal antibody. Subsequently the reagent in 1.5 mL opti-MEM. The mix was incubated for 30 V-(D)-J sequences were aligned with mouse Ig germline min at room temperature and distributed evenly to the sequences, with the heavy chain gene of SC10.17 identified culture plate. Supernatants were harvested three days after as IGHV5-17 (V), DQ52a.1 (D) and JH4 (J) and the kappa transfection, replaced by 20 mL of fresh DMEM supple light chain genes were identified as IGKV1-117, JK1. The mented with 10% FBS and harvested again at day 6 after obtained heavy and light chain sequences for hSC10.17 10 transfection. Culture supernatants were cleared from cell were aligned to the functional human variable region debris by centrifugation at 800xg for 10 min and stored at 4 sequences and reviewed for homology and canonical struc C. Recombinant chimeric and humanized antibodies were ture. Following analysis the hSC10.17 was generated using purified with Protein G beads (GE Healthcare). human VH3-48 (V), IGHD7-27 (D) and JH4 (J) for the 15 Example 6 heavy chain and human kappa light chain genes A17 and JK1. The resulting humanized heavy chain exhibited 93% Characteristics of CD324 Modulators homology to the human germline sequence and 88% homol ogy to the parent mouse sequence. Similarly, the humanized Various methods were used to analyze the binding char light chain exhibited 92% homology to the human germline acteristics of selected CD324 modulators generated as set sequence and 90% homology to the parent mouse sequence. forth above. Specifically, a number of these murine antibod The amino acid sequences of the humanized heavy Vari ies were characterized as to epitope recognition under reduc able region chain and the humanized kappa light chain for ing conditions, cross reactivity with regard to mouse CD324 hSC10.17 are shown in FIGS. 11A and 11B (SEQID NOS: by ForteBio and bin determination (each as per Example 7) 72 and 73), and the corresponding nucleic acid sequences 25 and the ability to kill cells using an in vitro cytotoxicity (SEQ ID NOS: 172 and 173) are set forth in FIG. 19. assay (as per Example 8). The results of each of these assays In any event the disclosed modulators were expressed and for exemplary modulators are presented in a tabular form in isolated using art recognized techniques. To that end Syn FIG. 12. thetic humanized variable DNA fragments (Integrated DNA With regard to epitope recognition the modulators were Technologies) of the heavy chain was cloned into human 30 tested to determine if they react with reduced CD324 using IgG1 expression vector. The variable light chain fragment an ELISA assay. More specifically purified, soluble. His was cloned into human C-kappa expression vector. The Tagged CD324 was reduced at 95° C. with DTT in the humanized antibody was expressed by co-transfection of the presence of SDS to denature the protein. This preparation heavy and the light chain into CHO cells. was then cooled, combined with 2.5-fold higher molar ratio More particularly, for antibody production directional 35 of iodoacetamide compared to the initial DTT concentration cloning of the murine and humanized variable gene PCR and incubated 15 minutes at 50° C. This procedure effec products into human immunoglobulin expression vectors tively blocked the free cysteine residues and allowed for was undertaken. All primers used in Ig gene-specific PCRS stability during ELISA screening where excess DTT would included restriction sites (AgeI and XhoI for IgEI, Xmal and interfere with antibody structure and binding. As seen in DraII for IgK, which allowed direct cloning into expression 40 FIG. 12 a number of the tested modulators did react with the vectors containing the human IgG1, and IGK constant reduced protein indicating that they recognized a linear regions, respectively. In brief. PCR products were purified epitope. with Qiaquick PCR purification kit (Qiagen, Inc.) followed Besides the aforementioned assays the humanized con by digestion with AgeI and XhoI (IgEI), Xmal and DraIII struct hSC10.17 was analyzed to determine its binding (IgK), respectively. Digested PCR products were purified 45 characteristics. Moreover, humanized antibody binding was prior to ligation into expression vectors. Ligation reactions directly compared with the parent murine antibody to iden were performed in a total volume of 10 uI, with 200 U tify any subtle changes in rate constants brought about by the T4-DNA Ligase (New England Biolabs), 7.5 uL of digested humanization process. and purified gene-specific PCR product and 25 ng linearized More specifically, the affinity of murine SC10. 17 was vector DNA. Competent E. coli DH10B bacteria (Life 50 measured by a Biacore using Surface plasmon resonance Technologies) were transformed via heat shock at 42° C. (SPR) to provide the results set forth in FIG. 13. Based on with 3 uI ligation product and plated onto amplicillin plates a concentration series of 25, 12.5, and 6.25 nM (generating (100 g/mL) The Agel-EcoRI fragment of the VH region the curves from top to bottom in FIG. 13) and using a 1:1 was than inserted into the same sites of p E6.4HulgG1 Langmuir binding model, the K of the SC10.17 antibody expression vector while the synthetic Xmal-DraIII VKinsert 55 binding to human CD324 antigen was estimated to be 2.0 was cloned into the Xmal-DraIII sites of -the respective nM. Similar experiments then run with the humanized pEE 12.4Hu-Kappa expression vector. hSC10.17 antibody with a Kd estimated to be 3.8 nM. Such Cells producing humanized antibody were generated by results indicated that the humanization process had not transfection of HEK 293 cells with the appropriate plasmids materially impacted the affinity of the modulator. using 293fectin. In this respect plasmid DNA was purified 60 with QIAprep Spin columns (Qiagen Inc.). Human embry Example 7 onic kidney (HEK) 293T (ATCC No CRL-11268) cells were cultured in 150 mm plates (Falcon, Becton Dickinson) under hCD324 Modulator Cross-Reactivity and Bin standard conditions in Dulbecco's Modified Eagle's Determination Medium (DMEM) supplemented with 10% heat inactivated 65 FCS, 100 ug/mL streptomycin, 100 U/mL penicillin G (all In light of the fact that the extracellular domains of human from Life Technologies). and mouse CD324 proteins share 82% sequence identity, the US 9,534,058 B2 93 94 disclosed modulators to human CD324 were tested to see if benefit for patients with solid tumors through reduced tox they associated with the mouse homolog. More specifically, icity and improved efficacy. To determine whether the dis a direct ELISA was used to determine the level of cross closed CD324 modulators are able to mediate the delivery of reactivity of hCD324-specific monoclonal antibodies with a cytotoxic agent to live cells, an in vitro cell killing assay its mouse homolog. In addition selected modulators were was performed wherein anti-mouse IgG Fab fragment cova examined through competitive binding to define associated bins as previously discussed. lently linked to saporin was combined with unlabeled To test cross-reactivity a high protein binding 96-well CD324 antibodies, and the ability of these saporin com assay plate was coated with 0.5 g/ml of a mouse CD324 plexes to internalize and kill cells was measured 5 days later purchased from Sino Biologics. The protein coating of the by measuring cell viability. plate occurred in 100 ul volume per well using a 50 mM 10 Specifically 500 cells/well of MCF7 cells, a breast cancer Sodium Carbonate buffer (pH9.6) during a 16 hour incuba cell line purchased from ATCC which endogenously express tion at 4°C. After washing the coated plate in PBS buffer CD324, were plated into 96 well tissue culture plates in their containing 0.05% Tween20 (PBST) the plate was then ATCC recommended culture media one day before the clocked washed with PBST and 100 uL/well PBSA contain addition of antibodies and toxin. Purified (naked) murine ing 10% spent hybridoma Supernatant or 1 ug/ml purified 15 CD324 modulator at 100 pM and 10 pM and a fixed monoclonal antibody (as positive control) was added to the concentration of 2 nM anti-mouse IgG Fab fragment cova plate for the duration of 1 hour at ambient temperature. After lently linked to saporin (Advanced Targeting Systems, HIT washing the plate with PBST, 100 uL per well of PBSA 48) were added to the cultures for 5 days. Viable cell containing a 1:10,000 dilution of goat anti-mouse IgG numbers were enumerated using CelTiter GloR (Promega polyclonal antibody, specific for the Fc portion of Mouse Corp.) as per manufacturers instructions. Raw lumines IgG and conjugated to horseradish peroxidase (Jackson cence counts using cultures containing cells with the saporin Immuno Research), was added to the plate for 30 minutes at Fab fragment were set as 100% reference values and all ambient temperature. After washing the plate extensively other counts calculated accordingly (referred to as “Normal with PBST, 100 uL per well TMB substrate (Thermo Fisher) ized RLU). Using this assay it was demonstrated that was added to the wells for 15 minutes. The enzymatic 25 reaction was stopped by adding 100 uL/well 2M sulfuric anti-CD324 antibodies, but not isotype control antibodies, acid. The absorbance of this colorimetric assay was mea are able to kill CD324 expressing cells (FIG. 14A with sured at 450 nm using a Victor plate reader (Perkin Elmer). corresponding tabular data in FIG. 14B and FIG. 12). In this assay a signal above background was indicative of In addition to the aforementioned assay, a Subset of cross-reactivity. CD324 antibodies, selected to represent modulators with FIG. 12 shows that, while the majority of tested modu 30 varying affinity, mouse-cross reactivity and differing cyto lators did not react with the murine ortholog, monoclonal toxic activity in this screen were tested to more accurately antibodies SC10.60 and SC 10.178 recognize both human determine their ability to kill cells in vitro. Using the same and mouse CD324 in this assay. general techniques set forth immediately above dilution As to antibody binning, a ForteBio RED was used per assays were performed provide killing curves and to deter manufacturers instructions to identify competing antibodies 35 mine EC50 values for the selected modulators (FIG. 14C that bound to the same or different bins. Briefly, a reference with corresponding tabular data in FIG. 14D). These data antibody (Ab1) was captured onto an anti-mouse capture further demonstrate that the exemplary antibodies described chip, a high concentration of non-binding antibody was then above are specific to CD324, are able to bind CD324 antigen used to block the chip and a baseline was collected. Mono on the cell surface, and thereby mediate the delivery of a meric, recombinant human hCD324-His was then captured 40 cytotoxic payload that results in cell death. by the specific antibody (Ab1) and the tip was dipped into a well with either the same antibody (Ab1) as a control or Example 9 into a well with a different test antibody (Ab2). If additional binding was observed with a new antibody, then Ab1 and CD324 Effectors can Mediate Cytotoxicity in Lung, Ab2 were determined to be in a different bin. If no further 45 Ovarian, Colon, Kidney, Liver and Pancreatic binding occurred, as determined by comparing binding Tumor Cells levels with the control Ab1, then Ab2 was determined to be in the same bin. As known in the art this process can be To corroborate the results of Example 8 and determine expanded to screenlarge libraries of unique antibodies using whether CD324 modulators can mediate toxin internaliza a full row of antibodies representing unique bins in a 96-well 50 tion and cell killing of primary human tumor cells, mouse plate. In the instant case this binning process showed the lineage-depleted NTX cells (i.e. human tumor cells propa screened antibodies bound to at least five different and gated as low-passage Xenografts in immunocompromised distinct bins (designated as bins A though E in FIG. 12) on mice) were plated and subsequently exposed to anti-CD324 the CD324 protein. In addition selected antibodies were antibodies and FAB saporin. Specifically, NTX tumors were found not to be in bins A-E but rather bound to other 55 dissociated into a single cell Suspension and plated on epitopes and were not cross-competitive with each other. PrimariaTM plates (BD Biosciences) in growth factor supple Such modulators were placed in an undefined bin (bin U) as mented serum free media as is known in the art. After 3-5 seen in FIG. 12. N.D. in FIG. 12 indicates that bins for the days of culture at 37° C./5% CO2/5% O2, cells were designated modulators were not determined. contacted with a control (IgG2b) or a murine CD324 modu 60 lator and Fab saporin as described in Example 8. Modulator Example 8 mediated saporin cytotoxicity was then assessed by quanti fying the remaining number of cells using CelTiter Glo 5-7 CD324 Modulators Facilitate Delivery of Cytotoxic days later. Agents As seen in FIG. 15, exposure to almost all of the CD324 65 modulators resulted in reduced cell numbers for each of the Targeting of a cytotoxic drug stably linked to an antibody six different tumor cell lines (including kidney, colorectal, represents an approach that might have great therapeutic lung, ovarian, pancreatic and liver), whereas the IgG2b US 9,534,058 B2 95 96 isotype control antibody did not impact the number of live introduction of a cytotoxic payload in accordance with the cells after treatment. Not only does this data demonstrate teachings herein. In this respect MCF7 cells expressing that exemplary antibodies described herein are specific to CD324 were exposed to different concentrations of the CD324, are able to bind CD324 antigen on the cell surface selected modulators and saporin linked to an anti-human Fab and facilitate the delivery of a cytotoxic payload resulting in 5 (Fab-ZAP human, Advanced Targeting Systems). Following cell death, but the above data also demonstrated that mul incubation the cells were washed and directed saporin tiple anti-CD324 antibodies can mediate killing of multiple cytotoxicity was then assessed by quantifying the remaining NTX tumor cells. number of cells using CellTiter Glo as per the manufactur er's instructions 5-7 days later. The results were normalized Example 10 10 to untreated cells and are graphically presented in FIG. 17. Examination of the curves set forth in FIG. 17 shows that CD324 Modulators Can Block CD324 Mediated the humanized CD324 modulator, hSC10.17, kills CD324 Homotypic Binding expressing cells with an EC50 of 4.4 pM. This apparent EC50 is in good agreement with that measured for the As previously discussed CD324 protein is known to bind 15 murine anti-CD324 modulator SC 10.17, which showed an other CD324 proteins, otherwise known as homotypic bind EC50 of 1.2 pM, indicating that the humanization process ing, in a calcium dependent manner. CD324 present on has not materially impacted the functional activity of the normal tissues may be sequestered in tight junctions where SC10.17 modulator. homotypic binding domains are inaccessible. In tumors, CD324 is often disregulated and these homotypic-binding Example 12 domains may now be accessible to modulators. Using anti bodies (e.g., antagonistic or neutralizing modulators) that CD324 Modulators Inhibit Tumorigenic Cells In disrupt this function may target cancer cells with disregu Vivo lated CD324 while sparing the normal cells where the binding domain is masked. 25 To determine the impact of CD324 modulators on tumor To determine if the disclosed CD324 modulators can growth, immunocompromised mice implanted with pancre block homotypic binding, MCF7 cells endogenously atic NTX tumor cells grew xenograft tumors and were expressing CD324 were added to a plate coated with recom subsequently treated with SC 10.17. Briefly, in independent binant CD324 protein, and the ability of CD324 modulators studies, immunocompromised mice were injected with to block the homotypic interactions between the recombi 30 50,000 cells of pancreatic non-traditional patient-derived nant protein and the cells assessed. Specifically, a high xenograft tumor lines known to express CD324 (refer to binding 96 well plate was coated 1.5 lug/ml of recombinant previous example). Mice were randomized at 180-200 mm3, CD324-Fc (RnD Systems) in PBS overnight. The following and treated twice weekly with a dose of 10 mg/kg antibody day, the plate was incubated in assay buffer (PBS with 2% (n=5 mice/group). Tumor weights were measured at least bovine serum albumin and 2 mM calcium chloride) and 35 one per week. subsequently incubated with or without CD324 modulators As evidenced by FIGS. 18A and 18B pancreatic tumor in assay buffer for 30 minutes. Simultaneously, MCF7 cells growth in two discrete NTX cell lines was inhibited by an were harvested and resuspended in assay buffer with or unconjugated murine CD324 modulator of the instant inven without CD324 modulators for 30 minutes. Finally the tion. More particularly SC 10.17 (empty circles) substan coated plate was washed and the MCF7 cell/modulator 40 tially eliminated any tumor growth when compared to a solution is added to the plate and incubated for 2 hours. To control IgG1 (filled triangles) in either tumor cell line PA14 measure the ability of MCF7 cells to bind to the plate, the (FIG. 18A) or PA3 (FIG. 18B). In conjunction with the plate was washed three times and then remaining cell count teachings of the instant application these data Suggest that was measured using CelTiter Glo as per manufacturers the disclosed CD324 modulators can effectively inhibit the instructions. 45 growth of tumors expressing CD324 and that such inhibition As seen in FIG. 16 SC10.9 and SC 10.17, but not SC10.22 is sustained for greater than three weeks after initial treat or IgG2a, block homotypic binding. These data demonstrate ment. that SC10.17 and SC10.9 specifically inhibit CD324 homo typic binding and may be used to selectively target tumori Example 13 genic cells expressing disregulated CD324. 50 Fabrication of Bispecific Antibodies Comprising Example 11 Antigen Binding Sites Specific for CD324 and Nectin-4 Humanized CD324 Modulators Facilitate Delivery of Cytotoxic Agents 55 In order to improve the ability of the disclosed modulators to kill tumorigenic cells bispecific constructs were generated As preferred embodiments of the present invention will comprising antigen binding sites for CD324 and Nectin-4. It likely employ humanized CD324 modulators in a therapeu will be appreciated that such bispecific antibody constructs tic setting, work was performed to demonstrate that human may be particularly useful in patients with moderate serum ized anti-CD324 antibodies (fabricated as set forth in 60 concentrations of soluble CD324. Moreover, in accordance Example 5) function as effective mediators of cell killing with the teachings herein Such constructs may be used in a through delivery of cytotoxic agents. conjugated or unconjugated State. Generally, using the saporin assay as set forth for the Variable regions were used from anti-CD324 antibody murine anti-CD324 antibodies in Example 8, a humanized hSC10.17 (see FIGS. 11 and 19 for amino acid and nucleic construct was tested to demonstrate the ability of humanized 65 acid sequences, respectively) and anti-Nectin-4 antibody modulators to selectively eliminate CD324 positive cells. Ha22-2(2.4)6.1 (as set forth in U.S.P.N. 2012/0078028 More particularly, hSC10. 17 was employed to mediate the which is incorporated herein by reference). Several IgG-like US 9,534,058 B2 97 98 anti-CD324/Nectin-4 bispecific antibody variants were con CD324 and Nectin-4 and; (ii) an in vitro killing assay to structed with human constant regions using the human IgG1 demonstrate the ability of the bispecific antibodies to inter and a kappa light chain (Table 1). Mutations to the constant nalize and mediate the delivery of a cytotoxin to live cells. The bridging ELISA assay was performed by coating regions of each of the variants were introduced for the Nectin-4 protein (R&D Systems) onto an ELISA plate, purpose of either: (i) preferentially pairing heavy chains of 5 which was then blocked with PBS+0.1% Tween and 3% different specificity in heteromeric rather than homomeric BSA. The plate was incubated with either anti-CD324/ fashion (asymmetric heavy chain pairing) or (ii) preferen Nectin-4 bispecific antibody; monospecific anti-Nectin-4 tially pairing each heavy chain with the corresponding light Ha22-2(2.4)6.1 antibody; or monospecific anti-CD324 chain (heavy chain/light chain pairing). Mutations were hSC10.17 antibody. After three washes with PBS+0.1% incorporated on the human IgG1 constant region using the 10 Tween, the plate was incubated with biotinylated CD324 Quikchange mutagenesis kit according to the manufactur W2A followed by three additional washes and incubation er's instructions (Agilent Technologies). pl.E6.4HugG1 with horseradish peroxidase conjugated Streptavidin. After and pEE 12.4Hu-kappa expression vectors (Lonza AG) were three washes, the plates were developed using the 1-step Turbo TMB reagent (Pierce), and quenched with 2 M used for transient transfection of the bispecific antibodies. 15 The bispecific antibodies were generated in transient sulfuric acid. ELISA analysis indicated that all four bispe transfections using art-recognized techniques of Suspension cific constructs, shown in Table 1 above, were capable of bridging Nectin-4 and CD324, whereas each of the mono or adherent cultures of HEK-293T cells, or suspension specific antibodies individually was not. These results con CHO-S cells. Polyethylenimine polymer was used as the firm that all the tested bisepecific constructs were assembled transfecting reagent, and equal mass ratios of four expres correctly and exhibited specificity to both Nectin-4 and sion vectors for each of the two heavy chains and two light CD324. chains were used for co-transfections. Seven to ten days Table 2 immediately below shows the results of an in vitro after transfection, the bispecific antibodies were purified killing assay performed using three cell lines: MCF-7, which from clarified cell-supernatants using MabSelect SuReTM express both Nectin-4 and CD324; SKBR3, which express Protein A (GE Healthcare Life Sciences). 25 Nectin-4 only and 293-hCD324, an engineered 293T cell line that overexpress CD324 and is negative in Nectin-4 TABLE 1. expression The 293-hCD324 cell line was made by trans Anti-CD324/Nectin-4 Bispecific Antibody Variants duction of 293T cells using a bicistronic lentiviral vector expressing both human CD324 and GFP, and expansion of Mutations for Mutations for 30 the CD324" FACS-sorted subset. 500 cells/well of MCF-7, Variable Asymmetric Heavy Chain Region Heavy Light Chain SKBR3, or 293-hCD324 in DMEM supplemented with 10% Construct Chain Specificity Chain Pairing Pairing. fetal bovine serum were plated into 96 well tissue culture treated plates. After incubation for 24 hours, 2 nM Anti hSC10.17/N4 Heavy 1 CD324 T366W S3S4C. Crosslab Human IgG Fab fragment covalently linked to saporin KiH-CM CH1-CLi 35 Heavy 2 Nectin 4 T366S, L368A, (Advanced Targeting Systems, #IT-48) was combined with Y407A, Y349C8 unlabeled anti-CD324/Nectin-4 bispecific antibodies or anti Light 1 CD324 Crossmab CD324 or anti-Nectin-4 monospecific antibodies at concen CH1-CLi trations varying between 0.01 pM and 1000 pM. The Fab Light 2 Nectin 4 saporin-antibody complexes were added to the cells. The hSC10.17N4 Heav 1 CD324 K392D Crossmab 40 Elec-CM K409Dii CH1-CLi ability of the complexes to internalize and kill the cells was Heavy 2 Nectin 4 D356K measured after 96, 72 or 144 hours by measuring cell D399Kii Light 1 CD324 Crossmab viability of MCF-7, 293-hCD324 or SKBR3 cells, respec CH1-CLi tively, using Cell Titer Glo(R) (Promega) as per manufactur Light 2 Nectin 4 er's instructions. Raw luminescence counts using cultures hSC10.17/N4 Heavy 1 CD324 T366W S354C* S188D, 192D 45 containing cells exposed to the Fab-Saporin fragment were KiH-KK Heavy 2 Nectin 4 T366S, L368A, S188K, 192K set as 100% reference values and all other counts calculated Y407A, Y349C8 Light 1 CD324 S176K, 137K accordingly (referred to as “Normalized RLU). Light 2 Nectin 4 S176D, 137D hSC10.17/N4 Heavy 1 CD324 T366W S354C* S188D, T192D TABLE 2 KiH-KR Heavy 2 Nectin 4 T366S, L368A, S188K, T192K 50 Y407A, Y349C8 Anti-CD324/Nectin-4 Bispecific Antibody in vitro Efficacy Light 1 CD324 S176K, N137R Light 2 Nectin 4 S176D, N137D ICSO on ICSO on ICSO on MCF-7 SKBR3 293-CD324 *Merchant A, et al. An efficient route to human bispecific IgG, Nat Biotechnol 16:677-681 Modulator (PM) (PM) (PM) SSR, W., et al. Immunoglobulin domain crossover as a generic approach for the 55 production of bispecific IgG antibodies. Proci Nati AcadSci USA. 108(27): 11187-11192 Ha22-2(2,4)6.1 IgG 9.94 O.95 >1000 (2011). hSC10.17 IgG 3.10 >1000 0.27 Gunasekaran K, et al. Enhancing antibody Fc heterodimer formation through electro static steering effects. J Biol Chem. 285(25): 19637-19646 (2010). SC10.17 N4 KH-CM 3.09 17.45 3.79 hSC10.17N4 Elec-CM 2.77 10.39 5.14 hSC10.17N4 KiH-KK S.98 144.1 12.25 Example 14 60 hSC10.17N4 KiH-KR S.21 77.8 S.66 Human IgG1 >1000 >1000 >1000 Characterization of Anti-CD324/Nectin-4 Bispecific Antibodies The results demonstrated that anti-CD324/Nectin-4 bispe cific antibodies were equally or more effective at delivering The bispecific antibodies generated in Example 13 were 65 toxin as monospecific anti-CD324 or anti-Nectin-4 antibod characterized using (i) a bridging ELISA assay to confirm ies in the CD324"Nectin-4" cell line, MCF-7. The results that the antibodies were able to bind specifically to both also demonstrated that anti-CD324/Nectin-4 bispecific anti US 9,534,058 B2 99 100 bodies were able to deliver toxin in both the CD324Nectin (including, for example, nucleotide sequence Submissions 4" cell line, SKBR3, and the CD324'Nectin-4T cell line, in, e.g., GenBank and RefSeq, and amino acid sequence 293-hCD324, but were less effective at delivering toxin than submissions in, e.g., SwissProt, PIR, PRF, PBD, and trans either monospecific anti-Nectin-4 or anti-CD324 antibodies, respectively. These data support the finding that the bispe lations from annotated coding regions in GenBank and cific antibodies generated in Example 13 were able to 5 RefSeq cited herein are incorporated by reference. The internalize and kill cells in vitro, with increased specificity foregoing detailed description and examples have been to cell lines expressing both antigens, and with decreased given for clarity of understanding only. No unnecessary off-target toxicity on single positive cells compared to limitations are to be understood therefrom. The invention is monospecific antibodies. not limited to the exact details shown and described, for The complete disclosure of all patents, patent applica- variations obvious to one skilled in the art will be included tions, and publications, and electronically available material within the invention defined by the claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 173

<21 Os SEQ ID NO 1 &211s LENGTH: 4815 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs SEQUENCE: 1 agtggcgt.cg galactgcaaa gCacctgttga gCttgcggala gt cagttcag actic cagc cc 60 gct coagc.cc ggc.ccgaccc gaccgcaccc gg.cgc.ctgcc ct cqct cqgc gtc.ccc.ggcc 12O

agc catgggc ccttggagcc gcagcct Ct c gg.cgctgctg. Ctgctgctgc aggt ct cotc 18O ttggctctgc caggagc.cgg agcc.ctgc.ca cc ctggctitt gacgcc.gaga gctacacgtt 24 O

cacggtgc.cc cqgcgccacc tigagagagg cc.gc.gtcCtg ggcagagtga attittgaaga 3 OO ttgcaccggit Cacalaagga Cagcc tattt tt CCCtcgac accCgattica aagtgggcac 360

agatggtgtg attacagtica aaaggcct ct acggittt cat aacccacaga to catttctt 42O ggit citacgcc tdggacticca cc tacagaaa gttitt.ccacc aaagt cacgc tigaatacagt 48O

ggggcaccac caccgc.cccC cqc.cc catca ggcct cogtt totggaatcc aagcagaatt 54 O

gct cacattt cocaact colt ct cotggcct cagaaga cag aagagagact gggittatt co 6 OO toccatcagc tigcc.cagaaa atgaaaaagg cc cattt colt aaaaacct gg tt cagat caa 660 atcCaacaaa gacaaagaag gCaaggttitt ct acagcatc actggccaag gagctgacac 72O acc cc ctgtt ggtgtctitta ttattgaaag agaalacagga tiggctgaagg tacagagcc 78O

totggataga gaacgcattg ccacatacac totc.ttct ct cacgctgttgt catccaacgg 84 O

gaatgcagtt gaggat.ccaa tigagattitt gatcacggta accgat caga atgacaacaa 9 OO gcc.cgaattic acccaggagg totttaaggg gtctgtcatg galaggtgct C titcCaggaac 96.O

Ctctgtgatg gaggt cacag ccacagacgc ggacgatgat gtgaac acct acaatgcc.gc O2O

catcgcttac accatcct ca gccaagatcc tdagctic cct gacaaaaata tott caccat O8O taacaggaac acaggagt catcagtgtggit caccactggg ctggaccgag agagttt CCC 14 O

tacgitat acc ctggtggttcaa.gctgctga CCttcaaggit gaggggittaa gCacaa.ca.gc 2 OO

aacagotgtg at cacagtica citgacaccala cqataatcct cogatct tca at cocaccac 26 O

gtaca agggit caggtgcct g agaacgaggc talacgt.cgta at Caccacac taaagtgac 32O

tgatgctgat gcc.cccalata ccc.ca.gc.gtg ggaggctgta tacaccatat taatgatga 38O

tggtggacaa tttgtcgt.ca ccacaaatcc agtgaacaac gatggcattt taaaa.ca.gc 4 4 O

aaagggcttggattittgagg ccaag cagca gtacattct a cacgtagcag tacgaatgt 5 OO

gg tacct titt gaggit ct ct c to accacct c cacagocacc git caccgtgg atgtgctgga 560

tgtgaatgaa gocccCatct ttgttgcct cc taaaagaga gtggaagtgt cc gaggactt 62O

US 9,534,058 B2 103 104 - Continued tt catctic ct gag tatgtaa Cttgcaatgg gcagotaticc agtgacttgt tctgagtaag tgttgttcatt aatgtttatt tagct ctdaa gcaa.gagtga tat actic cag gacittagaat agtgcctaaa gtgctgcagc caaagacaga gcggalactat gaaaagttggg Cttggagatg 414 O gCaggaga.gc ttgtcattga gcctgcaat ttagcaaact gatgctgagg atgattgagg 42OO tgggtctacc t catct ctoga aaattctgga aggaatggag gag to tcaac atgtgtttct 426 O gacacaagat tactcaaag.c ccagaatccc Caagtgcctg cittittgatga 432O tgtctacaga aaatgctggc tgagctgaac acatttgcc.c aattic caggit gtgcacagaa 438 O alacc.gagaat att Caaaatt CCalaatttitt ttcttaggag Caagaagaaa atgtggc cct 4 44 O aaagggggtt agttgagggg taggggg tag tgaggat Ctt gatttggat C to t t t t tatt 4500 taaatgtgaa titt caact tt tgacaatcaa agaaaagact tttgttgaaa tagctt tact 456 O gtttct caag tgttittggag aaaaaaat Ca accctgcaat cactttittgg aattgtc.ttg atttitt cqgc agttcaagct at atcgaata tagttctgtg tagagaatgt cactgtagtt 468O ttgagtgt at acatgtgtgg gtgctgataa ttgtg tattt t ctittggggg tggaaaagga 474. O aaacaatt Ca agctgagaaa agtatt ct ca aagatgcatt tittatalaatt ttattaaa.ca 48OO attttgttaa acCat 4815

<210s, SEQ ID NO 2 &211s LENGTH: 882 212. TYPE : PRT <213> ORGANISM: Homo sapiens < 4 OO SEQUENCE: 2

Met Gly Pro Trp Ser Arg Ser Lieu. Ser Ala Luell Lieu. Lieu. Lieu. Lieu. Glin 1. 5 15

Wall Ser Ser Trp Lieu. Cys Glin Glu Pro Glu Pro Cys His Pro Gly Phe 25

Asp Ala Glu Ser Thir Phe Thir Wall Pro Arg Arg His Luell Glu Arg 35 4 O 45

Gly Arg Wall Luell Gly Arg Wall Asn Phe Glu Asp Cys Thir Gly Arg Glin SO 55 6 O

Arg Thir Ala Phe Ser Lell Asp Thir Arg Phe Wall Gly Thir Asp 65 70

Gly Wall Ile Thir Wall Lys Arg Pro Luell Arg Phe His Asn Pro Glin Ile 85 90 95

His Phe Luell Wall Ala Trp Asp Ser Thir Tyr Phe Ser Thir 1OO 105 11 O

Wall Thir Luell Asn Thir Wall Gly His His His Arg Pro Pro Pro His 115 12 O 125

Glin Ala Ser Wall Ser Gly Ile Glin Ala Glu Luell Lell Thir Phe Pro Asn 13 O 135 14 O

Ser Ser Pro Gly Lell Arg Arg Glin Arg Asp Trp Wall Ile Pro Pro 145 150 155 160

Ile Ser Pro Glu Asn Glu Gly Pro Phe Pro Asn Luell Wall 1.65 17O 17s

Glin Ile Ser Asn Asp Glu Gly Lys Wall Phe Tyr Ser Ile 18O 185 19 O

Thir Gly Glin Gly Ala Asp Thir Pro Pro Wall Gly Wall Phe Ile Ile Glu 195 2OO 2O5

Arg Glu Thir Gly Trp Lell Lys Wall Thir Glu Pro Lell Asp Arg Glu Arg 21 O 215 22O US 9,534,058 B2 105 106 - Continued

Ile Ala Thir Thir Lell Phe Ser His Ala Wall Ser Ser Asn Gly Asn 225 23 O 235 24 O

Ala Wall Glu Asp Pro Met Glu Ile Luell Ile Thir Wall Thir Asp Glin Asn 245 250 255

Asp Asn Pro Glu Phe Thir Glin Glu Wall Phe Gly Ser Wall Met 26 O 265 27 O

Glu Gly Ala Luell Pro Gly Thir Ser Wall Met Glu Wall Thir Ala Thir Asp 28O 285

Ala Asp Asp Asp Wall Asn Thir Asn Ala Ala Ile Ala Thir Ile 29 O 295 3 OO

Lell Ser Glin Asp Pro Glu Lell Pro Asp ASn Met Phe Thir Ile Asn 3. OS 310 315

Arg Asn Thir Gly Wall Ile Ser Wall Wall Thir Thir Gly Lell Asp Arg Glu 3.25 330 335

Ser Phe Pro Thir Thir Lell Wall Wall Glin Ala Ala Asp Luell Glin Gly 34 O 345 35. O

Glu Gly Luell Ser Thir Thir Ala Thir Ala Wall Ile Thir Wall Thir Asp Thir 355 360 365

Asn Asp Asn Pro Pro Ile Phe Asn Pro Thir Thir Tyr Gly Glin Wall 37 O 375

Pro Glu Asn Glu Ala Asn Wall Wall Ile Thir Thir Lell Wall Thir Asp 385 390 395 4 OO

Ala Asp Ala Pro Asn Thir Pro Ala Trp Glu Ala Wall Thir Ile Luell 4 OS 415

Asn Asp Asp Gly Gly Glin Phe Wall Wall Thir Thir Asn Pro Wall Asn Asn 425 43 O

Asp Gly Ile Luell Thir Ala Lys Gly Luell Asp Phe Glu Ala Glin 435 44 O 445

Glin Tyr Ile Luell His Wall Ala Wall Thir Asn Wall Wall Pro Phe Glu Wall 450 45.5 460

Ser Luell Thir Thir Ser Thir Ala Thir Wall Thir Wall Asp Wall Luell Asp Wall 465 470

Asn Glu Ala Pro Ile Phe Wall Pro Pro Glu Lys Arg Wall Glu Wall Ser 485 490 495

Glu Asp Phe Gly Wall Gly Glin Glu Ile Thir Ser Thir Ala Glin Glu SOO 505

Pro Asp Thir Phe Met Glu Glin Lys Ile Thir Arg Ile Trp Arg Asp 515 525

Thir Ala Asn Trp Lell Glu Ile Asn Pro Asp Thir Gly Ala Ile Ser Thir 53 O 535 54 O

Arg Ala Glu Luell Asp Arg Glu Asp Phe Glu His Wall Asn Ser Thir 5.45 550 555 560

Thir Ala Luell Ile Ile Ala Thir Asp Asn Gly Ser Pro Wall Ala Thir 565 st O sts

Gly Thir Gly Thir Lell Lell Lell Ile Luell Ser Asp Wall Asn Asp Asn Ala 585 59 O

Pro Ile Pro Glu Pro Arg Thir Ile Phe Phe Glu Arg Asn Pro 595 6OO 605

Pro Glin Wall Ile Asn Ile Ile Asp Ala Asp Luell Pro Pro Asn Thir Ser 610 615

Pro Phe Thir Ala Glu Lell Thir His Gly Ala Ser Ala Asn Trp Thir Ile 625 630 635 64 O US 9,534,058 B2 107 108 - Continued

Glin Asn Asp Pro Thir Glin Glu Ser Ile Ile Lell Lys Pro Lys Met 645 650 655

Ala Luell Glu Wall Gly Asp Ile Asn Luell Lys Lell Met Asp Asn 660 665 67 O

Glin Asn Lys Asp Glin Wall Thir Thir Luell Glu Wall Ser Wall Asp 675 685

Glu Gly Ala Ala Gly Wall Cys Arg Ala Glin Pro Wall Glu Ala Gly 69 O. 695 7 OO

Lell Glin Ile Pro Ala Ile Lell Gly Ile Luell Gly Gly Ile Luell Ala Luell 7 Os

Lell Ile Luell Ile Lell Lell Lell Luell Luell Phe Luell Arg Arg Arg Ala Wall 72 73 O 73

Wall Glu Pro Lell Lell Pro Pro Glu Asp Asp Thir Arg Asp Asn Wall 740 74. 7 O

Tyr Asp Glu Glu Gly Gly Gly Glu Glu Asp Glin Asp Phe Asp 760 765

Lell Ser Glin Luell His Arg Gly Luell Asp Ala Arg Pro Glu Wall Thir Arg 770 775

Asn Asp Wall Ala Pro Thir Lell Met Ser Wall Pro Arg Luell Pro Arg 79 O 79.

Pro Ala Asn Pro Asp Glu Ile Gly Asn Phe Ile Asp Glu Asn Luell 805 810 815

Ala Ala Asp Thir Asp Pro Thir Ala Pro Pro Asp Ser Luell Luell Wall 825 83 O

Phe Asp Tyr Glu Gly Ser Gly Ser Glu Ala Ser Lieu Ser Ser Lieu 835 84 O 845

Asn Ser Ser Glu Ser Asp Lys Asp Glin Asp Asp Luell Asn Glu 850 855 860

Trp Gly Asn Arg Phe Lys Luell Ala Asp Met Gly Gly Gly Glu 865 87O 87s 88O Asp Asp

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO

SEQUENCE: 7 US 9,534,058 B2 109 110 - Continued

OOO

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO

SEQUENCE:

OOO

SEQ ID NO 10

SEQUENCE: 10

OOO

SEQ ID NO 11

SEQUENCE: 11

OOO

SEQ ID NO 12

SEQUENCE: 12

OOO

SEQ ID NO 13

SEQUENCE: 13

OOO

SEQ ID NO 14

SEQUENCE: 14

OOO

SEQ ID NO 15

SEQUENCE: 15

OOO

SEQ ID NO 16

SEQUENCE: 16

OOO

SEQ ID NO 17

SEQUENCE: 17

OOO

SEQ ID NO 18

SEQUENCE: 18

OOO US 9,534,058 B2 111 112 - Continued

SEQ ID NO 19

SEQUENCE: 19

OOO

SEQ ID NO 2 O LENGTH: 106 TYPE : PRT ORGANISM: Mus so. <4 OOs, SEQUENCE:

Glin Ile Wall Luell Thir Glin Ser Pro Ala Luell Met Ser Ala Ser Pro Gly 1. 5 15

Glu Lys Wall Thir Met Thir Ser Ala Ser Ser Ser Wall Arg Met 25

Trp Tyr Glin Glin Pro Arg Ser Ser Pro Pro Trp Ile His 35 4 O 45

Lell Thir Ser Asn Lell Ala Ser Gly Wall Pro Ala Arg Phe Ser Gly Ser SO 55 6 O

Gly Ser Gly Thir Ser Tyr Ser Luell Thir Ile Ser Ser Met Glu Ala Glu 65 70

Asp Ala Ala Thir Tyr Tyr Cys Glin Glin Trp Ser Ser His Pro Phe Thir 85 90 95

Phe Gly Ser Gly Thir Lell Glu Ile 1OO 105

<210s, SEQ ID NO 21 &211s LENGTH: 116 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 21

Asp Val Glin Lieu. Glin Glu Ser Gly Pro Gly Luell Wall Pro Ser Glin 1. 5 15

Ser Luell Ser Luell Thir Thir Wall Thir Gly Phe Ser Ile Thir Ser Asp 25

Ser Trp Asn Trp Ile Arg Glin Phe Pro Gly Asn Lys Luell Glu Trp 35 4 O 45

Met Gly Tyr Ile Ser Tyr Ser Gly His Thir Ser Tyr Asn Pro Ser Luell SO 55 6 O

Glu Ser Arg Ile Ser Ile Thir Asp Thir Ser Asn Glin Phe Phe 65 70 8O

Lell Glin Luell Asn Ser Wall Thir Thir Glu Asp Thir Ala Thir Tyr 85 90 95

Thir Arg Gly Asn Trp Asp Wall Wall Tyr Trp Gly Glin Gly Thir Luell Wall 1OO 105 11 O

Thir Wall Ser Ala 115

SEQ ID NO 22 LENGTH: 113 TYPE : PRT ORGANISM: Mus sp.

< 4 OOs SEQUENCE: 22 Asp Ile Val Met Ser Glin Ser Pro Ser Ser Leu Ala Val Ser Val Gly 1. 5 15 US 9,534,058 B2 113 114 - Continued

Glu Lys Val Thr Met Ser Ser Ser Glin Ser Lieu. Leu Tyr Ser 2O 25 3O

Asn Asn Gln Lys Asn Lell Ala Trp Glin Gln Lys Pro Gly Glin 35 4 O 45

Ser Pro Llys Lieu. Lieu Ile Tyr Trp Ala Ser Thir Arg Glu Ser Gly Val SO 55 6 O

Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thir Asp Phe Thr Lieu. Thr 65 70 8O

Ile Ser Ser Val Lys Ala Glu Asp Luell Ala Wall Tyr Tyr Cys His Glin 85 90 95

Tyr Tyr Thr Ser Pro Thir Phe Gly Gly Gly Thir Asn Lieu. Glu Ile 1OO 105 11 O Lys

<210s, SEQ ID NO 23 &211s LENGTH: 123 212. TYPE: PRT &213s ORGANISM: Mus so. <4 OOs, SEQUENCE: 23

Glin Val Glin Lieu Lys Glu Ser Gly Pro Gly Luell Wall Ala Pro Ser Glin 1. 5 15

Ser Lieu. Ser Ile Thr Thir Wall Ser Gly Phe Ser Lieu. Ser Arg Tyr 2O 25 3O

Ser Val Glin Trp Val Arg Glin Pro Pro Gly Gly Lieu. Glu Trp Lieu. 35 4 O 45

Gly Met Ile Trp Gly Gly Gly Ser Thir Asp Asn Ser Gly Lieu Lys SO 55 6 O

Ser Arg Lieu. Thir Ile Ser Asp Asn Ser Lys Ser Glin Wall Phe Lieu. 65 70 7s 8O

Llys Met Asn. Ser Lieu Glin Thir Asp Asp Thir Ala Met Tyr Phe Cys Ala 85 90 95

Arg Thr Glin Phe Tyr Gly His Asp Gly Gly Tyr Ala Met Asp Phe 1OO 105 11 O

Trp Gly Glin Gly Thr Ser Wall Thir Wall Ser Ser 115 12 O

<210s, SEQ ID NO 24 &211s LENGTH: 112 212. TYPE: PRT &213s ORGANISM: Mus so. <4 OOs, SEQUENCE: 24

Asp Val Lieu Met Thr Glin Thir Pro Luell Ser Luell Pro Val Ser Leu Gly 1. 5 1O 15

Asp Glin Ala Ser Ile Ser Arg Ser Ser Glin Ser Ile Wal His Ser 2O 25 3O

Asp Gly Asn Thr Tyr Lell Glu Trp Luell Arg Llys Pro Gly Glin Ser 35 4 O 45

Pro Arg Lieu. Lieu. Ile Lys Wall Ser Asn Arg Phe Ser Gly Val Pro SO 55 6 O

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thir Asp Phe Thr Lieu Lys Ile 65 70 8O

Ser Arg Val Glu Ala Glu Asp Luell Gly Wall Tyr Tyr Cys Phe Glin Gly 85 90 95 US 9,534,058 B2 115 116 - Continued Ser His Ala Pro Trp Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Ile Llys 1OO 105 11 O

<210s, SEQ ID NO 25 &211s LENGTH: 120 212. TYPE: PRT <213> ORGANISM: Mus sp. <4 OOs, SEQUENCE: 25 Asp Val Glin Lieu Val Glu Ser Gly Gly Gly Lieu Val Glin Pro Gly Gly 1. 5 1O 15 Ser Arg Llys Lieu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 2O 25 3O Gly Met His Trp Val Arg Glin Ala Pro Glu Thr Gly Lieu. Glu Trp Val 35 4 O 45 Ala Tyr Ile Thr Thr Arg Ser Ser Thr Ile Tyr Tyr Ala Ala Thr Val SO 55 6 O Lys Gly Arg Phe Thir Ile Ser Arg Asp Asn Ala Arg Asn. Thir Lieu. Phe 65 70 7s 8O Lieu Gln Met Thr Ser Lieu. Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Thr Arg Glu Pro Lieu. Thr Gly Tyr Tyr Ala Met Asp Tyr Trp Gly Glin 1OO 105 11 O Gly. Thir Ser Val Thr Val Ser Ser 115 12 O

<210 SEQ ID NO 26 &211s LENGTH: 113 212. TYPE: PRT <213> ORGANISM: Mus sp. <4 OOs, SEQUENCE: 26 Asp Ile Val Met Ser Glin Ser Pro Ser Ser Lieu. Thr Val Ser Val Gly 1. 5 1O 15 Glu Lys Gly Thr Met Ser Cys Llys Ser Ser Glin Ser Lieu. Leu Tyr Ser 2O 25 3O Ser Asn Gln Lys Asn Tyr Lieu Ala Trp Tyr Glin Glin Llys Pro Gly Glin 35 4 O 45 Ser Pro Llys Lieu. Lieu. Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val SO 55 6 O Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Ser Lieu. Thr 65 70 7s 8O Ile Ser Ser Val Lieu Ala Glu Asp Lieu Ala Val Tyr Phe Cys His Glin 85 90 95 Tyr Tyr Ser Ser Pro Tyr Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Ile 1OO 105 11 O Lys

<210s, SEQ ID NO 27 &211s LENGTH: 123 212. TYPE: PRT <213> ORGANISM: Mus sp.

<4 OOs, SEQUENCE: 27 Glin Val Glin Lieu Lys Glu Ser Gly Pro Gly Lieu Val Ala Pro Ser Glin 1. 5 1O 15

Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Arg Tyr 2O 25 3O US 9,534,058 B2 117 118 - Continued

Ser Val His Trp Val Arg Glin Pro Pro Gly Gly Lieu. Glu Trp Lieu. 35 4 O 45

Gly Met Ile Trp Gly Gly Gly Ser Ile Asp Asn Ser Gly Lieu Lys SO 55 6 O

Ser Arg Lieu. Ser Ile Ser Asp Asn Ser Lys Ser Glin Wall Phe Lieu. 65 70 7s 8O

Llys Met Asn. Ser Lieu Glin Ser Asp Asp Thir Ala Met Tyr His Cys Val 85 90 95 Arg Ala Glin Phe Tyr Gly Asp Gly Gly Tyr Ala Met Asp Tyr 1OO 105 11 O

Trp Gly Glin Gly Thr Ser Wall Thir Wall Ser Ser 115 12 O

<210s, SEQ ID NO 28 &211s LENGTH: 108 212. TYPE: PRT &213s ORGANISM: Mus so. <4 OOs, SEQUENCE: 28

Glin Ile Wall Lieu. Thir Glin Ser Pro Ala Ile Met Ser Ala Ser Pro Gly 1. 5 15

Glu Arg Val Thir Lieu. Thir Ser Ala Ser Ser Ser Wal Ser Ser Ser 2O 25 3O

Phe Leu Tyr Trp Tyr Glin Glin Lys Ser Gly Ser Ser Pro Llys Lieu. Trp 35 4 O 45

Ile Tyr Ser Thr Ser Thr Lieu Ala Ser Gly Wall Pro Ala Arg Phe Ser SO 55 6 O

Gly Ser Gly Ser Gly Thir Ser Ser Luell Thir Ile Ser Ser Met Glu 65 70 8O

Ala Glu Asp Ala Ala Ser Phe His Glin Trp Ser Ser Tyr Pro 85 90 95

Trp. Thir Phe Gly Gly Gly Thir Luell Glu Ile 1OO 105

<210s, SEQ ID NO 29 &211s LENGTH: 118 212. TYPE: PRT &213s ORGANISM: Mus so. <4 OOs, SEQUENCE: 29

Ser Asp Val Glin Lieu Glin Glu Ser Gly Pro Gly Lieu Val Llys Pro Ser 1. 5 1O 15

Glin Ser Lieu. Ser Lieu Thir Thir Wall Thir Asp Tyr Ser Ile Thr Ser 2O 25 3O

Asp Tyr Ala Trp Asn Trp Ile Arg Glin Phe Pro Gly Asn. Asn Lieu. Glu 35 4 O 45

Trp Met Gly Asn Ile Gly Tyr Ser Gly Asp Thir Ser Tyr Asn Pro Ser 55 6 O

Lieu Lys Ser Arg Ile Ser Ile Thir Arg Asp Thir Ser Lys Asn Glin Phe 65 70 7s 8O

Phe Lieu. Glin Lieu. Asn Ser Wall Thir Thir Glu Asp Ser Ala Thr Tyr Tyr 85 90 95

Cys Ala Arg Ser Ser Lell Gly Pro Phe Asp Trp Gly Glin Gly Thr 1OO 105 11 O

Ala Lieu. Thir Wal Ser Ser 115 US 9,534,058 B2 119 120 - Continued

<210s, SEQ ID NO 3 O &211s LENGTH: 113 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 3 O

Asp Ile Wall Met Thir Glin Ser Pro Ser Ser Luell Ala Met Ser Wall Gly 1. 5 1O 15

Glin Lys Wall Thir Met Ser Cys Llys Ser Ser Glin Ser Lell Luell Asn Ser 2O 25

Ser Thir Glin Asn Tyr Lieu Ala Trp Glin Glin Lys Pro Gly Glin 35 4 O 45

Ser Pro Luell Lell Ile Tyr Phe Ala Ser Thir Arg Gly Ser Gly Wall SO 55 6 O

Pro Asp Arg Phe Ile Gly Ser Gly Ser Gly Thir Asp Phe Thir Luell Thir 65 70

Ile Ser Ser Wall Glin Thr Glu Asp Luell Ala Asp Phe Glin Glin 85 90 95

His Ser Ile Pro Cys Thr Phe Gly Gly Gly Thir Luell Glu Ile 1OO 105 11 O Lys

SEQ ID NO 31 LENGTH: 118 TYPE : PRT ORGANISM; Mus Sp.

< 4 OOs SEQUENCE: 31

Glin Wall Glin Lieu Glin Gln Ser Gly Asn Glu Luell Wall Arg Pro Gly Ser 1. 5 1O 15

Ala Wall Lys Ile Ser Cys Lys Ala Ser Gly Ala Phe Ser Ser 2O 25

Trp Met Asn Trp Wall Lys Glin Arg Pro Gly Glin Gly Lell Glu Trp Ile 35 4 O 45

Gly Glin Ile Pro Gly Asp Asp Asp Ser ASn Tyr Asn Gly Phe SO 55 6 O

Lys Gly Ala Thir Lieu. Thir Ala Asp Ser Ser Ser Ser Ala Tyr 65 70

Met His Luell Ser Ser Lieu. Thir Ser Glu Asp Ser Ala Wall Phe 85 90 95

Ala Arg Gly Phe Ala Thir Pro Thr Met Asp Trp Gly Glin Gly Thir 105 11 O

Ser Wall Thir Wall Ser Ser 115

SEQ ID NO 32 LENGTH: 103 TYPE : PRT ORGANISM: Mus so.

< 4 OOs SEQUENCE: 32

Asp Ile Gln Met Asn Glin Ser Pro Ser Ser Lieu. Ser Ala Ser Lieu. Gly 1. 5 15

Asp Thir Ile Thr Ile Thr Cys His Wall Ser Glin Asn. Ile Asn Val Trip 25

Lieu. Thir Trp Tyr Glin Gln Lys Pro Gly Asn. Ile Pro Llys Luell Luell Luell US 9,534,058 B2 121 122 - Continued

35 4 O 45

Tyr Lys Ala Ser Asn Lell Glin Thir Gly Wall Pro Ser Arg Phe Ser Gly SO 55 6 O

Ser Gly Ser Gly Thir Gly Phe Thir Luell Thir Ile Ser Ser Luell Glin Pro 65 70 7s 8O

Glu Asp Ile Ala Thir Tyr Cys Glin Glin Gly Glin Ser Tyr Pro Phe 85 90 95

Thir Phe Gly Ser Gly Thir 1OO

<210s, SEQ ID NO 33 &211s LENGTH: 119 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 33

Glin Wall Glin Lieu Glin Glin Ser Gly Ala Glu Luell Met Thir Gly Ala 1. 5 15

Ser Wall Lys Ile Ser Ala Thir Gly Tyr Thir Phe Ser Ser 2O 25

Trp Ile Glu Trp Wall Lys Glin Arg Pro Gly His Gly Lell Glu Trp Ile 35 4 O 45

Gly Glu Ile Luell Pro Gly Ser Gly Thir ASn Tyr Asn Glu Asn Phe SO 55 6 O

Lys Gly Ala Thir Phe Thir Ala Asp Thir Ser Ser Asn Thir Ala Tyr 65 70

Met Glin Luell Ser Ser Lell Thir Ser Glu Asp Ser Wall Wall Tyr 85 90 95

Ala Arg Arg Gly Ala Tyr Gly Asn Phe Asp Tyr Trp Gly Glin Gly 105 11 O

Thir Thir Luell Thir Wall Ser Ser 115

<210s, SEQ ID NO 34 &211s LENGTH: 111 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 34

Asp Ile Wall Met Ser Glin Ser Pro Ser Ser Luell Ala Wall Ser Wall Gly 1. 5 1O 15

Glu Lys Wall Thir Met Ser Ser Ser Glin Ser Lell Luell Tyr Ser 2O 25 3O

Asn Asn Glin Asn Tyr Lell Ala Trp Glin Glin Lys Pro Gly Glin 35 4 O 45

Ser Pro Luell Lell Ile Tyr Trp Ala Ser Ser Arg Glu Ser Gly Wall SO 55 6 O

Pro Glu Arg Phe Thir Gly Ser Gly Ser Gly Thir Asp Phe Thir Luell Thir 65 70 7s 8O

Ile Ser Ser Wall Lys Ala Glu Asp Luell Ala Wall Tyr Glin Glin 85 90 95

Ser Ser Pro Tyr Thir Phe Gly Gly Gly Thir Luell 1OO 105 11 O

<210s, SEQ ID NO 35 &211s LENGTH: 123 212. TYPE : PRT US 9,534,058 B2 123 124 - Continued

<213> ORGANISM: Mus sp. <4 OOs, SEQUENCE: 35 Glin Val Glin Lieu Lys Glu Ser Gly Pro Gly Lieu Val Ala Pro Ser Glin 1. 5 1O 15 Ser Leu Ser Ile Thr Cys Thr Val Thr Gly Phe Ser Leu Ser Arg 2O 25 3O

Ser Val His Trp Ile Arg Gln Pro Pro Gly Lys Gly Lieu. Glu Trp Luell 35 4 O 45 Gly Met Ile Trp Gly Gly Gly Ser Thr Asp Tyr Asn Ser Ala Leu SO 55 6 O

Ser Arg Lieu. Ser Ile Asn Lys Asp Asn. Ser Lys Ser Glin Val Phe Luell 65 70 7s 8O

Lys Met Asn Ser Lieu Gln Thr Val Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Arg Thr Glin Phe Tyr Tyr Gly His Asp Gly Gly Tyr Ala Met Asp 1OO 105 11 O Trp Gly Glin Gly Thr Ser Val Thr Val Ser Ser 115 12 O

<210s, SEQ ID NO 36 &211s LENGTH: 107 212. TYPE: PRT <213> ORGANISM: Mus sp. <4 OOs, SEQUENCE: 36 Asp Ile Val Met Thr Glin Ser Gln Llys Phe Met Ser Thr Ser Val Gly 1. 5 1O 15

Asp Arg Val Ser Val Thr Cys Lys Ala Ser Glin Asn. Wall Ala Ile Asn 2O 25 3O

Val Ala Trp Tyr Glin Gln Llys Pro Gly Glin Ser Pro Lys Ala Lieu. Ile 35 4 O 45 Tyr Ser Ala Ser Tyr Arg Tyr Ser Val Val Pro Asp Arg Phe Thr Gly SO 55 6 O

Ser Gly Ser Gly Thr Asp Phe Thr Lieu Pro Ile Ser Asn Val Glin Ser 65 70 7s 8O Glu Gly Lieu Ala Asp Tyr Phe Cys Lieu. Glin Tyr Ile Asn Tyr Pro 85 90 95 Thr Phe Gly Gly Gly Thr Lys Lieu. Glu Ile Llys 1OO 105

<210s, SEQ ID NO 37 &211s LENGTH: 116 212. TYPE: PRT <213> ORGANISM: Mus sp. <4 OO > SEQUENCE: 37

Glu Val Glin Lieu. Glin Glin Ser Gly Pro Glu Lieu Lleu Lys Pro Gly Ala 1. 5 1O 15

Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp 2O 25 3O

Asn Met His Trp Val Lys Glin Ser His Gly Lys Ser Lieu. Glu Trp Ile 35 4 O 45

Gly Asin Ile Tyr Pro Tyr Asn Gly Gly Thr Gly Tyr Asn Glin Lys Phe SO 55 6 O

Lys Thr Lys Ala Thr Lieu. Thr Val Asp Asin Ser Ser Ser Thr Ala 65 70 7s US 9,534,058 B2 125 126 - Continued

Met Glu Lieu. Arg Ser Lieu. Thir Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Ile Gly Asn Tyr Trp Phe Ala Phe Trp Gly Glin Gly Thr Lieu Val 105 11 O

Thir Wal Ser Ala 115

<210s, SEQ ID NO 38 &211s LENGTH: 106 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 38

Glin Ile Wall Luell Ser Glin Ser Pro Ala Ile Luell Ser Ala Ser Pro Gly 1. 5 15

Glu Lys Wall Thir Met Thir Arg Ala Ser Ser Ser Wall Ser Ile 25

His Trp Tyr Glin Glin Ala Gly Ser Ser Pro Thir Ser Trp Ile 35 4 O 45

Ala Thir Ser Asn Lell Ala Ser Gly Wall Pro Thir Phe Ser Gly Ser SO 55 6 O

Gly Ser Gly Thir Ser Tyr Ser Luell Thir Wall ASn Arg Wall Glu Ala Glu 65 70 8O

Asp Ala Ala Thir Tyr Tyr Cys Glin Glin Trp Ser Thir Thir Pro Pro Thir 85 90 95

Phe Gly Gly Gly Thr Arg Lieu Glu Ile 1OO 105

<210s, SEQ ID NO 39 &211s LENGTH: 12O 212. TYPE : PRT &213s ORGANISM: Mus so.

<4 OOs, SEQUENCE: 39

Glu Wall Glin Lieu. Glin Glin Ser Gly Pro Asp Luell Wall Pro Gly Thir 1. 5 1O 15

Ser Wall Lys Ile Ser Lys Ala Ser Gly Tyr Ser Phe Thir Ala 25

Ile His Trp Wall Lys Glin Ser His Gly Lys Ser Lell Glu Trp Ile 35 4 O 45

Gly Arg Phe Ser Pro Asn Asn Asp Arg Thir Thir Tyr Asn Glin Phe SO 55 6 O

Lys Asp Ala Ile Lell Thir Wall Asp Ser Ser Ser Thir Ala Tyr 65 70

Met Asp Luell Arg Ser Lell Thir Ser Glu Asp Ser Ala Wall Tyr 85 90 95

Ala Arg Gly Glu Glu Ser Trp Asp Ala Trp Phe Thir Trp Gly Glin 1OO 105 11 O

Gly Thir Luell Wall Thir Wall Ser Ala 115 12 O

SEQ ID NO 4 O LENGTH: 110 TYPE : PRT ORGANISM: Mus sp.

< 4 OOs SEQUENCE: 4 O