The Pennsylvania State University
The Graduate School
College of Agricultural Sciences
VACCINE-INDUCED-IMMUNITY-MEDIATED COMPETITION
BETWEEN ENDEMIC BORDETELLAE AND HOST IMMUNITY
AGAINST THEM
A Dissertation in
Genetics
by
Xuqing Zhang
2010 Xuqing Zhang
Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
May 2010
ii
The dissertation of Xuqing Zhang was reviewed and approved* by the following:
Eric T. Harvill Associate Professor of Microbiology and Infectious Diseases Dissertation Advisor
Robert F. Paulson Associate Professor of Veterinary and Biomedical Sciences Chair of Committee
Avery August Professor of Immunology
Mary J. Kennett Professor of Veterinary and Biomedical Sciences
Sarah E. Ades Associate Professor of Biochemistry and Molecular Biology
Richard W. Ordway Associate Professor of Biology Chair, Intercollege Graduate Degree Program in Genetics
*Signatures are on file in the Graduate School
iii
ABSTRACT
Whooping cough is a re-emerging disease in vaccinated populations. Bordetella pertussis and B. parapertussis are causative agents of this disease. B. holmesii is a recently recognized Bordetella species that can also cause whooping-cough-like respiratory symptoms. B. bronchiseptica infects a wide range of mammals, resulting in diseases of various severities. These bordetellae are endemic in humans and animals, laying burdens on their health. This dissertation investigated several aspects of vaccine-induced-immunity- mediated competition between endemic bordetellae as well as their interactions with host immunity. Current whooping cough vaccines include only B. pertussis antigens and are ineffective against B. parapertussis and
B. holmesii. We demonstrated that efficient protection against B. parapertussis requires antibodies against O- antigen. Moreover, addition of B. parapertussis LPS containing O-antigen to an acellular vaccine conferred protection against this bacterium. O-antigen also enables B. parapertussis to avoid B. pertussis vaccine- induced immunity by inhibiting binding and functions of cross-reactive antibodies. B. holmesii was found to be circulating in Massachusetts in recent years. B. pertussis vaccine-induced antibodies did not efficiently bind to B. holmesii. Vaccinated mice given B. holmesii-specific, but not B. pertussis-specific, antibodies quickly controlled B. holmesii challenge. These data suggest that future vaccines targeting B. parapertussis and B. holmesii need to include their own protective antigens. Engagement of B. pertussis LPS with TLR4 induces production of several pro-inflammatory cytokines, including IL-1 and IL-6. Their roles in immunity against B. pertussis were investigated in this work. Following B. pertussis infection, IL-1R-/- mice showed uncontrolled bacterial numbers in the respiratory tract, systemic spread, and dysregulated inflammation.
These mice survived the challenge with B. parapertussis or a B. pertussis strain lacking pertussis toxin, indicating a role of IL-1R-mediated effects in overcoming the effects of this toxin. Mice lacking IL-6 generated less B. pertussis-specific antibodies, recruited fewer leukocytes to the lungs, produced decreased levels of cytokines, and delayed the clearance of B. pertussis. Therefore, IL-1R and IL-6 are required for efficient control of B. pertussis. A genetic module, sigE-BB3751(rseA)-mucB(rseB), bearing sequence homology to the E. coli rpoE-rseA-rseB system, is recently discovered in B. bronchiseptica strain RB50. This system is involved in resistance to heat and ethanol stress, as well as cell envelope perturbations by SDS and
iv some β-lactam antibiotics. Moreover, the mutant lacking SigE failed to cause lethal infection in RAG-/- mice.
The mutant lacking both RseA and RseA did not efficiently colonize murine hosts. These findings suggest that SigE and its proper regulation are important during infection. Combined, data contained herein demonstrated how B. parapertussis and B. holmesii evade B. pertussis vaccine-induced immunity, how IL-1R and IL-6 signaling contribute to host defenses against B. pertussis, and how SigE system is important for B. bronchiseptica stress responses and pathogenesis. We also discuss the implication of these findings and future avenues of research resulting from this work.
v
TABLE OF CONTENTS
LIST OF FIGURES……………………………………………………………………………………...... viii LIST OF ABBREVIATION…………………………………………………………………………...... xi ACKNOWLEDGEMENTS…………………………………………………………………………………...xii
Chapter 1 Introduction……….………………………………………………………………………………..1 The Genus Bordetella…………………………………………………………………………………….1 Evolution of the Endemic bordetellae…………………………………………………………………....1 Endemic bordetellae; disease and prevalence…………………………………………………………….2 Current Vaccine Strategies………………………………………………………………………………..4 Bordetella Virulence Determinants……………………………………………………..………………..5 Immunity to the endemic bordetellae…………………………………………………...………………..7 Genetic Manipulation Strategies to study host-bordetellae interactions…………………..……………..8 Preface…………………………………………………………………………………..……………….10 References………………………………………………………………………………….…………….12
Chapter 2 The O-antigen is a Critical Antigen for the Development of a Protective Immune Response to Bordetella parapertussis………………………………………………………...……………………….17 Abstract………………………………………………………………………………….……………….17 Introduction………………………………………………………………………………...……………18 Materials and Methods………………………………………………………………….………………..20 Results…………………………………………………………………………………….……………...24 Discussion……………………………………………………………………………….………………..32 Authors and Contributions………………………………………………………………………………..35 References……………………………………………………………………………….………………..36
Chapter 3 O-antigen Allows Bordetella parapertussis to Evade B. pertussis Vaccine-induced Immunity by Blocking Binding and Functions of Cross-reactive Antibodies………….…………………..………….39 Abstract………………………………………………………………………………….……………….39 Introduction……………………………………………………………………………...………………40 Materials and Methods………………………………………………………………..………………….42 Results………………………………………………………………………………….………………...45 Discussion………………………………………………………………………………………………..55 Authors and Contributions……………………………………………………………………………….58 References……………………………………………………………………………….……………….59
vi
Chapter 4 Emergence of Bordetella holmesii in Massachusetts and Its Evasion of B. pertussis Vaccine- induced Immunity………………...…………………………………………………………………… .62 Abstract………………………………………………………………………………….………………62 Introduction……………………………………………………………………………...……………...63 Materials and Methods………………………………………………………………..…………………65 Results………………………………………………………………………………….………………..67 Discussion……………………………………………………………………………………………….73 Authors and Contributions………………………………………………………………………………76 References……………………………………………………………………………….………………77
Chapter 5 IL-1R Signaling Contributes to Controlling Inflammatory Pathology and Overcoming the Effects of Pertussis Toxin during B. pertussis Infection………….………….……………….…………………79 Abstract………………………………………………………………………………….……………....79 Introduction……………………………………………………………………………...……………...80 Materials and Methods………………………………………………………………..………………....83 Results………………………………………………………………………………….………………..88 Discussion……………………………………………………………………………………………….100 Authors and Contributions………………………………………………………………………………104 References……………………………………………………………………………….……………....105
Chapter 6 Decreased Leukocyte Accumulation and Delayed Bordetella pertussis Clearance in IL-6-/- Mice …………………………………………………………………………………………………………..109 Abstract………………………………………………………………………………….………………109 Introduction……………………………………………………………………………...……………...110 Materials and Methods………………………………………………………………..………………...113 Results………………………………………………………………………………….………………..116 Discussion……………………………………………………………………………………………….123 Authors and Contributions………………………………………………………………………………126 References……………………………………………………………………………….……………...127
Chapter 7 SigE Facilitates the Adaptation of B. bronchiseptica to Stress Conditions and Sepsis in Mice…130 Abstract………………………………………………………………………………….……………...130 Introduction……………………………………………………………………………...……………..131 Materials and Methods………………………………………………………………..………………...133
vii
Results………………………………………………………………………………….………………..138 Discussion……………………………………………………………………………………………….147 Authors and Contributions………………………………………………………………………………150 References……………………………………………………………………………….……………...151
Chapter 8 Constitutively Active SigE in B. bronchiseptica Leads to Decreased Virulence in Murine Hosts………………………………………………….………………………………………………...154 Abstract………………………………………………………………………………….……………...154 Introduction……………………………………………………………………………...……………..155 Materials and Methods………………………………………………………………..………………...159 Results………………………………………………………………………………….……………….162 Discussion……………………………………………………………………………………………….168 Authors and Contributions………………………………………………………………………………172 References……………………………………………………………………………….……………...173
Chapter 9 Summary and Significance……………………………………………………………………….176 Implications…………………………………………………………………………….……………….176 Future directions……………………………………………………………………….………………..182 References……………………………………………………………………………….……………....186
Appendix……………………………………………………………………………………………………..190 Appendix A: qRT-PCR primers for Chapter 7………………………………………………………… 190 Appendix B: Comparison of RB50∆sigE to RB50 under various stress condistions (Chapter 7)……...191
viii
LIST OF FIGURES
Chapter 2 Figure 2.1: The O-antigen contributes to the generation of protective immunity to B. parapertussis………...24 Figure 2.2: A response against the O-antigen contributes to effective vaccine-induced immunity…………...25 Figure 2.3: The O-antigen is not required for the development of splenic IFN-γ or IL-10 responses to B. parapertussis……………………………………………………………………………………………...26 Figure 2.4: The O-antigen contributes to the production of a robust anti-B. parapertussis antibody Response………………………………………………………………………………………………....26 Figure 2.5: Generation of antibodies that mediate efficient opsonophagocytosis of B. parapertussis by PMNs requires the O antigen…………………………………………………………………………………….28 Figure 2.6: Antibodies to the O-antigen are required for efficient antibody-mediated clearance of B. parapertussis……………………………………………………………………………………………...29 Figure 2.7: Addition of purified B. parapertussis LPS to an acellular B. pertussis vaccine confers protection against B. parapertussis challenge……………………………………………………………………….30
Chapter 3 Figure 3.1: B. parapertussis is more susceptible to wP-induced immunity in the absence of O-antigen….....45 Figure 3.2: aP does not reduce B. parapertussis numbers………………………………………...... 46 Figure 3.3: Splenic production of IFN-γ and IL-10 is cross-reactive………………………………………....47 Figure 3.4: IFN-γ contributes to the protection against B. parapertussis by wP……………………………...48 Figure 3.5: O-antigen inhibits the binding of B. pertussis vaccine-induced antibodies to live, but not denatured, B. parapertussis cells………………………………………………………………………....49 Figure 3.6: O-antigen decreases the opsonization of B. parapertussis by B. pertussis vaccine-induced antibodies…………………………………………………………………………………………………50 Figure 3.7: O-antigen blocks B. pertussis vaccine-induced antibodies from mediating adherence of B. parapertussis to PMNs…………………………………………………………………………………...50 Figure 3.8: O-antigen blocks B. pertussis vaccine-induced antibody-mediated phagocytosis of B. parapertussis……………………………………………………………………………………………...51 Figure 3.9: Passive transfer of wP-induced serum antibodies mediates clearance of O-antigen deficient, but not wild-type, B. parapertussis from mouse lungs……………………………………………………....52 Figure 3.10: Passive transfer of B. parapertussis specific antibodies rapidly reduces B. parapertussis colonization in aP and wP vaccinated animals…………………………………………………………..53
Chapter 4
ix
Figure 4.1: B. holmesii cases and vaccine coverage in Massachusetts...... 67 Figure 4.2: Phylogenetic tree of B. holmesii isolates…………………………………………………………68 Figure 4.3: Both wP and aP failed to confer protection against B. holmesii………………………………....69 Figure 4.4: wH/wP/aP splenic IFN-γ and IL-10 responses are cross-reactive………………………………..70 Figure 4.5: wH/wP/aP antibody responses are not fully cross-reactive………………………………………71 Figure 4.6: Supplement wP with B. holmesii- but not B. pertussis-specific antibodies confer protection against B. holmesii……………………………………………………………………………………………….72
Chapter 5 Figure 5.1: IL-1 is induced by B. pertussis……………………………………………………………………88 Figure 5.2: Increased mortality and morbidity of B. pertussis-infected but not B. parapertussis-infected IL-1R- /- mice………………………………………………………………………………………………….....89 Figure 5.3: Increased inflammatory pathology and leukocyte recruitment of B. pertussis-infected IL-1R-/- mice……………………………………………………………………………………………………....92 Figure 5.4: IL-1R deficiency leads to increased pro-inflammatory and decreased anti-inflammatory cytokine production by BMDCs and BMMs…………………………………………………………………….....94 Figure 5.5: IL-1R-/- mice BMMs are efficient in killing B. pertussis……………………………………….....95 Figure 5.6: Antibody responses are not defective in B. pertussis-challenged IL-1R-/- mice…………………..95 Figure 5.7: Increased TNF-α, IFN-γ and decreased IL-10, IL-17 responses in B. pertussis-infected IL-1R-/- mice……………………………………………………………………………………………………....97 Figure 5.8: Intranasal administration of rmIL-17 restored the pulmonary IL-17 level but did not reduce B. pertussis numbers in IL-1R-/- mice…………………………………………………………………….....98 Figure 5.9: Pertussis toxin deficient B. pertussis failed to cause lethal infection in IL-1R-/- mice……………99
Chapter 6 Figure 6.1: B. pertussis induces IL-6 in vitro and in vivo……………………………………………………116 Figure 6.2: Delayed clearance of B. pertussis in IL-6-/- mice………………………………………………..117 Figure 6.3: IL-6 contributes to the generation of efficient vaccine-induced immunity against B. pertussis…………………………………..118 Figure 6.4: B. pertussis-specific antibody production is decreased in IL-6-/- mice…………………………..119 Figure 6.5: Serum antibodies from IL-6-/- mice are effective in antibody-mediated clearance of B. pertussis.…………………………………………………………………...... 119 Figure 6.6: Immune functions not corrected by supplementing antibodies are improperly regulated in IL-6-/- mice …………………………………………………………………………………………………..…120
x
Figure 6.7: IL-6 contributes to the recruitment of leukocytes into B. pertussis-infected lungs……………...121 Figure 6.8: Splenic cytokine production is dampened in B. pertussis-inoculated IL-6-/- mice………………122
Chapter 7 Figure 7.1: B. bronchiseptica SigE is an E. coli σE-like sigma factor……………………………………….138 Figure 7.2: Construction of a SigE-deficient strain of B. bronchiseptica…………………………………....139 Figure 7.3: Role of SigE in various environmental stress…………………………………………………....140 Figure 7.4: Colonization of the respiratory tract of C57BL/6 by RB50 and RB50ΔsigE over time………...142 Figure 7.5: Survival and systemic colonization of immunodeficient mice in response to RB50 and RB50ΔsigE……………………………………………………………………………………………...143 Figure 7.6: SigE is not required for serum resistance………………………………………………………..145 Figure 7.7: RB50ΔsigE is less cytotoxic to macrophage…………………………………………………….145
Chapter 8 Figure 8.1: RB50∆rseAB does not efficiently colonize the lower respiratory tract of C57BL/6 mice………162 Figure 8.2: RB50∆rseAB-specific antibodies are efficient in antibody-mediated clearance of RB50∆rseAB…………………………………………………………………………………………….163 Figure 8.3: RB50∆rseAB fails to cause lethal infection in RAG-/- mice……………………………………..164 Figure 8.4: rseAB is not required for serum resistance……………………………………………………….165 Figure 8.5: RB50∆rseAB is less cytotoxic to macrophages………………………………………………….165 Figure 8.6: RB50∆rseAB does not cause lethal infection in TLR4def mice………………………………….166
xi
LIST OF ABBREVIATIONS aP: Adacel, acellular Pertussis vaccine BG: Bordet-Gengou BMDC: bone marrow derived dendritic cells BMM: bone marrow derived macrophages CDC: the Center for Disease Control and Prevention cDNA: complementary DNA CFU: colony forming units CR3: complement receptor 3 ECF: extracytoplasmic function ELISA: enzyme linked immunosorbent assay ESR: extracytoplasmic stress responses g: gravity GM-CSF: granulocyte-macrophage colony stimulating factor HRP: Horseradish Peroxidase IACUC: Institutional Animal Care and Use Committee IFN: interferon Ig: immunoglobulin IL: interleukin i.p.: intraperitoneal IS: insertion sequence LD50: Mean Lethal Dose LDH: lactate dehydrogenase LPS: lipopolysaccharide LRT: lower respiratory tract MDPH: the Massachusetts Department of Public Health MHC: major histocompatability complex MLST: Multi-Locus Sequence Type PBS: phosphate buffered saline PBS-T: phosphate buffered saline with tween-20 PCR: polymerase chain reaction p.i.: post-inoculation PVDF: polyvinylidene diflouride Ptx: pertussis toxin qRT-PCR: Quantitative Real-Time Polymerase Chain Reaction SDS-PAGE: Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis TGF: transforming growth factor TLR: toll-like receptor Th: T helper TNF: tumor necrosis factor TTSS: type three secretion system UPGMA: Unweighted Pair Group Method with Arithmetic Mean wP: whole cell B. pertussis vaccine wH: whole cell B. holmesii vaccine
xii
ACKNOWLEDGEMENTS
Parts of this dissertation have been published in peer-reviewed research journals. Chapter 2: O- antigen is a Critical Antigen for the Development of a Protective Immune Response to Bordetella parapertussis was published in Infection and Immunity; Volume 77, Issue 11, page 5050-5058. Figures 2.1- 2.7 were published in that article. Chapter 3: O-antigen Allows Bordetella parapertussis to Evade B. pertussis Vaccine-induced Immunity by Blocking Binding and Functions of Cross-reactive Antibodies was published in PLoS ONE; Volume 4, Issue 9, e6989. Figures 3.1-3.10 were published in that article. All appropriate permissions have been obtained to reproduce any figures or text for these articles. I would like to thank the following people for scientific discussions regarding my thesis work: Dr. Eric Harvill, past and current members of his laboratory (Dr. Daniel Wolfe, Dr. Anne Buboltz, Dr. Elizabeth Goebel, Dr. Ash Pathak, Dr. Grainne Long, Sara Hester, Tania Goel, Laura Weyrich, Alexia Karanikas, Olivier Rolin, Daryl Nowacki, JiHye Park, and Dr. Ying Zhang. I would like to give special thanks to Dr. Daniel Wolfe, Dr. Anne Buboltz and Dr. Elizabeth Goebel for their guidance on experimental procedures, conceiving and designing experiments, and scientific writing. I would also like to thank Dr. Elizabeth Goebel and Tania Goel for their substantial contribution to the work in Chapter 2 and 6, respectively.); my committee, Dr. Robert Paulson, Dr. Sarah Ades (I would like to give special thanks to Dr. Sarah Ades, her student Sarah Barchinger and other members of her laboratory for their help in work in Chapter 7 and 8), Dr. Avery August, Dr. Mary Kennett; and other faculty, staff and students in the Veterinary and Biomedical Sciences Department. Furthermore, I would like to thank the following people for the donation of materials and/or the use of equipment: Dr. Biao He, Dr. Pamela Hankey, Dr. Sandeep Prabhu, Dr. Robert Paulson, and Dr. Avery August. I would also like to thank Dr. Mary Kennett for her help in histology analysis. I would like to thank Jenny Lavine for sorting out the information on B. holmesii prevalence. I would like to thank the staff of the Pennsylvania State University Flow Cytometry facility (Elaine Kunze, Susan Magargee, and Nicole Bern) for technical assistance. I would like to thank the Dr. Jeff Dodds and staff of the Henning Animal Facility for their hard work on providing care for our mice. I was fortunate to work with many exceptional scientists working at other organizations to whom I owe many thanks: I would like to thank Dr. Maria Rodríguez for her aid in completing the experiments shown in Figures 2.5 and 3.6-8, Dr. Andrew Preston at the University of Bristol, UK, for purifying Bordetella LPS and critical discussions, Dr. Scott Stibitz at the FDA for use of a novel Bordetella allelic exchange vector before its publication, and Dr. Tracy Nicholson at the Agricultural Research Service, USDA, for carrying out the microarray experiments related to work in Chapter 7 and 8. I would like to thank the Genetics graduate program director, Dr. Richard Ordway, program administrator, Yan Huaru, and students in the program for their help and encouragement during my graduate studies. Last but not least, I would like to thank my family and friends for their support during my thesis research.
1
Chapter 1
Introduction
The genus Bordetella
The genus Bordetella consists of nine species of gram-negative coccobacillus, Bordetella pertussis, B. parapertussishu (human adapted), B. parapertussisov (ovine adapted), B. bronchiseptica, B. holmesii, B. avium,
B. hinzii, B. petrii and B. trematum (62). Since the following research does not involve the ovine-adapted B. parapertussis, B. parapertussis will refer to the human-adapted organism thereafter. This dissertation will focus on the bordetellae that cause diseases in humans or other mammals. These bordetellae, including B. pertussis, B. parapertussis, B. bronchiseptica, and B. holmesii, will be referred to “endemic” bordetellae in this work. B. pertussis and B. parapertussis infect humans, causing the respiratory diseases known as whooping cough (40, 62). In contrast, B. bronchiseptica causes diseases in various mammals, including but not be limited to mice, rats, guinea pigs, dogs, cats, pigs, sheep, cows, horses, foxes, monkeys, rabbits, skunks, opossums, raccoons, ferrets, hedgehogs, koalas, leopards, polar bears, seals, bushbabies and occasionally immunocompromised humans (33, 62, 73). This bacterium can cause a wide range of diseases, from asymptomatic colonization in the upper respiratory tract to lethal pneumonia (33, 62). Despite differences in host range and disease severities, B. pertussis, B. parapertussis and B. bronchiseptica are so closely-related that the three have been suggested to be reclassified as subspecies, also known as the “classical bordetellae” or the “B. bronchiseptica cluster” (21, 30, 73, 75, 93). B. holmesii is a recently recognized
Bordetella species that has been isolated from blood or nasopharyngeal specimens of humans (97, 107).
Evolution of the endemic bordetellae
Based on genomic sequences, B. pertussis and B. parapertussis appear to have evolved independently from B. bronchiseptica-like progenitors through large scale gene loss and rearrangement (30, 75, 93). Strains of B. parapertussis isolated from various locations over the past 50 years are largely clonal (92, 108), indicating its recent emergence. Together with comparative genomic analysis determining age of divergence
(75), this suggests that B. parapertussis evolved from a B. bronchiseptica-like progenitor more recently than
B. pertussis.
2 Since the complete B. holmesii genome sequence is not available, the evolutionary relationship between this species and other bordetellae is still obscure. 16S rRNA sequence and insertion sequence (IS) presence analyses indicate that B. holmesii is closely-related to the classical bordetellae (97). However, further research suggests that this might be biased by horizontal transfer between B. holmesii and B. pertussis
(25). Multilocus sequence typing analysis, characterization of the BvgAS and antigen cross-recognition assays (25, 29, 74) also suggest that B. holmesii might not be as closely-related to B. pertussis as originally assumed. Instead, it might be more closely-related to B. avium and B. hinzii (25).
Endemic bordetellae; disease and prevalence
The disease and prevalence of the classical bordetellae has been the subject of much research due to their impact on human and animal health. B. bronchiseptica is prevalent in companion and agricultural mammals, with more than ~90% seroprevalence in some swine herds, ~75% culture-positivity in commercial rabbits, and ~10% culture-positivity in felines from various sources (7, 24, 83). However, epidemiology of B. bronchiseptica in natural settings is still obscure (33). B. bronchiseptica is rarely isolated from humans, and typically only from immunocompromised individuals (106). Studies using a murine model of infection suggest that B. pertussis immunity may limit the circulation of B. bronchiseptica diseases in human populations (32). B. bronchiseptica respiratory infections in non-human mammals result in various diseases of veterinary importance, such as kennel cough in dogs, atrophic rhinitis in pigs and snuffles in rabbits, although many B. bronchiseptica infections are asymptomatic (62).
B. pertussis and B. parapertussis are both etiologic agents of whooping cough (40, 62). Whooping cough most commonly presents as a severe paroxysmal cough that may be followed by post-tussive whooping
(from the desperate aspiratory effort between fits of coughing) and vomiting, though the disease may also be observed in milder forms, such as a persistent cough or even as a subclinical infection (62). On average, B. parapertussis infections are less often associated with the severe symptoms of whooping cough than B. pertussis, but the severity or duration of symptoms cannot reliably be used to differentiate between B. pertussis and B. parapertussis in a clinical setting and both pathogens are capable of causing substantial morbidity and mortality (6, 38, 60, 61).
3 The first B. holmesii isolate was submitted to the Center for Disease Control and Prevention (CDC) in
1983 and was initially designated as “CDC nonoxidizer group 2” (NO-2) (97). Since its establishment as a new Bordetella species in 1995 (97), this bacterium has been sporadically isolated from diverse countries, such as Australia, German, France, United Kingdom and Switzerland (26, 35, 74, 82, 97). B. holmesii infections usually have a relatively mild and uncomplicated course characterized by a nonspecific febrile illness (84), but severe systemic infection has also been reported (82). B. holmesii has been isolated from immunocompromised hosts (asplenic or sickle cell diseases patients and transplant recipients), often recovered from blood (49, 64, 71, 74, 84). B. holmesii has been isolated from pleural fluid, sputum or lung biopsy specimens of immunocompetent patients (82, 89). B. holmesii has also been isolated from nasopharyngeal specimens of otherwise healthy individuals, exhibiting whooping cough like symptoms, such as whoop or post-tussive vomiting (63, 107). Therefore, B. holmesii may be an important emerging human pathogen from the Bordetella genus, causing whooping cough like symptoms.
It is estimated that whooping cough causes 50 million cases and 300,000 deaths annually worldwide
(20). However, a few factors may have confounded more accurate estimation of whooping cough incidence, as well as the proportion of whooping cough diseases caused by individual species. Since differentiating between B. pertussis and B. parapertussis based on clinical symptoms is difficult and does not affect the course of treatment (62), it is not commonly performed by clinicians. B. holmesii is a relatively newly discovered species and may not be detected or distinguished from other bordetellae, leading to low awareness at the clinical level. Even if there is an intention to differentiate among these Bordetella species, some technical difficulties interfere with laboratory diagnosis. Culture, a classical method of differential diagnosis, is highly specific but is maximally sensitive only in the initial phases of diseases. Furthermore, culture heavily depends on specimen quality, laboratory expertise, special media and an extended incubation period of 5-10 days (96). Diagnostic serology is highly sensitive and faster than the culture method. However, serology assays for B. pertussis or B. parapertussis differ among laboratories, and assays specific to B. holmesii are not available. Differential diagnosis based on PCR also offers an improvement in sensitivity over that of the culture method. Unfortunately, there is no standardized PCR test available for B. pertussis or
B. parapertussis detection in clinical microbiology laboratories. One commonly used PCR protocol to
4 differentiate between B. pertussis and B. parapertussis targets the species-specific insertion sequence (IS) elements. However, B. holmesii shares identical sequences within the amplification regions of IS481 and
IS1001, otherwise specific to B. pertussis and B. parapertussis, respectively, which can potentially confound the differential diagnosis (78, 79).
Although whooping cough has been classified as a re-emerging disease by the CDC, diseases caused by B. parapertussis or B. holmesii are not listed as reportable to this agency, further hindering an accurate estimate of their prevalence. When carefully monitored, B. parapertussis infections have been observed at high rates, being reported to cause between 1% and 98% of whooping cough cases in given populations, with most estimates falling between 4% and 40% (9, 54, 95). Random sampling has shown that more than 90% of
B. parapertussis infections result in mild or subclinical disease (9), suggesting that the vast majority of infections will not be diagnosed as whooping cough. These observations suggest that B. parapertussis may be much more prevalent than researchers have previously appreciated. The frequency of B. holmesii isolation from nasopharyngeal specimens in two separate studies is similar, being 0.6% (78, 107). Other than that, B. holmesii has only been sporadically reported by physicians who encountered patients with underlying conditions. This raises the possibility of a biased and underestimated reporting rate of B. holmesii by clinicians only pursuing the identification of a bacterial isolate recovered from immunocompromised patients.
Current vaccine strategies
The common vaccination strategy against B. bronchiseptica is intranasal administration of live, attenuated strains (33). These vaccines appear to vary in their efficacies against B. bronchiseptica diseases in the swine herd (27, 34, 76).
Early whooping cough vaccines, consisting of whole inactivated B. pertussis cells, induce a strong antibody response and a balanced Th1/Th2 response (5, 50, 52). Clinical and experimental studies have shown that whole-cell vaccines are quite effective in reducing the incidence of B. pertussis disease (17), but these vaccines confer very low levels of protection against B. parapertussis (5, 50). The levels of cross- protection by these vaccines against B. holmesii have not been reported.
Most developed countries now use acellular vaccines consisting of some combination of the following B. pertussis antigens: pertussis toxin (Ptx), pertactin (PRN), filamentous hemagglutinin (FHA),
5 fimbriae (FIM) 2, and FIM 3. Acellular vaccines induce robust antibody responses only to this limited set of antigens, and the T cell response is skewed towards a Th2-type response (5, 51, 53). These vaccines are effective against B. pertussis, but some data have indicated that they are less effective than the whole cell vaccines against B. parapertussis (5, 50, 52). In addition, acellular vaccines may enhance the ability of B. parapertussis to colonize hosts (22) (Long G.H., Karanikas A.T., Harvill E.T., Read A.F., and Hudson P.J., unpublished data), and the prevalence of this pathogen may have increased despite, or perhaps due to, the introduction of these vaccines (48). It is unknown whether the acellular vaccines confer cross-protection against B. holmesii.
The vast majority of individuals begin to undergo whooping cough vaccinations at 2 months of age in some developed countries, in which vaccine coverage is more than 80% (14, 48, 80). The use of whooping cough vaccines has undoubtedly affected the epidemiology of B. pertussis, and has likely affected that of B. parapertussis as well. B. parapertussis has been found to cause a higher percent of whooping cough cases in vaccinated, compared to unvaccinated, individuals in a certain population (48), suggesting that vaccination may confer a selective advantage to B. parapertussis. Differences observed in the age-prevalence of B. parapertussis versus B. pertussis also support this theory. B. pertussis is most common in very young children prior to vaccination and in adolescents in whom vaccine-induced immunity has waned (18, 98). B. parapertussis, on the other hand, is most common in young children aging 1 to 10 years old, the age group that has been most recently vaccinated against B. pertussis (6, 47, 99) (Lavine J., Han L., Harvill E.T., and
Bjornstad O., unpublished data). Overall, these observations suggest that vaccination against B. pertussis may confer a selective advantage to B. parapertussis. Little is known about the epidemiology of B. holmesii, especially in recent years.
Importantly, whooping cough has been increasing in incidence over the past 20 years in countries that have high vaccine coverage (1, 15, 23, 86, 94). It is not clear what the relative roles of B. pertussis, B. parapertussis and B. holmesii are in this resurgence. The modification of vaccine strategies to efficiently protect against all these endemic bordetellae in humans would likely reduce the incidence of whooping cough diseases overall.
Bordetella virulence determinants
6 The colonization and persistence of B. bronchiseptica in the murine respiratory tract depend on the expression of an array of virulence determinants regulated by the BvgAS two-component system (19). The
BvgAS system is composed of BvgS, the transmembrane sensor kinase (87), and BvgA, the DNA-binding response regulator, present in all endemic bordetellae (4, 10, 29, 69). bvgAS expression can be activated by growth at 37ºC, or in the relative absence of MgSO4 or nicotinic acid (65, 66), although the in vivo signals that regulate this system are not fully understood. Bordetellae grown under such conditions are referred to as
Bvg+-phase. Through a four-step His-Asp-His-Asp phosphor-relay mechanism, BvgA is phosphorated by
BvgS, and promotes the transcription of Bvg+-phase-specific genes by binding to the BvgA-binding site in their promoter regions (81, 87). Genes that are positively regulated by the BvgAS system encode toxins, such as adenylate cyclase toxin (ACT), Ptx (B. pertussis specific), dermonecrotic toxin (DNT), type three secretion system (TTSS), as well as adhesions including FIM, PRN and FHA, and gene products that modify LPS structures (62). Under Bvg+ conditions, another set of genes is repressed through the regulation by BvgR, which is activated by BvgA (67). Under “modulating” conditions, such as 25ºC or in the relative presence of
MgSO4 or nicotinic acid, the BvgAS phosphor-transfer system is inactivated, which decreases the production of BvgR, and genes encoding flagellin as well as genes involved in starvation survival are thus expressed (2).
Bordetellae growing under sub-modulating conditions can display phenotypes intermediate between the Bvg+ and Bvg- phases, designated the Bvgi phase, which has been proposed to play a role in respiratory transmission and biofilm formation (28, 41, 88). Experiments using phase-locked mutants indicate that the
Bvg+ phase is both necessary and sufficient for respiratory tract infection (19), and suggest the critical roles of virulence determinants expressed in the Bvg+ phase during infection.
Although B. pertussis and B. parapertussis share most of their virulence determinants, each expresses factors not expressed by the other. For example, Ptx is only expressed by B. pertussis, whereas O-antigen is only expressed by B. parapertussis. The gene encoding Ptx is present in B. parapertussis genome, but some mutations in the promoter region prevent its expression (4, 58). Ptx is an AB5 toxin that can ADP-ribosylate and inactivate a subset of G proteins, which are shared by many chemokine receptor signaling pathways (8,
42). Clinically, Ptx is known to be the cause of some systemic symptoms associated with whooping cough, such as lymphocytosis, histamine sensitivity and insulinemia (72). This toxin has been shown to block the
7 early migration of neutrophils into the lungs (3, 43). Another study indicates that airway macrophages are the primary target of Ptx in the lower respiratory tract (LRT) (13). Ptx exerts multiple suppressive effects on the immune system other than those observed on innate immune cells; for example, Ptx suppresses the production of anti-Bordetella serum antibodies (12, 68), reduces major histocompatibility complex class II on the surface of monocytes (85), and interferes with CD1a expression on dendritic cells (59).
Although Ptx exerts multiple suppressive effects on host immunity, B. parapertussis is successful in infecting humans without the expression of this toxin. This may indicate that Ptx is not required for virulence of bordetellae in humans; alternatively, this may also indicate the existence of some alternative B. parapertussis-specific virulence mechanisms. O-antigen, the membrane distal repeating chain of disaccharides, is retained by B. parapertussis, but not B. pertussis (91). O-antigen confers serum resistance by inhibiting C3 deposition onto the surface of B. parapertussis (31). O-antigen also enables B. parapertussis to avoid B. pertussis-infection-induced immunity by preventing cross-reactive antibodies from binding to B. parapertussis (101).
Since the complete genome sequence of B. holmesii is not available, less is known about its virulence determinants. It has been determined that BvgS is functionally interchangeable between B. pertussis and B. holmesii, but BvgA of B. holmesii cannot substitute for its B. pertussis counterpart (99). Njamkepo et al. determined that anti-B. pertussis FHA, PRN, Ptx, ACT, FIM2 or FIM3 antibodies do not recognize any protein from five independent B. holmesii isolates (74), suggesting that these proteins are either not produced by B. holmesii or that the proteins produced do not cross-react with those expressed by B. pertussis. B. pertussis and B. holmesii also produce phenotypically and immunologically distinct LPS, and the LPS profile of B. holmesii does not appear to be modulated by temperature (91). One potential virulence determinant of
B. holmesii may be a putative pathogenicity island containing a functional, iron-regulated locus that appears to have been laterally transferred from B. pertussis (25).
Immunity to the endemic bordetellae
Although little is known about the immune responses against B. holmesii, clinical studies and experimental studies using animal models have identified key host factors involved in protective immunity against B. bronchiseptica, B. pertussis and B. parapertussis. Toll-like receptor (TLR)4 signaling in response
8 to B. bronchiseptica leads to rapid and robust TNF-α response, which is required for host survival (55-57).
Complement is also critical to the control of B. bronchiseptica infection as CD11b-/- mice, lacking
Complement Receptor 3, succumb to infection between days 3 and 4 post-inoculation (77). Additionally, antibodies are required for efficient clearance of B. bronchiseptica (44). TLR4, neutrophils, Fcγ receptors, and complement are required for the antibody-mediated clearance of B. bronchiseptica from the lungs (45).
Immunoglobulin (Ig) A mediates protection against B. bronchiseptica in the upper respiratory tract (104).
TLR4 deficient mice have a protracted course of B. pertussis infection, which is associated with elevated inflammatory pathology (39, 57). TNF-α deficient mice harbor more B. pertussis in their lungs at the later stages of infection associated with elevated inflammation (105). Both antibodies and T cells are required for efficient control of B. pertussis (44, 46). According to clinical studies, antibodies against B. pertussis
FHA, FIM, PRN and Ptx correlate with protection against disease (16, 62, 70). Ptx inhibits the antibody- mediated clearance of B. pertussis until the second week post-infection, when its inhibitory effect is overcome and antibodies clear the infection with the help of neutrophils and Fcγ receptors (43).
Clinically, B. parapertussis infection in humans induces antibody responses to FHA, PRN and LPS
(6, 90). In contrast to its close relatives, B. pertussis and B. bronchiseptica, B. parapertussis LPS does not efficiently stimulate TLR4-mediated signaling (57). There is very little inflammation or leukocyte recruitment to the lungs during the first few days of a B. parapertussis infection (100). During the second week, T cells produce IFN-γ, which contributes to the recruitment of neutrophils to the lungs (102).
However, IL-10, produced by macrophages during the first week, skews T cells away from Th1 phenotypes, limiting the IFN-γ responses (102). The combination of limiting pro-inflammatory TLR4 signaling and stimulating anti-inflammatory IL-10 production enables B. parapertussis to grow to high numbers and persist longer within its host. Antibodies are produced after about 2 weeks and T cells, IFN-γ, neutrophils, as well as the complement cascade, complement receptor 3, and Fcγ receptors, are critical to the function of antibodies against B. parapertussis (103).
Genetic manipulation strategies to study host-bordetellae interactions
The complete genome sequence of at least one strain of each classical bordetellae is available (75), and several other strains of classical bordetellae are being sequenced. Through in silico analysis using these
9 genome sequences, genes can be implicated in pathogenesis based on sequence similarity to known virulence determinants in other species. This approach identifies potentially interesting genes, but provides little information regarding specific functions of their encoded products. However, the genetic manipulation of bordetellae allows for the construction of bacterial mutants lacking potential virulence determinants in question. The resultant phenotypes of the strains lacking a specific factor may imply the functions of the encoded products.
Genetic manipulation of the hosts offers another approach to study bacterial pathogenesis on the host side. Murine models have been widely utilized in immunological research due to the availability of mouse strains deficient in specific immune factors. Intranasal inoculation of classical bordetellae in 50µL volume results in the deposition of bacteria throughout the respiratory tract at the time of infection (11, 36). Although transmission and coughing symptoms are not observed in laboratory mice even following high dose inoculation (5×105 CFU), the mouse is a natural host of B. bronchiseptica, making murine infection of this bacterium a suitable model to study its interaction with the host. Murine infections of the human-adapted bordetellae share many disease characteristics with infected humans, such as the production of Bordetella- specific antibodies, neutrophil migration to the lungs and memory T and B cell responses (62, 70, 100, 103).
Monitoring the host responses in mice with specific immunodeficiencies distinguishes the indispensable host defense mechanisms from the dispensable ones. Host immune responses are so complex that deficiency in one factor may impact various aspects of immune responses. The interactions between players in host immunity may be better revealed in the context of disease progression or in the host defenses against invading pathogens including bordetellae. Thus studying the immune response following a Bordetella infection in immunodeficient mice may also address general immunology questions.
The combination of bacterial mutants and knockout mouse strains permit the dissection of specific interactions between bordetellae and the host. The precise role of a specific virulence determinant in a complicated host-bacterial interaction may sometimes be hindered due to redundant virulence mechanisms or host defense pathways. In this regard, deletion of a bacterial factor may not result in a detectable difference in the course of infection. One way to attack this problem is to combine the tools of bacterial and mammalian genetics to alter both sides of the interaction, more specifically to explore the interactions between bacterial
10 factors and immune defense functions in vivo by examining bacterial factor mutants in mice with mutations causing specific immunodeficiencies (37). This approach has several advantages. First of all, by creating a defect on the bacteria side and identifying a complementary defect on the host side, bacterial factors can be matched to specific immune functions that they interact with. For instance, if the mutant bacteria lacking a specific factor are defective in wild-type hosts but behave similarly to the wild-type bacteria in hosts lacking immune factor “X”, this would suggest that “X” is the in vivo target for that factor. Secondly, the lack of certain immune functions may disrupt immune regulation, facilitating the identification of differences between mutant and wild-type bacteria. For example, if the mutant bacteria lacking a specific factor are only defective in the host lacking immune function “X”, but not in immunocompetent hosts, this would imply that that factor is required to overcome the defense mechanisms retained by hosts lacking “X”.
Preface
This dissertation will describe the interactions between endemic Bordetella species mediated mainly by vaccination, the contribution of two cytokine pathways to efficient immune responses against B. pertussis, and the role of the B. bronchiseptica SigE system in stress responses and pathogenesis. Chapters 2, 3 and 4 of this dissertation will explore how B. parapertussis and B. holmesii each evade B. pertussis vaccine-induced immunity. In synopsis, the isogenic O-antigen deficient strain of B. parapertussis confers less protection following B. parapertussis vaccination and infection, indicating that the effective adaptive immune responses against B. parapertussis require O-antigen. Furthermore, the addition of LPS, including O-antigen, to B. pertussis vaccines increases the efficacy of current whooping cough vaccines against B. parapertussis (109)
(Chapter 2). O-antigen also inhibits the binding of B. pertussis vaccine-induced antibodies to B. parapertussis, antibody-mediated opsonophagocytosis in vitro as well as bacterial clearance in vivo. This lack of binding of cross-reactive antibodies may contribute to the ability of B. parapertussis to circulate in B. pertussis vaccinated populations (110) (Chapter 3). B. holmesii is found to be circulating in Massachusetts in recent years. Experiments using a murine model of infection indicate that B. pertussis vaccine-induced immunity confers little protection against B. holmesii due to the lack of cross-reactive antibodies (Chapter 4).
Chapters 5 and 6 will outline the contributions of IL-1R and IL-6 to immune responses against B. pertussis. Mice lacking IL-1R display increased susceptibility to B. pertussis, which is associated with
11 uncontrolled inflammatory pathology, atypical disseminated diseases and the lack of IL-17 responses. The
IL-1R pathway contributes to the induction of IL-10 responses during B. pertussis infection, and also plays a role in overcoming the effects of a B. pertussis specific factor, pertussis toxin (Chapter 5). IL-6, which is the focus of chapter 6, contributes to the pulmonary leukocytes recruitment and the generation of B. pertussis- specific T cell cytokine responses (Chapter 6). After all, IL-6-/- mice show delayed clearance of B. pertussis, as well as decreased anamnestic immunity against this pathogen.
Chapters 7 and 8 will focus on the role of a B. bronchiseptica extracytoplasmic function sigma factor,
SigE, and its negative regulators in stress responses and pathogenesis. SigE plays a role in the growth of B. bronchiseptica under heat or ethanol stress, its thermotolerance, and resistance to cell envelope perturbations posed by detergents or β-lactam antibiotics. In addition, the SigE deficient strain is defective in causing systemic and lethal infection in RAG-/- mice (Chapter 7). The SigE negative regulators deletion strain failed to efficiently colonize immunocompetent mice, which implies the importance of the proper control of SigE activity during infection (Chapter 8).
The last chapter will summarize this dissertation as a whole and discuss the overall significance and implications of the research, as well as some future directions that can be taken to extend this work.
12 References
1. 2002. From the Centers for Disease Control and Prevention. Pertussis--United States, 1997-2000. JAMA 287:977-979. 2. Akerley, B. J., D. M. Monack, S. Falkow, and J. F. Miller. 1992. The bvgAS locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica. J Bacteriol 174:980-990. 3. Andreasen, C., and N. H. Carbonetti. 2008. Pertussis toxin inhibits early chemokine production to delay neutrophil recruitment in response to Bordetella pertussis respiratory tract infection in mice. Infect Immun 76:5139-5148. 4. Arico, B., and R. Rappuoli. 1987. Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes. J Bacteriol 169:2847-2853. 5. Barnard, A., B.P. Mahon, J. Watkins, K. Redhead, and K.H. Mills. 1996. Th1/Th2 cell dichotomy in acquired immunity to Bordetella pertussis: variables in the in vivo priming and in vitro cytokine detection techniques affect the classification of T-cell subsets as Th1, Th2, or Th0. Immunology 87:372-380. 6. Bergfors, E., B. Trollfors, J. Taranger, T. Lagergard, V. Sundh, and G. Zackrisson. 1999. Parapertussis and pertussis: differences and similarities in incidence, clinical course, and antibody responses. Int J Infect Dis 3:140-146. 7. Binns, S. H., S. Dawson, A. J. Speakman, L. E. Cuevas, C. J. Gaskell, C. A. Hart, K. L. Morgan, and R. M. Gaskell. 1999. Prevalence and risk factors for feline Bordetella bronchiseptica infection. Vet Rec 144:575-580. 8. Bokoch, G. M., and A. G. Gilman. 1984. Inhibition of receptor-mediated release of arachidonic acid by pertussis toxin. Cell 39:301-308. 9. Borska, K. a. S., M. 1972. Studies on the circulation of Bordetella pertussis and Bordetella parapertussis in populations of children. J Hyg Epidemiol Microbiol Immunol 16:159-172. 10. Boucher, P. E., and S. Stibitz. 1995. Synergistic binding of RNA polymerase and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis. J Bacteriol 177:6486-6491. 11. Burns, V., Pishko, E.J., Preston, A., Maskell, D.J., and Harvill, E.T. 2003. Role of Bordetella O-antigen in respiratory tract infection. Infect Immun 71:86-94. 12. Carbonetti, N. H., G. V. Artamonova, C. Andreasen, E. Dudley, R. M. Mays, and Z. E. Worthington. 2004. Suppression of serum antibody responses by pertussis toxin after respiratory tract colonization by Bordetella pertussis and identification of an immunodominant lipoprotein. Infect Immun 72:3350-3358. 13. Carbonetti, N. H., G. V. Artamonova, N. Van Rooijen, and V. I. Ayala. 2007. Pertussis toxin targets airway macrophages to promote Bordetella pertussis infection of the respiratory tract. Infect Immun 75:1713-1720. 14. CDC. 1996. National, state and urban area vaccination coverage levels among children aged 19-35 months -- United States, April 1994-March 1995 MMWR 45:145-150. 15. Celentano LP, M. M., Paramatti D, Salmaso S, Tozzi AE; EUVAC-NET Group. . 2005. Resurgence of pertussis in Europe. Pediatr Infect Dis J 24:761-765. 16. Cherry, J. D. 1997. Comparative efficacy of acellular pertussis vaccines: an analysis of recent trials. Pediatr Infect Dis J 16:S90-96. 17. Cherry, J. D. 1984. The epidemiology of pertussis and pertussis immunization in the United Kingdom and the United States: a comparative study Curr Probl Pediatr 14:1-78. 18. Cherry, J. D., D. X. Xing, P. Newland, K. Patel, U. Heininger, and M. J. Corbel. 2004. Determination of serum antibody to Bordetella pertussis adenylate cyclase toxin in vaccinated and unvaccinated children and in children and adults with pertussis. Clin Infect Dis 38:502-507. 19. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-3390. 20. Crowcroft, N. S., C. Stein, P. Duclos, and M. Birmingham. 2003. How best to estimate the global burden of pertussis? Lancet Infect Dis 3:413-418. 21. Cummings, C. A., M. M. Brinig, P. W. Lepp, S. van de Pas, and D. A. Relman. 2004. Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol 186:1484-1492. 22. David, S., van Furth, R., and Mooi, F.R. 2004. Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22:1892-1898. 23. de Melker, H. E., J. F. Schellekens, S. E. Neppelenbroek, F. R. Mooi, H. C. Rumke, and M. A. Conyn-van Spaendonck. 2000. Reemergence of pertussis in the highly vaccinated population of the Netherlands: observations on surveillance data. Emerg Infect Dis 6:348-357. 24. Deeb, B. J., R. F. DiGiacomo, B. L. Bernard, and S. M. Silbernagel. 1990. Pasteurella multocida and Bordetella bronchiseptica infections in rabbits. J Clin Microbiol 28:70-75. 25. Diavatopoulos, D. A., C. A. Cummings, H. G. van der Heide, M. van Gent, S. Liew, D. A. Relman, and F. R. Mooi. 2006. Characterization of a highly conserved island in the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J Bacteriol 188:8385-8394.
13 26. Dorbecker, C., C. Licht, F. Korber, G. Plum, C. Haefs, B. Hoppe, and H. Seifert. 2007. Community-acquired pneumonia due to Bordetella holmesii in a patient with frequently relapsing nephrotic syndrome. J Infect 54:e203-205. 27. Farrington, D. O., and W. P. Switzer. 1979. Parenteral vaccination of young swine against Bordetella bronchiseptica. Am J Vet Res 40:1347-1351. 28. Fuchslocher, B., L. L. Millar, and P. A. Cotter. 2003. Comparison of bipA alleles within and across Bordetella species. Infect Immun 71:3043-3052. 29. Gerlach, G., S. Janzen, D. Beier, and R. Gross. 2004. Functional characterization of the BvgAS two-component system of Bordetella holmesii. Microbiology 150:3715-3729. 30. Gerlach, G., F. von Wintzingerode, B. Middendorf, and R. Gross. 2001. Evolutionary trends in the genus Bordetella. Microbes Infect 3:61-72. 31. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O antigen protects Bordetella parapertussis from complement. Infect Immun 76:1774-1780. 32. Goebel, E. M., X. Zhang, and E. T. Harvill. 2009. Bordetella pertussis infection or vaccination substantially protects mice against B. bronchiseptica infection. PLoS One 4:e6778. 33. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-738. 34. Goodnow, R. A., F. J. Shade, and W. P. Switzer. 1979. Efficacy of Bordetella bronchiseptica bacterin in controlling enzootic atrophic rhinitis in swine. Am J Vet Res 40:58-60. 35. Greig, J. R., S. S. Gunda, and J. T. C. Kwan. 2001. Bordetella holmesii bacteraemia in an individual on haemodialysis. Scand J Infect Dis 33:716-717. 36. Harvill, E. T., P. A. Cotter, and J. F. Miller. 1999. Pregenomic comparative analysis between bordetella bronchiseptica RB50 and Bordetella pertussis tohama I in murine models of respiratory tract infection. Infect Immun 67:6109-6118. 37. Harvill, E. T., and J. F. Miller. 2000. Manipulating the host to study bacterial virulence. Curr Opin Microbiol 3:93-96. 38. Heininger, U., Stehr, K., Schmitt-Grohe, S., Lorenz, C., Rost, R., Christenson, P.D., Uberall, M., and Cherry, J.D. 1994. Clinical characteristics of illness caused by Bordetella parapertussis compared with illness caused by Bordetella pertussis. Pediatr Infect Dis J 13:306-309. 39. Higgins, S. C., E. C. Lavelle, C. McCann, B. Keogh, E. McNeela, P. Byrne, B. O'Gorman, A. Jarnicki, P. McGuirk, and K. H. Mills. 2003. Toll-like receptor 4-mediated innate IL-10 activates antigen-specific regulatory T cells and confers resistance to Bordetella pertussis by inhibiting inflammatory pathology. J Immunol 171:3119-3127. 40. Hoppe, J. E. 1999. Update on respiratory infection caused by Bordetella parapertussis. Pediatr Infect Dis J 18:375-381. 41. Irie, Y., S. Mattoo, and M. H. Yuk. 2004. The Bvg virulence control system regulates biofilm formation in Bordetella bronchiseptica. J Bacteriol 186:5692-5698. 42. Katada, T., M. Tamura, and M. Ui. 1983. The A protomer of islet-activating protein, pertussis toxin, as an active peptide catalyzing ADP-ribosylation of a membrane protein. Arch Biochem Biophys 224:290-298. 43. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T. Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated clearance of Bordetella pertussis. J Clin Invest 115:3594-3601. 44. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in immunity to Bordetella infections. Infect Immun 71:1719-1724. 45. Kirimanjeswara, G. S., P. B. Mann, M. Pilione, M. J. Kennett, and E. T. Harvill. 2005. The complex mechanism of antibody-mediated clearance of Bordetella from the lungs requires TLR4. J Immunol 175:7504-7511. 46. Leef, M., K. L. Elkins, J. Barbic, and R. D. Shahin. 2000. Protective immunity to Bordetella pertussis requires both B cells and CD4(+) T cells for key functions other than specific antibody production. J Exp Med 191:1841-1852. 47. Letowska, I., and W. Hryniewicz. 2004. Epidemiology and characterization of Bordetella parapertussis strains isolated between 1995 and 2002 in and around Warsaw, Poland. Eur J Clin Microbiol Infect Dis 23:499-501. 48. Liese JG, R. C., Stojanov S, Belohradsky BH; Munich Vaccine Study Group. . 2003. Clinical and epidemiological picture of B pertussis and B parapertussis infections after introduction of acellular pertussis vaccines. Arch Dis Child 88:684-687. 49. Lindquist, S. W., D. J. Weber, M. E. Mangum, D. G. Hollis, and J. Jordan. 1995. Bordetella holmesii sepsis in an asplenic adolescent. Pediatr Infect Dis J 14:813-815. 50. Mahon, B. P., M. T. Brady, and K. H. Mills. 2000. Protection against Bordetella pertussis in mice in the absence of detectable circulating antibody: implications for long-term immunity in children. J Infect Dis 181:2087-2091. 51. Mahon, B. P., and K. H. Mills. 1999. Interferon-gamma mediated immune effector mechanisms against Bordetella pertussis. Immunol Lett 68:213-217.
14 52. Mahon, B. P., M. S. Ryan, F. Griffin, and K. H. Mills. 1996. Interleukin-12 is produced by macrophages in response to live or killed Bordetella pertussis and enhances the efficacy of an acellular pertussis vaccine by promoting induction of Th1 cells. Infect Immun 64:5295-5301. 53. Mahon, B. P., B. J. Sheahan, F. Griffin, G. Murphy, and K. H. Mills. 1997. Atypical disease after Bordetella pertussis respiratory infection of mice with targeted disruptions of interferon-gamma receptor or immunoglobulin mu chain genes. J Exp Med 186:1843-1851. 54. Maixnerova, M. 2003. The 2001 serological survey in the Czech Republic--parapertussis. Cent Eur J Public Health 11 Suppl:S23-24. 55. Mann, P. B., K. D. Elder, M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4-dependent early elicited tumor necrosis factor alpha expression is critical for innate host defense against Bordetella bronchiseptica. Infect Immun 72:6650-6658. 56. Mann, P. B., M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4 is critical to innate host defense in a murine model of bordetellosis. J Infect Dis 189:833-836. 57. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 58. Marchitto, K. S., S. G. Smith, C. Locht, and J. M. Keith. 1987. Nucleotide sequence homology to pertussis toxin gene in Bordetella bronchiseptica and Bordetella parapertussis. Infect Immun 55:497-501. 59. Martino, A., E. Volpe, G. Auricchio, V. Colizzi, and P. M. Baldini. 2006. Influence of pertussis toxin on CD1a isoform expression in human dendritic cells. J Clin Immunol 26:153-159. 60. Mastrantonio, P., M. Giuliano, P. Stefanelli, T. Sofia, L. De Marzi, G. Tarabini, M. Quarto, and A. Moiraghi. 1997. Bordetella parapertussis infections. Dev Biol Stand 89:255-259. 61. Mastrantonio, P., Stefanelli, P., Giulano, M., Herrera Rojas, Y., Ciofi degli Atti, M., Anemona, A., and Tozzi, A.E. 1998. Bordetella parapertussis infection in children: epidemiology, clinical symptoms, and molecular characteristics of isolates. J Clin Microbiol 36:999-1002. 62. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 63. Mazengia, E., E. A. Silva, J. A. Peppe, R. Timperi, and H. George. 2000. Recovery of Bordetella holmesii from patients with pertussis-like symptoms: use of pulsed-field gel electrophoresis to characterize circulating strains. J Clin Microbiol 38:2330-2333. 64. McCavit, T. L., S. Grube, P. Revell, and C. T. Quinn. 2008. Bordetella holmesii bacteremia in sickle cell disease. Pediatr Blood Cancer 51:814-816. 65. Melton, A. R., and A. A. Weiss. 1993. Characterization of environmental regulators of Bordetella pertussis. Infect Immun 61:807-815. 66. Melton, A. R., and A. A. Weiss. 1989. Environmental regulation of expression of virulence determinants in Bordetella pertussis. J Bacteriol 171:6206-6212. 67. Merkel, T. J., and S. Stibitz. 1995. Identification of a locus required for the regulation of bvg-repressed genes in Bordetella pertussis. J Bacteriol 177:2727-2736. 68. Mielcarek, N., G. Riveau, F. Remoue, R. Antoine, A. Capron, and C. Locht. 1998. Homologous and heterologous protection after single intranasal administration of live attenuated recombinant Bordetella pertussis. Nat Biotechnol 16:454-457. 69. Miller, J. F., C. R. Roy, and S. Falkow. 1989. Analysis of Bordetella pertussis virulence gene regulation by use of transcriptional fusions in Escherichia coli. J Bacteriol 171:6345-6348. 70. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect 3:655-677. 71. Monnier, S., A. Therby, B. Couzon, F. Doucet-Populaire, and A. Greder-Belan. 2009. [Bordetella holmesii bacteremia in a 26-year-old patient with sickle cell disease.]. Med Mal Infect. 72. Munoz, J. J., H. Arai, R. K. Bergman, and P. L. Sadowski. 1981. Biological activities of crystalline pertussigen from Bordetella pertussis. Infect Immun 33:820-826. 73. Musser, J. M., E. L. Hewlett, M. S. Peppler, and R. K. Selander. 1986. Genetic diversity and relationships in populations of Bordetella spp. J Bacteriol 166:230-237. 74. Njamkepo, E., F. Delisle, I. Hagege, G. Gerbaud, and N. Guiso. 2000. Bordetella holmesii isolated from a patient with sickle cell anemia: analysis and comparison with other Bordetella holmesii isolates. Clin Microbiol Infect 6:131-136. 75. Parkhill, J., et. al. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 76. Pejsak, Z., B. Wasinska, I. Markowska-Daniel, and A. Hogg. 1994. Field evaluation of thirteen regimens for the control of progressive atrophic rhinitis. Comp Immunol Microbiol Infect Dis 17:125-132. 77. Pilione, M. R., L. M. Agosto, M. J. Kennett, and E. T. Harvill. 2006. CD11b is required for the resolution of inflammation induced by Bordetella bronchiseptica respiratory infection. Cell Microbiol 8:758-768.
15 78. Probert, W. S., J. Ely, K. Schrader, J. Atwell, A. Nossoff, and S. Kwan. 2008. Identification and evaluation of new target sequences for specific detection of Bordetella pertussis by real-time PCR. J Clin Microbiol 46:3228- 3231. 79. Reischl, U., N. Lehn, G. N. Sanden, and M. J. Loeffelholz. 2001. Real-time PCR assay targeting IS481 of Bordetella pertussis and molecular basis for detecting Bordetella holmesii. J Clin Microbiol 39:1963-1966. 80. Rota, M. C., F. D'Ancona, M. Massari, D. Mandolini, A. Giammanco, P. Carbonari, S. Salmaso, and M. L. Ciofi degli Atti. 2005. How increased pertussis vaccination coverage is changing the epidemiology of pertussis in Italy. Vaccine 23:5299-5305. 81. Roy, C. R., J. F. Miller, and S. Falkow. 1989. The bvgA gene of Bordetella pertussis encodes a transcriptional activator required for coordinate regulation of several virulence genes. J Bacteriol 171:6338-6344. 82. Russell, F. M., J. M. Davis, M. J. Whipp, P. H. Janssen, P. B. Ward, J. R. Vyas, M. Starr, S. M. Sawyer, and N. Curtis. 2001. Severe Bordetella holmesii infection in a previously healthy adolescent confirmed by gene sequence analysis. Clin Infect Dis 33:129-130. 83. Shashidhar, B. Y., N. R. Underdahl, and T. E. Socha. 1983. Serologic survey for Bordetella bronchiseptica in Nebraska specific-pathogen-free pigs. Am J Vet Res 44:1123-1125. 84. Shepard, C. W., M. I. Daneshvar, R. M. Kaiser, D. A. Ashford, D. Lonsway, J. B. Patel, R. E. Morey, J. G. Jordan, R. S. Weyant, and M. Fischer. 2004. Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin Infect Dis 38:799-804. 85. Shumilla, J. A., V. Lacaille, T. M. Hornell, J. Huang, S. Narasimhan, D. A. Relman, and E. D. Mellins. 2004. Bordetella pertussis infection of primary human monocytes alters HLA-DR expression. Infect Immun 72:1450- 1462. 86. Skowronski, D. M., G. De Serres, D. MacDonald, W. Wu, C. Shaw, J. Macnabb, S. Champagne, D. M. Patrick, and S. A. Halperin. 2002. The changing age and seasonal profile of pertussis in Canada. J Infect Dis 185:1448- 1453. 87. Stibitz, S. 1994. Mutations in the bvgA gene of Bordetella pertussis that differentially affect regulation of virulence determinants. J Bacteriol 176:5615-5621. 88. Stockbauer, K. E., B. Fuchslocher, J. F. Miller, and P. A. Cotter. 2001. Identification and characterization of BipA, a Bordetella Bvg-intermediate phase protein. Mol Microbiol 39:65-78. 89. Tang, Y. W., M. K. Hopkins, C. P. Kolbert, P. A. Hartley, P. J. Severance, and D. H. Persing. 1998. Bordetella holmesii-like organisms associated with septicemia, endocarditis, and respiratory failure. Clin Infect Dis 26:389-392. 90. Trollfors, B., T. Lagergard, J. Taranger, E. Bergfors, R. Schneerson, and J. B. Robbins. 2001. Serum immunoglobulin G antibody responses to Bordetella pertussis lipooligosaccharide and B. parapertussis lipopolysaccharide in children with pertussis and parapertussis. Clin Diagn Lab Immunol 8:1015-1017. 91. van den Akker, W. M. 1998. Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144:1527-1535. 92. van der Zee, A., H. Groenendijk, M. Peeters, and F. R. Mooi. 1996. The differentiation of Bordetella parapertussis and Bordetella bronchiseptica from humans and animals as determined by DNA polymorphism mediated by two different insertion sequence elements suggests their phylogenetic relationship. Int J Syst Bacteriol 46:640-647. 93. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J Bacteriol 179:6609-6617. 94. von Konig, C. H., S. Halperin, M. Riffelmann, and N. Guiso. 2002. Pertussis of adults and infants. Lancet Infect Dis 2:744-750. 95. Watanabe M, N. M. 2004. Whooping cough due to Bordetella parapertussis: an unresolved problem. Expert Rev Anti Infect Ther 2:447-454. 96. Wendelboe, A. M., and A. Van Rie. 2006. Diagnosis of pertussis: a historical review and recent developments. Expert Rev Mol Diagn 6:857-864. 97. Weyant, R. S., D. G. Hollis, R. E. Weaver, M. F. Amin, A. G. Steigerwalt, S. P. O'Connor, A. M. Whitney, M. I. Daneshvar, C. W. Moss, and D. J. Brenner. 1995. Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. J Clin Microbiol 33:1-7. 98. Wirsing von Konig, C. H., S. Postels-Multani, H. L. Bock, and H. J. Schmitt. 1995. Pertussis in adults: frequency of transmission after household exposure. Lancet 346:1326-1329. 99. Wirsing von Konig, C. H., and H. J. Schmitt. 1996. Epidemiologic aspects and diagnostic criteria for a protective efficacy field trial of a pertussis vaccine. J Infect Dis 174 Suppl 3:S281-286. 100. Wolfe, D. N., A. M. Buboltz, and E. T. Harvill. 2009. Inefficient Toll-like receptor-4 stimulation enables Bordetella parapertussis to avoid host immunity. PLoS ONE 4:e4280.
16 101. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 102. Wolfe, D. N., A. T. Karanikas, S. E. Hester, M. J. Kennett, and E. T. Harvill. 2009. IL-10 Induction by Bordetella parapertussis Limits a Protective IFN-{gamma} Response. J Immunol. 103. Wolfe DN, K. G., Harvill ET. . 2005. Clearance of Bordetella parapertussis from the lower respiratory tract requires humoral and cellular immunity. Infect Immun 73:6508-6513. 104. Wolfe, D. N., G. S. Kirimanjeswara, E. M. Goebel, and E. T. Harvill. 2007. Comparative role of immunoglobulin A in protective immunity against the Bordetellae. Infect Immun 75:4416-4422. 105. Wolfe, D. N., P. B. Mann, A. M. Buboltz, and E. T. Harvill. 2007. Delayed role of tumor necrosis factor- alpha in overcoming the effects of pertussis toxin. J Infect Dis 196:1228-1236. 106. Woolfrey, B. F., and J. A. Moody. 1991. Human infections associated with Bordetella bronchiseptica. Clin Microbiol Rev 4:243-255. 107. Yih, W. K., E. A. Silva, J. Ida, N. Harrington, S. M. Lett, and H. George. 1999. Bordetella holmesii-like organisms isolated from Massachusetts patients with pertussis-like symptoms. Emerg Infect Dis 5:441-443. 108. Yuk, M. H., U. Heininger, G. Martinez de Tejada, and J. F. Miller. 1998. Human but not ovine isolates of Bordetella parapertussis are highly clonal as determined by PCR-based RAPD fingerprinting. Infection 26:270- 273. 109. Zhang, X., E. M. Goebel, M. E. Rodriguez, A. Preston, and E. T. Harvill. 2009. The O antigen is a critical antigen for the development of a protective immune response to Bordetella parapertussis. Infect Immun 77:5050-5058. 110. Zhang, X., M. E. Rodriguez, and E. T. Harvill. 2009. O Antigen Allows B. parapertussis to Evade B. pertussis Vaccine-Induced Immunity by Blocking Binding and Functions of Cross-Reactive Antibodies. PLoS One 4:e6989.
17
Chapter 2
The O-antigen Is a Critical Antigen for the Development of a Protective Immune
Response to Bordetella parapertussis
Abstract:
Despite excellent vaccine coverage in developed countries, whooping cough is a reemerging disease that can be caused by two closely related pathogens, Bordetella pertussis and B. parapertussis. The two are antigenically distinct, and current vaccines, containing only B. pertussis-derived antigens, confer efficient protection against B. pertussis but not against B. parapertussis. B. pertussis does not express the O-antigen, while B. parapertussis retains it as a dominant surface antigen. Since the O-antigen is a protective antigen for many pathogenic bacteria, we examined whether this factor is a potential protective antigen for B. parapertussis. In a mouse model of infection, immunization with wild-type B. parapertussis elicited a strong antibody response to the O-antigen and conferred efficient protection against a subsequent B. parapertussis challenge. However, immunization with an isogenic mutant lacking the O-antigen, B. parapertussis∆wbm, induced antibodies that recognized other antigens but did not efficiently mediate opsonophagocytosis of B. parapertussis. The passive transfer of sera raised against B. parapertussis, but not B. parapertussis∆wbm, reduced B. parapertussis loads in the lower respiratory tracts of mice. The addition of 10 µg of purified B. parapertussis lipopolysaccharide (LPS), which contains the O-antigen, but not B. parapertussis∆wbm LPS drastically improved the efficacy of the acellular vaccine Adacel against B. parapertussis. These data suggest that the O-antigen is a critical protective antigen of B. parapertussis and its inclusion can substantially improve whooping cough vaccine efficacy against this pathogen.
18 Introduction:
Bordetella pertussis and B. parapertussis are the causative agents of whooping cough, resulting in approximately 50 million cases and 300,000 deaths annually worldwide (28). While whooping cough is considered by the CDC to be a reemerging disease (5), the relative incidences of B. pertussis and B. parapertussis are not clear (50). It is known, however, that the resurgence of whooping cough roughly correlates with the introduction of acellular pertussis vaccines (5). These vaccines contain only B. pertussis- derived antigens and confer little to no protection against B. parapertussis (9, 14, 15, 23, 27, 28). Current acellular pertussis vaccines contain some combination of filamentous hemagglutinin, pertactin, and fimbriae 2 and 3, all of which are expressed by both B. pertussis and B. parapertussis, and pertussis toxin, which is B. pertussis specific (33, 34). Based on genome sequences, the levels of amino acid sequence identity between
B. pertussis and B. parapertussis filamentous hemagglutinin, pertactin, and fimbria 2 and 3 proteins are about
98, 91, 71, and 92% (35), and antibodies raised against these antigens from B. pertussis cross-react with B. parapertussis (17, 31). However, immunization with purified B. pertussis filamentous hemagglutinin or pertactin does not confer protection against B. parapertussis (17). B. pertussis fimbriae confer some protection against B. parapertussis, but at much lower levels than they protect against B. pertussis (52).
Based on these observations and the fact that B. parapertussis infection induces protective immunity to itself
(56, 58), we hypothesized that the lack of protective antigens from B. parapertussis may be part of the reason why current whooping cough vaccines are ineffective against this bacterium.
Although B. pertussis and B. parapertussis are very closely related (8, 35, 48), they differ in the structure of their lipopolysaccharides (LPS) (1, 2, 39, 40, 47). B. pertussis produces a lipooligosaccharide containing lipid A and a branched-chain core oligosaccharide with a complex trisaccharide modification but lacks the O-antigen due to a natural deletion of the wbm locus responsible for its synthesis (39, 47). B. parapertussis LPS is similar to B. pertussis LPS but lacks the trisaccharide modification and includes an O- antigen (39, 40). In addition to conferring serum resistance by inhibiting C3 deposition onto the surfaces of bacteria (11), the O-antigen enables B. parapertussis to avoid B. pertussis-induced immunity by preventing antibody binding to cross-reactive antigens on the surfaces of B. parapertussis cells (56, 59). Since the O- antigen is one dominant surface antigen recognized by B. parapertussis immune sera (56) and has been
19 shown previously to be a protective antigen of various pathogenic bacteria (22, 36), we hypothesized that the
O-antigen is a protective antigen of B. parapertussis.
To assess the role of the O-antigen in the generation of an adaptive immune response to B. parapertussis, the immunity and protection generated by B. parapertussis infection or vaccination were compared to those generated by an isogenic mutant of B. parapertussis lacking the O-antigen (∆wbm) (39).
Animals immunized with B. parapertussis, but not B. parapertussis∆wbm, were protected against subsequent challenge with B. parapertussis. Mice immunized with B. parapertussis∆wbm were also deficient in the production of B. parapertussis-specific antibodies, and sera collected from these mice were less effective at reducing B. parapertussis colonization upon passive transfer than sera raised against B. parapertussis. The inclusion of LPS from B. parapertussis, but not from B. parapertussis∆wbm, rendered the acellular B. pertussis vaccine Adacel efficacious against B. parapertussis challenge. Together, these data indicate that the
O-antigen is an important protective antigen of B. parapertussis.
20 Materials and Methods:
Bacterial strains and growth. B. pertussis strain 536, B. parapertussis strain CN2591, and the isogenic B. parapertussis mutant strain lacking the O-antigen, CN2591∆wbm, have been described previously (39, 46).
For opsonization, attachment, and phagocytosis experiments, these strains were transformed with plasmid pCW505 (kindly supplied by Alison Weiss, Cincinnati, OH), which induces cytoplasmic expression of green fluorescent protein (GFP) without affecting growth or antigen expression (51). Bacteria were maintained on
Bordet-Gengou agar (Difco) supplemented with 10% sheep blood (Hema Resources) and 20 µg/ml streptomycin (Sigma-Aldrich). Liquid cultures were grown overnight on a roller drum at 37°C to mid-log phase in Stainer-Scholte broth (44, 49).
Cells. Peripheral blood polymorphonuclear leukocytes (PMNs) were isolated from human donors’ heparinized venous blood by using Ficoll-Histopaque (Sigma, St. Louis, MO) gradient centrifugation. PMNs were harvested, and the remaining erythrocytes were removed by hypotonic lysis. Cell viability was >99% as determined by trypan blue exclusion. Prior to functional assays, PMNs were washed twice with Dulbecco’s modified Eagle medium (HyClone) supplemented with 10% fetal calf serum (HyClone) and resuspended, and the cells were used immediately. All experiments were carried out with freshly isolated PMNs lacking FcγRI
(CD64) expression, as monitored by fluorescence-activated cell sorter analysis using a FACScan flow cytometer (Becton Dickinson, San Jose, CA) with anti-FcγRI monoclonal antibody 22 (41).
Opsonization. GFP-expressing strains were opsonized by incubation at 37°C for 30 min in a final volume of
50 µl containing 5% heat-inactivated serum samples from naïve C3-/- mice or convalescent C3-/- mice challenged with CN2591 or CN2591∆wbm. Serum-opsonized bacteria were incubated with Rphycoerythrin
(RPE)-labeled goat F(ab’)2 fragments of anti-mouse immunoglobulin G (IgG; Southern Biotechnology,
Birmingham, AL) for 30 min at 4°C. The opsonization of each strain was assessed by fluorescence-activated cell sorter analysis (43).
Attachment and phagocytosis. Attachment and phagocytosis of the B. parapertussis strains were evaluated as described previously, with a few modifications (42). Briefly, serum-opsonized, GFP-expressing bacteria were subsequently incubated with PMNs at a multiplicity of infection of 30 for 20 min at 37°C to allow binding. In selected experiments, 200 ng/ml cytochalasin D (Sigma-Aldrich) was added to inhibit
21 phagocytosis. After extensive washing to remove unattached bacteria, an aliquot was maintained on ice to be used as a bacterial attachment control. Another aliquot was further incubated for 1 h at 37°C to allow internalization. Phagocytosis was stopped by placing PMNs on ice. Cell surface-bound bacteria in both aliquots (obtained before and after 1 h of incubation at 37°C) were detected by incubation with RPE-labeled goat F(ab’)2 fragments of antimouse IgG at 4°C for 30 min. To avoid eventual cytophilic binding of antibodies, all incubations were done in the presence of 25% heat-inactivated human serum. After being washed, samples were analyzed by flow cytometry. Ten thousand cells per sample were analyzed. Green fluorescence intensity associated with PMNs maintained at 37°C for 20 min was determined to indicate the level of bacterial attachment. The decrease in red fluorescence after incubation for 1 h at 37°C reflects bacterial phagocytosis. Phagocytosis was calculated from the drop in the mean red fluorescence intensity of green fluorescence-positive cells as described previously (42).
Animal experiments. C57BL/6 mice were obtained from Jackson Laboratories. C3-/- mice were kind gifts from Rick Wetsel and have been described elsewhere (7). All mice were bred in our Bordetella-free, specific- pathogen-free breeding rooms at The Pennsylvania State University. Four- to six-week-old mice were sedated with 5% isoflurane (Abbott Laboratory) in oxygen and inoculated by pipetting of 50 µl of phosphate- buffered saline (PBS; Omnipur) containing 5 × 105 CFU of bacteria onto the external nares (18). This method reliably distributes the bacteria throughout the respiratory tract (13). For rechallenge experiments, mice were treated with gentamicin in drinking water (10 mg/ml) for 7 days starting on day 21 postinoculation (57).
Mice were challenged with 5 × 105 CFU of bacteria on day 30 postinoculation and dissected 3 days postchallenge (57). For passive transfer of sera, 200 µl serum samples (collected on day 28 postinoculation) from naïve or convalescent C3-/- mice were intraperitoneally (i.p.) injected at the time of inoculation (19, 38).
For vaccination, mice were i.p. injected with 108 CFU of heat-killed CN2591 or CN2591∆wbm in 200 µl of
PBS with Imject Alum adjuvant (Pierce) on days 0 and 14. For acellular B. pertussis vaccinations, mice were i.p. injected with one-fifth of a human dose of Adacel (Sanofi Pasteur; 0.5 µg of pertussis toxin, 1 µg of filamentous hemagglutinin, 0.6 µg of pertactin, and a 5-µg mixture of fimbriae 2 and 3 per mouse) in a 200-µl volume containing PBS and Imject Alum adjuvant with or without 10 µg of purified CN2591 LPS or
CN2591∆wbm LPS (45) on days 0 and 14. Vaccinated mice were challenged with bacteria on day 28. Mice
22 were sacrificed via CO2 inhalation, and the lungs, tracheae, and nasal cavities were excised. Tissues were homogenized in PBS, serially diluted, and plated onto Bordet-Gengou agar, and colonies were counted after incubation at 37°C for 3 to 4 days (25). All protocols were reviewed and approved by The Pennsylvania State
University Institutional Animal Care and Use Committee, and all animals were handled in accordance with institutional guidelines.
Splenocyte restimulations. Spleens were taken from C57BL/6 mice immunized with CN2591 or
CN2591∆wbm on day 28 postinoculation. Splenocytes were isolated as described previously (25, 37). In brief, spleens were homogenized and red blood cells were lysed by 0.84% ammonium chloride treatment.
Aliquots of cells (2 × 106) were resuspended in Dulbecco’s modified Eagle medium supplemented with 10% fetal calf serum, 1 mM sodium pyruvate (HyClone), and 100 µg/ml penicillin-streptomycin (HyClone) and placed into each well of a 96-well tissue culture plate. Splenocytes were stimulated with either medium alone or medium containing 107 CFU of heat-killed CN2591 or CN2591∆wbm (multiplicity of infection of 5) (37).
After 3 days, the supernatants were collected and analyzed for gamma interferon (IFN-γ) and interleukin-10
(IL-10) production via enzyme-linked immunosorbent assays (ELISAs) per the instructions of the manufacturer (R&D Systems).
Titer ELISAs. Antibody titers were determined as described previously (25, 56). In brief, exponential-phase live CN2591 or CN2591∆wbm bacteria were diluted to 5 × 107 CFU/ml in a 1:1 mix of 0.2 M sodium carbonate and 0.2 M sodium bicarbonate buffers. The wells of 96-well plates were coated with these antigens, and the plates were incubated for 2 h at 37°C in a humidified chamber and then washed and blocked. Serum samples from individual mice were diluted 1:50, added to the first wells of the plates, and serially diluted 1:2 across the plates, and the plates were incubated for 2 h at 37°C. Plates were washed, probed with a 1:4,000 dilution of goat anti-mouse Ig horseradish peroxidase-conjugated antibodies (Southern
Biotech) for 1 h, and washed again prior to visualization with 2,2’-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt in phosphate-citrate buffer with hydrogen peroxide at an absorbance of 405 nm.
Titers were determined via the end point method based on optical densities in identically treated wells probed with naïve sera.
23 Western blot analysis. Lysates containing 107 CFU of heat-killed CN2591 or CN2591 ∆wbm were run on
10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels under denaturing conditions.
Polyvinylidene difluoride membranes (Millipore) were probed overnight with either naïve sera or sera from
CN2591- or CN2591∆wbm-inoculated mice at a 1:500 dilution. Goat anti-mouse Ig horseradish peroxidase- conjugated antibodies (Southern Biotech) were used at a dilution of 1:10,000 as the detector antibody (56,
57). The membrane was visualized with enhanced chemiluminescence Western blotting detection reagent
(Pierce Biotechnology).
Statistical analysis. The mean ± standard error was determined for all appropriate data. Two-tailed, unpaired Student’s t tests were used to determine the statistical significance of differences between groups.
All experiments were performed at least twice with similar results.
24 Results:
The O-antigen is required for efficient generation of protective immunity against B. parapertussis infection.
To determine whether the O-antigen contributes to the generation of B. parapertussis infection-induced protective immunity against secondary challenge, mice were intranasally inoculated with either B. parapertussis or B. parapertussis∆wbm and challenged with either B. parapertussis or B. parapertussis∆wbm. Naïve animals challenged with wild-type B. parapertussis had mean loads of 106.2,
106.1, and 106.7 CFU in the nasal cavity, trachea, and lungs on day 3 postchallenge (Fig. 2.1, black bars).
Mice previously inoculated with B. parapertussis were substantially immune to subsequent challenge, harboring approximately 103 CFU in the nasal cavity, and had cleared the bacteria from both the trachea and Figure 2.1: The O-antigen contributes to the lungs by 3 days postchallenge (Fig. 2.1, white bars). generation of protective immunity to B. parapertussis. Groups of four C57BL/6 mice were inoculated with B. parapertussis (Bpp) or B. Prior infection with B. parapertussis and B. parapertussis∆wbm (Bpp∆wbm) and allowed to convalesce. Naïve and immunized mice were parapertussis∆wbm conferred similar levels of protection challenged with the indicated bacteria. The numbers of CFU recovered from the nasal cavities, tracheae, in the lower respiratory tract (LRT) against subsequent and lungs at day 3 postchallenge are expressed as the log10 means ± the standard errors. * indicates a P B. parapertussis∆wbm challenge (Fig. 2.1, right). value of <0.05 for comparison to results for naïve mice; ‡‡ indicates a P value of <0.01. The limit of detection is indicated by the y axis. Interestingly, B. parapertussis infection induced more protection against the O-antigen-deficient strain in the nasal cavity than B. parapertussis∆wbm infection did
(Fig. 2.1, top right). However, mice immunized with B. parapertussis∆wbm harbored at least 8,000-fold more
B. parapertussis bacteria in the lungs, 104.9 CFU, than B. parapertussis- immunized mice (P < 0.01) (Fig. 2.1, bottom), indicating that the mutant lacking the O-antigen did not induce effective protective immunity.
25 Effective vaccine-induced immunity requires a response against the O-antigen.
B. parapertussis∆wbm is known to colonize at a lower level than B. parapertussis in the presence of complement (11), raising the possibility that its defect in colonization contributes to the decreased protection against subsequent challenge (Fig. 2.1). To deliver equivalent amounts of antigens, mice were vaccinated with heat-killed B. parapertussis or B. Figure 2.2: A response against the O antigen contributes to effective vaccine-induced parapertussis∆wbm. Sham-vaccinated control mice immunity. Groups of four C57BL/6 mice were vaccinated with adjuvant only, B. parapertussis with challenged with B. parapertussis harbored 106.4, 105.8, adjuvant (Bpp), or B. parapertussis∆wbm with adjuvant (Bpp∆wbm) and challenged with B. and 106.8 CFU in the nasal cavity, trachea, and lungs 3 parapertussis. The numbers of CFU recovered from the nasal cavities, tracheae, and lungs at day 3 postchallenge are expressed as the log10 means ± the days later (Fig. 2.2, black bars). Vaccination with B. standard errors. * indicates a P value of <0.05 for comparison to results for mice vaccinated with parapertussis effectively decreased B. parapertussis adjuvant only; ‡‡ indicates a P value of <0.01. The limit of detection is indicated by the y axis. numbers by 99.99% in the LRT and by 80% in the nasal cavity (Fig. 2.2, white bars). Although vaccination with B. parapertussis∆wbm reduced B. parapertussis numbers in the LRT (Fig. 2.2, striped bars), animals vaccinated with B. parapertussis∆wbm had 160-, 16-, and 3-fold more bacteria in the lungs, trachea, and nasal cavity than B. parapertussis vaccinated animals (Fig.
2.2). This decreased protection conferred by B. parapertussis∆wbm vaccination further strengthens the conclusion that the O-antigen is required for the efficient generation of an adaptive immune response against
B. parapertussis.
The O-antigen is not required for the development of splenic IFN-γ and IL-10 responses to B. parapertussis.
Since the O-antigen contributes to the generation of efficient protective immunity against B. parapertussis, we investigated whether the O-antigen is involved in the generation of a T-cell response.
Splenocytes from naïve or B. parapertussis- or B. parapertussis∆wbm-vaccinated mice were stimulated with medium alone or with heat-killed B. parapertussis or B. parapertussis∆wbm, and 3 days later, IFN-γ and IL-
10 concentrations in the culture supernatants were measured. Vaccination with either strain resulted in
26 Figure 2.3: The O antigen is not required for the development of splenic IFN-γ or IL-10 responses to B. parapertussis. Splenocytes from groups of four C57BL/6 mice vaccinated with adjuvant only, B. parapertussis with adjuvant (Bpp Vac), or B. parapertussis∆wbm with adjuvant (Bpp∆wbm Vac) were stimulated with the indicated bacteria, and the resulting IFN-γ and IL-10 production levels are expressed as mean concentrations ± standard errors. * indicates a P value of <0.05 for comparison to results for medium-stimulated groups. B.p.p., wildtype B. parapertussis; B.p.p.∆wbm, B. parapertussis∆wbm. Elizabeth M. Goebel contributed to this experiment.
increased IFN-γ and IL-10 production. There was no
significant difference in IFN-γ or IL-10 production in
response to B. parapertussis or B. parapertussis∆wbm
between mice vaccinated with B. parapertussis and those vaccinated with B. parapertussis∆wbm (Fig. 2.3). Since the splenic IFN-γ and IL-10 responses are T- cell dependent (D. N. Wolfe, A. K. Karanikas, S. E. Hester, M. J. Kennett, and E. T. Harvill, in press), these data suggest that the O-antigen is not required for the generation of a T-cell response to B. parapertussis.
The O-antigen is required for the generation of an efficient antibody response against B. parapertussis.
Figure 2.4: The O-antigen contributes to the production of a robust anti-B. parapertussis antibody response. (A) Ig titers in sera from groups of four C57BL/6 mice immunized with B. parapertussis (B. parapertussis immune sera [B.p.p. IS]) or B. parapertussis∆wbm (B.p.p.∆wbm IS) supplemented with adjuvant were determined via B. parapertussis (B.p.p.)- or B. parapertussis∆wbm (B.p.p.∆wbm)-specific ELISAs. Titers are expressed as means ± standard errors. * indicates a P value of <0.05. (B) Lysates (107 CFU) from B. parapertussis (B.p.p.) or B. parapertussis∆wbm (B.p.p.∆wbm) were probed with naïve sera (NS), sera from B. parapertussis-immunized mice (B.p.p. IS), or sera from B. parapertussis∆wbm immunized mice (B.p.p.∆wbm IS), as indicated. Roman numerals to the right of the gel identify bands. Elizabeth M. Goebel conducted the experiment shown in Fig 2.4A.
As the O-antigen is required for the generation of anamnestic immunity to B. parapertussis but not an efficient T-cell response, we assessed whether the O-antigen contributes to efficient antibody generation. In
27 ELISAs using either strain as the antigen, B. parapertussis immune serum had significantly less recognition of the O-antigen mutant than of wild-type bacteria (Fig. 2.4A, left). B. parapertussis∆wbm immunization sera had similar Ig titers when probed with the wild-type and O-antigen mutant B. parapertussis strains (Fig. 2.4A, right). Sera raised against B. parapertussis∆wbm showed a 44% reduction in B. parapertussis-specific antibody titers compared to those in sera raised against B. parapertussis (Fig. 2.4A, first and third bars).
These data suggest that vaccination with B. parapertussis induces a robust antibody response against the O- antigen and that vaccination with B. parapertussis∆wbm induces an antibody response to other antigens that are shared.
To compare the antigens recognized by sera from different groups, Western blotting analyses were performed with lysates of B. parapertussis and B. parapertussis ∆wbm probed with naïve sera or B. parapertussis or B. parapertussis∆wbm immune sera (Fig. 2.4B). Naïve sera appeared to minimally bind antigens from either lysate (Fig. 2.4B, lanes 1 and 2). B. parapertussis-induced serum antibodies recognized a broad band or smear, band i, present in B. parapertussis lysate but not in B. parapertussis∆wbm lysate (Fig.
2.4B, lanes 3 and 4), suggesting that it represents LPS containing the O-antigen and that the O-antigen is one of the dominant antigens of B. parapertussis. Several higher-molecular-mass antigens shared by the two strains, for example, those represented by bands iii and iv, were also recognized by B. parapertussis immune serum antibodies. Interestingly, although B. parapertussis∆wbm-induced serum antibodies showed recognition of antigen(s) in band iii, these antibodies lacked recognition of antigen(s) in band iv and had strong recognition of additional antigen(s) in bands ii and v, not recognized by B. parapertussis-induced serum antibodies. As expected, the O-antigen (band i) was not recognized by B. parapertussis∆wbm-induced serum antibodies. Together, these data indicate that immunization with B. parapertussis induces a measurably stronger antibody response, dominated by the O-antigen, than that induced by B. parapertussis∆wbm and that immunization with B. parapertussis∆wbm induces a different antigen recognition profile from that induced by immunization with the wild-type counterpart.
The O-antigen contributes to the generation of antibodies that mediate opsonophagocytosis of B. parapertussis by PMNs.
28 To determine whether antibodies against the O-antigen are important for some key antibody functions, we assessed the opsonization of bacteria and subsequent attachment to, and phagocytosis by, PMNs mediated by antibodies raised against wild-type or O-antigen-deficient B. parapertussis. Because B. parapertussis∆wbm is not defective in colonization of mice lacking complement (11), sera were generated in complement deficient mice, thereby removing the difference in bacterial load as a factor affecting antibody production. Compared to the naïve sera, B. parapertussis immune sera mediated efficient opsonization of wild-type B. parapertussis and subsequent attachment to and phagocytosis by PMNs (Fig. 2.5, middle black bars). B. parapertussis immune sera were less effective against O-antigen-deficient B. parapertussis in all three assays (Fig. 2.5, middle white bars), suggesting that antibodies recognizing the O-antigen, rather than the shared antigens, are involved. Sera from mice immunized with O-antigen-deficient B. parapertussis were
similarly effective against the wild-type and O-
antigen-deficient strains (Fig. 2.5, right). Control
PMNs treated with cytochalasin, a phagocytosis
inhibitor, showed no phagocytosis (data not shown),
Figure 2.5: Generation of antibodies that mediate efficient opsonophagocytosis of B. parapertussis by PMNs requires the O antigen. GFP-expressing wild-type B. parapertussis (Bpp) or O-antigen-deficient B. parapertussis (Bpp∆wbm) was opsonized with naïve sera or sera from C3-/- mice challenged with B. parapertussis (B. parapertussis immune sera [B.p.p. IS]) or B. parapertussis∆wbm (B.p.p.∆wbm IS) and stained with RPE-labeled goat F(ab’)2 fragments of anti-mouse IgG. (A) Opsonization levels were measured as mean intensities ± standard errors of red fluorescence from bacteria opsonized with the indicated sera from four individual mice. (B) Opsonized bacteria were incubated with freshly isolated human peripheral blood PMNs for 20 min or 1 h and 20 min. Attachment levels were measured as mean intensities ± standard errors of green fluorescence associated with PMNs incubated for 20 min with bacteria opsonized by the indicated sera from four individual mice. (C) The cell surface-bound bacteria on PMNs were detected by incubation with RPE-labeled goat F(ab’)2 fragments of antimouse IgG. Mean phagocytosis levels ± standard errors were calculated from the drop in red fluorescence of green fluorescencepositive cells incubated for 1 h and 20 min compared to that of cells incubated for 20 min. Results were obtained from experiments done with four independent serum samples. AU indicates arbitrary units; * indicates a P value of <0.05; ** indicates a P value of <0.01. Maria Eugenia Rodriguez conducted this experiment.
29 indicating that although indirect, the assay measured phagocytosis. The observed high levels of activity of B. parapertussis immune sera against wild-type but not O-antigen-deficient B. parapertussis suggest that much of this activity is mediated by antibodies to the O-antigen.
The O-antigen is required for the generation of antibodies that efficiently clear B. parapertussis.
To determine if the decreased B.
parapertussis-specific antibody titers of, and
opsonophagocytosis mediated by, sera raised against
B. parapertussis∆wbm result in decreased antibody-
mediated clearance in vivo, mice received passively
transferred naïve sera or sera raised against wild-type
or O-antigen-deficient B. parapertussis in C3-/- mice.
Mice were then challenged with B. parapertussis and
sacrificed on day 14 postchallenge for bacterial
enumeration, since B. parapertussis poorly stimulates
Toll-like receptor 4 (TLR4) and antibodies therefore
Figure 2.6: Antibodies to the O antigen are required have no effect until around day 14 after T cells have for efficient antibody-mediated clearance of B. parapertussis. Groups of four C57BL/6 mice were been generated (19, 55; D. N. Wolfe, unpublished inoculated with B. parapertussis and i.p. injected with the indicated serum. Bacterial loads in the nasal data). Naïve sera had no effect on bacterial loads cavities, tracheae, and lungs at 14 days postinoculation are expressed as the log10 means ± standard errors. * throughout the respiratory tract on day 14 indicates a P value of <0.05 for comparison between results for groups receiving naïve serum (NS) and B. parapertussis immune serum. ‡ indicates a P value of postchallenge (Fig. 2.6). As seen in previous studies <0.05 for comparison between results for groups receiving B. parapertussis∆wbm immune serum (19, 56), B. parapertussis immune sera decreased the (B.p.p.∆wbm IS) and wild-type B. parapertussis immune serum (B.p.p. IS). The limit of detection is indicated by bacterial loads in the trachea and lungs by 96 and the y axis. Elizabeth M. Goebel contributed to this experiment. 99.6% at this time point. However, B. parapertussis∆wbm immune sera failed to significantly reduce B. parapertussis colonization, indicating that the O-antigen is required for the generation of antibodies that clear B. parapertussis from the LRT in vivo upon adoptive transfer. Neither serum treatment affected bacterial numbers in the nasal cavity.
30 Supplementing Adacel with B. parapertussis LPS containing the O-antigen confers protection against B. parapertussis challenge.
Figure 2.7: Addition of purified B. parapertussis LPS to an acellular B. pertussis vaccine confers protection against B. parapertussis challenge. Groups of four C57BL/6 mice were vaccinated as indicated and then challenged with B. parapertussis (B.p.p.) (A) or B. pertussis (B.p.) (B) and dissected at day 3 postchallenge. The numbers of CFU recovered from the nasal cavities, tracheae, and lungs are expressed as the log10 means ± the standard errors. ND indicates that CFU were not detectable. * indicates a P value of <0.05. The limit of detection is indicated by the y axis.
Since the O-antigen is necessary for the generation of efficient protective immunity to B. parapertussis (Fig. 2.1, 2.2, and 2.4), we examined whether B. parapertussis LPS alone, containing the O- antigen, is sufficient to induce protective immunity against this pathogen and whether supplementing Adacel with B. parapertussis LPS renders this vaccine effective against B. parapertussis. Mice were vaccinated with an adjuvant alone, the acellular pertussis vaccine Adacel with an adjuvant, or Adacel with an adjuvant supplemented with purified LPS from B. parapertussis or B. parapertussis∆wbm. Vaccination with adjuvant alone or Adacel had no effect on B. parapertussis loads throughout the respiratory tract 3 days postchallenge
(Fig. 2.7A). In contrast, vaccination with B. parapertussis LPS, but not B. parapertussis∆wbm LPS,
31 significantly reduced B. parapertussis loads in the lungs by 93.8% compared to those in the group vaccinated with adjuvant alone. Moreover, the addition of B. parapertussis LPS, but not B. parapertussis∆wbm LPS, to
Adacel caused significant decreases in bacterial loads, by 70.7, 99.6, and 96.2% in the nasal cavity, trachea, and lungs, respectively, suggesting that the efficacy of an acellular pertussis vaccine against B. parapertussis may be increased if B. parapertussis LPS containing the O-antigen is included. To ensure that the addition of
B. parapertussis LPS did not have an impact on the efficacy of Adacel against B. pertussis, mice were immunized with this vaccine with or without B. parapertussis LPS and challenged with B. pertussis. As expected, vaccination with the adjuvant alone did not affect the colonization by B. pertussis compared to that of naïve animals (Fig. 2.7B). Vaccination with Adacel reduced the B. pertussis load in the lungs by >99.5%
(Fig. 2.7B, bottom). This vaccine supplemented with B. parapertussis LPS caused a similar reduction of B. pertussis numbers (Fig. 2.7B, bottom), suggesting that the inclusion of B. parapertussis LPS does not affect the efficacy of the vaccine against B. pertussis. All together, our data suggest that the addition of B. parapertussis LPS containing the O-antigen to a current acellular vaccine extended its utility to include protective immunity to B. parapertussis.
32 Discussion:
A clear picture of B. parapertussis epidemiology is not available because differential diagnostic methods to distinguish between the two causative agents of whooping cough are rarely performed at the clinical level and diseases caused by B. parapertussis are not reportable to the CDC. However, when carefully monitored, B. parapertussis has been found to cause a substantial proportion of whooping cough cases and even larger proportions among vaccinated groups (4, 23, 24, 50). Although the mouse model does not replicate coughing symptoms of the disease, mechanisms of immune control and clearance of the bordetellae are consistent with what is known of these mechanisms in humans (19, 29, 30). The data presented here are consistent with the findings of experimental studies using a mouse infection model, as well as those of clinical studies, in which B. pertussis immunity failed to induce protective immunity to B. parapertussis (Fig. 2.7A) (9, 10, 14, 23, 27, 52, 56, 59). This work extends the findings of those previous studies to examine the role of the O-antigen in the generation of B. parapertussis-specific immunity.
We found that although immunization with wild-type B. parapertussis induced protective immunity to both the wildtype and the O-antigen-deficient B. parapertussis strains, prior infection or vaccination with the O-antigen-deficient strain conferred significantly less protection against the wild type in the lungs (Fig.
2.1 and 2.2). Immunization with B. parapertussis∆wbm induced splenic cytokine production similar to that induced by wild-type vaccination (Fig. 2.3), indicating that the decrease in protection conferred by the O- antigen-deficient strain was not due to inefficient T-cell cytokine production. Interestingly, B. parapertussis- induced antibodies recognized the O-antigen as a dominant antigen (Fig. 2.4A and B, lanes 3 and 4). Serum antibodies raised against the wild type, but not the O-antigen-deficient strain, mediated efficient opsonophagocytosis and reduced B. parapertussis colonization upon passive transfer (Fig. 2.5). Together, these data suggest that the O-antigen is required for the generation of an effective antibody response against
B. parapertussis.
Antibodies raised against B. parapertussis∆wbm lacked recognition of the O-antigen but recognized different antigens from those recognized by antibodies raised against wild-type B. parapertussis (Fig. 2.4B) and efficiently cleared B. parapertussis∆wbm (Fig. 2.1). These antigens are present in the B. parapertussis lysate (Fig. 2.4B), but B. parapertussis∆wbm immune serum is much less effective at binding live bacteria,
33 mediating opsonophagocytosis in vitro, or mediating bacterial clearance in vivo than B. parapertussis immune serum (Fig. 2.4 to 6), suggesting that these antigens may not be recognized on the surfaces of live B. parapertussis cells expressing the O-antigen. These data further indicate that the O-antigen is a dominant surface antigen of B. parapertussis and that antibodies against it are required for efficient clearance of this bacterium.
The O-antigen seems to contribute to the generation of effective protective immunity against B. parapertussis in the lungs but not in the trachea or nasal cavity (Fig. 2.1 and 2.2). Wolfe et al. observed that
B cells and T cells are required for clearance of B. parapertussis from the lungs and that CD4+ T cells, complement, and neutrophils are required for antibody mediated clearance in this organ (58). What immune components are required for B. parapertussis clearance in the trachea and nasal cavity is less understood.
Infection-induced immunity appeared to be more effective than vaccination-induced immunity in the nasal cavity and trachea (Fig. 2.1 and 2.2). This pattern may be due to different clearance mechanisms in infection- and vaccination-induced immunity to bordetellae (12). Vaccination is efficient in controlling disease but may be less effective in preventing subclinical colonization, as observed with B. pertussis (28). While the nasal cavity may be a reservoir of asymptomatic carriage of B. parapertussis, the protection in the lungs correlates with vaccine efficacy against severe disease and is thus the focus of this study (9).
The incidence of whooping cough has increased over the past 20 years, despite the maintenance of excellent vaccine coverage in developed countries (5). This trend may be due, at least in part, to vaccines’ being ineffective against B. parapertussis- induced disease (9, 16, 23). Of note, the switch from whole-cell to acellular vaccines correlates with increased prevalence of B. parapertussis (23). Moreover, whooping cough vaccinations have been proposed to shape the age-incidence patterns of the two causative agents. B. pertussis is more common in infants prior to vaccination and adolescents in whom vaccine-induced immunity has waned (6, 53), whereas B. parapertussis is most common in young children who have been recently vaccinated (3, 21, 54; J. Lavine, L. Han, E. T. Harvill, and O. Bjornstad, unpublished data). All these observations suggest that current whooping cough vaccines confer a selective advantage on B. parapertussis in its ongoing competition with B. pertussis.
34 We have shown that supplementing the acellular pertussis vaccine Adacel with 10 µg of purified B. parapertussis LPS containing the O-antigen reduced B. parapertussis numbers in the LRT by more than 90% within 3 days compared to the numbers in the group receiving Adacel alone (Fig. 2.7). Thus, the addition of this single antigen increased the efficacy of this vaccine against B. parapertussis in the mouse model. These results are not necessarily easily translated to improved human vaccines, since vaccine reactogenicity has been associated with LPS of B. pertussis. However, B. parapertussis LPS is less stimulatory toward TLR4 than B. pertussis LPS, and it is possible to purify the O-antigen portion of the LPS (20, 26, 55), thereby removing the TLR4 agonist, lipid A, to which is attributed most of the proinflammatory stimulation (32).
Alternatively, other, as-yet-unidentified antigens of B. parapertussis may prove to be protective and could be added to acellular whooping cough vaccines. However, the poor protection conferred by the O-antigen- deficient strain and the ability of the O-antigen to block the effects of antibodies recognizing other antigens
(56, 59) suggest that the inclusion of the O-antigen in the whooping cough vaccines should be favored over other, as-yet-unidentified protein antigens.
35 Authors and Contributions:
Xuqing Zhang1,2,†, Elizabeth M. Goebel1,3,†, Maria Eugenia Rodríguez4, Andrew Preston5, and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, The Pennsylvania State University, 115
Henning Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, The Pennsylvania State University, University Park
3Graduate Program in Immunology and Infectious Diseases, The Pennsylvania State University,
University Park
4CINDEFI (UNLP, CONICET La Plata), School of Science, La Plata University, La Plata, Argentina
5Department of Clinical Veterinary Science, University of Bristol, Bristol, United Kingdom
†XZ and EMG contributed equally to this work.
Conceived and designed the experiments: XZ, EMG, MER, AP, ETH.
Performed the experiments: XZ, EMG, MER, AP.
Analyzed the data: XZ, EMG, MER.
Wrote the paper: XZ, EMG, ETH.
36 References:
1. Allen, A., and D. Maskell. 1996. The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol. Microbiol. 19:37–52. 2. Allen, A. G., R. M. Thomas, J. T. Cadisch, and D. J. Maskell. 1998. Molecular and functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol. Microbiol. 29:27–38. 3. Bergfors, E., B. Trollfors, J. Taranger, T. Lagergard, V. Sundh, and G. Zackrisson. 1999. Parapertussis and pertussis: differences and similarities in incidence, clinical course, and antibody responses. Int. J. Infect. Dis. 3:140–146. 4. Borska, K., and M. Simkovicova´. 1972. Studies on the circulation of Bordetella pertussis and Bordetella parapertussis in populations of children. J. Hyg. Epidemiol. Microbiol. Immunol. 16:159–172. 5. CDC. 2002. Pertussis—United States, 1997–2000. JAMA 287:977–979. 6. Cherry, J. D., D. X. Xing, P. Newland, K. Patel, U. Heininger, and M. J. Corbel. 2004. Determination of serum antibody to Bordetella pertussis adenylate cyclase toxin in vaccinated and unvaccinated children and in children and adults with pertussis. Clin. Infect. Dis. 38:502–507. 7. Circolo, A., G. Garnier, W. Fukuda, X. Wang, T. Hidvegi, A. J. Szalai, D. E. Briles, J. E. Volanakis, R. A. Wetsel, and H. R. Colten. 1999. Genetic disruption of the murine complement C3 promoter region generates deficient mice with extrahepatic expression of C3 mRNA. Immunopharmacology 42:135–149. 8. Cummings, C. A., M. M. Brinig, P. W. Lepp, S. van de Pas, and D. A. Relman. 2004. Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J. Bacteriol. 186:1484–1492. 9. David, S., R. van Furth, and F. R. Mooi. 2004. Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22:1892. 10. de Melker, H. E., J. F. Schellekens, S. E. Neppelenbroek, F. R. Mooi, H. C. Rumke, and M. A. Conyn-van Spaendonck. 2000. Reemergence of pertussis in the highly vaccinated population of the Netherlands: observations on surveillance data. Emerg. Infect. Dis. 6:348–357. 11. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O antigen protects Bordetella parapertussis from complement. Infect. Immun. 76:1774–1780. 12. Gopinathan, L., G. S. Kirimanjeswara, D. N. Wolfe, M. L. Kelley, and E. T. Harvill. 2007. Different mechanisms of vaccine-induced and infection-induced immunity to Bordetella bronchiseptica. Microbes Infect. 9:442–448. 13. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect. Immun. 68:6720–6728. 14. He, Q., M. K. Viljanen, H. Arvilommi, B. Aittanen, and J. Mertsola. 1998. Whooping cough caused by Bordetella pertussis and Bordetella parapertussis in an immunized population. JAMA 280:635–637. 15. Heininger, U., K. Stehr, P. Christenson, and J. D. Cherry. 1999. Evidence of efficacy of the Lederle/Takeda acellular pertussis component diphtheria and tetanus toxoids and pertussis vaccine but not the Lederle whole- cell component diphtheria and tetanus toxoids and pertussis vaccine against Bordetella parapertussis infection. Clin. Infect. Dis. 28:602–604. 16. Heininger, U., K. Stehr, S. Schmitt-Grohe, C. Lorenz, R. Rost, P. D. Christenson, M. Uberall, and J. D. Cherry. 1994. Clinical characteristics of illness caused by Bordetella parapertussis compared with illness caused by Bordetella pertussis. Pediatr. Infect. Dis. J. 13:306–309. 17. Khelef, N., B. Danve, M. J. Quentin-Millet, and N. Guiso. 1993. Bordetella pertussis and Bordetella parapertussis: two immunologically distinct species. Infect. Immun. 61:486–490. 18. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T. Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated clearance of Bordetella pertussis. J. Clin. Investig. 115: 3594–3601. 19. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in immunity to Bordetella infections. Infect. Immun. 71:1719–1724. 20. Kubler-Kielb, J., E. Vinogradov, G. Ben-Menachem, V. Pozsgay, J. B. Robbins, and R. Schneerson. 2008. Saccharide/protein conjugate vaccines for Bordetella species: preparation of saccharide, development of new conjugation procedures, and physico-chemical and immunological characterization of the conjugates. Vaccine 26:3587–3593. 21. Letowska, I., and W. Hryniewicz. 2004. Epidemiology and characterization of Bordetella parapertussis strains isolated between 1995 and 2002 in and around Warsaw, Poland. Eur. J. Clin. Microbiol. Infect. Dis. 23:499– 501. 22. Li, J., C. Ryder, M. Mandal, F. Ahmed, P. Azadi, D. S. Snyder, R. D. Pechous, T. Zahrt, and T. J. Inzana. 2007. Attenuation and protective efficacy of an O-antigen-deficient mutant of Francisella tularensis LVS. Microbiology 153:3141–3153.
37 23. Liese, J. G., C. Renner, S. Stojanov, B. H. Belohradsky, and the Munich Vaccine tudy Group. 2003. Clinical and epidemiological picture of B pertussis and B parapertussis infections after introduction of acellular pertussis vaccines. Arch. Dis. Child. 88:684–687. 24. Maixnerova, M. 2003. The 2001 serological survey in the Czech Republic— parapertussis. Cent. Eur. J. Public Health 11(Suppl.):S23–S24. 25. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infect. Immun. 75:3665–3672. 26. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative Toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect. Immun. 73:8144–8152. 27. Mastrantonio, P., P. Stefanelli, M. Giuliano, Y. Herrera Rojas, M. Ciofi degli Atti, A. Anemona, and A. E. Tozzi. 1998. Bordetella parapertussis infection in children: epidemiology, clinical symptoms, and molecular characteristics of isolates. J. Clin. Microbiol. 36:999–1002. 28. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin. Microbiol. Rev. 18:326– 382. 29. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect. 3:655–677. 30. Mills, K. H., A. Barnard, J. Watkins, and K. Redhead. 1993. Cell-mediated immunity to Bordetella pertussis: role of Th1 cells in bacterial clearance in a murine respiratory infection model. Infect. Immun. 61:399–410. 31. Mooi, F. R., H. G. van der Heide, A. R. ter Avest, K. G. Welinder, I. Livey, B. A. van der Zeijst, and W. Gaastra. 1987. Characterization of fimbrial subunits from Bordetella species. Microb. Pathog. 2:473–484. 32. Munford, R. S., and A. W. Varley. 2006. Shield as signal: lipopolysaccharides and the evolution of immunity to gram-negative bacteria. PLoS Pathog. 2:e67. 33. Nicosia, A., A. Bartoloni, M. Perugini, and R. Rappuoli. 1987. Expression and immunological properties of the five subunits of pertussis toxin. Infect. Immun. 55:963–967. 34. Nicosia, A., and R. Rappuoli. 1987. Promoter of the pertussis toxin operon and production of pertussis toxin. J. Bacteriol. 169:2843–2846. 35. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M. T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga, L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D. Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis, J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S. Leather, S. Moule, H. Norberczak, S. O’Neil, D. Ormond, C. Price, E. Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M. Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead, B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat. Genet. 35:32–40. 36. Phalipon, A., C. Costachel, C. Grandjean, A. Thuizat, C. Guerreiro, M. Tanguy, F. Nato, B. Vulliez-Le Normand, F. Belot, K. Wright, V. Marcel-Peyre, P. J. Sansonetti, and L. A. Mulard. 2006. Characterization of functional oligosaccharide mimics of the Shigella flexneri serotype 2a O-antigen: implications for the development of a chemically defined glycoconjugate vaccine. J. Immunol. 176:1686–1694. 37. Pilione, M. R., and E. T. Harvill. 2006. The Bordetella bronchiseptica type III secretion system inhibits gamma interferon production that is required for efficient antibody-mediated bacterial clearance. Infect. Immun. 74:1043–1049. 38. Pishko, E. J., G. S. Kirimanjeswara, M. R. Pilione, L. Gopinathan, M. J. Kennett, and E. T. Harvill. 2004. Antibody-mediated bacterial clearance from the lower respiratory tract of mice requires complement component C3. Eur. J. Immunol. 34:184–193. 39. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L. Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect. Immun. 67:3763–3767. 40. Preston, A., B. O. Petersen, J. O. Duus, J. Kubler-Kielb, G. Ben-Menachem, J. Li, and E. Vinogradov. 2006. Complete structures of Bordetella bronchiseptica and Bordetella parapertussis lipopolysaccharides. J. Biol. Chem. 281: 18135–18144. 41. Repp, R., T. Valerius, A. Sendler, M. Gramatzki, H. Iro, J. R. Kalden, and E. Platzer. 1991. Neutrophils express the high affinity receptor for IgG (Fc gamma RI, CD64) after in vivo application of recombinant human granulocyte colony-stimulating factor. Blood 78:885–889. 42. Rodriguez, M. E., S. M. Hellwig, D. F. Hozbor, J. Leusen, W. L. van der Pol, and J. G. van de Winkel. 2001. Fc receptor-mediated immunity against Bordetella pertussis. J. Immunol. 167:6545–6551. 43. Rodriguez, M. E., W. L. Van der Pol, and J. G. Van de Winkel. 2001. Flow cytometry-based phagocytosis assay for sensitive detection of opsonic activity of pneumococcal capsular polysaccharide antibodies in human sera. J. Immunol. Methods 252:33–44.
38 44. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J. Gen. Microbiol. 63: 211–220. 45. Stanislavsky, E. S., T. A. Makarenko, and T. E. Kozhenova. 1992. Specific and non-specific mouse protection induced by different chemotypes of the Pseudomonas aeruginosa lipopolysaccharides. FEMS Microbiol. Immunol. 5:181–189. 46. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J. Bacteriol. 173:4288–4296. 47. van den Akker, W. M. 1998. Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144: 1527–1535. 48. van der Zee, A., F. Mooi, J. Van Embden, and J. Musser. 1997. Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J. Bacteriol. 179:6609–6617. 49. von Koenig, C. H., A. Tacken, and H. Finger. 1988. Use of supplemented Stainer-Scholte broth for the isolation of Bordetella pertussis from clinical material. J. Clin. Microbiol. 26:2558–2560. 50. Watanabe, M., and M. Nagai. 2004. Whooping cough due to Bordetella parapertussis: an unresolved problem. Expert Rev. Anti-Infect. Ther. 2:447– 454. 51. Weingart, C. L., G. Broitman-Maduro, G. Dean, S. Newman, M. Peppler, and A. A. Weiss. 1999. Fluorescent labels influence phagocytosis of Bordetella pertussis by human neutrophils. Infect. Immun. 67:4264–4267. 52. Willems, R. J., J. Kamerbeek, C. A. Geuijen, J. Top, H. Gielen, W. Gaastra, and F. R. Mooi. 1998. The efficacy of a whole cell pertussis vaccine and fimbriae against Bordetella pertussis and Bordetella parapertussis infections in a respiratory mouse model. Vaccine 16:410–416. 53. Wirsing von Konig, C. H., D. Gounis, S. Laukamp, H. Bogaerts, and H. J. Schmitt. 1999. Evaluation of a single- sample serological technique for diagnosing pertussis in unvaccinated children. Eur. J. Clin. Microbiol. Infect. Dis. 18:341–345. 54. Wirsing von Konig, C. H., and H. J. Schmitt. 1996. Epidemiologic aspects and diagnostic criteria for a protective efficacy field trial of a pertussis vaccine. J. Infect. Dis. 174(Suppl. 3):S281–S286. 55. Wolfe, D. N., A. M. Buboltz, and E. T. Harvill. 2009. Inefficient Toll-like receptor-4 stimulation enables Bordetella parapertussis to avoid host immunity. PLoS ONE 4:e4280. 56. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect. Immun. 75:4972–4979. 57. Wolfe, D. N., G. S. Kirimanjeswara, E. M. Goebel, and E. T. Harvill. 2007. Comparative role of immunoglobulin A in protective immunity against the bordetellae. Infect. Immun. 75:4416–4422. 58. Wolfe, D. N., G. S. Kirimanjeswara, and E. T. Harvill. 2005. Clearance of Bordetella parapertussis from the lower respiratory tract requires humoral and cellular immunity. Infect. Immun. 73:6508–6513. 59. Zhang, X., M. E. Rodriguez, and E. T. Harvill. 2009. O antigen allows B. parapertussis vaccine-induced immunity by blocking binding and functions of cross-reactive antibodies. PLoS One 4:e6989.
39
Chapter 3
O-antigen Allows Bordetella parapertussis to Evade B. pertussis Vaccine-induced
Immunity by Blocking Binding and Functions of Cross-reactive Antibodies
Abstract
Although the prevalence of B. parapertussis varies dramatically between studies in different populations with different vaccination regimens, there is broad agreement that whooping cough vaccines, composed only of B. pertussis antigens, provide little if any protection against B. parapertussis. In C57BL/6 mice a B. pertussis whole cell vaccine (wP) provided modest protection against B. parapertussis, that was dependent on IFN-. The wP was much more protective against an isogenic B. parapertussis strain lacking
O-antigen than its wild-type counterpart. O-antigen inhibited binding of wP-induced antibodies to B. parapertussis as well as antibody-mediated opsonophagocytosis in vitro and clearance in vivo. aP-induced antibodies also bound better in vitro to the O-antigen mutant than to wild-type B. parapertussis, but aP failed to confer protection against wild-type or O-antigen deficient B. parapertussis in mice. Interestingly, B. parapertussis specific antibodies provided in addition to either wP or aP were sufficient to very rapidly reduce B. parapertussis numbers in mouse lungs. This study identifies a mechanism by which one pathogen escapes immunity induced by vaccination against a closely related pathogen, and may explain why B. parapertussis prevalence varies substantially between populations with different vaccination strategies.
40 Introduction
Whooping cough is an acute, highly contagious, paroxysmal coughing illness (25). The first whooping cough vaccines consisting of whole inactivated B. pertussis were licensed in the mid-1940s and led to a dramatic decrease of disease incidence (7, 25). However, the potential health risk associated with whole cell vaccines led to the development of acellular vaccines, consisting of some combination of B. pertussis antigens including pertussis toxin (PT), pertactin, filamentous hemagglutinin (FHA) and 2 fimbriae serotypes.
Despite maintenance of high vaccine coverage, the reported whooping cough incidence has been increasing over the past 20 years in some developed countries (1, 6), although a large portion of whooping cough infections are thought to remain unreported (9). Both B. pertussis and B. parapertussis are causative agents of whooping cough (17, 25) that appear to have evolved independently from distinct lineages of B. bronchiseptica through rearrangements and large scale gene loss, with B. parapertussis emerging more recently than B. pertussis (10, 32). Although they are closely related, a few striking differences exist between the human-adapted bordetellae. For example, B. parapertussis lipopolysaccharide (LPS) includes a repetitive membrane-distal O-antigenic structure, while B. pertussis only expresses lipid A and a branched-chain core oligosaccharide with a complex trisaccharide modification, but lacks O-antigen (35, 42). B. pertussis expresses PT, but B. parapertussis does not due to mutations in the promoter region (3, 23). Since differential diagnosis of B. pertussis and B. parapertussis does not affect the course of treatment, it is rarely performed in clinical settings (15, 45). The CDC does not list B. parapertussis as reportable (1), but a few epidemiological studies have reported the percentage of whooping cough cases caused by B. parapertussis to be from 1% to
98%, most commonly 4-40% (45). Although B. parapertussis appears to contribute substantially to disease, whooping cough vaccines are solely derived from B. pertussis (25).
Clinical and experimental data indicate that whooping cough vaccines are very efficacious against B. pertussis but not against B. parapertussis (8, 15, 16, 21, 24), however, a mechanistic understanding of this phenomenon has not been described. While whooping cough vaccines may fail to generate efficient cross- immunity against B. parapertussis, it is also possible that cross-reacting adaptive immunity is generated but is evaded by B. parapertussis. Recently, our lab showed that the O-antigen of B. parapertussis shields it from
B. pertussis-infection-induced antibodies (50), relevant to the natural immune-mediated competition between
41 B. pertussis and B. parapertussis in unvaccinated population. However, nearly all people in industrialized countries are vaccinated, changing the immune landscape of the host population and the immune-mediated competition between these two human pathogens.
To examine the mechanisms used by B. parapertussis to evade B. pertussis vaccines-induced immunity, we showed that a B. pertussis whole cell vaccine (wP) had some effect, but a commercial acellular vaccine (aP) had no effect against B. parapertussis growth in mouse lungs. IFN-γ contributes to the protection against B. parapertussis by wP. O-antigen shielded B. parapertussis from the binding of vaccine- induced antibodies, interfered with opsonophagocytosis of B. parapertussis mediated by aP and wP-induced antibodies and blocked antibody-mediated clearance in vivo. wP conferred more protection against an isogenic B. parapertussis strain lacking O-antigen, indicating that O-antigen contributed to the evasion of wP- induced immunity. aP, however, failed to induce cross-protection against B. parapertussis with or without the hindrance of O-antigen. In B. pertussis vaccinated hosts, supplement of B. parapertussis-specific, but not
B. pertussis-specific, antibodies conferred protection against B. parapertussis, indicating that the lack of proper antibody responses causes the failure of these vaccines against B. parapertussis. Together these results explain the clinical finding that B. parapertussis avoids clearance by the current vaccines, and provides a mechanistic understanding that will guide new approaches to overcoming this problem.
42 Materials and Methods
Bacterial strains and growth. B. pertussis strain 536, B. parapertussis strain CN2591 and its isogenic mutant lacking O-antigen, CN2591∆wbm, have been described previously (35, 40). For opsonization, attachment and phagocytosis experiments, these strains were transformed with plasmid pCW505 (kindly supplied by Dr. Alison Weiss, Cincinnati, Ohio) which induces cytoplasmic expression of GFP without affecting growth, or antigen expression (46). Bacteria were maintained on Bordet-Gengou agar (Difco) supplemented with 10% sheep’s blood (Hema Resources) and 20µg/mL streptomycin (Sigma-Aldrich).
Liquid cultures were grown overnight in Stainer-Scholte broth at 37°C to mid-log phase (39, 44).
Cells. Peripheral blood polymorphonuclear leukocytes (PMNs) were isolated from heparinized venous blood using Ficoll-Histopaque (Sigma, St Louis, MO) gradient centrifugation. PMNs were harvested and the remaining erythrocytes were removed by hypotonic lysis. Cell viability was 99% as determined by Trypan
Blue exclusion. Prior to functional assays, PMNs were washed twice with Dulbecco’s modified Eagle medium (DMEM) (Hyclone) supplemented with 10% of fetal calf serum (FCS) (Hyclone), resuspended, and used immediately. All experiments were carried out with freshly isolated PMNs lacking FcRI (CD64) expression, as monitored by FACS analysis using a fluorescence-activated cell sorter FACScan (Becton
Dickinson, San Jose, CA) with anti-FcRI mAb 22 (36).
Opsonization. GFP-expressing strains were opsonized by incubation at 37oC with 5% heat-inactivated wP- induced/naive or aP/adjuvant-induced serum samples for 30 min in a final volume of 50 µL. Serum opsonized bacteria were incubated with R-phycoerythrin (RPE)–labeled goat F(ab')2 fragments of anti-mouse
IgG (Southern Biotechnology, Birmingham, AL) for 30 min at 4oC. Opsonization of each Bordetella strain was determined by FACS analysis (38).
Attachment and phagocytosis. Attachment and phagocytosis of the Bordetella strains were evaluated as previously described with a few modifications (37). Briefly, serum opsonized GFP-expressing bacteria were incubated with PMNs at multiplicity of infection (MOI) of 30 for 20 min at 37C to allow binding. After extensive washing to remove non-attached bacteria, an aliquot was maintained on ice to be used for bacterial attachment control. Another aliquot was further incubated for 1h at 37C to allow internalization.
Phagocytosis was stopped by placing PMNs on ice. Cell surface bound bacteria in both aliquots (before and
43 o after 1 hour incubation at 37 C) were detected by incubation with RPE–labeled goat F(ab')2 fragments of anti- mouse IgG at 4oC for 30 min. To avoid eventual nonspecific binding of antibodies, all incubations were done in the presence of 25% heat-inactivated human serum. After washing, samples were analyzed by flow cytometry. Ten thousand cells were analyzed per sample. Green fluorescence intensity associated with
PMNs maintained at 37C for 20 min has previously been shown to represent bacterial attachment (38).
Phagocytosis was calculated from the drop in mean red fluorescence intensity of green-positive cells after incubation for additional1h at 37C as described (38).
Animal experiments. C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor) and bred in our
Bordetella-free, specific pathogen-free breeding rooms at The Pennsylvania State University. 4-6 week old mice were sedated with 5% isoflurane (Abbott Laboratory) in oxygen and vaccinated by intraperitoneally
(i.p.) injection of 1×108 CFU of heat-inactivated bacteria in 1 mL of phosphate balanced saline (PBS,
Omnipur) (wP), 1/5 human dose of Adacel (Sanofi Pastuer) (0.5µg PT, 1µg FHA, 0.6 µg pertactin, 5 µg fimbriae 2 and 3 per mouse) with Imject Alum (Thermo Scientific) (aP) or only Imject Alum in 200µL PBS on day 14 and 28 prior to challenge (13). For challenge, mice were sedated and inoculated by pipetting 50 µL
PBS containing 5×105 CFU of the indicated bacteria onto the external nares (19). This method reliably distributes the bacteria throughout the respiratory tract (14). For adoptive transfer of immune serum, mice were vaccinated with the indicated bacteria on day 0 and 14 and sera were collected on day 28 or sera were collected from naïve animals. 200 µL of sera were i.p. injected at the time of inoculation (20, 34). For quantification of bacteria numbers, mice were sacrificed via CO2 inhalation and the lung, trachea, and nasal cavity were excised. Tissues were homogenized in PBS, serial diluted and plated onto Bordet-Gengou agar plates with 20 µg/mL streptomycin, and colonies were counted after incubation at 37°C for 3-5 days (20).
Gamma interferon (IFN-γ) was depleted by i.p. injections of 5 mg of the antibody from hybridoma XMG1.2 one day prior to challenge (31). The lower limit of detection was 10 CFU. For all experiments, protocols were reviewed and approved by the Pennsylvania State University IACUC and all animal were handled in accordance with institutional guidelines.
Splenocyte re-stimulations. Spleens were excised from groups of 3-4 C57BL/6 mice after vaccination.
Splenocytes were isolated as previously described (13, 33). In brief, spleens were homogenized and red blood
44 cells were lysed with 0.84% ammonium chloride. 2×106 cells were re-suspended in DMEM supplemented with 10% FCS, 1mM sodium pyruvate (HyClone), and 100 µg/mL penicillin and streptocycin (HyClone) and placed into each well of a 96-well tissue culture plate. Splenocytes were stimulated with either media alone or media containing 107 CFU (MOI of 5) of the indicated bacteria that had been heat-killed (13, 33). After three days, the supernatants were collected and analyzed for IFN-γ and interleukin-10 (IL-10) production via
Enzyme-linked immunosorbent assays (ELISA) as per the manufacturers’ instructions (R&D Systems).
Titer ELISAs. Antibody titers were determined as previously described (29, 50, 51). Briefly, heat- inactivated or exponential phase live bacteria were diluted to 5×107 CFU/mL in a 1:1 mix of 0.2 M sodium carbonate and 0.2 M sodium bicarbonate buffers. These antigens were coated onto 96-well plates, incubated for 2h at 37°C in a humidified chamber, washed and blocked. A1:50 or 1:10 dilution of wP-induced/naive or aP/adjuvant-induced serum samples from an individual mouse was added to the first well of each row and serially diluted 1:2 across the plates. Plates were incubated for 2h at 37°C, washed and probed with 1: 4000 dilution of goat anti-mouse Ig horseradish peroxidase (HRP)-conjugated antibodies (Southern Biotech) for 1h and visualized with 2,2’-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt in phosphate- citrate buffer with hydrogen peroxide at an absorbance of 405 nm. Titers were determined via the endpoint method based on optimal density of identically treated wells probed with naïve or adjuvant-induced sera.
Western Blot analysis. Lysates containing 5×105 CFU of indicated heat-killed bacteria were run on 7% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels in denaturing conditions.
Polyvinylidene Fluoride (PVDF) membranes (Millipore) were probed overnight with either naïve serum or serum from vaccinated mice at a 1:10 or 1: 100 dilution for aP and wP-induced serum respectively. 1:10,000 dilution of goat anti-mouse Ig HRP-conjugated antibodies (Southern Biotech) was used as the detector antibody (50, 52). The membrane was visualized with ECL Western Blotting Detection Reagent (Pierce
Biotechnology).
Statistical analysis. The means +/- standard error (error bars) were determined for all appropriate data.
Two-tailed, unpaired Student’s T-tests were used to determine statistical significance between groups.
Results were also analyzed by ANOVA and Tukey simultaneous test in Minitab with similar significance.
All experiments were performed at least twice with similar results.
45 Results:
B. parapertussis O-antigen contributes to the evasion of wP-induced immunity.
To examine whether wP is cross-protective against B. parapertussis and whether O-antigen interferes with its cross-protection, naïve or wP vaccinated C57BL/6 mice were challenged with 5×105 CFU of B. pertussis, B. parapertussis or an isogenic B. parapertussis strain lacking O-antigen (BppΔwbm). In comparison to naïve mice, wP treatment reduced B. pertussis numbers by 91.9%, 97.8% and >99.9% in the nasal cavity, trachea and lungs by day 3 post challenge; naïve mice having about 7000 fold more bacteria in the lungs than vaccinated mice (Fig. 3.1A). wP vaccination reduced B. parapertussis loads by 76.6%, 83.0% and 97.6% in the nasal cavity, trachea and lung; naïve mice having about 40 fold more bacteria in the lungs than vaccinated mice (Fig. 3.1A). These results are consistent with multiple clinical studies showing whole cell vaccines confer good protection against B. pertussis but relatively little protection against B.
Figure 3.1: B. parapertussis is more susceptible to wP-induced immunity in the absence of O-antigen. Groups of four naïve (black) or wP vaccinated (white) C57BL/6 mice were challenged with the indicated bacteria. (A) The number of CFUs recovered from the respiratory tract on day 3 post-challenge is expressed as the Log10 mean ± the standard error. Decreases in Log10CFU in vaccinated mice compared to naïve mice on day 3 post-challenge are indicated underneath the x axes. (B) The change in CFU number over the first 3 days after challenge is expressed as change in Log10 mean ± the standard error. * indicates P≤ 0.05. ** indicates P≤ 0.01. The limit of detection is indicated as the lower limit of the y axes.
46 parapertussis (16, 21, 47). Interestingly, compared to
naïve mice, wP reduced numbers of an O-antigen deficient
B. parapertussis strain by 89.4%, 99% and >99.9% in the
nasal cavity, trachea and lung; naïve mice having around
2000 fold more bacteria in the lungs than vaccinated mice
(Fig. 3.1A). The fold protection (reduction of bacterial
number in each individual vaccinated mouse compared to
mean number of bacteria in naive mice on day 3 post-
challenge) of wP against O-antigen deficient B.
parapertussis was significantly higher than against wild-
type B. parapertussis in both trachea and lung (lung:
P=0.0006, trachea: P=0.018), indicating that wP is more Figure 3.2: aP does not reduce B. parapertussis numbers. Groups of four C57BL/6 mice were efficacious against O-antigen deficient B. parapertussis. vaccinated with adjuvant only (black) or aP (white), challenged with the indicated bacteria and sacrificed on day 3 post-challenge. The numbers of CFUs To understand how vaccination affects the recovered from the respiratory tract are expressed as the Log10 mean ± the standard error. ** indicates P≤ infection, it is important to examine these effects in the 0.01. The limit of detection is indicated as the lower limit of the y axis. context of the dynamic infectious process. B. pertussis and B. parapertussis increased in numbers throughout the respiratory tract of naïve mice over 3 days, reflecting effective colonization and bacterial growth (Fig. 3.1B). O-antigen deficient B. parapertussis grew in the nasal cavity and trachea but not in the lungs of naïve mice due to its increased susceptibility to complement (12) (Fig. 3.1B). wP decreased the numbers of B. pertussis in all respiratory organs over 3 days, resulting in a net decline in numbers, particularly in the lower respiratory tract (LRT). Vaccination did not decrease B. parapertussis numbers as efficiently in the lung and B. parapertussis actually grew in numbers in the trachea and nasal cavity, reflecting successful colonization and expansion despite vaccination (Fig. 3.1B).
Interestingly, wP vaccination decreased O-antigen deficient B. parapertussis numbers as efficiently as it did
B. pertussis numbers in the trachea and lung (Fig. 3.1B). Together these results are consistent with clinical studies showing that wP vaccination confers relatively little protection against B. parapertussis and show that
O-antigen is required for B. parapertussis to avoid efficient wP vaccine-induced immunity.
47 Many developed countries have switched to acellular vaccines, although these provide even less protection against B. parapertussis (8, 21, 47). We therefore determined if the O-antigen of B. parapertussis contributes to the evasion of aP-induced immunity. While aP reduced B. pertussis colonization in both lung and trachea of vaccinated mice by 99.7% and 96.8% compared to the mice given just adjuvant, aP had no effects on either B. parapertussis or O-antigen deficient B. parapertussis colonization (Fig. 3.2). These data indicate that aP does not induce protective immunity against B. parapertussis. wP induces T cells that cross react with B. parapertussis.
To investigate why aP is less effective than wP
against B. parapertussis and why wP confers different
levels of protection against B. pertussis, O-antigen
deficient and wild-type B. parapertussis, we compared
their induction of T cell responses known to be important
for control and clearance of B. parapertussis (51).
Splenocytes from mice that were naïve, vaccinated with
wP, aP or adjuvant were stimulated with heat-killed B.
pertussis or wild-type or O-antigen deficient B.
Figure 3.3: Splenic production of IFN-γ and IL- parapertussis. After 3 days, IFN-γ and IL-10 production, 10 is cross-reactive. Splenocytes from groups of four naïve C57BL/6 mice or mice vaccinated with representative of T 1 and T responses, was measured. the indicated vaccine were stimulated with media H reg only (vertically hatched), heat-killed B. pertussis (black), B. parapertussis (white) or O-antigen aP vaccination did not affect IFN-γ or IL-10 levels, which deficient B. parapertussis (horizontally hatched) for 3 days. The concentration of IFN-γ and IL-10 in were similar to those induced by naïve and adjuvant- the supernatant is expressed as the mean ± the standard error. ND indicates none detected. treated controls (Fig. 3.3). In contrast, splenocytes from wP-vaccinated mice responded similarly to heat-killed B. parapertussis or B. pertussis, producing significantly higher IFN-γ and IL-10 than splenocytes from naïve or adjuvant-treated mice (Fig. 3.3). IFN-γ and IL-10 production was abolished in TCRβ/δ-/- mice (data not shown), indicating that vaccine-induced IFN-
γ and IL-10 production is dependent on T cells. These data indicate that the T-cell response to wP is cross- reactive to B. parapertussis and that O-antigen did not affect the T cell response.
IFN-γ contributes to wP-induced protection against B. parapertussis.
48 In the vaccination studies above (Fig. 3.1, 3.2), protection
against B. parapertussis correlates with the high IFN-γ
responses of wP but not aP vaccinated animals (Fig. 3.3).
IFN-γ has been shown to contribute to leukocyte
recruitment and the reduction of bacterial numbers during
B. parapertussis infection (D.N. Wolfe, A.T. Karanikas,
S.E. Hester, M.J. Kennett, E.T. Harvill, in press). To
determine how the cross-reactive IFN-γ response after wP
vaccination might contribute to its protection against B.
parapertussis, naïve or wP vaccinated mice were left
untreated or depleted of IFN-γ, challenged with B.
pertussis or B. parapertussis and sacrificed 3 days later for
bacterial enumeration. Vaccination or IFN-γ depletion had
no effects on colonization of the nasal cavity (Fig. 3.4).
Figure 3.4: IFN-γ contributes to the protection However, B. pertussis numbers were reduced by >99.9% against B. parapertussis by wP. Groups of four naïve (black and horizontally hatched) or wP and >99.5% in the lung and trachea of vaccinated mice vaccinated (white and vertically hatched) C57BL/6 mice were untreated (-) (black and white) or i.p. injected with (+) (horizontally and vertically compared to naïve mice regardless of the presence or hatched) anti-IFN-γ antibody, challenged with B. parapertussis and sacrificed 3 days post-challenge. absence of IFN-γ (Fig. 3.4). Although wP reduced B. The number of CFUs throughout the respiratory tract is expressed as the Log10 mean ± the standard parapertussis numbers in the lung and trachea by about error. * indicates P≤ 0.05. ** indicates P≤ 0.01. The limit of detection is indicated as the lower limit 98.6% and 99.6%, this effect was abolished in mice given of the y axis. IFN-γ neutralizing antibodies (Fig. 3.4), indicating that
IFN-γ contributes to the protection conferred by wP against B. parapertussis.
Serum antibody responses to aP and wP are cross-reactive to denatured but not live B. parapertussis.
We have previously shown that antibodies are required for anamnestic immunity to B. parapertussis
(51). To determine whether B. pertussis vaccines induce antibodies that recognize and/or protect against B. parapertussis, we first tested whether antibody responses are cross-reactive between strains and if O-antigen affects the responsiveness of antibodies. In a western blot, whole cell extracts of B. pertussis, wild-type and
49 O-antigen deficient B. parapertussis were probed with
serum antibodies from aP, adjuvant only, wP vaccinated or
naïve mice. Compared to the control, aP vaccination
induced serum antibodies that recognized distinct antigens
present in all three bacteria, although the size and intensity
of bands appeared to differ between B. pertussis and B.
parapertussis. While wP-induced serum antibodies
recognized four major bands in denatured B.
parapertussis, they recognize more antigens in B.
pertussis, especially those of high molecular weights (Fig.
3.5A).
To quantify the cross-reactivity of antibodies, we
determined the titers of aP or wP-induced serum antibodies
by ELISA using heat-inactivated bacteria as antigens. wP-
Figure 3.5: O-antigen inhibits the binding of B. induced sera had much higher titers than aP-induced sera pertussis vaccine-induced antibodies to live, but not denatured, B. parapertussis cells. (A) Western (Fig. 3.5B). For both aP and wP-induced serum blots were performed on lysates of indicated bacteria probed with serum antibodies collected from mice antibodies, B. pertussis-specific antibody titers were much that were vaccinated with aP, adjuvant only (Adj) or wP. (B) Heat-inactivated or (C) live B. pertussis (black), B. parapertussis (white) or O-antigen higher than B. parapertussis-specific antibody titers deficient B. parapertussis (hatched) were coated on ELISA plate. Serum antibody titer of mice regardless of the presence or absence of O-antigen (Fig. vaccinated with aP or wP is expressed as mean of the end point titers of four independent samples ± 3.5B). Since heat killing releases many antigens that are the standard error. ** indicates P≤ 0.01. The dashed line indicates the limit of detection. not exposed on the surface of live bacteria, similar experiments were performed with live bacteria as antigens. Interestingly, both wP and aP-induced serum antibodies bound to live B. parapertussis more efficiently in the absence of O-antigen (Fig. 3.5C). These data suggest that O-antigen interferes with the binding of B. pertussis vaccine-induced antibodies to live B. parapertussis.
O-antigen inhibits aP and wP-induced-antibody-mediated opsonization and subsequent attachment to, and phagocytosis by, PMNs.
50
Figure 3.7: O-antigen blocks B. pertussis vaccine- Figure 3.6: O-antigen decreases the opsonization induced antibodies from mediating adherence of of B. parapertussis by B. pertussis vaccine-induced B. parapertussis to PMNs. Naïve serum (white) or antibodies. Representative histograms show flow (A) aP, (B) wP, (C) wPP-induced serum (grey)- cytometric analysis of indicated bacteria opsonized opsonized GFP-expressing bacteria were incubated with naïve serum (white) or (A) aP, (B) wP, (C) with freshly isolated human peripheral blood PMNs. wPP-induced serum (grey) and stained with RPE- Representative histograms of flow cytometry analysis labeled goat F(ab)2 fragments of anti-mouse IgG. of these cells are shown. (D) Mean green (D) Mean red-fluorescence of B. pertussis (black), fluorescence associated with PMNs incubated with B. parapertussis (white), O-antigen deficient B. GFP-expressing B. pertussis (black), B. parapertussis parapertussis (hatched) opsonized with indicated (white) or O-antigen deficient B. parapertussis serum from four individual mice ± the standard error (hatched) opsonized with four independent indicated is shown. AU indicates arbitrary units. ** indicates serum ± the standard error is shown. AU indicates P≤ 0.01. Maria Eugenia Rodriguez conducted this arbitrary units. ** indicates P≤ 0.01. Maria Eugenia experiment. Rodriguez conducted this experiment.
To determine whether O-antigen interferes with key functions of antibodies, we assessed its effects on opsonization and subsequent attachment to and phagocytosis by PMNs mediated by aP or wP induced antibodies. Consistent with the ELISA results (Fig. 3.5C), B. pertussis was efficiently opsonized by both aP and wP-induced serum antibodies (Fig. 3.6A, B, D). Although B. parapertussis was efficiently opsonized by whole cell B. parapertussis (wPP)-induced serum antibodies (Fig. 3.6C, D), aP or wP-induced antibodies failed to opsonize this bacterium (Fig. 3.6A, B, D). In contrast, O-antigen deficient B. parapertussis was efficiently opsonized by aP or wP-induced antibodies (Fig. 3.6A, B, D), indicating that O-antigen hinders the opsonization of B. parapertussis by both aP and wP-induced serum antibodies.
51 To examine if O-antigen blocking of opsonization results in inhibitory effects on attachment of B. parapertussis to phagocytes, bacteria opsonized with vaccine-induced antibodies were further incubated with polymorphonuclear leukocytes (PMN) for 20 mins and cell Figure 3.8: O-antigen blocks B. pertussis vaccine- surface bound bacteria numbers were identified by flow cyt induced antibody-mediated phagocytosis of B. parapertussis. Freshly isolated human peripheral ometry. aP or wP-induced-antibody-opsonized B. pertussis blood PMNs were incubated for 20min or 1h and 20min with GFP-expressing B. pertussis (black), B. attached to PMNs efficiently (Fig. 3.7A, B, D). B. parapertussis (white), or O-antigen deficient B. parapertussis (hatched), that are opsonized with parapertussis attached to PMN after opsonization with serum from aP, wP, wPP-vaccinated or naïve mice. The cell surface bound bacteria were detected by incubation with RPE-labeled goat F(ab’)2 fragments wPP-induced serum antibodies (Fig. 3.7C, D), but neither of anti-mouse IgG. Mean phagocytosis calculated from the decrease in red-fluorescence of green- aP nor wP-induced antibodies mediated attachment of this positive cells incubated for 1h and 20 min compared to that incubated for 20min of experiments done with bacterium to PMNs (Fig. 3.7A, B, D). B. parapertussis 4 independent serum samples ± the standard error was shown. AU indicates arbitrary units. ** lacking O-antigen, opsonized with aP or wP-induced indicates P≤ 0.01. Maria Eugenia Rodriguez conducted this experiment. antibodies, efficiently attached to phagocytes (Fig. 3.7A, B, D), indicating that O-antigen also inhibits this process.
To determine if O-antigen interferes with aP or wP-induced antibodies ability to mediate phagocytosis of B. parapertussis by PMNs, an aliquot of cells from the attachment experiment was incubated for one extra hour and phagocytosis was measured. No significant internalization of naïve serum-opsonized bacteria was observed. B. pertussis opsonized with aP or wP-induced antibodies was efficiently phagocytosed, but similarly treated B. parapertussis was not (Fig. 3.8). In contrast, wPP-induced antibody- opsonized B. parapertussis was efficiently internalized by PMNs (Fig. 3.8). B. parapertussis lacking O- antigen opsonized by aP or wP-induced antibodies was efficiently phagocytosed by PMNs. Together these results indicate that O-antigen protects B. parapertussis from aP or wP-induced serum antibody mediated opsonization, attachment to phagocytes and subsequent internalization by these cells.
O-antigen blocks antibody-mediated clearance of B. parapertussis from mouse lungs.
Since O-antigen interferes with the binding of B. pertussis vaccine-induced antibodies to live B. parapertussis and phagocytosis dependent on these antibodies in vitro, we tested if O-antigen inhibits
52 antibody-mediated clearance in vivo. Serum from naïve
(NS), wP- or wPP-vaccinated mice were transferred to
naïve animals. Bacterial loads in the lungs were
determined on day 14 post B. parapertussis challenge
since antibodies have no effect until B. parapertussis
specific T cell responses are generated around day 14 (20, Figure 3.9: Passive transfer of wP-induced serum antibodies mediates clearance of O-antigen 49) (D.N. Wolfe unpublished data). Serum from wPP deficient, but not wild-type, B. parapertussis from mouse lungs. Groups of four C57BL/6 mice were vaccinated animals significantly lowered numbers of both adoptively transferred naïve serum (black), wP- induced serum (white) or wPP-induced serum wild-type and O-antigen deficient B. parapertussis (hatched) at the time of bacterial challenge and dissected 14 days later. The number of CFUs compared to naïve serum treated animals and modestly recovered from lung is expressed as the Log10 mean ± the standard error. * indicates P≤ 0.05 and ** indicates P≤ 0.01 compared to mice given naïve reduced B. pertussis numbers (Fig. 3.9). This indicates serum. The limit of detection is indicated as the lower limit of the y axes. ND indicates undetectable that although lower level of phagocytosis of O-antigen bacterial number. deficient B. parapertussis mediated by wPP-induced serum antibodies were observed compared to wild-type strain (Fig. 3.8), this low level of phagocytosis and/or other biological activities of passively transferred antibodies might be sufficient to reduce O-antigen deficient strain in vivo (Fig. 3.9). wP-induced serum completely cleared B. pertussis from the lung by day 14 post- challenge but did not reduce B. parapertussis numbers. These serum antibodies did, however, reduce the numbers of O-antigen deficient B. parapertussis by more than 90% (Fig. 3.9), indicating that O-antigen prevents the wP-induced serum antibody mediated reduction of B. parapertussis numbers in vivo.
B. parapertussis specific antibodies augment B. pertussis vaccine-induced protective immunity against
B. parapertussis.
We have previously shown that both antibodies and T cells are required for anamnestic protective immunity against B. parapertussis (51). Although wP vaccination induced T cell responses that were cross- reactive (Fig. 3.4) and antibodies that bound antigens from heat-killed B. parapertussis (Fig. 3.5B), O-antigen decreased the binding of these antibodies to live B. parapertussis (Fig. 3.5), the opsonophagocytosis mediated by these antibodies in vitro (Fig. 3.6-8) and their antibody-mediated clearance in vivo (Fig. 3.9). Based on these observations, we hypothesized that wP induces sufficient T cell response but the antibody response is
53
Figure 3.10: Passive transfer of B. parapertussis specific antibodies rapidly reduces B. parapertussis colonization in aP and wP vaccinated animals. Groups of four C57BL/6 mice were (B) left untreated (-) or vaccinated with (A) aP, (B) wPP or wP. Mice lacking a transfer of antibodies (-) or given naïve serum (NS), wP-induced serum (wP IS) or wPP-induced serum (wPP IS) were challenged with B. parapertussis. Mice were sacrificed three days post-challenge and the number of CFUs recovered from the respiratory tract is expressed as the Log10 mean ± the standard error. ** indicates P≤ 0.01. The limit of detection is indicated as the lower limit of the y axis. not sufficient to clear B. parapertussis because O-antigen protects B. parapertussis from wP-induced antibodies. If this were the case, then adding antibodies that bind live B. parapertussis should render wP induced immunity sufficient to rapidly clear B. parapertussis. To test this, mice were vaccinated with aP
(Fig. 3.10A) or wP (Fig. 3.10B), these vaccinated mice were left untreated or given naïve, wP or wPP- induced serum antibodies at the time of B. parapertussis challenge and sacrificed three days after challenge.
To compare the protective immunity to that generated by B. parapertussis, a group of mice were vaccinated with wPP and adoptively transferred with wPP-induced antibodies. Less than 100 CFUs of B. parapertussis were recovered in the LRT of this group of mice by day 3 post-challenge (Fig. 3.10B). The very high titers of this wPP-induced serum antibodies alone had modest effect on reducing B. parapertussis numbers (Fig.
3.10B), consistent with prior results with convalescent serum (20, 49). In both aP and wP vaccinated mice, naïve sera had no effect, indicating that components in the serum other than those induced by vaccination do
54 not affect bacteria numbers. Transfer of wP-induced sera had no effect on B. parapertussis colonization throughout the respiratory tract. However, B. parapertussis numbers were significantly lower in the LRT of both aP and wP vaccinated animals given wPP-induced sera than in those given naïve sera (Fig. 3.10). These data suggest that the addition of B. parapertussis specific antibodies is sufficient to render wP and aP effective against B. parapertussis.
55 Discussion:
The increasing incidence of whooping cough in highly vaccinated developed countries includes an unknown proportion of B. parapertussis infections(1, 6). Multiple clinical and experimental studies have shown that current whooping cough vaccines have little efficacy against this bacterium (8, 15, 16, 21, 24), but have not revealed why. In this study, we determined that O-antigen shields vaccine-induced antibodies from binding to B. parapertussis and prevents antibody-mediated opsonophagocytosis in vitro and antibody- mediated clearance in vivo. Although O-antigen requires a large multigenic wbm locus to produce and B. pertussis is still successful in the human population without this surface antigen (4), it is retained in B. parapertussis (32). Apart from its role in inhibiting complement deposition and complement-mediated killing
(12), our study suggests that O-antigen, by decreasing B. pertussis-vaccine-induced antibody binding, may confer a selective advantage to B. parapertussis in human populations in which there is high prevalence of detectable immunity to B. pertussis.
It is interesting that wP, but not aP, induced IFN-γ, which contributed to protection against B. parapertussis but not B. pertussis (Fig. 3.4). IFN-γ plays a role in the recruitment and activation of phagocytic cells (11, 41). In B. parapertussis infected mice, the peak of neutrophil numbers in the lung on day 7 and subsequent control of B. parapertussis numbers are dependent on IFN-γ (D.N. Wolfe, A.T.
Karanikas, S.E. Hester, M.J. Kennett, E.T. Harvill, in press). B. pertussis challenged IFN-γ-/- mice, however, have an indistinguishable course of infection in the respiratory tract and recruit similar numbers of leukocytes to the site of infection as compared to wild-type mice (22) (Wolfe unpublished data), indicating that IFN-γ is not required for B. pertussis clearance and leukocyte recruitment. In vaccinated IFN-γR-/- mice, no impaired reduction of B. pertussis numbers is observed during the first week after challenge, although a rebound of bacteria number was observed on day 10 (28). This is consistent with our observation that IFN-γ is not required for vaccine-mediated control of B. pertussis numbers on day 3 post-challenge (Fig. 3.4).
Consistent with multiple clinical and experimental studies, we found that while wP confers some level of protection against B. parapertussis, aP does not (8, 21). The decrease of pertussis acellular vaccines efficacy against B. parapertussis compared to whole cell vaccines has been suggested to be attributable to the failure of antibodies induced by pertussis acellular vaccines to block the adherence of B. parapertussis to
56 epithelial cells (43) or the immune suppressive effects of the FHA included in those vaccines (26). Among the antigens included in the aP, only fimbriae, but not FHA and pertactin, was shown to confer cross- protection against B. parapertussis in a mouse model (18, 47). wP contains more antigens than aP, among which there may be cross-protective antigens. Alternatively, the differences in Th1/Th2 skewing of wP and aP may affect vaccine efficacy. wP induces a relatively balanced Th1/Th2 response whereas aP induces a
Th2-type response (27). Our data showed that wP, but not aP, induced high splenic IFN-γ production and wP was no longer protective against B. parapertussis when IFN-γ was depleted, suggesting that IFN-γ contributes to the protection conferred by wP (Fig. 3.3, 3.4). These data are therefore consistent with the idea that inducing a Th1 response enhances immunity against B. parapertussis. The different Th1/Th2 skewing, quantity and quality of cross-reactive antibodies and possible immune suppression factors in aP may also explain why aP vaccination was not sufficient to induce protection against B. parapertussis even without the hindrance by O-antigen.
Our data reveal an interesting paradox. wP-mediated clearance of B. parapertussis by day 3 requires
IFN-, which aP does not induce (Fig. 3.3, 3.4). Yet when wPP-induced antibodies, which had limited effect in naïve animals in the first week of infection (Fig. 3.10B) (20), were given to aP-vaccinated animals, B. parapertussis was effectively cleared from mouse lungs within 3 days (Fig. 3.10A). IFN-γ appears to contribute to the protection conferred by wP, but aP-vaccination contributes to rapid clearance despite the lack of detectable IFN- induction in our splenocyte re-stimulation assay (Fig. 3.3). It is possible that some low level of IFN-γ was induced by aP vaccination, which we failed to detect, or some other cross-reactive protective T cell cytokine responses aid in the rapid clearance mediated by B. parapertussis-specific antibodies in aP-vaccinated animals.
Although it is not clear how much B. parapertussis contributes to the resurgence of whooping cough, the low efficacy of current vaccines against this bacterium might confer a selective advantage to B. parapertussis, relative to B. pertussis. Moreover, the lower protection against B. parapertussis conferred by acellular vaccines than whole cell vaccine could affect the relative prevalence, a possibility of greater significance since the recent switch from whole cell to acellular vaccines and the even more recent introduction of acellular vaccines, including the one used here, for adolescents and adults (2, 5, 8, 21).
57 Considering adults to be a possible reservoir for transmission to infants (30, 48), the lack of cross-protection of Adacel, determined in this study, may open a niche for B. parapertussis not only in adolescents/adults but also in infants. This study shows that B. parapertussis evades B. pertussis vaccine induced immunity by blocking cross-reactive antibodies binding via O-antigen. Our current data provide strong evidence that including more B. pertussis proteins that induce antibodies that recognize orthologs in B. parapertusis is unlikely to improve vaccines so that they protect against B. parapertussis. Since our study indicates that supplementing wP or aP with B. parapertussis-specific antibodies rendered them effective against B. parapertussis (Fig. 3.10), addition of protective antigens of B. parapertussis to the vaccine may substantially improve its efficacy against this pathogen.
58 Authors and Contributions:
Xuqing Zhang1,2, Maria Eugenia Rodríguez3, and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, The Pennsylvania State University, 115
Henning Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, The Pennsylvania State University, University Park
3CINDEFI (UNLP, CONICET La Plata), School of Science, La Plata University, La Plata, Argentina
Conceived and designed the experiments: XZ, MER, ETH.
Performed the experiments: XZ, MER.
Analyzed the data: XZ, MER.
Wrote the paper: XZ, ETH.
59 References:
1. 2002. From the Centers for Disease Control and Prevention. Pertussis--United States, 1997-2000. JAMA 287:977-979. 2. 2006. Prevention of pertussis among adolescents: recommendations for use of tetanus toxoid, reduced diphtheria toxoid, and acellular pertussis (Tdap) vaccine. Pediatrics 117:965-978. 3. Arico, B., and R. Rappuoli. 1987. Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes. J Bacteriol 169:2847-2853. 4. Burns, V., Pishko, E.J., Preston, A., Maskell, D.J., and Harvill, E.T. 2003. Role of Bordetella O-antigen in respiratory tract infection. Infect Immun 71:86-94. 5. CDC. 2006. Preventing Tetanus, Diphtheria, and Pertussis Among Adults: Use of Tetanus Toxoid, Reduced Diphtheria Toxoid and Acellular Pertussis Vaccine MMWR 55:1-33. 6. Celentano LP, M. M., Paramatti D, Salmaso S, Tozzi AE; EUVAC-NET Group. . 2005. Resurgence of pertussis in Europe. Pediatr Infect Dis J 24:761-765. 7. Cherry, J. D., P. A. Brunell, G.S. Golden, and D. T. Karson. 1988. Report of the task force on pertussis and pertussis immunization-1988. Pediatrics 81. 8. David, S., van Furth, R., and Mooi, F.R. 2004. Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22:1892-1898. 9. de Melker HE, V. F., Schellekens JF, Teunis PF, Kretzschmar M. . 2006. The incidence of Bordetella pertussis infections estimated in the population from a combination of serological surveys. J Infect 53:106-113. 10. Diavatopoulos DA, C. C., Schouls LM, Brinig MM, Relman DA, Mooi FR. . 2005. Bordetella pertussis, the causative agent of whooping cough, evolved from a distinct, human-associated lineage of B. bronchiseptica. PLoS Pathog 1:e45. 11. Ellis, T. N., and B. L. Beaman. 2004. Interferon-gamma activation of polymorphonuclear neutrophil function. Immunology 112:2-12. 12. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O antigen protects Bordetella parapertussis from complement. Infect Immun 76:1774-1780. 13. Gopinathan, L., G. S. Kirimanjeswara, D. N. Wolfe, M. L. Kelley, and E. T. Harvill. 2007. Different mechanisms of vaccine-induced and infection-induced immunity to Bordetella bronchiseptica. Microbes Infect 9:442-448. 14. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 15. He, Q., Viljanen, M.K., Arvilommi, H., Aittanen, B., and Mertsola, J. 1998. Whooping cough caused by Bordetella pertussis and Bordetella parapertussis in an immunized population. JAMA 280:635-637. 16. Heininger U, S. K., Christenson P, Cherry JD. . 1998. Evidence of efficacy of the Lederle/Takeda acellular pertussis component diphtheria and tetanus toxoids and pertussis vaccine but not the Lederle whole-cell component diphtheria and tetanus toxoids and pertussis vaccine against Bordetella parapertussis infection. Clin Infect Dis 28:602-604. 17. Hoppe, J. E. 1999. Update on respiratory infection caused by Bordetella parapertussis. Pediatr Infect Dis J 18:375-381. 18. Khelef, N., Danve, B., Quentin-Millet, M.J., and Guiso, N. 1993. Bordetella pertussis and Bordetella parapertussis: two immunologically distinct species. Infect Immun 61:486-490. 19. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T. Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated clearance of Bordetella pertussis. J Clin Invest 115:3594-3601. 20. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in immunity to Bordetella infections. Infect Immun 71:1719-1724. 21. Liese JG, R. C., Stojanov S, Belohradsky BH; Munich Vaccine Study Group. . 2003. Clinical and epidemiological picture of B pertussis and B parapertussis infections after introduction of acellular pertussis vaccines. Arch Dis Child 88:684-687. 22. Mahon, B. P., B. J. Sheahan, F. Griffin, G. Murphy, and K. H. Mills. 1997. Atypical disease after Bordetella pertussis respiratory infection of mice with targeted disruptions of interferon-gamma receptor or immunoglobulin mu chain genes. J Exp Med 186:1843-1851. 23. Marchitto, K. S., S. G. Smith, C. Locht, and J. M. Keith. 1987. Nucleotide sequence homology to pertussis toxin gene in Bordetella bronchiseptica and Bordetella parapertussis. Infect Immun 55:497-501. 24. Mastrantonio, P., Stefanelli, P., Giulano, M., Herrera Rojas, Y., Ciofi degli Atti, M., Anemona, A., and Tozzi, A.E. 1998. Bordetella parapertussis infection in children: epidemiology, clinical symptoms, and molecular characteristics of isolates. J Clin Microbiol 36:999-1002.
60 25. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 26. McGuirk, P., C. McCann, and K. H. Mills. 2002. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 195:221-231. 27. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect 3:655-677. 28. Mills, K. H., M. Brady, E. Ryan, and B. P. Mahon. 1998. A respiratory challenge model for infection with Bordetella pertussis: application in the assessment of pertussis vaccine potency and in defining the mechanism of protective immunity. Dev Biol Stand 95:31-41. 29. Myc, A., J. Buck, J. Gonin, B. Reynolds, U. Hammerling, and D. Emanuel. 1997. The level of lipopolysaccharide-binding protein is significantly increased in plasma in patients with the systemic inflammatory response syndrome. Clin Diagn Lab Immunol 4:113-116. 30. Nelson, J. D. 1978. The changing epidemiology of pertussis in young infants. The role of adults as reservoirs of infection. Am J Dis Child 132:371-373. 31. Parent, M. A., L. B. Wilhelm, L. W. Kummer, F. M. Szaba, I. K. Mullarky, and S. T. Smiley. 2006. Gamma interferon, tumor necrosis factor alpha, and nitric oxide synthase 2, key elements of cellular immunity, perform critical protective functions during humoral defense against lethal pulmonary Yersinia pestis infection. Infect Immun 74:3381-3386. 32. Parkhill, J., et. al. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 33. Pilione MR, H. E. 2006. The Bordetella bronchiseptica type III secretion system inhibits gamma interferon production that is required for efficient antibody-mediated bacterial clearance. Infect Immun 74:1043-1049. 34. Pishko, E. J., G. S. Kirimanjeswara, M. R. Pilione, L. Gopinathan, M. J. Kennett, and E. T. Harvill. 2004. Antibody-mediated bacterial clearance from the lower respiratory tract of mice requires complement component C3. Eur J Immunol 34:184-193. 35. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L. Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-3767. 36. Repp, R., T. Valerius, A. Sendler, M. Gramatzki, H. Iro, J. R. Kalden, and E. Platzer. 1991. Neutrophils express the high affinity receptor for IgG (Fc gamma RI, CD64) after in vivo application of recombinant human granulocyte colony-stimulating factor. Blood 78:885-889. 37. Rodriguez, M. E., S. M. Hellwig, D. F. Hozbor, J. Leusen, W. L. van der Pol, and J. G. van de Winkel. 2001. Fc receptor-mediated immunity against Bordetella pertussis. J Immunol 167:6545-6551. 38. Rodriguez, M. E., W. L. Van der Pol, and J. G. Van de Winkel. 2001. Flow cytometry-based phagocytosis assay for sensitive detection of opsonic activity of pneumococcal capsular polysaccharide antibodies in human sera. J Immunol Methods 252:33-44. 39. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220. 40. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J Bacteriol 173:4288-4296. 41. Sun, K., S. L. Salmon, S. A. Lotz, and D. W. Metzger. 2007. Interleukin-12 promotes gamma interferon- dependent neutrophil recruitment in the lung and improves protection against respiratory Streptococcus pneumoniae infection. Infect Immun 75:1196-1202. 42. van den Akker, W. M. 1998. Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144:1527-1535. 43. van den Berg, B. M., H. Beekhuizen, F. R. Mooi, and R. van Furth. 1999. Role of antibodies against Bordetella pertussis virulence factors in adherence of Bordetella pertussis and Bordetella parapertussis to human bronchial epithelial cells. Infect Immun 67:1050-1055. 44. von Koenig, C. H., A. Tacken, and H. Finger. 1988. Use of supplemented Stainer-Scholte broth for the isolation of Bordetella pertussis from clinical material. J Clin Microbiol 26:2558-2560. 45. Watanabe M, N. M. 2004. Whooping cough due to Bordetella parapertussis: an unresolved problem. Expert Rev Anti Infect Ther 2:447-454. 46. Weingart, C. L., G. Broitman-Maduro, G. Dean, S. Newman, M. Peppler, and A. A. Weiss. 1999. Fluorescent labels influence phagocytosis of Bordetella pertussis by human neutrophils. Infect Immun 67:4264-4267. 47. Willems, R. J., Kamerbeek, J., Geuijen, C.A., Top, J., Gielen, H., Gaastra, W., and Mooi, F.R. 1998. The efficacy of a whole cell pertussis vaccine and fimbriae against Bordetella pertussis and Bordetella parapertussis infections in a respiratory mouse model. Vaccine 16:410-416.
61 48. Wirsing von Konig, C. H., S. Postels-Multani, H. L. Bock, and H. J. Schmitt. 1995. Pertussis in adults: frequency of transmission after household exposure. Lancet 346:1326-1329. 49. Wolfe, D. N., A. M. Buboltz, and E. T. Harvill. 2009. Inefficient Toll-like receptor-4 stimulation enables Bordetella parapertussis to avoid host immunity. PLoS ONE 4:e4280. 50. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 51. Wolfe DN, K. G., Harvill ET. . 2005. Clearance of Bordetella parapertussis from the lower respiratory tract requires humoral and cellular immunity. Infect Immun 73:6508-6513. 52. Wolfe, D. N., G. S. Kirimanjeswara, E. M. Goebel, and E. T. Harvill. 2007. Comparative role of immunoglobulin A in protective immunity against the Bordetellae. Infect Immun 75:4416-4422.
62
Chapter 4
Emergence of Bordetella holmesii in Massachusetts and Its Evasion of B. pertussis
Vaccine-induced Immunity
Abstract:
Bordetella holmesii is closely-related to B. pertussis, but only rarely observed. Since 2005, culture- confirmed B. holmesii cases have been identified in Massachusetts every year. Using a murine model of infection, we determined that immunity induced by a B. holmesii isolate from Massachusetts resulted in protection against itself. However, a whole-cell (wP) or an acellular (aP) B. pertussis vaccine failed to confer protection against this B. holmesii isolate. Although T cell responses induced by wP or aP cross-reacted with
B. holmesii, vaccine-induced antibodies failed to efficiently bind B. holmesii. B. holmesii–specific antibodies provided in addition to wP were sufficient to rapidly reduce B. holmesii numbers in mouse lungs. This study demonstrates the established presence of B. holmesii as a respiratory pathogen in a highly vaccinated population and suggests that failure to induce cross-reacting antibodies may explain the poor cross-protection conferred by whooping cough vaccines against B. holmesii.
63 Introduction:
Whooping cough is a highly contagious and acute coughing illness in humans (17). Both Bordetella pertussis and B. parapertussis are causative agents of whooping cough (13, 17). The first whooping cough vaccines, consisting of whole inactivated B. pertussis, were licensed in the mid-1940s and led to a dramatic decrease of disease incidence by the mid-1960s (4, 17). However, the potential health risks associated with these vaccines led to the development of acellular vaccines, consisting of some combination of pertussis toxin, pertactin, filamentous hemagglutinin and two fimbriae serotypes, all solely derived from B. pertussis.
Despite high vaccine coverage, reported whooping cough incidence in some developed countries has been increasing over the past 20 years (1, 3). Furthermore, a large portion of whooping cough infections are thought to remain unreported (5).
In November 1983, the Centers for Disease Control and Prevention (CDC) received an isolate of a
Gram-negative bacterium recovered from an asplenic patient (39). During the decade that followed, additional clinical isolates with the same microbiological characteristics (slow-growing, gram-negative, small coccoid, asaccharolytic, oxidase negative, nonmotile and brown-soluble-pigment-producing) were submitted to the CDC for identification (39). This previously unidentified bacterium was initially designated as “CDC nonoxidizer group 2” (NO-2). Subsequent biochemical analysis, 16S rRNA sequencing, and DNA relatedness studies revealed that the NO-2 strains were a single new species belonging to the genus
Bordetella. In 1995, the NO-2 group was named “Bordetella holmesii” in honor of Barry Holmes (39). Since then, this bacterium has been isolated from diverse countries, including Australia, Germany, France, the
United Kingdom, the United States and Switzerland (7, 10, 26, 31, 39), indicating that B. holmesii is a wide- spread pathogen.
B. holmesii infections usually have a relatively milder infectious course (32), though severe systemic infection of a healthy adolescent has also been reported (31). B. holmesii has been isolated from immunocompromised hosts (asplenic or sickle cell disease patients and transplant recipients) (16, 19, 23, 26,
32). The association of B. holmesii with underlying conditions may be due to immunodeficiencies in these patients that increase risk for B. holmesii infection, but it may also reflect the reporting bias of clinicians who are more likely to pursue the identification of isolates associated with severe disease. Although B. holmesii
64 was often isolated from blood samples, it has also been found to cause respiratory diseases (18, 35, 43). B. holmesii has been isolated from the pleural fluid and lung biopsy specimens of an immunocompetent adolescent presenting with fever and pulmonary fibrosis (31) and from sputum of patients with respiratory failure (35). Moreover, B. holmesii was isolated from nasopharyngeal specimens of otherwise healthy individuals presenting with whooping cough-like symptoms such as paroxysms, whoop or post-tussive vomiting (18, 43). Therefore, B. holmesii appears able to infect the respiratory tract like other Bordetella species.
In this study, we demonstrated the increased presence of B. holmesii in a highly vaccinated population in Massachusetts since 2005. Sequence-based phylogenetic analyses on 30 independent isolates identified limited genetic variation among B. holmesii isolates. Using a murine model of infection, we found that both wP and aP failed to confer protection against a B. holmesii nasopharyngeal isolate from Massachusetts.
Although these vaccines induced cross-reactive T cell responses, vaccine-induced antibodies did not efficiently bind B. holmesii. The administration of B. holmesii-specific antibodies to wP-vaccinated mice quickly reduced B. holmesii numbers in the lungs, indicating that the poor cross-protection might be attributable to the lack of B. holmesii protective antigens in the vaccine.
65 Materials and Methods:
Identification of B. holmesii culture-positive cases in Massachusetts. A serum test was performed if the patient was ≥ 11 years old and had a cough for more than 14 days. In all other cases (< 11 years old or ≤ 14 days of cough) a nasopharyngeal swab was cultured. Details on culturing methods and tests performed for identification of Bordetella spp. have been previously described (18).
Bacterial strains and growth. B. pertussis strain 536 (34) and B. parapertussis strain CN2591 (29) have been previously described. Bacteria were maintained on Bordet-Gengou agar (Difco) supplemented with
10% sheep’s blood (Hema Resources) without antibiotics (B. holmesii) or with 20 µg/mL streptomycin (B. pertussis or B. parapertussis) (Sigma-Aldrich). Liquid cultures were grown overnight in Stainer-Scholte broth at 37°C to mid-log phase (33, 37).
Phylogenetic analysis. Phylogenetic analyses based on atpD, rpoB, tuf, and rnpB sequences were performed as previously described (6). Information on the B. holmesii isolates is listed in Figure 2. Concatenated sequences were aligned for the construction of unweighted-pair group method using average linkages
(UPGMA) trees using MEGA 4.0 software.
Animal experiments. 4-6 week old C57BL/6 mice were obtained from the Jackson Laboratories (Bar
Harbor) and bred in Bordetella-free, specific pathogen-free breeding rooms. Mice were vaccinated on days
14 and 28 prior to challenge as previously described (9, 45). For challenge, mice were sedated and inoculated by pipetting 50 µL PBS containing 5×105 CFU of B. pertussis or B. parapertussis or 107 CFU of B. holmesii onto the external nares (14). For adoptive transfer of serum antibodies, mice were vaccinated with the indicated bacteria on days 0 and 14, and sera were collected on day 28 from vaccinated mice or from naïve animals. 200 µL of sera were i.p. injected immediately before inoculation (15, 28). To quantify bacterial numbers, mice were sacrificed via CO2 inhalation, and the lungs were excised, homogenized in PBS, serially diluted and plated onto Bordet-Gengou agar plates. Bacterial colonies were counted after incubation at 37°C for 3-6 days (15). The lower limit of detection was 10 CFU. All protocols were approved by Institutional
Animal Care and Use Committee (IACUC), and all animal were handled in accordance with institutional guidelines.
66 Splenocyte re-stimulations. Spleens were excised from vaccinated mice. Splenocytes were isolated as previously described (27, 45) and stimulated with either media alone or media containing 107 CFU
(multiplicities of infection of 5) of the indicated heat-killed bacteria (9, 27). After three days, the supernatants were collected and analyzed for Interferon (IFN)-γ and interleukin-10 (IL-10) production via enzyme-linked immunosorbent assays (ELISA) as per the manufacturer’s instructions (R&D Systems).
Titer ELISAs. Antibody titers were determined as previously described (25, 40, 41) with the following modifications. wP or wH-induced/naive serum samples (1:200 dilution) or aP/adjuvant-induced serum samples (1:50 dilution) from each mouse was added to the first well of each row of 96-well plates.
Western Blot analysis. Lysates containing 107 CFU of indicated heat-killed bacteria were run on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels in denaturing conditions.
Polyvinylidene Fluoride (PVDF) membranes (Millipore) were probed overnight with either naïve serum
(1:100 dilution) or wH- (1:500 dilution), wP- (1:500 dilution), aP- (1:100 dilution) induced serum. A
1:10,000 dilution of goat anti-mouse Ig HRP-conjugated antibodies (Southern Biotech) was used as the detector antibody (40, 42). The membrane was visualized with ECL Western Blotting Detection Reagent
(Pierce Biotechnology).
Statistical analysis. The means +/- standard error (error bars) were determined for all appropriate data.
Two-tailed, unpaired Student’s T-tests were used to determine statistical significance between groups.
Results were also analyzed by ANOVA and Tukey simultaneous test in Minitab with similar significance.
67 Results:
B. holmesii is endemic in a highly vaccinated population.
Probert et al. have described detection of B.
holmesii from nasopharyngeal specimens collected
from 2003 to 2007 by PCR assays, but these isolates
were not validated by culture (30). Other than this
study, few publications have reported the prevalence of
B. holmesii in recent years. The MDPH provides a
Figure 4.1: B. holmesii cases and vaccine coverage in robust pertussis surveillance program and pertussis Massachusetts. Numbers of B. holmesii-culture- positive nasopharyngeal specimens confirmed by the diagnostic services. It has been estimated that vaccine Massachusetts Department of Public Health, by year, 1990-2009 (bars). Estimated vaccination coverage coverage for children among 19-35 months of age in among children 19-35 months of age in Massachusetts with four or more doses of any diphtheria and tetanus toxoids and pertussis vaccines (DTaP/DTP), by year, Massachusetts with four or more doses of any pertussis 1995-2008 (squares), is expressed as point estimate (%) ± 95% confidence interval. Ranking of vaccine vaccines was more than 85% between 1995 and 2008, coverage for four or more doses of DTaP/DTP in Massachusetts among all the states in the United States, ranking 5th amongst the 50 states in the U.S. on by year, 1995-2008, is expressed below the x axis. average (Fig. 4.1) (2). Here, we reported the numbers of B. holmesii-culture-positive nasopharyngeal specimens submitted to the MDPH from 1990 to 2008. B. holmesii was sporadically isolated from 1990 to 2004; however, since 2005 this bacterium has been isolated from nasopharyngeal swabs of 40 patients with respiratory symptoms in 2005, 2006, 2007, 2008 and 2009, respectively (Fig. 4.1). Together, these data indicate that B. holmesii is consistently present in the nasopharynx of a small number of patients suffering respiratory infections in Massachusetts where the vaccine coverage is high. This suggests that B. holmesii has established a successful chain of transmission despite the high level of immunity to B. pertussis.
Phylogenic relationship among B. holmesii isolates.
To evaluate the phylogenic relationship among B. holmesii isolates, an UPGMA tree was constructed based on concatenated sequences amplified from regions of atpD, rpoB, tuf, and rnpB genes (6). Consistent with previous findings (6), all the B. holmesii isolates tested are more closely-related to B. hinzii and B. avium than to the classical bordetellae (Fig. 4.2). Although single-nucleotide polymorphisms do exist among B.
68
Figure 4.2: Phylogenetic tree of B. holmesii isolates. An UPGMA phylogeny of 30 B. holmesii isolates, B. pertussis 536, B. parapertussis 2591, B. bronchiseptica RB50, B. avium 197N, and B. hinzii BC304 are based on concatenated sequences of atpD, rpoB, tuf and rnpB genes. Bootstrapping values greater than 50% in 1,000 resamplings are indicated. a CDC, Centers for Disease Control and Prevention; MDPH, Massachusetts Department of Public Health. b —, unknown. LSW and ATK performed this experiment. holmesii isolates, all the nasopharyngeal isolates from Massachusetts belong to branches with bootstrapping value less than 50%, indicating their close-relatedness. B. holmesii isolates from blood and nasopharyngeal specimens do not cluster separately, suggesting that evolutionary relationship among B. holmesii isolates are not associated with differences in anatomic isolation sites.
B. holmesii is not susceptible to B. pertussis vaccine-induced immunity.
Since B. holmesii is endemic in a highly-vaccinated population, we hypothesize that this bacterium may evade B. pertussis vaccine-induced immunity. We first examined whether B. holmesii immunization induces protection against itself and cross-protection against B. pertussis and/or B. parapertussis. C57BL/6 mice were vaccinated with heat-killed B. holmesii (wH). These mice or naïve mice were challenged with B. pertussis, B. parapertussis or B. holmesii and sacrificed on day 3 post-inoculation (p.i.) for bacterial number quantification. Since colonization efficiency of B. holmesii in the murine respiratory tract is low compared to
69 the classical bordetellae, possibly due to the decreased
attachment to mouse respiratory epithelium (Karanikas
A.T., Weyrich L.S., Goebel E.M., and Harvill E.T.,
unpublished data), a high challenge dose was used.
Similar numbers of B. pertussis were recovered from
the lungs of naïve and wH-vaccinated mice (Fig. 4.3A),
indicating that B. holmesii vaccination failed to reduce
B. pertussis numbers within 3 days. B. holmesii
vaccination reduced the B. parapertussis load by ~70%
in the lungs, indicating a modest cross-protection
provided by B. holmesii against B. parapertussis.
Compared to naïve mice, B. holmesii vaccination
reduced B. holmesii numbers by ~97% in the lungs
(Fig. 4.3A), indicating that B. holmesii induces an
effective anamnestic responses against itself.
To test whether B. pertussis vaccines provide
cross-protection against B. holmesii, C57BL/6 mice
Figure 4.3: Both wP and aP failed to confer were vaccinated with wP or aP. These mice or naïve protection against B. holmesii. Mice were vaccinated with wH (A), wP (B) or aP (C) (white bars). mice were challenged with B. holmesii or B. pertussis Vaccinated mice (white bars) or the naive (A, B)/adjuvant only vaccinated (C) mice (black bars) were and euthanized 3 days later. wP reduced B. pertussis challenged with B. pertussis (B.p.), B. parapertussis (B.p.p.) or B. holmesii (B.h.), and sacrificed on day 3 numbers in the lungs by > 99.99% compared to naïve post-inoculation. Bacterial numbers in the lungs were expressed as mean Log10CFU ± standard error. * mice; however, wP failed to reduce B. holmesii indicates P ≤ 0.05 and ** indicates P≤ 0.01 determined by ANOVA and Tukey simultaneous test. wP: B. pertussis whole cell vaccine; wH: B. holmesii whole cell numbers (Fig. 4.3B). Compared to the adjuvant-only- vaccine; aP: B. pertussis acellular vaccine. vaccinated mice, aP-vaccinated mice reduced B. pertussis numbers in their lungs by ~98% (Fig. 4.3C), but this vaccine did not reduce B. holmesii numbers either. Together, these data indicate that B. holmesii evades wP- and aP-induced immunity.
T cell responses following wH and wP/aP are cross-reactive.
70 To determine whether T cell responses
following vaccination are cross-reactive, splenocytes
from naïve or wH-, wP-, or aP-vaccinated mice were
stimulated with media alone or media containing heat-
killed B. pertussis, B. holmesii, or B. parapertussis for
72h. Concentrations of IFN-γ and IL-10, representing
Th1 and Treg cytokines, respectively, in the cell culture
supernatants were determined. Splenocytes from wH-
vaccinated mice produced low levels of IFN-γ and IL-
10 upon stimulation by B. pertussis, B. holmesii, or B.
parapertussis, and the levels were comparable to those
produced by naïve splenocytes (Fig. 4.4). However,
Figure 4.4: wH/wP/aP splenic IFN-γ and IL-10 splenocytes from wP-vaccinated mice, produced high responses are cross-reactive. Splenocytes from naïve mice or wH-, wP-, aP- vaccinated mice were stimulated levels of IFN-γ and IL-10 upon stimulation with heat- with media only (horizontally dashed bars) or media containing heat-killed B. pertussis (B.p.) (black bars), B. killed B. pertussis, B. holmesii, or B. parapertussis, parapertussis (B.p.p.) (tiltedly dashed bars) or B. holmesii (B.h.) (white bars). IFN-γ (A) or IL-10 (B) concentrations in the cell culture supernatant were indicating that wP induces a strong cross-reactive T expressed as mean ± standard error. wP: B. pertussis whole cell vaccine; wH: B. holmesii whole cell vaccine; cell response. Although splenocytes from aP- aP: B. pertussis acellular vaccine. vaccinated mice produced little IFN-γ, they produced similar level of IL-10 upon stimulation with heat-killed B. pertussis, B. holmesii, or B. parapertussis, indicating a low but cross-reactive T cell response following aP vaccination. These data indicate that B. pertussis vaccines induce cross-reactive T cell responses to B. holmesii. wP/aP-induced antibodies do not efficiently recognize B. holmesii.
To examine whether B. holmesii- and B. pertussis-induced antibodies are cross-reactive, Ig titers of wH-, wP-, or aP- induced sera were determined by ELISA using heat-inactivated bacteria as antigens. The B. holmesii-specific Ig titer of wH-induced serum was >450,000, which is around 10-fold and 25-fold higher than B. parapertussis- and B. pertussis-specific titer of this serum, respectively (Fig. 4.5A). This indicates that B. holmesii-induced antibodies bind less efficiently to B. parapertussis or B. pertussis than to B. holmesii.
71 B. pertussis-specific Ig titer of wP- and aP-induced
serum antibodies were 290,000 and 2,500, respectively.
wP- and aP-induced antibodies bind less well to B.
parapertussis (Fig. 4.5A) and confer little protection
against B. parapertussis in vivo (45). wP- or aP-
induced sera bound even less well to B. holmesii. A
similar trend was observed when live bacteria were
used to coat the ELISA plates (data not shown), which
rules out the possibility that heat-inactivation destroys
cross-reactive antigens.
To compare the antigens recognized by sera
from different groups, Western blot analyses were Figure 4.5: wH/wP/aP antibody responses are not fully cross-reactive. (A) B. pertussis (B.p.) (black performed on B. pertussis, B. parapertussis or B. bars), B. parapertussis (B.p.p.) (tiltedly dashed bars) or B. holmesii (B.h.) (white bars) specific Ig titers of serum holmesii lysates probed with naïve serum or wH-, wP-, antibodies form wH-, wP- or aP- vaccinated mice are expressed as mean Log10 Ig Titer ± the standard error. aP-induced sera. wH-induced serum antibodies ** indicates P≤ 0.01 determined by ANOVA and Tukey simultaneous test. (B) Western blots were performed on recognized B. holmesii antigens of various molecular B. pertussis, B. parapertussis or B. holmesii lysates probed with naïve serum or wH-, wP-, aP- induced serum (IS). wP: B. pertussis whole cell vaccine; wH: B. masses but lacked cross-recognition of some higher- holmesii whole cell vaccine; aP: B. pertussis acellular vaccine. molecular-mass B. pertussis and B. parapertussis antigens (Fig. 4.5B). wP- and aP-induced serum antibodies bound less efficiently to B. parapertussis antigens than to B. pertussis antigens, consistent with published data (45). Although wP-induced antibodies recognized some B. holmesii antigens, they lacked recognition of higher-molecular-mass (> 60kDa) antigens of B. holmesii. aP-induced antibodies only poorly recognized a single B. holmesii antigen.
B. holmesii-specific antibodies augment wP-induced immunity against B. holmesii.
Based on our data, we hypothesized that wP induces sufficient T cell responses but the antibody responses are not sufficient to confer cross-protection. If this were the case, adding B. holmesii-specific antibodies would render wP effective against B. holmesii. To test this, C57BL/6 mice were left untreated or vaccinated with wP, and later treated with either naïve serum or serum from wP- or wH-vaccinated mice and
72 challenged with B. holmesii. These mice were
euthanized on day 3 post-challenge to determine B.
holmesii numbers in the lungs. Neither wP-induced
serum nor vaccination alone reduced B. holmesii
numbers, but vaccinated mice given B. holmesii-
immune serum had substantially lowered B. holmesii
Figure 4.6: Supplement wP with B. holmesii- but not numbers in the lungs (Fig. 4.6), indicating that the B. pertussis- specific antibodies confer protection against B. holmesii. Groups of four wP-vaccinated addition of B. holmesii-specific antibodies to wP C57BL/6 mice were left untreated (none) or adoptively transferred naïve serum (NS), or wP-, wH- induced increases its efficacy against B. holmesii. serum, and challenged with B. holmesii. Bacterial numbers in the lungs on day 3 post-inoculation are expressed as mean Log10CFU ± the standard error. * indicates P≤ 0.05 determined by ANOVA and Tukey simultaneous test. wP: B. pertussis whole cell vaccine; wH: B. holmesii whole cell vaccine; aP: B. pertussis acellular vaccine.
73 Discussion:
Our epidemiology data indicate that B. holmesii is endemic in a highly vaccinated population (Fig.
4.1). Since its establishment as a species in 1995 (39), sporadic reports of B. holmesii cases have been reported worldwide (10, 16, 23, 24, 26, 31, 32, 35). However, few reports on its routine isolation have been described. Here we report that B. holmesii was cultured from nasopharyngeal specimens submitted to the
MDPH each year from 2005 to 2009. These observed cases are likely to be a small fraction of the total number of B. holmesii infections. One major obstacle to the identification of B. holmesii infection is the lack of awareness, since B. holmesii is not generally considered as an inhabitant of the respiratory tract and is excluded from commercially available identification systems. Current estimation of B. holmesii prevalence is further confounded by difficulties in the identification of Bordetella spp.. Culture-based laboratory diagnosis is highly specific but is sensitive only in the initial phases of disease and requires special media with an extended incubation period of 5-10 days (38). Moreover, cephalexin, the antibiotics commonly incorporated in both charcoal and Bordet-Gengou agar for Bordetella spp. recovery, has been reported to inhibit B. holmesii growth (18), likely lowering B. holmesii recovery rate. Diagnostic serology and PCR can be highly sensitive and quicker than culture, but no serology or PCR assay specific for B. holmesii is widely accepted.
2,628 B. pertussis cases were identified by culture between 1992 and 2008 in Massachusetts, while a total of
11,577 B. pertussis cases were identified by culture, serology and PCR combined. 8,949, or 77%, of B. pertussis cases were identified by serology or PCR, neither of which would detect B. holmesii. It is likely that the 44 culture-positive B. holmesii cases reported here only comprise a small proportion of all the B. holmesii infections in Massachusetts. Overall, due to the low awareness and the identification difficulties, B. holmesii infection might occur more frequently than the limited reported cases would suggest.
B. holmesii isolates seem to show little genetic variance. Several previous reports have demonstrated limited numbers of pulsed-field gel electrophoresis (PFGE) banding pattern (18) and little 16S rRNA heterogeneity (32, 39) among B. holmesii isolates. Diavatopoulos et al. also analyzed seven independent B. holmesii isolates by multilocus-sequence-typing and observed only one non- synonymous polymorphism among 3,666 bases (6). Using a similar method, we further analyzed 20 isolates from the CDC and 10 isolates from the MDPH. These isolates, although isolated from diverse geographic locations and dates, seem
74 to be a nearly uniform group (Fig. 4.2). Taken together, B. holmesii seems to be clonal, which indicates its recent emergence and may suggest a chain of transmission from an isolated source.
The murine model of human-adapted bordetellae infection has been well-established. B. pertussis and B. parapertussis infections in mice mimic the course of infection and most of the immune responses in humans with the exception of the coughing symptom (11, 12, 15, 20). Moreover, bacterial clearance from lungs following B. pertussis challenge in vaccinated adult mice correlates with vaccine efficacies in children
(21, 22). An animal model of B. holmesii infection has not been previously described. B. holmesii efficiently colonizes the murine respiratory tract only when large intranasal inoculums are delivered, a phenomenon currently under investigation in our laboratory.
We determined, for the first time, that B. pertussis vaccines confer little, if any, protection against B. holmesii. Comparative analysis of B. holmesii and B. pertussis 16S rRNA sequences suggested that B. holmesii is closely-related to B. pertussis (39). However, subsequent comparative genomic hybridization analysis suggested that this might be a result from lateral gene transfer of B. pertussis 16S rRNA to B. holmesii (6). Analysis of cellular fatty acid composition, sequencing of housekeeping genes and characterization of the BvgAS locus also suggested that B. holmesii might not be as closely-related to B. pertussis as originally assumed (6, 8, 39). Furthermore, anti-B. pertussis pertactin, pertussis toxin, fimbriae 2 and 3, adenylate cyclase toxin and filamentous hemagglutinin failed to recognize any protein from multiple B. holmesii isolates (26), suggesting that these proteins are either not produced by B. holmesii or that the proteins produced are antigenically distinct from those in B. pertussis. Using the murine model of infection, we determined that both wP and aP do not confer efficient protection against B. holmesii (Fig. 4.3B, 4.3C). The vaccine-induced T cell responses are cross-reactive to B. holmesii (Fig. 4.4); however, vaccine-induced antibodies bind poorly to B. holmesii (Fig. 4.5). Furthermore, B. holmesii-specific, but not B. pertussis- specific antibody administration, efficiently decreased B. holmesii numbers in the lungs of vaccinated mice
(Fig. 4.6), suggesting that the lack of cross-reactive antibody responses might result in the poor cross- protection of B. pertussis vaccines against B. holmesii.
A similar lack of cross-protection against B. parapertussis was attributed to the lack of a B. parapertussis-specific protective antigen, O-antigen, in the B. pertussis vaccines (44), and the blockage of
75 cross-reactive antibodies binding by O-antigen (45). B. holmesii may avoid B. pertussis vaccine-induced immunity via similar mechanisms. B. holmesii induced anamnestic immunity against itself (Fig. 4.3A), indicating that this bacterium produces protective antigens. The antigens recognized by wH could be the potential protective antigens of B. holmesii, but are yet to be identified. B. holmesii LPS is phenotypically and immunologically distinct from B. pertussis LPS (36), but the detailed structure of B. holmesii LPS and its ability to block the binding of cross-reactive antibodies require further investigation.
Our data indicate that B. holmesii is present in a highly vaccinated U.S. population. B. pertussis vaccines confer little protection against B. holmesii, which may potentially favor the emergence of B. holmesii in the human population. Careful surveillance of B. holmesii infections is needed to better evaluate its prevalence and potential mode of transmission. Genome sequencing of this organism will help address the presence of novel virulence determinants of B. holmesii, and guide the design of effective vaccines against this human pathogen.
76 Authors and Contributions
Xuqing Zhang1,2, Laura S. Weyrich1,3, Alexia T. Karanikas1,4, Jennie S. Lavine5 and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, the Pennsylvania State University, 115 Henning
Building, University Park, PA 16802
2Graduate Program in Genetics
3Graduate Program in Biochemistry, Microbiology, and Molecular Biology
4Graduate Program in Cell and Developmental Biology
5Center for Infectious Disease Dynamics, the Pennsylvania State University, 501 Agriculture and
Sciences Industry Building, University Park, PA 16802
Conceived and designed the experiments: XZ, ETH.
Performed the experiments: XZ, LSW (Fig. 4.2), ATK (Fig. 4.2).
Analyzed the data: XZ, LSW, JSL.
Wrote the paper: XZ, ETH.
77 References:
1. 2002. From the Centers for Disease Control and Prevention. Pertussis--United States, 1997-2000. JAMA 287:977-979. 2. CDC Immunization Coverage in the U.S., National Immunization Survey (NIS) - Children (19-35 months) posting date. [Online.] 3. Celentano LP, M. M., Paramatti D, Salmaso S, Tozzi AE; EUVAC-NET Group. . 2005. Resurgence of pertussis in Europe. Pediatr Infect Dis J 24:761-765. 4. Cherry, J. D., P. A. Brunell, G.S. Golden, and D. T. Karson. 1988. Report of the task force on pertussis and pertussis immunization-1988. Pediatrics 81. 5. de Melker HE, V. F., Schellekens JF, Teunis PF, Kretzschmar M. . 2006. The incidence of Bordetella pertussis infections estimated in the population from a combination of serological surveys. J Infect 53:106-113. 6. Diavatopoulos, D. A., C. A. Cummings, H. G. van der Heide, M. van Gent, S. Liew, D. A. Relman, and F. R. Mooi. 2006. Characterization of a highly conserved island in the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J Bacteriol 188:8385-8394. 7. Dorbecker, C., C. Licht, F. Korber, G. Plum, C. Haefs, B. Hoppe, and H. Seifert. 2007. Community-acquired pneumonia due to Bordetella holmesii in a patient with frequently relapsing nephrotic syndrome. J Infect 54:e203-205. 8. Gerlach, G., S. Janzen, D. Beier, and R. Gross. 2004. Functional characterization of the BvgAS two-component system of Bordetella holmesii. Microbiology 150:3715-3729. 9. Gopinathan, L., G. S. Kirimanjeswara, D. N. Wolfe, M. L. Kelley, and E. T. Harvill. 2007. Different mechanisms of vaccine-induced and infection-induced immunity to Bordetella bronchiseptica. Microbes Infect 9:442-448. 10. Greig, J. R., S. S. Gunda, and J. T. C. Kwan. 2001. Bordetella holmesii bacteraemia in an individual on haemodialysis. Scand J Infect Dis 33:716-717. 11. Harvill, E. T., P. A. Cotter, and J. F. Miller. 1999. Pregenomic comparative analysis between bordetella bronchiseptica RB50 and Bordetella pertussis tohama I in murine models of respiratory tract infection. Infect Immun 67:6109-6118. 12. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 13. Hoppe, J. E. 1999. Update on respiratory infection caused by Bordetella parapertussis. Pediatr Infect Dis J 18:375-381. 14. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T. Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated clearance of Bordetella pertussis. J Clin Invest 115:3594-3601. 15. Kirimanjeswara, G. S., P. B. Mann, and E. T. Harvill. 2003. Role of antibodies in immunity to Bordetella infections. Infect Immun 71:1719-1724. 16. Lindquist, S. W., D. J. Weber, M. E. Mangum, D. G. Hollis, and J. Jordan. 1995. Bordetella holmesii sepsis in an asplenic adolescent. Pediatr Infect Dis J 14:813-815. 17. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 18. Mazengia, E., E. A. Silva, J. A. Peppe, R. Timperi, and H. George. 2000. Recovery of Bordetella holmesii from patients with pertussis-like symptoms: use of pulsed-field gel electrophoresis to characterize circulating strains. J Clin Microbiol 38:2330-2333. 19. McCavit, T. L., S. Grube, P. Revell, and C. T. Quinn. 2008. Bordetella holmesii bacteremia in sickle cell disease. Pediatr Blood Cancer 51:814-816. 20. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect 3:655-677. 21. Mills, K. H., M. Brady, E. Ryan, and B. P. Mahon. 1998. A respiratory challenge model for infection with Bordetella pertussis: application in the assessment of pertussis vaccine potency and in defining the mechanism of protective immunity. Dev Biol Stand 95:31-41. 22. Mills, K. H., M. Ryan, E. Ryan, and B. P. Mahon. 1998. A murine model in which protection correlates with pertussis vaccine efficacy in children reveals complementary roles for humoral and cell-mediated immunity in protection against Bordetella pertussis. Infect Immun 66:594-602. 23. Monnier, S., A. Therby, B. Couzon, F. Doucet-Populaire, and A. Greder-Belan. 2009. [Bordetella holmesii bacteremia in a 26-year-old patient with sickle cell disease.]. Med Mal Infect. 24. Morris, J. T., and M. Myers. 1998. Bacteremia due to Bordetella holmesii. Clin Infect Dis 27:912-913.
78 25. Myc, A., J. Buck, J. Gonin, B. Reynolds, U. Hammerling, and D. Emanuel. 1997. The level of lipopolysaccharide-binding protein is significantly increased in plasma in patients with the systemic inflammatory response syndrome. Clin Diagn Lab Immunol 4:113-116. 26. Njamkepo, E., F. Delisle, I. Hagege, G. Gerbaud, and N. Guiso. 2000. Bordetella holmesii isolated from a patient with sickle cell anemia: analysis and comparison with other Bordetella holmesii isolates. Clin Microbiol Infect 6:131-136. 27. Pilione MR, H. E. 2006. The Bordetella bronchiseptica type III secretion system inhibits gamma interferon production that is required for efficient antibody-mediated bacterial clearance. Infect Immun 74:1043-1049. 28. Pishko, E. J., G. S. Kirimanjeswara, M. R. Pilione, L. Gopinathan, M. J. Kennett, and E. T. Harvill. 2004. Antibody-mediated bacterial clearance from the lower respiratory tract of mice requires complement component C3. Eur J Immunol 34:184-193. 29. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L. Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-3767. 30. Probert, W. S., J. Ely, K. Schrader, J. Atwell, A. Nossoff, and S. Kwan. 2008. Identification and evaluation of new target sequences for specific detection of Bordetella pertussis by real-time PCR. J Clin Microbiol 46:3228- 3231. 31. Russell, F. M., J. M. Davis, M. J. Whipp, P. H. Janssen, P. B. Ward, J. R. Vyas, M. Starr, S. M. Sawyer, and N. Curtis. 2001. Severe Bordetella holmesii infection in a previously healthy adolescent confirmed by gene sequence analysis. Clin Infect Dis 33:129-130. 32. Shepard, C. W., M. I. Daneshvar, R. M. Kaiser, D. A. Ashford, D. Lonsway, J. B. Patel, R. E. Morey, J. G. Jordan, R. S. Weyant, and M. Fischer. 2004. Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin Infect Dis 38:799-804. 33. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220. 34. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J Bacteriol 173:4288-4296. 35. Tang, Y. W., M. K. Hopkins, C. P. Kolbert, P. A. Hartley, P. J. Severance, and D. H. Persing. 1998. Bordetella holmesii-like organisms associated with septicemia, endocarditis, and respiratory failure. Clin Infect Dis 26:389-392. 36. van den Akker, W. M. 1998. Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144:1527-1535. 37. von Koenig, C. H., A. Tacken, and H. Finger. 1988. Use of supplemented Stainer-Scholte broth for the isolation of Bordetella pertussis from clinical material. J Clin Microbiol 26:2558-2560. 38. Wendelboe, A. M., and A. Van Rie. 2006. Diagnosis of pertussis: a historical review and recent developments. Expert Rev Mol Diagn 6:857-864. 39. Weyant, R. S., D. G. Hollis, R. E. Weaver, M. F. Amin, A. G. Steigerwalt, S. P. O'Connor, A. M. Whitney, M. I. Daneshvar, C. W. Moss, and D. J. Brenner. 1995. Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. J Clin Microbiol 33:1-7. 40. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 41. Wolfe DN, K. G., Harvill ET. . 2005. Clearance of Bordetella parapertussis from the lower respiratory tract requires humoral and cellular immunity. Infect Immun 73:6508-6513. 42. Wolfe, D. N., G. S. Kirimanjeswara, E. M. Goebel, and E. T. Harvill. 2007. Comparative role of immunoglobulin A in protective immunity against the Bordetellae. Infect Immun 75:4416-4422. 43. Yih, W. K., E. A. Silva, J. Ida, N. Harrington, S. M. Lett, and H. George. 1999. Bordetella holmesii-like organisms isolated from Massachusetts patients with pertussis-like symptoms. Emerg Infect Dis 5:441-443. 44. Zhang, X., E. M. Goebel, M. E. Rodriguez, A. Preston, and E. T. Harvill. 2009. The O antigen is a critical antigen for the development of a protective immune response to Bordetella parapertussis. Infect Immun 77:5050-5058. 45. Zhang, X., M. E. Rodriguez, and E. T. Harvill. 2009. O Antigen Allows B. parapertussis to Evade B. pertussis Vaccine-Induced Immunity by Blocking Binding and Functions of Cross-Reactive Antibodies. PLoS One 4:e6989.
79
Chapter 5
IL-1R Signaling Contributes to Controlling Inflammatory Pathology and
Overcoming the Effects of Pertussis Toxin during B. pertussis Infection.
Abstract:
Interleukin (IL)-1R-/- mice are healthy despite being colonized by commensal microbes, but are defective in defenses against specific pathogens, suggesting that IL-1R-mediated effects contribute to immune responses against specific pathogenic mechanisms. To better define the critical role of IL-1R in immunity to respiratory infections, we challenged IL-1R-/- mice with Bordetella pertussis and B. parapertussis, the causative agents of whooping cough. Following infection by B. pertussis, but not B. parapertussis, IL-1R-/- mice showed increased mortality associated with elevated bacterial numbers, atypical systemic spread, and higher inflammatory pathology compared to wild-type mice. IL-17 responses were nearly abolished, but restoring the pulmonary IL-17 levels did not decrease B. pertussis burdens in IL-1R-/- mice. B. pertussis- stimulated dendritic cells and macrophages from IL-1R-/- mice produced higher levels of tumor necrosis factor
(TNF)-α and IL-6 but lower levels of IL-10 than wild-type cells. Moreover, elevated levels of gamma- interferon (IFN-γ) and TNF-α were detected locally and systemically following B. pertussis infection in IL-
1R-/- mice. These data demonstrate a role for IL-1R signaling in protecting against B. pertussis infection by restricting infection within the respiratory tract and controlling inflammatory pathology. Since B. parapertussis did not cause severe disease in IL-1R-/- mice, we hypothesized that the extreme requirement for
IL-1R involves pertussis toxin (Ptx), which is expressed only by B. pertussis. An isogenic Ptx deficient strain of B. pertussis was completely defective in causing lethal disease in IL-1R-/- mice, indicating that the virulence of B. pertussis in these mice involves Ptx and that IL-1R protects wild-type mice from aspects of
Ptx-mediated virulence.
80 Introduction:
Inflammatory responses effectively combat infection and, when properly controlled, ensure restoration of normal tissue architecture. A complex array of cytokines can contribute to the regulation of inflammation under different conditions. By discovering the specific conditions under which key cytokines are required for regulation, we can better define their individual roles. Interleukin (IL)-1, a pleiotropic pro- inflammatory cytokine presented either as IL-1α or IL-1β, is a key player in this regulation. IL-1α is active in both 31 kDa precursor polypeptide form (pro-IL-1α) and calpain-cleaved “mature” 17 kDa form (19, 22).
Pro-IL-1β is inactive and requires cleavage by caspase-1 to be active and secreted (11, 19, 22, 75). There are two membrane receptors for IL-1, type І IL-1 receptor, which mediates signal transduction, and type II IL-1 receptor, which lacks the cytosolic domains and acts as a decoy receptor (73). Both IL-1α and IL-1β bind to the same receptors and induce indistinguishable responses including endothelial activation, leukocyte recruitment, T helper cytokines production, and alterations of the hypothalamic thermoregulatory set point
(19).
IL-1 has been implicated in various inflammatory diseases as well as during microbial infections. IL-
1 signaling plays pathogenic roles in some autoimmune diseases, such as rheumatoid arthritis and Crohn’s disease (19). It is also involved in inducing pathogenic damage by bacterial pathogens, for example Yersinia enterocolitica and Shigella flexneri (21, 66). On the other hand, IL-1 signaling also plays beneficial roles in combating microbial infections. For example, exogenous administration of rmIL-1α provided protection against an intracellular pathogen, Listeria monocytogenes, infection (16). IL-1β deficient mice challenged with Staphylococcus aureus, a gram-positive bacterium, developed larger lesions associated with decreased neutrophil recruitment (55). IL-1R-/- mice showed increased intestinal damage and lethality following challenge by Citrobacter rodentium, a gram-negative pathogen (41).
IL-1R-/- mice are also defective in host defenses against some respiratory pathogens, suggesting that
IL-1 signaling is particularly important in the control of respiratory infection. For example, mice deficient in
IL-1R had higher Pseudomonas aeruginosa loads in the lungs (65), and suffered lethal necrotic pneumonia following Mycobacterium tuberculosis infection (24). Although IL-1 signaling is required for the control of several pathogens, the critical aspects of host-pathogen interactions that require this pathway for effective
81 immune responses have not yet been determined. Since IL-1α-/-, IL-1β-/- and IL-1R-/- mice are viable and healthy despite a complex flora resident in them, IL-1 signaling is apparently not required for healthy homeostasis or the containment of non-pathogens. There appear to be specific virulence mechanisms of certain pathogens that stress the host responses in ways that reveal important roles of the IL-1 signaling.
Here, we examine the role of IL-1R in the immune responses to Bordetella pertussis and B. parapertussis, identifying a key role in mitigating the virulence associated with pertussis toxin (Ptx) secreted only by B. pertussis.
B. pertussis and B. parapertussis are gram-negative coccobacillus, causing whooping cough in humans, an acute and severe respiratory disease (51). Despite high vaccine coverage in developed countries, whooping cough causes approximately 50 million cases and 300,000 deaths annually worldwide (14). Even though a large portion of infections remain unreported (18), whooping cough incidence is on the rise (25, 35,
70, 76). B. pertussis utilizes complex strategies to modulate and evade host immune responses by producing various virulence determinants, such as Ptx, adenylate cyclase toxin, tracheal cytotoxin, filamentous hemagglutinin, fimbriae, pertactin and lipopolysaccharide (51, 56). B. parapertussis shares most of the virulence determinants with B. pertussis (51), but does not express Ptx (4, 49). Although B. pertussis and B. parapertussis are closely-related (62), they use distinct strategies to modulate host immune responses, revealing details of the different sophisticated immune regulations necessary to combat each.
Ptx is a multi-subunit toxin with an AB5 configuration. The B-oligomer binds to glycoproteins or glycolipids on the surface of target cells (77, 80). The enzymatic activity of Ptx resides in the A subunit, also known as S1. Once in the cell cytosol, S1 mediates ADP-ribosylation of the α-subunit of a subset of Gi proteins in mammalian cells (6, 36). The modification results in the inhibition of Gi protein-coupled signaling pathways, causing a variety of downstream effects. Ptx is known to be the cause of some systemic symptoms associated with whooping cough, such as lymphocytosis, histamine sensitivity and insulinemia
(58). Ptx also exerts multiple modulating effects on the immune system, including targeting airway macrophages to promote infection (10), blocking the early migration of neutrophils into the lungs (2, 38), suppressing the production of anti-Bordetella serum antibodies (9, 54), reducing major histocompatability complex class II on the surface of monocytes (68), and interfering with CD1a expression on dendritic cells
82 (50). A recent study indicates that Ptx contributes to the induction of pro-inflammatory cytokine production at the peak of infection (3), but whether these cytokines are important for host defenses against B. pertussis are not fully understood.
A murine model of B. pertussis infection in specific gene-deficient mice has established the non- redundant contribution of several innate-immune system components or effectors, such as toll-like-receptor
(TLR)-4, tumor necrosis factor (TNF)-α and IL-6 in host defenses against B. pertussis (34, 48, 56, 79) (Goel
T., Zhang X. and Harvill E.T., unpublished data). TLR4 deficient mice have a protracted infectious course of
B. pertussis, which is associated with elevated inflammatory pathology (34, 48). TNF-α deficient mice are more susceptible to B. pertussis infection due to overwhelming pathology (79). Downstream signaling of IL-
1R overlaps with that of TLR4 and TNFR, and IL-1β is produced in response to B. pertussis activation of
TLR4 (34). It is not known if IL-1, a pro-inflammatory cytokine downstream of TLR4, is dispensable or is required to combat B. pertussis infection.
We demonstrated here that although mice lacking type І IL-1 receptor (IL-1R-/-) showed comparable macrophage bactericidal efficiency, normal neutrophil recruitment in the early stages of infection and sufficient antibody responses against B. pertussis, they suffered increased mortality from B. pertussis infection. This was associated with increased bacterial burdens throughout the respiratory tract, atypical disseminated diseases, increased histopathology, increased leukocyte recruitment, elevated pro-inflammatory cytokine production and decreased anti-inflammatory cytokine production. IL-1R is not required for the control of B. parapertussis, which lacks the expression of Ptx. IL-1R-/- mice did not succumb to infection by a B. pertussis strain lacking Ptx. Overall, our study suggests an indispensable protective role of IL-1R signaling during B. pertussis infection in limiting inflammatory pathology and overcoming the effects of Ptx.
83 Materials and Methods:
Bacterial strains and growth. The B. pertussis strain 536, a streptomycin resistant derivative of Tohama I, and the B. parapertussis strain 12822, an isolate from German clinical trials, have been previously described
(32, 72). BPH101 (B.p. ∆ptx), a pertussis toxin-deficient derivative of strain 536, is a gift from Dr. Drusilla
Burns (US Food and Drug Administration) (31). Bacteria were maintained on Bordet-Gengou agar (Difco) supplemented with 10% defibrinated sheep blood (Hema Resources) and 20 μg/mL streptomycin (Sigma-
Aldrich). Liquid cultures were grown overnight in Stainer-Scholte broth at 37°C to mid-log phase (71).
Stimulation of macrophage cell lines. The murine macrophage cell line, RAW 264.7, was obtained from
ATCC and cultured in Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) supplemented with 10% fetal calf serum (FCS) (HyClone). Approximately 105 cells were placed in each well of 96 well tissue culture plates (Falcon) and incubated with media or media containing live B. pertussis at multiplicities of infection
(MOI) of 5 or 25. Cell culture supernatant was collected after 48h incubation and IL-1α or IL-1β concentration was measured via enzyme-linked immunosorbent assays (ELISA) as per the manufacturers’ instructions (R&D Systems).
Animal experiments. C57BL/6, B6.129S7-Il1r1tm1Imx/J (IL-1R-/-) and B6.129S2-Igh-6tm1Cgn/J (μMT) mice were obtained from Jackson Laboratories (Bar Harbor) and bred in Bordetella-free, specific pathogen-free breeding rooms at The Pennsylvania State University. For inoculation, 4-6 week-old mice were lightly sedated with 5% isoflurane (Abbott Laboratories) in oxygen and inoculated by pipetting 50μL phosphate
buffered saline (PBS) containing 5×105 CFU (unless otherwise specified) of bacteria onto the external nares
(39). This method reliably distributes the bacteria throughout the respiratory tract (30). For survival curves or mean lethal dose (LD50) determination, mice were inoculated with the indicated dose and the percent survival was monitored over a 100-day period. Mice with lethal bordetellosis, indicated by ruffled fur, labored breathing, and diminished responsiveness, were euthanized to alleviate unnecessary suffering (29,
79). For adoptive transfer of serum antibodies, sera were collected from naïve animals or on days 21 or 28 post B. pertussis inoculation and 200µL pooled serum was i.p. injected at the time of inoculation (39). These mice were euthanized on day 14 p.i. for bacterial number quantification in their lungs, by which time the inhibition by pertussis toxin in antibody-mediated clearance of B. pertussis is overcome with T cell help in
84 wild-type animals (38) (D.N. Wolfe unpublished data). For intranasal administration of rmIL-17, C57BL/6 or
IL-1R-/- mice were lightly sedated and intranasally inoculated 50µL PBS or PBS containing rmIL-17 (R&D systems) on days 3 (1.25µg/mouse) and 6 (1µg/mouse) post-inoculation (p.i.) and sacrificed on day 7 p.i.. For quantification of bacterial numbers, mice were sacrificed via CO2 inhalation, lung, trachea, nasal cavity, spleen and liver were excised and around 750µL blood was collected from each mouse by cardiac puncture into tubes with 50µL 0.5M pH8 EDTA. Tissues were homogenized in 1 mL PBS, serially diluted and plated onto Bordet-Gengou agar plates with 20µg/mL streptomycin, and colonies were counted after 4-5 days incubation at 37°C (39). The lower limit of detection was 10 CFU. All protocols were reviewed and approved by The Pennsylvania State University Institutional Animal Care and Use Committee (IACUC) and all animals were handled in accordance with institutional guidelines.
Lung pathology. For analysis of lung pathology, mice were intranasally inoculated as described above and euthanized at the indicated days p.i.. The tracheas and lungs were excised and inflated with approximately 2 mL of 10% formaldehyde. The tissues were then sectioned and stained with haemolysin and eosin at the
Animal Diagnostic Laboratories Facility of The Pennsylvania State University. Sections were examined and scored by a veterinarian with training and experience in rodent pathology (M.J.K.) who was blinded to experimental treatment (46, 47, 63). A score of 0 indicates no noticeable inflammation or lesions; a score of 1 indicates few or scattered foci affecting less than 10% of the tissue, typically with a few mild perivascular and/or peribronchial lymphoid aggregates; a score of 2 indicates frequent mild perivascular and/or peribronchial lymphoid aggregates, with or without occasional small foci of pneumonia, with overall inflammation affecting no more than 10 to 20% of the tissue; a score of 3 indicates moderate lesions, typically with abundant perivascular and peribronchial lymphoid infiltrates and multiple mild to moderate foci of pneumonia, with inflammation affecting approximately 20 to 30% of the tissue; and a score of 4 indicates extensive pneumonia and marked inflammation affecting more than 30% of the tissue; a score of 5 indicates extensive lesions with >50% of the tissue affected. If a severity falls between categories, 0.5 was added to the pathology score of the lower category.
Bone-marrow derived cell assays. Bone marrow derived macrophages (BMM) and dendritic cells (BMDC) were prepared as previously published with modifications (43, 69). In brief, bone marrow was isolated from
85 femurs of C57BL/6 or IL-1R-/- mice and cultured for 10 days in DMEM supplemented with 10% FCS,
100µg/mL penicillin-streptomycin (HyClone), 20 ng/mL macrophage-colony-stimulating-factor (M-CSF)
(PeproTech) for BMM differentiation or in RPMI supplemented with 2mM L-glutamine (HyClone), 10%
FCS, 100µg/mL penicillin-streptomycin, 40 ng/mL granulocyte-macrophage-colony-stimulating-factor (GM-
CSF) (PeproTech) for BMDC differentiation. For cytokine responses of the BMDCs, 2×105 cells were seeded into each well of 96 well tissue culture plates in media without antibiotics and stimulated with media or media containing B. pertussis at a MOI of 10. After 2h, 12h, 24h or 36h, the culture supernatant was removed and assayed for TNF-α, IL-6 or IL-10 by ELISA (R&D Systems). For BMM cytokine secretion assays, 105 cells were seeded into each well of 96 well tissue culture plates in media without antibiotics and stimulated with media or media containing B. pertussis lipopolysaccharide (LPS) (final concentration 1µg/mL) or E. coli LPS
(final concentration 100ng/mL). After 12h, the culture supernatant was removed and assayed for TNF-α, IL-6 or IL-10 by ELISA (R&D Systems). For BMM bactericidal assay, 105 cells were seeded into each well of 96 well tissue culture plates and primed with media without antibiotics and containing 25ng/mL rm gamma- interferon (IFN-γ) (R&D systems) or 1ug/mL B. pertussis LPS for 2h. Early exponential-phase B. pertussis were opsonized with 5% convalescent-phase complement depleted (incubated at 56°C for 30 min) immune serum from C57BL/6 mice for 30 min in a shaking 37°C incubator. Primed BMMs were inoculated with opsonized B. pertussis at a MOI of 10. After 2h or 4h, 1% ice-cold Triton X-100 in PBS was added to lyse the macrophages. 1/10 serial dilutions of the lysed macrophages from each well were plated for bacterial enumeration. Bacterial numbers in similarly treated wells without cells were enumerated as total bacterial numbers.
Splenocyte re-stimulation. Spleens were excised on the indicated days p.i. from groups of B. pertussis-
inoculated C57BL/6 or IL-1R-/- mice. Splenocytes were isolated as previously described (64, 78). In brief, spleens were homogenized and red blood cells were lysed with 0.84% ammonium chloride treatment. 2×106 cells were re-suspended in 200µL DMEM supplemented with 10% FCS and 100µg/mL penicillin- streptomycin, and placed into each well of 96 well tissue culture plates. Splenocytes were stimulated with
10µL media alone or media containing 107 CFU (MOI of 5) of heat-inactivated B. pertussis (64, 78). After 3
86 days, the supernatants were collected, and TNF-α, IFN-γ, IL-10 and IL-17 concentrations were determined by
ELISA (R&D Systems).
Titer ELISAs. Antibody titers were determined as previously described (46). Briefly, heat-inactivated
exponential–phase B. pertussis, diluted to 5×107 CFU/mL in a 1:1 mix of 0.2M sodium carbonate and 0.2M sodium bicarbonate buffers, was used to coat 96 well plates (Greiner Bio-one) by incubating for 4h at 37°C in a humidified chamber and the plates were washed and blocked. A 1:50 [for immunoglobulin (Ig)] or 1:20 (for
IgG1 and IgG2a) dilution of serum samples collected from individual C57BL/6 or IL-1R-/- mouse on days 7,
14 or 21 p.i. were added to the first well and serially diluted 1:2 across the plates. Plates were incubated for
2h at 37°C, washed and probed with 1:4000 dilution of goat anti-mouse Ig, or 1:2000 dilution of goat-anti- mouse IgG1 or IgG2a horseradish peroxidase (HRP)-conjugated antibodies (Southern Biotechnology
Associates and Pharmingen) for 1h and visualized with 2,2’-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt in phosphate-citrate buffer with hydrogen peroxide at an absorbance of 405 nm.
Titers were determined via the end-point method using a cut off that is 0.1 higher than the optical density of similarly treated wells probed with naïve serum (46).
Quantification of leukocyte and cytokine in the lungs. To quantify leukocytes, lungs were perfused with 2-
3mL sterile PBS, excised, and placed in 4 mL of RPMI 1640 (HyClone). Lungs were homogenized, laid over
Histopaque 1119 (Sigma Aldrich) and centrifuged for 30 min at 700g at 20°C. The leukocyte layer was collected, spun at 300g for 5 min and re-suspended in PBS supplemented with 2% FCS. The total number of leukocytes was determined by counting at 40× magnification on a hemocytometer. Aliquots of cells were blocked with anti-mouse CD16/CD32 antibodies (BD Biosciences Pharmingen) and stained with FITC- labeled anti-mouse-Ly6G, F4/80 or CD4 antibodies (BD Biosciences Pharmingen), and the percentages of
Ly6G+, F4/80+ or CD4+ cells were determined by flow cytometry. Percentages were multiplied by the total number of leukocytes to calculate the number of Ly6G+, F4/80+ or CD4+ cells respectively. To measure the cytokine concentration in the lungs, lungs were homogenized in 1mL PBS, tissues were spun down at 8,000g for 10 min at 4°C, and IL-1α, IL-1β, TNF-α, IFN-γ, IL-10 and IL-17 concentrations in the aliquots of the supernatants were examined via ELISAs (R&D Systems).
87 Statistical analysis. The means ± the standard error (error bars) were determined for all appropriate data.
Two-tailed, unpaired Student’s T-tests were used to determine statistical significance between groups.
Results were also analyzed by ANOVA and Tukey simultaneous test in Minitab with similar significance.
88 Results:
B. pertussis induces IL-1 production in vitro and in vivo.
To determine if B. pertussis stimulates the
production of IL-1, we stimulated RAW cells, a murine
macrophage cell line, with media or media containing
B. pertussis and the concentrations of IL-1α or IL-1β in
the cell culture supernatants were measured after 48h.
Macrophages incubated with media alone produced
little IL-1 (Fig. 5.1A). Macrophages incubated with B.
pertussis for 48h had produced ~40ng/mL or
~600pg/mL IL-1α, and ~800pg/mL or ~2000pg/mL IL-
1β at MOI 5 or 25, respectively (Fig. 5.1A).
To examine if IL-1 is produced at the site of B.
Figure 5.1: IL-1 is induced by B. pertussis. (A) RAW pertussis infection in vivo, C57BL/6 mice were cells were incubated with media alone (-) or media containing live B. pertussis at a MOI of 5 or 25 for 48h. inoculated with 5×105 CFU of B. pertussis in 50µL IL-1α (white bars) or IL-1β (black bars) concentration of culture supernatant is expressed as mean ± standard PBS and IL-1α and IL-1β concentrations in the lungs error. (B) Groups of 3-4 C57BL/6 mice were inoculated with 5×105 CFUs of B. pertussis and sacrificed on days 0, 1, 3, 7, 10 and 26 p.i.. IL-1α were examined on days 0, 1, 3, 7, 10 and 26 p.i.. (white circles) or IL-1β (black circles) concentration in the lungs is expressed as mean ± standard error. Compared to the level in naïve mice (day 0), IL-1α levels were elevated within 24h post B. pertussis infection, peaked at 2,400pg/mL by day 7 p.i. and declined thereafter (Fig. 5.1B white circle). IL-1β levels showed a similar trend, peaking at ~3,800pg/mL by day 7 p.i.
(Fig. 5.1B black circle). Together these data indicate that B. pertussis induces IL-1α and IL-1β production in vitro by macrophage and in vivo in the lungs. lncreased mortality, and elevated respiratory tract and systemic colonization in B. pertussis-infected IL-
1R-/- mice.
To determine whether IL-1R signaling is an important aspect of the immune response to B. parapertussis or B. pertussis infection, we monitored survival after challenging wild-type C57BL/6 or IL-1R-/- mice with 106 CFU of B. parapertussis or B. pertussis. Challenged C57BL/6 mice showed no signs of disease
89
Figure 5.2: Increased mortality and morbidity of B. pertussis-infected but not B. parapertussis- infected IL-1R-/- mice. (A) Groups of IL-1R-/- (n=9) mice were inoculated with 106 CFUs of B. parapertussis (square) or B. pertussis (triangle), and monitored for survival. (B) Groups of 3-4 C57BL/6 (square) or IL-1R-/- (triangle) mice were inoculated with 5×105 CFUs of B. parapertussis (B) or B. pertussis (C). Bacterial loads in the nasal cavity, trachea or lung on days 0, 3, 7, 14, 28 p.i. (B) or days 0, 1, 3, 7, 10, 14, 26 p.i. (C) were expressed as mean of Log10CFU ± the standard error. (D) Groups of 3 C57BL/6 (black bars) or IL-1R-/- (white bars) mice were inoculated with 5×105 CFUs of B. pertussis, and bacterial loads in the blood, spleen or liver on days 3, 7,14 or 21 p.i. were expressed as mean of Log10CFU ± the standard error. * indicates P ≤ 0.05. ** indicates P≤ 0.01. The limit of detection is indicated by the y axis. Sara E. Hester performed experiments shown in Figure 5.2C. and were euthanized at the end of the experiment (100 days p.i.) (data not shown). Similarly, IL-1R-/- mice challenged with B. parapertussis did not show any sign of disease throughout the 100-days period (Fig. 5.2A square). However, IL-1R-/- mice challenged with B. pertussis showed signs of disease during the second week p.i., including ruffled fur, hunched posture, decreased activity, labored breathing, and were euthanized when the morbidity became apparent. All IL-1R-/- mice succumbed to lethal bordetellosis by day 17 p.i. (Fig. 5.2A triangle). We also performed similar survival curve studies at different challenge doses and determined that
7 -/- LD50 of B. pertussis in C57BL/6 was greater than 5×10 CFU, whereas in IL-1R mice the LD50 was approximately 103 CFU, indicating that IL-1R deficiency greatly increases sensitivity to lethal B. pertussis infection.
Groups of C57BL/6 or IL-1R-/- mice were challenged with 5×105 CFU of B. parapertussis and euthanized on days 0, 3, 7, 14 or 28 p.i. to determine whether IL-1R contributes to the control of bacterial
90 numbers following B. parapertussis infection. Other than small and transient differences in the tracheas, B. parapertussis had similar colonization kinetics throughout the respiratory tracts in C57BL/6 and IL-1R-/- mice
(Fig. 5.2B), indicating that IL-1R signaling is not required for the control and clearance of B. parapertussis.
To test if the increased mortality of IL-1R-/- mice following B. pertussis infection is associated with higher bacterial loads in the respiratory tract, mice were inoculated with 5×105 CFU of B. pertussis, and sacrificed on days 0, 1, 3, 7, 10, 14 and 26 p.i.. In wild-type mice, B. pertussis grew rapidly throughout the respiratory tract during the first week p.i., and decreased thereafter (Fig. 5.2C solid lines). In IL-1R-/- mice, B. pertussis similarly grew to high numbers during the first week p.i., but these mice failed to reduce bacterial numbers throughout the respiratory tract thereafter. We originally planned a day 28 p.i. time point, but two out of five IL-1R-/- mice showed signs of severe disease on day 24 p.i. and were euthanized. The surviving
IL-1R-/- mice became very morbid on day 26 p.i. and were sacrificed along with the C57BL/6 controls for bacterial numbers determination. The IL-1R-/- mice harbored two orders of magnitude more B. pertussis in the nasal cavity and three orders of magnitude more B. pertussis in the lower respiratory tract (LRT) compared to C57BL/6 mice (Fig. 5.2C). In a separate experiment, groups of C57BL/6 and IL-1R-/- mice were challenged with 5×105 CFU B. pertussis and sacrificed on day 21 p.i. to avoid the loss of sick animals. On this time point, C57BL/6 mice harbored 102.7±0.2 CFU of B. pertussis in their lungs, whereas 107.1±0.3 CFU of
B. pertussis were recovered from the lungs of IL-1R-/- mice (data not shown). Together, these data indicate that IL-1R is required for the clearance of B. pertussis, but not B. parapertussis, from the respiratory tract.
To test if IL-1R is required for the control of relatively low numbers of B. pertussis, separate groups of mice were challenged with 103 CFU of B. pertussis. 28 days following this low dose inoculation, B. pertussis burdens were more than 4 orders of magnitude higher in the lungs, and approximately 2 orders of magnitude higher in the tracheas and nasal cavities, in IL-1R-/- mice than wild-type mice (data not shown).
By day 56, although B. pertussis was completely cleared throughout the respiratory tract of wild-type mice, half of IL-1R-/- mice became morbid. The surviving IL-1R-/- mice still harbored ~300 CFU of B. pertussis in their lungs on this time point (data not shown).
B. pertussis does not colonize systemic organs of wild-type mice but causes atypical disseminated diseases in mice lacking certain immune functions (8, 44). To test if B. pertussis colonizes systemic organs of
91 IL-1R-/- mice, in a separate experiment, C57BL/6 and IL-1R-/- mice were challenged with 5×105 CFU B. pertussis and the bacterial loads in their blood, spleen and liver were enumerated on days 3, 7, 14 and 21 p.i..
B. pertussis was not recovered from blood or spleen of C57BL/6 mice on any time point. However, B. pertussis was recovered from blood and spleen of IL-1R-/- mice on days 14 and 21 p.i. (Fig. 5.2D). In the liver, B. pertussis colonized at a low level in one out of three of both C57BL/6 and IL-1R-/- mice on day 3 p.i., but was not recovered from the livers of C57BL/6 mice on any of the later time points. Interestingly, B. pertussis consistently colonized the livers of IL-1R-/- mice on days 7, 14 and 21 p.i. (Fig. 5.2D). These data indicate that in the absence of IL-1R signaling, B. pertussis causes severe systemic infection.
IL-1R-/- mice showed elevated inflammatory pathology post B. pertussis infection.
Since IL-1R-/- mice have been reported to show increased inflammation during infection by other bacteria (24, 41), and we visually observed that the lungs of B. pertussis-inoculated IL-1R-/- mice were consistently more inflamed than C57BL/6 lungs in multiple experiments, we examined the role of IL-1R signaling in the control of inflammatory pathology post B. pertussis infection. Sham (PBS) inoculated
C57BL/6 or IL-1R-/- mice showed little sign of inflammation (Fig. 5.3A). On day 3 p.i. with 5×105 CFU of B. pertussis, C57BL/6 mice showed pulmonary edema and scattered mild neutrophil infiltration in the parenchyma and bronchi, whereas IL-1R-/- mice showed severe diffuse suppurative pneumonia with fibrin, areas of consolidation (microabcesses), and some hemorrhage. On day 7 p.i., lung tissues from both C57BL/6 and IL-1R-/- mice showed severe diffuse suppurative pneumonia with fibrin and areas of consolidation, necrosis and hemorrhage, and the overall affected area of IL-1R-/- mice lungs (average pathology score 4.4) was significantly larger than that of C57BL/6 mice lungs (average pathology score 3.8) (Fig. 5.3B). On day
21 p.i., lungs of C57BL/6 mice showed marked peribronchiolar, perivascular, lymphoid aggregates, and patchy to diffuse pneumonia with areas of consolidation and lymphocytic infiltrates. IL-1R-/- lungs, however, showed severe diffuse pneumonia with mixed inflammatory cell infiltrates (primarily neutrophils), fibrin and large areas of consolidation, and no lymphocytic cuffing (Fig. 5.3A), indicating poor resolution.
To quantify the numbers of different cell types infiltrated into the lungs, C57BL/6 or IL-1R-/- mice were inoculated with B. pertussis, and total leukocytes were separated from lung homogenates and evaluated by flow cytometry after cell surface staining. 1 and 3 days later, wild-type and IL-1R-/- mice contained
92
Figure 5.3: Increased inflammatory pathology and leukocyte recruitment of B. pertussis-infected IL- 1R-/- mice. (A) Representative field (10×) and (B) pathology scores of H&E-stained lung sections of 5×105 CFUs B. pertussis-inoculated C57BL/6 (black circles) or IL-1R-/- (white circles) mice on the indicated days p.i.. The line represents the mean pathology score. (C) Groups of 4 C57BL/6 (square) or IL-1R-/- (triangle) mice were inoculated with 5×105 CFUs of B. pertussis, and total leukocyte, Ly6G+ neutrophil, F4/80+ macrophage and CD4+ T cell numbers in the lungs were expressed as mean ± standard error. * indicates P ≤ 0.05. ** indicates P≤ 0.01. Mary J. Kennett contributed to the experiments shown in Figure 5.3 A and B. similar numbers of total leukocytes, Ly6G+ neutrophils, F4/80+ macrophages and CD4+ T cells in their lungs
(Fig. 5.3C), suggesting that IL-1R-/-mice are not defective in cell recruitment during the early stages of B. pertussis infection. Consistent with results from histopathology examination (Fig. 5.3A and 5.3B), more total leukocytes, neutrophils, macrophages and CD4+ T cells were recovered from IL-1R-/- mice lungs on day 7 p.i. than from the wild-type mice lungs (Fig. 5.3C). By day 14 p.i., total leukocytes, neutrophils, macrophages and CD4+ T cells numbers had declined in C57BL/6 mice but these numbers were ~20, 150, 50 and 30 fold higher, respectively, in IL-1R-/- mice. On day 21 p.i., total leukocytes, neutrophils, macrophages and CD4+ T cells numbers in the lungs of IL-1R-/- mice were ~20, 90, 80 and 60 fold higher, respectively, than those in wild-type mice (Fig. 5.3C). Together, these data indicate that IL-1R signaling deficiency results in
93 uncontrolled B. pertussis-induced inflammation, marked by increased cell recruitment and tissue architecture destruction.
Bone-marrow derived cells from IL-1R-/- mice produce higher levels of pro-inflammatory cytokines and lower levels of anti-inflammatory cytokines in response to B. pertussis.
Since B. pertussis-infected IL-1R-/- mice harbored more bacteria by the first week p.i. (Fig. 5.2B), we hypothesized that innate immune functions might be improperly regulated in these mice. We first examined the production of pro-inflammatory cytokines, TNF-α and IL-6, and the anti-inflammatory cytokine, IL-10, by bone-marrow derived dendritic cells (BMDC) from C57BL/6 or IL-1R-/- mice after stimulation with live B. pertussis at a MOI of 10. Incubation in media alone resulted in little cytokine production from either type of
BMDCs (Fig. 5.4A-C, white symbols). B. pertussis-stimulated BMDCs from C57BL/6 mice had produced
~350pg/mL TNF-α by 2h, but these levels decreased to ~250pg/mL by 12h and plateaued at this level. TNF-α production by B. pertussis-stimulated IL-1R-/- mice BMDCs was similar to that of wild-type cells by 2h post- stimulation, but increased thereafter and was significantly higher than that of wild-type cells at all later time points (Fig. 5.4A). IL-6 production by B. pertussis-stimulated wild-type and IL-1R deficient BMDCs increased to high levels by 12h and remained at similar levels thereafter (Fig. 5.4B). IL-6 production by IL-
1R deficient BMDCs was somewhat higher than that of wild-type cells; with statistical significance only reached at an earlier time point (2h) (Fig. 5.4B). IL-10 production by wild-type BMDCs increased to
~16,000pg/mL by 24h post B. pertussis stimulation and stayed at this level by 36h post-stimulation (Fig.
5.4C). Interestingly, IL-1R deficient BMDCs produced ~50% less IL-10, compared to wild-type cells, at 12,
24 and 36h post-stimulation (Fig. 5.4C). Thus BMDCs lacking IL-1R produced higher levels of the pro- inflammatory cytokines TNF-α and IL-6 and lower levels of the anti-inflammatory cytokine IL-10 in response to B. pertussis, suggesting substantial contribution of IL-1R signaling to regulation of cytokine responses to
B. pertussis.
To test if the cytokine production profile of cells from IL-1R-/- mice is specific to B. pertussis, bone- marrow derived macrophages (BMM) from wild-type or IL-1R-/- mice were stimulated with media alone or media containing B. pertussis or E. coli LPS, and TNF-α, IL-6 and IL-10 levels in the supernatants were measured after 12h incubation. Cells incubated with media alone produced little cytokine (Fig. 5.4D-F).
94
Figure 5.4: IL-1R deficiency leads to increased pro-inflammatory and decreased anti-inflammatory cytokine production by BMDCs and BMMs. (A-C) BMDCs from groups of 4 C57BL/6 (square) or IL- 1R-/- (triangle) mice were stimulated with media alone (white) or media containing live B. pertussis at a MOI of 10 (black). (A) TNF-α, (B) IL-6 or (C) IL-10 concentrations after 0, 2, 12, 24 or 36h incubation were expressed as mean ± standard error. (D-F) BMMs from groups of 4 C57BL/6 (black bars) or IL-1R-/- (white bars) mice were incubated with media alone or media containing B. pertussis (Bp) or E. coli LPS. (D) TNF-α, (E) IL-6 or (F) IL-10 concentration after 12h incubation was expressed as mean ± standard error. * indicates P ≤ 0.05. ** indicates P≤ 0.01.
Similar to the BMDC cytokine production profile, IL-1R deficient BMMs produced significantly more TNF-
α, more IL-6 and less IL-10 than wild-type BMMs by 12h post-stimulation (Fig. 5.4D-F). E. coli LPS- stimulated IL-1R deficient BMMs also produced significantly more TNF-α, more IL-6 but similar levels of
IL-10 compared to similarly treated wild-type BMMs (Fig. 5.4D-F). Thus the higher pro-inflammatory cytokine production by IL-1R deficient BMMs appears to be a general response to microbial stimulus, but the decreased IL-10 production may be B. pertussis-specific.
IL-1R-/- mice BMMs are efficient in killing B. pertussis.
Since large amounts of phagocytes infiltrated into the lungs of IL-1R-/- mice but failed to control bacterial numbers, we hypothesized that bactericidal efficiencies of phagocytes from these mice might be decreased. To test this, BMMs from C57BL/6 or IL-1R-/- mice were primed with either rmIFN-γ or B.
95 Figure 5.5: IL-1R-/- mice BMMs are efficient in killing B. pertussis. BMMs from groups of 4 C57BL/6 (black bars) or IL-1R-/- (white bars) mice were primed with rmIFN-γ or B. pertussis (Bp) LPS for 2h and incubated with opsonized B. pertussis at a MOI of 10. The percent killing of B. pertussis after 2h or 4h incubation was expressed as mean ± standard error.
pertussis LPS, inoculated with opsonized B. pertussis,
and the viable bacteria were enumerated after 2h or 4h incubation. Around 90% of B. pertussis was killed by a 2h incubation with BMMs from either C57BL/6 or
IL-1R-/- mice (Fig. 5.5). Similar percent killing was observed by 4h incubation with BMMs from C57BL/6 or
IL-1R-/- mice (Fig. 5.5). These data indicate that BMMs from IL-1R-/- mice are similarly efficient in killing B. pertussis compared to wild-type BMMs.
IL-1R signaling is not required for efficient antibody responses against B. pertussis.
To test if the failure of IL-1R-/- mice to control
large numbers of B. pertussis is associated with
decreased antibody generation, B. pertussis-specific
titers of serum antibodies from C57BL/6 or IL-1R-/-
mice collected on days 7, 14 and 21 p.i. were
measured. The titers of sera collected on day 7 p.i.
Figure 5.6: Antibody responses are not defective in B. from both strains of mice were under the limit of pertussis-challenged IL-1R-/- mice. (A) B. pertussis- specific Ig titers of serum from groups of 3-4 C57BL/6 (black bars) or IL-1R-/- (white bars) mice were detection (Fig. 5.6A). On day 14 p.i., Ig titers of sera expressed as mean of Log10Titer ± standard error. (B) -/- Ratios of B. pertussis-specific IgG2a and IgG1 titer of from wild-type and IL-1R mice were comparable. On serum from groups of 3-4 C57BL/6 (black) or IL-1R-/- (white) mice collected on day 21 p.i. were expressed as day 21 p.i. the B. pertussis-specific Ig titers of sera mean ± standard error. (C) Groups of 4 µMT mice were adoptively transferred naïve serum (NS) or immune from IL-1R-/- mice were significantly higher than that serum collected from C57BL/6 or IL-1R-/- mice on day 21 p.i.. B. pertussis numbers in the lungs on day 14 p.i. of wild-type mice. These data indicate that IL-1R were expressed as mean of Log10CFU ± the standard error. (D) Naïve (dashed bars) or convalescent-phase (day 28 p.i.) (black bars) serum from C57BL/6 mice signaling is not required for the generation of B. was adoptively transferred to groups of 4 C57BL/6 or - IL-1R-/- mice. B. pertussis numbers in the lungs on day pertussis-specific antibodies. The higher titer of IL-1R 14 p.i. were expressed as mean of Log10CFU ± the standard error. * indicates P≤ 0.05. ** indicates P≤ /- mice serum is likely due to higher bacterial loads later 0.01. The limit of detection is indicated by the y axis. ND indicates not detectable values. during infection. The ratio of B. pertussis-specific
96 IgG2a/IgG1 titers of serum collected on day 21 p.i., an indication of T helper (Th) 1/Th2 skewing, was higher in serum from IL-1R-/- mice than C57BL/6 mice (Fig. 5.6B), indicating that T cell responses in IL-1R-/- mice may be more polarized towards Th1 responses.
To test the efficiency of serum antibodies collected from wild-type versus IL-1R-/- mice in antibody- mediated clearance of B. pertussis in vivo, B cell deficient mice (µMT) were adoptively transferred naïve serum or immune serum from C57BL/6 or IL-1R-/- mice collected on day 21 p.i. and sacrificed to enumerate bacterial numbers in the lungs 14 days later. Compared to the naïve serum treated mice, C57BL/6 immune serum treatment reduced B. pertussis numbers from µMT mice lungs by 75% (Fig. 5.6C). IL-1R-/- mouse immune serum treated µMT mice completely cleared B. pertussis from their lungs (Fig. 5.6C), indicating that the higher titer and Th1-skewed immune serum from IL-1R-/- mice is more effective in antibody-mediated clearance in vivo.
Although antibodies from IL-1R-/- mice efficiently cleared B. pertussis from B cell deficient mice
(Fig. 5.6C), these antibodies did not protect the IL-1R-/- mice themselves from disease (Fig. 5.2A, C, D), suggesting a defect in antibody function in the absence of IL-1R. To test this, naïve or immune serum from wild-type mice, collected on day 28 p.i., was adoptively transferred to C57BL/6 or IL-1R-/- mice and B. pertussis numbers in the lungs were determined on day 14 p.i.. Naïve serum treatment had no effect on B. pertussis numbers in the lungs of either mouse strain (compare Fig. 5.6D and 5.2B). Immune serum treatment decreased B. pertussis numbers in both C57BL/6 and IL-1R-/- mice by more than 95% (Fig. 5.6D).
However, adoptively transferred serum antibodies failed to reduce B. pertussis numbers below 107 CFU in IL-
1R-/- mice, indicating that some immune functions not ameliorated by the addition of antibodies are improperly regulated in these mice.
Higher Th1 cytokine and lower Th2 and Th17 cytokine responses in B. pertussis-infected IL-1R-/-s.
Since B. pertussis-stimulated BMDCs from IL-1R-/- mice produced higher levels of TNF-α (Fig.
5.4A), we further tested if TNF-α levels are elevated at the site of infection in IL-1R-/- mice. TNF-α levels in the lungs of B. pertussis-inoculated C57BL/6 mice peaked on day 7 p.i. and declined thereafter, whereas in the lungs of IL-1R-/- mice, TNF-α levels continued to increase throughout the infectious course and were about 7 fold higher than the levels in the wild-type mice lungs on day 21 p.i. (Fig. 5.7A). Since Th1 skewing
97 was indicated (Fig. 5.6B), we also examined IFN-γ, IL-
10 and IL-17 concentrations, as representative of Th1,
Th2 and Th17 cytokines, in the lungs during B.
pertussis infection to test if the increased inflammatory
responses in IL-1R-/- mice correlates with altered T cell
cytokine production. The IFN-γ concentrations were
higher in the lungs of IL-1R-/- mice than in the lungs of
C57BL/6 mice by day 7 p.i. and at later time points,
although they followed a similar pattern, peaking on
day 7 p.i. and declining thereafter (Fig. 5.7B). IL-10
levels in the lungs of both C57BL/6 and IL-1R-/- mice
increased modestly, ~2 fold compared to the basal
Figure 5.7: Increased TNF-α, IFN-γ and decreased level, on day 3 p.i. and plateaued thereafter (Fig. 5.7C). IL-10, IL-17 responses in B. pertussis-infected IL-1R- /- -/- mice. Groups of 4 C57BL/6 (square) or IL-1R A dramatic peak in IL-17 concentrations at (triangle) mice were inoculated with 5×105 CFUs of B. pertussis and sacrificed on days 0, 3, 7, 14 and 21 p.i.. ~2,000pg/mL on day 7 p.i. was observed in wild-type (A, E) TNF-α, (B, F) IFN-γ, (C, G) IL-10 and (D, H) IL-17 concentrations in the (A-D) lungs or (E-H) cell -/- culture supernatants of splenocytes stimulated with mice lungs but not in IL-1R mice (Fig. 5.7D). media alone (white) or media containing heat-killed B. pertussis (black) were expressed as mean ± the standard Together, these data indicate that pro-inflammatory error. * indicates P≤ 0.05. ** indicates P≤ 0.01. cytokine levels were higher in the lungs of B. pertussis- infected IL-1R-/- mice than in wild-type mice, consistent with their higher bacterial loads (Fig. 5.2B), higher inflammatory pathology (Fig. 5.3) and higher pro-inflammatory cytokine production by innate immune system cells (Fig. 5.4).
To measure systemic cytokine responses, which might not be affected as much as lung cytokine concentrations by differential bacterial loads in the lungs, splenocytes from the same groups of mice described above were stimulated in vitro with media or media containing heat-killed B. pertussis, and TNF-α,
IFN-γ, IL-10 and IL-17 concentrations in the cell culture supernatants were determined. Incubation in media resulted in little production of any tested cytokine (Fig. 5.7 E-H white symbols). Consistent with the findings of lung TNF-α concentrations (Fig. 5.7A), splenic TNF-α responses from both C57BL/6 and IL-1R-/- mice
98 increased to over 3,000 pg/mL by day 7 p.i. (Fig. 5.7E). Interestingly, splenic TNF-α response declined thereafter in C57BL/6 mice but remained high in the IL-1R-/- mice (Fig. 5.7E). IFN-γ concentration in the culture supernatants of splenocytes from both types of mice increased to high levels by day 7 p.i. and stayed high thereafter (Fig. 5.7F). Interestingly, production of IL-10 by C57BL/6 splenocytes kept increasing throughout the time course (Fig. 5.7G square), whereas IL-1R-/- splenocytes failed to increase IL-10 production after an early peak on day 3 p.i. and had produced significantly less IL-10 by day 21 p.i. (Fig.
5.7G triangle) than wild-type splenocytes. Splenic IL-17 production by C57BL/6 mice cells was high
(~2,000pg/mL) by day 3 p.i., kept increasing thereafter and reached ~10,000pg/mL on day 21 p.i., whereas
IL-1R-/- mice splenocytes barely produced any IL-17 (Fig. 5.7H). Together, these data indicate that IL-1R-/- mice induce an increased TNF-α and IFN-γ response, a decreased IL-10 responses and virtually no IL-17 response.
Intranasal administration of rmIL-17 did not reduce B. pertussis numbers in IL-1R-/- mice.
Figure 5.8: Intranasal administration of rmIL-17 restored the pulmonary IL-17 level but did not reduce B. pertussis numbers in IL-1R-/- mice. Groups of 4 C57BL/6 or IL-1R-/- mice were inoculated with 5×105 CFUs of B. pertussis, intranasally administrated PBS (dashed bars) or PBS containing rmIL-17 (black bars) on days 3 and 6 p.i., and euthanized on day 7 p.i.. (A) IL-17 concentration in the lungs was expressed as mean ± the standard error. (B) B. pertussis numbers in the lungs were expressed as mean of Log10CFU ± the standard error.
Since very little IL-17 response was detected in
the lungs of IL-1R-/- mice or was produced by
splenocytes from IL-1R-/- mice, and since IL-17 has
been implicated in the control of B. pertussis
colonization (3), we hypothesized that the lack of IL-17
responses in IL-1R-/- mice might partially account for
the failure of these mice to control B. pertussis numbers. To test this, C57BL/6 and IL-1R-/- mice were inoculated with B. pertussis, intranasally administrated PBS or PBS containing rmIL-17 on days 3 and 6 p.i. and sacrificed on day 7 p.i.. Consistent with previous finding (Fig. 5.7D), little IL-17 was detected in the lungs of PBS-treated IL-1R-/- mice (Fig.
99 5.8A white bars). Although rmIL-17 treatment restored IL-17 level in the lungs of IL-1R-/- mice to that in wild-type mice (Fig. 5.8A black bars), PBS- or rmIL-17-treated IL-1R-/- mice harbored similar numbers of B. pertussis in their lungs (Fig. 5.8B), tracheas and nasal cavities (data not shown), and the bacterial loads were
~30-fold higher than those in C57BL/6 mice, indicating that restoration of IL-17 level in the lungs on day 7 p.i. is not sufficient to decrease B. pertussis burdens of IL-1R-/- mice.
IL-1R signaling contributes to overcoming the effects of pertussis toxin.
IL-1R is required for the control of bacterial
numbers following B. pertussis but not B. parapertussis
infection (Fig. 5.2A, B, C), suggesting that IL-1R may
be important in the host response to some B. pertussis-
specific virulence mechanisms. Since Ptx is not
expressed by B. parapertussis (4, 49), we hypothesized
Figure 5.9: Pertussis toxin deficient B. pertussis failed that IL-1R might contribute to overcoming the effects to cause lethal infection in IL-1R-/- mice. Groups of 4 C57BL/6 (square) or IL-1R-/- (triangle) mice were of Ptx. To test if Ptx is required for B. pertussis to inoculated with 2×106 CFUs of B. pertussis (black) or B. pertussis∆ptx (white) and monitored for survival. cause lethal diseases in IL-1R-/- mice, we challenged
C57BL/6 or IL-1R-/- mice with 2×106 CFU of B. pertussis or B. pertussis∆ptx and monitored survival.
C57BL/6 showed no signs of disease following challenge with either strain and were euthanized on day 100 p.i. (Fig. 5.9). High dose wild-type B. pertussis-challenged IL-1R-/- mice showed signs of severe disease as early as day 5 p.i. and all of them were euthanized by day 13 p.i. to avoid suffering. Interestingly, B. pertussis∆ptx challenged IL-1R-/- mice did not show any sign of disease by day 100 p.i. (Fig. 5.9), indicating that IL-1R signaling is only required to prevent lethal disease caused by B. pertussis when Ptx is expressed.
100 Discussion:
IL-1R, TLR or TNFR engagement of their distinct ligands results in activation of overlapping signal transduction cascades that share signaling intermediates. The Toll-like receptor /IL-1 domain recruits the myeloid differentiation primary response gene (88) (MyD88) adaptor protein upon activation, leading to further activation of signal transduction events that induce cellular responses known to regulate the innate immune responses. Elucidating the specific and/or redundant functions of these receptor mediated signaling pathways is critical to understanding the innate immune response. TLR4 deficient mice are colonized to higher numbers after the first week of B. pertussis infection, and have higher pathology and cellular infiltration than wild-type mice (34). TNF-α deficient mice also have increased B. pertussis loads and elevated inflammation in their lungs (79). We showed here that mice lacking IL-1R are more susceptible to
B. pertussis infection, likely due to uncontrolled inflammation and atypical disseminated diseases. Thus IL-1 is not a dispensable cytokine downstream of TLR4, but rather its signaling pathway is an essential component of immune response to B. pertussis infection. Blocking IL-1 secretion or IL-1R mediated signaling has been a proposed treatment of chronic inflammatory diseases, such as rheumatoid arthritis and Crohn’s disease (7,
26). Some respiratory infections have been identified in patients using drugs blocking IL-1R signaling (23).
This, together with our data, indicates that therapeutics strategies involving IL-1 blockage may lead to increased susceptibility of B. pertussis infection.
IL-1R signaling has been shown to play detrimental or beneficial roles during inflammatory responses on mucosal surfaces (19). In the digestive tract, for example, blockage of components of IL-1R signaling during Y. enterocolitica or S. flexneri infection controls inflammation (21, 66, 67), whereas IL-1 signaling deficiency leads to increased inflammation caused by C. rodentium (41). Similar to the digestive tract, the respiratory tract has a large mucosal area where mounting the proper inflammatory response is critical.
However, in comparison, which innate immune signaling pathways are important for inducing and resolving inflammatory responses during respiratory pathogen invasions are less defined. Here we showed that during infection by a respiratory pathogen, B. pertussis, IL-1R-/- mice lungs had extensive infiltration of neutrophils and lymphocytes (Fig. 5.3). In contrast, the wild-type mice showed only mild lymphoid peribronchiolar cuffing. The increased inflammation and lung pathology were associated with decreased anti-inflammatory
101 cytokine and increased pro-inflammatory cytokine responses by BMDCs and BMMs from IL-1R-/- mice (Fig.
5.4), and both at the site of infection and systemically during B. pertussis infection (Fig. 5.7). Thus, consistent with the observation during C. rodentium infection, we defined a beneficial role of IL-1R signaling in controlling inflammatory responses by B. pertussis.
The contributions of IL-1R signaling pathway to the control of B. pertussis infection can be multifold, including direct and/or indirect effects. BMMs lacking IL-1R are as effective as wild-type cells in killing B. pertussis in vitro (Fig. 5.5), suggesting that IL-1R-/- mice might not be defective in direct bactericidal efficiency. Instead, the effects of losing IL-1R signaling might be indirect. IL-1R-/- mice showed extensive lung pathology with elevated cellular infiltration (Fig. 5.3), as well as increased pro-inflammatory cytokine production by dendritic cells/macrophages (Fig. 5.4), in the lungs and systemically during B. pertussis infection (Fig. 5.7). In addition, antibody (Fig. 5.6A, C) and B. pertussis-specific IFN-γ responses (Fig. 5.6B) were increased in these mice, which may reflect a higher bacterial burden. However, since IFN-γ and antibody responses are normally suppressed at the acute stage of B. pertussis infection (38, 52, 57), the high bacterial load might not be the only reason for the elevated responses. Alternatively, the enhanced adaptive immune responses in IL-1R-/- mice may reflect the relative lack of regulatory cytokine production. Compared to the cells from wild-type mice, BMDCs and BMMs from IL-1R-/- mice decreased the production of IL-10
(Fig. 5.4C, F), a prototypic regulatory cytokine. Moreover, these mice failed to increase Ag-specific systemic
IL-10 responses in the later stages of infection (Fig. 5.7G). The involvement of IL-1R in inducing B. pertussis-specific IL-10 response is in line with the finding that TLR4-mediated innate IL-10 response inhibits Th1 responses and inflammatory pathology in the lungs during B. pertussis infection (34), since IL-
1R and TLR4 share downstream signaling events. IL-10 has been shown to dampen inflammatory cytokine responses to B. pertussis (53). Dirix et al. recently reported that peripheral blood mononuclear cell-derived
IL-10 depresses B. pertussis-specific IFN-γ production in vaccinated infants, further supporting the role of IL-
10 in controlling B. pertussis-specific inflammatory cytokine responses (20). These data suggest that following B. pertussis infection IL-1R contributes to the induction of IL-10, which is important for controlling inflammatory responses.
102 Our data indicated that IL-1R signaling is required for the IL-17 responses during B. pertussis infection (Fig. 5.7D, H). IL-17 producing Th17 cells are distinct from Th1 or Th2 cells and have been shown to play pathogenic roles in autoimmune diseases (28, 40, 42, 61). Additionally, this cytokine has been shown to contribute to host defenses against bacterial infections, including Klebsiella pneumonia (27), Bacteroides fragilis (13), Streptococcus pneumonia (81) and M. tuberculosis (37). IL-17 has been shown to promote macrophage killing of B. pertussis (33). Depletion of IL-17 reduces the efficacy of a B. pertussis whole cell vaccine (33), and affects B. pertussis numbers in murine lungs (3). These data suggest a role for IL-17 in immune responses to B. pertussis.
IL-23 (28, 61), transforming growth factor (TGF)-β and IL-6 (5, 45) have been shown to influence the production of IL-17. Besides IL-6, pro-inflammatory cytokines, such as TNF-α and IL-1β, can increase the efficiency of Th 17 differentiation in mice (12). IL-1β has been found to be essential for the differentiation of IL-17 producing human Th cells (1). Mouse models of arthritis and encephalomyelitis have also revealed the involvement of IL-1 in the generation of IL-17 producing cells (59, 74). The role of IL-1R signaling in induction of local and systemic IL-17 production during bacterial infection has not been previously described. We showed here a severe lack of IL-17 induction in B. pertussis-challenged IL-1R-/- mice, which might be attributable to the role of IL-1 in the generation of IL-17 producing cells. Alternatively, since Th17 cells are negatively regulated by IFN-γ (15, 28, 61), the high IFN-γ responses observed in B. pertussis-challenged IL-1R-/- mice (Fig. 5.7B, F) might have inhibitory effect on IL-17 production in these mice. Although we have established that IL-1R signaling is required for the generation of IL-17 responses during microbial infection, restoring the pulmonary IL-17 peak did not decrease B. pertussis burdens in the lung (Fig. 5.8). This could be due to the limitations of our delivery method or could indicate that the defect of
IL-1R-/- mice in controlling B. pertussis infection is not simply their failure to induce IL-17.
IL-1R signaling deficiency does not lead to lethal infection by B. parapertussis or B. pertussis∆ptx
(Fig. 5.2A, 5.2B, 5.9), both lacking Ptx expression. This highlights an interesting interaction between IL-1R signaling and a specific bacterial virulence factor, Ptx. Nasso, M. et al. recently showed that human Ptx- treated dendritic cells promote Th1 cytokine secretion by T cells, which are down-regulated by IL-10 (60).
Although whether IL-1R is involved in the production of IL-10 by Ptx-treated dendritic cells has not been
103 directed tested, mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K), required for this effect (60), are important signaling components downstream of or interacting with IL-1R (17). Moreover, our data showed that B. pertussis-challenged IL-1R-/- mice BMDCs and splenocytes produce lower IL-10
(Fig. 5.4, 5.7). Murine macrophages produce lower levels of IL-1β following stimulation with B. pertussis∆Ptx than with wild-type B. pertussis (data not shown), indicating that Ptx contributes to the induction of IL-1β. It is likely that Ptx induces IL-1β, which activates IL-1R mediated signaling via MAPK and PI3K, leading to the production of IL-10 and thus the control of inflammatory responses. In the absence of IL-1R, lower levels of IL-10 are produced, resulting in overwhelming inflammation, tissue damage, uncontrolled bacterial growth and ultimately lethality of the animal. The B. pertussis strain lacking Ptx induces lower inflammatory responses (3, 60), thus eliminating the requirement for IL-1R-mediated regulation.
104 Authors and Contributions:
Xuqing Zhang1,2, Sara E. Hester1,3,4, Mary J. Kennett1 , and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, the Pennsylvania State University, 115 Henning
Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, the Pennsylvania State University, University Park
3Department of Biochemistry, Microbiology, and Molecular Biology, The Pennsylvania State
University, University Park
4Graduate Program in Biochemistry, Microbiology and Molecular Biology, The Pennsylvania State
University, University Park
Conceived and designed the experiments: XZ, ETH.
Performed the experiments: XZ, SEH, MJK.
Analyzed the data: XZ.
Wrote the paper: XZ, ETH.
105 References:
1. Acosta-Rodriguez, E. V., G. Napolitani, A. Lanzavecchia, and F. Sallusto. 2007. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol 8:942-949. 2. Andreasen, C., and N. H. Carbonetti. 2008. Pertussis toxin inhibits early chemokine production to delay neutrophil recruitment in response to Bordetella pertussis respiratory tract infection in mice. Infect Immun 76:5139-5148. 3. Andreasen, C., D. A. Powell, and N. H. Carbonetti. 2009. Pertussis toxin stimulates IL-17 production in response to Bordetella pertussis infection in mice. PLoS One 4:e7079. 4. Arico, B., and R. Rappuoli. 1987. Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes. J Bacteriol 169:2847-2853. 5. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238. 6. Bokoch, G. M., and A. G. Gilman. 1984. Inhibition of receptor-mediated release of arachidonic acid by pertussis toxin. Cell 39:301-308. 7. Bresnihan, B., J. M. Alvaro-Gracia, M. Cobby, M. Doherty, Z. Domljan, P. Emery, G. Nuki, K. Pavelka, R. Rau, B. Rozman, I. Watt, B. Williams, R. Aitchison, D. McCabe, and P. Musikic. 1998. Treatment of rheumatoid arthritis with recombinant human interleukin-1 receptor antagonist. Arthritis Rheum 41:2196-2204. 8. Byrne, P., P. McGuirk, S. Todryk, and K. H. Mills. 2004. Depletion of NK cells results in disseminating lethal infection with Bordetella pertussis associated with a reduction of antigen-specific Th1 and enhancement of Th2, but not Tr1 cells. Eur J Immunol 34:2579-2588. 9. Carbonetti, N. H., G. V. Artamonova, C. Andreasen, E. Dudley, R. M. Mays, and Z. E. Worthington. 2004. Suppression of serum antibody responses by pertussis toxin after respiratory tract colonization by Bordetella pertussis and identification of an immunodominant lipoprotein. Infect Immun 72:3350-3358. 10. Carbonetti, N. H., G. V. Artamonova, N. Van Rooijen, and V. I. Ayala. 2007. Pertussis toxin targets airway macrophages to promote Bordetella pertussis infection of the respiratory tract. Infect Immun 75:1713-1720. 11. Cerretti, D. P., C. J. Kozlosky, B. Mosley, N. Nelson, K. Van Ness, T. A. Greenstreet, C. J. March, S. R. Kronheim, T. Druck, L. A. Cannizzaro, and et al. 1992. Molecular cloning of the interleukin-1 beta converting enzyme. Science 256:97-100. 12. Cho, M. L., J. W. Kang, Y. M. Moon, H. J. Nam, J. Y. Jhun, S. B. Heo, H. T. Jin, S. Y. Min, J. H. Ju, K. S. Park, Y. G. Cho, C. H. Yoon, S. H. Park, Y. C. Sung, and H. Y. Kim. 2006. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous arthritis animal model IL-1 receptor antagonist-deficient mice. J Immunol 176:5652-5661. 13. Chung, D. R., D. L. Kasper, R. J. Panzo, T. Chitnis, M. J. Grusby, M. H. Sayegh, and A. O. Tzianabos. 2003. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J Immunol 170:1958-1963. 14. Crowcroft, N. S., C. Stein, P. Duclos, and M. Birmingham. 2003. How best to estimate the global burden of pertussis? Lancet Infect Dis 3:413-418. 15. Cruz, A., S. A. Khader, E. Torrado, A. Fraga, J. E. Pearl, J. Pedrosa, A. M. Cooper, and A. G. Castro. 2006. Cutting edge: IFN-gamma regulates the induction and expansion of IL-17-producing CD4 T cells during mycobacterial infection. J Immunol 177:1416-1420. 16. Czuprynski, C. J., and J. F. Brown. 1987. Recombinant murine interleukin-1 alpha enhancement of nonspecific antibacterial resistance. Infect Immun 55:2061-2065. 17. Daun, J. M., and M. J. Fenton. 2000. Interleukin-1/Toll receptor family members: receptor structure and signal transduction pathways. J Interferon Cytokine Res 20:843-855. 18. de Melker, H. E., F. G. Versteegh, J. F. Schellekens, P. F. Teunis, and M. Kretzschmar. 2006. The incidence of Bordetella pertussis infections estimated in the population from a combination of serological surveys. J Infect 53:106-113. 19. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095-2147. 20. Dirix, V., V. Verscheure, T. Goetghebuer, M. Hainaut, A. S. Debrie, C. Locht, and F. Mascart. 2009. Monocyte-derived interleukin-10 depresses the Bordetella pertussis-specific IFN-{gamma} response in vaccinated infants. Clin Vaccine Immunol. 21. Dube, P. H., P. A. Revell, D. D. Chaplin, R. G. Lorenz, and V. L. Miller. 2001. A role for IL-1 alpha in inducing pathologic inflammation during bacterial infection. Proc Natl Acad Sci U S A 98:10880-10885. 22. Fitzgerald, K. A., and L. A. O'Neill. 2000. The role of the interleukin-1/Toll-like receptor superfamily in inflammation and host defence. Microbes Infect 2:933-943.
106 23. Fleischmann, R. M., J. Tesser, M. H. Schiff, J. Schechtman, G. R. Burmester, R. Bennett, D. Modafferi, L. Zhou, D. Bell, and B. Appleton. 2006. Safety of extended treatment with anakinra in patients with rheumatoid arthritis. Ann Rheum Dis 65:1006-1012. 24. Fremond, C. M., D. Togbe, E. Doz, S. Rose, V. Vasseur, I. Maillet, M. Jacobs, B. Ryffel, and V. F. Quesniaux. 2007. IL-1 receptor-mediated signal is an essential component of MyD88-dependent innate response to Mycobacterium tuberculosis infection. J Immunol 179:1178-1189. 25. Gilberg, S., E. Njamkepo, I. P. Du Chatelet, H. Partouche, P. Gueirard, C. Ghasarossian, M. Schlumberger, and N. Guiso. 2002. Evidence of Bordetella pertussis infection in adults presenting with persistent cough in a french area with very high whole-cell vaccine coverage. J Infect Dis 186:415-418. 26. Hallegua, D. S., and M. H. Weisman. 2002. Potential therapeutic uses of interleukin 1 receptor antagonists in human diseases. Ann Rheum Dis 61:960-967. 27. Happel, K. I., P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, and J. K. Kolls. 2005. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp Med 202:761-769. 28. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6:1123-1132. 29. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect Immun 67:1493-1500. 30. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 31. Hausman, S. Z., and D. L. Burns. 2000. Use of pertussis toxin encoded by ptx genes from Bordetella bronchiseptica to model the effects of antigenic drift of pertussis toxin on antibody neutralization. Infect Immun 68:3763-3767. 32. Heininger, U., P. A. Cotter, H. W. Fescemyer, G. Martinez de Tejada, M. H. Yuk, J. F. Miller, and E. T. Harvill. 2002. Comparative phenotypic analysis of the Bordetella parapertussis isolate chosen for genomic sequencing. Infect Immun 70:3777-3784. 33. Higgins, S. C., A. G. Jarnicki, E. C. Lavelle, and K. H. Mills. 2006. TLR4 mediates vaccine-induced protective cellular immunity to Bordetella pertussis: role of IL-17-producing T cells. J Immunol 177:7980-7989. 34. Higgins, S. C., E. C. Lavelle, C. McCann, B. Keogh, E. McNeela, P. Byrne, B. O'Gorman, A. Jarnicki, P. McGuirk, and K. H. Mills. 2003. Toll-like receptor 4-mediated innate IL-10 activates antigen-specific regulatory T cells and confers resistance to Bordetella pertussis by inhibiting inflammatory pathology. J Immunol 171:3119-3127. 35. Hodder, S. L., J. D. Cherry, E. A. Mortimer Jr, A. B. Ford, J. Gornbein, and K. Papp. 2000. Antibody responses to Bordetella pertussis antigens and clinical correlations in elderly community residents. Clin Infect Dis 31:7- 14. 36. Katada, T., M. Tamura, and M. Ui. 1983. The A protomer of islet-activating protein, pertussis toxin, as an active peptide catalyzing ADP-ribosylation of a membrane protein. Arch Biochem Biophys 224:290-298. 37. Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper. 2005. IL-23 compensates for the absence of IL-12p70 and is essential for the IL- 17 response during tuberculosis but is dispensable for protection and antigen-specific IFN-gamma responses if IL-12p70 is available. J Immunol 175:788-795. 38. Kirimanjeswara, G. S., L. M. Agosto, M. J. Kennett, O. N. Bjornstad, and E. T. Harvill. 2005. Pertussis toxin inhibits neutrophil recruitment to delay antibody-mediated clearance of Bordetella pertussis. J Clin Invest 115:3594-3601. 39. Kirimanjeswara, G. S., Mann, P.B., and Harvill, E.T. 2003. Role of antibodies in immunity to Bordetella infections. Infect Immun 71:1719-1724. 40. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, and D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201:233-240. 41. Lebeis, S. L., K. R. Powell, D. Merlin, M. A. Sherman, and D. Kalman. 2009. Interleukin-1 receptor signaling protects mice from lethal intestinal damage caused by the attaching and effacing pathogen Citrobacter rodentium. Infect Immun 77:604-614. 42. Lubberts, E. 2003. The role of IL-17 and family members in the pathogenesis of arthritis. Curr Opin Investig Drugs 4:572-577. 43. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Rossner, F. Koch, N. Romani, and G. Schuler. 1999. An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223:77-92.
107 44. Mahon, B. P., B. J. Sheahan, F. Griffin, G. Murphy, and K. H. Mills. 1997. Atypical disease after Bordetella pertussis respiratory infection of mice with targeted disruptions of interferon-gamma receptor or immunoglobulin mu chain genes. J Exp Med 186:1843-1851. 45. Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441:231-234. 46. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infect Immun 75:3665-3672. 47. Mann, P. B., K. D. Elder, M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4-dependent early elicited tumor necrosis factor alpha expression is critical for innate host defense against Bordetella bronchiseptica. Infect Immun 72:6650-6658. 48. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 49. Marchitto, K. S., S. G. Smith, C. Locht, and J. M. Keith. 1987. Nucleotide sequence homology to pertussis toxin gene in Bordetella bronchiseptica and Bordetella parapertussis. Infect Immun 55:497-501. 50. Martino, A., E. Volpe, G. Auricchio, V. Colizzi, and P. M. Baldini. 2006. Influence of pertussis toxin on CD1a isoform expression in human dendritic cells. J Clin Immunol 26:153-159. 51. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 52. McGuirk, P., B. P. Mahon, F. Griffin, and K. H. Mills. 1998. Compartmentalization of T cell responses following respiratory infection with Bordetella pertussis: hyporesponsiveness of lung T cells is associated with modulated expression of the co-stimulatory molecule CD28. Eur J Immunol 28:153-163. 53. McGuirk, P., C. McCann, and K. H. Mills. 2002. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 195:221-231. 54. Mielcarek, N., G. Riveau, F. Remoue, R. Antoine, A. Capron, and C. Locht. 1998. Homologous and heterologous protection after single intranasal administration of live attenuated recombinant Bordetella pertussis. Nat Biotechnol 16:454-457. 55. Miller, L. S., E. M. Pietras, L. H. Uricchio, K. Hirano, S. Rao, H. Lin, R. M. O'Connell, Y. Iwakura, A. L. Cheung, G. Cheng, and R. L. Modlin. 2007. Inflammasome-mediated production of IL-1beta is required for neutrophil recruitment against Staphylococcus aureus in vivo. J Immunol 179:6933-6942. 56. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect 3:655-677. 57. Mills, K. H., A. Barnard, J. Watkins, and K. Redhead. 1993. Cell-mediated immunity to Bordetella pertussis: role of Th1 cells in bacterial clearance in a murine respiratory infection model. Infect Immun 61:399-410. 58. Munoz, J. J., H. Arai, R. K. Bergman, and P. L. Sadowski. 1981. Biological activities of crystalline pertussigen from Bordetella pertussis. Infect Immun 33:820-826. 59. Nakae, S., S. Saijo, R. Horai, K. Sudo, S. Mori, and Y. Iwakura. 2003. IL-17 production from activated T cells is required for the spontaneous development of destructive arthritis in mice deficient in IL-1 receptor antagonist. Proc Natl Acad Sci U S A 100:5986-5990. 60. Nasso, M., G. Fedele, F. Spensieri, R. Palazzo, P. Costantino, R. Rappuoli, and C. M. Ausiello. 2009. Genetically detoxified pertussis toxin induces Th1/Th17 immune response through MAPKs and IL-10- dependent mechanisms. J Immunol 183:1892-1899. 61. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, and C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6:1133-1141. 62. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M. T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga, L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D. Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis, J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S. Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E. Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M. Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead, B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 63. Pilione, M. R., L. M. Agosto, M. J. Kennett, and E. T. Harvill. 2006. CD11b is required for the resolution of inflammation induced by Bordetella bronchiseptica respiratory infection. Cell Microbiol 8:758-768.
108 64. Pilione, M. R., and E.T. harvill. 2006. The Bordetella bronchiseptica type III secretion system inhibits gamma interferon production that is required for efficient antibody-mediated bacterial clearance. Infect Immun 74:1043-1049. 65. Reiniger, N., M. M. Lee, F. T. Coleman, C. Ray, D. E. Golan, and G. B. Pier. 2007. Resistance to Pseudomonas aeruginosa chronic lung infection requires cystic fibrosis transmembrane conductance regulator-modulated interleukin-1 (IL-1) release and signaling through the IL-1 receptor. Infect Immun 75:1598-1608. 66. Sansonetti, P. J., J. Arondel, J. M. Cavaillon, and M. Huerre. 1995. Role of interleukin-1 in the pathogenesis of experimental shigellosis. J Clin Invest 96:884-892. 67. Sansonetti, P. J., A. Phalipon, J. Arondel, K. Thirumalai, S. Banerjee, S. Akira, K. Takeda, and A. Zychlinsky. 2000. Caspase-1 activation of IL-1beta and IL-18 are essential for Shigella flexneri-induced inflammation. Immunity 12:581-590. 68. Shumilla, J. A., V. Lacaille, T. M. Hornell, J. Huang, S. Narasimhan, D. A. Relman, and E. D. Mellins. 2004. Bordetella pertussis infection of primary human monocytes alters HLA-DR expression. Infect Immun 72:1450- 1462. 69. Siciliano, N. A., J. A. Skinner, and M. H. Yuk. 2006. Bordetella bronchiseptica modulates macrophage phenotype leading to the inhibition of CD4+ T cell proliferation and the initiation of a Th17 immune response. J Immunol 177:7131-7138. 70. Skowronski, D. M., G. De Serres, D. MacDonald, W. Wu, C. Shaw, J. Macnabb, S. Champagne, D. M. Patrick, and S. A. Halperin. 2002. The changing age and seasonal profile of pertussis in Canada. J Infect Dis 185:1448- 1453. 71. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220. 72. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J Bacteriol 173:4288-4296. 73. Stylianou, E., L. A. O'Neill, L. Rawlinson, M. R. Edbrooke, P. Woo, and J. Saklatvala. 1992. Interleukin 1 induces NF-kappa B through its type I but not its type II receptor in lymphocytes. J Biol Chem 267:15836- 15841. 74. Sutton, C., C. Brereton, B. Keogh, K. H. Mills, and E. C. Lavelle. 2006. A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med 203:1685- 1691. 75. Thornberry, N. A., H. G. Bull, J. R. Calaycay, K. T. Chapman, A. D. Howard, M. J. Kostura, D. K. Miller, S. M. Molineaux, J. R. Weidner, J. Aunins, and et al. 1992. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356:768-774. 76. von Konig, C. H., S. Halperin, M. Riffelmann, and N. Guiso. 2002. Pertussis of adults and infants. Lancet Infect Dis 2:744-750. 77. Witvliet, M. H., D. L. Burns, M. J. Brennan, J. T. Poolman, and C. R. Manclark. 1989. Binding of pertussis toxin to eucaryotic cells and glycoproteins. Infect Immun 57:3324-3330. 78. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 79. Wolfe, D. N., P. B. Mann, A. M. Buboltz, and E. T. Harvill. 2007. Delayed role of tumor necrosis factor- alpha in overcoming the effects of pertussis toxin. J Infect Dis 196:1228-1236. 80. Wong, W. S., and P. M. Rosoff. 1996. Pharmacology of pertussis toxin B-oligomer. Can J Physiol Pharmacol 74:559-564. 81. Zhang, Z., T. B. Clarke, and J. N. Weiser. 2009. Cellular effectors mediating Th17-dependent clearance of pneumococcal colonization in mice. J Clin Invest 119:1899-1909.
109
Chapter 6
Decreased Leukocyte Accumulation and Delayed Bordetella pertussis Clearance
in IL-6-/- Mice.
Abstract
IL-6, a pleiotropic cytokine primarily produced by the innate immune system, has been implicated in the development of acquired immune responses, though its roles are largely undefined and may vary in the context of different diseases. Using a murine model of infection, we established that IL-6 influences the adaptive immune responses against the endemic human respiratory pathogen, Bordetella pertussis. IL-6 was induced in the lungs of C57BL/6 mice by B. pertussis. IL-6-/- mice showed a protracted infectious course and were less efficiently protected by B. pertussis vaccination than wild-type mice. Antibodies from IL-6-/- mice, though lower in titer, efficiently reduced B. pertussis numbers in IL-6 sufficient mice. IL-6-/- mice treated with antibodies from wild-type mice harbored significantly more B. pertussis than similarly treated wild-type mice, suggesting additional defects not ameliorated by supplementing antibodies. Pulmonary leukocyte recruitment and splenic T cell cytokine responses to B. pertussis, including TH1, TH2 and TH17 cytokine production, were lower in IL-6-/- mice than in wild-type mice. Together, these results reveal the dysregulation of multiple aspects of adaptive immune responses in B. pertussis-infected IL-6-/- mice and suggest that IL-6 is involved in regulating antibody generation, pulmonary leukocyte accumulation and T cell cytokine production in response to B. pertussis as well as the generation of effective vaccine-induced immunity against this pathogen.
110 Introduction
IL-6, though primarily produced as a part of the innate immune response, has recently been recognized as a crucial regulator of the generation of adaptive immune responses (23). For example, IL-6 plays a critical role in the differentiation of B cells and promotes the proliferation of plasmablasts during their final stages of maturation into immunoglobulin producing plasma cells (1, 34, 57, 61). Additionally, by binding to its soluble receptor, IL-6 can promote the production of some chemokines, such as MCP-1 and IL-
8, by endothelial cells, which increase expression of adhesion molecules and contribute to the recruitment of leukocytes to the site of inflammation (51). IL-6 is also a regulator of T cell proliferation, differentiation and survival (13, 23, 46). Recent reports have implicated this cytokine in the differentiation of naïve T cells to
TH17 cells, a lineage shown to be involved in the development of autoimmune diseases and host defenses against invading pathogens (5, 18, 47).
The role of IL-6 in regulating protective immune responses has been revealed by challenging IL-6
-/- -/- deficient (IL-6 ) mice with various pathogens. For instance, IL-6 mice fail to induce a protective TH1 response against the fungal pathogen, Candida albicans (50). These mice also have a decreased TH1 response and an increased mortality rate following infection with the intracellular pathogen Chlamydia trachomatis
-/- (65). Additionally, IL-6 mice have decreased TH2 cytokine responses, decreased IgG2b production, and increased lyme arthritis incidence in response to Borrelia burgdorferi infection (3).
Several lines of evidence support the importance of IL-6 in host defenses against certain respiratory pathogens. For example, Mycobacterium tuberculosis induces decreased IFN-γ responses and a lethal infection in IL-6-/- mice (30). These mice also show elevated pulmonary pro-inflammatory cytokine levels and an increased susceptibility to Streptococcus pneumoniae (60). Furthermore, IL-6 has been shown to protect against Klebsiella pneumoniae infection by augmenting neutrophil-mediated killing of bacteria (59).
Notably, IL-6-/- mice are not diseased by the normal flora of the respiratory tract, suggesting that IL-6- mediated immune responses are important for host defenses against specific virulence mechanisms of certain pathogens.
The complex interactions between various adaptive immune factors following Bordetella pertussis infection make the murine model of B. pertussis infection suitable to further explore how IL-6 impacts the
111 adaptive immune responses in the respiratory tract during infection. B. pertussis is one of the etiologic agents of whooping cough (41), an acute and severe respiratory disease, causing approximately 50 million cases and
300,000 deaths worldwide annually (9). The incidence of whooping cough is on the rise in regions of high vaccine coverage in developed countries (16, 21, 52, 62). Notably, a large portion of whooping cough infections are thought to remain unreported (12). B. pertussis produces various toxins and adhesins, such as pertussis toxin, adenylate cyclase toxin, filamentous hemagglutinin, fimbriae, pertactin and lipopolysaccharide, many of which are known to contribute to pathogenesis and immune subversion (41).
Unlike many other bacterial and viral diseases in which antibodies against a single surface antigen or toxin mediate protection, immunity against B. pertussis is much more complex, in that no single arm of the immune response alone can confer effective protection (43). Both antibodies and T cells are required to clear the infection, but neither alone is sufficient (28, 38, 44, 67). Although previous clinical and experimental studies
have established the roles of various host immune factors, such as B cells, antibodies, neutrophils, CD4+ T cells, TNF-α and IFN-γ, in immunity against B. pertussis (27, 32, 36, 37, 41-43, 45, 68), many other contributing host factors to immunity against this bacterium are still being identified (X. Zhang, S.E. Hester,
M.J. Kennett, E.T. Harvill, submitted for publication; A.T. Karanikas, E.T. Harvill, unpublished observations). Since IL-6 is crucial for host defenses against various respiratory pathogens (8, 25, 29, 60) and is induced by B. pertussis LPS in vitro (40), we sought to determine the role of this cytokine in the immune response against B. pertussis. The complexity of immune responses against B. pertussis provides us the opportunity to dissect the involvement of IL-6 in regulating various arms of the immune responses.
IL-6-/- mice were delayed in their clearance of B. pertussis and were less efficient in generating vaccine-induced immunity against B. pertussis compared to wild-type mice. Compared to serum antibodies from wild-type mice, antibodies from B. pertussis-infected IL-6-/- mice had decreased B. pertussis-specific titer, despite higher bacterial numbers in these mice. Both sera efficiently reduced bacterial numbers in IL-6 sufficient mice. Additionally, wild-type-serum-treated IL-6-/- mice still harbored more bacteria than similarly treated wild-type mice, suggesting that the inefficient clearance of B. pertussis in IL-6-/- mice is not due solely to decreased antibody generation. IL-6-/- mice had decreased leukocyte accumulation in the lungs during the later stages of B. pertussis infection and lower levels of splenic TH1, TH2 and TH17 cytokine production as
112 compared to wild-type mice. Overall, this study establishes roles for IL-6 in antibody generation, leukocyte recruitment and T cell cytokine production in response to B. pertussis infection.
113 Material and Methods
Bacterial strains and growth. The B. pertussis strain 536, a streptomycin resistant derivative of Tohama I, has been previously described (56). Bacteria were maintained on Bordet-Gengou agar (Difco) supplemented with 10% defibrinated sheep blood (Hema Resources) and 20 μg/mL streptomycin (Sigma-Aldrich). Liquid cultures were grown overnight in Stainer-Scholte broth at 37°C to mid-log phase (54).
Stimulation of macrophage cell line. The murine macrophage cell line, RAW 264.7, was obtained from
ATCC and cultured in Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) supplemented with 10% fetal bovine serum (FBS) (HyClone). Approximately 105 cells were placed in each well of 96-well plates
(Falcon) and stimulated with live B. pertussis at multiplicities of infection (MOI) of 1 or 10. Cell culture supernatants were collected at the indicated time points and IL-6 concentration was measured via Enzyme- linked immunosorbent assays (ELISA) as per the manufacturers’ instructions (R&D Systems).
Animal experiments. C57BL/6J, B6.129S6-Il6tm1Kopf/J (IL-6-/-) and B6.129S2-Igh-6tm1Cgn/J (μMT) mice were obtained from Jackson Laboratories (Bar Harbor) and bred in Bordetella-free, specific pathogen-free breeding rooms at The Pennsylvania State University. For inoculation, 4-6 week-old mice were lightly sedated with
5% Isoflurane (Abbott Laboratories) in oxygen and inoculated by pipetting 50 μL phosphate-buffered saline
(PBS) containing 5×105 CFU of bacteria onto the external nares (28). This method reliably distributes bacteria throughout the respiratory tract (19). For vaccination, mice were i.p. injected with 108 CFU of heat- inactivated bacteria in 200 µL PBS on days 14 and 28 prior to challenge (70). For adoptive transfer of serum antibodies, sera were collected on day 28 post B. pertussis inoculation or from naïve animals, and 200 µL of pooled serum was i.p. injected before the bacterial inoculation (28). Bacterial numbers in the lungs were quantified on day 14 post-inoculation since pertussis toxin delays the antibody-mediated clearance of B. pertussis until T cell responses are generated (27) (D.N. Wolfe, E.T. Harvill, unpublished observations). For quantification of bacteria numbers, mice were sacrificed via CO2 inhalation and lungs, tracheas, and nasal cavities were excised. Tissues were homogenized in 1 mL PBS, serially diluted and plated onto Bordet-
Gengou agar plates with 20 µg/mL streptomycin, and colonies were counted after incubation at 37°C for 4-5 days (28). The lower limit of detection was 10 CFU. All protocols were reviewed and approved by The
114 Pennsylvania State University Institutional Animal Care and Use Committee (IACUC) and all animals were handled in accordance with institutional guidelines.
Splenocyte re-stimulation. Spleens were excised on the indicated days post-inoculation from groups of 3-4
B. pertussis-inoculated C57BL/6 and IL-6-/- mice. Splenocytes were isolated as previously described (48, 66).
In brief, spleens were homogenized and red blood cells were lysed with 0.84% ammonium chloride treatment.
2×106 cells were re-suspended in 200 µL DMEM supplemented with 10% FBS, and 100 µg/mL penicillin and streptomycin (HyClone) and placed into each well of 96-well tissue culture plates. Splenocytes were
stimulated with 10 µL media alone or media containing 107 CFU (MOI of 5) of heat-inactivated B. pertussis
(48, 66). After 3 days, the supernatants were collected and analyzed for TNF-α, IL-2, IL-4, IL-5, IL-12, GM-
CSF, IL-10 and IFN-γ concentrations by Bio-plex™ TH1/ TH2 Panel (Bio-Rad). IL-17 concentrations were quantified via ELISA (R&D Systems) as per the manufacturers’ instructions.
Titer ELISAs. Antibody titers were determined as previously described (39). Briefly, heat-inactivated
exponential–phase B. pertussis diluted to 5×107 CFU/mL in a 1:1 mix of 0.2 M sodium carbonate and 0.2 M sodium bicarbonate buffers was used to coat 96-well plates (Greiner Bio-one) by incubating for 2 h in a humidified chamber at 37°C. The plates were washed and blocked, and a 1:50 dilution of serum samples
collected from individual C57BL/6 or IL-6-/- mouse on days 28, 49, 77 or 108 post-inoculation were added to the first well and serially diluted 1:2 across the plates. Plates were incubated for 2 h at 37°C, washed and probed with 1:4,000 dilution of goat anti-mouse Ig, IgG1, IgG2a or IgG2b horseradish peroxidase (HRP)- conjugated antibodies (Southern Biotechnology Associates and Pharmingen) for 1 h and visualized with 2,2’-
Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt in phosphate-citrate buffer with hydrogen peroxide at an absorbance of 405 nm. Titers were determined via the end-point method using a cut off that is 0.1 higher than the optical density of similarly treated wells probed with naïve serum (39).
Quantification of leukocytes and cytokine in the lungs. To quantify leukocytes, lungs were perfused with sterile PBS, excised, and placed in 4 mL of RPMI 1640 medium (HyClone). Lungs were homogenized and laid over Histopaque 1119 (Sigma Aldrich) and centrifuged for 30 min at 700 g at room temperature. The leukocyte layer was collected, spun down at 300 g for 5 min and re-suspended in PBS supplemented with 2%
FBS. The total number of cells was determined by counting at 40× magnification on a hemocytometer.
115 Aliquots of cells were blocked with anti-mouse CD16/CD32 antibodies (BD Biosciences Pharmingen) and stained with FITC-labeled anti-mouse-CD4 antibodies, or FITC-labeled anti-mouse-Ly6G (BD Biosciences
Pharmingen). The percentages of CD4+ and Ly6G+ cells were determined by flow cytometry. Percentages were multiplied by the total number of leukocytes to calculate the total number of CD4+ or Ly6G+ cells, respectively. To measure the cytokine concentrations in the lungs, lungs were homogenized in 1 mL PBS, tissues were spun down at 8,000 g for 10 min at 4°C, and IL-6 concentrations were determined via cytokine
ELISAs in accordance with the suppliers’ protocols (R&D Systems).
Statistical analysis. The means ± standard error (error bars) were determined for all appropriate data. Two- tailed, unpaired Student’s T-tests were used to determine statistical significance between groups. Results were also analyzed by ANOVA and Tukey simultaneous test in Minitab with similar significance.
116 Results
IL-6 is induced in response to B. pertussis in vitro and in vivo.
As IL-6 has been shown to be elicited in
response to various respiratory pathogens and by B.
pertussis LPS (8, 25, 29, 40, 60), we examined whether
macrophages produce IL-6 in response to live B.
pertussis in vitro. Murine macrophages were incubated
with media alone or media containing B. pertussis and
IL-6 concentrations in the supernatants were measured
via ELISA at various time points thereafter.
Macrophages incubated with media alone produced
little IL-6 (less than 5 pg/mL) by 24h. However,
macrophages incubated with B. pertussis at a MOI of 1
produced increasing levels of IL-6 over time and the
Figure 6.1: B. pertussis induces IL-6 in vitro and in concentration of IL-6 in the culture supernatant reached vivo. (A) IL-6 concentration of RAW cells culture supernatants after incubation with media alone (white 2,000 pg/mL by 24 h. Furthermore, in culture bars) or media with live B. pertussis at a MOI of 1 (dashed bars) or 10 (black bars) for the indicated time. supernatants of macrophages incubated with B. (B) Groups of 3-4 C57BL/6 mice were inoculated with B. pertussis and sacrificed at the indicated time points. pertussis at a MOI of 10, the IL-6 concentration IL-6 concentration in the lungs of each group of mice is expressed as mean ± standard error. Tania Goel performed this experiment. reached 1,700 pg/mL by 6 h and plateaued at ~3,500 pg/mL by 8 h (Fig. 6.1A).
To determine if B. pertussis induces IL-6 production in vivo, C57BL/6 mice were inoculated with
5×105 CFU B. pertussis and their lungs were excised on days 0, 3, 7, 14, 28, 49, 77, and 108 post-inoculation to measure the concentrations of IL-6 in the lungs. IL-6 levels increased from levels in naïve mice (160 pg/mL) by day 3 (~1,100 pg/mL) and peaked on day 7 (~2,000 pg/mL) post B. pertussis inoculation. IL-6 levels thereafter were not significantly different between infected and naïve mice (Fig. 6.1B). Combined, these data suggest that B. pertussis induces IL-6 production by murine macrophages in vitro and in mouse lungs during the first week of infection.
117 IL-6 contributes to the clearance of B. pertussis.
To determine whether IL-6 is required for the control
of B. pertussis in vivo, C57BL/6 and IL-6-/- mice were
inoculated with B. pertussis and sacrificed on days 0, 3,
7, 14, 28, 49, 77 and 108 post-inoculation for bacterial
enumeration throughout the respiratory tract.
Consistent with previous findings, B. pertussis loads
throughout the respiratory tract of C57BL/6 mice
peaked on day 3 post-inoculation and declined
thereafter. The bacteria were cleared from nasal
cavities and tracheas by day 28 post-inoculation and
from lungs by day 49 post-inoculation (Fig. 6.2) (28).
Figure 6.2: Delayed clearance of B. pertussis in IL-6-/- Similar numbers of B. pertussis were recovered from mice. Groups of 3-4 C57BL/6 (solid line with -/- diamonds) and IL-6-/- (dashed line with squares) mice the nasal cavities of IL-6 and C57BL/6 mice until day were inoculated with B. pertussis and sacrificed on the indicated days post-inoculation. Bacterial loads are 14 post-inoculation, but the IL-6 deficient mice had expressed as mean Log10CFU ± standard error. The dashed line indicates the limit of detection. *: p ≤ 0.05. elevated burdens thereafter, with clearance observed **: p ≤ 0.01. about 80 days later than that in C57BL/6 mice (Fig. 6.2). Clearance of B. pertussis from the tracheas of IL-6-/-
mice was also delayed relative to that of C57BL/6 mice. In the lungs of IL-6-/- mice, B. pertussis loads were similar to those in C57BL/6 mice until day 7 post-inoculation, but were about 40-fold and 13,000-fold higher on days 14 and 28 post-inoculation, respectively. Approximately 1,700 and 80 CFU B. pertussis were recovered from the lungs of IL-6-/- mice on days 49 and 77 post-inoculation, respectively, when no detectable
B. pertussis was recovered from the lungs of wild-type mice. Notably, IL-6-/- mice did not clear B. pertussis until day 108 post-inoculation, which was a delay of approximately 9 weeks as compared to C57BL/6 mice
(Fig. 6.2). Overall, these data indicate that IL-6 is critical to the efficient clearance of B. pertussis from the respiratory tract of mice.
IL-6 is required for the generation of efficient vaccine-induced immunity against B. pertussis.
118 Since IL-6-/- mice are defective in controlling
B. pertussis numbers 2 weeks or more post-inoculation
(Fig. 6.2), we hypothesized that IL-6 contributes to
anamnestic immunity against B. pertussis. To deliver
equivalent amounts of antigens, C57BL/6 and IL-6-/-
mice were vaccinated with heat-killed B. pertussis.
Naïve or vaccinated mice were challenged with B.
pertussis and sacrificed 3 days later for bacterial
number quantification. B. pertussis vaccination did not
have significant effect on B. pertussis colonization in
the nasal cavities of C57BL/6 mice, but completely
cleared B. pertussis from the tracheas of these mice
Figure 6.3: IL-6 contributes to the generation of (Fig. 6.3). Naïve C57BL/6 mice harbored > 800-fold efficient vaccine-induced immunity against B. pertussis. Groups of 4 naïve or vaccinated C57BL/6 more B. pertussis in their lungs as compared to (black bars) or IL-6-/- (white bars) mice were challenged with B. pertussis and sacrificed on day 3 post-challenge. vaccinated C57BL/6 mice, indicating that vaccination Bacterial loads are expressed as mean Log10CFU ± standard error. The dashed line indicates the limit of protects the lungs of these mice. In IL-6-/- mice, B. detection. ND indicates undetectable bacterial number. **: p ≤ 0.01. pertussis vaccination had no effect in bacterial numbers in the nasal cavities but was able to reduce B. pertussis numbers in the tracheas and lungs relative to naïve IL-
6-/- mice. Notably, vaccinated IL-6-/- mice harbored significantly more B. pertussis in their lungs compared to vaccinated wild-type mice (Fig. 6.3), indicating that IL-6 contributes to the generation of efficient vaccine- induced immunity against B. pertussis in the lungs.
Despite lower titers, serum antibodies from IL-6-/- mice are sufficient for antibody-mediated clearance of B. pertussis.
119
Figure 6.5: Serum antibodies from IL-6-/- mice are effective in antibody-mediated clearance of B. pertussis. Groups of 3-4 µMT mice were adoptively transferred naïve serum (NS, dashed bars) or immune serum (IS) from C57BL/6 (black bars), or IL-6-/- mice (white bars) right before B. pertussis inoculation. Mice were sacrificed 14 days post-inoculation. Bacterial numbers in the lung are expressed as mean Log10CFU ± standard error. The dashed line indicates the limit of detection. *: p ≤ 0.05. Tania Goel performed this experiment.
To examine the role of IL-6 in the generation
of an efficient antibody response, we compared B.
pertussis-specific serum antibody titers on days 28, 49,
77 and 108 post B. pertussis inoculation in wild-type
and IL-6-/- mice via ELISA. B. pertussis-specific total
Figure 6.4: B. pertussis-specific antibody production Ig titers of serum antibodies collected from C57BL/6 is decreased in IL-6-/- mice. Serum was collected from groups of 4 B. pertussis-inoculated C57BL/6 (solid line mice were high (titer>5,000) by day 28 post- with diamonds) or IL-6-/- (dashed line with squares) mice on days 28, 49, 77 and 108 post-inoculation. B. inoculation and stayed at high levels on days 49, 77 and pertussis-specific antibody titers are expressed as mean Log10Titer ± standard error. The dashed line indicates the limit of detection. ND indicates undetectable titer. 108 post-inoculation (Fig. 6.4). In comparison, B. *: p ≤ 0.05. **: p ≤ 0.01. Tania Goel performed this experiment. pertussis-specific Ig titers of serum antibodies from IL-
6-/- mice were below 1,000 on days 28, 49 and 108 post-inoculation and were ~2,500 on day 77 post- inoculation (Fig. 6.4). IgG2a titers of serum antibodies from both C57BL/6 and IL-6-/- mice were low or below the limit of detection at all the time points tested (data not shown). IgG1 titers of serum antibodies from C57BL/6 and IL-6-/- mice were comparable. IgG2b titers of serum antibodies from C57BL/6 mice were
>3,000 by day 28 post-inoculation, and increased to >6,000 by day 108 post-inoculation. In contrast, B. pertussis-specific IgG2b titers of serum antibodies from IL-6-/- mice were below the limit of detection on day
28 post-inoculation and were approximately 1/10 those from C57BL/6 mice on days 49 and 108 post-
120 inoculation (Fig. 6.4). Although IL-6-/- mice had higher and more sustained numbers of B. pertussis (Fig.
6.2), they generated much lower antibody titers, indicating that IL-6 contributes to the generation of B. pertussis-specific IgG2b antibodies.
To examine whether the lower serum antibody titers in IL-6-/- mice (Fig. 6.4) could contribute to the defect in efficient B. pertussis clearance, we adoptively transferred naïve serum from C57BL/6 mice or immune serum from B. pertussis-inoculated C57BL/6 or IL-6-/- mice into µMT (B cell deficient) mice right before B. pertussis inoculation, and bacterial numbers in the lungs were determined 14 days post-inoculation.
μMT mice treated with immune serum from C57BL/6 mice reduced B. pertussis numbers in the lungs by
>99% relative to those given naïve serum (Fig. 6.5). Treatment with immune serum generated in IL-6-/- mice resulted in similar reduction of bacterial numbers in the lungs (Fig. 6.5), indicating that despite having lower
antibody titers, antibodies from IL-6-/- mice are sufficient to efficiently reduce B. pertussis numbers in the lungs.
Supplementing antibodies is not sufficient to abrogate higher B. pertussis numbers in IL-6-/- mice.
To test whether antibody functions are
impaired in the absence of IL-6, naive or immune
serum from C57BL/6 mice was adoptively transferred
into groups of C57BL/6 or IL-6-/- mice right before B.
pertussis inoculation. These mice, along with control
mice not treated with any serum, were sacrificed 14 or
21 days post-inoculation to enumerate bacterial
Figure 6.6: Immune functions not corrected by numbers in the lungs. Compared to the control mice, supplementing antibodies are improperly regulated in IL-6-/- mice. Group of 3-4 C57BL/6 (black bars) and naïve serum treatment did not have any effect on B. IL-6-/- (white bars) mice were adoptively transferred naïve serum (NS) or immune serum (IS) from C57BL/6 pertussis numbers in the lungs of either type of mouse mice at the time of B. pertussis inoculation. These mice and the control mice not given any serum antibodies (none) were sacrificed on days 14 or 21 post- (Fig. 6.6). Consistent with previous experiments (Fig. inoculation. Bacterial numbers in the lung are expressed as mean Log10CFU ± standard error. The dashed line 6.2), more B. pertussis was recovered from the lungs of indicates the limit of detection. * indicates p ≤ 0.05 and ** indicates p ≤ 0.01 compared to the naïve serum control or naïve serum-treated IL-6-/- mice than treated group. † indicates p ≤ 0.05 and †† indicates p ≤ 0.01 compared to similarly treated wild-type mice. similarly treated C57BL/6 mice on days 14 and 21
121 post-inoculation (Fig. 6.6). On both time points, immune serum treatment reduced B. pertussis numbers in the lungs of both C57BL/6 and IL-6-/- mice by more than 98% as compared to control mice (Fig. 6.6). IL-6
was undetectable in the immune serum from wild-type mice used for adoptive transfer into IL-6-/- mice (data
not shown), suggesting that the antibody-mediated clearance in IL-6-/- mice was not due to transferred IL-6 in the serum. In IL-6-/- mice, adoptively-transferred antibodies reduced B. pertussis numbers proportionately, but the overall bacterial loads were much higher than in C57BL/6 mice, indicating that some immune functions not ameliorated by the addition of antibodies are improperly regulated in these mice.
IL-6 contributes to leukocyte recruitment during B. pertussis infection.
Cellular responses mediated by CD4+ T cells,
but not CD8+ T cells, are critical for protective
immunity against B. pertussis (32, 44). Neutrophils
infiltrate into the site of infection (26, 42) and can take
up and kill B. pertussis (33, 49, 55, 63, 64). Thus, we
hypothesized that IL-6-/- mice are defective in
recruiting these leukocytes to the site of infection. To Figure 6.7: IL-6 contributes to the recruitment of leukocytes into B. pertussis-infected lungs. Total -/- leukocyte, CD4+ T cell, and Ly6G+ neutrophil numbers test this, groups of C57BL/6 and IL-6 mice were in the lungs of groups of 4 C57BL/6 (black) and IL-6-/- (white) mice on day 28 post-B. pertussis- inoculation inoculated with B. pertussis and total leukocytes, are expressed as mean ± standard error. *: p ≤ 0.05. **: p ≤ 0.01. CD4+ T cells and Ly6G+ neutrophils in the lungs were quantified. On day 28 post-inoculation, ~9×105 leukocytes were recovered from lungs of wild-type mice, most of which were CD4+ T cells (Fig. 6.7). Interestingly, despite harboring about 100-fold more B. pertussis in their lungs at this time point (Fig. 6.2), the lungs of IL-6-/- mice contained about 13%, 4%, and 23% as many total leukocytes, CD4+ T cells, and neutrophils, respectively, compared to wild-type mice. The mean number of leukocytes recruited into lungs of IL-6-/- mice was lower than that of wild-type mice on days 3, 7,
14 and 49, despite much higher bacterial numbers at the later time points, though these differences did not reach statistical significance (data not shown). These data suggest that IL-6 is required for efficient recruitment of leukocytes to the lungs during B. pertussis infection.
Dampened systemic cytokine responses in B. pertussis-infected IL-6-/- mice.
122 To examine whether IL-6 contributes to the
generation of B. pertussis-specific T cell responses,
splenocytes were collected from C57BL/6 and IL-6-/-
mice on various days post-B. pertussis-inoculation and
cultured with media or media containing heat-killed B.
pertussis. Incubation in media alone resulted in little
cytokine production on all time points tested (data not
shown). Stimulation with heat-killed B. pertussis
induced similar levels of TNF-α, IL-2, IL-4, IL-5 and
IL-12 production by splenocytes from both C57BL/6
and IL-6-/- (data not shown). Compared to the B.
pertussis-stimulated wild-type splenocytes, splenocytes
from IL-6-/- mice produced significantly less IL-10 on
day 14 and less IFN-γ and GM-CSF on day 28 post-
inoculation (Fig. 6.8A). IL-17 production by IL-6-/-
Figure 6.8: Splenic cytokine production is dampened mice splenocytes was significantly lower on days 3, 28 in B. pertussis-inoculated IL-6-/- mice. Splenocytes from groups of 3-4 C57BL/6 (black) and IL-6-/- (white) and 49 post-inoculation (Fig. 6.8B). The affected mice sacrificed on the indicated days post-B. pertussis- inoculation were exposed to heat-killed B. pertussis for 3 cytokines, IFN-γ, IL-10, GM-CSF, IL-17, are days. The (A) IFN-γ, IL-10, GM-CSF, or (B) IL-17 concentrations in the culture supernatant are expressed as representatives of TH1, Treg, TH1/TH2, and TH17 mean ± standard error. *: p ≤ 0.05. **: p ≤ 0.01. Tania Goel performed experiments shown in Figure 6.8A. cytokine respectively, indicating a generally dampened
T cell response against B. pertussis infection in IL-6-/- mice despite higher bacterial loads in these mice.
123 Discussion
Cytokine regulation has been proposed as pivotal to the immunological switch from innate to adaptive immunity (22). Since its discovery as a factor promoting antibody production, more and more evidence has implicated IL-6 as a regulator of adaptive immune responses, with the exact mechanisms undefined (13). One approach to understand how exactly IL-6 impacts different arms of the adaptive immune responses is to examine the role of this cytokine in the generation of efficient immune responses against various pathogens. Immunity against the human respiratory pathogen, B. pertussis, requires several adaptive immune factors, which makes B. pertussis infection a suitable model to further explore the regulation of adaptive immunity by IL-6. We identified a role for IL-6 in the later stages of B. pertussis infection (after 7 days) (Fig. 6.2) as well as in generating efficient vaccine-induced immunity (Fig. 6.3), suggesting that IL-6 is critical to the generation of effective adaptive immunity against this pathogen.
B. pertussis-specific antibodies are detectable around two week post-inoculation (X. Zhang, S.E.
Hester, M.J. Kennett, E.T. Harvill, submitted for publication) and are required for the control of B. pertussis numbers during later stages of infection (28, 38). Increased bacterial loads in IL-6-/- mice by two weeks post- inoculation (Fig. 6.2) led us to hypothesize a decreased antibody response in these mice. Indeed, IL-6 showed decreased B. pertussis-specific antibody generation (Fig. 6.4). Adoptively transferred immune sera from IL-6-
/- mice were efficient in clearing B. pertussis in B-cell deficient mice (Fig. 6.5), suggesting that these antibodies are sufficient for antibody-mediated clearance and that some other aspects of adaptive immunity might be affected in IL-6-/- mice. Further supporting this, immune sera from wild-type mice supplied in addition to endogenous antibodies generated in response to B. pertussis infection failed to correct the increased bacterial burdens in the IL-6-/- mice. Together, these results suggest that the inefficient control of B. pertussis numbers in IL-6-/- mice is not due solely to decreased antibody generation.
Leukocyte accumulation in the lungs and systemic T cell cytokine responses were decreased in IL-6-/- mice following B. pertussis infection. It is known that cellular immunity mediated by CD4+ T cells is crucial to protective immunity against B. pertussis (32, 44). Furthermore, in vitro assays have indicated efficient killing of phagocytosed B. pertussis by human neutrophils (33). These previously published observations led us to test whether leukocyte accumulation in the lungs of B. pertussis-infected IL-6-/- mice was decreased.
124 We observed decreased neutrophil and CD4+ T cell accumulation in the lungs four weeks post-inoculation
(Fig. 6.7), when the bacterial load was significantly higher in IL-6-/- mice than in wild-type mice (Fig. 6.2).
Not only was the recruitment of T cells decreased, but we also observed a decreased splenic cytokine response (GM-CSF, IFN-γ, IL-10 and IL-17 production) in these mice (Fig. 6.8), indicating an overall
dampening of T cell responses. It has been previously shown that neutrophils and CD4+ T cells are required for clearance of B. pertussis (4, 27, 32). Thus the decreased leukocyte recruitment may contribute to the higher bacterial numbers observed in B. pertussis-infected IL-6-/- mice. The observed decrease in CD4+ T cell accumulation, IFN-γ production and neutrophil recruitment in B. pertussis-infected IL-6-/-mice could be due
to a direct impact of IL-6 deficiency on each of these responses. Alternatively, since there is a CD4+ T cell- dependent increase in IFN-γ levels during B. pertussis infection (4) and IFN-γ is known to contributes to neutrophil recruitment during microbial infections (6, 15, 58), the decreased IFN-γ production and/or neutrophil accumulation may be indirectly affected by IL-6 deficiency.
IL-6 contributes to the generation of B. pertussis-specific IL-17 responses. IL-17 producing TH17 cells are distinct from TH1 or TH2 cells and have been shown to play pathogenic roles in autoimmune diseases
(18, 31, 35, 47). There have been studies establishing a role for IL-17 in host defenses against bacterial pathogens, including K. pneumonia, Bacteroides fragilis and M. tuberculosis (7, 17, 24). Several reports have suggested that B. pertussis infection skews the host immune response towards the expansion of TH17 cells (2,
14). IL-17 has been shown to promote macrophage killing of B. pertussis and depletion of IL-17 reduced the efficacy of a B. pertussis whole cell vaccine (20). Andreasen et al. have recently established the role of a B. pertussis virulence factor, pertussis toxin, in IL-17 induction and the involvement of IL-17 in controlling B. pertussis numbers in the lungs of mice (2). IL-6 has been shown to influence the production of IL-17 (5).
Here we establish that IL-6 is required for efficient induction of systemic IL-17 response during B. pertussis infection (Fig. 6.8B).
IL-6 contributes to host defenses against various pathogens including S. pneumoniae, E. coli, L. monocytogenes, B. burgdorferi, and C. trachomatis (3, 10, 11, 60, 65). Here, we show that efficient clearance of B. pertussis and vaccine-induced immunity against this pathogen are IL-6 dependent (Fig. 6.2 and 6.3).
Blocking IL-6 or its receptor may increase susceptibility to various pathogens, including B. pertussis, which
125 could be a concern for patients with Castleman’s disease and rheumatoid arthritis undergoing the trials of a new anti-IL-6 therapy (53, 69).
126 Authors and Contributions:
Xuqing Zhang1,2,† Tania Goel1,3,4,†, and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, the Pennsylvania State University, 115 Henning
Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, The Pennsylvania State University, University Park
3Department of Biochemistry, Microbiology, and Molecular Biology, The Pennsylvania State
University, University Park
4Graduate Program in Biochemistry, Microbiology and Molecular Biology, The Pennsylvania State
University, University Park
†XZ and TG contributed equally to this work.
Conceived and designed the experiments: XZ, TG, ETH.
Performed the experiments: XZ, TG.
Analyzed the data: XZ, TG.
Wrote the paper: XZ, TG, ETH.
127
References
1. Akira, S., T. Taga, and T. Kishimoto. 1993. Interleukin-6 in biology and medicine. Adv Immunol 54:1-78. 2. Andreasen, C., D. A. Powell, and N. H. Carbonetti. 2009. Pertussis toxin stimulates IL-17 production in response to Bordetella pertussis infection in mice. PLoS One 4:e7079. 3. Anguita, J., M. Rincon, S. Samanta, S. W. Barthold, R. A. Flavell, and E. Fikrig. 1998. Borrelia burgdorferi- infected, interleukin-6-deficient mice have decreased Th2 responses and increased lyme arthritis. J Infect Dis 178:1512-1515. 4. Barnard, A., B.P. Mahon, J. Watkins, K. Redhead, and K.H. Mills. 1996. Th1/Th2 cell dichotomy in acquired immunity to Bordetella pertussis: variables in the in vivo priming and in vitro cytokine detection techniques affect the classification of T-cell subsets as Th1, Th2, or Th0. Immunology 87:372-380. 5. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238. 6. Bonville, C. A., C. M. Percopo, K. D. Dyer, J. Gao, C. Prussin, B. Foster, H. F. Rosenberg, and J. B. Domachowske. 2009. Interferon-gamma coordinates CCL3-mediated neutrophil recruitment in vivo. BMC Immunol 10:14. 7. Chung, D. R., D. L. Kasper, R. J. Panzo, T. Chitnis, M. J. Grusby, M. H. Sayegh, and A. O. Tzianabos. 2003. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J Immunol 170:1958-1963. 8. Clemans, D. L., R. J. Bauer, J. A. Hanson, M. V. Hobbs, J. W. St Geme, 3rd, C. F. Marrs, and J. R. Gilsdorf. 2000. Induction of proinflammatory cytokines from human respiratory epithelial cells after stimulation by nontypeable Haemophilus influenzae. Infect Immun 68:4430-4440. 9. Crowcroft, N. S., C. Stein, P. Duclos, and M. Birmingham. 2003. How best to estimate the global burden of pertussis? Lancet Infect Dis 3:413-418. 10. Dalrymple, S. A., L. A. Lucian, R. Slattery, T. McNeil, D. M. Aud, S. Fuchino, F. Lee, and R. Murray. 1995. Interleukin-6-deficient mice are highly susceptible to Listeria monocytogenes infection: correlation with inefficient neutrophilia. Infect Immun 63:2262-2268. 11. Dalrymple, S. A., R. Slattery, D. M. Aud, M. Krishna, L. A. Lucian, and R. Murray. 1996. Interleukin-6 is required for a protective immune response to systemic Escherichia coli infection. Infect Immun 64:3231-3235. 12. de Melker, H. E., F. G. Versteegh, J. F. Schellekens, P. F. Teunis, and M. Kretzschmar. 2006. The incidence of Bordetella pertussis infections estimated in the population from a combination of serological surveys. J Infect 53:106-113. 13. Dienz, O., and M. Rincon. 2009. The effects of IL-6 on CD4 T cell responses. Clin Immunol 130:27-33. 14. Fedele, G., P. Stefanelli, F. Spensieri, C. Fazio, P. Mastrantonio, and C. M. Ausiello. 2005. Bordetella pertussis- infected human monocyte-derived dendritic cells undergo maturation and induce Th1 polarization and interleukin-23 expression. Infect Immun 73:1590-1597. 15. Gentil, K., and E. Pearlman. 2009. Gamma interferon and interleukin-1 receptor 1 regulate neutrophil recruitment to the corneal stroma in a murine model of Onchocerca volvulus keratitis. Infect Immun 77:1606- 1612. 16. Gilberg, S., E. Njamkepo, I. P. Du Chatelet, H. Partouche, P. Gueirard, C. Ghasarossian, M. Schlumberger, and N. Guiso. 2002. Evidence of Bordetella pertussis infection in adults presenting with persistent cough in a french area with very high whole-cell vaccine coverage. J Infect Dis 186:415-418. 17. Happel, K. I., P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, and J. K. Kolls. 2005. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp Med 202:761-769. 18. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6:1123-1132. 19. Harvill, E. T., Preston, A., Cotter, P.A., Allen, A.G., Maskell, D.J., and Miller, J.F. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 20. Higgins, S. C., A. G. Jarnicki, E. C. Lavelle, and K. H. Mills. 2006. TLR4 mediates vaccine-induced protective cellular immunity to Bordetella pertussis: role of IL-17-producing T cells. J Immunol 177:7980-7989. 21. Hodder, S. L., J. D. Cherry, E. A. Mortimer Jr, A. B. Ford, J. Gornbein, and K. Papp. 2000. Antibody responses to Bordetella pertussis antigens and clinical correlations in elderly community residents. Clin Infect Dis 31:7- 14. 22. Hoebe, K., E. Janssen, and B. Beutler. 2004. The interface between innate and adaptive immunity. Nat Immunol 5:971-974.
128 23. Jones, S. A. 2005. Directing transition from innate to acquired immunity: defining a role for IL-6. J Immunol 175:3463-3468. 24. Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper. 2005. IL-23 compensates for the absence of IL-12p70 and is essential for the IL- 17 response during tuberculosis but is dispensable for protection and antigen-specific IFN-gamma responses if IL-12p70 is available. J Immunol 175:788-795. 25. Khair, O. A., J. L. Devalia, M. M. Abdelaziz, R. J. Sapsford, and R. J. Davies. 1995. Effect of erythromycin on Haemophilus influenzae endotoxin-induced release of IL-6, IL-8 and sICAM-1 by cultured human bronchial epithelial cells. Eur Respir J 8:1451-1457. 26. Khelef, N., C. M. Bachelet, B. B. Vargaftig, and N. Guiso. 1994. Characterization of murine lung inflammation after infection with parental Bordetella pertussis and mutants deficient in adhesins or toxins. Infect Immun 62:2893-2900. 27. Kirimanjeswara, G. S., Agosto, L.M., Kennet, M.J., Bjornstad, O.N., and Harvill, E.T. 2005. Pertussis toxin inhibits neutrophil recruitment to inhibit antibody-mediated clearance of Bordetella pertussis. J Clin Invest. 28. Kirimanjeswara, G. S., Mann, P.B., and Harvill, E.T. 2003. Role of antibodies in immunity to Bordetella infections. Infect Immun 71:1719-1724. 29. Kube, D., U. Sontich, D. Fletcher, and P. B. Davis. 2001. Proinflammatory cytokine responses to P. aeruginosa infection in human airway epithelial cell lines. Am J Physiol Lung Cell Mol Physiol 280:L493-502. 30. Ladel, C. H., C. Blum, A. Dreher, K. Reifenberg, M. Kopf, and S. H. Kaufmann. 1997. Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect Immun 65:4843-4849. 31. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, and D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201:233-240. 32. Leef, M., K. L. Elkins, J. Barbic, and R. D. Shahin. 2000. Protective immunity to Bordetella pertussis requires both B cells and CD4(+) T cells for key functions other than specific antibody production. J Exp Med 191:1841-1852. 33. Lenz, D. H., C. L. Weingart, and A. A. Weiss. 2000. Phagocytosed Bordetella pertussis fails to survive in human neutrophils. Infect Immun 68:956-959. 34. Lipsky, P. E. 2006. Interleukin-6 and rheumatic diseases. Arthritis Res Ther 8 Suppl 2:S4. 35. Lubberts, E. 2003. The role of IL-17 and family members in the pathogenesis of arthritis. Curr Opin Investig Drugs 4:572-577. 36. Mahon, B. P., and K. H. Mills. 1999. Interferon-gamma mediated immune effector mechanisms against Bordetella pertussis. Immunol Lett 68:213-217. 37. Mahon, B. P., M. S. Ryan, F. Griffin, and K. H. Mills. 1996. Interleukin-12 is produced by macrophages in response to live or killed Bordetella pertussis and enhances the efficacy of an acellular pertussis vaccine by promoting induction of Th1 cells. Infect Immun 64:5295-5301. 38. Mahon, B. P., B. J. Sheahan, F. Griffin, G. Murphy, and K. H. Mills. 1997. Atypical disease after Bordetella pertussis respiratory infection of mice with targeted disruptions of interferon-gamma receptor or immunoglobulin mu chain genes. J Exp Med 186:1843-1851. 39. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infect Immun 75:3665-3672. 40. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 41. Mattoo S, C. J. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326-382. 42. McGuirk, P., B. P. Mahon, F. Griffin, and K. H. Mills. 1998. Compartmentalization of T cell responses following respiratory infection with Bordetella pertussis: hyporesponsiveness of lung T cells is associated with modulated expression of the co-stimulatory molecule CD28. Eur J Immunol 28:153-163. 43. Mills, K. H. 2001. Immunity to Bordetella pertussis. Microbes Infect 3:655-677. 44. Mills, K. H., A. Barnard, J. Watkins, and K. Redhead. 1993. Cell-mediated immunity to Bordetella pertussis: role of Th1 cells in bacterial clearance in a murine respiratory infection model. Infect Immun 61:399-410. 45. Mills, K. H., M. Ryan, E. Ryan, and B. P. Mahon. 1998. A murine model in which protection correlates with pertussis vaccine efficacy in children reveals complementary roles for humoral and cell-mediated immunity in protection against Bordetella pertussis. Infect Immun 66:594-602. 46. Mizutani, H., L. T. May, P. B. Sehgal, and T. S. Kupper. 1989. Synergistic interactions of IL-1 and IL-6 in T cell activation. Mitogen but not antigen receptor-induced proliferation of a cloned T helper cell line is enhanced by exogenous IL-6. J Immunol 143:896-901.
129 47. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, and C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6:1133-1141. 48. Pilione MR, H. E. 2006. The Bordetella bronchiseptica type III secretion system inhibits gamma interferon production that is required for efficient antibody-mediated bacterial clearance. Infect Immun 74:1043-1049. 49. Rodriguez, M. E., S. M. Hellwig, D. F. Hozbor, J. Leusen, W. L. van der Pol, and J. G. van de Winkel. 2001. Fc receptor-mediated immunity against Bordetella pertussis. J Immunol 167:6545-6551. 50. Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, C. Toniatti, P. Puccetti, F. Bistoni, and V. Poli. 1996. Impaired neutrophil response and CD4+ T helper cell 1 development in interleukin 6-deficient mice infected with Candida albicans. J Exp Med 183:1345-1355. 51. Romano, M., M. Sironi, C. Toniatti, N. Polentarutti, P. Fruscella, P. Ghezzi, R. Faggioni, W. Luini, V. van Hinsbergh, S. Sozzani, F. Bussolino, V. Poli, G. Ciliberto, and A. Mantovani. 1997. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity 6:315-325. 52. Skowronski, D. M., G. De Serres, D. MacDonald, W. Wu, C. Shaw, J. Macnabb, S. Champagne, D. M. Patrick, and S. A. Halperin. 2002. The changing age and seasonal profile of pertussis in Canada. J Infect Dis 185:1448- 1453. 53. Smolen, J. S., A. Beaulieu, A. Rubbert-Roth, C. Ramos-Remus, J. Rovensky, E. Alecock, T. Woodworth, and R. Alten. 2008. Effect of interleukin-6 receptor inhibition with tocilizumab in patients with rheumatoid arthritis (OPTION study): a double-blind, placebo-controlled, randomised trial. Lancet 371:987-997. 54. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220. 55. Steed, L. L., E. T. Akporiaye, and R. L. Friedman. 1992. Bordetella pertussis induces respiratory burst activity in human polymorphonuclear leukocytes. Infect Immun 60:2101-2105. 56. Stibitz, S., and M. S. Yang. 1991. Subcellular localization and immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J Bacteriol 173:4288-4296. 57. Suematsu, S., T. Matsuda, K. Aozasa, S. Akira, N. Nakano, S. Ohno, J. Miyazaki, K. Yamamura, T. Hirano, and T. Kishimoto. 1989. IgG1 plasmacytosis in interleukin 6 transgenic mice. Proc Natl Acad Sci U S A 86:7547-7551. 58. Sun, K., S. L. Salmon, S. A. Lotz, and D. W. Metzger. 2007. Interleukin-12 promotes gamma interferon- dependent neutrophil recruitment in the lung and improves protection against respiratory Streptococcus pneumoniae infection. Infect Immun 75:1196-1202. 59. Sutherland, R. E., J. S. Olsen, A. McKinstry, S. A. Villalta, and P. J. Wolters. 2008. Mast cell IL-6 improves survival from Klebsiella pneumonia and sepsis by enhancing neutrophil killing. J Immunol 181:5598-5605. 60. van der Poll, T., C. V. Keogh, X. Guirao, W. A. Buurman, M. Kopf, and S. F. Lowry. 1997. Interleukin-6 gene- deficient mice show impaired defense against pneumococcal pneumonia. J Infect Dis 176:439-444. 61. Van Snick, J. 1990. Interleukin-6: an overview. Annu Rev Immunol 8:253-278. 62. von Konig, C. H., S. Halperin, M. Riffelmann, and N. Guiso. 2002. Pertussis of adults and infants. Lancet Infect Dis 2:744-750. 63. Weingart, C. L., G. Broitman-Maduro, G. Dean, S. Newman, M. Peppler, and A. A. Weiss. 1999. Fluorescent labels influence phagocytosis of Bordetella pertussis by human neutrophils. Infect Immun 67:4264-4267. 64. Weingart, C. L., and A. A. Weiss. 2000. Bordetella pertussis virulence factors affect phagocytosis by human neutrophils. Infect Immun 68:1735-1739. 65. Williams, D. M., B. G. Grubbs, T. Darville, K. Kelly, and R. G. Rank. 1998. A role for interleukin-6 in host defense against murine Chlamydia trachomatis infection. Infect Immun 66:4564-4567. 66. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 67. Wolfe, D. N., G. S. Kirimanjeswara, and E. T. Harvill. 2005. Clearance of Bordetella parapertussis from the lower respiratory tract requires humoral and cellular immunity. Infect Immun 73:6508-6513. 68. Wolfe, D. N., P. B. Mann, A. M. Buboltz, and E. T. Harvill. 2007. Delayed role of tumor necrosis factor- alpha in overcoming the effects of pertussis toxin. J Infect Dis 196:1228-1236. 69. Yoshio-Hoshino, N., Y. Adachi, C. Aoki, A. Pereboev, D. T. Curiel, and N. Nishimoto. 2007. Establishment of a new interleukin-6 (IL-6) receptor inhibitor applicable to the gene therapy for IL-6-dependent tumor. Cancer Res 67:871-875. 70. Zhang, X., M. E. Rodriguez, and E. T. Harvill. 2009. O antigen allows B. parapertussis to evade B. pertussis vaccine-induced immunity by blocking binding and functions of cross-reactive antibodies. PLoS One 4:e6989.
130
Chapter 7
SigE Facilitate the Adaptation of B. bronchiseptica to Stress Conditions and
Sepsis in Mice
Abstract
The extracytoplasmic function (ECF) sigma factor, σE, is involved in stress response and virulence in a variety of bacteria species, but its role in the respiratory pathogen, Bordetella bronchiseptica, has not been investigated. An in-frame deletion mutant of sigE in the B. bronchiseptica strain RB50 is defective in growth under heat or ethanol stress, thermotolerance, and resistance to cell envelope perturbations posed by detergent or β-lactam antibiotics. Although a sigE-deficient strain colonizes immunocompetent mice and causes lethal infection in TLR4def or TNF-α-/- mice as efficiently as its wild-type counterpart, it is defective in causing systemic and lethal infection in RAG-/- mice (lacking B-cells and T-cells). Deletion of sigE did not affect sensitivity to complement-mediated killing, but it did lead to decreased expression of some type three secretion system (TTSS) genes and decreased cytotoxicity to macrophages. This study extends the knowledge of how a transcription regulatory system other than the BvgAS system affects B. bronchiseptica physiology and pathogenesis.
131 Introduction
The cell envelope of gram-negative bacteria is a dynamic, strictly regulated and multifunctional cellular compartment. It keeps the cell intact, acts as a barrier against extracellular hazards and is involved in processes such as nutrient transport, energy production and biosynthesis of cell surface molecules. Changing environmental conditions are sensed at the cell envelope, and signals are transduced across the envelope via intercompartmental signaling mechanisms, so that gene expression can be altered accordingly. One such signaling system is the two-component signal transduction system, composed of a transmembrane sensor kinase and a DNA-binding response regulator. Another signaling system is the extracytoplasmic function
(ECF) family of alternative sigma factors, which regulate gene expression in response to extracytoplasmic stress by binding to core RNA polymerase and conferring different promoter specificities.
σE is an ECF sigma factor present in many gram-negative bacteria that may play critical and distinct roles in different species (39, 46). In Escherichia coli, the gene rpoE encodes σE, which is regulated in response to misfolded outer membrane proteins; it is essential for cell envelope maintenance and bacterial survival (21,
38). Pathogenic bacteria that colonize hosts also contend with the additional stress imposed by a host immune system, and σE is often important in response to such stress. For example, Mycobacterium tuberculosis lacking σE is more sensitive to heat shock, detergent, oxidative stress and macrophage-mediated killing than wild-type (33). σE of Salmonella typhimurium is required for growth and survival in the presence of antimicrobial peptides, oxidative and acid stress, as well as survival and proliferation in epithelial and macrophage cell lines (23, 40). σE is important for growth of Vibrio cholerae under ethanol stress and contributes to host colonization for both V. cholerae and S. typhimurium (23, 29). Expression of σE in nontypeable Haemophilus influenza (NTHi) is increased following phagocytosis by macrophages and σE is required for intracellular survival of this bacterium (10). Together these studies suggest that σE is responsive to various signals in different organisms.
Bordetella bronchiseptica is a pathogen that is closely-related to B. pertussis and B. parapertussis, the causative agents of whooping cough in humans (3, 43). B. bronchiseptica causes a range of diseases from asymptomatic infection to fatal pneumonia in a wide range of mammals (17, 37, 41). It is the etiological agent of atrophic rhinitis in swine, kennel cough in dogs and snuffles in rabbits (17, 37). In addition,
132 infections established by B. bronchiseptica are typically chronic, asymptomatic, and difficult to completely eradicate (17). B. bronchiseptica is capable of surviving harsh conditions, suggesting that it may exist outside mammalian hosts (15, 44). Therefore, it is likely that B. bronchiseptica flexibly regulates expression of sets of genes in response to various conditions. Relative to its genome size, B. bronchiseptica has a large number of putative transcription factors (32). One well-studied example of this is BvgAS, a two-component system that regulates virulence factor expression. In contrast to BvgAS, the role of other transcription factors in stress responses and pathogenesis has not been fully examined.
B. bronchiseptica genome encodes an E. coli σE ortholog, SigE. In fact, we have shown that B. bronchiseptica SigE actively directs transcription of the E. coli σE-dependent promoter rpoHP3 in vitro and in
E E. coli, indicating that SigEBb can function as a σ -like sigma factor. To investigate the role of SigE in B. bronchiseptica, an in-frame sigE deletion mutant was constructed using a Bordetella-specific allelic exchange strategy. The resulting strain was viable with no growth defect under non-stress conditions compared to the wild-type strain. Growth of the sigE mutant strain in various stress conditions also showed that SigE contributes to the growth of B. bronchiseptica under ethanol and heat stress and resistance to agents that affect cell envelope integrity such as detergent and β-lactam antibiotics. Although B. bronchiseptica SigE was not required for colonization in immunocompetent hosts and causing lethal diseases in hosts deficient in
TLR4 or TNF-α, SigE was required for lethal infection and systemic spread of B. bronchiseptica in RAG-/- mice. Together, these data indicate that SigE contributes to the ability of B. bronchiseptica to cope with certain stressful conditions and to colonize systemic organs in hosts lacking adaptive immunity.
133 Material and Methods
Bacterial strains and growth. Experiments were performed using the previously described B. bronchiseptica strain RB50 (9), an isogenic mutant lacking O-antigen, RB50Δwbm (45), a TTSS mutant of
RB50 lacking bscN (WD3) (58), B. bronchiseptica strain AVS lacking TTSS and adenylate cyclase toxin (34) and an isogenic mutant lacking sigE, RB50ΔsigE, which was constructed in this study and is described below.
Bacteria were maintained on Bordet-Gengou agar (Difco) containing 10% defibrinated sheep blood (Hema
Resources) and 20μg/mL streptomycin. For growth under ethanol stress, mid-log-phase cultures were sub- cultured into fresh Stainer-Scholte broth (51) with or without 3% ethanol and incubated at 37oC in a gyratory water bath unless otherwise noted. Unless otherwise noted, culture density was monitored by measuring
OD600 and viability was monitored by measuring CFU/mL.
Protein purification. The plasmid pXQZ001 was constructed by PCR amplifying sigE from RB50 genomic
DNA (5’GGCCTGGCATATGaGCGAACGCGATGTCGA3’,
5’GGCCTAGGATCCTTACCAGCGACGCTCGGCAT3’) and cloning it into the expression vector pET-15b
(Novagen). N-terminally His-tagged B. bronchiseptica SigE and E. coli σE were purified from strain
BL21(DE3) slyD::kan pLysS pXQZ001, and BL21(DE3) slyD::kan pLysS pSEA5036, respectively, as previously described (8). Briefly, cells were grown at 25°C to an OD600 of 0.5, at which point IPTG was added to induce protein production. Following 1.5-3 hours of induction, cells were harvested by centrifugation and resuspended in lysis buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole,
2.5 mM β-mercaptoethanol, 1 mM PMSF). Resuspended cells were then lysed by sonication and the lysate was cleared by centrifugation. The supernatant containing soluble His-SigE was loaded onto a Ni-NTA column (Qiagen). Bound proteins were eluted with a stepwise gradient of 20, 60, 100, and 200 mM imidazole in column buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 2.5 mM β –mercaptoethanol). Fractions containing SigE were pooled and dialyzed into 20 mM Tris-HCl pH 8.0, 50 mM NaCl, and 2.5 mM β- mercaptoethanol.
Run-off in vitro transcription. 100 nM E. coli core RNA polymerase (RNAP) (Epicentre) was incubated with 500 nM His-SigE (His-SigE+RNAP), His-σE (His-σE+RNAP), or the appropriate volume of transcription
-1 buffer (40 mM Tris-HCl pH 8.0, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT, 0.1 mg ml BSA) for 10 minutes
134 at 30°C to form holoenzyme. Multi-round transcription reactions were initiated by addition of His-SigE alone, core RNAP alone, His-SigE+RNAP or His-σE+RNAP, to a final concentration of 50 nM SigE or σE and 10 nM core RNAP, to pre-warmed (30 °C) transcription mix containing 5.0 nM supercoiled plasmid template pSEB015(8), 5% glycerol, 200 µM ATP, 200 µM CTP, 200 µM GTP, 10 µM UTP, and 2.5 µCi [α-
32P]UTP in transcription buffer. After 10 minutes at 30 °C, reactions were stopped by the addition of stop solution (80% formamide, 20 mM EDTA, 0.1% xylene cyanol, and 0.1% bromophenol blue). Samples were electrophoresed on 6% polyacrylamide gels containing 7.5 M urea, and visualized by phosphorimaging.
Construction of RB50ΔsigE strain. A left-flanking PCR product
(5’GGGAATTCAAGATCGAGATCGGCCTGTCGAAT3’,
5’AGGGATCCGAAGGCTTTCTTGTCGCCACGTTGTA3’) with 637bp proximal to the sigE gene and a non-overlapping 534bp right-flanking product (5’AGGGATCCTGGTAAGGAGTGGCAGTCATGCAA3’,
5’GCGAATTCAAAGCAACGGTGTCATCAACGTCC3’) were amplified from B. bronchiseptica RB50 genomic DNA with EcoRΙ and BamHΙ sites overhanging on the 5’, 3’ and 3’, 5’, respectively. The two flanking fragments were digested with BamHΙ and ligated. The resulting construct was PCR-amplified
(5’GGGAATTCAAGATCGAGATCGGCCTGTCGAAT 3’,
5’GCGAATTCAAAGCAACGGTGTCATCAACGTCC3’), cloned into TopoTA vector (Invitrogen) and verified by sequencing. The deletion construct was then cloned into the EcoRΙ site of pSS3962 allelic exchange vector (Stibitz S. unpublished data), resulting in the deletion of the 528bp central region of sigE with only 66bp of the 5’end and 6bp of the 3’end of the sigE gene remaining in place. Tri-parental mating with wild-type B. bronchiseptica strain RB50, E. coli strain DH5α harboring the pSS3962ΔsigE vector, and
DH5α harboring the helper plasmid pSS1827 (53) was performed under modulating conditions (with 50mM
MgSO4) and incubated on modulating plates containing 100µg/mL kanamycin and 60µg/mL streptomycin to select for the integration of pSS3962ΔsigE into RB50 chromosome. Bordetella colonies on modulating plates were streaked onto plates without MgSO4 to activate the pertussis toxin (Ptx) promoter on the vector which drives the expression of the endonuclease SceΙ. This resulted in the cutting of the SceΙ site on the vector and approximately 50% of the resultant colonies on these plates had the wild-type sigE gene deleted from the chromosome by homologous recombination. The deletion strain was verified by colony PCR
135 (5’GGGAATTCAAGATCGAGATCGGCCTGTCGAAT3’,
5’GCGAATTCAAAGCAACGGTGTCATCAACGTCC3’) and Southern blot analysis.
Cloning of sigE for complementation. Cholramphenicol resistance gene, cat, was PCR amplified
(5’GCGGCGGGATCCTGTGTAAGGCTGGAGCTGCTTC3’,
5’GCCGCCGGATCCCATATGAATATCCTCCTTA3’) from pKD3 (12) with BamHΙ sites overhanging on both 5’ and 3’ sites. This amplicon was blunt cloned into the BamHΙ cite of pJS72 [a kind gift from Dr.
Kenneth Keiler, a pJS71 (50) derivative with tac promoter] to replace the omega spectinomycin cassette, a plasmid with tac promoter, resulting in cholramphenicol resistant pSEB025 (pEV). The sigE gene was PCR amplified (5’GCGCGGTCTAGAAGGAGGAGGCGTCATGAGCGAACGCGATG3’,
5’GCCCGGCTCGAGTTACCAGCGACGCTCGGCAT3’) from RB50 genomic DNA with XbaΙ and XhoΙ site overhanging on the 5’ and 3’, respectively. The amplicon was cloned into the XbaΙ and XhoΙ site of pEV, resulting in pSEB026 (pSigE). In this construct, the sigE gene was expressed from the tac promoter of pSigE.
Tri-parental mating with RB50∆sigE, E. coli strain DH5α harboring the pEV or pSigE, and DH5α harboring the helper plasmid pSS1827 (53) was performed on Bordet-Gengou plates, and incubated on Bordet-Gengou plates containing 20µg/mL cholramphenicol and 20µg/mL streptomycin to select for RB50∆sigE that maintained pEV or pSigE. The resulting strains were designated RB50∆sigEpEV and RB50∆sigEpSigE.
Disk diffusion assay. Mid-log-phase B. bronchiseptica cultures were diluted to 6×108 CFU/mL to generate a lawn of bacteria on Stainer-Scholte agar plates. Disks containing 300 iu Polymyxin B, 10 µg ampicillin (BD
Diagnostics), 100 µg mecillinam (Leo Pharmaceutical Products) or 75 mg/mL sodium dodecyl sulfate (SDS) and 1 mM EDTA were applied to the plates and the zone of inhibition was measured after overnight incubation at 37°C.
Complement killing assay. Complement killing assays were performed as previously described (16).
Briefly, blood freshly collected from C57BL/6 mice was pooled, incubated at 4°C for 1 hour and centrifuged at 2000g for 10min. The serum was collected and diluted 1:5 in phosphate buffered saline (PBS).
Complement-inactive serum was prepared by heating an aliquot of the diluted sample at 56°C for 30 min.
From mid-log-phase cultures, approximately 500 CFU of RB50, RB50ΔsigE and RB50Δwbm in 5 µl of PBS
136 were incubated with 45 µl of diluted serum or PBS for 1 hour at 37°C. Bacterial numbers before and after incubation were determined by plating and CFU counts. Each strain was run in triplicate. qRT-PCR. For RNA isolation, 3 independent biological replicates of RB50 and RB50ΔsigE were grown in
Stainer-Scholte media containing 1.5% ethanol at 37°C while shaking until the OD of B. bronchiseptica cultures reached 0.5. Another set of 3 independent biological replicates of RB50ΔsigE were cultured until they reached OD 0.5 (at later time). Bacteria were harvested and total RNA was extracted using RNeasy columns (Qiagen) as per the manufacturers’ instructions with the treatment with RNase-free DNase І
(Invitrogen). Quantitative real-time PCR (qRT-PCR) was completed as previously described (42). 1 µg RNA from each biological replicate was reverse transcribed using 500 ng of random oligonucleotide hexamers
(Invitrogen) and ImProm-II™ Reverse Transcriptase (Promega). The resulting cDNA was diluted 1:100 and
1 µL was used in qRT-PCRs containing 800 nM primers designed with Primer Express software (Applied
Biosystems) and 2×SYBR Green PCR master mix (Invitrogen). Primer sequences are listed in the supplemental material (Appendix A). To confirm the lack of DNA contamination, reactions without reverse transcriptase were performed. Dissociation curve analysis was performed for verification of product homogeneity. Threshold fluorescence was established within the geometric phase of exponential amplification, and the cycle threshold (Cr) was determined for each reaction. The Cr from all biological replicates for each strain under the same treatment was compiled, and the 16S RNA amplicon was used as internal control for data normalization. The fold change in transcript level was determined using the relative quantitative method (∆∆Cr) (31).
Cytotoxicity assay. Cytotoxicity assays were performed as previously described (19). Briefly, J774 murine macrophage cells, were cultured in Dulbecco modified Eagle medium (DMEM) (HyClone) with 10% fetal bovine serum (FBS) (HyClone). The cells were grown to 80% confluency in 96-well plates at 37C in 5%
CO2. Cells were washed with RPMI (Mediatech) containing 5% FBS and bacteria were added in 50 L
RPMI at a multiplicity of infection (MOI) of 15. After a 5 minute centrifugation at 250g, the J774 cells were incubated for the indicated time. The percent lactate dehydrogenase (LDH) release, a measure of cytotoxicity, was determined by using Cytotox96 Kit (Promega) according to the manufacturer’s protocol.
137 Animal experiments. C57BL/6, TNF-α-/-, RAG1-/- (RAG-/-), C3H/HEN (TLRsuf) and C3H/HEJ (TLRdef) mice were obtained from Jackson laboratories. All mice were bred in our Bordetella-free, specific pathogen-free breeding rooms at The Pennsylvania State University. For inoculation, mice were sedated with 5% isoflurane
(Abbott laboratory) in oxygen and 50 μL of PBS containing 1×105 or 5×105 CFU of the indicated bacteria was pipeted onto the external nares (27). This method reliably distributes the bacteria throughout the respiratory tract (20). Survival curves were generated by inoculating TLRdef, TNF-α-/- and RAG-/- mice with either RB50 or RB50ΔsigE. Mice suffering from lethal bordetellosis as determined by severe hunched posture, ruffled fur, extremely labored breathing and apathy were euthanized to prevent unnecessary suffering (36). For quantifying bacterial load, mice were euthanized via CO2 inhalation and lung, trachea, nasal cavity, spleen, liver and/or kidneys were excised. Tissues were homogenized in PBS, aliquots were serially diluted, plated, incubated at 37°C for 2 to 3 days, and CFU was determined. All protocols were reviewed by the university
IACUC and all animals were handled in accordance with institutional guidelines.
Statistical analysis. The mean +/- standard error (SE) of the geometric mean was determined for all appropriate data and expressed as error bars. Two-tailed, unpaired Student’s T-tests were used to determine statistical significance between groups. All experiments were performed at least twice with similar results.
138 Results sigE encodes a σE-like sigma factor
B. bronchiseptica SigE and E. coli σE share
54% amino acid sequence identity and 73% similarity
when aligned using NEEDLE (EMBL-EBI),
suggesting that these two proteins may share a similar
function. For comparison, P. aeruginosa AlgU and E.
coli σE, which are functionally homologous (57), share
65% identity and 80 % similarity when aligned using
this algorithm. To determine whether SigE is a σE-like
sigma factor, we purified N-terminally His-tagged
SigE, and assayed it for activity at the E. coli σE-
E Figure 7.1: B. bronchiseptica SigE is an E. coli σ -like dependent promoter, rpoHP3, using run-off in vitro sigma factor. (A) Amino acid sequence alignment of E E B. bronchiseptica SigE (SigEBb) and E. coli σ (σ Ec) transcription assays. B. bronchiseptica His-SigE can using NEEDLE (EMBL-EBI). (B) Multi-round Run-off in vitro transcription from a supercoil plasmid template containing an E. coli σE-dependent promoter, rpoHP3, direct transcription of rpoHP3 similarly to E. coli His- with E. coli core RNA polymerase (Core RNAP) (Lane E 1), His-SigEBb (Lanes 3), E. coli core RNA polymerase σ (Fig. 7.1). E bound to His-σ Ec (Lanes 3) and E. coli core RNA E polymerase bound to His-SigEBb (Lane 4). Sarah E. In E. coli, the gene encoding σ , rpoE, is Barchinger performed this experiment. essential. However, plasmid-encoded B. bronchiseptica SigE allows the cells to live in the absence of rpoE (data not shown). This further supports that sigE encodes a sigma factor functionally homologous to E. coli σE.
Deletion of sigE from B. bronchiseptica
To investigate the role of B. bronchiseptica SigE, we first constructed an in-frame sigE deletion strain of B. bronchiseptica strain RB50 (RB50ΔsigE). 176 out of 200 codons were deleted in-frame leaving 22 and
2 codons at the 5’ and 3’ ends of the gene, respectively (Fig. 7.2 and Materials and Methods). Unlike in E. coli or Yersinia enterocolitica, but the same as in many other bacterial pathogens, deletion of sigE was not lethal in B. bronchiseptica (10, 14, 22, 29, 33, 54). RB50ΔsigE has no growth defect compared to RB50 under optimal, non-stress growth conditions: 37°C in Stainer-Scholte broth (Fig. 7.3B).
139
Figure 7.2: Construction of a SigE-deficient strain of B. bronchiseptica. Schematic representation of construction of strain RB50ΔsigE.
SigE contributes to B. bronchiseptica stress response
Heat shock
In E. coli, the P3 promoter of rpoH (rpoHP3), encoding σ32, the heat shock sigma factor, is regulated by σE, when the cells are exposed to particularly high temperatures (1, 7). We have shown that B. bronchiseptica SigE directs transcription from E. coli rpoHP3 (Fig. 7.1B). The promoter region of the gene encoding B. bronchiseptica σ32, fam, is highly similar to the known E. coli σE-dependent promoters and B. bronchiseptica SigE can direct transcription of fam (data not shown) (46). We therefore predicted a role for
SigE in response to high temperature. To examine this, RB50 and RB50ΔsigE were grown in a shaking water bath at 37oC, and then shifted to 50oC, a lethal temperature for B. bronchiseptica. Cell viability was measured for three hours after shifting to 50oC. RB50ΔsigE died more quickly than RB50 (Fig. 7.3A), suggesting that
SigE contributes to heat shock response.
Inducing a heat shock response at an elevated, sublethal temperature, such as 40oC, allows cells to accumulate heat shock proteins, and prepares them to better survive a lethal temperature (47). To investigate the role of SigE in this phenomenon, known as thermotolerance, RB50 and RB50ΔsigE were diluted from
o o overnight cultures into fresh media, grown to an OD600 of 0.1 at 37 C, shifted to 40 C for 90 minutes, then
140 shifted to 50oC, and cell viability was measured. Wild-type RB50 became thermotolerant after this treatment and CFU numbers had not been reduced by 2h incubation at 50oC (Fig. 7.3A). Similarly to the previous experiment, RB50ΔsigE died more quickly than RB50 after the shift to 50oC, providing further evidence that sigE is required for survival at a lethal temperature and that SigE contributes to thermotolerance. While overall survival at 50oC was lower in cells lacking sigE, RB50ΔsigE adapted at 40oC survived better than
RB50ΔsigE shifted directly from 37oC to 50oC,
indicating that RB50ΔsigE does still exhibit some
thermotolerance.
Figure 7.3: Role of SigE in various environmental stress. (A) RB50 (square) and RB50ΔsigE (triangle) were subcultured to 107CFU/mL in fresh Stainer-Scholte media. o All cultures were incubated at 37 C to an OD600 of 0.1. Half of the cultures were shifted to 40oC (dashed line), while the other half remained at 37oC (solid line). After 90 minutes, all cultures were shifted to 50oC, and cell viability was measured by CFU/mL after further culturing for 0, 1, 2, or 3 hours. The mean CFU ± SE of three independent experiments was shown. (B) RB50 (square), RB50ΔsigE (triangle) were sub-cultured to an OD600 around 0.01 in fresh Stainer-Scholte media with (dashed line) or without (solid line) 3% ethanol. RB50ΔsigEpEV (circle) or RB50ΔsigEpSigE (open diamond) were sub-cultured to an OD600 around 0.01 in fresh Stainer-Scholte media with 3% ethanol. 1mM IPTG was added to a separate culture of RB50ΔsigEpSigE (closed diamond) at the time of sub- culturing. Cell growth was measured by OD600. A representative dataset of three independent experiments was shown. (C) RB50 (black) or RB50ΔsigE (white) was diluted to 6×108 CFU/mL to generate a lawn of bacteria on Stainer-Scholte agar plates with disks containing 300 iu Polymyxin B, 10 µg ampicillin, 100 µg mecillinam or 75 mg/mL SDS and 1mM EDTA placed on them and incubated overnight at 37°C. Average of diameters of zone of inhibition from 3-7 independent experiments was shown. *: P≤0.05; **: P≤0.01. Sarah E. Barchinger performed this experiment. Ethanol Stress
Ethanol stress is also known to induce expression of heat shock proteins, and the V. cholerae σE ortholog is required for survival during ethanol stress (29). To test the role of SigE in response to ethanol stress, RB50 and RB50ΔsigE were sub-cultured from mid-log-phase overnight cultures into fresh Stainer-
Scholte broth with or without 3% ethanol. Both strains grew similarly in the media without ethanol, as noted above. RB50 grew significantly slower in media containing 3% ethanol than in media without ethanol, but its
141 cell density continued to increase throughout the course of the growth curve, ultimately reaching a final density similar to that of cells grown in media without ethanol (Fig. 7.3B, data not shown). The cell density of RB50ΔsigE, however, never surpassed an OD600 of about 0.1, even after 24 hours, and the number of viable cells decreased consistently after 5h of incubation, indicating that sigE is required for survival during ethanol stress (Fig. 7.3B, data not shown). Adding back a copy of sigE on a plasmid under the control of an
IPTG-inducible promoter (RB50∆sigEpSigE) restores cell growth in 3% ethanol to wild-type levels only in the presence of IPTG, indicating that the original phenotype is indeed specifically due to loss of SigE activity.
Specific Cell Envelope Stress
σE contributes to cell envelope stress responses in many bacterial species (21, 48). To test whether
SigE of B. bronchiseptica aids in combating stress in the presence of agents affecting cell envelope integrity, we performed disk diffusion assays comparing the sensitivity of RB50 and RB50ΔsigE to the β-lactam antibiotic ampicillin, which inhibits proper formation of the peptidoglycan layer (25), mecillinam, which binds specifically penicillin binding protein 2 and blocks cell elongation (24), 7.5% SDS + 0.1mM EDTA, which affects outer membrane integrity (30, 55), or the cationic antimicrobial peptide polymyxin B, which specifically attacks the cytoplasmic membrane (18, 23, 49), using either 0.1mM EDTA or water as a control.
Neither strain was susceptible to water or EDTA alone. Unlike in S. typhimurium, where σE is required for resistance to polymyxin B, both RB50 and RB50ΔsigE exhibited similar sensitivity to this treatment (Fig.
7.3D). However, RB50ΔsigE was significantly more sensitive than RB50 to ampicillin, mecillinam and
SDS+0.1mM EDTA (Fig. 7.3C).
Both RB50 and RB50ΔsigE were equally sensitive to osmotic stress, another indicator of membrane integrity (28). Both strains also showed similar sensitivity to non-β-lactam antibiotics, and grew similarly when cultured in the presence of agents that induce oxidative stress, such as hydrogen peroxide or paraquat
(Appendix B). All together, these data suggest a role for SigE in combating cell envelope stress.
Growth in the murine respiratory tract is not affected by the lack of SigE
Bacteria encounter different sets of microbicidal hazards inside of a host. It has been shown that σE- like sigma factors of various pathogens contribute to virulence in mice (2, 23, 29). To determine whether
SigE contributes to colonization and persistence in the hosts, groups of C57BL/6 mice were inoculated with
142 RB50 or RB50ΔsigE, and colonization was measured
in the nasal cavity, trachea and lung on days 0, 3, 7, 14,
28 and 63 post-inoculation. Both strains showed
similar colonization kinetics in the lung and trachea of
C57BL/6 mice, peaking in numbers on days 3 and 7
post-inoculation in trachea and lung, respectively, and
declining thereafter with complete clearance in both
organs being observed by day 63 post- inoculation (Fig.
7.4). Both wild-type and sigE-deficient RB50 also
colonized the nasal cavity at comparable levels,
peaking on day 3 post-inoculation, and stabilizing at
about 104-5 CFU by 2 weeks post-inoculation. These
data indicate that B. bronchiseptica SigE is not required
for colonization or persistence in the murine respiratory
tracts.
SigE contributes to systemic spread and lethal B.
Figure 7.4: Colonization of the respiratory tract of bronchiseptica infection in RAG-/- mice C57BL/6 by RB50 and RB50ΔsigE over time. Groups of three 4-6 week-old C57BL/6 mice were More severe infections in various inoculated with 5×105 CFU of RB50 (black) or RB50ΔsigE (white). The bacterial load is expressed as immunodeficient animals can involve bacterial growth Log10CFU ± SE. The limit of detection is indicated as the dashed line. in different locations and under different conditions.
For example, more inflamed and damaged respiratory organs, or even systemic organs that the bacteria do not normally colonize, can present the bacteria with different stresses. To examine the role of SigE in coping with these stresses, we tested if the strain lacking sigE is defective in causing lethal diseases in some immunodeficient mouse. TLR4def and TNF-α-/- mice were challenged with RB50 or RB50ΔsigE and signs of severe disease were monitored. Consistent with published studies, TLR4def and TNF-α-/- mice inoculated with
105 CFU wild-type B. bronchiseptica quickly developed signs of bordetellosis with ruffled fur, hunched backs, difficulty breathing, and succumbed 2 to 5 days post-inoculation (35, 36). Mice challenged with
143
Figure 7.5: Survival and systemic colonization of immunodeficient mice in response to RB50 and RB50ΔsigE. Groups of (A) TLR4def (n=12) (C) TNF-α-/- (n=8) (E) RAG-/- (n=6) mice were inoculated with 105 (A and C) or 5×105(E) CFU of RB50 (square) or RB50ΔsigE (triangle) and monitored for survival. Groups of four (B) TLR4suf (solid) (D) C57BL/6 (solid) and (B) TLR4def (dashed) (D) TNF-α-/- (dashed) were inoculated with 105 CFU of RB50 (black and tilted dash) or RB50ΔsigE (white and horizontal dash) and sacrificed on day 3 post-inoculation for bacterial enumeration in the indicated organs. (F) Groups of four RAG-/- mice were inoculated with 5×105 CFU of RB50(black) or RB50ΔsigE (white), and were dissected on day 28 post-inoculation for bacterial enumeration in the indicated organs. In a separate experiment, RB50ΔsigE (dashed) inoculated RAG-/- mice were euthanized for bacterial numbers in the indicated organs on day 122 post-inoculation. CFU are expressed as the Log10mean ± SE. Limit of detection is indicated as the bottom of the y-axis. **: P≤0.01. RB50ΔsigE also showed similar signs of diseases and time to death (Fig. 7.5A, 7.5C). In a separate experiment, similarly challenged TLR4def and TNF-α-/- mice were dissected on day 3 post-inoculation for bacterial enumeration in the respiratory as well as systemic organs. Both wild-type and sigE-deficient RB50 colonized the lungs of TLR4def mice at similar levels, 107-8 CFU, which was almost 1000 fold higher than in the lungs of TLR4suf mice. Moreover, both strains colonized the systemic organs in TLR4def, but not TLR4suf
144 mice (Fig. 7.5B). Similarly, both strains colonized at higher levels in the lungs of TNF-α-/- mice than in the lungs of C57BL/6 mice and were recovered from systemic organs only in TNF-α-/- mice (Fig. 7.5D). These data indicate that SigE is not required for B. bronchiseptica to cause lethal infection or colonize systemic organs in TLR4 or TNF-α deficient host.
We then determined if SigE is required for virulence in mice deficient in adaptive immunity.
Previously, we have observed that B and T cell deficient RAG-/- mice succumb to B. bronchiseptica infection, and death is associated with systemic spread of the infection. Groups of RAG-/- mice were intranasally inoculated with 5 × 105 CFU of RB50 or RB50ΔsigE to assess the role of SigE in the systemic spread of B. bronchiseptica in the hosts lacking B and T cells. RB50-inoculated RAG-/- mice showed symptoms of lethal bordetellosis on day 13 post-inoculation and succumbed between days 14-35 post-inoculation (Fig.7.5A).
However, RAG-/- mice inoculated with RB50ΔsigE survived 122 days post-inoculation without any overt signs of diseases and were euthanized on day 122 post-inoculation. Nasal cavity, trachea, lung, spleen, liver and kidneys of these mice were excised to enumerate the bacterial loads. Although 105-7 CFU of RB50ΔsigE was recovered from the respiratory tract, this strain failed to colonize spleen or kidney; and only 300 CFU was recovered from liver (Fig. 7.5F, dashed bars). In a separate experiment, RB50- and RB50ΔsigE- inoculated RAG-/- mice were sacrificed on day 28 post-inoculation, when RB50 challenged mice were still alive. The bacterial loads of RB50 and RB50ΔsigE in the respiratory tract on day 28 post-inoculation were similar, about 105-7 CFU. At this time point, 104-6 CFU of RB50 was recovered from systemic organs.
RB50ΔsigE, however, failed to colonize spleen, kidney or liver (Fig. 7.5F, black and white bars). These observations led us to conclude that SigE is required for B. bronchiseptica to cause sepsis and lethal infection in RAG-/- mice.
RB50ΔsigE is not susceptible to complement-mediated killing
The failure of RB50ΔsigE to colonize distal organs of RAG-/- mice suggests that this mutant is defective in either getting into or survival in their bloodstream. Since we have previously shown that the ability of B. bronchiseptica to cause systemic infection is dependent on its resistance to complement-mediated killing (6), we hypothesized that RB50ΔsigE might be susceptible to complement-mediated killing. To test this, 500 CFU of RB50 or RB50ΔsigE was incubated with 20% of complement-active or complement-
145 inactive serum from naïve mice at 37°C for 1 hour.
Since it has previously been shown that RB50Δwbm is susceptible to complement-mediated killing; this strain was included in the assay as a positive control for complement activity (6) (Fig. 7.6). RB50Δwbm survived the complement-inactive serum treatment, but was almost completely killed when treated with Figure 7.6: SigE is not required for serum resistance. . RB50 (black), RB50ΔsigE (white) and RB50Δwbm complement-active serum, indicating that in this (dashed) were exposed to PBS (none) or PBS containing complement (C’) active or complement inactive serum assay, complement is active. The percent survival for 1 hour. The average percent survival of three replicate ± SE is shown. of RB50 and RB50ΔsigE in PBS, PBS containing complement active or inactive serum were comparable, suggesting that SigE is not required for resistance to complement. RB50ΔsigE survives in the presence of serum without B. bronchiseptica-specific antibodies, indicating that its defect in causing systemic infection in mice lacking B and T cells is not due to failure to survive the antimicrobial components in serum, including complements.
SigE contributes to cytotoxicity to macrophages Figure 7.7: RB50ΔsigE is less cytotoxic to macrophage.(A) J774 cells were incubated with media only (white diamond) or media containing RB50 (black square), RB50ΔsigE (white triangle), TTSS deficient RB50 stain WD3 (black diamond), or ACT and TTSS deficient RB50 stain AVS (black circle) for indicated time. The average of percent cytotoxicity of four wells treated similarly as measured by (LDH release from a well/LDH release from positive control well) ×100 ± SE is shown. (B) Quantitative real-time PCR analysis was performed to measure mRNA levels in three independent biological replicates of RB50 (black), RB50ΔsigE, which was harvested at the same time as RB50 (white) and RB50ΔsigE, which was harvested at similar culture density to RB50 (hatched) growing in the Stainer-Scholte containing 1.5% ethanol. Differences in mRNA levels are expressed as mean fold-changes compared to RB50 ± SE. *:P≤0.05 as compared to wild-type strain. Sara E. Hester performed the experiment shown in Fig. 7.7 A RB50ΔsigE interacts with complement
similarly to RB50, but does not colonize systemic
organs of RAG-/- mice. We further tested whether
146 RB50ΔsigE interacts with another major bactericidal component in the bloodstream, phagocytes, differently from RB50. B. bronchiseptica is cytotoxic to one type of phagocytes, macrophages. We thus hypothesized that SigE might contribute to the cytotoxicity of B. bronchiseptica to macrophages. To test this, J774 murine macrophages were incubated with RB50, RB50ΔsigE, RB50 lacking type three secretion system (TTSS)
(WD3), or RB50 lacking both TTSS and adenylate cyclase toxin (AVS) at a MOI of 15 for up to 4 hours.
Cytotoxicity was measured according to LDH release. Since the TTSS contributes to cytotoxicity (58), strains WD3 and AVS were included as negative controls and these two stains had induced little cytotoxicity by 4 hours of incubation, similar to media only treated group. Wild-type RB50 has caused 24% and 85% cytotoxicity by3 and 4 hours of incubation. However, RB50ΔsigE had caused significantly less cytotoxicity:
7% and 45% by 3 and 4 hours of incubation (Fig. 7.7A). RB50ΔsigE shows intermediate cytotoxicity between that caused by wild-type and TTSS deficient RB50, suggesting that SigE only partially contributes to the TTSS-dependent cytotoxicity of B. bronchiseptica to macrophages. This is consistent with preliminary microarray data indicating that SigE may be involved in regulating gene expression of some TTSS genes under ethanol stress. To determine whether SigE regulates some TTSS genes, qRT-PCR was performed on
RNA extracted from cells under ethanol stress, conditions that requires SigE for survival (Fig. 7.3B). Since
RB50ΔsigE grows slower in the presence of ethanol, RNA were extracted from this strain exposed to ethanol either for the same period of time or at the similar culture density compared to the wild-type strain to rule out the impact of different growth phase on TTSS gene expression. Under both circumstances, the expression of some TTSS genes, bsp22, bcrHІ, bopD and bopB, was lower in RB50ΔsigE compared to wild-type RB50 and bopD expression is significantly lower in RB50ΔsigE, extracted at the similar culture density to RB50 (Fig.
7.7B).
147 Discussion
The ability of B. bronchiseptica to cause diseases in a wide range of hosts and transmit between them suggests that it can survive various stress imposed both inside and outside a host. Although the BvgAS two- component system is known to regulate virulence factor expression, this system alone is not likely to sense all the in vitro and in vivo conditions, and mount the optimum responses. ECF sigma factors, such as σE, have been increasingly implicated as contributing to both stress responses and virulence in many bacteria, including Salmonella enterica, M. tuberculosis, V. cholerae, and Pseudomonas aeruginosa (29, 33, 48, 56).
In this work, we show that SigE, a σE-like sigma factor in the respiratory pathogen B. bronchiseptica, is involved in both stress responses and pathogenesis.
B. bronchiseptica SigE shares 54% amino acid sequence identity and 73% similarity with the well- characterized ECF sigma factor, E. coli σE. B. bronchiseptica SigE can direct transcription of an E. coli σE- dependent promoter, rpoHP3, indicating that SigE is a σE-like sigma factor. Moreover, the predicted SigE operon structure, including potential co-transcribed negative regulators, shows some similarities to the σE systems of E. coli and P. aeruginosa, and studies on the regulation of the B. bronchiseptica SigE system are currently underway. In E. coli, the gene encoding σE, rpoE, is essential, however, in many other organisms the gene encoding a σE-like sigma factor can be deleted (10, 13, 23, 29, 33, 56). Using an allelic exchange strategy, we generated a sigE in-frame deletion strain of B. bronchiseptica and the growth kinetics of SigE deficient strain is similar to its isogenic parent under optimal growth conditions, indicating that SigE is not essential in B. bronchiseptica.
Changes in osmolarity, detergents, β-lactam antibiotics, high temperature, and ethanol, among others, can induce damage to the cell envelope (48). σE senses alterations in the composition of the cell envelope in many bacterial species. For example, E. coli σE is required for response to extreme heat shock, under which circumstances σ32 is activated through its σE-dependent promoter, P3 (1). We have demonstrated that B.
E bronchiseptica SigE can also transcribe this E. coli σ -dependent promoter (Fig. 7.1B). SigE can also transcribe a putative promoter upstream of the gene encoding σ32 in B. bronchiseptica, fam (data not shown).
Consistent with a role in regulating the heat shock response, we have demonstrated a role for SigE in survival at 50oC, growth in the presence of 3% ethanol, and in thermotolerance. E. coli σE is involved in maintenance
148 of the cell envelope (21), similarly SigE deficient B. bronchiseptica is more sensitive to agents that act at the cell envelope, including SDS and some β-lactam antibiotics (Fig. 7.3D). However, this response is specific to certain types of damage, as SigE is not important in response to antimicrobial peptides that also affect the envelope, such as polymyxin B (Fig. 7.3D). Neither E. coli nor B. bronchiseptica requires σE to cope with osmotic or oxidative stress (S2) (47).
Pathogens encounter a spectrum of stresses in different compartments inside of mammalian hosts imposed by numerous effectors of the immune system. We took an approach of using mouse strains that are deficient in specific aspects of the immune responses which exposed B. bronchiseptica to a variety of different conditions in different compartments of the host. SigE is not required for colonization and persistence of RB50 in an immunocompetent host. Deletion of sigE also does not seem to affect the virulence of RB50 in TLR4- or TNF-α-deficient mice. However, in mice lacking B and T cells, RB50∆sigE fails to cause systemic lethal infections, indicating that the SigE-deficient stain fails to either get into or survive in the blood stream of these mice. Complement is a major bactericidal factor in the blood stream but RB50ΔsigE survives incubation with complement active serum, indicating that this mutant is resistant to complement- mediated killing and other serum anti-microbial components. RB50ΔsigE is less cytotoxic to macrophages as compared to RB50. The TTSS is required for full cytotoxicity, suggesting that RB50ΔsigE may have lower levels of TTSS. This is consistent with preliminary microarray data showing that expression of some TTSS genes is decreased in cells lacking SigE. Although cytotoxicity is decreased, it is not completely abolished; the remaining cytotoxicity may be enough to help establish systemic infection in TLR4- and TNF-α-deficient mice, but not in RAG-/- mice. In a TLR4- or TNF-α-deficient host, there is uncontrolled bacterial growth until the bacterial number is so high that even ineffective cytotoxicity is enough to kill phagocytic cells. In comparison, bacterial numbers are kept lower in RAG-/- mice and low cytotoxicity has a more limited effect on killing phagocytic cells, which may prevent systemic colonization. Members of the σE regulon of S. typhimurium are more important for systemic than enteric infection (23, 30, 48). Our data suggest that members of the B. bronchiseptica SigE regulon might be required for systemic infection in certain immunocompromised hosts. Studies on how SigE is activated in vivo and the members of its regulon will shed more light on its role during infection.
149 σE has different functions in various pathogens. For instance, σE mutant of V. vulnificus exhibits increased sensitivity to the membrane perturbing agents, ethanol, peroxide and SDS, and to heat (5); whereas a σE mutant of the closely-related species V. cholerae displays different patterns of stress sensitivity (29). σE of V. cholerae is required in the presence of ethanol, but is not required for heat shock or for resistance to peroxide or antimicrobial peptides (29). σE of Salmonella enterica serovar Typhimurium contributes to resistance to oxidative stress and stationary-phase survival, but not heat shock (11, 23, 26, 54). In P. aeruginosa, σE facilitates persistence in the airway of cystic fibrosis patients (4). It is likely that the discrepancies in the functions of σE are due to differences in environmental niches and specific insults bacteria encounter in vivo. Since B. bronchiseptica is predicted to have multiple other ECF sigma factors (52), their complimentary and redundant functions might in part account for the dispensability of B. bronchiseptica SigE in coping with stresses which other organisms require σE to contend. Future studies on what conditions activate other ECF sigma factors and their roles in B. bronchiseptica pathogenesis will provide a more comprehensive understanding of how B. bronchiseptica copes with extracytoplasmic stresses.
150 Authors and Contributions:
Xuqing Zhang1,2,†, Sarah E. Barchinger3,4,†, Sara E. Hester1,3,4, Sarah E. Ades3,4, and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, Pennsylvania State University, 115 Henning
Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, the Pennsylvania State University, University Park
3Department of Biochemistry, Microbiology, and Molecular Biology, The Pennsylvania State
University, University Park
4Graduate Program in Biochemistry, Microbiology and Molecular Biology, The Pennsylvania State
University, University Park
†XZ and SEB contributed equally to this work.
Conceived and designed the experiments: XZ, SEB, SEA, ETH.
Performed the experiments: XZ, SEB, SEH.
Analyzed the data: XZ, SEB.
Wrote the paper: XZ, SEB, SEA, ETH.
151 References:
1. Ades, S. E., I. L. Grigorova, and C. A. Gross. 2003. Regulation of the alternative sigma factor sigma(E) during initiation, adaptation, and shutoff of the extracytoplasmic heat shock response in Escherichia coli. J Bacteriol 185:2512-2519. 2. Ando, M., T. Yoshimatsu, C. Ko, P. J. Converse, and W. R. Bishai. 2003. Deletion of Mycobacterium tuberculosis sigma factor E results in delayed time to death with bacterial persistence in the lungs of aerosol- infected mice. Infect Immun 71:7170-7172. 3. Arico, B., R. Gross, J. Smida, and R. Rappuoli. 1987. Evolutionary relationships in the genus Bordetella. Mol Microbiol 1:301-308. 4. Boucher, J. C., M. J. Schurr, and V. Deretic. 2000. Dual regulation of mucoidy in Pseudomonas aeruginosa and sigma factor antagonism. Mol Microbiol 36:341-351. 5. Brown, R. N., and P. A. Gulig. 2009. Roles of RseB, sigmaE, and DegP in virulence and phase variation of colony morphotype of Vibrio vulnificus. Infect Immun 77:3768-3781. 6. Burns, V. C., E. J. Pishko, A. Preston, D. J. Maskell, and E. T. Harvill. 2003. Role of Bordetella O antigen in respiratory tract infection. Infect Immun 71:86-94. 7. Costanzo, A., and S. E. Ades. 2006. Growth phase-dependent regulation of the extracytoplasmic stress factor, sigmaE, by guanosine 3',5'-bispyrophosphate (ppGpp). J Bacteriol 188:4627-4634. 8. Costanzo, A., H. Nicoloff, S. E. Barchinger, A. B. Banta, R. L. Gourse, and S. E. Ades. 2008. ppGpp and DksA likely regulate the activity of the extracytoplasmic stress factor sigmaE in Escherichia coli by both direct and indirect mechanisms. Mol Microbiol 67:619-632. 9. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-3390. 10. Craig, J. E., A. Nobbs, and N. J. High. 2002. The extracytoplasmic sigma factor, final sigma(E), is required for intracellular survival of nontypeable Haemophilus influenzae in J774 macrophages. Infect Immun 70:708-715. 11. Crouch, M. L., L. A. Becker, I. S. Bang, H. Tanabe, A. J. Ouellette, and F. C. Fang. 2005. The alternative sigma factor sigma is required for resistance of Salmonella enterica serovar Typhimurium to anti-microbial peptides. Mol Microbiol 56:789-799. 12. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640-6645. 13. De Las Penas, A., L. Connolly, and C. A. Gross. 1997. SigmaE is an essential sigma factor in Escherichia coli. J Bacteriol 179:6862-6864. 14. Flannagan, R. S., and M. A. Valvano. 2008. Burkholderia cenocepacia requires RpoE for growth under stress conditions and delay of phagolysosomal fusion in macrophages. Microbiology 154:643-653. 15. Gerlach, G., F. von Wintzingerode, B. Middendorf, and R. Gross. 2001. Evolutionary trends in the genus Bordetella. Microbes Infect 3:61-72. 16. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O-antigen Protects Bordetella parapertussis from Complement. Infect Immun. 17. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-738. 18. Hancock, R. E., and A. Patrzykat. 2002. Clinical development of cationic antimicrobial peptides: from natural to novel antibiotics. Curr Drug Targets Infect Disord 2:79-83. 19. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect Immun 67:1493-1500. 20. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 21. Hayden, J. D., and S. E. Ades. 2008. The Extracytoplasmic Stress Factor, sigma, Is Required to Maintain Cell Envelope Integrity in Escherichia coli. PLoS ONE 3:e1573. 22. Heusipp, G., M. A. Schmidt, and V. L. Miller. 2003. Identification of rpoE and nadB as host responsive elements of Yersinia enterocolitica. FEMS Microbiol Lett 226:291-298. 23. Humphreys, S., A. Stevenson, A. Bacon, A. B. Weinhardt, and M. Roberts. 1999. The alternative sigma factor, sigmaE, is critically important for the virulence of Salmonella typhimurium. Infect Immun 67:1560-1568. 24. Ishino, F., S. Tamaki, B. G. Spratt, and M. Matsuhashi. 1982. A mecillinam-sensitive peptidoglycan crosslinking reaction in Escherichia coli. Biochem Biophys Res Commun 109:689-696. 25. Kaldalu, N., R. Mei, and K. Lewis. 2004. Killing by ampicillin and ofloxacin induces overlapping changes in Escherichia coli transcription profile. Antimicrob Agents Chemother 48:890-896. 26. Kenyon, W. J., D. G. Sayers, S. Humphreys, M. Roberts, and M. P. Spector. 2002. The starvation-stress response of Salmonella enterica serovar Typhimurium requires sigma(E)-, but not CpxR-regulated extracytoplasmic functions. Microbiology 148:113-122.
152 27. Kirimanjeswara, G. S., Agosto, L.M., Kennet, M.J., Bjornstad, O.N., and Harvill, E.T. 2005. Pertussis toxin inhibits neutrophil recruitment to inhibit antibody-mediated clearance of Bordetella pertussis. J Clin Invest. 28. Korber, D. R., A. Choi, G. M. Wolfaardt, and D. E. Caldwell. 1996. Bacterial plasmolysis as a physical indicator of viability. Appl Environ Microbiol 62:3939-3947. 29. Kovacikova, G., and K. Skorupski. 2002. The alternative sigma factor sigma(E) plays an important role in intestinal survival and virulence in Vibrio cholerae. Infect Immun 70:5355-5362. 30. Lewis, C., H. Skovierova, G. Rowley, B. Rezuchova, D. Homerova, A. Stevenson, A. Sherry, J. Kormanec, and M. Roberts. 2008. Small outer-membrane lipoprotein, SmpA, is regulated by sigmaE and has a role in cell envelope integrity and virulence of Salmonella enterica serovar Typhimurium. Microbiology 154:979-988. 31. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 32. Madan Babu, M., S. A. Teichmann, and L. Aravind. 2006. Evolutionary dynamics of prokaryotic transcriptional regulatory networks. J Mol Biol 358:614-633. 33. Manganelli, R., M. I. Voskuil, G. K. Schoolnik, and I. Smith. 2001. The Mycobacterium tuberculosis ECF sigma factor sigmaE: role in global gene expression and survival in macrophages. Mol Microbiol 41:423-437. 34. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infect Immun 75:3665-3672. 35. Mann, P. B., K. D. Elder, M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4-dependent early elicited tumor necrosis factor alpha expression is critical for innate host defense against Bordetella bronchiseptica. Infect Immun 72:6650-6658. 36. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 37. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 38. Mecsas, J., P. E. Rouviere, J. W. Erickson, T. J. Donohue, and C. A. Gross. 1993. The activity of sigma E, an Escherichia coli heat-inducible sigma-factor, is modulated by expression of outer membrane proteins. Genes Dev 7:2618-2628. 39. Missiakas, D., and S. Raina. 1998. The extracytoplasmic function sigma factors: role and regulation. Mol Microbiol 28:1059-1066. 40. Muller, C., I. S. Bang, J. Velayudhan, J. Karlinsey, K. Papenfort, J. Vogel, and F. C. Fang. 2009. Acid stress activation of the sigma(E) stress response in Salmonella enterica serovar Typhimurium. Mol Microbiol 71:1228-1238. 41. Musser, J. M., D. A. Bemis, H. Ishikawa, and R. K. Selander. 1987. Clonal diversity and host distribution in Bordetella bronchiseptica. J Bacteriol 169:2793-2803. 42. Nicholson, T. L. 2007. Construction and validation of a first-generation Bordetella bronchiseptica long- oligonucleotide microarray by transcriptional profiling the Bvg regulon. BMC Genomics 8:220. 43. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M. T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga, L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D. Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis, J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S. Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E. Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M. Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead, B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 44. Porter, J. F., R. Parton, and A. C. Wardlaw. 1991. Growth and survival of Bordetella bronchiseptica in natural waters and in buffered saline without added nutrients. Appl Environ Microbiol 57:1202-1206. 45. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L. Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-3767. 46. Rhodius, V. A., W. C. Suh, G. Nonaka, J. West, and C. A. Gross. 2006. Conserved and variable functions of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 47. Rouviere, P. E., A. De Las Penas, J. Mecsas, C. Z. Lu, K. E. Rudd, and C. A. Gross. 1995. rpoE, the gene encoding the second heat-shock sigma factor, sigma E, in Escherichia coli. EMBO J 14:1032-1042. 48. Rowley, G., M. Spector, J. Kormanec, and M. Roberts. 2006. Pushing the envelope: extracytoplasmic stress responses in bacterial pathogens. Nat Rev Microbiol 4:383-394. 49. Sahalan, A. Z., and R. A. Dixon. 2008. Role of the cell envelope in the antibacterial activities of polymyxin B and polymyxin B nonapeptide against Escherichia coli. Int J Antimicrob Agents 31:224-227.
153 50. Skerker, J. M., and L. Shapiro. 2000. Identification and cell cycle control of a novel pilus system in Caulobacter crescentus. EMBO J 19:3223-3234. 51. Stainer, D. W., and M. J. Scholte. 1970. A simple chemically defined medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63:211-220. 52. Staron, A., H. J. Sofia, S. Dietrich, L. E. Ulrich, H. Liesegang, and T. Mascher. 2009. The third pillar of bacterial signal transduction: classification of the extracytoplasmic function (ECF) sigma factor protein family. Mol Microbiol 74:557-581. 53. Stibitz, S., and N. H. Carbonetti. 1994. Hfr mapping of mutations in Bordetella pertussis that define a genetic locus involved in virulence gene regulation. J Bacteriol 176:7260-7266. 54. Testerman, T. L., A. Vazquez-Torres, Y. Xu, J. Jones-Carson, S. J. Libby, and F. C. Fang. 2002. The alternative sigma factor sigmaE controls antioxidant defences required for Salmonella virulence and stationary-phase survival. Mol Microbiol 43:771-782. 55. Wu, Q. L., D. Kong, K. Lam, and R. N. Husson. 1997. A mycobacterial extracytoplasmic function sigma factor involved in survival following stress. J Bacteriol 179:2922-2929. 56. Yu, H., J. C. Boucher, N. S. Hibler, and V. Deretic. 1996. Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (sigmaE). Infect Immun 64:2774-2781. 57. Yu, H., M. J. Schurr, and V. Deretic. 1995. Functional equivalence of Escherichia coli sigma E and Pseudomonas aeruginosa AlgU: E. coli rpoE restores mucoidy and reduces sensitivity to reactive oxygen intermediates in algU mutants of P. aeruginosa. J Bacteriol 177:3259-3268. 58. Yuk, M. H., E. T. Harvill, and J. F. Miller. 1998. The BvgAS virulence control system regulates type III secretion in Bordetella bronchiseptica. Mol Microbiol 28:945-959.
154
Chapter 8
Constitutively Active SigE in B. bronchiseptica Leads to Decreased Virulence in
Murine Hosts.
Abstract:
The extracytoplasmic function (ECF) sigma factor activity is usually tightly regulated by its negative regulators. Although ECF sigma factors have been shown to be involved in stress responses and virulence in many bacterial species, the role of their regulators during infection are less defined. A Bordetella bronchiseptica strain lacking rseA and rseB, encoding negative regulators of an ECF sigma factor, SigE, is constructed to examine the effects of constitutive SigE activity on pathogenesis. RB50ΔrseAB less efficiently colonizes and fails to persist in the lower respiratory tracts of C57BL/6 mice. Adoptively-transferred antibodies against this strain are efficient in reducing RB50ΔrseAB numbers in vivo. This mutant is as resistant to complement as wild-type bacteria but induces lower cytotoxicity to macrophage. RB50ΔrseAB does not cause lethal diseases in mice lacking B and T cells or in mice lacking TLR4. These data suggest that
B and T cells- or TLR4-mediated host defense mechanisms alone might not be responsible for the decreased colonization of RB50ΔrseAB. Taken together, these results indicate that constitutively active SigE disrupts some as yet unknown virulence mechanisms required for efficient colonization and persistence, highlighting the importance of tight regulation of SigE activity during infection.
155 Introduction:
The ability to modify gene expression according to changes in the environment or the state of the cell is critical to bacterial pathogens that need to defend themselves against stress originating from the external environment between hosts as well as within the infected hosts. The extracytoplasmic stress responses (ESR) of bacteria have thus received much attention to understand bacterial pathogenesis. The best characterized
ESR are those mediated by the two-component systems and the alternative extracytoplasmic function (ECF) sigma factors (39, 41). Sigma factor is the dissociable subunit of RNA polymerase that confers promoter specificity (13). The interaction between sigma factor and promoter region provides a means of regulating gene expression in response to various environmental conditions (34). By having multiple alternative sigma factors, bacteria can rapidly redirect transcription to a specific subset of promoters according to a particular stimulus. A subgroup of sigma factor in the ECF family regulates functions related to sensing and responding to changes in the bacterial cell envelope and extracellular environment, and in some cases genes involved in virulence (21, 41).
Many conditions, such as temperature changes, oxidative stress, and osmotic stress are commonly encountered by bacteria within various locations in the host. σE, an ECF sigma factor, has been shown to play diverse roles in responding to these conditions in various bacterial species. In E. coli, σE directs transcription of many genes important for cell envelope maintenance and during heat shock (19, 32). In Pseudomonas aeruginosa, a major cause of respiratory infection in cystic fibrosis patients, algU, an ortholog of E. coli rpoE, is important for the production of alginate, a substance that is often found in excess in cystic fibrosis patients and plays several roles in pathogenesis (12, 15, 47). In Salmonella typhimurium, σE is important for surviving oxidative stress and resistance to antimicrobial peptides (35, Humphreys, 1999 #8). In
Haemophilus influenzae, σE helps the bacteria survive inside macrophages (8). σE is important for growth of
Vibrio cholerae under ethanol stress as well as its colonization of the intestine (24).
The best characterized σE regulation system is in E. coli (1). In this organism, σE is regulated by
RseA, an anti-sigma factor located in the inner membrane whose cytoplasmic domain binds tightly to σE, preventing its interaction with RNA polymerase (9, 34). σE is also regulated by RseB, a periplasmic protein that binds to RseA and protects it from degradation (6, 16). During certain stress responses, accumulation of
156 outer membrane proteins activates the sequential degradation of the periplasmic domain of RseA by two inner membrane proteases, DegS and RseP (YaeL) (2, 3, 46). The ClpXP protease degrades the cytoplasmic RseA-
N-terminus (11), freeing σE to associate with core RNA polymerase and direct transcription of its regulon.
Some other bacteria, especially many beta and gamma proteobacteria, have been found to utilize ECF sigma factors and their regulatory modules related to E. coli σE system, supported by homologous sequences, conserved gene contexts, and, in some cases, overlapping regulatory mechanisms (4, 20, 29).
We recently identified a genetic module similar to the E. coli rpoE-rseA-rseB system in Bordetella bronchiseptica. B. bronchiseptica is closely-related to B. pertussis and B. parapertussis (36), the causative agents of whooping cough in humans (31). This bacterium causes a wide range of diseases in various mammals, including kennel cough in dogs, atrophic rhinitis in swine, snuffles in rabbits and asymptomatic colonization in the upper respiratory tracts of many mammals (31). The rseA homologue of B. bronchiseptica, BB3751, has some homology to E. coli rseA (amino acid sequence similarity 33.3%); while the rseB homologue, annotated as mucB, is more conserved (amino acid sequence similarity 40.3%). It is worth-noting that most of the homology between BB3751 and E. coli rseA is in the region important for binding σE (Barchinger S.E. unpublished data). B. bronchiseptica SigE and E. coli σE share ~75% amino acid sequence similarity. In fact, SigE can initiate transcription from an E. coli σE-dependent promoter, demonstrated by an in vitro multi-round transcription assay and an in vivo reporter assay (Chapter 7,
Barchinger S.E. unpublished data). SigE can complement a deletion of the E. coli rpoE gene (Barchinger
S.E. unpublished data), which is essential for E. coli viability (10), further supporting SigE being a σE-like sigma factor. The regulatory relationships appear to be conserved for the B. bronchiseptica proteins, demonstrated by cloning the B. bronchiseptica putative regulators, BB3751 and mucB, along with sigE under the control of an IPTG-inducible promoter on a plasmid, in a strain with a chromosomally-encoded lacZ reporter of E. coli σE activity. Overexpression of BB3751 with sigE reduces reporter activity compared to overexpression of sigE alone. Overexpression of sigE, BB3751 and mucB reduces the reporter activity to basal levels (Barchinger S.E. unpublished data). The cytoplasmic domain of BB3751 is sufficient to inhibit B. bronchiseptica SigE, demonstrated by an in vivo reporter assay and an in vitro multi-round transcription assay
(Barchinger S.E. unpublished data). Taken together, these data indicate that BB3751 and mucB encode
157 negative regulators of SigE in B. bronchiseptica; and we have designated these genes rseA and rseB, respectively.
Previous work has identified roles for SigE in B. bronchiseptica stress responses and during infection
(Chapter 7). Unlike in E. coli strain K-12 (10), sigE is not essential in RB50. However, B. bronchiseptica lacking sigE are more sensitive to heat and ethanol stress, and agents that affect the integrity of the cell envelope, such as SDS and some β-lactam antibiotics. This is consistent with a predicted role for SigE in cell envelope maintenance, similar to the E. coli system. We have also deleted the genes encoding both of the negative regulators, rseA and rseB, in B. bronchiseptica strain RB50, to constitutively activate SigE.
RB50ΔrseAB is more resistant to detergents (SDS) and β-lactam antibiotics (ampicillin, mecillinam, meropenem) than RB50 (Barchinger S.E. unpublished data). Survival after 18h of growth in liquid culture at
45ºC was increased ~100-fold for RB50∆rseAB compared to RB50, indicating a role of the SigE system in response to heat shock. This provides further evidence that SigE is important for promoting survival during cell envelope stress. Moreover, SigE is required for causing lethal systemic infection in mice lacking B and T cells (Chapter 7), indicating that it might be important for coping with certain stress during infection.
Compared to σE, there are fewer reports on the roles of the negative regulators during infection. In P. aeruginosa, mutations in rseA homologue, mucA, or rseB homologue, mucB, lead to the alginate- overproducing mucoid phenotype, associated with the establishment of lethal disease in CF patients (29, 30).
This is opposite the situation for Vibrio vulnificus, in which the rseB mutation causes decreased expression of extracellular polysaccharides and decreased virulence (4). Similarly, in Actinobacillus pleuropneumoniae, a strict respiratory pathogen of swine, inactivation of rseA (mlcA) attenuates the virulence in porcine lungs (43).
The roles of rseA/rseB during B. bronchiseptica infection have not been investigated prior to this study.
In a murine model of respiratory infection, RB50∆rseAB colonized the lower respiratory tract (LRT) of C57BL/6 mice less efficiently than did RB50. Adoptively-transferred antibodies generated from
RB50∆rseAB-infected mice were similar to antibodies against RB50 in efficiently reducing RB50∆rseAB numbers. This strain still colonized mice lacking B and T cells at lower levels, suggesting that constitutive
SigE activity may disrupt virulence mechanisms targeting some innate immune factors. RB50∆rseAB was as resistant as RB50 to complement-mediated killing, but was less cytotoxic to macrophages. In addition,
158 RB50∆rseAB failed to cause lethal diseases in mice lacking TLR4. Although large numbers of bacteria colonized the LRTs of these mice, unlike RB50 causing severe pathology, RB50∆rseAB appeared to cause little pathology in TLR4def mice. These data established the importance of proper control of SigE activity during B. bronchiseptica infection.
159 Materials and Methods
Bacterial strains and growth. Experiments were performed using the previously described B. bronchiseptica strain RB50 (7), an isogenic mutant lacking O-antigen, RB50Δwbm (38), a TTSS mutant of
RB50 lacking bscN (WD3) (50), B. bronchiseptica strain AVS lacking TTSS and adenylate cyclase toxin
(25), RB50 lacking sigE (Chapter 7), and an isogenic mutant lacking BB3751 (rseA) and mucB (rseB),
RB50ΔrseAB, which was constructed in this study and is described below. Bacteria were maintained on
Bordet-Gengou agar (Difco) containing 10% defibrinated sheep blood (Hema Resources) and 20μg/mL streptomycin.
Construction of RB50ΔrseAB strain. A left-flanking PCR product
(5’AGTGAATTCCCCCTTCTTCAGCGTCTTG3’, 5’GATGGATCCCAACAATAAGCCCGCAAAG3’) with 636bp proximal to the sigE gene and a non-overlapping 767bp right-flanking product
(5’ATTGGATCCTTGCATGACTGCCACTC3’, 5’GGAGAATTCGGGTCTCGGGTTACAAATAGC3’) were amplified from B. bronchiseptica RB50 genomic DNA with EcoRΙ and BamHΙ sites overhanging on the
5’, 3’ and 3’, 5’, respectively. The two flanking fragments were digested with BamHΙ and ligated. The resulting construct was PCR-amplified (5’AGTGAATTCCCCCTTCTTCAGCGTCTTG3’,
5’GGAGAATTCGGGTCTCGGGTTACAAATAGC3’), cloned into TopoTA vector (Invitrogen) and verified by sequencing. The deletion construct was then cloned into the EcoRΙ site of pSS4245 allelic exchange vector (Stibitz S. unpublished data), resulting in the deletion of the 1544bp central region of rseA and rseB with only 6bp of the 5’end of rseA and 9bp of the 3’end of the rseB gene remaining in place. Tri-parental mating with wild-type B. bronchiseptica strain RB50, E. coli strain DH5α harboring the pSS4245ΔrseAB vector, and DH5α harboring the helper plasmid pSS1827 (45) was performed under modulating conditions
(with 50mM MgSO4) and incubated on modulating plates containing 100µg/mL kanamycin and 60µg/mL streptomycin to select for the integration of pSS4245ΔrseAB into the B. bronchiseptica chromosome.
Bordetella colonies on modulating plates were streaked onto plates without MgSO4 to activate the pertussis toxin promoter on the vector which drives the expression of the endonuclease SceΙ. This resulted in the cutting of the SceΙ site on the vector and approximately 50% of the resultant colonies on these plates had the wild-type rseA and rseB gene deleted from the chromosome by homologous recombination. The deletion
160 strain was verified by colony PCR (5’AGTGAATTCCCCCTTCTTCAGCGTCTTG3’,
5’GGAGAATTCGGGTCTCGGGTTACAAATAGC3’) and Southern blot analysis.
Complement killing assay. Complement killing assays were performed as previously described (14).
Briefly, blood freshly collected from C57BL/6 mice was pooled, incubated at 4°C for 1 hour and centrifuged at 2000g for 10min. The serum was collected and diluted 1:5 in phosphate buffered saline (PBS).
Complement-inactive serum was prepared by heating an aliquot of the diluted sample at 56°C for 30 min.
From mid-log-phase cultures, approximately 500 CFU of RB50, RB50ΔrseAB or RB50Δwbm in 5 µl of PBS were incubated with 45µl of diluted serum or PBS for 1 hour at 37°C. Bacterial numbers before and after incubation were determined by plating and CFU counts. Each strain was run in triplicate.
Cytotoxicity assay. Cytotoxicity assays were performed as previously described (17). Briefly, J774 murine macrophage cells, were cultured in Dulbecco modified Eagle medium (DMEM) (HyClone) with 10% fetal bovine serum (FBS) (HyClone). The cells were grown to 80% confluency in 96-well tissue culture plates
(Falcon) at 37C in 5% CO2. Cells were washed with RPMI (Mediatech) containing 5% FBS and bacteria were added in 50L RPMI at a multiplicity of infection (MOI) of 15. After a 5 minute centrifugation at 250g, cells were incubated for the indicated time. The percent lactate dehydrogenase (LDH) release, a measure of cytotoxicity, was determined by using Cytotox96 Kit (Promega) according to the manufacturer’s protocol.
Animal experiments. C57BL/6, RAG1-/- (RAG-/-), C3H/HEN (TLR4suf) and C3H/HEJ (TLR4def) mice were obtained from Jackson laboratories. All mice were bred in our Bordetella-free, specific pathogen-free breeding rooms at The Pennsylvania State University. For inoculation, mice were sedated with 5% isoflurane
(Abbott laboratory) in oxygen and 50μL of PBS containing 5×105 CFU of the indicated bacteria was pipeted onto the external nares (22). This method reliably distributes the bacteria throughout the respiratory tract
(18). Survival curves were generated by inoculating TLR4def or RAG-/- mice with RB50 or RB50ΔrseAB.
Mice suffering from lethal bordetellosis as determined by severe hunched posture, ruffled fur, extremely labored breathing and apathy were euthanized to prevent unnecessary suffering (28). For quantifying bacterial loads, mice were euthanized via CO2 inhalation and lung, trachea, nasal cavity, spleen, liver and/or kidneys were excised. Tissues were homogenized in PBS, aliquots were serially diluted, plated, incubated at
37°C for 2 to 3 days, and CFU was determined. For immune serum collection, C57BL/6 mice were
161 vaccinated with RB50 or RB50∆rseAB by intraperitoneally injecting 108 CFU heat-killed bacteria in 200µL
PBS on days 0 and 14 and euthanized on day 28 to collect serum. For adoptive transfer, 200µL of pooled immune serum or serum from naïve animals was intraperitoneally injected before inoculation (23). Bacterial numbers in the lungs were quantified 12h post-inoculation. All protocols were reviewed by the university
IACUC and all animals were handled in accordance with institutional guidelines.
Lung pathology. For analysis of lung pathology, mice were intranasally inoculated and euthanized as described above. The tracheas and lungs were excised and inflated with approximately 2 mL of 10% formaldehyde. The tissues were then sectioned and stained with haemolysin and eosin (H&E) at the Animal
Diagnostic Laboratories Facility of The Pennsylvania State University. Sections were examined and scored by a veterinarian with training and experience in rodent pathology (M.J.K.) who was blinded to experimental treatment (25, 37). A score of 0 indicates no noticeable inflammation or lesions; a score of 1 indicates few or scattered foci affecting <10% of the tissue; a score of 2 indicates frequent mild perivascular and/or peribronchial lymphoid aggregates, with overall inflammation affecting no more than 10 to 20% of the tissue; a score of 3 indicates moderate lesions, typically with abundant perivascular and peribronchial lymphoid infiltrates, with inflammation affecting ~20-30% of the tissue; and a score of 4 indicates extensive pneumonia and marked inflammation affecting >30% of the tissue; a score of 5 indicates extensive lesions with >50% of the tissue affected. If a severity falls between categories, 0.5 was added to the pathology score of the lower category.
Statistical analysis. The mean +/- standard error (SE) of the geometric mean was determined for all appropriate data and expressed as error bars. Two-tailed, unpaired Student’s T-tests were used to determine statistical significance between groups.
162 Results:
RB50∆rseAB does not efficiently colonize or persist in the lower respiratory tracts of C57BL/6 mice.
rseA and rseB, except for 6bp on the 5’ end of
rseA and 9bp on the 3’ end of rseB, were deleted from
the RB50 chromosome using an allelic exchange
strategy, resulting in the isogenic rseA and rseB-
deficient strain of RB50, RB50∆rseAB. The
generation time of RB50∆rseAB (73.14±0.17min) is
longer than its parental strain RB50 (63.26±0.08min)
under optimal, non-stress growth conditions: 37°C in
Stainer-Scholte broth. To evaluate the impact of
constitutive SigE activity on infection, C57BL/6 mice
were inoculated with 5×105 CFU RB50 or
RB50∆rseAB in 50µL PBS and euthanized on the
indicated days post-inoculation to evaluate bacterial
loads in the lungs, tracheas and nasal cavities. RB50
colonized all respiratory organs efficiently and grew Figure 8.1: RB50∆rseAB does not efficiently colonize the lower respiratory tract of C57BL/6 mice. Groups rapidly to millions of CFUs in the nasal cavities and of three C57BL/6 mice were inoculated with 5×105 CFU of RB50 (square) or RB50∆rseAB (triangle) and sacrificed on days 0, 1, 3, 7, 14, 28 post-inoculation. lungs during the first week of infection and bacterial The bacterial load is expressed as mean Log10CFU ± SE. The limit of detection is indicated as the dashed numbers declined thereafter (Fig. 8.1, squares). RB50 line. * indicates P≤0.05 and ** indicates P≤0.01. was cleared from the tracheas and lungs around day
60, although the nasal cavity remained colonized (Chapter 7). Although the rseA and rseB double deletion strain retained its ability to efficiently colonize and persist in the nasal cavity, it was observed at lower numbers than RB50 as early as day 3 post-inoculation and was cleared earlier from the lower respiratory tracts (LRT) (Fig. 8.1). These data indicate the importance of proper regulation of SigE activity in combating some immune mediated clearance mechanisms, perhaps unique in the LRT.
163 Serum antibodies from RB50∆rseAB-vaccinated animals are efficient in reducing bacterial numbers in vivo.
Deletion of rseA and rseB appears to change
the profile of outer membrane proteins in B.
bronchiseptica (Barchinger S.E. unpublished data),
which may result in altered antigen profile. These
observations led us to hypothesize that the antigens
exposed on the surface of RB50∆rseAB might be more Figure 8.2: RB50∆rseAB-specific antibodies are efficient in antibody-mediated clearance of RB50∆rseAB. C57BL/6 mice were adoptively immunogenic and thus antibodies generated against transferred naïve serum (dashed bar) or immune serum from RB50 (black bar) or RB50∆rseAB (white bar)- them might be more efficient in clearing this bacterium. vaccinated animals, inoculated with 5×105 CFU of RB50∆rseAB, and dissected 12h after inoculation. To test this, immune serum was collected from RB50- Bacterial numbers in the indicated organs are expressed as mean Log10CFU ± SE. or RB50∆rseAB-vaccinated C57BL/6 mice. These sera or naïve sera were adoptively transferred to C57BL/6 mice at the time of RB50∆rseAB inoculation. Mice were sacrificed 12h later to enumerate bacterial loads in the respiratory tract. Compared to the naïve serum, both types of immune serum had no effect in the nasal cavity (Fig. 8.2). Immune serum from either strain rapidly reduced RB50∆rseAB numbers in the LRT to a similar extent (Fig. 8.2). These data indicate that antibodies generated in RB50∆rseAB-vaccinated animals are similarly effective in vivo compared to RB50- specific antibodies, and suggest that the quicker clearance of RB50∆rseAB may not be attributable to differential antibody functions.
RB50∆rseAB failed to cause lethal infection in RAG-/- mice.
The defect of RB50∆rseAB in colonization of the LRTs of C57BL/6 mice was more pronounced during the later stages of infection (Fig. 8.1). We thus hypothesized that virulence mechanisms disrupted in
RB50∆rseAB might target host adaptive immune responses. If RB50∆rseAB were particularly defective in resisting the adaptive immunity, then deleting adaptive immunity would affect the phenotypes of
RB50∆rseAB relative to that of RB50. To test this hypothesis, RAG-/- mice, lacking B and T cells, were inoculated with 5×105 CFU of RB50 or RB50∆rseAB and monitored for survival. As we have shown
164 previously (Chapter 7), RAG-/- mice succumbed to
RB50 infection by day 35 post-inoculation (Fig. 8.3A,
squares). In contrast, the rseAB deficient strain failed
to cause lethal infection in these animals, which
remained healthy until the end of the experiment (day
100 post-inoculation) (Fig. 8.3A, triangle). To explore
why RB50∆rseAB failed to cause lethal infection in
RAG-/- mice, in a separate experiment, RAG-/- mice
were inoculated with RB50 or RB50∆rseAB and
euthanized on day 21 post-inoculation to enumerate
bacterial loads in various organs. Although
Figure 8.3: RB50∆rseAB fails to cause lethal infection RB50∆rseAB colonized nasal cavities similarly to in RAG-/- mice. (A) RAG-/- mice were inoculated with 5×105 CFU of RB50 (square) or RB50∆rseAB (triangle) RB50, about two orders of magnitude more RB50 was and monitored for survival. (B) RAG-/- mice were 5 inoculated with 5×10 CFU of RB50 (black bar) or recovered from lungs and tracheas of RAG-/- mice than RB50∆rseAB (white bar) and sacrificed on day 21 post- inoculation. Bacterial numbers in the indicated organs RB50∆rseAB (Fig. 8.3B), indicating that RB50∆rseAB are expressed as mean Log10CFU ± SE. The limit of detection is indicated by the y axis. is defective in colonization of the LRTs of mice lacking adaptive immunity. These data suggest that innate immune factors are responsible for the defect of this mutant in colonization of the LRTs.
RB50ΔrseAB is not susceptible to complement-mediated killing.
It has been previously determined that the decreased virulence of the V. vulnificus rseB mutant is associated with its sensitivity to complement due to the apparent lost of extracellular polysaccharides (4).
Among the innate immune defense mechanisms, we first hypothesized that RB50∆rseAB might show decreased resistance to complement-mediated killing. To test this, 500 CFU of RB50 or RB50ΔrseAB were incubated with 20% of complement-active or complement-inactive serum from a naïve mouse at 37°C for 1 h.
Since RB50Δwbm is susceptible to complement-mediated killing; this strain was incubated with the same serum as a positive control for complement activity (5). RB50Δwbm survived the complement-inactive serum treatment but was almost completely killed when treated with complement-active serum, indicating that in
165 this assay, complement is active (Fig. 8.4, dashed bars).
The percent survival of RB50 or RB50ΔrseAB in PBS,
PBS containing complement active or inactive serum were comparable, indicating that RB50ΔrseAB is as resistant to complement as wild-type bacteria. These data indicate that constitutive active SigE does not alter serum resistance of B. bronchiseptica and suggest that Figure 8.4: rseAB is not required for serum complement-mediated killing might not be responsible resistance. RB50∆wbm (dashed bar), RB50 (black bar) or RB50∆rseAB (white bar) was exposed to PBS (none) for the quick reduction of RB50∆rseAB numbers. or PBS containing complement active or complement inactive serum for 1h. The average percent survival of three replicates ± SE is shown.
RB50∆rseAB is less cytotoxic to murine macrophages.
B. bronchiseptica is cytotoxic to macrophages
and the Type Three Secretion System (TTSS)
contributes to this cytotoxicity (50). Since previous
study indicates that SigE might directly or indirectly
regulate expression of some TTSS related genes
(Chapter 7), we hypothesized that constitutive SigE
Figure 8.5: RB50∆rseAB is less cytotoxic to activity might affect the cytotoxicity of B. macrophages. Murine macrophages, J774, were incubated with media (cross) or media containing RB50 bronchiseptica to macrophages. To test this, J774 (square), RB50∆rseAB (triangle), RB50∆bscN (WD3) (diamond), or RB50∆bscNcyaA (AVS) (circle) for 1, 2, murine macrophages were incubated with media or 3 or 4h. The average percent cytotoxicity of four similarly treated wells as measured by (LDH release media containing RB50, RB50ΔrseAB, RB50 lacking from a well/LDH release from positive control well) × 100 ± SE is shown. ** indicates P≤0.01 compared to RB50. Sara E. Hester conducted this experiment. TTSS (WD3), or RB50 lacking both TTSS and adenylate cyclase toxin (AVS) at a MOI of 15 for up to 4h. Cytotoxicity was measured according to LDH release. Similar to the media-treated group (Fig. 8.5, cross), the negative control strains, WD3 and AVS, had caused little cytotoxicity even by 4h incubation (Fig. 8.5, diamond and circle). Wild-type RB50 had caused
~20% and ~85% cytotoxicity by 3h and 4h incubation, respectively (Fig. 8.5, square). However,
166 RB50ΔrseAB caused significantly less cytotoxicity: ~20% by 4 hours incubation (Fig. 8.5, triangle). These results indicate that RB50∆rseAB is less cytotoxic to macrophages.
RB50∆rseAB failed to cause lethal infection in TLR4 deficient mice.
Since the decreased colonization of
RB50∆rseAB was observed as early as day 3 post-
inoculation (Fig. 8.1), and since this mutant was still
defective in colonizing hosts lacking adaptive immune
responses (Fig. 8.3), we hypothesized that the proper
regulation of SigE activity might be important for B.
bronchiseptica to resist these innate immune factors.
To test this, we challenged mice lacking a key
component of the innate immunity, TLR4, with RB50
or RB50∆rseAB, and monitored these mice for survival.
Consistent with previous findings, RB50-challenged
TLR4def mice developed severe bordetellosis and
succumbed 2 to 5 days post-inoculation (26, 28). In
contrast, RB50∆rseAB-challenged TLR4def mice did not
display any sign of diseases during the 100-day period,
and were euthanized at the end of the experiment (Fig.
8.6A). Since RB50-induced bordetellosis is associated Figure 8.6: RB50∆rseAB does not cause lethal infection in TLR4def mice. (A) TLR4def mice were inoculated with 5×105 CFU of RB50 (square) or with overwhelming bacterial loads and severe RB50∆rseAB (triangle) and monitored for survival. TLR4suf (+) or TLR4def (-) mice were inoculated with inflammatory pathology (26), we sought to determine 5×105 CFU of RB50 (black bar) or RB50∆rseAB (white bar) and sacrificed on day 3 post-inoculation. (B) whether these disease parameters are absent in Bacterial numbers in the indicated organs are expressed def as mean Log10CFU ± SE. The limit of detection is RB50∆rseAB-challenged TLR4 mice. Groups of indicated by the y axis. (C) Histology pathology scores of H&E-stained lung sections are shown. The line TLR4suf or TLR4def mice were challenged with RB50 or represents the mean pathology score. ** indicates P≤0.01. Mary J. Kennett contributed to the experiment shown in Fig. 8.6 C. RB50∆rseAB and euthanized 3 days later to enumerate bacterial loads in the respiratory organs and to evaluate histopathology damage in the LRT. RB50 and
167 RB50∆rseAB colonized at similar levels in the nasal cavities of both TLR4suf and TLR4def mice (Fig. 8.6B).
In the LRT of TLR4suf mice, the average loads of RB50∆rseAB, as well as the histopathology damage caused by this mutant, appeared to be lower than those of RB50, but these comparisons did not reach statistical significance (Fig. 8.6B, C). In the TLR4def mice, significantly less RB50∆rseAB was recovered from lungs, spleens and kidneys compared to RB50 (Fig. 8.6B). Interestingly, although large numbers of RB50∆rseAB
(~107 CFU) colonized the LRT of these mice, unlike wild-type RB50, these bacteria did not appear to cause much histopathology damage (Fig. 8.6C). Taken together, these data indicate that RB50∆rseAB fails to cause lethal disease in TLR4 deficient mice, which was associated with decreased lung colonization, decreased systemic colonization and less histopathology damage.
168 Discussion:
ECF sigma factors, such as σE, have been increasingly implicated in stress responses and virulence in many bacteria, including Salmonella enterica, V. cholorae and P. aeruginosa (24, Rowley, 2006 #6, 49). The activity of σE is usually tightly regulated by its negative regulators, for example, the well-characterized rseA- rseB system in E. coli (1). Whether similar regulatory mechanisms are shared by other bacterial species and whether these regulators play a role during infection are less understood. We identified a similar genetic module to E. coli rpoE-rseA-rseB system in the respiratory pathogen, B. bronchiseptica. Moreover, we demonstrated that rseA (BB3751) and rseB (mucB) encode negative regulators of SigE, and are required for efficient colonization and persistence of B. bronchiseptica in murine hosts.
By binding tightly to the periplasmic domain of RseA, E. coli RseB inhibits the protease cleavage of
RseA (6). Deletion of rseB in E. coli results in a two-fold increase in transcription from σE–dependent promoters, whereas deletion of rseA leads to a nine-fold increase (9, 33). Conversely, inactivation of either
MucA (RseA) or MucB (RseB) in P. aeruginosa results in comparably large increases in AlgU (σE) activity
(40, 42). These findings suggest that the relative contribution of RseB to regulating SigE activity varies between species. Reporter assays have shed some light on the relative regulatory roles for RseA and RseB in
B. bronchiseptica SigE activity. A strain overexpressing sigE and rseA has decreased reporter activity compared to a strain overexpressing sigE alone. In the strain overexpressing sigE, rseA and rseB, beta- galactosidase activity is reduced to the same levels as a vector control, suggesting that RseB contributes substantially to the negative regulation of SigE in B. bronchiseptica. This study measured the combined effects of deletion of rseA and rseB on B. bronchiseptica virulence. Although we expect similar phenotypes of rseA single and rseA/rseB double mutant, future studies determining the role of RseB in SigE activity regulation in B. bronchiseptica and during infection can be accomplished by constructing and testing a rseB single deletion mutant.
It is intriguing that a strain lacking the negative regulators of SigE is more resistant to a lot of stressful conditions measured in vitro, including heat stress, perturbations by detergents and β-lactam antibiotics (Barchinger S.E. unpublished data), but is less fit during infection (Fig. 8.1). It is possible that constitutive SigE activity is beneficial when bacteria encounter the specific environmental hazards tested in
169 our in vitro experiments, while failure to appropriately shut off SigE activity during infection is instead deleterious to bacteria. When constitutively active, SigE might occupy the RNA core polymerase to prevent its engagement with other alternative sigma factors, preventing their regulon from being expressed at appropriate time and locations, and thus decreasing the fitness of B. bronchiseptica during infection. The presence of 12 genes encoding ECF sigma factors in B. bronchiseptica strain RB50 (44) is an indication of the need of this organism to express distinct groups of genes to adapt to different extracytoplasmic stress conditions, although their roles in B. bronchiseptica physiology and pathogenesis have not been investigated.
It is also not understood what in vitro or in vivo conditions will induce SigE activity in B. bronchiseptica.
Future studies using a SigE reporter system might address these questions.
There are two main possibilities to explain the attenuated virulence of the RB50∆rseAB mutant.
Because different profiles of outer membrane proteins were observed for RB50 and RB50∆rseAB (Barchinger
S.E. unpublished data), it is plausible that attenuation is due to a different profile of outer membrane proteins that may have been directly or indirectly affected by the rseA and rseB mutation. The second possibility is that the attenuation is due solely to the deleterious effects of overexpression of SigE and/or some member(s) of its regulon. Future experiments using isogenic RB50∆rseAB strain lacking sigE might distinguish between these two possibilities.
RB50∆rseAB grows slower than RB50 in optimal in vitro growth conditions for some undefined reasons. This raises the concern that this slower growth might lead to the observed defects of this mutant.
Although we cannot rule out this possibility, several observations suggest that the defects may not be explained solely by slower growth. If decreased growth rate was the only reason why RB50∆rseAB colonizes the host less efficiently, the bacterial numbers recovered throughout the respiratory tract would be decreased.
However, RB50∆rseAB colonizes efficiently in the nasal cavities of C57BL/6 (Fig. 8.1, 8.2), RAG-/- (Fig. 8.3) and TLR4def (Fig. 8.6) mice. Future experiments are needed to rule out the possibility that conditions in the nasal cavities favor the growth of RB50∆rseAB. It is also plausible that some immune defense mechanisms unique to the LRT, instead of the slower growth rate, is responsible for the reduced numbers recovered from the LRT but not from the nasal cavities.
170 Although the lower colonization by RB50∆rseAB compared to RB50 is more pronounced at the later stages of infection, adaptive immune factors might not be the targets of virulence determinants disrupted in
RB50∆rseAB. This is supported by efficient bacteria number reduction mediated by antibodies raised against
RB50∆rseAB (Fig. 8.2). This strain fails to cause lethal diseases in mice lacking B and T cells (Fig. 8.3), further indicating that some innate immune mechanisms might be the primary targets of virulence determinants lacking in RB50∆rseAB.
RB50ΔrseAB survives incubation with complement active serum (Fig. 8.4), indicating that rseA and rseB are not required for resistance to complement-mediated killing or other serum anti-microbial components. RB50ΔrseAB is less cytotoxic to macrophages compared to RB50. This is contrary to our previous findings that RB50∆sigE, the strain lacking SigE, also causes less cytotoxicity to macrophages, possibly due to decreased expression of TTSS related genes (Fig. 7.7). Although we cannot rule out the possibility that the lower cytotoxicity is due to slower growth of the RB50ΔrseAB mutant, it is also plausible that SigE activity negatively impacts cytotoxicity through TTSS dependent mechanisms. In line with this hypothesis is the previous finding that AlgU has negative effect on expression of TTSS in P. aeruginosa (48). qRT-PCR experiments measuring relative expression of genes contributing to cytotoxicity or experiments determining bacterial growth after exposure to macrophages may distinguish between these possibilities.
TLR4 and downstream signaling events are critical innate immune defense mechanisms against gram- negative bacteria including B. bronchiseptica (26, 27). TLR4def mice challenged with 5×105 CFU RB50 develop lethal diseases 2-5 days post-inoculation; whereas RB50∆rseAB fails to cause lethal diseases in these animals (Fig. 8.6 A). This correlates with decreased systemic spread of RB50∆rseAB as well as less histopathology damage caused by this bacterium (Fig. 8.6 B, C). These data suggest that TLR4 is not the primary target of virulence mechanisms disrupted in RB50∆rseAB. In the respiratory tract of TLR4def mice,
RB50∆rseAB grows to large numbers, which are higher than the loads of RB50 and RB50∆rseAB in TLR4suf mice (Fig. 8.6 B). However, RB50∆rseAB induces less inflammatory pathology in TLR4def mice compared to the pathology observed in TLR4suf mice following infection by either the wild-type or mutant bacteria (Fig.
171 8.6 C). Thus some virulence mechanisms that induce inflammatory pathology appear to be disrupted in
RB50∆rseAB.
It has been observed in several bacterial pathogens that σE is dispensable for virulence during infection but deletion of the negative regulators results in attenuated virulence. For instance, V. vulnificus rpoE deletion mutant is not significantly attenuated for virulence in immunocompetent mice (4). The negative regulator mutant of V. vulnificus lacking rseB, however, is attenuated in virulence (4). Similarly, in
A. pleuropneumoniae, a strict respiratory pathogen of swine, inactivation of rseA (mlcA), but not rpoE, results in attenuated virulence in porcine lungs (43). RB50 lacking sigE colonizes wild-type mice as efficiently as
RB50 (Fig. 7.4); whereas the mutant lacking the negative regulators, rseA and rseB, is attenuated in these mice (Fig. 8.1). These findings suggest that ECF sigma factors of RB50 may have overlapping functions and the others sigma factors might compensate for the lack of SigE. However, it is critical to ensure the tight regulation of these sigma factors activities during infection.
172 Authors and Contributions:
Xuqing Zhang1,2, Sara E. Hester1,3,4, Mary J. Kennett1, and Eric T. Harvill1
1Department of Veterinary and Biomedical Sciences, The Pennsylvania State University, 115
Henning Building, University Park, Pennsylvania 16802
2Graduate Program in Genetics, The Pennsylvania State University, University Park
3Department of Biochemistry, Microbiology, and Molecular Biology, The Pennsylvania State
University, University Park
4Graduate Program in Biochemistry, Microbiology and Molecular Biology, The Pennsylvania State
University, University Park
Conceived and designed the experiments: XZ, SEH, ETH.
Performed the experiments: XZ, SHE, MJK.
Analyzed the data: XZ, SEH, MJK.
Wrote the paper: XZ, ETH.
173 References:
1. Ades, S. E. 2004. Control of the alternative sigma factor sigmaE in Escherichia coli. Curr Opin Microbiol 7:157-162. 2. Ades, S. E., L. E. Connolly, B. M. Alba, and C. A. Gross. 1999. The Escherichia coli sigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13:2449-2461. 3. Alba, B. M., and C. A. Gross. 2004. Regulation of the Escherichia coli sigma-dependent envelope stress response. Mol Microbiol 52:613-619. 4. Brown, R. N., and P. A. Gulig. 2009. Roles of RseB, sigmaE, and DegP in virulence and phase variation of colony morphotype of Vibrio vulnificus. Infect Immun 77:3768-3781. 5. Burns, V. C., E. J. Pishko, A. Preston, D. J. Maskell, and E. T. Harvill. 2003. Role of Bordetella O antigen in respiratory tract infection. Infect Immun 71:86-94. 6. Cezairliyan, B. O., and R. T. Sauer. 2007. Inhibition of regulated proteolysis by RseB. Proc Natl Acad Sci U S A 104:3771-3776. 7. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-3390. 8. Craig, J. E., A. Nobbs, and N. J. High. 2002. The extracytoplasmic sigma factor, final sigma(E), is required for intracellular survival of nontypeable Haemophilus influenzae in J774 macrophages. Infect Immun 70:708-715. 9. De Las Penas, A., L. Connolly, and C. A. Gross. 1997. The sigmaE-mediated response to extracytoplasmic stress in Escherichia coli is transduced by RseA and RseB, two negative regulators of sigmaE. Mol Microbiol 24:373-385. 10. De Las Penas, A., L. Connolly, and C. A. Gross. 1997. SigmaE is an essential sigma factor in Escherichia coli. J Bacteriol 179:6862-6864. 11. Flynn, J. M., I. Levchenko, R. T. Sauer, and T. A. Baker. 2004. Modulating substrate choice: the SspB adaptor delivers a regulator of the extracytoplasmic-stress response to the AAA+ protease ClpXP for degradation. Genes Dev 18:2292-2301. 12. Gacesa, P. 1998. Bacterial alginate biosynthesis--recent progress and future prospects. Microbiology 144 ( Pt 5):1133-1143. 13. Giacometti, A., O. Cirioni, Y. Gov, R. Ghiselli, M. S. Del Prete, F. Mocchegiani, V. Saba, F. Orlando, G. Scalise, N. Balaban, and G. Dell'Acqua. 2003. RNA III inhibiting peptide inhibits in vivo biofilm formation by drug-resistant Staphylococcus aureus. Antimicrob Agents Chemother 47:1979-1983. 14. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O-antigen Protects Bordetella parapertussis from Complement. Infect Immun. 15. Govan, J. R., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60:539-574. 16. Grigorova, I. L., R. Chaba, H. J. Zhong, B. M. Alba, V. Rhodius, C. Herman, and C. A. Gross. 2004. Fine- tuning of the Escherichia coli sigmaE envelope stress response relies on multiple mechanisms to inhibit signal- independent proteolysis of the transmembrane anti-sigma factor, RseA. Genes Dev 18:2686-2697. 17. Harvill, E. T., P. A. Cotter, M. H. Yuk, and J. F. Miller. 1999. Probing the function of Bordetella bronchiseptica adenylate cyclase toxin by manipulating host immunity. Infect Immun 67:1493-1500. 18. Harvill, E. T., A. Preston, P. A. Cotter, A. G. Allen, D. J. Maskell, and J. F. Miller. 2000. Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect Immun 68:6720-6728. 19. Hayden, J. D., and S. E. Ades. 2008. The Extracytoplasmic Stress Factor, sigma, Is Required to Maintain Cell Envelope Integrity in Escherichia coli. PLoS ONE 3:e1573. 20. Helmann, J. D. 2002. The extracytoplasmic function (ECF) sigma factors. Adv Microb Physiol 46:47-110. 21. Kazmierczak, M. J., M. Wiedmann, and K. J. Boor. 2005. Alternative sigma factors and their roles in bacterial virulence. Microbiol Mol Biol Rev 69:527-543. 22. Kirimanjeswara, G. S., Agosto, L.M., Kennet, M.J., Bjornstad, O.N., and Harvill, E.T. 2005. Pertussis toxin inhibits neutrophil recruitment to inhibit antibody-mediated clearance of Bordetella pertussis. J Clin Invest. 23. Kirimanjeswara, G. S., P. B. Mann, M. Pilione, M. J. Kennett, and E. T. Harvill. 2005. The complex mechanism of antibody-mediated clearance of Bordetella from the lungs requires TLR4. J Immunol 175:7504-7511. 24. Kovacikova, G., and K. Skorupski. 2002. The alternative sigma factor sigma(E) plays an important role in intestinal survival and virulence in Vibrio cholerae. Infect Immun 70:5355-5362. 25. Mann, P., E. Goebel, J. Barbarich, M. Pilione, M. Kennett, and E. Harvill. 2007. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infect Immun 75:3665-3672.
174 26. Mann, P. B., K. D. Elder, M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4-dependent early elicited tumor necrosis factor alpha expression is critical for innate host defense against Bordetella bronchiseptica. Infect Immun 72:6650-6658. 27. Mann, P. B., M. J. Kennett, and E. T. Harvill. 2004. Toll-like receptor 4 is critical to innate host defense in a murine model of bordetellosis. J Infect Dis 189:833-836. 28. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 29. Martin, D. W., M. J. Schurr, M. H. Mudd, and V. Deretic. 1993. Differentiation of Pseudomonas aeruginosa into the alginate-producing form: inactivation of mucB causes conversion to mucoidy. Mol Microbiol 9:497- 506. 30. Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. Govan, B. W. Holloway, and V. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients. Proc Natl Acad Sci U S A 90:8377-8381. 31. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 32. Mecsas, J., P. E. Rouviere, J. W. Erickson, T. J. Donohue, and C. A. Gross. 1993. The activity of sigma E, an Escherichia coli heat-inducible sigma-factor, is modulated by expression of outer membrane proteins. Genes Dev 7:2618-2628. 33. Missiakas, D., M. P. Mayer, M. Lemaire, C. Georgopoulos, and S. Raina. 1997. Modulation of the Escherichia coli sigmaE (RpoE) heat-shock transcription-factor activity by the RseA, RseB and RseC proteins. Mol Microbiol 24:355-371. 34. Missiakas, D., and S. Raina. 1998. The extracytoplasmic function sigma factors: role and regulation. Mol Microbiol 28:1059-1066. 35. Muller, C., I. S. Bang, J. Velayudhan, J. Karlinsey, K. Papenfort, J. Vogel, and F. C. Fang. 2009. Acid stress activation of the sigma(E) stress response in Salmonella enterica serovar Typhimurium. Mol Microbiol 71:1228-1238. 36. Parkhill, J., M. Sebaihia, A. Preston, L. D. Murphy, N. Thomson, D. E. Harris, M. T. Holden, C. M. Churcher, S. D. Bentley, K. L. Mungall, A. M. Cerdeno-Tarraga, L. Temple, K. James, B. Harris, M. A. Quail, M. Achtman, R. Atkin, S. Baker, D. Basham, N. Bason, I. Cherevach, T. Chillingworth, M. Collins, A. Cronin, P. Davis, J. Doggett, T. Feltwell, A. Goble, N. Hamlin, H. Hauser, S. Holroyd, K. Jagels, S. Leather, S. Moule, H. Norberczak, S. O'Neil, D. Ormond, C. Price, E. Rabbinowitsch, S. Rutter, M. Sanders, D. Saunders, K. Seeger, S. Sharp, M. Simmonds, J. Skelton, R. Squares, S. Squares, K. Stevens, L. Unwin, S. Whitehead, B. G. Barrell, and D. J. Maskell. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 37. Pilione, M. R., L. M. Agosto, M. J. Kennett, and E. T. Harvill. 2006. CD11b is required for the resolution of inflammation induced by Bordetella bronchiseptica respiratory infection. Cell Microbiol 8:758-768. 38. Preston, A., A. G. Allen, J. Cadisch, R. Thomas, K. Stevens, C. M. Churcher, K. L. Badcock, J. Parkhill, B. Barrell, and D. J. Maskell. 1999. Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect Immun 67:3763-3767. 39. Raivio, T. L. 2005. Envelope stress responses and Gram-negative bacterial pathogenesis. Mol Microbiol 56:1119-1128. 40. Rowen, D. W., and V. Deretic. 2000. Membrane-to-cytosol redistribution of ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol Microbiol 36:314- 327. 41. Rowley, G., M. Spector, J. Kormanec, and M. Roberts. 2006. Pushing the envelope: extracytoplasmic stress responses in bacterial pathogens. Nat Rev Microbiol 4:383-394. 42. Schurr, M. J., H. Yu, J. M. Martinez-Salazar, J. C. Boucher, and V. Deretic. 1996. Control of AlgU, a member of the sigma E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J Bacteriol 178:4997-5004. 43. Sheehan, B. J., J. T. Bosse, A. J. Beddek, A. N. Rycroft, J. S. Kroll, and P. R. Langford. 2003. Identification of Actinobacillus pleuropneumoniae genes important for survival during infection in its natural host. Infect Immun 71:3960-3970. 44. Staron, A., H. J. Sofia, S. Dietrich, L. E. Ulrich, H. Liesegang, and T. Mascher. 2009. The third pillar of bacterial signal transduction: classification of the extracytoplasmic function (ECF) sigma factor protein family. Mol Microbiol 74:557-581. 45. Stibitz, S., and N. H. Carbonetti. 1994. Hfr mapping of mutations in Bordetella pertussis that define a genetic locus involved in virulence gene regulation. J Bacteriol 176:7260-7266.
175 46. Walsh, N. P., B. M. Alba, B. Bose, C. A. Gross, and R. T. Sauer. 2003. OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. Cell 113:61-71. 47. Wozniak, D. J., A. B. Sprinkle, and P. J. Baynham. 2003. Control of Pseudomonas aeruginosa algZ expression by the alternative sigma factor AlgT. J Bacteriol 185:7297-7300. 48. Wu, W., H. Badrane, S. Arora, H. V. Baker, and S. Jin. 2004. MucA-mediated coordination of type III secretion and alginate synthesis in Pseudomonas aeruginosa. J Bacteriol 186:7575-7585. 49. Yu, H., J. C. Boucher, N. S. Hibler, and V. Deretic. 1996. Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (sigmaE). Infect Immun 64:2774-2781. 50. Yuk, M. H., E. T. Harvill, and J. F. Miller. 1998. The BvgAS virulence control system regulates type III secretion in Bordetella bronchiseptica. Mol Microbiol 28:945-959.
176
Chapter 9
Summary and Significance
B. pertussis, B. parapertussis, B. holmesii, and B. bronchiseptica are endemic respiratory pathogens in humans or other mammals. B. pertussis and B. parapertussis are both etiologic agents of whooping cough
(36, 50), a resurging disease in developed countries despite high vaccine coverage (1, 14, 18, 66, 73). B. holmesii, a recently recognized Bordetella species, also causes whooping-cough like diseases in humans (75,
79). B. bronchiseptica is prevalent in companion and agricultural mammals (28), and is very closely-related to these human-adapted bordetellae (19, 56). This dissertation presented several aspects of interactions between these endemic bordetellae with the host, as well as cross-protection mediated by vaccines, aiming to not only address some basic scientific questions but also to provide implications for future vaccine design.
Implications
O-antigen and the emergence of B. parapertussis as a human pathogen
O-antigen is costly to produce in terms of energy and is a protective antigen of some bacterial species
(41, 57, 58). Our research determined that O-antigen is a dominant surface antigen of B. parapertussis, efficiently inducing immunity that is protective (83) (Chapter 2). O-antigen must therefore confer some advantages to bacteria in order to be maintained. For example, the O-antigen of Klebsiella pneumoniae decreases macrophage activation, conveys resistance to neutrophil killing, and promotes persistent infection after the onset of bacteremia (44). O-antigen also protects B. bronchiseptica and B. parapertussis from complement-mediated killing in naïve animals (26, 59).
Our study suggested that O-antigen may favor the emergence of B. parapertussis as a human pathogen (Chapter 3). B. parapertussis diverged from a B. bronchiseptica-like progenitor some time later than B. pertussis (56). B. parapertussis likely invaded a population in which B. pertussis was endemic. Thus, this pathogen had to avoid B. pertussis-induced immunity to exploit the human hosts (8). Therefore, blocking binding and functions of B. pertussis infection- or vaccination-induced antibodies via O-antigen could have allowed B parapertussis to invade the human population and prosper in it (77, 84) (Chapter 3). Immune-
177 mediated competition with B. pertussis may thus be one selective pressure that causes B. parapertussis to maintain its O-antigen.
Cross-protection by B. pertussis immunity against endemic bordetellae
Cross-protection by closely-related pathogens is common. One well-known example is the cross- protection of cow pox immunity against small pox. However, pathogens may evolve to avoid cross- protection. For instance, evolution of the hemagglutinin and neuraminidase genes allows multiple influenza strains to co-circulate in one population (24). While protection by closely-related species is observed for a range of pathogens, this is not always the case for the bordetellae. The great majority of human populations have immunity to B. pertussis due to vaccination and/or natural infection. B. bronchiseptica is susceptible to
B. pertussis immunity, possibly via antibody responses against two shared antigens, pertactin and filamentous hemagglutinin (27). Moreover, current B. bronchiseptica isolates from humans are sensitive to B. pertussis- induced immunity (27), suggesting that B. bronchiseptica may not be antigenically distinct enough to avoid B. pertussis-induced immunity. Although B. parapertussis/B. holmesii and B. pertussis do share cross-reactive antigens, B. pertussis-specific antibodies do not efficiently bind to B. parapertussis or B. holmesii (77, 83)
(Chapter 3, 4). Therefore, B. parapertussis and B. holmesii are resistant to B. pertussis-induced immunity
(77, 83) (Chapter 3, 4).
Human health and vaccine design
Long term epidemiology studies of B. pertussis, B. parapertussis and B. holmesii are essential to understand the relative roles of these pathogens in the resurgence of whooping cough. Current vaccines, consisting of only B. pertussis antigens, are effective against B. pertussis, but are ineffective against B. parapertussis and B. holmesii (17, 32, 33, 42, 49, 84) (Chapter 3, 4). This may confer a selective, immune- mediated advantage to these two pathogens. Indeed, B. parapertussis has been reported to cause a higher proportion of disease in vaccinated versus unvaccinated individuals (42), and in the age-group that is most recently vaccinated against B. pertussis (6, 40, 76). B. holmesii has been consistently isolated from patients in
Massachusetts where the vaccine coverage is quite high (Chapter 4). These data may warrant efforts to design vaccines against these two human pathogens.
178 The immune response induced by B. parapertussis or B. holmesii does protect against subsequent challenge against itself (77, 83) (Chapter 2, 4). This raises the question: what antigens of B. parapertussis or
B. holmesii induce a protective immune response? Our data indicate that O-antigen is a key protective antigen of B. parapertussis (83) (Chapter 2). Further research to identify other protective antigens of B. parapertussis or B. holmesii and inclusion of them in the vaccine would likely decrease the incidence of these two endemic bordetellae. B. parapertussis and B. holmesii can account for a substantial portion of whooping cough cases (9, 46, 61, 74, 79). Thus, introducing vaccines that are effective against these two pathogens would likely decrease the overall whooping cough incidence.
Indispensible and distinct roles played by IL-1 and IL-6 signaling following B. pertussis-infection
One of the key innate immune defense mechanisms is the recognition of pathogen-associated- molecular-patterns by pattern-recognition-receptors, such as Toll-like receptors. For gram-negative bacteria, the engagement of LPS with TLR4 leads to activation of signaling events that induce various cellular responses including secretion of cytokines. These cytokines thus engage with their receptors and mount downstream signaling events affecting various aspects of host defenses. Elucidating functions of these cytokine-mediated signaling pathways is critical to understanding the innate immune response. Since innate immune effectors also impact adaptive immune functions, studies on these innate immune cytokines may also reveal critical events regulating the switch from innate to adaptive immunity. Following B. pertussis infection, TLR4-deficient mice harbor more bacteria later during infection, which is associated with elevated cellular infiltration and pathology (35). B. pertussis-induced TNF-α, IL-1 and IL-6 production are dependent on TLR4 (35, 48). TNF-α deficient mice have increased B. pertussis loads and elevated inflammation in their lungs (78). We showed indispensible and distinct roles of IL-1 and IL-6 in immune responses to B. pertussis, as discussed below.
Mortality or morbidity associated with infectious diseases often occurs as a result of dysregulated inflammation. The mucosal surface of the respiratory tract is normally maintained sterile by the generation of strong immune responses. These responses must be strong enough to eliminate pathogens. They must also be resolved appropriately to limit any damage. This underscores a critical balance between host and pathogen that dictate the outcome of an infection. Intranasal inoculation of wild-type C57BL/6 mice with
179 approximately 5×105 CFU of B. pertussis has no apparent effect on the health of the animal, despite the ability of this bacterium to efficiently colonize the respiratory tract and persist in the lungs for more than 30 days. However, a similar dose of B. pertussis challenge in IL-1R-/- mice results in lethal infection, likely due to uncontrolled bacterial numbers in the respiratory tract, massive cellular infiltration, overwhelming pathology, as well as disseminated spread of the infection (Chapter 5). Compared to the wild-type cells, IL-
1R-deficient dendritic cells or macrophages produce less IL-10 in response to B. pertussis. Moreover, IL-1R-
/- mice fail to increase antigen-specific systemic IL-10 responses in the later stages of infection (Chapter 5).
Several clinical and experimental studies have shown that IL-10 depresses B. pertussis-specific IFN-γ production (23, 52). Higgins et al. have shown that TLR4-mediated innate IL-10 responses inhibit Th1 responses during B. pertussis infection (35). Since IL-1R and TLR4 signaling share the adaptor molecule,
MyD88, IL-1R signaling may be involved in inducing the IL-10 responses via similar signaling events. These data suggest that the decreased IL-10 responses in IL-1R-/- mice may be partially responsible for their elevated pro-inflammatory cytokine responses and uncontrolled inflammatory responses.
Although IL-6-/- mice harbor similar numbers of bacteria compared to wild-type mice during the first week following B. pertussis inoculation, they harbor more bacteria later during infection, and show a delayed clearance (Chapter 6). These data implicate a role for IL-6, an innate immune effecter, in adaptive immune responses against B. pertussis. Indeed, we observed decreased B. pertussis-specific antibody generation, decreased leukocyte accumulation in the lungs, as well as decreased T cell cytokine responses following B. pertussis infection in IL-6-/- mice. These are consistent with increasing evidence showing the modulating role of IL-6 in adaptive immune functions (20, 37).
TNF-α, IL-1 and IL-6 are all effecter cytokines of TLR4 signaling (35, 48). Although each plays indispensible roles for efficient immune responses against B. pertussis, they impact different aspects of the host immunity (78) (Chapter 5, 6). This highlights the complexity of immunity against B. pertussis. TNF-α or IL-1R deficient mice survive the challenge of B. parapertussis or a B. pertussis strain lacking Ptx (78)
(Chapter 5), suggesting that TNF-α and IL-1R are required to overcome the effects of this toxin. What these
Ptx-associated effects are may warrant further investigation.
Regulation of B. pertussis-induced IL-17 responses by IL-6 and IL-1R
180 IL-17-producing Th17 cells are distinct from Th1 or Th2 cells and have been shown to play pathogenic roles in autoimmune diseases (31, 39, 43, 55). IL-17 also contributes to host defenses against bacterial infections, including those induced by Klebsiella pneumonia (30), Bacteroides fragilis (15),
Streptococcus pneumonia (85) and Mycobacterium tuberculosis (38). Some recent studies suggest that
Bordetella infection may induce a Th17-polarized immune response. B. bronchiseptica-infected murine macrophages induce IL-17 production by T cells in vitro and a strong IL-17 response is detected by re- stimulated lung tissue from B. bronchiseptica-infected mice (64). Nasso et al. have recently shown that the genetically detoxified pertussis toxin induces the secretion of IL-17 by purified T cells, through crucial roles played by MAPK and IL-10 (54). Pertussis toxin contributes to the induction of IL-17 during B. pertussis infection in mice (5). IL-17 has been shown to promote macrophage killing of B. pertussis and the efficacy of a B. pertussis whole cell vaccine (34). Studies using the neutralizing antibodies have suggested the involvement of IL-17 in controlling B. pertussis numbers in the lungs (5).
Several cytokines have been implicated in Th17 cells development. IL-23 can differentiate T cells into Th17 cells (31, 39, 55). Transforming growth factor β (TGF-β) upregulates IL-23R expression and is critical for the commitment to Th17 development (47). IL-6 and TGF-β together induce the differentiation of
Th17 cells from naïve T cells (7). IL-1β has been found to be essential for the differentiation of IL-17- producing human Th cells (2). Mouse models of arthritis and encephalomyelitis have also revealed the involvement of IL-1 in the generation of IL-17-producing cells (53, 70). The role for IL-6 or IL-1R in inducing IL-17 production during bacterial infection has not been previously described. In this dissertation,
IL-6 is determined to be required for the efficient induction of antigen-specific splenic IL-17 response during
B. pertussis infection (Chapter 6). Our data also showed that IL-1R is necessary for the local and systemic
IL-17 responses during B. pertussis infection (Chapter 5). Although the roles for Th17 cells in immune responses against B. pertussis are not fully understood, this work demonstrated the involvement of IL-6 and
IL-1R in inducing IL-17 responses following B. pertussis infection.
Potential microbial infection following anti-cytokine therapies
IL-1R and IL-6 are required for efficient control of B. pertussis infection, which raises the concern of exacerbating B. pertussis infection for patients undergoing anti-cytokine therapies. Blocking IL-1 secretion or
181 IL-1R mediated signaling is a common treatment for chronic inflammatory diseases, such as rheumatoid arthritis and Crohn’s disease (10, 29). Anti-IL-6 treatment has been proposed for patients with Castleman’s disease or rheumatoid arthritis (67, 80). These treatments are associated with increased incidence of respiratory infections (25). Based on our data (Chapter 5, 6), similar effects may be observed for B. pertussis infection.
SigE system in B. bronchiseptica physiology and pathogenesis, regulation other than BvgAS
The ability to communicate information about the changing environment and the state of the cell is critical to pathogenic bacteria, and is usually through signal transduction systems. One example of such systems is the BvgAS two-component system. BvgAS regulates the expression of many virulence-associated genes in classical bordetellae and is both necessary and sufficient for respiratory tract infections (16).
Another well-established class of signal transduction systems is the extracytoplasmic (ECF) sigma factor. B. bronchiseptica strain RB50 is predicted to encode 12 ECF sigma factors (68). Although members of the iron starvation subfamily of ECF sigma factors have been reported to regulate expression of heme iron transport genes (60, 72), the functions of other ECF sigma factors in B. bronchiseptica physiology and pathogenesis have not been previously determined.
We focused on a genetic module in RB50, which encodes the E. coli σE-like sigma factor, SigE, and the putative negative regulators, RseA and RseB. By constructing the RB50∆sigE and RB50∆rseAB mutants and exposing them to various stress conditions, we determined that the B. bronchiseptica SigE system contributes to resistance to heat and ethanol stress, as well as cell envelope stresses posed by SDS and some
β-lactam antibiotics. RB50∆sigE colonizes and persists in wild-type mice similarly to wild-type bacteria, whereas RB50∆rseAB colonizes the LRTs of these mice less efficiently and is cleared from the LRTs faster than the wild-type bacteria (Chapter 7, 8). In hosts lacking B and T cells (RAG-/- mice), wild-type B. bronchiseptica establishes systemic colonization and survives additional stresses in the systemic organs.
RB50∆sigE, however, does not cause systemic and lethal infection in these mice (Chapter 7). Together, these findings indicate the role of SigE and the proper regulation of its activity in both physiology and pathogenesis of B. bronchiseptica.
182 Future Directions
Remaining questions on the roles of IL-1R or IL-6 in immunity against bordetellae
Disseminated colonization of B. pertussis outside of the respiratory tract is only observed in mice lacking certain immune functions. For example, systemic colonization of B. pertussis has been observed in
IFN-γR-/- mice (45). Depletion of NK cells results in a marked reduction of IFN-γ in the lung that leads to disseminated spread of B. pertussis (12). We observed systemic spread of B. pertussis into blood, spleens and livers of the IL-1R-/- mice (Chapter 5). Small numbers of B. pertussis are recovered from the livers of both wild-type and IL-1R-/- mice on day 3 post-inoculation. However, the bacterium is consistently recovered from the livers of mice lacking IL-1R but not wild-type mice later during infection. This indicates some IL-1R- dependent clearance mechanisms in the liver. Future studies trying to understand this phenomenon and the broader questions related to the mechanisms of systemic spread of bordetellae may improve our understanding of Bordetella pathogenesis.
IL-1R-/- mice are not responsive to either IL-1α or IL-1β. We determined that these mice are more susceptible to B. pertussis infection. Future experiments using depletion antibodies specific for IL-1α or IL-
1β, or using IL-1α-/- or IL-1β-/- mice, may address which IL-1 is critical to host defenses against B. pertussis.
If IL-1β is required, we can further explore the role of caspase-1 in immune responses against B. pertussis since caspase-1 is required for the secretion and activation of IL-1β (21). IL-18, a critical cytokine for Th1 cell activation, is structurally similar to IL-1R ligands (71). Moreover, IL-18R is in the same TIR superfamily as IL-1R, sharing MyD88 as the downstream adaptor molecule (22). Future experiments using IL-18/IL-18R and/or MyD88 deficient mice will shed more light on the distinct roles of TIR superfamily receptor pathways during B. pertussis infection.
We have preliminary results indicating a role of IL-1R and IL-6 in host defenses against B. bronchiseptica. Since B. bronchiseptica has an overlapping but distinct repertoire of virulence determinants compared to B. pertussis, the interactions between IL-1R or IL-6 signaling pathway and this bacterium might be different from how it interacts with B. pertussis. It will be interesting to determine what B. bronchiseptica factors induce IL-1 and IL-6 production during infection, what aspects of the immune responses are impaired
183 in IL-1R-/- or IL-6-/- mice following B. bronchiseptica infection, and how these differ from the situations during B. pertussis infection.
Determine the conditions inducing SigE activity via reporter assay
RB50∆sigE behaves similarly to RB50 in wild-type mice (Chapter 7). This observation may indicate that SigE is not important in colonizing the immunocompetent hosts. Alternatively, redundant roles played by other ECF sigma factors may compensate for SigE functions. To distinguish between these two possibilities, we can develop a reporter assay through fusing SigE-dependent promoter sequence with a reporter gene. SigE-dependent promoter sequence can be identified by in silico approaches or by comparing
5’ RACE (Rapid Amplification of cDNA Ends) products from RNA generated in the presence and absence of
SigE. Once the reporter assay is developed, we can examine whether SigE activity is induced by various stresses, and determine when and where SigE activity is induced during infection.
Define SigE regulon in RB50
Another approach to better understand the function of SigE is to determine its regulon. SigE has similar activity to σE, indicating that SigE-dependent promoters are similar to E. coli σE-dependent promoters
(Chapter 7). We took the advantage of this observation and constructed a position-weight matrix using known E. coli σE-regulated promoter and scanned the B. bronchiseptica RB50 genome with this matrix (63)
(Barchinger S.E., Nixon B.T., unpublished data). Using in vitro transcription assays, we have identified five sequences that are transcribed by holoenzyme reconstituted with purified SigE and E. coli core RNA polymerase in vitro (Barchinger S.E., unpublished data). These sequences are in the promoter regions of fam, which encodes the heat shock sigma factor, σ32, hfq, which encodes a small RNA-binding protein, rseA, mucD, a serine protease, and BB3108, encoding a hypothetical protein (Barchinger S.E., unpublished data). A second approach to identify SigE-dependent promoters is run-off transcription coupled to microarray analysis
(ROMA) (13). A third approach is to identify the genes with increased expression in the strain lacking the negative regulators, RB50∆rseAB, by microarray analysis. Once more SigE-dependent promoters are verified, a new PWM specific for SigE can be created to better predict the SigE regulon by in silico analyses.
It will also be informative to compare these methods and discuss the advantages and disadvantages of each
184 approach. By focusing on the genes identified by multiple approaches, we will also minimize the number of false positives.
Determine functions of other ECF sigma factors in RB50
B. bronchiseptica strain RB50 has twelve predicted sigma factors, six of which are conserved in other bacterial species [BB1837, BB2661, BB1302, BB3268, SigE (BB3752), BB3268] (Barchinger S.E., Ades
S.E., unpublished data) (68). The genomic context of these sigma factors is also conserved, suggesting that their adjacent genes might be regulators of the sigma factor. Future studies on the roles of these sigma factors and their putative regulators in B. bronchiseptica will not only improve our understanding of physiology and pathogenesis of B. bronchiseptica but also shed light on the functions of their homologues in other bacterial species. Although three of the remaining sigma factors in RB50 do not share significant sequence conservation with other species, the other three are FecI-like sigma factors, which are predicted to be involved in iron scavenging (11, 60). Since iron scavenging is a critical aspect of bacterial physiology, these FecI-like sigma factors might be important for B. bronchiseptica.
ECF sigma factors in other bordetellae
The ECF sigma factors have an interesting pattern of conservation in B. parapertussis and B. pertussis. Future studies can explore questions on the evolution of these proteins and possibly relate these to functional changes during host adaptation. B. parapertussis retained all six conserved sigma factors, whereas
BB2661 was deleted from B. pertussis genome and homologue of BB3268 in B. pertussis is a pseudogene. It is likely that the sigma factors lost or not functional in B. pertussis are required for interactions with the hosts specific for B. bronchiseptica. Sequences are available for several Bordetella genomes. With these and the knowledge of SigE regulon members in RB50, comparisons can be made to determine how many SigE regulon members are present in other Bordetella species and whether SigE-dependent promoter sequence can be found for these genes. In addition, the PWM can be used to search for regulon members in the other
Bordetella genomes to determine if any additional genes have been added to the regulon.
Proteolytic degradation of RseA in RB50
In E. coli, the membrane proteases, DegS and RseP, initiate the proteolytic cascade to degrade RseA and thus release σE (3, 4). Putative homologues of these membrane proteases in B. bronchiseptica are
185 identified (Barchinger S.E., Ades S.E., unpublished data), suggesting similar regulatory mechanism. In E. coli, an inducing stress, such as exposure to ethanol or high temperature, triggers the degradation of RseA (4).
Future studies comparing RseA stability before and after exposure to these stresses will determine if this mechanism is conserved in B. bronchiseptica. Mutants of homologues of these proteases in B. bronchiseptica can be constructed to determine their roles in stress responses and during infection.
Potential roles for SigE in regulating TTSS
B. bronchiseptica, like several other gram-negative pathogens, expresses a TTSS (82). In vitro studies have implicated the TTSS in causing necrotic cell death or cytotoxicity to mammalian cells (69). The ability of B. bronchiseptica to establish persistent infection is dependent on TTSS, presumably due to modulation of cellular signaling pathways and subsequent cellular functions (62, 65, 81). We observed the impact of SigE system on cytotoxicity and the expression of some TTSS genes (Chapter 7, 8). We will be able to determine if this effect is direct or indirect once we determine if SigE regulon members include TTSS genes. BvgAS two-component system regulates TTSS secretion in B. bronchiseptica (82). btrS, encoding an
ECF sigma factor, is necessary and sufficient for transcription of all bsc TTSS genes (51). BvgAS exerts control over the entire TTSS by regulating btrS (51). Future experiments are needed to determine the role, if any, SigE plays in the TTSS regulatory cascade.
186 References
1. 2002. From the Centers for Disease Control and Prevention. Pertussis--United States, 1997-2000. JAMA 287:977-979. 2. Acosta-Rodriguez, E. V., G. Napolitani, A. Lanzavecchia, and F. Sallusto. 2007. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol 8:942-949. 3. Ades, S. E. 2008. Regulation by destruction: design of the sigmaE envelope stress response. Curr Opin Microbiol 11:535-540. 4. Ades, S. E., L. E. Connolly, B. M. Alba, and C. A. Gross. 1999. The Escherichia coli sigma(E)-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13:2449-2461. 5. Andreasen, C., D. A. Powell, and N. H. Carbonetti. 2009. Pertussis toxin stimulates IL-17 production in response to Bordetella pertussis infection in mice. PLoS One 4:e7079. 6. Bergfors, E., B. Trollfors, J. Taranger, T. Lagergard, V. Sundh, and G. Zackrisson. 1999. Parapertussis and pertussis: differences and similarities in incidence, clinical course, and antibody responses. Int J Infect Dis 3:140-146. 7. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238. 8. Bjornstad, O. N., and E. T. Harvill. 2005. Evolution and emergence of Bordetella in humans. Trends Microbiol 13:355-359. 9. Borska, K. a. S., M. 1972. Studies on the circulation of Bordetella pertussis and Bordetella parapertussis in populations of children. J Hyg Epidemiol Microbiol Immunol 16:159-172. 10. Bresnihan, B., J. M. Alvaro-Gracia, M. Cobby, M. Doherty, Z. Domljan, P. Emery, G. Nuki, K. Pavelka, R. Rau, B. Rozman, I. Watt, B. Williams, R. Aitchison, D. McCabe, and P. Musikic. 1998. Treatment of rheumatoid arthritis with recombinant human interleukin-1 receptor antagonist. Arthritis Rheum 41:2196-2204. 11. Burgos, J. M., N. D. King-Lyons, and T. D. Connell. 2009. Expression of BfrH, a putative siderophore receptor of Bordetella bronchiseptica, is regulated by iron, Fur1, and the extracellular function (ECF) sigma factor EcfI. Infect Immun. 12. Byrne, P., P. McGuirk, S. Todryk, and K. H. Mills. 2004. Depletion of NK cells results in disseminating lethal infection with Bordetella pertussis associated with a reduction of antigen-specific Th1 and enhancement of Th2, but not Tr1 cells. Eur J Immunol 34:2579-2588. 13. Cao, M., P. A. Kobel, M. M. Morshedi, M. F. Wu, C. Paddon, and J. D. Helmann. 2002. Defining the Bacillus subtilis sigma(W) regulon: a comparative analysis of promoter consensus search, run-off transcription/macroarray analysis (ROMA), and transcriptional profiling approaches. J Mol Biol 316:443-457. 14. Celentano LP, M. M., Paramatti D, Salmaso S, Tozzi AE; EUVAC-NET Group. . 2005. Resurgence of pertussis in Europe. Pediatr Infect Dis J 24:761-765. 15. Chung, D. R., D. L. Kasper, R. J. Panzo, T. Chitnis, M. J. Grusby, M. H. Sayegh, and A. O. Tzianabos. 2003. CD4+ T cells mediate abscess formation in intra-abdominal sepsis by an IL-17-dependent mechanism. J Immunol 170:1958-1963. 16. Cotter, P. A., and J. F. Miller. 1994. BvgAS-mediated signal transduction: analysis of phase-locked regulatory mutants of Bordetella bronchiseptica in a rabbit model. Infect Immun 62:3381-3390. 17. David, S., van Furth, R., and Mooi, F.R. 2004. Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22:1892-1898. 18. de Melker, H. E., J. F. Schellekens, S. E. Neppelenbroek, F. R. Mooi, H. C. Rumke, and M. A. Conyn-van Spaendonck. 2000. Reemergence of pertussis in the highly vaccinated population of the Netherlands: observations on surveillance data. Emerg Infect Dis 6:348-357. 19. Diavatopoulos, D. A., C. A. Cummings, H. G. van der Heide, M. van Gent, S. Liew, D. A. Relman, and F. R. Mooi. 2006. Characterization of a highly conserved island in the otherwise divergent Bordetella holmesii and Bordetella pertussis genomes. J Bacteriol 188:8385-8394. 20. Dienz, O., and M. Rincon. 2009. The effects of IL-6 on CD4 T cell responses. Clin Immunol 130:27-33. 21. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095-2147. 22. Dinarello, C. A. 1999. IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol 103:11-24. 23. Dirix, V., V. Verscheure, T. Goetghebuer, M. Hainaut, A. S. Debrie, C. Locht, and F. Mascart. 2009. Monocyte-derived interleukin-10 depresses the Bordetella pertussis-specific IFN-{gamma} response in vaccinated infants. Clin Vaccine Immunol.
187 24. Finkelman, B. S., C. Viboud, K. Koelle, M. J. Ferrari, N. Bharti, and B. T. Grenfell. 2007. Global patterns in seasonal activity of influenza A/H3N2, A/H1N1, and B from 1997 to 2005: viral coexistence and latitudinal gradients. PLoS One 2:e1296. 25. Fleischmann, R. M., J. Tesser, M. H. Schiff, J. Schechtman, G. R. Burmester, R. Bennett, D. Modafferi, L. Zhou, D. Bell, and B. Appleton. 2006. Safety of extended treatment with anakinra in patients with rheumatoid arthritis. Ann Rheum Dis 65:1006-1012. 26. Goebel, E. M., D. N. Wolfe, K. Elder, S. Stibitz, and E. T. Harvill. 2008. O antigen protects Bordetella parapertussis from complement. Infect Immun 76:1774-1780. 27. Goebel, E. M., X. Zhang, and E. T. Harvill. 2009. Bordetella pertussis infection or vaccination substantially protects mice against B. bronchiseptica infection. PLoS One 4:e6778. 28. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol Rev 44:722-738. 29. Hallegua, D. S., and M. H. Weisman. 2002. Potential therapeutic uses of interleukin 1 receptor antagonists in human diseases. Ann Rheum Dis 61:960-967. 30. Happel, K. I., P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, and J. K. Kolls. 2005. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae. J Exp Med 202:761-769. 31. Harrington, L. E., R. D. Hatton, P. R. Mangan, H. Turner, T. L. Murphy, K. M. Murphy, and C. T. Weaver. 2005. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6:1123-1132. 32. He, Q., Viljanen, M.K., Arvilommi, H., Aittanen, B., and Mertsola, J. 1998. Whooping cough caused by Bordetella pertussis and Bordetella parapertussis in an immunized population. JAMA 280:635-637. 33. Heininger U, S. K., Christenson P, Cherry JD. . 1998. Evidence of efficacy of the Lederle/Takeda acellular pertussis component diphtheria and tetanus toxoids and pertussis vaccine but not the Lederle whole-cell component diphtheria and tetanus toxoids and pertussis vaccine against Bordetella parapertussis infection. Clin Infect Dis 28:602-604. 34. Higgins, S. C., A. G. Jarnicki, E. C. Lavelle, and K. H. Mills. 2006. TLR4 mediates vaccine-induced protective cellular immunity to Bordetella pertussis: role of IL-17-producing T cells. J Immunol 177:7980-7989. 35. Higgins, S. C., E. C. Lavelle, C. McCann, B. Keogh, E. McNeela, P. Byrne, B. O'Gorman, A. Jarnicki, P. McGuirk, and K. H. Mills. 2003. Toll-like receptor 4-mediated innate IL-10 activates antigen-specific regulatory T cells and confers resistance to Bordetella pertussis by inhibiting inflammatory pathology. J Immunol 171:3119-3127. 36. Hoppe, J. E. 1999. Update on respiratory infection caused by Bordetella parapertussis. Pediatr Infect Dis J 18:375-381. 37. Jones, S. A. 2005. Directing transition from innate to acquired immunity: defining a role for IL-6. J Immunol 175:3463-3468. 38. Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M. Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper. 2005. IL-23 compensates for the absence of IL-12p70 and is essential for the IL- 17 response during tuberculosis but is dispensable for protection and antigen-specific IFN-gamma responses if IL-12p70 is available. J Immunol 175:788-795. 39. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, and D. J. Cua. 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med 201:233-240. 40. Letowska, I., and W. Hryniewicz. 2004. Epidemiology and characterization of Bordetella parapertussis strains isolated between 1995 and 2002 in and around Warsaw, Poland. Eur J Clin Microbiol Infect Dis 23:499-501. 41. Li, J., C. Ryder, M. Mandal, F. Ahmed, P. Azadi, D. S. Snyder, R. D. Pechous, T. Zahrt, and T. J. Inzana. 2007. Attenuation and protective efficacy of an O-antigen-deficient mutant of Francisella tularensis LVS. Microbiology 153:3141-3153. 42. Liese JG, R. C., Stojanov S, Belohradsky BH; Munich Vaccine Study Group. . 2003. Clinical and epidemiological picture of B pertussis and B parapertussis infections after introduction of acellular pertussis vaccines. Arch Dis Child 88:684-687. 43. Lubberts, E. 2003. The role of IL-17 and family members in the pathogenesis of arthritis. Curr Opin Investig Drugs 4:572-577. 44. Lugo, J. Z., S. Price, J. E. Miller, I. Ben-David, V. A. Merrill, P. Mancuso, J. B. Weinberg, and J. G. Younger. 2007. Lipopolysaccharide O-antigen promotes persistent murine bacteremia. Shock 27:186-191. 45. Mahon, B. P., B. J. Sheahan, F. Griffin, G. Murphy, and K. H. Mills. 1997. Atypical disease after Bordetella pertussis respiratory infection of mice with targeted disruptions of interferon-gamma receptor or immunoglobulin mu chain genes. J Exp Med 186:1843-1851. 46. Maixnerova, M. 2003. The 2001 serological survey in the Czech Republic--parapertussis. Cent Eur J Public Health 11 Suppl:S23-24.
188 47. Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441:231-234. 48. Mann, P. B., D. Wolfe, E. Latz, D. Golenbock, A. Preston, and E. T. Harvill. 2005. Comparative toll-like receptor 4-mediated innate host defense to Bordetella infection. Infect Immun 73:8144-8152. 49. Mastrantonio, P., Stefanelli, P., Giulano, M., Herrera Rojas, Y., Ciofi degli Atti, M., Anemona, A., and Tozzi, A.E. 1998. Bordetella parapertussis infection in children: epidemiology, clinical symptoms, and molecular characteristics of isolates. J Clin Microbiol 36:999-1002. 50. Mattoo, S., and J. D. Cherry. 2005. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin Microbiol Rev 18:326- 382. 51. Mattoo, S., M. H. Yuk, L. L. Huang, and J. F. Miller. 2004. Regulation of type III secretion in Bordetella. Mol Microbiol 52:1201-1214. 52. McGuirk, P., C. McCann, and K. H. Mills. 2002. Pathogen-specific T regulatory 1 cells induced in the respiratory tract by a bacterial molecule that stimulates interleukin 10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella pertussis. J Exp Med 195:221-231. 53. Nakae, S., S. Saijo, R. Horai, K. Sudo, S. Mori, and Y. Iwakura. 2003. IL-17 production from activated T cells is required for the spontaneous development of destructive arthritis in mice deficient in IL-1 receptor antagonist. Proc Natl Acad Sci U S A 100:5986-5990. 54. Nasso, M., G. Fedele, F. Spensieri, R. Palazzo, P. Costantino, R. Rappuoli, and C. M. Ausiello. 2009. Genetically detoxified pertussis toxin induces Th1/Th17 immune response through MAPKs and IL-10- dependent mechanisms. J Immunol 183:1892-1899. 55. Park, H., Z. Li, X. O. Yang, S. H. Chang, R. Nurieva, Y. H. Wang, Y. Wang, L. Hood, Z. Zhu, Q. Tian, and C. Dong. 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol 6:1133-1141. 56. Parkhill, J., et. al. 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35:32-40. 57. Phalipon, A., C. Costachel, C. Grandjean, A. Thuizat, C. Guerreiro, M. Tanguy, F. Nato, B. Vulliez-Le Normand, F. Belot, K. Wright, V. Marcel-Peyre, P. J. Sansonetti, and L. A. Mulard. 2006. Characterization of functional oligosaccharide mimics of the Shigella flexneri serotype 2a O-antigen: implications for the development of a chemically defined glycoconjugate vaccine. J Immunol 176:1686-1694. 58. Pier, G. B. 2007. Pseudomonas aeruginosa lipopolysaccharide: a major virulence factor, initiator of inflammation and target for effective immunity. Int J Med Microbiol 297:277-295. 59. Pishko, E. J., D. J. Betting, C. S. Hutter, and E. T. Harvill. 2003. Bordetella pertussis acquires resistance to complement-mediated killing in vivo. Infect Immun 71:4936-4942. 60. Pradel, E., and C. Locht. 2001. Expression of the putative siderophore receptor gene bfrZ is controlled by the extracytoplasmic-function sigma factor BupI in Bordetella bronchiseptica. J Bacteriol 183:2910-2917. 61. Probert, W. S., J. Ely, K. Schrader, J. Atwell, A. Nossoff, and S. Kwan. 2008. Identification and evaluation of new target sequences for specific detection of Bordetella pertussis by real-time PCR. J Clin Microbiol 46:3228- 3231. 62. Reissinger, A., J. A. Skinner, and M. H. Yuk. 2005. Downregulation of mitogen-activated protein kinases by the Bordetella bronchiseptica Type III secretion system leads to attenuated nonclassical macrophage activation. Infect Immun 73:308-316. 63. Rhodius, V. A., W. C. Suh, G. Nonaka, J. West, and C. A. Gross. 2006. Conserved and variable functions of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 64. Siciliano, N. A., J. A. Skinner, and M. H. Yuk. 2006. Bordetella bronchiseptica modulates macrophage phenotype leading to the inhibition of CD4+ T cell proliferation and the initiation of a Th17 immune response. J Immunol 177:7131-7138. 65. Skinner, J. A., A. Reissinger, H. Shen, and M. H. Yuk. 2004. Bordetella type III secretion and adenylate cyclase toxin synergize to drive dendritic cells into a semimature state. J Immunol 173:1934-1940. 66. Skowronski, D. M., G. De Serres, D. MacDonald, W. Wu, C. Shaw, J. Macnabb, S. Champagne, D. M. Patrick, and S. A. Halperin. 2002. The changing age and seasonal profile of pertussis in Canada. J Infect Dis 185:1448- 1453. 67. Smolen, J. S., A. Beaulieu, A. Rubbert-Roth, C. Ramos-Remus, J. Rovensky, E. Alecock, T. Woodworth, and R. Alten. 2008. Effect of interleukin-6 receptor inhibition with tocilizumab in patients with rheumatoid arthritis (OPTION study): a double-blind, placebo-controlled, randomised trial. Lancet 371:987-997. 68. Staron, A., H. J. Sofia, S. Dietrich, L. E. Ulrich, H. Liesegang, and T. Mascher. 2009. The third pillar of bacterial signal transduction: classification of the extracytoplasmic function (ECF) sigma factor protein family. Mol Microbiol 74:557-581.
189 69. Stockbauer, K. E., A. K. Foreman-Wykert, and J. F. Miller. 2003. Bordetella type III secretion induces caspase 1-independent necrosis. Cell Microbiol 5:123-132. 70. Sutton, C., C. Brereton, B. Keogh, K. H. Mills, and E. C. Lavelle. 2006. A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med 203:1685- 1691. 71. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kunikata, T. Murakami, O. Sanou, H. Kojima, M. Fujii, T. Ohta, M. Ikeda, H. Ikegami, and M. Kurimoto. 1997. Purification and characterization of the human interleukin-18 receptor. J Biol Chem 272:25737-25742. 72. Vanderpool, C. K., and S. K. Armstrong. 2003. Heme-responsive transcriptional activation of Bordetella bhu genes. J Bacteriol 185:909-917. 73. von Konig, C. H., S. Halperin, M. Riffelmann, and N. Guiso. 2002. Pertussis of adults and infants. Lancet Infect Dis 2:744-750. 74. Watanabe M, N. M. 2004. Whooping cough due to Bordetella parapertussis: an unresolved problem. Expert Rev Anti Infect Ther 2:447-454. 75. Weyant, R. S., D. G. Hollis, R. E. Weaver, M. F. Amin, A. G. Steigerwalt, S. P. O'Connor, A. M. Whitney, M. I. Daneshvar, C. W. Moss, and D. J. Brenner. 1995. Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. J Clin Microbiol 33:1-7. 76. Wirsing von Konig, C. H., and H. J. Schmitt. 1996. Epidemiologic aspects and diagnostic criteria for a protective efficacy field trial of a pertussis vaccine. J Infect Dis 174 Suppl 3:S281-286. 77. Wolfe, D. N., E. M. Goebel, O. N. Bjornstad, O. Restif, and E. T. Harvill. 2007. The O antigen enables Bordetella parapertussis to avoid Bordetella pertussis-induced immunity. Infect Immun 75:4972-4979. 78. Wolfe, D. N., P. B. Mann, A. M. Buboltz, and E. T. Harvill. 2007. Delayed role of tumor necrosis factor- alpha in overcoming the effects of pertussis toxin. J Infect Dis 196:1228-1236. 79. Yih, W. K., E. A. Silva, J. Ida, N. Harrington, S. M. Lett, and H. George. 1999. Bordetella holmesii-like organisms isolated from Massachusetts patients with pertussis-like symptoms. Emerg Infect Dis 5:441-443. 80. Yoshio-Hoshino, N., Y. Adachi, C. Aoki, A. Pereboev, D. T. Curiel, and N. Nishimoto. 2007. Establishment of a new interleukin-6 (IL-6) receptor inhibitor applicable to the gene therapy for IL-6-dependent tumor. Cancer Res 67:871-875. 81. Yuk, M. H., E. T. Harvill, P. A. Cotter, and J. F. Miller. 2000. Modulation of host immune responses, induction of apoptosis and inhibition of NF-kappaB activation by the Bordetella type III secretion system. Mol Microbiol 35:991-1004. 82. Yuk, M. H., E. T. Harvill, and J. F. Miller. 1998. The BvgAS virulence control system regulates type III secretion in Bordetella bronchiseptica. Mol Microbiol 28:945-959. 83. Zhang, X., E. M. Goebel, M. E. Rodriguez, A. Preston, and E. T. Harvill. 2009. The O antigen is a critical antigen for the development of a protective immune response to Bordetella parapertussis. Infect Immun 77:5050-5058. 84. Zhang, X., M. E. Rodriguez, and E. T. Harvill. 2009. O Antigen Allows B. parapertussis to Evade B. pertussis Vaccine-Induced Immunity by Blocking Binding and Functions of Cross-Reactive Antibodies. PLoS One 4:e6989. 85. Zhang, Z., T. B. Clarke, and J. N. Weiser. 2009. Cellular effectors mediating Th17-dependent clearance of pneumococcal colonization in mice. J Clin Invest 119:1899-1909.
190
Appendix
Appendix A: qRT-PCR primers for chapter 7
Gene Forward Primer Reverse Primer 16S TCAGCATGTCGCGGTGAAT TGTGACGGGCGGTGTGTA bsp22 (BB1617) CGGCACGGGCGTCAT GGTGTAGGCACTTTCGAGTTCCT bcrH1 (BB1619) CCGACGCGTTGAAAATGTT CAGCAGATAACGGGCTTCCA bopD (BB1620) CGGCTCGGTGAAGACATCTAC GCCTCCCGCATCTGTTGA bopB (BB1621) GCTCAATTCGACGAGGCCTAT TGTGCGTACTCGCCATATCG
191 Appendix B: Comparison of RB50∆sigE to RB50 under various stress conditions
Agent Concentration Treatment RB50ΔsigE Ampicillin 10µg Disk more sensitive Bacitracin 10U Disk more sensitive Cholramphenicol 30µg Disk = Colistin 10µg Disk = Deoxycholate 150µg/µL Disk = Ethanol 1.50% Culture more sensitive Ethanol 3.00% Culture more sensitive Erythromycin 15µg Disk = Hydrogen Peroxide 0.015% Culture = Hydrogen Peroxide 0.030% Culture = Hydrogen Peroxide 0.075% Culture = Hydrogen Peroxide 3% Disk = Imipenem 10µg Disk = Kanamycin 30µg Disk = Mecillinam 25µg Disk more sensitive Mecillinam 50µg Disk more sensitive Mecillinam 100µg Disk more sensitive Meropenem 10µg Disk = Nalidixic Acid 30µg Disk = Paraquat 0.01% Culture = Paraquat 0.10% Culture = Paraquat 2% Disk = Polymyxin B 0.36% Culture = Polymyxin B 300iu/ie/ui Disk = Rifampicin 150µg Disk = Sodium Chloride 0.06M Plates = Sodium Chloride 0.1M Plates = Sodium Chloride 0.3M Plates, Culture = Sodium Chloride 0.6M Plates, culture = Sodium Chloride 2.0M Plates = SDS 5% Disk more sensitive SDS 7.50% Disk more sensitive SDS 10% Disk more sensitive SDS 15% Disk more sensitive SDS 20% Disk more sensitive Sulfamethoxazole/Trimethoprim 23.75/1.25µg Disk = Tetracycline 30µg Disk = TritonX 175µg/uL Disk =
Vita Xuqing Zhang
Education and Professional Positions: The Pennsylvania State University Ph.D. in Genetics, GPA 3.96 Fall 2005 – Spring 2010 Graduate Research Assistant (Advisor: Dr. Eric T. Harvill) Fudan University, China B.S. in Biological Sciences, GPA 3.55 Fall 2001 – Spring 2005 Undergraduate Research Assistant (Advisor: Dr. Long Yu)
Awards and Honors: University Graduate Fellowship ($18,000) The Pennsylvania State University, Graduate School Fall 2005 – Spring 2006 Interdisciplinary Seed Grant Award ($5000) The Huck Institute/Center for Network Analysis Summer 2007 Travel Grant College of Agricultural Sciences ($500) Fall 2006 Genetics Program ($500) Fall 2006 8th International Bordetella Symposium ($750) Fall 2006 College of Agricultural Sciences ($500) Fall 2007
Selected Presentations at Professional Meetings: Eighth International Symposium of the Genus Bordetella November 2006 Institut Pasteur, Paris, France Poster: SigE in B. bronchiseptica gene expression and in vitro stress Cambridge Bordetella workshop July 2008 University of Cambridge, Cambridge, UK Oral presentation: O-antigen and B. parapertussis evasion of B. pertussis vaccines Bordetella Group reception for 99th general ASM meeting May 2009 Philadelphia, USA Poster: O-antigen allows Bordetella parapertussis to evade a B. pertussis vaccine via blocking binding of cross-reactive antibodies.
Publications: Goebel, E.M., Zhang, X., and Harvill, E.T. Bordetella pertussis infection or vaccination substantially protects mice against B. bronchiseptica. PLoS ONE 2009 Aug 26;4(8):e6778 Zhang, X., Rodríguez, M.E. and Harvill, E.T. O-antigen allows Bordetella parapertussis to evade B. pertussis vaccine-induced immunity by blocking binding and functions of cross- reactive antibodies. PLoS ONE 2009 Sep 14;4(9):e6989 Zhang, X., Goebel, E.M., Rodríguez, M.E., Preston, A. and Harvill, E.T. O-antigen is a Critical Antigen for the Development of a Protective Immune Response to Bordetella parapertussis. Infect Immun 2009 77:5050-5058.