FUNCTIONAL SIGNIFICANCE OF THE PHYSICAL INTERACTION BETWEEN THE HERPES SIMPLEX VIRUS TYPE 1 ORIGIN-BINDING PROTEIN, UL9, AND THE DNA POLYMERASE PROCESSIVITY FACTOR, UL42.
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Kelly S. Trego, B.S.
*****
The Ohio State University 2003
Dissertation Committee: Approved by
Professor Deborah Parris, Adviser
Professor David Bisaro ______Professor Arthur Burghes Adviser
Associate Professor Louis Mansky Department of Molecular Genetics
ABSTRACT
The origin (ori)-binding protein of herpes simplex virus type 1 (HSV-1), encoded by the UL9 open-reading frame, has been shown to physically interact with a number of cellular and viral proteins, including three HSV-1 proteins (ICP8, UL42, and UL8) essential for ori-dependent DNA replication. In this report, it is demonstrated for the first time that the DNA polymerase processivity factor, UL42 protein, provides accessory function to the UL9 protein, by enhancing the 3' to 5' helicase activity of UL9 on partially duplex non-specific DNA substrates. UL42 fails to enhance the unwinding activity of a non-cognate helicase, suggesting enhancement of unwinding requires the physical interaction between UL42 and UL9. UL42 increases the steady-state rate for unwinding a 23/38-mer by UL9, but only at limiting UL9 concentrations, consistent with a role in increasing the affinity of UL9 for DNA. Optimum enhancement of unwinding was observed at UL42:UL9 molecular ratios of 4:1, although enhancement was reduced when high ratios of UL42:DNA were present. Under the assay conditions employed, UL42 did not alter the rate of dissociation of UL9 from the DNA substrate. UL42 also did not alter the requirement or time for an assembly/conformational change step, regardless of whether it was added to DNA prior to or at the same time as UL9, or after steady-state unwinding by UL9 alone had been achieved. Thus, the increased affinity of UL9 for
ii DNA most likely is the result of an increase in the association rate constant for binding of
UL9 to DNA, and explains why helicase enhancement is observed only at subsaturating concentrations of UL9 with respect to DNA. Consistent with this interpretation are results which demonstrate that UL42 also enhances the ATPase activity of UL9 on single-strand and partially duplex DNA substrates when UL9 is limiting. In contrast,
ICP8 enhances unwinding at both saturating and subsaturating UL9 concentrations, and reduces or eliminates the lag period. The different means by which ICP8 and UL42 enhance activities of UL9 suggest that these two members of the presumed functional replisome may act synergistically on UL9 to effect initiation of HSV-1 DNA replication in vivo.
iii
Dedicated to my supportive and loving husband
iv ACKNOWLEDGMENTS
I wish to thank my advisor, Dr. Deborah Parris, for intellectual support, encouragement and guidance that made this dissertation possible. I would also like to thank the members of my advisory committee, Drs. David Bisaro, Arthur Burghes, and
Louis Manksy for their support and helpful suggestions.
I am grateful to members of the Parris laboratory, both past and present, for making my years in laboratory more enjoyable and productive. Further, I wish to thank
Yali Zhu and Rong Guo for assistance in conducting some of the experiments, and
Murari Chaudhuri, Liping Song, and Houleye Diallo for assistance with purification of some of the proteins used in this study.
I would like to thank my parents, husband and son for their love, patience, and never-ending support.
v VITA
January 27, 1974 Born, Wooster, Ohio
1996 B.S. Zoology, Miami University
1996-present Graduate Teaching and Research Associate, The Ohio State University
FIELDS OF STUDY
Major Field: Molecular Genetics
Minor Field: Molecular Virology
vi TABLE OF CONTENTS
Abstract………………..…………………………………………………………………..ii
Dedication…………………………………………………………………………...……iv
Acknowledgments……………………………………………………………………..…..v
Vita………………………………………………………………………………………..vi
List of Tables……………...... viii
List of Figures………………………………………………………………………….....ix
Chapters:
1. Introduction………………………………………………………………………1
2. Materials and Methods……………………………………………………….....38
3. Purification and in vitro activities of UL9, UL42, and ICP8 proteins……….…52
4. Development of a coupled helicase/polymerase assay…………………………68
5. Functional interaction between the herpes simplex virus type 1 DNA polymerase processivity factor and origin-binding proteins: enhancement of UL9 helicase activity……………………………………….………………..96
6. DNA-dependent ATPase activity of UL9…………………………..…………133
7. Discussion……………………………………………………………..………153
List of References……………..……………………………………………………168
vii LIST OF TABLES
Table Page
2.1 Oligonucleotides Used for Construction of Linear Helicase/polymerase DNA substrates and markers…………….………………………………50
2.2 Oligonucleotides Used for Construction of Mini-Circle Helicase/polymerase DNA substrate and markers……………………….51
5.1 Unwinding by UL9 with or without Accessory Proteins…………….…126
viii LIST OF FIGURES
Figure Page
1.1 Structure of the herpes simplex virus type 1 genome………………...….31
1.2 Structure of the herpes simplex virus type 1 origins of replication, oriL and oriS……………………………………………………………………..…32
1.3 HSV-1 proteins required for elongation of DNA replication……...…….33
1.4 Model of HSV-1 origin activation by UL9 and ICP8……………………34
1.5 Diagram of UL9 functional domains and the known physical interactions between UL9 and HSV-1 DNA replication proteins and cellular proteins…………………………………………………………………...36
3.1 Expression of recombinant UL9 protein in Sf9 insect cells……..………58
3.2 Purification scheme for UL9 protein…………………………………… 59
3.3 Purity of UL9 preparation………………………………..………………61
3.4 Helicase activity of purified UL9 protein………………………………..62
3.5 Purity of UL42 preparation……………………………………………....64
3.6 Ability of purified UL42 protein to stimulate HSV-1 DNA polymerase..65
3.7 Purity of protein preparations……………………………………………67
4.1 The standard helicase assay reports “all-or-none” unwinding……….…..81
4.2 Design of a coupled helicase/ polymerase assay………………..……….82
4.3 Helicase activity of UL9 on the linear helicase/polymerase substrate…..83
ix Figure Page
4.4 Ability of various polymerases to strand displace the linear HP substrate………………………………………………………………….84
4.5 DNA polymerization by T7 DNA pol holoenzyme in the presence of UL9………………………………………...………………………….86
4.6 DNA polymerization by T7 DNA pol holoenzyme on the modified linear helicase/polymerase substrate…………..………………………………..87
4.7 Design of a mini-circle substrate…………………………………...……89
4.8 Helicase activity of UL9 on the mini-circle DNA substrate….………….90
4.9 Ability of T7 DNA polymerase holoenzyme to strand displace the mini- circle substrate………………………..………………………………….92
4.10 Ability of HSV-1 DNA polymerase catalytic subunit and holoenzyme to strand displace………………………………………………..…………..93
4.11 Polymerization by HSV-1 or T7 DNA pol holoenzyme in the presence of UL9………………………………………………………………………95
5.1 Effect of increasing concentration of UL9 protein on the kinetics of unwinding………………………………………………………………115
5.2 The effect of increasing concentration of UL9 protein in the helicase assay………………………………………………………………..…...116
5.3 Effect of UL42 on UL9 helicase activity……………………………….118
5.4 Effect of UL42 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9…………………………………….....120
5.5 Effect of a high UL42 concentration of UL42 protein on UL9 unwinding……………………………………………………………....122
x Figure Page
5.6 Effect of ICP8 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9……………………………………………..……124
5.7 Effect of competitor DNA on the kinetics of UL9 unwinding with or without accessory proteins………………………………………...……127
5.8 Exponential curve fits of UL9 unwinding kinetics after the addition of DNA trap with or without accessory proteins…………………………..128
5.9 Effect of preloading on UL9 unwinding kinetics………………...…….129
5.10 Kinetics of unwinding by UL9 following the addition of accessory proteins to steady-state reactions………………………………...……..131
6.1 Titration of ATP in ATPase reaction……………………………...……140
6.2 Effect of increasing concentrations of single-strand (38-mer) and partially duplex (23/38-mer) DNA coeffectors on ATP hydrolysis……….……..142
6.3 Plots of maximum rate constants of ATP hydrolysis on single-strand or partially duplex DNA………………………………………………...…144
6.4 Effect of increasing concentrations of UL9 protein on the ATPase activity with single-strand and partially duplex DNA coeffector……………….146
6.5 Plots of maximum rate constants for ATP hydrolysis with increasing concentrations of UL9 on single-strand or partially duplex DNA coeffector……………………………………………………………….148
6.6 ATP hydrolysis by a subsaturating amount of UL9 protein with or without UL42 protein……………………………………………………...…….150
6.7 Effect of UL42 on the ATP hydrolysis of a subsaturating concentration of UL9 preincubated with DNA coeffector……………………….……….151
7.1 Model of UL9 movement off origin sequence with the assistance of accessory proteins, ICP8 and UL42……………………………………166 xi CHAPTER 1
INTRODUCTION
Viruses of the family, Herpesviridae, comprise a large group of pathogens of considerable public health importance. Eight human herpesviruses have been isolated, and together may cause more morbidity in the human population than any other virus group, with those associated with the common cold. However, to date, all approved drugs to treat herpesvirus infections have targeted only the virally induced thymidine kinase and DNA polymerase (reviewed in Crumpacker and Schaffer, 2002). Thus, much time and effort has been spent on trying to understand the replication and latency of these viruses in an attempt to better identify targets for antiviral agents. Although many of the enzymatic activities of viral proteins have been elucidated, recent studies have only begun to illuminate the critical protein-protein interactions involved in processes such as
DNA replication. Clearly, further knowledge of these interactions is likely to lead to novel targets for antiviral compounds. The focus of research for this dissertation was to investigate the functional significance of the physical interaction between two proteins involved in viral DNA replication-the herpes simplex virus type 1 (HSV-1) origin-
1 binding protein, UL9, and the DNA polymerase processivity factor, UL42. Prior to
discussing herpesvirus DNA replication, aspects of the Herpesviridae family will be
reviewed. General features of DNA replication in other well-established systems will
also be discussed, focusing on similarities and differences with respect to initiation of
DNA replication.
The herpesvirus family. Historically, viruses were classified as herpesviruses
based upon several physical characteristics, including a linear double-stranded DNA
genome, an icosahedral capsid of T=16, surrounded by an amorphous region termed
tegument, and a glycoprotein-containing envelope (reviewed in Roizman and Pellet,
2001). All herpesviruses share the common feature of establishing latent infections in
normal hosts which persist for life. Herpesviruses have been further delineated into three
subfamilies based on common biological properties including host-cell range, length of
reproductive cycle, properties of growth in culture, and cellular location of latency
(reviewed in Weir, 1998).
HSV-1 is a member of the Alphaherpesvirinae subfamily, which also contains
HSV-2 and varicella-zoster virus (VZV) ( reviewed in Roizman and Pellet, 2001; Weir et
al., 1998). Generally, alphaherpesviruses have a variable host range, have a relatively
short replication cycle, spread rapidly in tissue culture, and establish a latent infection in
sensory ganglia. Epidemiologically, the alphaherpesvirus subfamily is associated with
fever blisters (HSV-1), severe genital infection (HSV-2), and chicken pox and shingles
(VZV). In contrast, members of the Betaherpesvirinae subfamily have a more restricted host range, longer replication cycle, and establish latency in lymphoreticular cells.
Human cytomegalovirus (HCMV) is associated with retinitis and pneumonia in
2 immunocompromised patients, and can cause congenital birth defects when contracted in utero. In addition, human herpesvirus 6 and human herpesvirus 7 are associated with mild disease in healthy people (HHV-6-roseola), but can cause complications in immunosuppressed patients. Lastly, the Gammaherpesvirinae subfamily is associated
with restricted host range, and latency in lymphoid cells which is often associated with
tumors. Epstein-Barr virus (EBV) of this family is the etiological agent of heterophile-
antigen-positive infectious mononucleosis, and has been shown to be associated with
Burkitt’s lymphoma, nasopharygeal carcinoma, and Hodgkin’s lymphoma. Moreover,
EBV activation in immunocompromised hosts can lead to fatal polyclonal lymphoma.
The other member of this subfamily is human herpesvirus 8, also known as Kaposi’s
sarcoma associated herpesvirus, first identified in AIDS patients (Chang et al., 1994).
Clearly, these viruses are significant pathogens, and much effort has been made to
understand their replication, pathogenesis, and latency. Of the human herpesviruses,
HSV-1 has been the most intensely studied, and thus, remains the best understood model
for DNA replication of this highly important family of viruses (reviewed in Roizman and
Knipe, 2001).
General characteristics of DNA replication. The transmission and maintenance
of genetic information from one generation to the next is a central process for all
organisms, and a vast amount of research has indicated the striking conservation of the
basic machinery necessary to replicate DNA from prokaryotes, eukaryotes, and viruses
(reviewed in Kornberg and Baker, 1992). An emerging general theme is that DNA
replication is achieved by the assembly and coordination of supermacromolecular
complexes consisting of a myriad of protein-protein, and protein-DNA interactions.
3 Comparison of multiple systems has demonstrated the basic requirements for replicating most double-stranded DNA templates (reviewed in Kornberg and Baker, 1992; Stillman,
1994; Alberts, 2003). Central to the process of DNA replication is the requirement to faithfully copy the duplex parental template DNA to form daughter DNA molecules.
This requirement is satisfied by DNA polymerases. However, because DNA polymerases cannot initiate synthesis de novo, they require a primer for extension. A fundamental asymmetry exists in DNA replication, because of the antiparallel nature of the template strands and the fact that polymerases are able to synthesize DNA only in the
5’-3’ direction. Thus, on one strand, replication occurs continuously in the 5’-3’ direction, whereas on the other strand, replication occurs discontinuously by synthesis and joining of short Okazaki fragments. This requires a coordination of leading and lagging strand synthesis at the replication fork. Thus, specialized enzymes which can synthesize RNA primers (primases) synthesize only one primer for the leading strand, but must lay down a primer for each Okazaki fragment synthesized on the lagging strand. In order to expose single strands as templates for DNA synthesis, the dsDNA must be unwound in the direction of fork movement by helicases, and helical stress ahead and behind the replication fork must be removed by topoisomerases. Also integral to replication fork progression is the maintenance of unwound single-stranded regions by single-stranded DNA binding proteins. Further processing of replicated DNA requires the removal of RNA primers, gap filling, ligation of lagging strands, and in some cases, the unlinking of daughter molecules.
Initiation of DNA replication. Prior to elongation, the enzymes required for the processes described above need to be coordinated and assembled. For organisms that
4 initiate unwinding at discrete origin sequences, the process of initiation can be divided
into the formation of a pre-replicative complex, assembly of factors that initiate
unwinding of origin DNA, and assembly of the enzymes responsible for elongation
(reviewed in Bell and Dutta, 2002). An early model system used to study DNA
replication was Escherichia coli, and those studies have had implications for many other
systems. For example, early studies using bacteria led to the replicon hypothesis, which
proposed that origins of DNA replication have two main elements, a cis-acting origin
sequence, and an initiator, a trans-acting substance (Jacob et al., 1963). The replicon model applies to many systems, although the number of factors involved in initiation varies widely among organisms. This is best illustrated by examining the initiation of
DNA replication in a wide variety of systems. Below, Escherichia coli, simian virus 40
(SV40), and eukaryotic initiation processes are described.
Escherichia coli initiation of DNA replication. The identification of a group of novel, temperature-sensitive mutants led to the identification of the trans-acting initiator
protein, DnaA (reviewed in Kornberg and Baker, 1992). Further, studies of multiple
bacterial origin sequences have established consensus 9-mer DnaA binding boxes, and
flanking sequence, together termed oriC (reviewed in Messer, 2002). Origins of E. coli
contain 5 DnaA boxes, and an AT-rich region containing three 13-mer repeats, as well as
an AT cluster (reviewed in Kornberg and Baker, 1992; Messer, 2002). The formation of
the pre-replicative complex begins when DnaA protein molecules complexed with ATP
bind to the five binding sites in a high affinity interaction, and introduce a 40o bend at
each site (Schaper and Messer, 1995). More DnaA protein then binds to additional sites
in a cooperative manner causing a conversion from the initial complex to an open or
5 active origin of 28 bp unwound containing from 20-30 molecules of DnaA (Krause and
Messer, 1999; Crooke et al., 1993). Upon origin opening, single-strand DNA binding
protein (SSB) binds, and assists in holding the strands apart, allowing 44-52 bp of DNA
to become unwound (Krause, and Messer, 1999). The open complex formation allows
for the loading of DnaB hexameric helicase and helicase loader, DnaC in a stoichiometry
of two DnaB6-DnaC6 complexes (Fang et al., 1999; Carr and Kaguni, 2001).
Interestingly, the SSB covered DNA is a poor substrate for DnaB binding, so loading is achieved through the physical interaction of DnaB with DnaA (Wahle et al., 1989b;
Sutton et al., 1998). Further, this process is dependent upon DnaB interacting with DnaC in an ATP bound form (Wahle et al., 1989a), but is independent of helicase activity, as
DnaC inhibits the helicase function of DnaB (Wahle et al., 1989b). Subsequently, ATP hydrolysis triggers the dissociation of DnaC (Sutton et al., 1998; Wahle et al., 1989a), allowing two head-to-head positioned DnaB helicase hexamers to move past each other in the 5’-3’ direction (Fang et al., 1999). After approximately 65 nucleotides are unwound (Fang et al., 1999), the helicase is able to interact with primase, and elongation proceeds (reviewed in Kornberg and Baker, 1992).
Simian Virus 40 initiation of DNA replication. Much of what is known about
eukaryotic DNA replication comes from extensive studies using mammalian cell extracts
that support the replication of plasmids containing the SV40 DNA replication origin.
SV40 DNA replication is unusual in that it requires only one viral protein, the SV40 large
tumor antigen (T antigen), which functions both as an origin binding protein and as a
replicative helicase (reviewed in Fanning and Knippers, 1992). In the absence of DNA,
T antigen monomers form into hexamers in the presence of magnesium and ATP, and
6 have been shown to unwind DNA in the 3’-5’ direction. Unlike other replicative helicases, T antigen is able to unwind purely double stranded origin-containing substrates starting from internal sites (reviewed in Fanning and Knippers, 1992). However, T antigen hexamers cannot productively load onto origin-containing DNA; rather, monomeric T antigen molecules in solution assemble around pentanucleotide repeats within origin DNA in an ATP-dependent manner (Dean et al., 1992). Thus, multiple data support a model for a prereplication complex in which two hexamers bind cooperatively
(Mastrangelo et al., 1989; Parsons et al., 1991), and are assembled head-to-head (Valle et al., 2000), mediated through the sequence specific interaction with a head-to-head pair of four pentanucleotide repeats at the core origin of replication (Joo et al., 1998). However, it was unclear until recently whether the two molecules separated into single hexamers during fork progression, or remained together. Electron microscopic analysis of origin unwinding revealed a sizable number of products in which the two forks of the plasmid
DNA substrate were joined through a T antigen bridge, with two single-strand loops being extruded from the complex (Wessel et al., 1992). Further, it was observed that dimerization of T antigen hexamers on a model DNA fork or DNA bubble substrate stimulated DNA unwinding by 15-fold (Smelkova and Borowiec, 1997). Further analysis indicated that the double hexamer is most likely a more active helicase, compared to a single hexamer, due to the ability of the double hexamer to efficiently cycle between a high and low affinity state for the replication forks (Alexandrov et al., 2002). This, coupled to the binding and hydrolysis of ATP, allows for efficient translocation and unwinding of DNA. Further, the authors note that formation of double hexamers was necessary for efficient unwinding of even single replication forks (Alexandrov et al.,
7 2002), giving credence to the model in which the two hexamers remain bound together with DNA actively spooled through the protein complex (Wessel et al., 1992). Lastly, little is known about the structure of the double hexamer, but mutational analysis and electron microscopy have indicated that multiple configurations may exist, and additional research will be necessary to determine the specific form of the double hexameric helicase complex active in bi-directional unwinding.
Eukaryotic initiation of DNA replication. As with prokaryotes and SV40, the initiation of eukaryotic DNA replication requires cis acting origin sequences and trans acting initiator proteins. However, in eukaryotic cells, initiation occurs at hundreds, if not thousands of origins, and is tightly integrated with other events of the cell cycle
(reviewed in Bell and Dutta, 2002). Attempts to characterize eukaryotic origins have indicated that required cis sequences differ greatly between organisms. With the exception of S. cerevisiae, cis-acting sequences are not well characterized, are spread over greater than 1000 bases of DNA, and sites of initiation are not generally tightly linked within these regions (reviewed in Bell and Dutta, 2002). As noted previously, the first step of initiation is the formation of a pre-replicative complex (pre-RC). In eukaryotes, this involves the ordered assembly of a number of factors, including origin recognition complex (ORC), Cdc6p, Cdt1p, and Mcm2-7p (reviewed in Bell and Dutta,
2002). The pre-RC complex formation occurs in G1, and once formed, requires activation by at least two kinases that trigger the transition into an active replicative complex.
ORC proteins were first identified in S. cerevisiae through their interaction with the conserved origin sequence (Bell and Stillman, 1992), but homologs have been found
8 in all eukaryotes studied (reviewed in Bell and Dutta, 2002). The largest five subunits of
S. cerevisiae ORC bind specifically to the origin of replication in an ATP-dependent manner (Bell and Stillman, 1992). However, ATP hydrolysis is not necessary for binding, and evidence suggests that ORC remains bound to ATP (Klemm et al., 1997).
ATP hydrolysis is stimulated by single-strand DNA, suggesting that hydrolysis may be reserved for the unwinding step of activation (Lee et al., 2000). Cdc6p is known to play an important role in the assembly of the pre-RC complex after the ORC has assembled and before the MCM proteins bind to the complex. Further, regulation of Cdc6 activity is directly involved in the cell cycle-regulated formation of the pre-RC complex (reviewed in Bell and Dutta, 2002). Cdtp was first identified in Schizosaccharomyces pombe, and has been shown to physically associate with Cdc6p and cooperatively promote the association of the MCM proteins with the DNA (Nishitani et al., 2000). Thus, the assembly of the MCM proteins onto the chromatin requires the coordinated effort of
ORCs, Cdc6p, and Cdt1p, and once the MCMs have been loaded, the other proteins can be removed without preventing DNA replication (Rowles et al., 1999; Hua and Newport,
1998).
All eukaryotes appear to have six MCM analogs that have been classified as
MCM2-7, and biochemical studies have identified a multiprotein complex consisting of all 6 MCMs (reviewed in Bell and Dutta, 2002). Further, MCM proteins have been associated with moving replication forks (Aparicio et al., 1997; Tanaka et al., 1999; Zou and Stillman, 2000), and the inactivation of MCM proteins during replication rapidly stalls fork progression (Labib et al., 2000). Biochemical data support the hypothesis that the MCM proteins act as a helicase, although reported in vitro helicase activity has been
9 weak, and has been observed with only a subset of the six MCM proteins (reviewed in
Bell and Dutta, 2002). In contrast, the intact heterohexameric molecule exhibits strong
ATPase activity that requires the ATP binding sites of each subunit (Schwacha and Bell,
2001). In conclusion, it has been hypothesized that the MCM complex forms the replicative helicase during eukaryotic DNA replication, but additional insight is necessary to understand the progression from the initiation complex to coordinated assembly and movement of replication forks.
Herpes simplex virus type 1 as a model for DNA replication. Viruses, such as herpes simplex virus (HSV) that infect and replicate inside eukaryotic cells, provide a simplified model to understand the process of initiation and transition to elongation of
DNA replication. For example, HSV must assemble the components required for DNA replication at the correct cis-acting sequences, and with the appropriate stoichiometry to lead to productive initiation and elongation (reviewed in Boehmer and Lehman, 1997; see below). However, whereas eukaryotic initation and elongation factors consist of multiple subunits, most of the herpesvirus homologs consist of a single polypeptide. Further, during lytic replication, HSV DNA synthesis is not linked to the cell cycle, which simplifies the understanding of the transition from initiation to elongation. Lastly, and perhaps most importantly, the haploid genome is genetically tractable, and thus has provided significant insight toward understanding the basic components required for initiation and elongation of a replication fork (reviewed in Roizman and Knipe, 2001).
The genome and replication model for HSV-1. The genome of HSV-1 is a linear duplex DNA molecule of 152 kb, and is composed of two covalently linked unique components termed US (unique short) and UL (unique long). Each unique segment is
10 flanked by inverted repeats designated ab and b’a’ for the long component, and a’c’ and ca for the short component (Fig. 1.1). The S and L components can rearrange relative to one another, yielding four isomers in equimolar amounts (Fig. 1.1; reviewed in Knopf,
2000; Boehmer and Lehman, 1997). Further, the genome is completely sequenced
(McGeoch and Schaffer, 1992), and contains at least 84 open reading frames as well as three functional origins of replication (reviewed in Whitley, 2001).
Although HSV-1 DNA is linear, as early as 0.5 hr after infection, viral DNA accumulates in the nucleus, and adopts a configuration consistent with end-joining
(reviewed in Boehmer and Lehman, 1997). This has been interpreted as circularization, because terminal restriction enzyme fragments become underrepresented relative to fragments arising from the joints (Deshmane et al., 1995; Garber et al., 1993;
Poffenberger and Roizman, 1985). Further, examination of viral DNA by pulse-field electrophoresis demonstrated the presence of a slowly migrating species that was concluded to be circles (Garber et al., 1993). Thus, one model predicts that recombination between terminal repeats leads to circularization and a ‘theta’ mode of
DNA replication for initial round of replication, followed by rolling circle replication
(Roizman, 1979; Skaliter et al., 1996). However, little in vivo evidence exists to support either theta or rolling circle replication, although rolling circle replication products have been observed in vitro using artificial substrates (Skaliter and Lehman, 1994; Skaliter et al., 1996; Falkenberg et al., 2000). Interestingly, the presence of slowly migrating DNA, as well as ‘endless’ molecules is also consistent with the formation of concatemers.
Importantly, very recent evidence demonstrated that genome circularization does not occur in productive infections, but may occur during the establishment of latency
11 (Jackson and DeLuca, 2003). Using Gardella gels (Gardella et al., 1984) that resolve circular from linear or concatameric molecules, the authors failed to observe circular genomes at any time during productive DNA replication. Rather, the temporal pattern proceeded from linear DNA, to DNA which failed to migrate, and then to an increase in the abundance of linear DNA of genome length (Jackson and DeLuca, 2003). Together, the data challenge the current models, and suggest that other models of HSV-1 DNA replication be considered and tested (reviewed in Sandri-Goldin, 2003). Although the mechanism of DNA replication is far from clear, it is known that viral replication is dependent upon at least one origin, and the presence of a viral protein (UL9) that possesses all the properties of an initiator protein (reviewed below).
HSV-1 origins of DNA replication. Examination of replicating HSV-1 DNA by electron microscopy was utilized to locate the viral origins of DNA replication, and replication bubbles were observed within UL, and within the TRS/IRS sequences
(Friedmann et al., 1977). Subsequently, passage of HSV-1 at high multiplicity created defective genomes, consisting of sequence elements that allowed amplification and packaging. Defective genomes were classified into two groups, class I which contained sequence from within the S component, and class II which contained sequences predominantly from the center of UL (reviewed in Boehmer and Lehman, 1997). Further, either type of defective molecule could be replicated upon cotransfection with wild-type virus, demonstrating the presence of functional origin sequence in the respective defective genome (Vlazny and Frenkel, 1981; Spaete and Frenkel, 1982; Spaete and
Frenkel, 1985). The origin contained in class I defectives was further refined to a 995-bp region by examining the ability of defined segments of HSV-1 DNA to replicate
12 autonomously in the presence of wild-type HSV-1 helper virus (Stow, 1982). Further subcloning defined a 90-bp segment called oriS that maps to the inverted repeat of the S region, such that each virus contains two copies of oriS (Stow and McMonagle, 1983).
Similar cloning techniques led to the identification of the origin contained in class II defectives, termed oriL. Results demonstrated that oriL contained a perfect 144-bp palindrome (Fig. 1.2), and deletions within the palindrome abolished oriL function
(Weller et al., 1985). The sequence of oriS is quite similar to oriL, with each origin containing an alternating AT sequence at the center of the palindrome (Fig. 1.2).
However, the rightward arm of oriS only shares weak homology with oriL, and yet the region leftward of the center of the oriS palindrome is similar to the entire left arm of the oriL palindrome (Fig. 1.2). Because the perfect palindrome within oriL is prone to deletion upon propagation in Escherichia coli, most of the data about the functional organization of the origin has been based on oriS (Fig. 1.2) (reviewed in Boehmer and
Lehman, 1997). For example, studies determined that substitution of the AT region in the center of the palindrome with GC-rich sequences impairs replication (Stow and
McMonagle, 1983; Lockshon and Galloway, 1988). Further, insertion of increasing numbers of AT dinucleotides into the center of the palindrome have an oscillating effect on origin function, which suggests a spacing role for the AT region (Lockshon and
Galloway, 1988). Lastly, evidence to date suggests that the three HSV-1 origins are functionally redundant, although they are conserved among all HSV serotypes for an as yet unknown reason (reviewed in Boehmer and Lehman, 1997).
Seven HSV-1 gene products required for origin-dependent DNA replication.
Three approaches have been used to identify viral encoded proteins involved in DNA
13 replication. First, cell-free extracts from infected cells were assayed for induced biochemical activities that have been associated with DNA replication in other systems.
Activities identified in this manner include a DNA polymerase (Hay et al., 1971), a single-strand DNA binding protein (Bayliss et al., 1975; Purifoy and Powell, 1976), an origin-binding protein (Elias et al., 1986), a thymidine kinase (Kit and Dubbs, 1963), a deoxyribonuclease (Hay et al., 1971; Morrison and Keir, 1968), and a ribonucleotide reductase (Cohen, 1972). Second, many virus mutants were isolated that were partially or completely deficient in DNA replication, and several had genes mapped within the coding region of pol (Chartrand et al., 1979; Coen et al., 1984), a DNA binding protein
(Conley et al., 1981; Quinn and McGeoch, 1985), a ribonucleotide reductase (Preston et al., 1984), and an exonuclease (Hay et al., 1971; Moss, 1986). A third approach used a transient DNA replication assay in which plasmids containing cloned large fragments of
HSV-1 DNA were tested for their ability to support the amplification of a plasmid containing an HSV-1 origin of replication (Challberg, 1986). Subcloning each of the
HSV-1 DNA fragments, together with sequence analysis of the HSV-1 genome led to the identification of seven genes that mapped to the unique long region (UL5, UL8, UL9,
UL29 (ICP8), UL30 (pol), UL42, and UL52) and were necessary and sufficient for origin-dependent DNA replication in transfection assays (Wu et al., 1988; McGeoch et al., 1988). The protein products of these genes have been identified, and include the polymerase catalytic subunit (UL30-pol), the polymerase accessory protein (UL42), the major single-stranded DNA binding protein, (UL29 or ICP8), the helicase-primase complex (UL5-helicase, UL8, UL52-primase), and the origin-binding protein, UL9
(reviewed in Boehmer and Lehman, 1997; see below). Further, it was shown that
14 infection of insect cells (Sf9) with baculoviruses expressing each of the seven genes supported the replication of ori-containing plasmids (Stow, 1992). This experiment confirmed the earlier finding, but also demonstrated that cellular proteins involved in viral DNA replication are sufficiently conserved to allow DNA replication to proceed in insect cells. The results from all of these experiments demonstrate the ability for genetic, biochemical, and molecular biological techniques to complement one another and produce a better understanding of requirements for ori-dependent DNA replication.
HSV-1 proteins required for elongation of DNA replication. Although seven proteins were required for ori-dependent DNA replication, transfection of SV 40- transformed cells with six of the essential HSV replication genes was sufficient to induce amplification of integrated SV 40 DNA (Heilbronn and zur Hausen, 1989). The gene encoding the HSV-1 origin-binding protein, UL9, was not required. Subsequently, it was demonstrated that extracts of insect cells infected with recombinant baculoviruses expressing pol, UL42, UL5, UL8, UL52, and ICP8 were able to promote rolling circle replication of circular plasmid templates (Skaliter and Lehman, 1994). This reaction was independent of UL9, and was actually inhibited by UL9 protein when the plasmid template contained an HSV-1 origin of replication (Skaliter and Lehman, 1994).
Furthermore, in vitro leading and lagging strand synthesis was observed on M13 substrates using purified pol/UL42, UL5/UL8/UL52, and ICP8 proteins, with no requirement for UL9 protein (Sherman et al., 1992). Additional genetic evidence using temperature-sensitive mutants of the UL9 gene demonstrated that replication continued if infected cells were shifted to the nonpermissive temperature at late times post infection
(Blummel and Matz, 1995). Lastly, immunofluoresence analysis from transiently
15 transfected mammalian cells demonstrated a punctate pattern of localization with ICP8,
UL5, UL8, and UL52, but larger globular formations upon the addition of pol and UL42
(Uprichard and Knipe, 1997; Zhong and Hayward, 1997). The structures formed were indistinguishable from replication compartments observed in infected cells (de Bruyn
Kops and Knipe, 1994), both by pattern, and the presence of DNA synthesis at the sites.
Formation of globular replication compartment structures was not dependent on UL9 or origin-containing DNA. However, some disagreement exists as to whether there was a qualitative difference between compartments formed in the presence vs. the absence of
UL9 (Uprichard and Knipe, 1997; Zhong and Hayward, 1997). Together, the data suggest that although seven proteins are required for origin-dependent DNA replication in vivo, six proteins are able to perform DNA elongation, with perhaps a more transient requirement for the UL9 protein, presumably at the initiation step. The six proteins involved in elongation are discussed in more detail below.
a. UL29 (ICP8): single-stranded DNA-binding (ssb) protein. ICP8 is the product of the UL29 gene (Quinn and McGeoch, 1985), and has been shown to bind single-stranded DNA rapidly and cooperatively, and with an affinity that is at least 5-fold greater than that for double-stranded DNA (Ruyechan, 1983; Ruyechan and Weir, 1984;
Lee and Knipe, 1985). Electron microscopy of ICP8 bound to DNA showed regular
DNA-protein filaments in which the DNA was held in an extended configuration
(Ruyechan, 1983; Makhov et al., 1996). Multiple experimental results have indicated that the binding site size for ICP8 to DNA is 12-22 nucleotides (Boehmer and Lehman,
1993a; Dutch and Lehman, 1993; Hernandez and Lehman, 1990; O’Donnell and Lehman,
1987). Like other single-strand DNA binding proteins such as E. coli SSB, the ability of
16 ICP8 to cooperatively bind ssDNA produces helix destabilization (melting) in an ATP- and direction-independent manner, and this property has been suggested to be important during DNA replication (Powell et al., 1981; Boehmer and Lehman, 1993a). Recently,
ICP8 was shown to have strand-annealing and strand-invasion properties that may establish a new role for ICP8 in recombination-mediated DNA replication (Dutch and
Lehman, 1993; Nimonkar and Boehmer, 2002; Nimonkar and Boehmer, 2003). ICP8 has been shown to physically and functionally interact with other HSV-1 proteins involved in
DNA replication, including pol (Hernandez and Lehman, 1990), UL8 (Hamatake et al.,
1997), and UL9 (Boehmer and Lehman, 1993b; Fierer and Challberg, 1992).
b. UL5, UL8, and UL52: DNA helicase-primase: The HSV-1 helicase- primase is a stable heterotrimer composed of a 1:1:1 ratio of the products of the UL5,
UL8, and UL52 genes (Crute et al., 1988; Crute et al., 1989; Dodson et al., 1989).
Interestingly, none of these proteins shows functional activity when purified alone
(Calder and Stow, 1990). However, a sub-complex of UL5/UL52 possesses ATPase, helicase and primase activity, and therefore constitutes the core enzyme (Calder and
Stow, 1990; Dodson and Lehman, 1991). The UL5/UL52 or UL5/UL8/UL52 complex has been shown to unwind DNA in the 5’-3’ direction (Crute et al., 1988; reviewed in
Boehmer and Lehman, 1997), and produce primase products of 6-13 bases in length
(Sherman et al., 1992; Crute and Lehman, 1991; Tenney et al., 1994). Genetic and structural analysis has revealed that UL5 is the helicase (Zhu and Weller, 1992), and
UL52 is the primase (Klinedinst and Challberg, 1994; Dracheva et al., 1995).
Specifically, the UL5 gene contains seven conserved ATP-binding and DNA helicase motifs, and mutations in any of these conserved domains dramatically reduces or
17 abolishes helicase activity in vitro, without affecting primase function (Graves-
Woodward and Weller, 1996; Graves-Woodward et al., 1997). On the other hand, sequence analysis of the UL52 gene indicated a proposed divalent metal-binding motif conserved among polymerases and primases. Mutagenesis of this site inactivated primase function in vitro, and abolished origin-specific DNA replication in vivo
(Klinedinst and Challberg, 1994; Dracheva et al., 1995). However, recently, it was demonstrated that mutations in a zinc finger motif of UL52 dramatically reduced not only primase activity, but also ATPase and helicase activities (Biswas and Weller, 1999;
Biswas and Weller, 2001). Furthermore, the ability of either UL5 or UL52 to bind to ssDNA was dramatically reduced, suggesting that a complex interplay may exist between these subunits.
The precise role of UL8 in the heterotrimeric complex is not clear, since it is not necessary in vitro, and does not appear to have any unique enzymatic or DNA binding activities. However, the addition of UL8 to reactions containing UL5/UL52 stimulates both the helicase and primase activities (Hamatake et al., 1997; Tanguy Le Gac et al.,
1996; Sherman et al., 1992; Tenney et al., 1994; Tenney et al., 1995). In addition, the
UL8 subunit has been shown to physically interact with ICP8 (Falkenberg et al., 1997),
UL9 (McLean et al., 1994), and pol (Marsden et al., 1997). Recent experiments have provided evidence that UL8 is required for unwinding of substrates coated with ICP8
(Tanguy Le Gac, et al., 1996; Falkenberg et al., 1997), and for the efficient utilization of primers on natural DNA templates (Sherman et al., 1992). UL8 may also facilitate localization of the complex to the nucleus (Barnard et al., 1997). Together, these
18 experiments suggest a role for UL8 of mediating interactions between the helicase- primase complex and other HSV-1 proteins involved in DNA replication.
c. UL30 (pol) and UL42: polymerase holoenzyme. In the mid 1960’s, a viral specific DNA polymerase was demonstrated to be induced during HSV-1 infection
(Keir et al., 1966). Subsequently, it was shown that the polymerase was virus encoded and produced a 136 kD protein that was essential for virus replication (Purifoy et al.,
1977; Jofre et al., 1977, Quinn and McGeoch, 1985; Gibbs et al., 1985). DNA sequence and amino acid comparisons demonstrated that pol exhibited significant similarities to other viral and cellular DNA polymerases including human DNA polymerase α-primase,
Saccharomyces cerevisiae DNA polymerase δ, Escherichia coli DNA polymerase I, and bacteriophage T4 DNA polymerase (Digard and Coen, 1990; Blanco et al., 1991).
Further, HSV-1 DNA polymerase purified from infected cells was shown to be stably associated as a heterodimer with a 65 kD protein (Gallo et al., 1988; Crute and Lehman,
1989), that was confirmed to be the product of the UL42 gene (Parris et al., 1988). Thus, the pol holoenzyme consists of a stable heterodimer composed of pol:UL42 (Crute and
Lehman, 1989; Gottlieb et al., 1990), and this interaction is essential for viral replication
(Digard et al., 1993a; Digard et al., 1993b; Reddig et al., 1994).
HSV-1 DNA polymerase possesses 5’-3’ deoxynucleotide polymerization and 3’-
5’ exonuclease proofreading activities, as well as RNase H activity all of which are intrinsic to the UL30 catalytic subunit (Haffey et al., 1990; Marcy et al., 1990). The small subunit encoded by the UL42 gene has strong dsDNA binding ability (Marsden et al., 1987; Gallo et al., 1988; Weisshart et al., 1999), and has been shown to stimulate the activity of pol catalytic subunit on nicked or gapped DNA templates in high-salt buffer, 19 and to increase the processivity of pol on primed ssDNA templates (Gallo et al., 1989;
Hernandez and Lehman, 1990; Gottlieb et al., 1990). Thus, UL42 is a functional homologue of processivity factors such as the β subunit of E. coli DNA polymerase III, the eukaryotic proliferating cell nuclear antigen (PCNA), and bacteriophage T4 gene 45 protein. However, the latter processivity factors contain multiple subunits, encircle the
DNA, require ATP for assembly as toruses, and lack stable DNA binding activity
(reviewed in Kelman and O’Donnell, 1995), while UL42 acts as a monomer and possesses strong DNA binding ability (Marsden et al., 1987; Gallo et al., 1988). It has been proposed that UL42 acts to tether pol to the template (Gottlieb et al., 1990).
However, this model is limited by the failure to explain how such binding would allow unimpeded elongation. Recent experiments provide evidence against a simple tethering model, since it was shown that while UL42 lowered the dissociation rate of pol, it did not affect the rate of translocation (Weisshart et al., 1999; Chaudhuri et al., 2003). Further, data from Chauduri and Parris (2002) demonstrate that while UL42 or pol alone has a low affinity for primer-template in high salt, the binding of pol/UL42 complex to DNA primer-template is resistant to increases in ionic strength. Thus, the binding ability of
UL42 alone does not account for the increased affinity or processivity of the holoezyme, at least under conditions of high ionic strength. Rather, the data suggest that the physical interaction between UL42 and pol confers a substantial conformational change to one or both subunits that serves to increase the affinity of the holoenzyme for DNA (Chaudhuri and Parris, 2002).
Model for elongation of DNA replication for HSV-1. Studies of DNA replication in E. coli and bacteriophages T4 and T7 have established the presence of
20 macromolecular complexes, termed replisomes or replication machines, that require the coordination of multiple protein-protein, and protein-DNA interactions (reviewed in
Kornberg and Baker, 1992). The multiple physical and functional interactions between the six HSV-1 proteins suggest the formation of a putative replisome responsible for elongation (Fig. 1.3). Evidence for the replisome model was provided by demonstrating that purified pol/UL42, UL5/UL52, UL8, and ICP8 were able to coordinate synthesis of leading and lagging strands and produce double-stranded DNA concatamers (Falkenberg et al., 2000). However, several questions remain unanswered. For example, the stoichiometry of the replisome at the replication fork remains unknown. In addition, it is unclear how leading and lagging strand synthesis are coordinated, and if or how the polymerase modulates between processive replication of the leading strand, and non- processive replication of the lagging strand. Further, while numerous attempts have been made to observe origin-dependent DNA replication in vitro, thus far, none have been successful. In fact, as noted above, the presence of UL9 protein inhibited the DNA replication of origin-containing plasmids (Skaliter and Lehman, 1994). Thus, while six proteins are able to carry out elongation of DNA replication, UL9, the origin binding protein, is additionally required for initiation.
UL9, HSV-1 origin-binding protein. The origin-binding protein was first identified through a screen for HSV-1 induced factors capable of binding to the 90 bp region of oriS that was demonstrated to be sufficient for origin function in transient assays
(Elias et al., 1986). Further purification based upon the sequence-specific binding activity led to the identification of an 83 kD protein capable of recognizing two inverted repeats, named box I and box II, that surround the AT-rich region (Fig. 1.2) (Elias and
21 Lehman, 1988). Subsequently, it was demonstrated that the origin-binding protein was the product of the UL9 gene (Olivo et al., 1988; Weir et al., 1989), and sequence analysis indicated that the gene product was an 851 amino acid protein, with a predicted molecular mass of 94 kD (McGeoch et al., 1988). Additionally, putative ATP-binding and helicase domains were identified (Walker et al., 1982; Gorbalenya et al., 1989), which suggested a probable multifunctional role for the origin-binding protein.
Origin-binding activity of UL9 protein. Initial experiments indicated that UL9 protein was able to bind to two sites within oriS, with the affinity for box I about 10-fold higher than for box II (Elias and Lehman, 1988; Hazuda et al., 1991). Further, sequence analysis suggested a putative third site for UL9 binding, named box III, which differed from box I by one nucleotide (Fig. 1.2). UL9 binding to box III was observed; however binding was not sequence-specific (Elias et al., 1990; Elias et al., 1992). Mutagenesis of residues within each of the box regions demonstrated that only box I was essential for origin activity (Weir and Stow, 1990). However, box II was required for efficient origin function, and mutagenesis of box III caused a small reduction in oriS activity (Weir and
Stow, 1990). Interestingly, a single base change that converted the sequence of box I to that of box III was sufficient to abolish both UL9 binding and the replicative ability of oriS (Weir and Stow, 1990).
Gel filtration analysis of recombinant UL9 protein indicated that UL9 is a homodimer in solution (Bruckner et al., 1991; Fierer and Challberg, 1992). Thus, attempts were made to better understand both the stoichiometry of UL9 bound to origin sequence, and the mechanism of origin activation. The DNA binding domain of UL9 was localized to the C terminal 317 aa (Weir et al., 1989; Deb and Deb, 1991), although
22 the C terminal 34 aa were dispensable for binding (Arbuckle and Stow, 1993).
Interestingly, the C terminal DNA-binding domain of UL9 is a monomer in solution
(Elias et al., 1992), and expression of this domain has a dominant negative effect on virus replication in the presence of WT protein (Stow et al., 1993; Perry et al., 1993). These data suggest that UL9 dimerization or higher-ordered structures are likely to be a necessary part of productive origin activation.
UL9 binding to the two high affinity sites of oriS was demonstrated to be cooperative (Elias et al., 1990; Hazuda et al., 1992). Further, Koff et al., 1991, demonstrated that UL9 protein was able to loop and distort the AT-rich DNA between
UL9 binding sites in an ATP independent manner. The AT-rich spacer region was determined to be important, since the introduction of AT dinucleotide repeats had an oscillating pattern of functional origin activity, with replication most reduced in mutants
(+6nt) that affected the relative positions of the transected domains on the DNA helix
(Lockshon and Galloway, 1988). Surprisingly, an altered spacer region (+4 or -6 base pairs) actually promoted formation of a more stable UL9: DNA complex compared to
WT origin (Gustaffson et al., 1994). This paradox can be resolved by assuming that the proper length of the spacer AT sequence is most likely required to induce a conformational change of DNA, leading to initiation of DNA replication.
Evidence that initiation requires cooperative binding and a conformational change of the origin was provided by analysis of the truncated C-terminal UL9 that was monomeric and transdominant in replication. The transdominant effect was explained by demonstrating that cooperative binding was not observed with truncated UL9 (Elias et al.,
1992). Further, the truncated UL9 bound to the origin, but did not alter its conformation
23 (Stabell and Olivo, 1993). Although UL9 is known to exist in solution as a homodimer, it was unclear whether one, or both subunits of the homodimer interacted with the box I origin sequence. Studies performed with the monomeric, C-terminal DNA binding domain of UL9 generated conflicting results. In one study, only one of the two monomers of UL9 protein was found to bind to box I (Martin et al., 1994). However, in two other studies, results were consistent with both monomers of the UL9 homodimer able to contact box I (Stabell and Olivo, 1993; Fierer and Challberg, 1995). This apparent disagreement was resolved when further analysis demonstrated that low concentrations of UL9: DNA formed a complex consisting of one monomer bound to box
I, whereas two or more protein monomers per DNA molecule were formed at high UL9 concentration (Simonsson et al., 1998). Finally, photocross-linking studies with full length UL9 protein demonstrated that only one of the two monomers likely contacts box I
(Lee and Lehman, 1999).
The genetic and biochemical data, as well as electron microscopic analysis of
UL9 bound to oriS, together provides a model of initial UL9 binding (Fig. 1.4-panel 1-3).
Briefly, UL9 binds cooperatively as a homodimer to box I and box II (Elias et al., 1990;
Hazuda et al., 1992), with one monomer of the homodimer contacting the DNA (Lee and
Lehman, 1999). Interactions between the two dimers causes approximately a 90o bend in the DNA that destabilizes the AT-rich intervening sequence in an ATP-independent manner (Elias et al., 1992; Makhov et al., 1996; Koff et al., 1991; Stabell and Olivo,
1993).
ATPase and helicase activities of UL9 protein. In addition to its origin-specific
DNA binding ability, UL9 protein possesses DNA-dependent ATPase and helicase
24 activities (Bruckner et al., 1991; Fierer and Challberg, 1992). The ability of UL9 to hydrolyze nucleoside 5’-triphosphates is influenced strongly by the structure, sequence, and length of the DNA cofactor, with a preference for long polymers with minimum secondary structure (Bruckner et al., 1991; Fierer and Challberg, 1992; Dodson and
Lehman, 1993). The minimum length of coeffector that elicited activity was 14 nucleotides, and correlates with the minimum length of 15 nucleotides required for origin specific binding (Hazuda et al., 1991). Further, ATPase activity increased with increasing DNA length up to approximately 60 nucleotides, suggesting a non-distributive mechanism for ATP hydrolysis (Dodson and Lehman, 1993).
Unwinding by UL9 protein proceeds in the 3’-5’ direction, and requires a single- stranded DNA loading site (Fierer and Challberg, 1992; Boehmer et al., 1993). UL9 is able to quantitatively unwind strands of DNA up to about 200 bases in length (Fierer and
Challberg, 1992; Boehmer et al., 1993). Further, unwinding is stoichiometric, rather than catalytic, and requires a large protein:DNA ratio for unwinding to be observed (Boehmer et al., 1993).
Relevance of UL9 helicase activity. The ability of UL9 protein to recognize origin sequence and to act as a helicase suggested that it acts as a replication initiator, to open the origin and allow the assembly of enzymes responsible for elongation. However, attempts to observe unwinding of origin-containing DNA by UL9 alone were not successful (Fierer and Challberg, 1992; Boehmer et al., 1993). In spite of the lack of origin unwinding, structure-function analysis demonstrated that the helicase activity most likely had an in vivo relevance. Specifically, mutations in six of the seven conserved helicase motifs of UL9 (Fig. 1.5) inactivated the function of the UL9 protein based on in
25 vivo complementation assays (Martinez et al., 1992). Biochemical characterization of these mutants correlated with the complementation data, and demonstrated that the conserved residues were important for ATPase and helicase function, but dispensable for dimerization or origin-binding activity (Marincheva and Weller, 2001). This correlation provides the strongest evidence to date that the helicase activity of UL9 is necessary for at least one step of HSV-1 DNA replication.
UL9 interacts with other viral proteins. As expected for a protein involved in initiation of DNA synthesis, UL9 interacts physically with a number of the other viral proteins required for ori-dependent DNA replication, including an interaction with a member from each of the other three components of the replisome (Fig. 1.5).
Furthermore, the sequences within UL9 required for the respective interactions appear to be distinct (Fig. 1.5A). Specifically, UL9 interacts with ICP8, the major single-strand
DNA binding protein, and requires the C-terminal 27 aa of UL9 (Boehmer and Lehman,
1993b; Boehmer, et al., 1994. UL9 also interacts with UL8, the non catalytic subunit of the helicase-primase heterotrimeric complex (Calder and Stow, 1990), and amino acids
132-210 are required for this interaction (McLean et al., 1994; personal communication).
Lastly, work from the Parris lab has demonstrated a physical interaction between UL9 and UL42, a member of the polymerase holoenzyme. This interaction was mapped to the
N-terminus of UL9 (Monahan et al., 1998), and aa 347-530 are sufficient for UL9 to bind to UL42 (unpublished results, Mohanty and Parris). The ability of UL9 to potentially interact simultaneously with all of the proteins suggests that it may act as the initiator protein capable of assembling the elongation complex at the correct location, and perhaps with the correct stoichiometry required for productive DNA replication (Fig. 1.5B). The
26 ability of UL9 to interact with so many DNA replication proteins also suggests the reason
why high concentrations of WT UL9 protein inhibit HSV DNA replication (Malik et al.,
1992; Stow et al., 1993).
The significance of the physical interaction between UL9 and the other proteins
stretches beyond a proposed role in assembly, and is best demonstrated by the interaction
between UL9 and ICP8, the major ssDNA binding protein (Lee and Knipe, 1985; Powell
et al., 1981; Ruyechan and Weir, 1984). ICP8 increases the ATPase activity of UL9 on
non-specific DNA substrates and on substrates that contain all or part of the HSV-1 ori
(Aslani et al., 2001; Dodson and Lehman, 1993; He and Lehman, 2001; Tanguy Le Gac,
and Boehmer, 2002). The helicase activity of UL9 is also stimulated by ICP8 (Fierer and
Challberg, 1992; Boehmer et al., 1993; Makhov et al., 1996). The C-terminal 27 AA
residues of UL9 are essential for ICP8 binding (Boehmer et al., 1994). Binding of ICP8
to this region or removal of the C-terminus of UL9 has been shown to enhance the
helicase activity of UL9 on non-ori-containing DNA substrates (Boehmer et al., 1994;
Makhov et al., 1996), and suggests that the C-terminal UL9 domain may negatively
modulate helicase activity.
Although UL9 alone cannot unwind oriS, it was found that ICP8 could promote
the unwinding of short oriS containing duplex containing either a 3’ single-stranded tail or an unpaired AT-rich region (Lee and Lehman, 1997; He and Lehman, 2000).
Furthermore, ICP8 was able to promote a conformational change of duplex 80-mer oriS to
form a stable hairpin structure (oriS*) consisting of intrastrand base pairing between box I
and box III that appears to be an evolutionarily conserved intermediate during initiation
of DNA synthesis (Aslani et al., 2000; Aslani et al., 2001; Aslani et al., 2002). Under
27 conditions that favored the formation of UL9-oriS* complex, ATP-dependent unwinding
of the 80 bp minimal oriS was observed (Aslani et al., 2002).
Although the complete mechanism by which ICP8 modulates UL9 activities has
not been elucidated, ICP8 clearly affects activities of UL9 on non-specific and ori-
containing DNA. It has been shown that ICP8 increases the rate and amount of DNA
which can be unwound by UL9, and also enhances the processivity of the UL9 3' to 5'
helicase activity (Boehmer, 1998; Boehmer et al., 1993; Fierer and Challberg, 1992;
Makhov et al., 1996). Interestingly, the ss DNA binding activity of ICP8 is not required
for the enhancement of UL9 helicase activity in vitro, although it may play an important
role in initiation in vivo (Arana et al., 2001).
In addition to the interactions of three HSV replication proteins with UL9, several
cellular proteins have been shown to interact with UL9, including pol α primase, hTid-1,
a human homolog of the DnaJ chaperonin protein (Eom and Lehman, 2002), and two
other ubiquitous heat shock proteins, Hsp 40 and Hsp 70 (Tanguy Le Gac and Boehmer,
2002). Results demonstrate that hTid-1 enhances the binding of UL9 to oriS, and
facilitates formation of the multimer from the dimeric UL9 protein, but has no effect on
the DNA-dependent ATPase or helicase activities of UL9. Similarly, Hsp40 and Hsp70
increases the affinity of UL9 for oriS. Further, Hsp40 and Hsp70 increases the DNA-
dependent ATPase activity of UL9 on ori-DNA, and enhances the UL9-mediated
distortion of the AT-rich region of oriS.
Despite the immense amount of research examining steps involved in initiation of
HSV-1 DNA replication, several key issues remain. Biochemical attempts to observe
ATP-dependent origin opening have indicated slow and limited unwinding, such that
28 unwinding of a 136-mer oriS was much less efficient than that observed for an 80-mer
(Aslani et al., 2002). The failure to recapitulate origin-dependent DNA replication in vitro demonstrates the complexity involved in the transition from open origin complex to the formation of a competent elongating replisome. Interestingly, modulating the activity of UL9 appears to be central in modulating initiation and commitment to DNA replication. It seems likely that the many interactions between UL9 and the viral and cellular proteins assist in controlling this critical step of HSV-1 DNA replication.
Work from the Parris laboratory has demonstrated a physical interaction between
UL9 and the DNA polymerase processivity factor, UL42 (Monahan et al., 1998). UL9 and UL42, expressed in cells infected with recombinant baculoviruses containing these genes, could be co-immunoprecipitated with specific antibodies to either UL9 or UL42.
Moreover, UL9 translated in vitro in rabbit reticulocyte lysates was found to bind to affinity columns containing GST-UL42 fusion protein expressed in E. coli, but not to columns containing GST alone. Results also demonstrated that the N-terminal 533 AA residues of UL9, essential for helicase activity, were sufficient for interaction with GST-
UL42. In that report, it was hypothesized that the interaction of UL42 with UL9 might serve as a bridging function to allow the entry of the DNA polymerase holoenzyme into the initiation complex. However, the hypothesis that guided my research was that the functional significance of the physical interaction between UL9 and UL42 was to enhance or modify one or more enzymatic activities or functions of UL9.
In this dissertation, my results demonstrate for the first time that UL42 enhances the helicase and ATPase activity of UL9 on non-specific DNA substrates. Further, the results provide some insight into the mechanism by which UL42 enhances the helicase
29 activity of UL9, and demonstrate that the enhancement is caused by at least some mechanisms distinct from one previously ascribed to ICP8.
30
UL US ab’c’b a’c a
oriL oriS oriS
Figure 1.1. Structure of the herpes simplex virus type 1 genome. Representation of the linear,152 Kbp HSV-1 genome (not to scale). The genome consists of a unique long and short region, UL and US, respectively, and the positions of the three origins of replication are indicated. Each unique sequence is flanked by inverted repeated sequences (IRS): UL is flanked by ab and b’a’, and US is flanked by a’c’ and ca. The two ends contain direct terminal repeats (TRS) (a). During replication, the two unique regions invert relative to one another yielding four isomers in equimolar amounts as depicted by the arrows below the genome model (reviewed in Boehmer and Lehman, 1997).
31
OriL
5’AAAAAAAGTGAGAACGCGAAGCGTTCGCACTTTGTCCTAATAATATATATATTATTAGGACAAAGTGCGAACGCTTCGCGTTCTCACTTTTTTT
Box III Box IA+T Box I Box III
3’ TTTTTTTCACTCTTGCGCTTCGCAAGCGTGAAACAGGATTATTATATATATAATAATCCTGTTTCACGCTTGCGAAGCGCAAGAGTGAAAAAAA
Palindrome
OriS
32
AAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAATATATATATATTATTAGGGCGAAGTGCGAGCACTGGCGCCGTG 5’ Box III Box IA+T Box II 3’TTTTCTTCACTCTTGCGCTTCGCAAGCGTGAAGCAGGGTTATATATATATAATAATCCCGCTTCACGCTCGTGACCGCGGCAC
Palindrome
Figure 1.2. Structure of the herpes simplex virus type 1 origins of replication, oriL and oriS. The DNA sequences of the minimal oriL and oriS are shown. Minimal oriL is 144 bases, but only the 94 bases that are homologous to oriS (83 bases) are shown here. The arrows above the sequence depict the relative orientation of the UL9 protein recognition sites, Boxes I, II, and III. A+T represents the AT- rich sequence. The arrows below the sequence depict the center of symmetry of the palindromes.
32
ssb protein ICP8
Helicase UL5 (5’-3’)
Primase UL8 UL52
Pol
UL42 Pol accessory protein
ds DNA binding activity
Figure 1.3. HSV-1 proteins required for elongation of DNA replication. Model of protein-protein interactions between HSV-1 proteins involved in elongation. The solid lines indicate known physical and functional interactions between proteins.
33
Figure 1.4. Model of HSV-1 origin activation by UL9 and ICP8. 1-2: UL9 binds cooperatively as a homodimer to box I and box II, with one monomer contacting the DNA (Elias et al., 1990; Hazuda et al., 1992; Lee and Lehman, 1999). 3: Interactions between the two dimers causes approximately a 90oC bend in the DNA that destabilizes the AT-rich intervening sequence in an ATP-independent manner (Elias et al., 1992; Makhov et al., 1996; Koff et al., 1991; Stabell and Olivo, 1993). 4: ICP8 binds the single-stranded DNA. 5: UL9:ICP8 complex unwinds origin DNA alone, or with other accessory proteins, while ICP8 stabilizes ss DNA.
34
Box III Box IAT-rich Box II 1
UL9 binding to Box I and Box II
2
UL9 UL9
90o bend and ATP- independent conformational change
3
UL9 UL9
ICP8 binding to single- ICP8 stranded DNA
4
UL9
ATP-dependent unwinding and formation of open 5 complex??
Figure 1.4 35
Figure 1.5. Diagram of UL9 functional domains and the known physical interactions between UL9 and HSV-1 DNA replication proteins and cellular proteins. A. Functional domains are located within UL9 as indicated, with the vertical black bars indicating the 7 conserved helicase motifs. The horizontal black bars indicate domains of UL9 that were determined to be necessary for interaction with UL8 (AA 132- 210), UL42 (AA 347-530), and ICP8 (AA 825-851). B. Model of the protein-protein interactions between UL9 and the HSV-1 DNA replication proteins or cellular proteins. The solid arrows indicate known physical and functional interactions between proteins.
36
A
Helicase motifs DNA binding
100 200 300 400 500 600 700 800
UL8 (132-210) UL42 (347-530) ICP8 (825-851)
B
ssb protein ICP8 Origin binding/ Helicase/ ATPase UL5 Helicase (3’-5’) (5’-3’) UL9 UL8 Primase UL52 Cellular proteins
α Pol , HSP40, HSP70, Pol hTID-1 UL42 Pol accessory protein
ds DNA binding activity
Figure 1.5
37
CHAPTER 2
MATERIALS and METHODS
Growth of Sf9 cells and preparation of infected-cell extracts. UL9, UL42, and
ICP8 proteins were purified from Sf9 insect cells infected with recombinant baculoviruses (Autographica californica), which express the respective HSV-1 genes from the polyhedrin promoter. Sf9 cells were propagated in TNM-FH insect medium
(Invitrogen, Carlsbad, CA) supplemented with 100 U of penicillin per ml, 100 µg of streptomycin sulfate per ml, and 10% fetal bovine serum at 27oC. Twenty 150 cm2 flasks containing subconfluent monolayers of Sf9 cells (2 × 107 cells per flask) were infected with recombinant baculovirus at an input multiplicity of 5 PFU per cell and incubated at
27oC for 44 hours (for UL42) or 72 hours (for UL9 or ICP8). Dislodged cells in medium were collected by low-speed centrifugation and suspended in 4o C hypotonic buffer containing 10 mM Tris-Cl, pH 7.4, 10 mM NaCl, and 3 mM MgCl2. The cytoplasm was separated from nuclei by dounce homogenization using 5 strokes of a tight fitting pestle, followed by centrifugation at 2,000 g. The nuclear pellet was suspended in 20 ml lysis buffer. Lysis buffer A for nuclei from which ICP8 or UL9 was prepared contained 20
38
mM Hepes, pH 7.6, 1 M NaCl, 25% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA and 2 mM
2-mercaptoethanol. For the preparation of UL42 protein, lysis buffer B, containing 10
mM Tris-Cl, pH 8.2, 1 M NaCl, 3.5 mM EDTA, and 1 mM 2-mercaptoethanol, was used.
After 30 min of gentle mixing at 4oC, the soluble fractions were collected following ultracentrifugation at 70,000g for 30 min at 4oC, and were stored at –80oC.
In vivo labeling of recombinant baculovirus infected Sf9 cells. 25 cm2 flasks
containing subconfluent monolayers of Sf9 cells (1.7 X 106 cells per flask) were infected
with recombinant baculovirus at an input multiplicity of 5 PFU per cell and incubated at
27oC. Virus was removed 1 hour post infection, and cells were overlayed with 5 ml
Complete media. Mock infected cells were treated similarly, without added virus. After
12 hours, [35S]methionine (50 mCi/mli) was added to each flask. Nuclear extracts were generated every 12 hours, from 24-72 hours post infection as described above, using lysis buffer B. Mock infected cells were harvested 72 hours post infection. Samples were subjected to SDS-PAGE and autoradiography.
Purification of UL9. The purification of UL9 was monitored by applying
portions of column fractions to nitrocellulose filters and probing with polyclonal antibody
RH-7 to UL9 (gift of Dan Tenney and Robert Hamatake, Bristol-Myers Squibb). The
RH-7 antibody and immunoblotting procedure have been described previously (Monahan
et al., 1998). In most cases fractions were also monitored for the presence of DNA-
dependent ATPase activity by the malachite green-ammonium molybdate colorimetric
assay of Lanzetta and co-workers, 1979, essentially as described by Dodson and
Lehman, 1993, except that denatured salmon sperm DNA (40 µg/ml) was included in
each reaction. The UL9-containing-nuclear extract (20 ml) was diluted 1:4 in ice-cold 39
Buffer V (20 mM Hepes, pH 7.6, 1 mM EDTA, 10% glycerol) to achieve a final salt
concentration of 0.25 M NaCl and centrifuged at 4oC for 10 min at 25,000 g to remove
particulates. The clarified extract was applied to 2 tandemly-assembled prepacked 5-ml
Hi-TrapTM Heparin columns (Amersham Biosciences, Piscataway, NJ) equilibrated in
Buffer V containing 0.25 M NaCl. The column was washed with 50 ml of the same buffer, and proteins were eluted with a 70-ml linear salt gradient from 0.25 to 1.3 M
NaCl in Buffer V. Peak fractions of UL9 eluted between 600 and 800 mM NaCl and were pooled and applied to a 5-ml column of ceramic hydroxyapatite HTP type II
(BioRad, Hercules, CA) equilibrated in Buffer D (10 mM Na2HPO4, pH 7.0, 10%
glycerol) containing 0.15 M NaCl. The unbound fraction contained UL9 and was
dialyzed against Buffer V, 0.25 M NaCl, and applied to a 10-ml cellulose phosphate P11
column (Whatman, Clifton, NJ) equilibrated in the same buffer. The column was washed
with 40 ml Buffer V, 0.25 M NaCl, and proteins were eluted with a 60-ml linear salt
gradient from 0.25 to 1 M NaCl in Buffer V. UL9 eluted between 450 and 510 mM
NaCl. The purity of UL9-containing fractions separated by electrophoresis through SDS-
polyacrylamide gels was judged to be >95% by silver-staining (Fig. 2), which
demonstrated the absence of contaminating polypeptides. Protein concentration was
determined by comparison to bovine serum albumin (BSA) standards following
electrophoresis through SDS-polyacrylamide gels and staining with Coomassie blue.
Purification of UL42. UL42 protein was purified as described previously
(Chaudhuri and Parris, 2002) except that the Blue Sepharose column was replaced with 2
linked 5-ml prepacked HiTrap Blue columns (Amersham Biosciences, Piscataway, NJ).
UL42 eluted from the HiTrap Blue column between 1.5 to 2 M KCl. After the final Q- 40
Sepharose column, the preparation was concentrated by ultrafiltration using a Centricon
30 (Amicon, Bedford, MA) and stored in Buffer V, 0.3 M NaCl at 4oC. Protein
concentration and purity were assessed as indicated above for UL9.
Purification of ICP8 protein. The procedure used was based on the procedure
reported by Boehmer and Lehman, 1993. The presence of ICP8 in fractions was
monitored by immunoblotting against mouse monoclonal antibody 39S specific for ICP8
(gift of Martin Zweig, National Institutes of Health). Briefly, ICP8-containing nuclear
extract was dialyzed against Buffer V, 0.1 M NaCl, and clarified by centrifugation at 4oC for 10 min at 25,000 g. The dialyzed extract was applied to two tandemly linked 5-ml
Hi-trap heparin columns equilibrated in Buffer V, 0.1 M NaCl. The column was washed with 30 ml of the same buffer, and protein was eluted with a 50-ml linear salt gradient from 100 to 750 mM NaCl in Buffer V. Peak fractions of ICP8, which eluted between
275 to 375 mM NaCl, were pooled and applied directly to a 4.5-ml hydroxyapatite column (Macroprep Ceramic hydroxyapatite HTP type I, BioRad) equilibrated in Buffer
D containing 0.1 M NaCl. The column was washed with 40 ml Buffer D, 0.1 M NaCl, and ICP8 was eluted using a 50-ml linear gradient of Na2HPO4 (10 to 200 mM) in Buffer
D, 0.1 M NaCl. Fractions containing ICP8 eluted from 60 to 80 mM Na2HPO4 and were
pooled, dialyzed against Buffer V, 0.1 M NaCl, and applied to a 10- ml Q-Sepharose
column equilibrated in the same buffer. The column was washed with 40 ml of
equilibration buffer and bound proteins were eluted with a 40-ml linear salt gradient from
100 to 750 mM NaCl in Buffer V. The peak ICP8-containing fractions eluted between
400 and 450 mM NaCl and were combined and stored at 4oC. Protein concentration and
purity were estimated as described above. 41
Antibody development and Western blot analysis. Polyclonal antibody (pAb)
KST-1 was prepared using purified UL9 protein as immunogen. UL9 protein was
purified as noted above, and rabbits were immunized with 250 µg/animal according to standard procedures (Cocalico Biologicals, Inc., Reamstown, PA).
For immunoblotting, samples were subjected to SDS-PAGE analysis followed by electrophoresis transfer to nitrocellulose for 6 hr at 450 mAmps as previously described
(Towbin et al., 1979). Nitrocellulose filters were blocked in TBS containing 3% gelatin and 0.02% sodium azide, washed with TBS, and probed with pAb KST-1 diluted 1:250 in
TBS containing 1% gelatin. After washing, the blot was probed with 3 µCi- [125I]
Staphylococcus aureus protein A (specific activity 60 mCi/mg; ICN Biochemicals, Inc.,
Irvine, CA) in TBS containing 1% gelatin. The blot was then exposed to Kodak X-
OMAT film with an intensifying screen at -80oC.
Preparation of DNA substrates for helicase assays. All synthetic
oligonucleotides were purchased from Integrated DNA technologies, Inc. (Coralville, IA)
as gel-purified products. The helicase substrate was adapted from one previously utilized
(Villani et al., 1994) and consisted of a 23-mer top strand annealed to a 38-mer bottom
strand to yield a partially double-stranded (ds) DNA substrate with a 15-nucleotide 3’ ss
overhang (Fig. 3.4A). The 23-mer (top) DNA was labeled at the 5’ end with [γ-32P] ATP
using T4 polynucleotide kinase according to the instructions of the manufacturer
(Invitrogen), and unincorporated nucleotide was removed using spin column
chromatography (MicrospinTM G-25, Amersham Biosciences). The partially ds DNA helicase substrate was prepared by mixing the labeled 23-mer DNA with 38-mer DNA
42
(1:2 molar ratio) in buffer containing 10 mM Hepes, pH 7.6, 50 mM NaCl, 5% glycerol,
heating to 50o C for 3 min, and slowly cooling to room temperature. Annealed substrate
(5 - 70 × 105 dpm/pmol) was stored at 4oC. For some experiments, a cold-competitor
helicase substrate was added after reactions were initiated to trap dissociated UL9. The
competitor helicase substrate contained a 45-mer top strand
(5' GGCTCAGGATGCTCAGGAGGTGGGAGGACAGGAGGACAGGCGTCG) annealed to a
60-mer bottom strand
(5'
CGACGCCTGTCCTCCTGTCCTCCCACCTCCTGAGCATCCTGAGCCTTTTTTTTTTTTTT
T) as described above to provide a 15 nucleotide 3' ss overhang.
Helicase assays (standard substrate). The assay used was a modification of one previously described (Boehmer et al., 1993). Reactions (80 µl) were performed at 37oC for the times indicated in buffer (Buffer H) containing 50 mM EPPS, pH 8.6, 25 mM
NaCl, 2.5 mM MgCl2, 3 mM ATP, 5 mM dithiothreitol, 10% glycerol, 8% DMSO, and
0.1 mg/ml bovine serum albumin. Reactions contained 0.5 nM labeled 23/38-mer DNA
substrate, and 5 nM (ten-fold excess) unlabeled 23-mer to trap unwound DNA.
Immediately prior to initiation of reactions, UL9 was incubated without or with accessory
protein (UL42 or ICP8) for 10 min at room temperature to facilitate complex formation,
followed by dilution to achieve the concentration specified in each experiment. Except as
noted otherwise, reactions were initiated by the addition of UL9 or a mixture of UL9 and
accessory protein. For some experiments as indicated, UL9, with or without accessory
protein, was preincubated with the labeled DNA substrate in reaction buffer containing
2.5 mM EDTA, and reactions were initiated by the addition of MgCl2 to 6 mM, 5 nM 43
unlabeled 23-mer ss DNA trap, and accessory protein, where indicated. Reactions were
terminated with helicase stop buffer: 15 mM EDTA, pH 8.0, 1% sodium dodecyl sulfate,
5% glycerol, 0.04% bromophenyl blue, and 0.04% xylene cyanol (final concentrations),
and the products were immediately loaded onto native 12% polyacrylamide gels and
separated by electrophoresis. Reaction products were quantified using a Molecular
Dynamics Phosphorimager and ImageQuant software (Sunnyvale, CA). The amount of
ss DNA released under condition n was determined as a fraction of total radioactivity in
that lane, to normalize for loading error, and corrected for background presence of ss
DNA in substrate (condition 0, no UL9) as follows:
Concentration Unwound =[(ss DNAn/totaln)- (ss DNA0/total0)]/[1-(ss DNA0/total0)] × 0.5
nM (equation 1)
Autoradiograms were also obtained by exposure of the gel to X-ray film (T-mat, Eastman
Kodak, Rochester, NY) at -80oC with an intensifying screen.
For determination of the apparent equilibrium dissociation constant (Kd) for the
formation of productive complex of UL9 and DNA, the concentration of DNA unwound
([unwound]) after 20 min at 37oC was plotted as a function of UL9 concentration
([UL9]). The data were fit by a nonlinear method to the Hill equation (Bell and Bell,
1988; Neet, 1980):
n n n [unwound] = ([unwound]max × [UL9] ) ÷(Kd + [UL9] ) (equation 2)
where Kd is the concentration of UL9 at which one-half of the maximum DNA unwinding ([unwound]max) was observed and n is the value of the Hill coefficient.
44
Helicase assays with Hepatitis C Virus NS3h (HCV-NS3h) protein. HPV-
NS3h protein was kindly provided by Smita Patel, Robert Wood Johnson Medical
School, Piscataway, NJ (Levin and Patel, 1999). NS3h protein was preincubated at room
temperature in buffer containing 20 mM Mops pH 7.0, 5 mM MgAc, 0.1 mg/ml BSA,
and 2 nM 23/38-mer (23-mer 32P-end-labeled), and reactions were initiated by the
addition of 5 mM ATP, 20 nM unlabeled 23-mer, 10 mM NaCl, with or without 50 nM
UL42 (final concentrations). Reactions were monitored kinetically, and stopped by the
addition of helicase stop buffer and the products were analyzed as noted above (helicase
assays).
DNA Polymerase assays. HSV-1 Pol activity was measured by the incorporation
of [3H]dTTP (specific activity 40-60 Ci/mmol, Amersham Biosciences) into
trichloroacetic acid-insoluble radioactivity. Reactions (100 µl) were performed in buffer
containing 50 mM Tris, pH 8.0, 125 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 2 % glycerol, 0.2 mg/ml bovine serum albumin, with 5 µg/ml poly dA/oligo dT20 substrate
(1:1 molar ratio), and 5 µCi/ml [3H]dTTP. HSV-1 polymerase was diluted in buffer containing 20 mM Tris, pH 8.0, 50 mM NaCl, 2 mM dithiothreitol, 2 % glycerol, and 0.5 mg/ml bovine serum albumin, and incubated with or without UL42 enzyme for 15 min on ice. Reactions were initiated by the addition of either pol alone, or pol and UL42, and incubated for 30 min at 37oC. The amount of incorporation was determined by
subtracting the acid precipitable counts from buffer alone from the incorporated counts
from each sample. The ability of UL42 protein to stimulate pol activity was determined
by comparison of pol activity in the presence and absence of UL42. Fold stimulation was
45
determined by dividing the incorporated counts from pol in the presence of UL42 by the
counts incorporated by pol alone.
Preparation of DNA molecules for ATPase assays. All synthetic
oligonucleotides were purchased from Integrated DNA technologies, Inc. (Coralville, IA)
as gel-purified products. The DNA molecules consisted of a 23/38-mer, 38-mer, and
38/38-mer. The 23/38-mer (Fig. 3.4A) was prepared as indicated for the helicase assays,
except that the 23-mer was not radiolabeled, and the two molecules were annealed using
a 1:1 molar ratio. The 38/38mer was similarly prepared, using the 38-mer of the helicase
assay and the complementary sequence:
5’A15GGAGATAGAGGCCAAGGAGGAGA3’.
ATPase assays. Reactions were performed at 37o C in buffer containing 50 mM
32 EPPS, pH 8.6, 25 mM NaCl, 4.5 mM MgCl2, 3 mM cold ATP, γ P-ATP (0.12 µCi/µl), 5 mM dithiothreitol, 10% glycerol, 8% DMSO, 0.1 mg/ml bovine serum albumin, and
DNA substrate as indicated. Reactions were initiated with UL9 or UL9/UL42 enzymes at
the concentration indicated. For some experiments as indicated, UL9 was preincubated
with the DNA substrate in reaction buffer containing 2.5 mM EDTA, and reactions were
initiated by the addition of MgCl2 to 6 mM, and UL42, where indicated. For the ATP
titration experiments, the specific activity of ATP was kept constant, and MgCl2 was
titrated with maximum observed linear rate shown. Reactions were terminated by the
addition of EDTA to a final concentration of 125 mM at the times indicated.
Aliquots (2 µl) were spotted onto PEI-thin layer chromatography plates and dried.
Products of ATPase were separated using buffer containing 1.0 M Formic acid and 0.4 M
46
LiCl2, and the products were quantified by phosphorimage analysis. The amount of ATP hydrolyzed (nM) under condition n was determined as a fraction of total radioactivity in that lane, to normalize for spotting error, and corrected for background presence of ADP
(condition 0, no UL9) as follows:
6 ATP hydrolyzed=[(ADPn/totaln)- (ADP0/total0)] × 3×10 nM (equation 3)
DNA substrates for linear helicase/ polymerase assays. All oligonucleotides were purchased in gel-purified form from Integrated DNA Technologies (Coralville, IA)
(Table 2.1). HP A, HP B, and/or HP C were labeled at the 5’end using γ-[32P]-ATP according to standard procedures. The linear helicase/polymerase substrate was prepared by annealing HP A, HP B, and HP C together, with a 10 % molar excess of HP A and HP
B. An additional helicase substrate was prepared by annealing HP A and HP C together, with a 10% molar excess of HP A. The annealed products was analyzed with non- denaturing gel electrophoresis (10%), and the amount of annealed products were quantified with phosphorimage analysis, by comparing the amount of counts in the annealed bands to the amount of counts in a band corresponding to each labeled strand, normalizing for specific activity. HP D (45-mer) was used as a size marker for gap- filling synthesis (44-mer product).
The modified linear helicase/polymerase substrate (23/37/65-mer) was formed by annealing HP E, HP F, and HP G. HP E and HP F were labeled at the 5’end using γ-
[32P]-ATP according to standard procedures, and were annealed to HP G with a 1.8-fold molar excess compared to the unlabeled HP G. Annealed product was purified by non-
47 denaturing gel electrophoresis, and eluted into buffer containing 20 mM Tris pH 7.4, 50 mM NaCl, and 1.0 mM EDTA.
DNA substrates for mini-circle assays. All oligonucleotides were purchased in gel-purified form from Integrated DNA Technologies (Table 2.2). MC A (70-mer) phosphorylated on the 5’ end was circularized with a bridging oligonucleotide (MC D) complementary to 10 nucleotides on each end of MC A and the ends ligated with T4
DNA ligase (Invitrogen, Carlsbad, CA) essentially as described previously (Salinas and
Benkovic, 2000; Fire and Xu, 1995). The circularized 70-mer ss template was purified by denaturing gel electrophoresis and annealed (1:1) to a 50-mer primer (MC B) labeled at the 5’end using γ-[32P]-ATP according to standard procedures. The 70-mer marker was prepared by annealing a 5-end-labeled 20-mer to the 3’ end of the linear 70-mer template strand, followed by extension with Klenow fragment (Invitrogen) for 15 min at
o 37 C in buffer containing 50 mM Tris-Cl, pH 8.0, 10 mM MgCl2, 50 mM NaCl, and 500
µM each of all four dNTPs.
Helicase/ polymerase assays. Standard reactions contained 0.5 nM DNA template, 50 mM EPPS, pH 8.6, 25 mM NaCl, 5 mM dithiothreitol, bovine serum albumin (0.1 mg/ml), 10% glycerol, and 0.04-1 mM dNTPs (each), 3 mM ATP, 2.5 mM
EDTA, with or without UL9 protein, and were initiated by the addition of polymerase and 6-11 mM MgCl2. Portions were removed at the times indicated, and terminated by the addition of EDTA to 50 mM. Products were separated by electrophoresis through
10% polyacrylamide, 7 M Urea gels, and exposed with an intensifying screen to X-ray film (Kodak T-MatTM) at -80oC.
48
Helicase assays with linear H/P substrate. Helicase reactions (20 µl) were
performed in Buffer H containing 10 fmol each substrate (HP A/ C, or HP A/B/C), and a
10-fold excess of cold 18-mer (HP A). Reactions were initiated by the addition of 0-40
nM UL9, and incubated at 370C for 20 min. Reaction were stopped by the addition of
helicase stop buffer, and immediately loaded onto 10% non-denaturing polyacrylamide
gels. Reaction products (unwound 18-mer) were quantified with phosphorimage
analysis.
Helicase assays with mini-circle DNA substrate. Helicase reactions were
performed in Buffer H (without MgCl2)containing 0.5 nM 50/70-mer, 2.5 mM EDTA,
25 nM UL9 protein with or without 25 nM ICP8 protein, were initiated with by the
addition of 6 mM MgCl2 and a 10-fold excess of unlabeled 50-mer. Reactions were
performed at 37oC, and samples were removed at the indicated times, quenched with helicase stop buffer, and the products were separated immediately by electrophoresis through 10% native polyacrylamide gels. Reaction products were quantified as described for standard helicase assays (above).
49
Table 2.1. Oligonucleotides Used for Construction of Linear Helicase/Polymerase DNA Substrates and Markers.
Name Length Use Sequence (5’-3’) HP A 18 Helicase substrate-1 ATGATAGTACGTCTGTGT
HP B 34 Polymerase primer-1 ACTCCTTCCGCACGTAATTTTTGACGCACGTTGT
HP C 62 Template-1 ACACAGACGTACTATCATGACGCATCAGACAACGTGCGTCAAAAATTACGTGCGGAAGGAGT
HP D 45 Size marker-1 GCCACTACGACACCTTGATCGCCTCGCAGCCGTCCAACCAACTCA
HP E 23 Helicase substrate-2 GAGGTGAAGGTACGGTTGTAGGC 50 HP F 27 Polymerase primer-2 CGGCAAAGGTTCGTGGTTATCGTAATG
HP G 65 Template-2 GCCTACAACCGTACCTTCACCTCTTCCCTCAACTCACGCATTACGATAACCACGAACCTTTGCCG
HP H 42 Size marker-2 CGGCAAAGGTTCGTGGTTATCGTAATGCGTGAGTTGAGGGAA
50
Table 2.2. Oligonucleotides Used for Construction of Mini-Circle Helicase/Polymerase DNA Substrate and Markers.
Name Length Use Sequence (5’-3’) MC A 70 Template CACCATAACCTCCACCCTCCCCAATATTCACCATCAACCCTTCACCTCACTTCACTCCACTATACCACTC
MC B 50 Primer for Circular GTGGAGTGAAGTGAGGTGAAGGGTTGATGGTGAATATTGGGGAGGGTGGA Template MC C 20 Primer for Linear GAGTGGTATAGTGGAGTGAA Template MC D 20 Circularization of GGTTATGGTGGAGTGGTATA Template
51
51
CHAPTER 3
PURIFICATION AND IN VITRO ACTIVITIES OF UL9, UL42, AND ICP8 PROTEINS
Although the HSV-1 DNA polymerase processivity factor, UL42, interacts physically with the ori-binding protein, UL9, no functional interaction between the two proteins has been described. To begin to assess the functional significance of the
UL42:UL9 interaction, each protein was expressed in Sf9 cells using recombinant baculoviruses. Nuclear extracts were generated and the respective proteins were purified using conventional column chromatography. The individual in vitro properties of UL9 and UL42 were then examined, prior to examination of their properties when present together.
Purification of UL9. It was important to optimize the expression and stability of
UL9 protein in Sf9 insect cells. Thus, cells were infected with recombinant baculovirus expressing UL9 at a multiplicity of infection of 5, and the kinetics of UL9 protein expression were examined in the presence of [35S]methionine. Samples of infected cells were removed every 12 hours, from 24 to 72 hours, and nuclear extracts were generated as described in Materials and Methods. In addition, nuclear extracts from mock-infected
52
cells were processed after 72 hours. Samples were analyzed by SDS-PAGE, followed by
autoradiography (Fig. 3.1). Comparison of infected and mock infected extracts revealed
a novel band of 88 kD which corresponded to the expected migration for UL9 protein
(Fierer and Challberg, 1992). The results demonstrate that UL9 protein was expressed as
early as 48 hours post infection, but that maximum expression was achieved after 72
hours of infection. Mock infected cells harvested after 72 hours lacked a comparable
band (lane 6). Therefore, nuclear extract was generated from cells infected for 72 hours
with recombinant baculovirus expressing UL9.
UL9 protein was purified to near homogeneity using Hitrap heparin,
hydroxyapatite, and phosphocellulose columns as detailed in Materials and Methods.
Fractions were monitored after each step by reactivity with the RH7 antibody directed
against UL9. Antigen-antibody complexed immunoblots were detected by probing with
[125I] Staphylococcus aureus protein A, and the radioactivity present in each fraction was quantified by phosphorimage analysis. In most cases, fractions were also monitored for the presence of DNA-dependent ATPase activity by the malachite green-ammonium molybdate assay (Lanzetta et al., 1979; Dodson and Lehman, 1993).
The nuclear extract was first applied to a Hitrap heparin column because UL9 is a known DNA binding protein (Elias et al., 1986). Figure 3.2A demonstrates that fractions containing the highest concentration of UL9 protein correlate with those containing maximum DNA-dependent ATP hydrolysis. The peak UL9 fractions were pooled and applied to a hydroxyapatite column. UL9 protein was found in the unbound and wash fractions (1-14) and in fractions 25-28 which eluted between 50-100 mM Na2PO4 (Fig
3.2B). ATPase activity was not quantified due to the presence of the phosphate in the
53
hydroxyapatite buffers. However, SDS-PAGE chromatography of these fractions
showed that the unbound fractions (fractions 1-14) contained most of the UL9 protein. In
contrast, the UL9 protein from the bound fractions contained contaminants which were
not easily removed with the final chromatography step (results not shown). Thus, the
unbound fractions from the hydroxyapatite column were pooled and applied to a cellulose
phosphate column (Fig 3.2C). The results demonstrate that the ATPase activity is
coincident with the presence of UL9 protein. Furthermore, this chromatography step
proved very effective in concentrating UL9. Total protein content of fractions from each
step of the purification was quantified using a Coomassie dye-based assay (Biorad).
Purity was monitored by loading equivalent amounts of total protein (2 µg) from respective fractions onto an SDS-PAGE, followed by silver stain and Western blot analysis (Fig. 3.3A). The results show a distinct band with a migration expected for a 88 kD polypeptide corresponding to the UL9 protein. To confirm that the 88 kD band was
UL9 protein, Western blot analysis was performed using antibody raised against purified
UL9 protein as noted in Material and Methods. The specificity of the antibody was noted by the fact that only one band was present in the nuclear extract, coincident with the expected molecular weight of UL9 (Fig. 3.3B). Further, control nuclear extract from Sf9 cells expressing UL42 protein did not react with the UL9 antibody (lane 5). UL9 protein fractions after cellulose phosphate were judged to be >95% pure by the virtual absence of contaminating protein species, and by comparison with bovine serum albumin standards in a Coomassie-stained gel (data not shown).
Helicase activity of UL9 protein. UL9 previously was shown to possess DNA helicase activity, and to unwind partially duplex non-specific DNA substrates in the 3’-5’
54
direction (Fierer and Challberg, 1992; Boehmer et al., 1993). I was interested in designing a helicase assay capable of measuring functional UL9 activity. To this end, a
DNA substrate was employed that consisted of a 5’ end-labeled 23-mer annealed to a 38- mer to provide a 3’ single-stranded DNA overhang (Fig 3.4A). The single-stranded region is necessary for UL9 to load onto the DNA (Fierer and Challberg, 1992).
To confirm the functional helicase activity of the purified UL9 protein, 10 nM
UL9 protein was incubated with 0.5 nM 23/38mer DNA substrate at 37oC, and the release of the 23-mer strand was monitored over time (1-120 min). A ten-fold molar excess of non-radioactive 23-mer also was included to minimize reannealing of the unwound labeled 23-mer to the 38-mer. Reaction products were analyzed by electrophoresis through native polyacrylamide gels to separate unwound ss DNA from the annealed partially duplex DNA substrate (Fig. 3.4B). Boiling denatured most but not all of the
DNA substrate, and there was little ss DNA in the unreacted substrate or in reactions incubated at 37oC for 120 min in the absence of UL9. Substantial unwinding was not detected before 5 min, but unwinding clearly increased over time. The concentration of
DNA unwound was determined by phosphorimaging analysis and plotted as a function of time (Fig. 3.4C). As expected, the concentration of DNA unwound increased over time, such that 85% of the substrate (0.43 nM) was unwound after 45 min. No additional unwinding was observed thereafter. A lag was observed prior to the onset of unwinding, as noted by the sigmoidal shape of the curve (Fig 3.4C). The sigmoidal shape is consistent with an assembly lag which has been observed previously for UL9 protein
(Boehmer et al., 1993).
55
Purification and in vitro analysis of UL42 protein. UL42 was purified to near homogeneity as detailed in Materials and Methods using a three-step procedure consisting of chromatography over DEAE, Blue-sepharose, and Q-sepharose columns.
After the final step, fractions were analyzed by SDS-PAGE (Fig. 3.5). Equivalent amounts (2 µg) of protein were loaded, and gels were stained with silver following electrophoresis. The strong band migrating at a position of 61 kD is consistent with the reported size of UL42, and is present in all samples. As with UL9, after the final chromatography step, UL42 was judged to be nearly homogenous by the virtual absence of other contaminating bands.
UL42 does not have any known inherent enzymatic activity, although it is known to bind to, and stimulate the activity of HSV-1 DNA polymerase (Gallo et al., 1989). The ability of UL42 preparations to stimulate HSV-1 pol activity was assessed using HSV-1 pol purified from baculovirus infected Sf9 cells (gift of M. Chaudhuri). The assay consisted of a poly dA primer annealed to oligo dT20, and measured the incorporation by pol of 3[H]dTTP into acid-insoluble material, with or without UL42. Assays were carried out in the presence of 125 mM KCl, because the activity of the pol catalytic subunit is inhibited at this concentration, but is stimulated with stoichiometric amounts of UL42
(Chaudhuri and Parris, 2002). Figure 3.6A shows the effect of increasing polymerase concentration on dTTP incorporation into the poly dA/oligo dT template. The results demonstrate a linear relationship between dTTP incorporation and pol concentration. A concentration of pol was used that utilized between 2-4% of the substrate in 30 min. The level of activity ensured reproducibility, and sensitivity for detection of stimulation by
UL42. To examine the effect of UL42 on polymerase, 2.2 nM pol was selected. To
56
facilitate complex formation between pol and UL42, the proteins were preincubated together on ice for 15 min. Reactions were initiated by the addition of pol alone or pol with the indicated concentration of UL42 (0.25-19.6 nM). All concentrations of UL42 tested stimulated pol activity, and no activity was observed in reactions incubated with
UL42 alone. Stimulation was determined by dividing the pol activity in the presence of
UL42 by the activity of pol alone. The results were plotted as a function of UL42 concentration, and fit to the Michaelis-Menten function (Fig 3.6B). Stimulation was linear up to 2.45 nM UL42, yielding a 15-fold increase, and a maximum increase of 27- fold was observed with 19.6 nM UL42. Further, the apparent Kd for productive binding to pol was 2.07 + 0.12 nM. Because the maximum pol activity is predicted to occur when saturated with UL42 to form a heterodimer (Gallo and Parris, 1988; Crute and
Lehman, 1989; Gottlieb et al., 1990), the Kd represents 50% saturation of the pol present
(2.2 nM). Thus, for fully active UL42, 1.1 nM would produce 50 % saturation.
Therefore, the UL42 preparation was 52% active.
Purification of ICP8 protein. ICP8 was purified as detailed in Material and
Methods, and Fig. 3.7 shows a silver stain representative of preparations of purified
UL42, UL9, and ICP8 proteins. I have demonstrated that each preparation was purified to near homogeneity, and in sufficient amount and concentration to further attempt to dissect the functional significance of the physical interactions between UL9 and proteins which interact with it.
57
AcNPV-UL9
Mock
24 36 48 60 72 72 Time (hrs) 220
97 UL9 66
46
30
123456
Figure 3.1. Expression of recombinant UL9 protein in Sf9 insect cells. Sf9 insect cells were infected with recombinant baculovirus expressing UL9 (AcNPV-UL9), or were mock-infected in the presence of [35S]methionine as noted in Materials and Methods. Nuclear extracts were generated and samples were analyzed by SDS-PAGE followed by autoradiography. Lanes 1-5, AcNPV-UL9 infected nuclear extracts 24, 36, 48, 60, 72 hours post infection. Lane 6, nuclear extract from mock-infected cells 72 hours post infection.
58
Figure 3.2. Purification scheme for UL9 protein. Nuclear extract from insect cells containing recombinant baculovirus-expressed UL9 protein was fractionated over Hi trap heparin (A), hydroxyapatite (B), and cellulose phosphate (C) columns as described in the Materials and Methods. Fractions were monitored by reactivity with the RH7 antibody, and immunoblots were quantified by phoshorimage analysis to determine the UL9 concentration of each fraction (relative units). After the Hi trap heparin and cellulose phosphate columns, fractions were monitored for the presence of DNA-dependent ATPase activity by the malachite green-ammonium molybdate assay as indicated in Materials and Methods. The concentration of UL9 (arbitrary units) (-solid pink line), DNA-dependent ATPase activity (z-solid blue line), and salt concentration (NaCl or Na2P04) (solid black line) was plotted for each fraction.
59
Hitrap Heparin A 30 2000 25 1500 20 15 1000
10 NaCl (mM) (mM) 500 ATP hydrolyzed hydrolyzed (nM) (nM) 5
UL9 Conc.Conc. (arbitrary (arbitrary units) units) 0 0 0 4 8 121216202428 16 20 24 28 Fraction Number
B Hydroxyapatite
30 500 25 400
20 300
15 (mM) 4 200 PO 10 2
Na 100 5
(arbitrary conc. UL9 units) 0 0 0 5 10 15 20 25 30 35 40 45 50 Fraction number
Cellulose Phosphate C 35 2000 30
25 1500 20 15 1000
(mM) NaCl 10
ATP hydrolyzed (nM) 500 5
units) (arbitrary Conc. UL9 0 0 0 5 10 15 20 25 30 35 40 45 50 Fraction Number
Figure 3.2 60
AB 1234 1234 5
200 201
116 122 97 UL9 UL9
85 66
45
42
32
Figure 3.3. Purity of UL9 preparation. UL9 protein was expressed in insect cells infected with recombinant baculovirus and purified by column chromatography as described in Materials and Methods. Preparations from each step of the purification (2 µg total protein) were subjected to electrophoresis through a denaturing gradient polyacrylamide gel (5-15%) followed by silver stain (A) or Western blot (B) analysis. A and B, Lane 1, nuclear extract; lane 2, pooled fractions after Hitrap heparin column; lane 3, pooled fractions (unbound) after hydroxyapatite column; lane 4, sample of peak fractions from phosphocellulose column. B, Lane 5, 2 µg control nuclear extract containing UL42 protein.
61
Figure 3.4. Helicase activity of purified UL9 protein. A. The DNA substrate consisted of a [32P]-end labeled 23-mer annealed to a 38-mer to provide a 3’ ss DNA tail for loading UL9. B and C. UL9 protein (10 nM) was incubated with the 23/38-mer substrate (0.5 nM) at 37oC as described in Materials and Methods. At the times indicated, aliquots were removed and the products were immediately separated by electrophoresis through a 12% non-denaturing polyacrylamide gel. B. An autoradiogram of the gel is shown. The substrate was denatured by heating to 95oC for 5 min (23/38 ∆ 95C), retained on ice (0), or incubated at 37oC with buffer (120’ 0 UL9) or 10 nM UL9. C. The gel was also exposed to a phosphor screen and the concentration of free (unwound) 23-mer was quantified using a Molecular Dynamics phosphorimager and ImageQuant software as described in Materials and Methods and plotted as a function of time. Unwinding by 10 nM UL9 protein (z), or buffer control ().
62
A *5’-GGAGATAGAGGCCAAGGAGGAGA 3’-TTTTTTTTTTTTTTTCCTCTATCTCCGGTTCCTCCTCT
B 95C ∆ ∆ ∆ ∆ Time (min)
23/38 0 12.5510152030456090120 120’ UL9 0
5’* 3’
5’*
C 0.5
0.4
0.3
0.2
(nM) Unwound DNA 0.1
0.0 0 20 40 60 80 100 120 140 Time (min)
Figure 3.4 63
1234
200
116 97
66 UL42
45
Figure 3.5. Purity of UL42 preparation. UL42 protein was expressed in insect cells infected with recombinant baculovirus and purified by column chromatography as described in Materials and Methods. Preparations from each step of the purification (2 µg total protein) were subjected to electrophoresis through denaturing gradient polyacrylamide gel (5-15%) followed by silver staining. Lane 1, nuclear extract; lane 2, pooled fractions after DEAE column; lane 3, pooled fractions after Hitrap Blue column; lane 4, sample of pooled fractions from Q sepharose column.
64
Figure 3.6. Ability of purified UL42 protein to stimulate HSV-1 DNA polymerase. Polymerase activity was measured by the incorporation of [3H]dTTP into acid-insoluble material using a poly dA/oligo dT template as described in Materials and Methods. A. The indicated concentration (0.1-22.2 nM) of purified HSV-1 DNA polymerase was incubated with 5 µg/ml template for 30 min at 37oC as indicated in Materials and Methods, and the amount of dTTP incorporated was plotted as a function of pol concentration. B. HSV-1 polymerase (2.2 nM) was preincubated on ice for 15 min with increasing concentrations of purified UL42 protein (0.25-19.6 nM). Reactions containing 5 µg/ml template were initiated by the addition of pol or pol and UL42, and proceeded for 30 min at 37oC. Fold-stimulation was determined by dividing the pol activity in the presence of UL42 by the activity of pol alone. The results were plotted as a function of UL42 concentration and were fit to the Michaelis-Menten function.
65
A 400
350
300
250
200
150
100
dTTP incorporated (fmoles) (fmoles) incorporated incorporated dTTP 50
0 0 5 10 15 20 25 Pol (nM)
B
30
25
20
15
Apparent Kd= 2.07 + 0.12 nM 10
Stimmax= 29.5 + 0.5 fold
5
activity pol of stimulation Fold 0 0 5 10 15 20 UL42 (nM)
Figure 3.6 66
200
116 ICP8 97 UL9
66 UL42
45
Figure 3.7. Purity of protein preparations. Proteins were purified from nuclei of insect cells infected with recombinant baculoviruses by column chromatography as described in Materials and Methods. The UL42 (3 µg, lane 1), UL9 (2 µg, lane 2), or ICP8 (1 µg, lane 3) proteins were subjected to electrophoresis through a denaturing gradient (5-15%) polyacrylamide gel followed by silver staining. Preparations were estimated to be at least 95% pure.
67
CHAPTER 4
DEVELOPMENT OF A COUPLED HELICASE/POLYMERASE ASSAY
In the standard helicase assay, the reaction is all or none-that is, unwinding is recorded only when a DNA molecule is completely unwound, and not for partial or incomplete unwinding events. Thus, a major limitation of conventional assays is that
UL9 protein has to be able to load, assemble, and track with a sufficient rate and processivity to achieve complete unwinding without reannealing occurring behind the
UL9 molecules. Thus, with low stoichiometries of UL9 to DNA, UL9 is able to track along the DNA, but no unwinding is observed due to reannealing behind the UL9 molecule (Fig. 4.1A). On the other hand, when multiple molecules of UL9 are loaded onto the substrate, then unwinding is more likely to be observed as indicated in Figure
4.1B. To better assess mechanisms of unwinding by UL9 alone or in the presence of accessory proteins, I sought to design a new, more sensitive, helicase assay capable of measuring the movement of single helicase molecules on the DNA substrate.
Design of a linear helicase/ polymerase (HP) substrate. A complex linear
DNA substrate was designed (Fig. 4.2) to track the movement of a helicase as a function
68 of polymerase extension. The 34-mer represents a suitable primer with a 62-mer
template for extension by a DNA polymerase. It was predicted that a polymerase would
extend 10 nucleotides up to the 5’ end of the 18-mer and stop and produce a 44-mer if it
could not strand displace, although a 62-mer product would be formed if the polymerase
could strand displace. The single-strand region also served as a suitable binding site for a
helicase (such as UL9) to bind and unwind the downstream 18-mer strand. It was
predicted that if the helicase activity is rate-limiting, the extension of the primer by
polymerase would provide a surrogate assay for helicase unwinding. That helicase
activity is rate-limiting is suggested by the extremely rapid extension of primer by the
polymerases used in the assay described below.
UL9 unwinding of the linear HP substrate. Previous results have indicated that
UL9 requires a 3’-single-stranded region to unwind DNA molecules in vitro (Fierer and
Challberg, 1992). However, it was unclear whether UL9 would be able to efficiently unwind the 18-mer of the 18/34/62-mer substrate. Thus the ability of UL9 protein to unwind the linear HP substrate was compared to unwinding of a partially duplex substrate with a 3’ single strand tail (18/62-mer). Reactions containing 0.5 nM of DNA substrate were initiated with increasing concentrations of UL9 (0-40 nM) and incubated for 20 minutes at 37oC in the presence of a ten-fold excess of unlabeled 18-mer trap to
minimize reannealing of unwound labeled 18-mer. Reaction products were analyzed by
electrophoresis through native 10% polyacrylamide gels to separate unwound ss DNA
from the DNA substrate. The amount of DNA unwound was determined by
phosphorimage analysis, and plotted as a function of UL9 concentration (Fig. 4.3).
Unwinding of both DNA substrates was detected at all UL9 concentrations tested.
69 Unwinding increased linearly following addition of increasing UL9 concentrations up to
10 nM, and maximum unwinding was predicted at 11 nM for the 18/34/62mer, and 19 nM for the 18/62mer. These results demonstrate that UL9 is able to unwind the linear HP substrate with at least an equal efficiency as the simple partial duplex substrate.
Ability of various polymerases to strand displace. The coupled helicase/ polymerase (HP) assay requires a polymerase that is both rapid and processive, but that does not strand displace the downstream primer. Thus, three commercially available
DNA polymerases were selected, and their respective abilities to gap-fill or strand displace were tested under conditions of the UL9 helicase assay. Figure 4.4 illustrates the ability of the Escherichia coli DNA polymerase I large proteolytic fragment (Klenow), bacteriophage T7/thioredoxin DNA polymerase holoenzyme, and bacteriophage T4 DNA polymerase catalytic subunit to extend the entire length of the template. Increasing concentrations of Klenow fragment (0.001-1.0 unit as supplied by the manufacturer) was titrated with the 18/34/62 substrate in which all three strands were labeled on the 5’ end with 32P. Reactions were incubated for 5 min at 37oC and terminated with EDTA.
Reaction products were separated by electrophoresis through gels containing 10% polyacrylamide, 7 M urea and exposed with an intensifying screen to X-ray film (Kodak
T-Mat). At the lowest concentration of Klenow tested (0.001 unit), no extension of the primer was observed (Fig. 4A, compare lanes 3,4 with 1,2). With ten times more enzyme
(0.01 unit), a portion of the 34-mer was extended by 5 min, to a length of 44, corresponding to gap-filling. However, at the highest concentrations (0.1-1.0 unit), the
34-mer was extended to the full length of the template strand, as noted by the increase of
70 62-mer. These results suggested that Klenow fragment was able to displace the 18-mer primer during elongation, and therefore was not appropriate to use in a coupled assay.
The ability of bacteriophage T4 and T7 DNA polymerases to strand displace was examined using the 18/34/62-mer substrate with the 18 and 34-mer strands labeled. The amount of enzyme was fixed at 0.5 unit, and reactions were conducted for 15 sec-5 min at
37oC. Fig. 4.4B shows the reaction products formed over time following the addition of bacteriophage T4 DNA polymerase catalytic subunit. At the shortest time, all of the 34- mer was utilized, and most of the products extended to the full length of the 62-mer template. Although some partially extended products were observed, no 44-mer products corresponding to only gap-filling synthesis were formed. By 1 min after initiation, all of the 34-mer was extended to 62-mer. Together, these results suggest that the T4 DNA polymerase catalytic subunit was capable of efficient strand displacement synthesis, and therefore, not appropriate for use in the coupled assay.
The kinetics of polymerization by T7 DNA pol holoenzyme are shown in Fig.
4.4C. As demonstrated with T4 pol catalytic subunit, all of the substrate was utilized by
15 sec after initiation. However, with T7 DNA pol, the 34-mer was extended 10 bases to
44-mer, indicative of gap-filling synthesis. The observed 44-mer product was not extended further even after 5 min of incubation. A small amount of substrate was extended to 62-mer by 15 sec, however, the amount of product converted did not increase with time. Thus, T7 DNA polymerase holoenzyme was selected as the polymerase to use in the coupled HP assay based upon its ability to efficiently gap-fill without substantial strand displacement.
71 DNA polymerization by T7 DNA pol holoenzyme in the presence of UL9.
The above results demonstrated that T7 DNA pol and UL9 can act independently and efficiently on the 18/34/62-mer substrate. However, in order to measure UL9 helicase unwinding as a measure of polymerase extension, it was necessary to determine whether
T7 DNA polymerase was active under the conditions required for UL9 unwinding.
Specifically, UL9 requires large amounts of ATP to drive the movement of UL9 along the DNA. Further, the assay was designed to load UL9 onto the substrate in the presence of ATP, and then to initiate with enzyme and MgCl2 to provide a sensitive measure of
UL9 unwinding. Thus, it was important to determine if T7 DNA polymerase was active in the presence of excess ATP, and to determine if it could load onto the substrate and extend in the presence of preloaded UL9 protein. Reactions (20 µl) contained 0.5 nM
18/34/62mer, and EDTA, with or without 40 nM UL9, and were initiated by the addition of 0.2 unit of T7 DNA polymerase, MgCl2, dNTPs, with or without ATP.
Control experiments demonstrated that in the absence of T7 pol and UL9, the 34- mer primer strand was not extended after 3 minutes (Fig. 4.5; lane 4). When reactions were initiated with 0.2 unit of T7 DNA pol (without ATP) and allowed to proceed for one minute, accumulation of 44-mer product was observed together with smaller products.
However, after 3 minutes, there was nearly quantitative extension of the primer to the 44 position (Fig. 4.5: compare lanes 5 and 6). A small amount of the substrate was extended to 62-mer; however the appearance correlated with degradation of the 18mer by the 3’-5’ exonucease activity of the pol. Thus, extension was most likely due to the removal of the
18-mer rather than strand displacement. Similar patterns of extension were observed in
72 the presence of 3 mM ATP, the concentration used in the helicase assay (compare lanes
4, 5 with 6, 7).
The T7 pol activity was monitored in the presence of preloaded UL9 and ATP.
The results demonstrate that T7 pol can load and extend the primer even in the presence of pre-loaded UL9 (compare lanes 8 and 10). Although the conditions were appropriate for helicase unwinding, no strand displacement synthesis by T7 pol was observed after 3 min in the presence of UL9 and ATP. Because it was possible that the 3 min reaction time was insufficient for substantial unwinding, the reaction time was increased.
However, with increased reaction times or with higher concentrations of T7 pol, degradation of the 18-mer strand was observed (results not shown). Because degradation of the 18-mer would lead to full length extension by T7 pol, and would be indistinguishable from strand displacement, it was necessary to modify the DNA substrate to render it resistant to the 3’-5’ nuclease activity associated with T7 pol.
A new substrate was designed which contained three phosphothioate linkages on the 3’ end of the helicase primer. The modified DNA substrate (23/27/65-mer) is shown in Fig. 4.6A. The 23-mer and 27-mer strands were labeled with 32P, and the 27-mer provided a primer for extension by T7 DNA polymerase. Increasing concentrations of enzyme (0.0625-0.25 U/ 20 µl rxn) were incubated with 0.5 nM substrate, and reactions were allowed to proceed for 5 minutes. Despite the expectation that the substrate would be resistant to degradation, T7 pol holoenzyme degraded the 23-mer (Fig 4.6B).
Degradation was also associated with increased accumulation of 65-mer.
Design of a mini-circle substrate. Since attempts failed to render the linear HP substrate nuclease-resistant, a new circular substrate was designed to avoid
73 exonucleolytic degradation of the helicase strand (Fig 4.7). The substrate consisted of a
70-mer mini-circle annealed to a complementary 50-mer primer strand that was 5’ end- labeled to serve as a template for polymerase extension and as a substrate for helicase unwinding. Thus, a polymerase that could only gap-fill would extend the 50-mer to produce a 70-mer product, while a polymerase capable of strand displacement would produce a product greater than 70, the length of which would be dependent upon the ability of the polymerase to perform strand displacement synthesis. Labeling of the 5’ end allowed for precise determination of the proportion of primer which was extended to a particular size, because all labeled products had the same specific activity.
UL9 unwinding of the mini-circle HP substrate. As with the linear HP substrate, it was important to examine the ability of UL9 to unwind the 50-mer of the mini-circle substrate. However, previous results have demonstrated that UL9 helicase activity is not highly processive (Fierer and Challberg, 1992; Boehmer et al., 1993).
Thus, unwinding was measured kinetically with and without an equimolar ratio of the
HSV-1 encoded single-strand DNA binding protein, ICP8, which had been shown to increase the processivity of UL9 helicase activity. Reactions contained 25 nM UL9 protein (with or without 25 nM ICP8), 0.5 nM 50/70-mer mini-circle DNA, and a 10-fold excess of unlabeled 50-mer to prevent reannealing of unwound, labeled DNA product, and were performed at 37oC. Reaction products were analyzed immediately following termination by electrophoresis through native polyacrylamide gels to separate unwound ss DNA from the annealed partially duplex DNA substrate (Fig. 4.8A). Upon addition of
UL9 protein, 50-mer product accumulated over time. However, the presence of ICP8 dramatically increased the amount of DNA unwound by UL9. Unwinding was quantified
74 by phosphorimage analysis and plotted as a function of time (Fig. 4.8B). Unwinding by
UL9 alone increased linearly over time, but only 10% of the substrate was unwound after
120 min. However, the addition of ICP8 protein dramatically increased the amount of unwinding, such that over 60% of the substrate was unwound in 120 min. Because ICP8 is a known helix destabilizing protein (Powell et al., 1981; Boehmer and Lehman,
1993a), DNA unwinding was measured in control reactions containing ICP8 without
UL9. However, no significant unwinding of the substrate was observed over a two hour period in reactions containing 25 nM ICP8 (Fig. 4.8B).
Ability of bacteriophage T7 DNA polymerase holoenzyme to strand displace the mini-circle substrate. Initial studies using linear HP substrates indicated that bacteriophage T7 DNA polymerase holoenzyme most likely did not strand displace (Fig.
4.4C). However, increased amounts of enzyme or long incubation times produced longer products consistent with either strand displacement synthesis, or read-through due to degradation of the helicase primer (Fig. 4.6). Thus, it was important to determine the effect of increasing concentrations of T7 DNA pol with the mini-circle substrate. To this end, reactions containing 0.5 nM 50/70-mer were initiated with increasing concentration of T7 DNA polymerase (0.06-1.0 unit), and extension after 1 or 5 min was monitored.
Figure 4.9 demonstrates that the 50-mer primer was readily extended by the T7 DNA polymerase to form a prominent 70-mer band after 1 min of incubation with little additional extension after 5 min. These results demonstrate that the T7 DNA polymerase efficiently engaged in gap-filling synthesis. Therefore, this enzyme was selected as an appropriate pol to use in the coupled helicase/polymerase assay.
75 Ability of HSV-1 DNA polymerase catalytic subunit and holoenzyme to strand displace. The herpes simplex virus type-1 (HSV-1) DNA polymerase is a stable heterodimer composed of a large catalytic subunit (pol) and a processivity factor (UL42), both of which are essential for viral DNA replication in vivo, and for long chain synthesis in vitro (reviewed in Boehmer and Lehman, 1997). However, few studies have examined the ability of DNA polymerase to engage in strand displacement synthesis. Therefore, the ability of the polymerase catalytic subunit and holoenzyme to strand displace the
50/70-mer mini-circle was examined (Fig. 4.10A). Purified HSV-1 pol (2.7-21.6 nM) was incubated with 0.5 nM mini-circle template for 1 or 5 min, and products were analyzed as described above. At the lowest concentrations of pol tested (2.7-5.4 nM) only a portion of the 50-mer template was extended by 1 min. However, by 5 min, the substrate was efficiently extended to 70, indicative of gap-filling but not strand displacement synthesis. Increasing HSV-1 pol concentration to 10.8 or 21.6 nM increased the proportion of substrate extended, but only very limited strand displacement synthesis was observed. Since the HSV-1 pol catalytic subunit did not significantly strand displace, the ability of the pol/UL42 holoenzyme to engage in strand displacement synthesis was determined (Fig. 10B). The HSV-1 pol (2.7 nM) was preincubated for 5 min with or without 62.5 nM UL42, a ratio of pol:UL42 that efficiently stimulated polymerase activity (see Fig. 3.6). Reactions were performed with 25 mM NaCl and 125 mM NaCl, and products were analyzed over time (15 sec-5 min) (Fig. 10B). Control reactions containing pol and 25 mM NaCl extended the 50-mer primer to 70, but no strand displacement was observed. The addition of UL42 did not alter the ability of
HSV-1 pol to strand displace. Increasing the salt to 125 mM inhibited the activity of pol
76 alone, such that only a weak band at 70 was observed after 5 min incubation. By contrast, pol in the presence of UL42 was able to extend the 50-mer with 125 mM NaCl.
However, no products larger than 70 bp were observed, indicating that pol/UL42 holoenyzme was not able to strand displace, even under this optimum salt concentration for gap-filling synthesis. No extension or degradation was observed with control reactions containing 62.5 nM UL42 without pol.
Polymerization by HSV-1 or T7 DNA pol holoenzyme in the presence of UL9.
Using the mini-circle substrate, results demonstrated that neither the bacteriophage T7 DNA polymerase, nor the HSV-1 pol, with or without UL42 were able to perform substantial strand displacement synthesis. Moreover, UL9 was shown to unwind the mini-circle substrate, albeit slowly. Thus, unwinding by UL9 was measured as a function of extension by these polymerases. To this end, 50 nM UL9 or buffer was preincubated for 5 min with 0.5 nM 50/70-mer, 3 mM ATP, and 0.25 mM dNTPs, and then reactions (100 µl) were initiated with T7 DNA polymerase (1.25 units), or HSV-1 polymerase (43.1 nM). Products were monitored kinetically (20 sec-10 min), for extension in the presence vs. absence of UL9 protein (Fig. 4.11). Control reactions containing T7 DNA pol without UL9 efficiently produced 70-mer product after 20 sec, and this product was not extended further even after 10 min of incubation. However, in reactions containing prebound UL9, the distribution of products changed such that partially gap-filled products were observed even after 10 min incubation, indicating that the ability of pol to extend was partially occluded in the presence of UL9. Thus, the prominent 70-mer produced by T7 DNA pol without UL9 was reduced. Instead, products
77 were distributed around 70, with limited strand displacement of a few nucleotides above
70, as well as products corresponding to 69 and 68-mers.
Reactions containing 43.1 nM HSV-1 DNA polymerase without UL9 also produced a 70-mer product after 20 sec (Fig. 4.11B). However, a small amount of product corresponding to extension to 77 nucleotides was also observed after 20 sec, but extension did not increase substantially over time. In the presence of UL9, the ability of pol to extend was partially inhibited, since most of the template remained unextended even after 1 min incubation. However, template that was extended produced a mixture of
70-mer product, and products greater than 70 nt consistent with limited strand displacement synthesis. Notably, the distribution, but not the maximum length of extended molecules differed between reactions containing UL9 and those without. These results together demonstrate that extensive strand displacement was not observed by either T7 or HSV-1 DNA pol holoenzyme in the presence of UL9.
Discussion. A linear helicase/polymerase DNA substrate was designed to measure helicase unwinding and polymerase extension. To this end, results demonstrated that UL9 was able to unwind the linear HP substrate with the same efficiency as a simple partial duplex substrate, suggesting that UL9 molecules were able to load internally on ss
DNA. Further, results demonstrated that bacteriophage T7 DNA polymerase was able to gap-fill the HP substrate under conditions required for helicase unwinding. However, attempts to observe coupled unwinding and polymerization were complicated by the efficient exonuclease activity of the T7 DNA polymerase, which degraded the helicase strand.
78 The design of an endless mini-circle DNA substrate successfully prevented degradation of the helicase strand, and results demonstrated that T7 DNA polymerase lacked significant strand displacement activity. Furthermore, the substrate was used to determine that the HSV-1 DNA polymerase catalytic subunit alone or with the UL42 processivity factor could perform only limited strand displacement synthesis. However, the helicase/polymerase assay did not prove to be a sensitive measure of UL9 helicase activity. It is possible that due to the extended time to unwind this substrate, UL9 dissociates and is unable to rebind after extension by pol due to the lack of a single- stranded loading site.
Although the mini-circle substrate was not used to further analyze the mechanism of UL9 unwinding, it was determined to be a sensitive assay to measure the ability of
HSV-1 DNA polymerase to engage in strand-displacement synthesis. Interestingly, polymerases such as pol δ, T4, or T7 polymerases containing mutations in 3’-5’ exonuclease domains have been shown to increase or acquire strand displacement ability
(Jin et al., 2001; Podust et al, 1995; Reha-Krantz et al., 1991; Tabor and Richardson,
1989). Therefore, the mini-circle assay was used to determine the ability of exo-deficient
HSV-1 pol and pol/UL42 to strand displace. Briefly, it was shown that exo-deficient pol was capable of slow, but significant strand displacement synthesis, and the addition of
UL42 increased the rate and processivity of synthesis, producing products up to 1000 nucleotides in length (Zhu et al., 2003).
It was suggested that enzymes which possess both polymerase and exo activities tend to cycle between polymerization and excision, and thus maintain an equilibrium that slows, or prevents strand displacement. In contrast, enzymes able to engage in strand
79 displacement synthesis possess a polymerizing activity which is favored over the exo activity in a given enzyme-DNA association event. Therefore, exo- mutants, such as exo-
HSV-1 DNA pol, acquire strand displacement ability because the equilibrium shifts towards polymerization. Thus, it is likely that the exonuclease activity of HSV-1 DNA polymerase not only serves to increase fidelity, but also serves to modulate the polymerizing ability of the enzyme. Future work in the Parris lab will use the mini-circle substrate to investigate the effect of unregulated strand displacement synthesis on the various processes involved in DNA replication.
80
A 5’ 3’ *
*
*
*
B
5’* 3’
*
*
*
Figure 4.1. The standard helicase assay reports “all-or-none” unwinding. In the standard helicase assay, the reaction is all-or-none, so intermediate steps cannot be tracked. A. With low stoichiometries of UL9: DNA the molecule binds, tracks, and unwinds the DNA substrate, but no unwinding is reported due to reannealing behind UL9. B. With high stoichiometries of UL9: DNA, multiple molecules load, assemble, and track with sufficient rate and processivity to achieve complete unwinding. 81
34 18 * * 62
Polymerase Helicase
* * * *
* * * *
Polymerase + Helicase
* *
* *
Figure 4.2. Design of a coupled helicase/ polymerase assay. The substrate consists of a 34-mer and 18-mer annealed to a 62-mer. The 34-mer represents a suitable primer with a 62-mer template for extension by a DNA polymerase. It was predicted that a polymerase would extend up to the 5’ end of the 18-mer and stop and produce a 44-mer if it could not strand displace, although a 62-mer product would be formed if the polymerase could strand displace. The single-strand region also served as a suitable binding site for a helicase (such as UL9) to bind and unwind the downstream 18-mer strand. It was predicted that if the helicase activity is rate-limiting, the extension of the primer by polymerase would provide a surrogate assay for helicase unwinding.
82
8
7
6
5
4
3
2
DNA Unwound(fmoles) 1
0 0 1020304050
UL9 (nM)
Figure 4.3. Helicase activity of UL9 on the linear helicase/polymerase substrate. Increasing concentrations of UL9 (0-40 nM) were incubated with 0.5 nM 18/62-mer (■) or 18/34/62-mer (●) substrate (0.5 nM) for 20 min at 37oC as described in Materials and Methods. Reaction products were separated by electrophoresis through native 10% polyacrylamide gels, and the amount of free 18-mer was quantified by phosphorimage analysis as described in Materials and Methods, and plotted as a function of UL9 concentration.
83
Figure 4.4. Ability of various polymerases to strand displace the linear HP substrate. A. Polymerase reactions contained 0.5 nM 18/34/62-mer substrate (each 32 strand P-end-labeled), 40 µM dNTPs (each), 2.5 mM MgCl2, and were initiated by the addition of Escherichia coli DNA polymerase I large proteolytic fragment (Klenow) (0.001-1.0 unit) or buffer. Reactions were incubated for 5 min at 37oC, terminated with EDTA, and products were separated by electrophoresis through gels containing 10% polyacrylamide, 7 M urea and exposed with an intensifying screen to X-ray film (Kodak T-Mat). M, 45-mer. B, C. Reactions contained 0.5 nM 18/34/62-mer (18-mer and 34- 32 mer P-end labeled), 300 µM dNTPs (each), 2.5 mM MgCl2, and were initiated by the addition of 0.5 unit bacteriophage T4 DNA polymerase catalytic subunit (B), or bacteriophage T7/thioredoxin DNA polymerase holoenzyme (C). Reactions were incubated at 37oC for 15 sec, 1 min, 5 min, or 5 min without enzyme, and terminated with EDTA. Product formation was monitored as in A.
84
A BCT7 Klenow T4 units sec sec
nono T7 T7 no T4 T4 no no 15 60 300 0 .001 0.01 0.1 1 M M 15 60 300 M 62 62 62
45 45 44 44
34 85 34 45 44
18 18 34
1 234567891011 1 234 5 1 234 5 Figure 4.4
85 T7 T7+UL9
-ATP +ATP +ATP T7 No 1 3131 3 (min)
62
45
34
18
1234579 6 810
Figure 4.5. DNA polymerization by T7 DNA pol holoenzyme in the presence of UL9. Polymerase reactions (20 µl) contained 0.5 nM 18/34/62-mer (18-mer and 34-mer 32P-end labeled), 2.5 mM EDTA, without (lanes 5-8) or with 40 nM UL9 (lanes 9-10), and were initiated by the addition of 0.2 unit of T7/thioredoxin DNA polymerase, 11 mM
MgCl2, 300µM (each) dNTPs, without (lanes 5-6) or with 3 mM ATP (lanes 7-10). The samples were incubated at 37oC for 1 or 3 min, and terminated with EDTA. Product formation was analyzed by electrophoresis of samples through a denaturing polyacrylamide gel and exposure of the gel to X-ray film. Lane 1, 18 and 34 nt markers; lane 2 and 3, the 62 and 45 nt markers; lane 5, incubation of 18/34/62 in reaction buffer for 3 min at 37oC without enzyme.
86
Figure 4.6. DNA polymerization by T7 DNA pol holoenzyme on the modified linear helicase/polymerase substrate. A. The substrate consists of a 27-mer and 23-mer annealed to a 65-mer. The 23-mer primer was modified on the 3’ end to contain three phosphothioate linkages. The 23-mer and 27-mer strands were labeled with 32P, and the 27-mer provided a primer for extension by T7 DNA polymerase. B. Polymerase reactions (20 µl) contained 0.5 nM 23/27/65mer, 2.5 mM EDTA, 1 mM dNTPs (each), and 3 mM ATP, and were initiated by the addition of increasing concentrations of T7
DNA pol holoenzyme (0.0625-0.125 unit) and 11 mM MgCl2. The samples were incubated for 5 min at 37oC, and terminated with EDTA. Product formation was analyzed as in Fig. 4.5. Lane 1, incubation of 23/27/65 in reaction buffer for 5 min without enzyme; lane 2, 0.0625 U; lane 3, 0.125 U; lane 4, 0.25 U T7 DNA pol; lane 5 and 6, the 42 and 65 nt markers.
87
A 27 23 xxx * * 65
B T7 DNA Polymerase
0 MM
65
42
27
23 Degradation products
Degradation products
123456
Figure 4.6 88
*
Polymerase Helicase
70 nt circle * 50 nt primer * 20 nt ssDNA gap
*
* +
Gap filled product Release of 50-mer of 70 (denaturing (native gel) gel)
Polymerase + Helicase
*
Strand-displacement product >70 (denaturing gel)
Figure 4.7. Design of a mini-circle substrate. The substrate consisted of a 70-mer mini-circle annealed to a complementary 50-mer primer strand that was 5’ 32P end- labeled to serve as a template for polymerase extension and as a substrate for helicase unwinding. Thus, a polymerase that could only gap-fill would extend the 50-mer to produce a 70-mer product, while a polymerase capable of strand displacement would produce a product greater than 70, the length of which would be dependent upon the ability of the polymerase to perform strand displacement synthesis.
89
Figure 4.8. Helicase activity of UL9 on the mini-circle DNA substrate. Helicase reactions contained 0.5 nM 50/70-mer, 2.5 mM EDTA, 25 nM UL9 protein with or without 25 nM ICP8 protein, were initiated with by the addition of 6 mM MgCl2 and a 10-fold excess of unlabeled 50-mer, and were performed at 37oC. Samples were removed at the indicated times, quenched with EDTA, and the products were separated immediately by electrophoresis through 10% native polyacrylamide gels. A. Autoradiograms of gels are shown. The substrate was denatured by heating to 95oC for 5 min (∆), or incubated with UL9 or UL9 and ICP8 for the times indicated. B. Gels were also exposed to phosphor screens and percent of free (unwound) 50-mer was quantified using a Molecular Dynamics phosphorimager and ImageQuant software as described in Materials and Methods and plotted as a function of time. Reactions contained 25 nM UL9 (); 25 nM UL9 and 25 nM ICP8(); 25 nM ICP8 (), or buffer alone ().
90
A UL9 ∆ Time (min) 95C 02.551020304560 90120
*
*
UL9/ICP8 ICP8
Time (min) 2.5 5 10 20 30 4560 90 120 120
*
*
100 B 90 80
70 60
50
40 30
(%) Unwound DNA 20 10
0 0 20406080100120
Time (minutes)
Figure 4.8
91
T7 DNA pol
0.06 0.13 0.25 0.5 1.0 (U/20 µl rxn)
M 1515151515 (min)
70
50
Figure 4.9. Ability of T7 DNA polymerase holoenzyme to strand displace the mini- circle substrate. Polymerization reactions (20 µl) contained 0.5 nM 50/70-mer, 1 mM dNTPs (each), 3 mM ATP, and 5 mM EDTA, and were initiated by the addition of increasing concentrations of T7 polymerase holoenzyme (0.06, 0.13, 0.25, 0.5, or 1.0 o unit), and 11 mM MgCl2. The samples were incubated at 37 C, and reactions were terminated after 1 min or after 5 min. Product formation was analyzed as in Fig. 4.5. M, 50 nt marker. 92
Figure 4.10. Ability of HSV-1 DNA polymerase catalytic subunit and holoenzyme to strand displace. Reactions were performed as in Fig. 4.9. A. Reactions were initiated by the addition of increasing concentrations of HSV-1 DNA polymerase catalytic subunit (2.7, 5.4, 10.8, or 21.6 nM active concentration), and were incubated for 1 or 5 min. B. HSV-1 pol (2.7 nM) was preincubated for 5 min with buffer or 62.5 nM UL42, and reactions were performed with 25 mM NaCl and 125 mM NaCl, and products were analyzed over time (15 sec-5 min). Control reactions contained 62.5 nM UL42 without pol.
93
HSV-1 pol A (nM) 2.7 5.4 10.8 21.6 (min) 15151515
70
50
B
Pol 2.7 (nM) ++ + + UL42 25X ++ ++ 15’’1’ 5’ 15’’1’ 5’ 15’’ 1’ 5’ 15’’1’ 5’ 15’’1’ 5’ 15’’1’ 5’
70
50
25 mM NaCl 125 mM NaCl
Figure 4.10 94
-UL9 +UL9
T7 holoenzyme HSV-1 pol T7 holoenzyme HSV-1 pol
20” 1’ 5’ 10’ 20” 1’ 5’ 10’ 20” 1’ 5’ 10’ 20” 1’ 5’ 10’
70
50
1 2 3 4 5 6 7 8 9 10 11121314151617
Figure 4.11. Polymerization by HSV-1 or T7 DNA pol holoenzyme in the presence of UL9. Polymerase reactions (100 µl) contained 0.5 nM 50/70-mer, 3 mM ATP, 0.25 mM dNTPs, 2.5 mM EDTA, and buffer (lanes 2-9) or 50 nM UL9 (lanes 10-17), and were initiated by the addition of 6 mM MgCl2, and 1.25 units T7 DNA polymerase (lanes 2-5; 10-13) or 43.1 nM HSV-1 DNA polymerase (lanes 6-9; 14-17). Products were examined kinetically (20 sec-20 min). Lane 1, 70-mer marker.
95
CHAPTER 5
FUNCTIONAL INTERACTION BETWEEN THE HERPES SIMPLEX VIRUS TYPE 1
POLYMERASE PROCESSIVITY FACTOR AND ORIGIN-BINDING PROTEINS:
ENHANCEMENT OF UL9 HELICASE ACTIVITY
The UL9 helicase has been shown to unwind DNA stoichiometrically, with large amounts of protein required for unwinding, and the extent of unwinding proportional to
UL9 protein concentration (Boehmer et al., 1993). Therefore, unwinding was examined as a function of UL9 protein concentration. To this end, reactions containing 0.5 nM
23/38-mer partially ds DNA substrate with a 3’ ss DNA overhang (Fig. 3.4), were initiated with increasing concentration of UL9 protein (1.6-50 nM), and unwinding was monitored kinetically (Fig. 5.1). A ten-fold concentration of non-radioactive 23-mer also was included in order to minimize reannealing of the unwound, labeled 23-mer to the 38-mer.
Reaction products were analyzed by electrophoresis through native polyacrylamide gels to separate unwound ss DNA from the annealed ds DNA substrate, and the concentration of
DNA unwound was determined by phosphorimage analysis for each concentration of UL9
96 protein (1.6-50 nM) and plotted as a function of time (Fig. 5.1). The results demonstrate that increasing the UL9:DNA stoichiometry increased both the rate and extent of unwinding, but only up to a certain point (compare 12.5 nM with 50 nM UL9). The inability of UL9 to unwind greater than 80%-85% of the substrate at even the highest stoichiometries in the presence of DNA trap suggests that both unwinding and reannealing are promoted by high concentrations of UL9 protein, as indicated for T4 Dda protein
(Raney et al., 1994). At the lowest stoichiometries (1.56-3.13 nM), the rate and extent of unwinding were less than that observed with higher stoichiometries. Together, these results support the earlier finding that UL9 unwinds stoichiometrically (Boehmer et al,
1993).
Because UL9 has been shown to unwind DNA stoichiometrically (Fig. 5.1;
Boehmer et al., 1993), it was of interest to determine the apparent equilibrium dissociation constant for UL9 under my reaction conditions. Reactions contained 0.5 nM 23/38-mer partially ds DNA substrate, and were performed in triplicate with increasing concentrations of UL9 ranging from 0.8 to 100 nM. Kinetic analysis revealed that rates of unwinding were increasing linearly by 20 min for all UL9 concentrations > 1.6 nM (Fig
5.1). Therefore, helicase reactions were terminated after 20 min at 37oC and the reaction products were analyzed by electrophoresis through native polyacrylamide gels to separate unwound ss DNA from the annealed ds DNA substrate (Fig. 5.2A). Boiling denatured most but not all of the DNA substrate and there was little ss DNA in the unreacted substrate or in reactions incubated at 37oC for 20 min in the absence of UL9. Substantial unwinding after 20 min was not detected below a UL9 concentration of 3.13 nM, but
97 unwinding was readily detectable at all other UL9 concentrations tested. The
concentration of DNA unwound was determined by phosphorimaging analysis and plotted
as a function of UL9 concentration (Fig. 5.2B). The data fit poorly to the Michaelis-
Menten function (eq. 2, Hill coefficient equal to 1), but fit well when the Hill coefficient
was set from 2 to 3, in increments of 0.1 (Bell and Bell, 1988; Neet, 1980). The curves
shown in Fig. 5.2B represent the fits for Hill coefficients of 1, 2, and 3 and demonstrate
that UL9 unwinds the DNA cooperatively. Thus, cooperative action is predicted to occur
among 2 or 3 subunits, presumably homodimers of UL9 since UL9 exists as a homodimer
in solution (Bruckner et al., 1991; Fierer and Challberg, 1992). Both fits estimated
virtually the same apparent equilibrium dissociation constant (Kd) for productive complex
of UL9 with DNA. With a Hill coefficient of 2, the apparent Kd was 9.6 + 0.8 nM, and
for a coefficient of 3, it was 9.3 + 0.4 nM.
Because of the poor ability of UL9 to unwind DNA at low UL9:DNA ratios, a
subsaturating concentration of UL9 (3.13 nM) was initially selected to test the hypothesis
that UL42 enhances UL9 helicase activity. In order to maximize the probability for
complex formation between UL9 and UL42, a high concentration of UL9 (250 nM) was
pre-incubated with different molar ratios of UL42 for 10 min and the mixture was serially
diluted just prior to initiation of helicase reactions to yield a final UL9 concentration of
3.13 nM and a DNA substrate concentration of 0.5 nM. Fig. 5.3 shows the results of
assays terminated after 40 min at 37oC. Although an equimolar ratio of UL42:UL9 unwound slightly less DNA than 3.13 nM UL9 alone, increasing concentrations of UL42 stimulated the UL9 unwinding activity such that maximum helicase activity was observed
98 with 12.5 nM UL42, equivalent to a 4:1 UL42:UL9 ratio (Fig. 5.3A). Reactions
incubated for shorter (20 min) or longer (60 min) times at 37oC also demonstrated optimum enhancement of helicase activity with a 4:1 UL42:UL9 ratio (results not shown).
Although helicase activity was enhanced above that observed with 3.13 nM UL9 alone at concentrations of UL42 up to 100 nM, the level of stimulation was reduced compared to the maximum observed with a 4:1 UL42:UL9 ratio (Fig. 5.3B). At even higher UL42 concentrations (200 nM), the unwinding activity of UL9 was reduced compared to that in the absence of UL42. Moreover, no significant unwinding of the DNA substrate was observed when incubated with up to 200 nM UL42 alone (results not shown, but see Fig.
5.4). The enhancement of UL9 unwinding activity by UL42 was specific since bovine serum albumin did not significantly stimulate or inhibit UL9 helicase activity over the same wide concentration range (Fig. 5.3).
Enhancement of UL9 helicase activity by UL42 does not occur at saturating
UL9 concentrations. To determine the effect of UL42 on both the rate and extent of unwinding by UL9, a detailed kinetic analysis of unwinding was performed over a range of
UL9 concentrations from subsaturating (below Kd) to saturating (five times Kd) with
respect to the 0.5 nM 23/38-mer DNA substrate. UL42 concentration was adjusted to a
4:1 ratio with respect to UL9 for low UL9 concentrations, but was not allowed to exceed
a concentration of 12.5 nM in reaction mixes, since higher concentrations of UL42
reduced the amount of stimulation of unwinding (Fig. 5.3B,and results not shown). Fig.
5.4A shows the kinetics of unwinding over a 90 min period at 3.13 nM UL9,
representative of a subsaturating UL9 concentration, while Fig. 5.4B shows unwinding at
99 50 nM UL9, representative of a saturating UL9 concentration, in the absence or in the presence of 12.5 nM UL42. Little or no unwinding of the DNA substrate was observed following incubation at 37oC in the absence of protein or in the presence of 12.5 nM UL42 alone. At the low UL9 concentration (3.13 nM), a lag of approximately 20 min was observed prior to a faster linear rate for unwinding the DNA, consistent with an assembly lag as suggested previously (Boehmer et al., 1993). Although the concentration of DNA unwound by UL9 in the presence of 12.5 nM UL42 was consistently higher than that observed with UL9 alone, those reactions containing UL9 and UL42 also display a lag of approximately 20 min prior to reaching the maximum steady-state rate for unwinding (Fig.
5.4A). Between 20 and 60 min, the amount of DNA unwound increased linearly with respect to time in reactions containing 3.13 nM UL9 alone or with a 4-molar ratio of
UL42. Over this time-frame, the steady state rate of unwinding by UL9 in the presence of
UL42 was 5.15 + 0.39 pM (molecules)/min, 2.5 times the rate of 2.08 + 0.44 pM/min observed with 3.13 nM UL9 alone (Table 5.1). Significant enhancement of the steady- state rate of unwinding by UL9 was observed at two other concentrations of UL9 below the apparent Kd (Table 5.1). However, the relative enhancement in rate was not consistent most likely due to the higher percentage error associated with low rate of unwinding with
1.56 nM UL9 and by the inability to use optimum ratios of UL42:UL9 above UL9 concentrations of 3.13 nM.
At saturating UL9 concentrations (50 nM), the time associated with the assembly lag was reduced, compared with that observed at lower UL9 concentrations. Unwinding of the DNA increased in a linear fashion with respect to time from 5 to 20 min after
100 initiation of reactions with UL9 alone (50 nM) or with 12.5 nM UL42 (Fig. 5.4B).
Although the steady-state rate of unwinding by 50 nM UL9 was nine times faster than observed at the subsaturating concentration of 3.13 nM, no increase in rate of unwinding was detected in the presence, compared to absence, of UL42. Indeed, as observed in results described above, the addition of 12.5 nM UL42 caused a slight reduction in the rate of unwinding by UL9 (Table 5.1, Fig. 5.4B). Thus, UL42 increases the rate and amount of unwinding observed after 90 min of incubation with subsaturating UL9 concentrations but not at saturating ones.
As noted above, an inhibitory effect of UL42 on the unwinding of subsaturating concentrations of UL9 was observed (Fig. 5.3B). Thus, when the effect of UL42 on saturating concentrations of UL9 was examined, UL42 was kept constant at 12.5 nM while the UL9 concentration was increased to 50 nM (Fig. 5.4B). Therefore, it was possible that the lack of stimulation observed at saturating concentrations of UL9 was due to a lack of an optimum UL9:UL42 ratio. Thus, the kinetics of unwinding by 25 nM UL9 was examined with and without an equimolar ratio of UL42. At 25 nM UL9, UL9 was close to saturating the 0.5 nM DNA (see Fig. 5.2B), and UL42 of that concentration also did not fully saturate the DNA substrate. As shown in Fig. 5.5A, this amount of UL42 neither stimulated nor inhibited the unwinding by 25 nM UL9, providing further evidence that UL42 does not stimulate unwinding at saturating or close to saturating concentrations of UL9.
Although inhibition of UL9 unwinding by large concentrations (200 nM) of UL42 had been observed, the mechanism by which UL42 inhibited unwinding was unclear.
101 Thus, the kinetics of unwinding by 25 nM UL9 was examined in the presence of a 15-fold excess of UL42 or bovine serum albumin (BSA) control protein. Notably, unwinding by
UL9 was dramatically inhibited at all times after initiation (Fig. 5.5). In contrast, the 15- fold excess of BSA neither stimulated nor inhibited unwinding by UL9, consistent with the results observed for subsaturating UL9 (see Fig. 5.3).
The ability of UL42 to enhance saturating or subsaturating concentrations of a non-homologous helicase, hepatitis C virus (HCV NS3h) was tested. Reactions contained
23/38-mer substrate (2 nM), and 50 nM or 6.25 nM NS3h protein, and were initiated by the addition of buffer or 50 nM UL42 protein. The amount of 23-mer unwound in the absence vs. presence of UL42 was monitored kinetically (20 sec-10 min), and was plotted as a function of time (Fig. 5.5C). Notably, the addition of UL42 protein did not significantly affect either the rate of unwinding, or the maximum amount of DNA unwound by either concentration of NS3h helicase.
UL42 differs from ICP8 in parameters associated with enhancement of UL9 helicase activity. Another essential HSV-1 DNA replication protein, ICP8, also has been shown to enhance the ability of UL9 to unwind DNA containing a 3' ss overhang
(Boehmer et al., 1993; Makhov et al., 1996). To begin to assess whether UL42 and ICP8 enhance UL9 unwinding by similar or different mechanisms, the effect of ICP8 on unwinding by subsaturating and saturating UL9 concentrations was tested under the same assay conditions. The stoichiometry of ICP8 to UL9 which produces optimum enhancement of unwinding by UL9 has been shown to be 1:1, but even much higher stoichiometries produce similar enhancement, provided that the ICP8 concentration is
102 maintained below that required to coat 100% of the ss DNA in the reactions (Boehmer,
1998). Moreover, because ICP8 is an ATP-independent helix-destabilizing protein, levels of ICP8 need to be used which are unable to melt significant amounts of the DNA substrate under the reaction conditions used. Control experiments revealed that in the absence of UL9, only small amounts (2.4%) of the substrate melted after 20 min with 12.5 nM ICP8, although larger amounts were melted with higher concentrations. UL9 and
ICP8 proteins were preincubated to drive complex formation and reactions were initiated following dilution to achieve a UL9 concentration of 3.13 or 50 nM. When either a 4:1
(not shown) or 2:1 ratio of ICP8 was used with a final UL9 concentration of 3.13 nM, an enhancement in the rate and extent of UL9 unwinding was observed at all times up to 90 min (Fig. 5.6A). However, the low but detectable level of melting of the DNA substrate by 12.5 nM ICP8 alone (0.63 pM/min), compared with the low level of unwinding by 3.13 nM UL9, complicated the interpretation of the results (Table 5.1). Therefore, Fig. 5.6A shows the results of triplicate unwinding reactions obtained with 6.25 nM ICP8 (a 2:1 ratio with respect to UL9). This concentration of ICP8 would be expected to drive complex formation with UL9, but unwind only small amounts of the DNA compared to reactions containing no added protein. The steady-state rate of unwinding by 3.13 nM
UL9 in the presence of ICP8 was 5.26 + 1.11 pM/min, an enhancement of 2.5-fold (Table
5.1), and similar to the rate observed in the presence of UL42. In contrast to what was observed with UL42 at saturating UL9 concentrations, the addition of 12.5 nM ICP8 enhanced the steady-state rate of unwinding by 50 nM UL9 more than 5-fold (Fig. 5.6B,
Table 5.1). This concentration of ICP8 resulted in the melting of a small percentage of the
103 DNA substrate after 60 min (Fig. 5.6B) and probably accounts for the slight difference in the maximum concentration of DNA unwound by 50 nM UL9 in the presence versus the absence of ICP8. The ability of ICP8 to enhance the rate of unwinding by UL9 at both saturating and subsaturating UL9 concentrations suggests that one or more mechanisms for enhancement may differ between UL42 and ICP8.
UL42 does not alter the dissociation rate of UL9 from the 23/38-mer DNA substrate. The results which demonstrated that UL42 enhanced the steady-state rate for unwinding at subsaturating UL9 to DNA concentrations are consistent with the hypothesis that UL42 increases the affinity of UL9 for the DNA substrate. Because moderately high concentrations of UL42 resulted in reduced enhancement of unwinding, it was not possible to accurately measure the apparent Kd of UL9 in the presence of UL42 as was done for UL9 alone (Fig. 5.2B). However, increased affinity could be due to decreased dissociation rate, increased association rate, and/or increased assembly rate. Thus, the ability of excess unlabeled competitor DNA substrate to alter the steady-state rate of UL9 unwinding in the absence or presence of accessory protein was first measured. Parallel reactions were initiated by the addition of 3.13 nM UL9 alone, or in combination with
UL42 (12.5 nM) or ICP8 (6.25 nM), and incubated at 37oC. After 40 min, a protein trap consisting of a 100-fold excess of unlabeled 45/60-mer competitor substrate was added.
To control reactions, a comparable volume of buffer was added and portions of each reaction were removed and analyzed for unwinding. The results (Fig. 5.7) demonstrate that new steady-state kinetics were established in each set of reactions after approximately
5 min as indicated by the slight reduction in rate in buffer controls (closed symbols) due to
104 dilution of UL9. The addition of cold competitor substrate effectively trapped the UL9 as it dissociated from labeled 23/38-mer substrate (Fig. 5.7A), such that essentially no additional unwinding was observed within 5 min of the addition of trap. Although UL42
(Fig. 5.7B) and ICP8 (Fig. 5.7C) each increased the rate of unwinding by UL9, neither accessory protein significantly altered the rate of dissociation of UL9 from the labeled
DNA substrate. Indeed, UL9 was estimated to have a half-life of 1.3-1.6 min on the DNA substrate, regardless of the presence or absence of accessory protein, based on exponential fits of kinetic data following the addition of excess unlabeled 45/60-mer to trap UL9 which dissociated from the labeled DNA substrate (Fig. 5.8). However, on longer DNA substrates, ICP8 has been shown to decrease the rate of dissociation of UL9 (Boehmer,
1998). Because of the short length of the DNA substrate used in these experiments and the inability to observe a change in dissociation kinetics of UL9 in the presence of ICP8, it is likely that the dissociation of the UL9 from the end of the DNA, as it completes unwinding and/or translocation is more rapid than its rate of dissociation from an internal position. Thus under these assay conditions, a change in dissociation kinetics cannot account for the increased rate of unwinding observed in the presence of either UL42 or
ICP8.
Effect of accessory proteins on the association kinetics of UL9 with DNA. To begin to address other mechanisms by which UL42 could enhance the steady-state rate for unwinding by UL9, it was important to determine whether UL42 was capable of increasing the rate following preloading of UL9 onto the DNA. Because the preceding reactions involved initiation with UL9 and included excess ss DNA trap to prevent
105 reannealing of unwound substrate, it was important to know how unwinding rates were
affected when UL9 was preloaded onto labeled DNA substrate in the absence of the DNA
trap. Reactions were assembled in buffer containing labeled DNA and ATP, but with
EDTA to prevent premature initiation as described in Materials and Methods. Parallel
reactions were prepared to contain UL9 (3.13 nM) for preloading, and were initiated by
the addition of MgCl2 and the ss DNA trap, or did not contain UL9 and were initiated by
the addition of UL9 and MgCl2 (Fig. 5.9A). The amount of DNA unwound as a function
of time at 37oC was monitored. Despite equilibration of UL9 with labeled DNA for 10 min prior to initiation, a lag of 10-15 min was observed before rapid unwinding occurred in reactions containing preloaded UL9 or in those in which UL9 was added at the time of initiation. However, lack of preincubation of UL9 with the labeled DNA substrate slowed the initial rate of unwinding by UL9, in part due to competition between the partially duplex labeled DNA substrate and the excess ss DNA trap for binding to UL9.
Nevertheless, reaction rates were indistinguishable at later times regardless of whether
UL9 had been preloaded onto DNA or whether it was added at the time of initiation.
Taken together, these results suggest that the initial stages of unwinding are limited more
by the rate of assembly of UL9 than by the rate at which UL9 binds to the DNA.
It was predicted that if UL42 enhanced the assembly of UL9 onto DNA, then a
decrease in the lag time prior to the onset of a rapid and linear rate for unwinding should
be observed. In two sets of reactions, UL9 was preincubated with the labeled DNA
substrates and reactions were initiated with or without UL42 protein in buffer containing
MgCl2 and ss DNA trap (Fig. 5.9B). In a third set of reactions, UL9 and UL42 were
106 included in the preincubation mix and reactions were initiated with MgCl2 and ss DNA trap. Similar kinetics for unwinding were observed in reactions containing both UL9 and
UL42, regardless of whether UL42 was included in the preincubation mix. As observed above, reaction rates in the presence of UL42 were higher than in reactions containing only UL9. Despite the more rapid rate for unwinding by UL9 in the presence of UL42,
UL42 did not significantly decrease the initial lag period associated with functional UL9 assembly (Fig. 5.9B).
To better distinguish association kinetics from the kinetics of assembly into functionally competent protein, reactions were initiated with UL9 (3.13 nM) and allowed to reach steady-state (15 min), prior to the addition of UL42 (12.5 nM), ICP8 (6.25 nM), or equivalent volume of buffer. Similar rates of unwinding were observed for approximately 15 min after the addition of UL42 or buffer (Fig. 5.10A). However, following this 15 min lag period, the rate of unwinding increased substantially for reactions containing UL42, but remained the same for control reactions. In other experiments, when UL42 (or buffer) was added 40 min after initiation, similar rates of unwinding were also observed for approximately 15 min following the addition of UL42 vs. buffer, and an increased rate for unwinding thereafter in UL42-containing reactions (results not shown).
The fact that steady-state reaction rates did not change for 15 min following the addition of UL42, regardless of the time of addition of the accessory protein, argues that UL42 has little or no impact on the inherent ability of UL9 to assemble into a functionally competent complex.
107 Similar reactions were performed in which ICP8 was added 15 min following initiation of reactions with UL9 (Fig. 5.10B). In contrast to what was observed following the addition of UL42, the concentration of unwound product increased rapidly (within 5 min) following the addition of ICP8, compared to only a slight increase in unwinding observed over the same period in controls in which buffer only was added to reactions.
Thus ICP8-containing reactions did not require an additional assembly period, or the period was drastically reduced before a new steady-state rate was established, suggesting a role for ICP8 in facilitating assembly of functionally competent UL9 onto DNA. This is consistent with observations by others that ICP8 eliminates the lag period observed in
UL9 helicase reactions (Boehmer, 1998; Boehmer et al., 1993).
Discussion. It is becoming increasingly evident that the formation of the HSV-1
DNA replisome is likely to involve a large number of viral (and perhaps host) protein- protein interactions (Boehmer and Lehman, 1997). Results from the Parris lab previously demonstrated that two of the essential HSV-1 DNA replication proteins, UL9 and UL42, physically interact (Monahan et al., 1998), and so I set out to determine whether the proteins also exhibited a functional interaction. These results demonstrate for the first time that the polymerase processivity factor, UL42, which has no known inherent enzymatic activity, also provides accessory function to UL9, the protein thought to initiate
DNA replication. Although the events required to initiate ori-dependent DNA replication remain unclear, it is likely that the helicase activity of UL9 is important in this process
(Marincheva and Weller, 2001). Nevertheless, in vitro, UL9 alone unwinds DNA poorly and requires high stoichiometries with respect to DNA for optimum unwinding (e.g. Fig.
108 5.1; Fig. 5.2). ICP8, another essential HSV-1 DNA replication protein, has been shown to enhance UL9 ATPase and helicase activities (Aslani et al., 2002; Dodson and Lehman,
1993; He and Lehman, 2001; Lee and Lehman, 2001; Boehmer et al., 1993; Fierer and
Challberg, 1992; Makhov et al., 2003; Tanguy Le Gac and Boehmer, 2002). Although it was clear in the initial experiments that UL42 also enhances the helicase activity of UL9 in vitro, the mechanism(s) by which it does so was not. Therefore, the behavior of UL9 in the presence of UL42 was compared to that in the presence of ICP8 to better uncover how each accessory function worked.
Mechanism by which UL42 enhances the steady-state rate of unwinding. The ability of UL42 to enhance the steady-state rate of helicase activity at subsaturating, but not at saturating, concentrations of UL9 suggested that UL42 increased the amount of
UL9 bound in functional complex to the DNA substrate at equilibrium. Several possible mechanisms by which this could be accomplished include increasing the rate of binding of
UL9 to the DNA substrate, decreasing its rate of dissociation from DNA, and/or increasing the ability or rate of UL9 to assemble into functional complex once bound to
DNA. To simplify analysis, a short DNA substrate was selected to minimize the possibility for enzyme dissociation prior to completing unwinding of the DNA. That dissociation of UL9 from the DNA is controlled predominantly by translocation off the end, rather than from an internal location, is suggested by the fact that ICP8 does not decrease the dissociation rate of UL9 from the 23/38-mer (compare Fig. 5.7C with 5.7A), despite the fact that it does increase retention of UL9 on longer DNA substrates
(Boehmer, 1998). Because UL42 did not alter dissociation kinetics of UL9 from this
109 short DNA substrate (Fig. 5.7A and B), dissociation cannot account for the increased steady-state of unwinding observed for UL9 in the presence of UL42. However, these studies have not addressed possible effects of UL42 on the processivity of UL9 helicase activity on longer DNA substrates.
UL9 requires a period of time after binding to DNA before initiating unwinding
(Boehmer, 1998; Boehmer et al., 1993), and unwinds stoichiometrically (Boehmer et al.,
1993). These results suggest that assembly of UL9 into a functional helicase activity is required following initial binding of UL9 to DNA, and is most likely a rate limiting step
(Boehmer, 1998). Although neither the stoichiometry nor the nature of the functional helicase is known, it is interesting to note that unwinding was observed to be cooperative
(Fig. 5.2B). This cooperativity may reflect an essential assembly step which is required for
UL9 helicase function. However, the possibility that the lag period may involve dissociation of homodimers of UL9 has not been excluded (Tanguy Le Gac and Boehmer,
2002). These results demonstrate that UL42 does not alter the requirement for a slow assembly or disassembly step since no significant change in the lag time was observed prior to rapid unwinding by UL9 in the presence compared with the absence of UL42 (Fig.
5.4A, 5.9B). Moreover, addition of UL42 to ongoing steady-state reactions increased the rate of unwinding, but only after a delay of 10-15 min (Fig. 5.10A), roughly equivalent to the lag period observed prior to the onset of unwinding by UL9.
Given that UL42 does not alter the rate of dissociation of UL9 from the DNA under the reaction conditions, or substantially alter the requirement for assembly or disassembly into competent complex, the results are most consistent with UL42 increasing
110 the rate of association of UL9 with DNA. The ability to load UL9 onto DNA at a faster rate would result in a higher occupancy of UL9 on DNA, and an increase in steady-state rate, but only under conditions in which limiting UL9 is present. Interestingly, an extremely short lag time is also associated with the highest UL9:DNA stoichiometries
(100:1) used (Fig. 5.4B), suggesting an increased rate of assembly would be expected when more UL9 is bound to DNA. Nevertheless, UL42 increases by only 2.5-fold the steady-state rate of unwinding at subsaturating concentrations (3.13 nM) of UL9 (Table
5.1). Because the functional titration results (Fig. 5.2) demonstrate that a 2.5-fold increase in the amount of bound UL9 would remain far from saturating, increased binding at 3.13 nM UL9 is unlikely to result in a substantial alteration in lag time, although a slight increase in rate of assembly may occur. An increase in association rate of UL9 with DNA by UL42 is also consistent with the inability of UL42 to enhance UL9 helicase activity at saturating concentrations of UL9, since occupancy of UL9 on DNA under those conditions cannot be increased.
It was considered unlikely that UL42 increases the rate of association of UL9 with the DNA substrate by simply preventing nonproductive associations of UL9 with DNA.
First, enhancement of helicase activity increases proportionately with the addition of UL42 up to an optimum stoichiometry of 4 molecules of UL42 per molecule of UL9. However, neither the nature of complex is known nor the number of “active” molecules of each.
Second, higher concentrations of UL42 reduce the enhancement effect on helicase activity
(Fig. 5.3B), indicating that high occupancy of the DNA by UL42 actually decreases the ability of UL9 to associate with the DNA substrate. Third, UL42 failed to stimulate a
111 non-specific helicase, hepatitis C virus (HCV NS3h) at either subsaturating or saturating concentrations of helicase with respect to DNA (Fig. 5.5C). However, the possibility cannot be excluded that UL42 binding to ds DNA also contributes to or is required for enhanced UL9 loading.
Whether or not UL42 has an effect on the inherent rate by which UL9 unwinds
DNA was not addressed directly by these studies. However, it is considered unlikely that an increased rate of translocation and unwinding by UL9 could account for the increased steady-state rate of unwinding observed in the presence of UL42. An effect on translocation rate would be expected to have an effect on steady-state rates at saturating and subsaturating UL9 concentrations, but UL42 increased the steady-state rate of unwinding at only subsaturating concentrations of UL9 (Fig. 5.4). Moreover, in the presence of UL42, unwinding rates never exceeded that observed at saturating UL9 concentrations alone.
Mechanism by which ICP8 enhances the steady-state rate of unwinding.
ICP8 increased the steady-state rate for unwinding at subsaturating and saturating UL9 concentrations, as well as the maximum proportion of DNA unwound at all UL9 concentrations. These results demonstrate that ICP8 differs from UL42 in at least some aspects of the mechanism(s) by which it enhances helicase activity. Previous studies demonstrated that ICP8 increased the length of DNA which could be effectively unwound by UL9 (Boehmer and Lehman, 1993; Fierer and Challberg, 1992; Makhov et al., 1996).
Moreover, ICP8 allowed retention of UL9 on long (100-mer) DNA substrates following the addition of an unlabeled substrate, demonstrating that it increased the processivity of
112 unwinding by UL9 (Boehmer, 1998). A shorter DNA substrate was employed and demonstrated that ICP8 did not alter the rate of dissociation of UL9, most likely because
UL9 alone is capable of translocating off the end once unwinding begins. Because ICP8 increases the steady-state for unwinding of the short DNA substrate even when dissociation is not limiting, it is likely that ICP8 enhances the helicase activity of UL9 by mechanisms in addition to its effect on processivity.
Unlike UL42, ICP8 increased both the steady-state rate and amount of unwinding by UL9 (Fig. 5.6B) at all UL9 concentrations. Moreover, although the addition of UL42 prior to initiation or after steady-state rates had been established did not substantially alter the lag time associated with an assembly or disassembly step for the formation of functionally competent UL9 complex, the addition of ICP8 to steady-state reactions had an almost immediate effect on the steady-state rate as previously observed by others
(Boehmer, 1998; Boehmer et al., 1993). An approximate a two-fold increase in unwinding was observed within the first 5 min following the addition of ICP8 (Fig.
5.10B). In fact, ICP8 decreased the lag period associated with unwinding by UL9, when added at the time of initiation (Fig. 5.6) or following the establishment of steady-state kinetics (Fig. 5.10B). These results are consistent with the proposed ability of ICP8 to alter the conformation of UL9 to render it more competent for unwinding (Arana et al.,
2001; Lee and Lehman, 1999). The reduction in lag time indicates that ICP8 may increase the inherent rate of unwinding and/or increase the rate of assembly or disassembly of UL9 into functional complex. The complexity of the response to ICP8 prevents the ruling out of an effect on association kinetics of UL9 with DNA substrate.
113 At subsaturating UL9 concentrations, a condition which is likely to exist in HSV-
1-infected cells, the individual effects of UL42 and ICP8 on the steady-state rate for unwinding by UL9 are modest (2.5-fold; Table 5.1). However, it should be noted that
Mut L, a protein important in DNA repair, increases the ability of the helicase encoded by the UvrD gene to load onto DNA only two- to four-fold (Mechanic et al., 2000). These findings that UL42 and ICP8 enhance UL9 helicase activity by apparently different mechanisms suggest the possibility that they can act synergistically. Such synergism would provide for an even larger impact on unwinding. Although the ability of ICP8 and
UL42 to bind to UL9 simultaneously has not been determined, UL42 binds to the N- terminal portion of UL9 whereas ICP8 binds to the C-terminal domain (Boehmer et al.,
1994; Monahan et al., 1998). Given the poor ability of UL9 to unwind DNA and the high stoichiometries of UL9 to DNA required to achieve unwinding in vitro, it seems likely that other factors assist UL9 to unwind DNA in vivo, and UL42 now joins ICP8 as a likely candidate.
114
UL9 conc.
50 0.4 25 12.5 6.3
0.3
3.1
0.2
1.6
DNA Unwound (nM) 0.1
0.0 0 20406080100120140
Time (min)
Figure 5.1. The effect of increasing concentration of UL9 protein on the kinetics of unwinding. Increasing concentrations of UL9 (1.56-50 nM) were incubated with 23/38- mer substrate (0.5 nM) in bulk reactions at 37oC as described in Materials and Methods. Samples were removed at various times following initiation, terminated with the addition of EDTA, and the products were immediately separated by electrophoresis through 12% non-denaturing polyacrylamide gels. The concentration of 23-mer unwound was determined as described in Materials and Methods, and plotted as a function of time.
115
Figure 5.2. The effect of increasing concentration of UL9 protein in the helicase assay. Increasing concentrations of UL9 (0.8-100 nM) were incubated in triplicate with the 23/38-mer substrate (0.5 nM) for 20 minutes at 37oC as described in Materials and Methods, and the products were separated by electrophoresis through 12% non- denaturing polyacrylamide gels. A. Autoradiograms of gels are shown. The substrate was denatured by heating to 95oC for 5 min (∆), retained on ice (S), or incubated at 37oC with the indicated final concentrations of UL9. B. Gels were also exposed to phosphor screens and the concentration of free (unwound) 23-mer, was normalized for loading, was quantified using a Molecular Dynamics phosphorimager and ImageQuant software as described in Materials and Methods and plotted as a function of UL9 concentration. The data points shown represent the mean values + standard deviation of three independent replicates. The curve with the solid line shows the fit to the Michaelis-Menten equation (Hill coefficient of 1.0). The curve with the long dashed line shows the fit of the data
using eq. 2 and a Hill coefficient of 2 (apparent Kd = 9.6 + 0.8 nM), while the curve with the short broken line shows the best fit for the data with a Hill coefficient of 3.0 (apparent
Kd = 9.3 + 0.4 nM).
116
A UL9 (nM)
∆ S 0 0.8 1.6 3.1 6.3 12.5 25 50 100
dsDNA
ssDNA
B
0.4
0.3
0.2 0.2
0.1
0.1 DNA Unwound (nM) DNA Unwound (nM)
0.0 0 5 10 15 20 [UL9] (nM)
0.0 0 20406080100
[UL9] (nM)
Figure 5.2
117
Figure 5.3. Effect of UL42 on UL9 helicase activity. UL42 and UL9 proteins were incubated together at different ratios for 10 min at room temperature to allow for complex formation and diluted immediately prior to initiation of reactions to achieve a final UL9 concentration of 3.13 nM and the indicated concentrations of UL42. For controls containing no added UL42 protein, UL9 protein was similarly incubated alone at room temperature (0 nM UL42) or with bovine serum albumin (BSA) and diluted immediately prior to initiation of reactions. All reactions contained 0.5 nM 23/38mer and were initiated by the addition of preincubated UL9, UL9/UL42, or UL9/BSA mixes. Reactions were incubated at 37oC and terminated after 40 min by the addition of EDTA. The products were separated as described in the legend to Fig. 5.2 and the concentration of unwound 23-mer was plotted as a function of final UL42 () or BSA () protein concentration. A. Reactions were initiated with UL9 and UL42 (0-25 nM ) or with UL9 and BSA (12.5 nM ). The data point for UL9 alone (3.13 nM) was the average of two independent reactions. B. Reactions were initiated with 3.13 nM UL9 and a higher concentration range of UL42 (12.5-200 nM) or BSA (200 nM).
118
A 0.12
0.10
0.08
0.06
0.04
DNA Unwound Unwound (nM) (nM) 0.02
0.00 0 5 10 15 20 25 30 UL42 concentration (nM)
B 0.12
0.10
0.08
0.06
0.04
DNA (nM) Unwound 0.02
0.00 50 100 150 200 UL42 concentration (nM)
Figure 5.3
119
Figure 5.4. Effect of UL42 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9. Reactions were performed in bulk as described in the legend to Fig. 5.3, except that samples were removed at various times following initiation and terminated by the addition of EDTA. The concentration of unwound 23-mer was determined as described and plotted as a function of time. The data shown represent the mean values + standard deviation from three independent experiments. A. Unwinding with a subsaturating concentration (3.13 nM ) of UL9 alone (), with 3.13 nM UL9 and 12.5 nM UL42 (), with 12.5 nM UL42 alone (∆), or with no added protein (). B. Unwinding with a saturating (50 nM) concentration of UL9 alone (), with 50 nM UL9 and 12.5 nM UL42 (), with 12.5 nM UL42 alone (∆), or with no added protein ().
120
A 0.4
0.3
0.2
0.1 UnwoundDNA (nM)
0.0 0 20406080100
Time (min)
B 0.4
0.3
ound (nM) 0.2
0.1 DNA Unw
0.0 0 20406080100
Time (min)
Figure 5.4
121
Figure 5.5. Effect of a high UL42 concentration of UL42 protein on UL9 unwinding. Reactions were performed as described in the legend to Fig. 5.4. A. Unwinding with 25 nM UL9 alone (), with 25 nM UL9 and 25 nM UL42 (), or with 375 nM UL42 (). B. Unwinding with 25 nM UL9 alone (), with 375 nM UL42 (), with 375 nM BSA (▲). Control reactions lacking UL9 contained 375 nM UL42 () or 375 nM BSA (∆). C. Effect of UL42 on the kinetics of unwinding of Hepatitis C Virus NS3h (HCV-NS3h) helicase. HPV-NS3h helicase (6.25 nM or 50 nM) was preincubated at room temperature in buffer containing 20 mM Mops pH 7.0, 5 mM MgAc, 0.1 mg/ml BSA, and 2 nM 23/38-mer (23-mer 32P-end-labeled), and reactions were initiated by the addition of 5 mM ATP, 20 nM unlabeled 23-mer, 10 mM NaCl, with or without 50 nM UL42 (final concentrations). Reactions were monitored kinetically (0- 600 sec), and were stopped by the addition of EDTA and analyzed as in Fig. 5.4. Unwinding with 6.25 nM NS3h alone () or with 50 nM UL42 (); Unwinding with 50 nM NS3h alone () or with 50 nM UL42 ().
122
A B
0.4 0.4
0.3 0.3
0.2 0.2
DNA unwound (nM) unwound DNA 0.1 (nM) unwound DNA 0.1
0.0 0.0 0 20406080100120140 0 20406080100120140 Time (min) Time (min)
C 1.5
1.0
0.5
DNA Unwound (nM)
0.0 0 100 200 300 400 500 600 700 Time (sec)
Figure 5.5
123
Figure 5.6. Effect of ICP8 on the kinetics of unwinding at subsaturating and saturating concentrations of UL9. Reactions were performed essentially as described in the legend to Fig. 5.4, except that the accessory protein added was ICP8. Each data point represents the mean + standard deviation from three independent experiments. A. Unwinding with a subsaturating concentration (3.13 nM) of UL9 alone (), with 3.13 nM UL9 and 6.25 nM ICP8 (), with 6.25 nM ICP8 alone (), or with no added protein (). B. Unwinding with a saturating concentration (50 nM) of UL9 alone (), with 50 nM UL9 and 12.5 nM ICP8 (), with 12.5 nM ICP8 alone (), or with no added protein ().
124
A
0.4
0.3
0.2
DNA Unwound (nM) 0.1
0.0 0 20406080100
Time (min)
B
0.4
0.3
0.2
DNA Unwound (nM) 0.1
0.0 0 10203040506070 Time (min)
Figure 5.6
125 Table 5.1. Unwinding by UL9 with or without Accessory Proteins.
UL9 Unwinding Unwinding rate Fold Unwinding Fold conc. rate for UL9a for UL9 and increase rate for UL9 increase (nM) (pM/min) UL42b with and ICP8d with (pM/min) UL42c (pM/min) ICP8c 1.56 1.48 + 0.17 2.38 + 0.67 1.6 n.d.e n.d. 3.13 2.08 + 0.44 5.15 + 0.39 2.5 5.26 + 1.11f 2.5 6.25 4.32 + 0.04 5.54 + 0.09 1.3 n.d. n.d. 50 18.8 + 0.7 16.6 + 1.8 0.9 101 + 5g 5.4
a Calculated by linear regression analysis using the fastest linear rate, and represent the
mean value + standard deviation from at least three independent experiments.
b UL42 concentration was 12.5 nM and was mixed with the indicated UL9 concentration
for 10 minutes prior to initiation. The rate for unwinding by UL42 alone was
indistinguishable from the buffer control.
c Measured by dividing the unwinding rate for UL9 with accessory protein, as indicated, by
that for UL9 alone at each of the indicated concentrations.
d Determined as indicated above, except that the amount of DNA unwound by ICP8 alone
was subtracted from that for UL9 together with ICP8.
e Not done. f ICP8 concentration was 6.25 nM, and was mixed with 3.125 nM UL9 for 10 minutes
prior to initiation. The rate of unwinding by ICP8 alone was 0.26 pM/min.
gICP8 concentration was 12.5 nM, and was mixed with 50 nM UL9 for 10 minutes prior
to initiation. The rate of unwinding by ICP8 alone was 0.63 pM/min.
126
ABUL9UL9+UL42 C UL9+ICP8 0.4 0.4 0.4
0.3 0.3 0.3
0.2 0.2 0.2
0.1 0.1 0.1 DNADNADNA Unwound Unwound Unwound (nM) (nM) (nM) DNADNADNA Unwound Unwound Unwound (nM) (nM) (nM) (nM) (nM) (nM) Unwound Unwound Unwound DNA DNA DNA
0.0 0.0 0.0 127 0 20406080100 0 20406080100 0 20406080100 Time (min) Time (min) Time (min)
Figure 5.7. Effect of competitor DNA on the kinetics of UL9 unwinding with or without accessory proteins. UL9 was incubated alone (A), or together with a four-fold molar concentration of UL42 (B), or a two-fold molar concentration of ICP8 (C) at room temperature for 10 min and diluted immediately prior to initiation of reactions to achieve final concentrations of 3.13 nM for UL9, 12.5 nM for UL42 or 6.25 nM for ICP8, and 0.5 nM labeled 23/38-mer DNA substrate. Reactions were incubated at 37oC and samples were removed at the times indicated and terminated by the addition of EDTA. A 100-fold excess (50 nM) of non-radioactive competitor substrate (45/60-mer) was added (open symbols) forty minutes after initiation (indicated by the arrow), or the same volume of buffer was added to control reactions (closed symbols).
127
A UL9 BCUL9+UL42 UL9+ICP8 0.025 0.025 0.025
0.020 0.020 0.020
0.015 0.015 0.015
0.010 0.010 0.010
DNA Unwound (nM) DNA Unwound (nM) 0.005 DNA Unwound (nM) 0.005 0.005
0.000 0.000 0.000 0 102030405060 0 102030405060 0 5 10 15 20 25 128 Time (min) Time (min) Time (min)
Figure 5.8. Exponential curve fits of UL9 unwinding kinetics after the addition of DNA trap with or without accessory proteins. The concentration of DNA unwound at the time of addition of a 100-fold excess of DNA trap (Figure 5.7) was set to zero, and the concentration of DNA unwound after the addition of trap was plotted as a function of time. The data was fit to an exponential decay function, and the half-life was determined. A, 3.13 nM UL9 (), T1/2= 1.3 + 0.4 min; B, 3.13 nM UL9 and 12.5 nM UL42 (),
T1/2=1.6 + 0.5 min; C, 3.13 nM UL9 and 6.25 nM ICP8 (▲), T1/2=1.3 + 0.5 min.
128
Figure 5.9. Effect of preloading on UL9 unwinding kinetics. UL9 (3.13 nM) was preincubated with 0.5 nM labeled 23/38-mer DNA for 10 minutes at 37oC in the presence
of EDTA, and reactions were initiated with MgCl2 and 5 nM unlabeled 23-mer ssDNA trap (). In parallel reactions containing 0.5 nM labeled 23/38-mer and 5 nM unlabeled 23-mer DNA trap, reactions were initiated by the addition of 3.13 nM UL9 () or a comparable volume of buffer (). Samples were removed at the indicated times, quenched with EDTA, and the concentration of 23-mer unwound was quantified as described in Materials and Methods. B. Effect of preloading UL42 with UL9. For all reactions, UL9 or a mixture of UL9 and UL42 was preincubated with 0.5 nM labeled 23/38-mer DNA substrate for 10 min. () Reactions contained 3.13 nM UL9 and were initiated by the addition of MgCl2 and 5 nM 23-mer ss DNA trap; () reactions contained
3.13 nM UL9 and were initiated by the addition of MgCl2, ss DNA trap, and UL42 (12.5 nM, final concentration); (▲) reaction mixes contained 3.13 nM UL9 and 12.5 nM UL42,
and were initiated by the addition of MgCl2 and 5 nM 23-mer ss DNA trap.
129
A 0.3
0.2
0.1
(nM) DNA Unwound
0.0 0 10203040506070 Time (min)
B
0.3
0.2
0.1
DNA Unwound Unwound (nM) (nM)
0.0 0 10203040506070 Time (min)
Figure 5.9
130
Figure 5.10. Kinetics of unwinding by UL9 following the addition of accessory proteins to steady-state reactions. Reactions containing 0.5 nM labeled 23/38-mer substrate were initiated by the addition of UL9 (3.13 nM, final concentration) and samples were removed at the indicated times following initiation. A. Fifteen minutes after initiation (indicated by the arrow), UL42 (12.5 nM final concentration; ) or an equivalent volume of buffer () was added and unwinding by UL9 was monitored as a function of time. In control reactions lacking UL9, the DNA substrate was incubated in the absence of added protein () or 15 min after initiation, 12.5 nM UL42 was added (). B. Reactions were conducted as indicated for panel A, except that ICP8 (6.25 nM) was added after 15 min to reactions containing 3.13 nM UL9 (▲), or a comparable volume of buffer was added (). Control reactions lacking UL9 contained no added protein () or 6.25 nM ICP8 was added 15 min after initiation (∆).
131
A
0.25
0.20
0.15
0.10
DNA Unwound (nM) (nM) 0.05
0.00 0 20406080100
Time (min)
B 0.4
0.3
0.2
0.1 DNA Unwound (nM)
0.0 0 20406080100 Time (min)
Figure 5.10
132
CHAPTER 6
DNA-DEPENDENT ATPASE ACTIVITY OF UL9
The ability of helicases to bind and hydrolyze nucleoside triphosphates is integral to their ability to unwind DNA. Specifically, nucleotide hydrolyis drives the unidirectional translocation of helicases along DNA to allow the separation of the DNA strands (reviewed in Levin and Patel, 2003). However, unlike helicase activity which is stoichiometric, ATP hydrolysis represents a simpler catalytic process.
UL9 has been shown to possess a DNA-dependent ATPase activity (Bruckner et al., 1991; Fierer and Challberg, 1992), and its ability to hydrolyze nucleoside 5’- triphosphates is influenced strongly by the structure, sequence, and length of the DNA cofactor (Dodson and Lehman, 1993). UL9 requires at least 14 nucleotides to elicit
DNA-dependent ATP hydrolysis, and activity increases with increasing DNA length up to approximately 60 nucleotides (Dodson and Lehman, 1993). Further, optimum activity was observed on single-stranded substrates containing minimum secondary structure
(Dodson and Lehman, 1993).
133 Because UL42 increases the steady-state rate of helicase activity of UL9 on a
23/38-mer DNA substrate, I was interested to determine whether UL42 likewise
stimulated the ATPase activity of UL9. To this end, a sensitive radioactive release assay
was employed to measure the conversion of α-[32P]-ATP to α-[32P]-ADP. Products were
separated by thin layer chromatography, and the concentration of ATP hydrolyzed was
quantified by phosphorimage analysis. Initially, the apparent Km for ATP binding was
determined to ensure that ATP concentration would not be limiting. Thus, 50 nM UL9
was incubated at 37oC with increasing concentrations of ATP (0-5 mM), and a large
excess of 23/38-mer DNA (500 nM). Reactions were terminated at various times, and the
concentration of ATP hydrolyzed was plotted as a function of time (Fig. 6.1A). The rate
of ATP hydrolysis increased with increasing concentrations of ATP up to 2.5 mM.
Concentrations of ATP above 5 mM ATP were inhibitory (data not shown). The
maximum steady-state rate constants were determined, plotted as a function ATP
concentration (Fig. 6.1B), and fit to the Michaelis-Menten function. The results
demonstrated an apparent Km for ATP of 0.68 + 0.11 nM and a steady-state catalytic rate
-1 constant of 360 + 19 min . The use of ATP concentrations approximately five times Km
(3 mM) in all subsequent reactions ensured that ATP was saturating. This amount of
ATP was also used in the helicase reactions (see Chapter 5).
Although the helicase assay utilized the partially duplex DNA substrate, the
ATPase assay provided a means to test the ability of UL9 to hydrolyze ATP as it translocates on single-stranded and partially duplex DNA substrate. Thus, UL9 protein
(50 nM) was incubated with increasing concentrations (0-1024 nM) of ss DNA (38-mer) or 23/38-mer DNA, and the formation of ADP was monitored for up to 1 hour. The
134 concentration of ATP hydrolyzed was plotted as a function of time for the single-stranded or partially duplex DNA coeffectors (Fig. 6.2A and B, respectively). The maximum steady-state rate constants were determined and plotted as a function of DNA concentration. The data were fit to the Michaelis-Menten function (Fig. 6.3A,B) to estimate the apparent Km catalytic rate constant at saturating DNA concentrations.
Interestingly, there was little difference between the catalytic rate of ATP hydrolysis during translocation on single-stranded DNA (407 + 19 min-1) and that during translocation on partially duplex DNA (460 + 16 min-1) (Fig. 6.3A and B, respectively).
Similarly, the Km (47.4 + 9.7 nM) for single-strand DNA was comparable to that for the partially duplex DNA (38.0 + 5.9 nM). Thus, similar steady-state kinetics appear to drive
UL9 translocation on single-strand vs. partially duplex DNA substrates.
Because UL42 was shown to increase the steady-state rate of UL9 unwinding at subsaturating, but not saturating UL9 concentrations, it was of interest to determine if
UL42 increased the ability of UL9 to hydrolyze ATP on subsaturating or saturating concentrations of UL9 to DNA. Thus, it was important to determine the apparent Km for
UL9 binding to the single-strand and partially duplex DNA coeffector under the standard conditions of the ATPase assay. Ideally, concentrations five times the Km of DNA are best used, but it was not possible to achieve concentrations of UL9 high enough to approach saturation under these conditions (results not shown). Thus, reactions were adjusted to contain a DNA concentration (50 nM) which at least half was bound to 50 nM
UL9 (~Km). Reactions were initiated by the addition of increasing concentrations of UL9
(0-288 nM), and terminated at various times thereafter. The ATPase activity with the 38- mer or 23/38-mer DNA coeffector for each UL9 concentration was plotted (Fig. 6.4).
135 The maximum rates were plotted vs. UL9 concentration for the single-strand and partially duplex DNA coeffector (Fig. 6.5A,B). Interestingly, the data fit poorly to the Michaelis-
Menten function, but fit well to the Hill equation with a coefficient of 2. The results estimated an apparent Km of 72.7 + 14.7 nM for UL9 and 38-mer DNA, and 94.2 + 14.9
nM for UL9 and 23/38-mer DNA. The efficiency of ATP conversion (Vmax/Km) on the
single-strand DNA was 245/min, while that on the partially duplex DNA was marginally
higher (265/min). An increased efficiency of ATP hydrolysis was also observed by
others using a hairpin vs. completely single-stranded DNA (Arana et al., 2001).
Because UL42 was shown to increase the helicase activity at subsaturating
concentrations of UL9 to DNA, I was interested in testing whether UL42 also stimulated
the rate of ATP hydrolysis at subsaturating UL9 to DNA concentrations. The results
shown in Fig. 6.5 suggest that 25 nM UL9 was below Km for both the single-strand and
partially duplex DNA. It was also of interest to determine the ability of UL42 to
stimulate the ATPase activity of UL9 on blunt double-stranded DNA (38/38-mer) as well
as its effect on the inherent DNA-independent ATPase activity of UL9. Thus, reactions
contained 50 nM 38/38-mer, 23/38-mer, 38-mer, or no DNA, and were initiated by the
addition of 25 nM UL9, or a mixture of 25 nM UL9 and 50 nM UL42. Product formation
was monitored kinetically (Fig. 6.6). As expected, the rate of ATP hydrolysis by UL9
alone was the highest on the single-strand and partially duplex DNA. The ATPase rate
was significantly higher on the fully duplex DNA (38/38-mer) than for UL9 in the
absence of DNA. This was an unexpected result, because it has been shown by others
that UL9 is not able to unwind fully duplex DNA (Fierer and Challberg, 1992; Boehmer
et al., 1993). In addition, in experiments containing limiting DNA (10 mM) and 125 nM
136 UL9, there was no difference in the rate of ATP hydrolysis in the absence of DNA, or in
reactions containing fully duplex DNA (results not shown). These results may indicate
partial melting of the 38/38-mer DNA, or the presence of some single-strand DNA in the
reactions, since the substrate was made from annealing the two strands in a 1:1 molar
ratio. In reactions containing no DNA or the fully duplex DNA, there was no observed
difference in the rate of ATP hydrolysis in the absence vs. presence of UL42.
Interestingly, at limiting UL9 concentrations with respect to DNA, the rate of
ATP hydrolysis was higher on the partially duplex DNA coeffector compared to the
single-strand DNA. However, with both substrates, there was a substantial lag period of
approximately 30 min prior to a linear rate of ATPase hydrolysis. The addition of UL42
to these reactions did not change the lag period. However, a slight increase in linear
unwinding rates was observed in the presence vs. absence of UL42 with the single-strand
and partially duplex DNA coeffector.
Because it appeared that UL42 increased the rate of UL9 ATP hydrolysis on 38-
mer and 23/38-mer without reducing the lag period, experiments were designed to test the
ability of UL42 to increase the rate of hydrolysis if added at the time of initiation. To this
end, UL9 (25 nM) was preincubated for 20 min with the 23/38-mer or 38-mer DNA
coeffector (50 nM) and ATP, and the reactions were initiated by the addition of MgCl2 and buffer or UL42 (50 nM or 100 nM). Product formation was observed kinetically (0-
90 min), and the amount of ATP hydrolyzed was plotted vs. time (Fig. 6.7). Figure 6.7A shows the effect of UL42 on the ability of UL9 to hydrolyze ATP with a 23/38-mer DNA coeffector. Interestingly, although UL42 was added at the time of initiation, there was a
20 minute lag prior to any increase in rate. However, following the lag period, UL42
137 increased the steady-state rate of ATP hydrolysis of UL9 by 1.5 fold. Similar reactions performed with 38-mer DNA indicated that there was also a 10-20 min lag prior to an increased rate in the presence of UL42 (Fig. 6.7B). A comparison of the steady-state rates of ATP hydrolysis on the single-stranded DNA with and without UL42 demonstrated a 3-fold increase in rate.
Discussion. These results demonstrate for the first time that the polymerase processivity factor, UL42, increases the steady-state rate of ATP hydrolysis by UL9.
Under conditions of limiting UL9 and DNA, UL42 increases the steady-state rate of hydrolysis on the partially duplex helicase substrate, as well as on single-strand DNA.
Further experiments will be required to determine if UL42 increases the inherent rate of
ATP hydrolysis, or whether UL42 affects the rate of hydrolysis with double-stranded
DNA.
The results from the helicase assay demonstrated that UL42 increased the rate of unwinding, but did not substantially affect the rate of assembly/disassembly. That the addition of UL42 at the time of initiation increased the rate of hydrolysis, but only after
10-20 minutes, provides further evidence that UL42 is unlikely to affect the assembly step of UL9 and DNA. Moreover, the results are consistent with the helicase assay results suggesting that UL42 increases the affinity of UL9 for DNA. Interestingly, UL42 increased the rate of hydrolysis on single-stranded DNA to a greater extent than on the partially duplex DNA substrate, but the rates did not exceed those with partially duplex
DNA. These results demonstrate that UL42 likely does not increase the ATPase rate or helicase rate simply by its inherent ability to bind double-stranded DNA. Instead, the
138 ability to stimulate UL9 on single-stranded DNA suggests that UL42 is increases the rate by another mechanism.
Since ATP hydrolysis drives the unidirectional translocation of a helicase along
DNA, the measurement of hydrolysis provides a simplified assay to better understand helicase movement alone or in the presence of accessory proteins. That the results of the helicase and ATPase experiments correlate well suggests that the ATPase assay could be used to further examine the ability of UL42 to enhance UL9 activity. For example, these studies did not exclude the possibility that UL42 may increase the processivity of UL9 on
DNA. Thus, future experiments could use the ATPase assay to examine the ability of
UL9 and UL42 to translocate on long, or endless, DNA substrates. Further, future experiments should address the ability of UL42 to assist UL9 to translocate on origin- containing DNA. Finally, the ability of ICP8 and UL42 to enhance UL9 activity in a synergistic manner may be best understood at the level of translocation and ATP hydrolysis.
139
Figure 6.1. Titration of ATP in ATPase reaction. Reactions containing 50 nM UL9,
500 nM 23/38-mer, MgCl2, and increasing concentrations of ATP (0.313-5 mM), were incubated at 37oC as described in Materials and Methods. Samples were removed at the indicated times (0-30 min), terminated by the addition of EDTA, and the products were separated by thin layer chromatography. A. The concentration of ATP hydrolyzed was determined as described in Materials and Methods, and plotted as a function of time. B.
The observed maximum rate constants (kobs) for ATP hydrolysis were plotted as a function of ATP concentration and fit to the Michaelis-Menten function. The apparent -1 Km was 0.68 + 0.11 mM, and the kcat was 360 + 19 min .
140
A [ATP] (mM) 400000 2.5 5.0
300000
1.0 200000 0.5
0.25 100000 (nM) hydrolyzed ATP 0.125 0.0625 0.0313 0 0 5 10 15 20 25 30 35 40
Time (min)
B 350
300
250
) -1 200
(min Apparent K = 0.68 + 0.11 mM 150 m obs
k -1 kcat= 360 + 19 min 100
50
0 012345 Conc. ATP (mM)
Figure 6.1 141
Figure 6.2. Effect of increasing concentrations of single-strand (38-mer) and partially duplex (23/38-mer) DNA coeffectors on ATP hydrolysis. Reactions
containing 50 nM UL9, 3 mM ATP, 4.5 mM MgCl2, and increasing concentrations of 38- mer or 23/38-mer (0-1024 nM) were incubated at 37oC as described in Materials and Methods. Samples were removed at the indicated times (0-60 min), terminated by the addition of EDTA, and the products were separated by thin layer chromatography. The concentration of ATP hydrolyzed with the 38-mer (A) or 23/38-mer (B) DNA coeffector was determined as described in Materials and Methods, and plotted as a function of time.
142
A [38mer] (nM) 1200000
1024 1000000 768 512
800000 256
600000 128
64 32 400000 16 (nM) hydrolyzed ATP 8 200000 4 2 0 0 0 10203040506070 Time (min)
[23/38mer] (nM) B 1200000 1024 768
1000000 512
256 800000 128 64 600000
400000 32 16 8 ATP hydrolyzed (nM) hydrolyzed ATP 200000 4 2
0 0 0 10203040506070
Time (min)
Figure 6.2 143
Figure 6.3. Plots of maximum rate constants of ATP hydrolysis on single-strand or partially duplex DNA. The observed maximum rate constants (kobs) for ATP hydrolysis (Fig. 6.2) were plotted as a function of 38-mer (A), or 23/38-mer (B) DNA concentration and fit to the Michaelis-Menten function. A, the apparent Km= 47.4 + 9.7 nM, and the -1 kcat= 407 + 19 min with 38-mer DNA coeffector. B, the apparent Km= 38.0 + 5.9 nM, -1 and the kcat= 460 + 16 min with 23/38-mer DNA coeffector.
144
A
500
400
)
-1 300
(min Apparent Km=47.4 + 9.7 nM
obs 200 k -1 kcat=407 + 19 min
100
0 0 200 400 600 800 1000 1200 38-mer DNA (nM)
B 500
400
) -1 300
Apparent Km=38.0 + 5.9 nM (min
obs 200 -1
k kcat=460 + 16 min
100
0 0 200 400 600 800 1000 1200 23/38-mer DNA (nM)
Figure 6.3 145
Figure 6.4. Effect of increasing concentrations of UL9 protein on the ATPase activity with single-strand and partially duplex DNA coeffector. Reactions containing 50 nM 38-mer (A) or 23/38-mer (B), 3 mM ATP, 4.5 mM MgCl2, and increasing concentrations of UL9 protein (6.3-288 nM) were incubated at 37oC as described in Materials and Methods. Samples were removed at the indicated times (0-60 min), terminated by the addition of EDTA, and the products were separated by thin layer chromatography. The concentration of ATP hydrolyzed with the 38-mer (A) or 23/38- mer (B) DNA coeffector was determined as described in Materials and Methods, and plotted as a function of time.
146
A [38mer] (nM) 1200000
1000000 175 288
800000
600000 100
400000 50
(nM) hydrolyzed ATP 200000 25 6.3 0 0 10203040506070 Time (min)
[23/38mer] (nM) B 1200000 288 1000000 175
800000
600000 100
400000 50
(nM) hydrolyzed ATP 200000 25 0 6.3 0 10203040506070 Time (min)
Figure 6.4 147
Figure 6.5. Plots of maximum rate constants for ATP hydrolysis with increasing concentrations of UL9 on single-strand or partially duplex DNA coeffector. The
observed maximum rate constants (kobs) for ATP hydrolysis (Fig. 6.4) on 38-mer (A) or 23/38-mer (B) DNA coeffector were plotted as a function of UL9 concentration. Data
were fit to eq. 2, with a Hill coefficient of 2. A, the apparent Km was 72.7 + 14.7 nM, and the Vmax was 17.8 + 1.8 µM/min with 38-mer DNA coeffector. B, the apparent Km was 94.2 + 14.9 nM, and the Vmax was 25.0 + 2.2 µM/min with 23/38-mer DNA coeffector.
148 A
38-mer 20000
15000
10000
K =72.7 + 14.7 nM m 5000 Vmax=17,820 + 1752 nM/min
hydrolysisATP (nM/min)
0 0 50 100 150 200 250 300 350
UL9 conc. (nM)
B
23/38-mer 25000
20000
15000
10000
Km=94.2 + 14.9 nM 5000 ATP hydrolysis(nM/min) Vmax=24,980 + 2170 nM/min
0 0 50 100 150 200 250 300 350 UL9 conc. (nM)
Figure 6.5 149
160000
120000
80000
40000 ATP hydrolyzed (nM)
0 0 10203040506070
Time (min)
Figure 6.6. ATP hydrolysis by a subsaturating amount of UL9 protein with or without UL42 protein. Reactions contained 50 nM DNA coeffector: 23/38-mer (triangles), 38-mer (diamonds), 38/38-mer (squares), or no DNA (circles) coeffector. Reactions were initiated by the addition of 25 nM UL9 (open symbols) or 25 nM UL9 and 50 nM UL42 (closed symbols), and were incubated at 37oC for the times indicated.
150
Figure 6.7. Effect of UL42 on the ATP hydrolysis of a subsaturating concentration of UL9 preincubated with DNA coeffector. UL9 protein (25 nM) was preincubated with 50 nM 23/38-mer (A) or 38-mer (B) in the presence of 2.5 mM EDTA and 3 mM
ATP, and reactions were initiated by the addition of 6 mM MgCl2 and buffer () or UL42 () (50 nM UL42 (A); 100 nM UL42 (B)). Steady-state rates 23/38-mer, UL9: 3182 nM /min, UL9/UL42: 4593 nM /min. Steady-state rates 38-mer, UL9: 1081 nM/min, UL9/UL42: 3048 nM/min.
151 A 23/38-mer
400000
300000
200000
100000 (nM) hydrolyzed ATP
0 0 20406080100 Time (min)
B 38-mer
400000
300000
200000
100000
(nM) hydrolyzed ATP
0 0 20406080100 Time (min)
Figure 6.7 152
CHAPTER 7
DISCUSSION
A common theme of DNA replication is the presence of multiple protein-protein and protein-DNA interactions to form a replisome that modulates the initiation and elongation of DNA synthesis. For many organisms, initiation occurs at discrete sites, referred to as replication origins. These sites allow the coordinated binding and unwinding of DNA to allow the assembly of an elongation complex. Origin activation varies widely among organisms, involving only one protein, in the case of SV40 T antigen, or a multitude of factors for eukaryotic initiation. However, the required steps all appear to involve sequence-specific binding, localized conformational change and/or unwinding, followed by an expanded open complex of single-stranded DNA, and assembly of elongation factors. Notably, for many systems, the least understood step of initiation is the transition between a static open complex, and the formation of a competent elongating replisome.
Initiation of HSV-1 DNA replication presumably involves the sequence-specific binding of the origin-binding protein, UL9 (Elias et al., 1990; reviewed in Boehmer and
153 Lehman, 1997). Previous studies have demonstrated that UL9 binds the origin cooperatively (Elias et al., 1990; Hazuda et al., 1992), and that the physical interaction between two bound homodimers causes a conformational change in origin DNA that destabilizes the intervening AT-rich sequence (Fig. 1.4-panel 1-3) (Koff et al., 1991;
Elias et al., 1992; Stabell and Olivo, 1993). However, UL9 alone cannot unwind origin
DNA (Fierer and Challberg, 1992; Boehmer et al., 1993). Interestingly, the helicase activity of UL9 is weak, and requires high stoichiometries with respect to DNA for optimum unwinding of non-ori-containing DNA (Boehmer et al., 1993; Fig. 5.1 and 5.2).
Nevertheless, the helicase activity of UL9 is most likely required for replication, as mutations in six of the seven conserved helicase domains abolished the function of the
UL9 protein according to in vivo complementation assays (Martinez et al., 1992).
Biochemical characterization of these mutants demonstrated that the conserved residues were important for ATPase and helicase function, but were dispensable for dimerization or origin-binding activity (Marincheva and Weller, 2001). The correlation of the genetic and biochemical data strongly suggests that the UL9 helicase activity is necessary for at least one step of HSV-1 DNA replication.
UL9 is known to interact with other HSV-1 proteins involved in DNA replication, as well as cellular proteins ( (Fig. 1.5), and it is likely that these physical interactions serve to functionally modulate the biological activities of UL9. For example, since UL9 appears incapable of initiating DNA replication alone, at least some of these protein- protein interactions are likely to be essential in modulating the ability of UL9 to initiate
DNA replication. Interestingly, the major single-strand DNA binding protein, ICP8, has been shown to increase the DNA-dependent ATPase and helicase activity of UL9 on non-
154 origin-containing DNA substrates (Dodson and Lehman, 1993; Fierer and Challberg,
1992; Boehmer et al., 1993; Makhov et al., 1996), and to enable UL9 to unwind short, duplex, origin-containing DNA (Aslani et al., 2002). However, observed unwinding is slow and inefficient, and thus, is likely to involve additional interactions between UL9 and HSV-1 or cellular proteins. It is reasonable to speculate that the function of those interactions may expand or stabilize the open complex of single-stranded DNA or enhance other activities that UL9 plays in the transition from initiation to elongation.
Results from the Parris lab previously demonstrated that another essential HSV-1 replication protein, UL42, physically interacts with UL9 (Monahan et al., 1998). UL42 is the polymerase processivity factor (Gallo et al., 1989; Hernandez and Lehman, 1990;
Gottlieb et al., 1990), but possesses no known inherent enzymatic activity. In this dissertation, my results demonstrate for the first time that the UL42 protein enhances the helicase and DNA-dependent ATPase activities of UL9 on non-specific DNA substrates.
The comparison of enhancement by UL42 to that by ICP8 provided some insight into the mechanism(s) by which each accessory protein works.
Initial experiments to examine the effect of UL42 protein on UL9 helicase activity indicated that the steady-state rate of UL9 unwinding could be increased up to 2.5-fold, but only at subsaturating concentrations of UL9 (Fig. 5.4; Table 5.1). These results suggested that UL42 was able to increase the amount of UL9 bound in functional complex to the DNA substrate at equilibrium. An increase in bound UL9 protein might result from an increased rate of association, a decreased rate of dissociation, and/or an increased ability or rate of UL9 to assemble into functional complex once bound to DNA.
155 Each of these possibilities was examined, and primarily by exclusion, it was determined that UL42 most likely increases the rate of association of UL9 molecules with the DNA.
Analysis of the kinetics of unwinding by UL9 has demonstrated the existence of a lag period, which suggests a rate-limiting step following initial binding of UL9 to DNA.
This has been suggested to be an assembly step, requiring the formation of an active helicase multimer (Boehmer et al., 1993). However, the stoichiometry of the functional helicase remains unknown. Interestingly, results presented in this dissertation demonstrate that unwinding was cooperative, with an optimum Hill coefficient fit of between 2 to 3 (Fig. 5.2). Since UL9 is presumed to bind as a homodimer (Bruckner et al., 1991; Fierer and Challberg, 1992), this could reflect the assembly of a functional helicase tetramer or hexamer. Alternatively, a Hill coefficient of 2 supports a model that would allow multiple homodimers to bind cooperatively to the DNA, to allow collective and explosive unwinding. (see Fig. 4.1). Electron microscopic analysis of unwinding by
UL9 on non-ori-containing DNA provides support for this model (Makhov et al., 1996).
The authors noted that loading of UL9 occurred at the single-strand/double-strand DNA junction, and multiple molecules continuously moved inward from both DNA ends to allow rapid and explosive unwinding across the entire length of the DNA. Although some molecules were determined to be homodimers, the presence of large aggregates of
UL9 prevented the precise determination of stoichiometry (Makhov et al., 1996).
Notably, the possibility of a disassembly step prior to unwinding by UL9 has not been formally excluded. Results of experiments examining the effect of human heat shock proteins (HSPs) Hsp 40 and Hsp 70 on UL9 origin binding suggested that addition of
HSPs increased the affinity of UL9 for origin sequence (Tanguy Le Gac and Boehmer,
156 2002). The authors suggested that the function of the HSPs was to monomerize UL9 to produce high affinity origin-binding protomers, because the monomeric C-terminal DNA binding domain of UL9 was not affected by HSPs, and behaved similarly to HSP- stimulated wild-type UL9. However, the lack of an effect of HSPs on DNA-dependent
ATPase and helicase activities on non-origin-containing DNA suggests that a HSP disassembly step is not required for unwinding of non-origin-containing DNA (Tanguy
Le Gac and Boehmer, 2002).
Kinetic measurements of UL9 unwinding and ATPase activity demonstrated a significant lag time following binding but prior to initiation of activity in the presence or absence of UL42 (Fig. 5.4; 5.10A; 6.6; 6.7). This suggested that although UL42 increased the steady-state rate of unwinding as well as ATP hydrolysis, it did not significantly reduce the requirement for assembly or disassembly into a functional complex. Further, the addition of UL42 to ongoing reactions increased the rate of unwinding only after a delay of 10-15 minutes, the equivalent time for assembly/disassembly to take place (Fig. 5.10A). Similarly, the addition of UL42 at the time of initiation to ATPase reactions containing preincubated UL9 increased the rate of
ATP hydrolysis only after a delay of 20 minutes (Fig. 6.7). Thus, the helicase and
ATPase results together suggest that UL42 does not significantly affect the assembly/disassembly step. Therefore, the results suggest that UL42 may affect the affinity of UL9 for DNA, changing either the off or on rate.
The DNA substrate used in this study was sufficiently short to allow UL9 to complete translocation across the DNA prior to dissociating from the end. This was suggested by the fact that ICP8 did not decrease the dissociation rate of UL9 from the
157 template (Fig. 5.7C; Fig. 5.8), although it has been shown to increase the processivity of
UL9 on longer DNA substrates (Boehmer, 1998). Likewise, there was no effect on the dissociation rate of UL9 by the addition of UL42 (Fig. 5.7B; Fig. 5.8). Thus, decreased dissociation was ruled out as the primary mechanism of enhancement of UL9 unwinding rate observed under my assay conditions. Further studies using longer DNA substrates would be required to determine whether or not UL42 increases the processivity of UL9 on longer DNA substrates.
Since UL42 did not substantially alter the requirement for assembly, or decrease the dissociation rate of UL9 from the DNA, the results are most consistent with UL42 increasing the rate constant for association of UL9 with DNA. This mechanism is supported by the fact that UL42 appears to stimulate unwinding by only subsaturating concentrations of UL9 (Fig. 5.4). Saturating concentrations of UL9 protein would not be affected by a further increase in binding rate, consistent with lack of UL42 enhancement of unwinding when UL9 is saturating with respect to DNA.
Although my results are most consistent with UL42 enhancing UL9 association with DNA, direct confirmation was limited by the helicase assay, since the ability to observe unwinding is all-or-none. In fact, unwinding requires multiple steps, making it difficult to fully dissect mechanism. Other means are available to measure association rates directly, but also proved difficult. For example, electrophoretic mobility shift assays (EMSAs) have been used to determine the affinity of UL9 for origin-containing
DNA (Elias and Lehman, 1990; Hazuda et al., 1991); however, the rapid rate of dissociation of UL9 from non-specific DNA prevents this type of analysis. Filter binding assays are also a common means to measure equilibrium binding. However, they are
158 non-informative if more than one protein can bind or dissociate independently from one another. However, it would be possible to employ this assay upon successful purification of a stable co-complex of UL9 and UL42. Finally, the biacore biosensor assay can be a sensitive measure of relative affinity. However, attempts to measure affinity of UL9 for origin-containing DNA were thwarted by extensive non-specific binding of UL9 to chip surfaces and by UL9 aggregation. The non-specific binding could not be abrogated by the addition of nonionic or ionic detergents, or by altering ionic strength, and bound protein was resistant even to high concentrations of salt, chaotropic agents or SDS
(results not shown).
Because UL42 has strong double-stranded DNA binding activity (Gallo et al.,
1988), one possible mechanism for enhancement of helicase activity could be reduction or the prevention of non-productive UL9 binding to duplex DNA as a result of UL42 binding to ds DNA regions. The fact that high concentrations of UL42 inhibit UL9 unwinding argues against this hypothesis, since a high occupancy of DNA should actually stimulate unwinding (Fig. 5.5B). Further, UL42 increases the steady-state rate of
ATP hydrolysis by UL9 by 3-fold on single-stranded DNA, demonstrating that UL42 does not stimulate UL9 simply by virtue of its ds DNA binding activity (Fig. 6.7B).
Although the possibility cannot be excluded that the ability of UL42 to bind to ds
DNA contributes in part to the observed stimulation of UL9, it seems as likely that the increase in UL9 activity by UL42 is mediated through a conformational change caused by the physical interaction between the two proteins. Interestingly, enhancement of activity in the presence of UL42 increases up to an optimum stoichiometry of 4 molecules of UL42 per molecule of UL9, suggesting a functional complex (Fig. 5.3).
159 Further, the failure of UL42 to stimulate the helicase from hepatitis C virus (HCV NS3h) at either subsaturating or saturating concentrations of NS3h protein with respect to DNA, suggests that the observed increase of UL9 activity by UL42 is due to a specific interaction between the two proteins (Fig. 5.5C). Recent investigations of other HSV-1 protein-protein interactions have suggested the importance of conformational changes in regulating enzyme activity. For example, evidence demonstrated that the ss DNA binding ability of ICP8 was not required for stimulation of UL9 on non-specific DNA substrates (Arana et al., 2001). Rather, the increase in processivity of UL9 with ICP8 is likely due to a conformational change induced by ICP8 binding to the C-terminal tail of
UL9 (Lee and Lehman, 1999). Further, recent evidence has shown that the increase in the processivity of HSV-1 DNA polymerase by UL42 is likely due to a conformational change upon binding, rather than by UL42 tethering the pol to DNA as a function of its ds DNA binding ability (Weisshart, 1999; Chaudhuri and Parris, 2002).
This study did not directly address the possibility that UL42 changes the rate of translocation of UL9 along DNA, since steady-state reactions involve multiple steps.
However, a change in inherent rate would be expected to be observed at both saturating and subsaturating concentrations of UL9. Thus, a precise determination of any rate change must be addressed by pre-steady-state reactions.
Results by others suggested that ICP8 increases the processivity of UL9 on non- specific DNA substrates (Boehmer, 1998). However, as noted above, increased processivity was ruled out as the primary mechanism of enhancement in this study, due to the short DNA substrate used. Thus, the stimulation of UL9 unwinding by ICP8 observed in this study points to mechanisms in addition to decreased disassociation rates.
160 The recent discovery that increased processivity of UL9 by ICP8 is likely due to a conformational change of UL9 upon ICP8 binding (Arana et al., 2001) suggests the possibility that the physical interaction between ICP8 and UL9 likely modulates other activities of UL9 important for unwinding.
The effect of ICP8 on UL9 unwinding differed from that observed with UL42 in several ways. First, whereas UL42 increased the steady state rate at only subsaturating concentrations of UL9 (Fig. 5.4), ICP8 increased the rate at both saturating and subsaturating UL9 concentrations (Fix. 5.6). Further, the kinetics of UL9 unwinding observed with ICP8 differed from that with UL42. Specifically, the addition of ICP8 at the time of initiation, or 15 minutes later resulted in a dramatic decrease in lag time, which was not observed in the presence of UL42 (Fig. 5.10). These differences suggest that the mechanism by which ICP8 stimulates UL9 differs from UL42 in at least some aspects. The dramatic reduction in the lag time prior to UL9 unwinding suggests that
ICP8 plays a role in the assembly or disassembly of UL9 into functional complex.
However, these results do not rule out an effect of ICP8 on an association step, or an increase in the inherent rate of unwinding.
The observed effect of UL42 and ICP8 on the helicase activity of UL9 is modest.
However, it is interesting that UL42 and ICP8 appear to stimulate UL9 by different mechanisms. Thus, one could speculate that while the effect of each enzyme is modest, a synergistic effect between UL42 and ICP8 could be dramatic. Although it has not been determined that UL42 and ICP8 are able to bind to UL9 simultaneously, UL42 and ICP8 bind to UL9 in distinct and separate domains, with UL42 localized to the N-terminus
(Monahan et al., 1998), and ICP8 localized to the C-terminus (Boehmer et al., 1994) (see
161 Fig. 1.5A). If UL42 and ICP8 can act synergistically with respect to UL9 activity, then the addition of both proteins to reactions containing UL9 should increase unwinding greater than 5-fold, since each protein individually increased UL9 unwinding by 2.5 fold
(Table 5.1). Further, the kinetics of unwinding should reflect both a decrease in lag time due to the effect of ICP8, followed by an increased steady-state rate due in part, to the effect of UL42. Admittedly, testing a model of synergism is complicated by the requirement for optimizing reactions condition for three proteins. However, it has been demonstrated that a mutant lacking the 27 aa of UL9 (DM27) not capable of binding
ICP8, exhibits many of the properties of UL9:UL42 complex, including increased rate and processivity of unwinding (Boehmer et al., 1994). Thus, DM27 initially could be used to test whether additional enhancement of unwinding occurs with UL42. The ability of UL42 to stimulate DM27 would support the hypothesis that ICP8 and UL42 are distinct in their mechanism of UL9 enhancement and contribute differently to stimulation of the activity of UL9 during DNA replication.
The best understood role for UL9 protein in HSV-1 DNA replication is the sequence-specific recognition and binding to origin DNA. The requirement for UL9 and at least one copy of HSV-1 origin suggests that binding of DNA by UL9 is a biologically relevant step in the initiation of DNA replication (reviewed in Boehmer and Lehman,
1997). However, following initial sequence-specific binding of UL9 to DNA, the essential steps leading to assembly of a replisome competent for DNA elongation are poorly understood. This is exemplified by the failure to recapitulate origin-dependent
DNA replication in vitro (Skaliter and Lehman, 1994; reviewed in Boehmer and Lehman,
1999). The presence of UL9 inhibited in vitro DNA replication of ori-containing
162 plasmids in reactions containing the six essential HSV-1 DNA replication proteins required for DNA elongation (Skaliter and Lehman, 1994). However, the presence of
UL9 on replication of non-ori DNA had no effect on amplification. The dominant negative results from the in vitro assays suggest that the ability of UL9 to bind the origin in a sequence-specific manner may sequester the proteins required for elongation.
Therefore, under normal conditions of virus replication, a mechanism must exist to enable UL9 to move from double-stranded sequence-specific binding to single-stranded binding and movement from the origin. That ICP8 is required for UL9 helicase activity at the origin, and also stimulates UL9 helicase activity on non-origin containing DNA, lends support to this idea. My results demonstrating that UL42 increases the ATPase and helicase activity on non-origin containing DNA suggest a role for UL42 that is independent of the UL9 processes immediately at the origin.
The current model for initiation of HSV-1 DNA replication suggests that after
UL9 binds, ICP8 is recruited to assist in origin-opening in a series of ATP-independent and ATP-dependent steps (see Fig. 1.4). Although it is likely that UL9 localizes the other
HSV-1 proteins required for origin-dependent DNA replication, it is not clear whether this occurs on origin sequence, or whether UL9 moves off the origin sequence prior to interacting with the replisome. My model favors UL9 movement from the origin sequence prior to interacting with the replisome, because otherwise, it is difficult to envision how the strong affinity of UL9 for the origin would not prevent movement of the replisome, and thus, prevent elongation. However, how this movement occurs is still an open question. ICP8 likely plays a role in this process, but probably other proteins are also involved (Fig. 7.1-panel 1). Experiments to date have not addressed whether UL42
163 has any effect on the ability of UL9 to unwind origin-containing DNA, so it is not possible to rule out any effect by UL42 on initial origin opening. However, the fact that
UL42 stimulates the ATPase and helicase activity on non-origin containing DNA suggests that it might assist UL9 to further open the DNA to allow entry of the replisome.
A mechanism of enhancement that assists UL9 to load more molecules onto the DNA would likely facilitate unwinding (Fig. 7.1-panel 2-3). This model is attractive because
ICP8 likely assists UL9 by enabling UL9 to assemble efficiently, and by increasing the amount of DNA that one molecule unwinds. A synergistic reaction between UL42 and
ICP8 would allow UL9 to more efficiently load, assemble, and track such that explosive unwinding could occur, followed by ICP8 mediated coating of the single-strand DNA to prevent reannealing (Fig. 7.1-panel 3-4). For simplicity, these reactions are depicted with each UL9 monomer bound to one ICP8 and UL42 molecule. However, the functional stoichiometry of UL9/UL42 is unclear at this time. Further, this model depicts UL42 and
ICP8 simultaneously binding to UL9, although studies have not determined if both proteins can bind to UL9 at the same time. Interestingly, even if the interactions are mutually exclusive, UL42 could load multiple UL9 molecules onto the single-strand
DNA, followed by UL42 dissociation. ICP8 could facilitate the assembly and processive movement of the UL9 molecules on the DNA. Either scenario could lead to explosive unwinding of the DNA to form a large open complex for replisome assembly.
The steps leading to efficient replisome assembly are poorly understood, but the fact that UL9 binds to at least one partner of each subgroup of the replisome suggests that it assists to assemble the replisome for elongation (Fig. 1.5). Other models have suggested that UL9 dissociates following primer synthesis by the helicase-primase
164 complex, and prior to recruitment of the pol/UL42 holoenzme (Boehmer and Lehman,
1999; Boehmer and Lehman, 1997). These models are based, in part, on the observation that UL9 is not required during late stages of DNA replication, and that in vitro studies demonstrated a subcomplex of six proteins required for elongation. However, the model fails to encompass the data suggesting a physical interaction between UL42 and UL9
(Monahan et al., 1998). At the least, this interaction likely serves to assemble the pol/UL42 holoenzyme together with the UL5/UL8/UL52 helicase/primase heterotrimer complex in a manner leading to initiation of elongation. It is possible that UL9 does not remain in the elongation complex; however, no studies to date have addressed this question.
In summary, the role of UL9 in HSV-1 DNA replication is not completely understood. However, activity of UL9 on non-origin containing DNA substrates suggests that UL9 moves from origin-binding to non-origin DNA as one part of its role in replication. The role for UL42 may be to allow more UL9 to load onto the DNA to increase the functional stoichiometry of helicase molecules on the DNA, and to enable
UL9 to more efficiently unwind the DNA. This interaction and unwinding may be transient, but ultimately may be required for origin-dependent DNA replication.
165
Figure 7.1. Model of UL9 movement off origin sequence with the assistance of accessory proteins, ICP8 and UL42. 1: UL9:ICP8 complex unwinds origin DNA alone, or with other accessory proteins, and ICP8 stabilizes ss DNA, allowing a switch from origin-dependent to origin-independent DNA unwinding 2: UL9 binds cooperatively with the aid of accessory proteins. UL42 increases loading of UL9 molecules, and ICP8 decreases assembly time, and increases processivity. 3: Localized and explosive unwinding of origin-flanking sequence. 4: Assembly of replisome and switch to elongation of DNA replication.
166
1
UL9
UL9 ICP8
Switch from origin-dependent to ori- independent unwinding
UL42 2 UL9 UL9 ICP8 Cooperative binding ICP8 increases processivity and assembly UL42 increases affinity/loading
3
Localized unwinding in explosive manner
UL52 UL8 4 UL5 UL9 ICP8 pol UL42
ICP8 coating single-strand DNA Assembly of replisome Elongation proceeds
Figure 7.1 167
REFERENCES
Alberts, B. 2003. DNA replication and recombination. Nature 421:431-435.
Alexandrov, A. I., M. R. Botchan, and N. R. Cozzarelli. 2002. Characterization of simian virus 40 T-antigen double hexamers bound to a replication fork: the active form of the helicase. J. Biol. Chem. 277:44886-44897.
Aparicio, O. M., D. M. Weinstein, and S. P. Bell. 1997. Components and dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM proteins and Cdc45p during S phase. Cell 91:59-69.
Arana, M. E., B. Haq, N. Tanguy Le Gac, and P. E. Boehmer. 2001. Modulation of the herpes simplex virus type-1 UL9 DNA helicase by its cognate single-strand DNA- binding protein, ICP8. J. Biol. Chem. 276:6840-6845.
Arbuckle, A. I., and N. D. Stow. 1993. A mutational analysis of the DNA-binding domain of the herpes simplex virus type 1 UL9 protein. J. Gen. Virol. 74:1349-1355.
Aslani, A., B. Macao, S. Simonsson, and P. Elias. 2001. Complementary intrastrand base pairing during initiation of herpes simplex virus type 1 DNA replication. Proc. Natl. Acad. Sci. USA 98:7194-7199.
Aslani, A., M. Olsson, and P. Elias. 2002. ATP-dependent unwinding of a minimal origin of DNA replication by the origin-binding protein and the single-strand DNA binding protein ICP8 from herpes simplex virus type 1. J. Biol Chem. 277:41204- 41212.
Aslani, A., S. Simonsson, and P. Elias. 2000. A novel conformation of the herpes simplex virus origin of DNA replication recognized by the origin binding protein. J. Biol. Chem. 275:5880-5887.
Barnard, E. C., G. Brown, and N. D. Stow. 1997. Deletion mutants of the herpes simplex virus type 1 UL8 protein: effect on DNA synthesis and ability to interact with and influence the intracellular localization of the UL5 and UL52 proteins. Virology 237:97-106.
168 Bayliss, G. J., H. S. Marsden, and J. Hay. 1975. Herpes simplex virus proteins: DNA- binding proteins in infected cells and in the virus structure. Virology 68:124-134.
Bell, J. E., and E. T. Bell. 1988. Proteins and enzymes, pp. 465-467. Prentice Hall,Inc., Englewood Cliffs, NJ.
Bell, S. P., and A. Dutta. 2002. DNA replication in eukaryotic cells. Annu. Rev. Biochem. 71:333-374.
Bell, S. P., and B. Stillman. 1992. ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357:128-134.
Biswas, N., and S. K. Weller. 1999. A mutation in the C-terminal putative Zn2+ finger motif of UL52 severely affects the biochemical activities of the HSV-1 helicase-primase subcomplex. J. Biol. Chem. 274:8068-8076.
Biswas, N., and S. K. Weller. 2001. The UL5 and UL52 subunits of the herpes simplex virus type 1 helicase-primase subcomplex exhibit a complex interdependence for DNA binding. J. Biol. Chem. 276:17610-17619.
Blanco, L., A. Bernad, M. A. Blasco, and M. Salas. 1991. A general structure for DNA-dependent DNA polymerases. Gene 100:27-38.
Blummel, J. and B. Matz. 1995. Thermosensitive UL9 gene function is required for early stages of herpes simplex virus DNA synthesis. J. Gen. Virol. 76:3119-3124.
Boehmer P. E., M. C. Craigie, N. D. Stow, and I. R. Lehman. 1994. Association of origin binding protein and single strand DNA-binding protein, ICP8, during herpes simplex virus type 1 DNA replication in vivo. J. Biol. Chem. 269:29329-29334.
Boehmer, P. E. 1998. The herpes simplex virus type-1 single strand DNA-binding protein, ICP8, increases the processivity of the UL9 protein DNA helicase. J. Biol. Chem. 273:2676-2683.
Boehmer, P. E., and I. R. Lehman. 1993a. Herpes simplex virus type 1 ICP8: helix- destabilizing properties. J. Virol. 67:711-715.
Boehmer, P. E., and I. R. Lehman. 1993b. Physical interaction between the herpes simplex virus 1 origin binding protein and single-stranded DNA-binding protein ICP8. Proc. Natl. Acad. Sci. USA 90:8444-8448.
Boehmer, P. E., and I. R. Lehman. 1997. Herpes simplex virus DNA replication. Annu. Rev. Biochem. 66:347-384.
169 Boehmer, P. E., M. S. Dodson, and I. R. Lehman. 1993. The herpes simplex virus type-1 origin binding protein: DNA helicase activity. J. Biol. Chem. 268:1220-1226.
Bruckner, R. C., J. J. Crute, M. S. Dodson, and I. R. Lehman. 1991. Herpes simplex virus 1 origin binding protein: a DNA helicase. J. Biol. Chem. 266:2669-2674.
Calder, J. M., and N. D. Stow. 1990. Herpes virus helicase-primase: the UL8 protein is not required for DNA-dependent ATPase and DNA helicase activities. Nucleic Acids Res. 18:3373-3378.
Carr, K. M., and J. M. Kaguni. 2001. Stoichiometry of DnaA and DnaB protein in initiation at the Escherichia coli chromosomal origin. J. Biol.Chem. 276:44919-44925.
Challberg, M. D. 1986. A method for identifying the viral genes required for herpesvirus DNA replication. Proc. Natl. Acad. Sci. USA 83:9094-9098.
Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. Identification of herpesvirus-like sequences in AIDS-associated Kaposi’s sarcoma. Science 266:1865-1869.
Chartrand, P., N. D. Stow, M. C. Timbury, and N. M Wilkie. 1979. Physical mapping of Paar mutations of herpes simplex virus type 1 and type 2 by intertypic marker rescue. J. Virol. 31:265-276.
Chaudhuri, M., and D. S. Parris. 2002. Evidence against a simple tethering model for enhancement of herpes simplex virus DNA polymerase processivity by accessory protein UL42. J. Virol. 76:10270-10281.
Chaudhuri, M., L. Song, and D. S. Parris. 2003. The herpes simplex virus type 1 DNA polymerase processivity factor increases fidelity without altering pre-steady-state rate constants for polymerization or excision. J. Biol. Chem. 278:8996-9004.
Coen, D. M., D. P. Aschman, P. T. Gelep, M. J. Retondo, S. K. Weller, and P. A. Schaffer. 1984. Fine mapping and molecular cloning of mutations in the herpes simplex virus DNA polymerase locus. J. Virol. 49:236-247.
Cohen, G. H. 1972. Ribonucleotide reductase activity of synchronized KB cells infected with herpes simplex virus. J. Virol. 9:408-418.
Conley, A. J., D. M. Knipe, P. C. Jones, and B. Roizman. 1981. Molecular genetics of herpes simplex virus. VII. Characterization of a temperature-sensitive mutant produced by in vitro mutagenesis and defective in DNA synthesis and accumulation of polypeptides. J. Virol. 37:191-206.
170 Crooke, E., R. Thresher, D. S. Hwang, J. Griffith, and A. Kornberg. 1993. Replicatively active complexes of DnaA protein and the Escherichia coli chromosomal origin observed in the electron microscope. J. Mol. Biol. 233:16-24.
Crumpacker, C. S., and P. A. Schaffer. 2002. New anti-HSV therapeutics target the helicase-primase complex. Nature. Med. 8:327-328.
Crute, J. J., and I. R. Lehman. 1989. Herpes simplex-1 DNA polymerase: identification of an intrinsic 5'-3' exonuclease with ribonuclease H activity. J. Biol. Chem. 264:19266-19270.
Crute, J. J., and I. R. Lehman. 1991. Herpes simplex virus-1 helicase-primase: physical and catalytic properties. J. Biol. Chem. 266:4484-4488.
Crute, J. J., E. S. Mocarski, and I. R. Lehman. 1988. A DNA helicase induced by herpes simplex virus type 1. Nucleic Acids. Res. 16:6585-6596.
Crute, J. J., T. Tsurumi, L. Zhu, S. K. Weller, P. D. Olivo, M. D. Challberg, E. S. Mocarski, and I. R. Lehman. 1989. Herpes simplex virus 1 helicase-primase: a complex of three herpes-encoded gene products. Proc. Natl. Acad. Sci. USA. 86:2186- 2189.
De Bruyn Kops, A., and D. M. Knipe. 1994. Preexisting nuclear architecture defines the intranuclear location of herpesvirus DNA replication structures. J. Virol. 68:3512- 3526.
Dean, F. B., J. A. Borowiec, T. Eki, and J. Hurwitz. 1992. The simian virus 40 T antigen double hexamer assembles around the DNA at the replication origin. J. Biol. Chem. 267:14129-14137.
Deb, S., and S. P. Deb. 1991. A 269-amino-acid segment with a pseudo-leucine zipper and a helix-turn-helix motif codes for the sequence-specific DNA-binding domain of herpes simplex virus type 1 origin-binding protein. J. Virol. 65:2829-2838.
Deshmane, S. L., R. Raengsakulrach, B., J. F. Berson, and N. W. Fraser. 1995. The replicating intermediates of herpes simplex virus type 1 DNA are relatively short. J. Neurovirol. 1:165-176.
Digard, P., W. R. Bebrin, K. Weisshart, and D. M. Coen. 1993a. The extreme C terminus of herpes simplex virus DNA polymerase is crucial for functional interaction with processivity factor UL42 and for viral replication. J. Virol. 67:398-406.
Digard. P., and D. M. Coen. 1990. A novel functional domain of an α-like DNA polymerase: the DNA binding site on the herpes simplex virus polymerase for the viral UL42 protein. J. Biol. Chem. 265:17393-17396.
171
Digard. P., C. S. Chow, L. Pirrit, and D. M. Coen. 1993b. Functional analysis of the herpes simplex virus UL42 protein. J. Virol. 67:1159-1168.
Dodson, M. S., and I. R. Lehman. 1991. Association of DNA helicase and primase activities with a subassembly of the herpes simplex virus 1 helicase-primase composed of the UL5 and UL52 gene products. Proc. Natl. Acad. Sci. USA 88:1105-1109.
Dodson, M. S., and I. R. Lehman. 1993. The herpes simplex virus type 1 origin binding protein: DNA-dependent nucleoside triphosphatase activity. J. Biol. Chem. 268:1213-1219.
Dodson, M. S., J. J. Crute, R. C. Bruckner, and I. R. Lehman. 1989. Overexpression and assembly of the herpes simplex virus type 1 helicase-primase in insect cells. J. Biol. Chem. 264:20835-20838.
Dracheva, S., E. V. Koonin, and J. J. Crute. 1995. Identification of the primase active site of the herpes simplex virus type 1 helicase-primase. J. Biol. Chem. 270:14148- 14153.
Dutch, R. E., and I. R. Lehman. 1993. Renaturation of complementary DNA strands by herpes simplex virus type 1 ICP8. J. Virol. 67:6945-6949.
Elias, P., and I. R. Lehman. 1988. Interaction of origin binding protein with an origin of replication of herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 85:2959-2963.
Elias, P., C. M. Gustafasson, O. Hammarsten, and N. D. Stow. 1992. Structural elements required for the cooperative binding of the herpes simplex virus origin binding protein to oris reside in the N-terminal part of the protein. J. Biol. Chem. 267:17424- 17429.
Elias, P., C. M. Gustafsson, and O. Hammarsten. 1990. The origin binding protein of herpes simplex virus 1 binds cooperatively to the viral origin of replication oris. J. Biol. Chem. 265:17167-17173.
Elias, P., M. E. O’Donnell, E. Mocarski, and I. R. Lehman. 1986. A DNA binding protein specific for an origin of replication of herpes simplex virus type 1. Proc. Natl. Acad. Sci. USA 83:6322-6326.
Eom, C.-Y., and I. R. Lehman. 2002. The human DnaJ protein, hTid-1, enhances binding of a multimer of the herpes simplex virus type 1 UL9 protein to oriS, an origin of viral DNA replication. Proc. Natl. Acad. Sci. USA 99:1894-1898.
172 Falkenberg, M., D. A. Bushnell, P. Elias, and I. R. Lehman. 1997. The UL8 subunit of the heterotrimeric herpes simplex virus type 1 helicase-primase is required for the unwinding of single strand DNA-binding protein (ICP8)-coated DNA substrates. J. Biol. Chem. 272:22766-22770.
Falkenberg, M., I. R. Lehman, and P. Elias. 2000. Leading and lagging strand DNA synthesis in vitro by a reconstituted herpes simplex virus type 1 replisome. Proc. Natl. Acad. Sci. USA 97:3896-3900.
Fang, L. H., M. J. Davey, and M. O’Donnell. 1999. Replisome assembly at oriC, the replication origin of E. coli, reveals an explanation for initiation sites outside an origin. Mol. Cell 4:541-553.
Fanning, E., and R. Knippers. 1992. Structure and function of simian virus 40 large tumor antigen. Annu. Rev. Biochem. 61:55-85.
Fierer, D. S., and M. D. Challberg. 1992. Purification and characterization of UL9, the herpes simplex virus type 1 origin-binding protein. J. Virol. 66:3986-3995.
Fierer, D. S., and M. D. Challberg. 1995. The stoichiometry of binding of the herpes simplex virus type 1 origin binding protein, UL9, to oriS. J. Biol. Chem. 270:7330-7334.
Fire, A., and S. Q. Xu. 1995. Rolling replication of short DNA circles. Proc. Natl. Acad. Sci. USA 92:4641-4645.
Friedmann, A., J. Schlomai, and Y. Becker. 1977. Electron microscopy of herpes simplex virus DNA molecules isolated from infected cells by centrifugation in CsCl density gradients. J. Gen. Virol. 34:507-522.
Gallo, M. L., D. H. Jackwood, M. Murphy, H. S. Marsden, and D. S. Parris. 1988. Purification of the herpes simplex virus type 1 65-kilodalton DNA-binding protein: properties of the protein and evidence of its association with the virus-encoded DNA polymerase. J. Virol. 62:2874-2883.
Gallo, M. L., D. I. Dorsky, C. S. Crumpacker, and D. S. Parris. 1989. The essential 65-kilodalton DNA-binding protein of herpes simplex virus stimulates the virus-encoded DNA polymerase. J. Virol. 63:5023-5029.
Garber, D. A., S. M. Beverley, and D. M. Coen. 1993. Demonstration of circularization of herpes simplex virus DNA following infection using pulse field gel electrophoresis. Virology 197:459-462.
Gardella, T., P. Medveczky, T Sairenji, and C. Mulder. 1984. Detection of circular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis. J. Virol. 50:248-254.
173
Gibbs, J. S., H. C. Chiou, J. D. Hall, D. W. Mount, M. J. Retondo, S. K. Weller, and D. M. Coen. 1985. Sequence and mapping analyses of the herpes simplex virus DNA polymerase gene predict a C-terminal substrate binding domain. Proc. Natl. Acad. Sci. USA 82:7696-7973.
Gorbalenya, A. E., E. V. Koonin, A. P. Donchenko, and B. M. Blinov. 1989. Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17:4713-4730.
Gottlieb, J., A. I. Marcy, D. M. Coen, and M. D. Challberg. 1990. The herpes simplex virus type 1 UL42 gene product: a subunit of DNA polymerase that functions to increase processivity. J. Virol. 64:5976-5987.
Graves-Woodward, K. L., and S. K. Weller. 1996. Replacement of Gly815 in helicase motif V alters the single-stranded DNA-dependent ATPase activity of the herpes simplex virus type 1 helicase-primase. J. Biol. Chem. 271:13629-13635.
Graves-Woodward, K. L., J. Gottlieb, M. D. Challberg, and S. K. Weller. 1997. Biochemical analysis of mutations in the HSV-1 helicase-primase that alter ATP hydrolysis, DNA unwinding, and coupling between hydrolysis and unwinding. J. Biol. Chem. 272:4623-4630.
Gustafsson, C. M., O. Hammarsten, M. Falkenberg, and P. Elias. 1994. Herpes simplex virus DNA replication: a spacer sequence directs the ATP-dependent formation of a nucleoprotein complex at oriS. Proc. Natl. Acad. Sci. USA. 91:4629-4633.
Haffey, M. L., J. Novotny, R. E. Bruccoleri, R. D. Carroll, J. T. Stevens, and J. T. Matthews. 1990. Structure-function studies of the herpes simplex virus type 1 DNA polymerase. J. Virol. 64:5008-5018.
Hamatake, R. K., M. Bifano, W. W. Hurlburt, and D. J. Tenney. 1997. A functional interaction of ICP8, the herpes simplex virus single-stranded DNA-binding protein, and the helicase-primase complex that is dependent on the presence of the UL8 subunit. J. Gen. Virol. 78:857-865.
Hay, J., H. Moss, and I. W. Halliburton. 1971. Induction of deoxyribonucleic acid polymerase and deoxyribonuclease activities in cells infected with herpes simplex virus type II. Biochem. J. 124:64-76.
Hazuda, D. J., H. C. Perry, A. M. Naylor, and W. L. McClements. 1991. Characterization of the herpes simplex virus origin binding protein interaction with oriS. J. Biol. Chem. 266:24621-24626.
174 Hazuda, D. J., H. C. Perry, and W. L. McClements. 1992. Cooperative interactions between replication origin-bound molecules of herpes simplex virus origin-binding protein are mediated via the amino terminus of the protein. J. Biol. Chem. 267:14309- 14315.
He, X., and I. R. Lehman. 2001. An initial ATP-independent step in the unwinding of a herpes simplex virus type 1 origin of replication by a complex of the viral origin- binding protein and single-strand DNA-binding protein. Proc. Natl. Acad. Sci. USA 98:3024-3028.
He, X. and I. R. Lehman. 2000. Unwinding of a herpes simplex virus type 1 origin of replication (oris) by a complex of the viral origin binding protein and the single-stranded DNA binding protein. J. Virol. 74:5726-5728.
Heilbronn, R., and H. zur Hausen. 1989. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome. J. Virol. 63:3683-3692.
Hernandez, T. R., and I. R. Lehman. 1990. Functional interaction between the herpes simplex-1 DNA polymerase and UL42 protein. J. Biol. Chem. 265:11227-11232.
Hua, X. H., and J. Newport. 1998. Identification of a preinitiation step in DNA replication that is independent of origin recognition complex and cdc6, but dependent on cdk2. J. Cell. Biol. 140:271-281.
Jackson, S. A., and N. A. DeLuca. 2003. Relationship of herpes simplex virus genome configuration to productive and persistent infections. Proc. Natl. Acad. Sci. USA 100:7871-7876.
Jacob, F., S. Brenner, and R. Cuzin. 1963. On the regulation of DNA replication in bacteria. Cold Spring Harbor Symp. Quant. Biol. 28:329-348.
Jin, Y. H., R. Obert, P. M. J. Burgers, T. A. Kunkel, M. A. Resnick, and D. A. Gordenin. 2001. The 3’-5’ exonuclease of DNA polymerase δ can substitute for the 5’ flap endonuclease Rad27/Fen 1 in processing Okazaki fragments and preventing genome instability. Proc. Natl. Acad. Sci. USA 98:5122-5127.
Jofre, J. T., P. A. Schaffer, and D. S. Parris. 1977. Genetics of resistance to phosphonoacetic acid in strain KOS of herpes simplex virus type 1. J. Virol. 23:833- 836.
Joo, W. S., H. Y. Kim, J. D. Purviance, K. R. Sreekumar, and P. A. Bullock. 1998. Assembly of T-antigen double hexmers on the simian virus 40 core origin only requires a subset of available binding sites. Mol. Cell. Biol. 18:2677-2687.
175 Keir, H. M., H. Subak-Sharpe, W. I. Shedden, D. H. Watson, and P. Wildy. 1966. Immunological evidence for a specific DNA polymerase produced after infection by herpes simplex virus. Virology 30:154-157.
Kelman, Z., and M. O’Donnell. 1995. Structural and functional similarities of prokaryotic and eukaryotic DNA polymerase sliding clamps. Nucleic Acids Res. 23:3613-1620.
Kit, S., and D. Dubbs. 1963. Acquisition of thymidine kinase activity by herpes simplex virus-infected mouse fibroblast cells. Biochem. Biophys. Res. Commun. 11:55- 66.
Klemm, R. D., R. J. Austin, and S. P. Bell. 1997. Coordinate binding of ATP and origin DNA regulates the ATPase activity of the origin recognition complex. Cell 88:493-502.
Klinedinst, D. K., and M. D. Challberg. 1994. Helicase-primase complex of herpes simplex virus type 1: a mutation in the UL52 subunit abolishes primase activity. J. Virol. 68:3693-3701.
Knopf, C. W. 2000. Molecular mechanisms of replication of herpes simplex virus 1. Acta virologica. 44:289-307.
Koff, A., J. F. Schwedes, and P. Tegtmeyer. 1991. Herpes simplex virus origin- binding protein (UL9) loops and distorts the viral replication origin. J. Virol. 65:3284- 3292.
Kornberg, A. and T. A. Baker. 1992. DNA Replication. W.H. Freeman and Company, New York.
Krause, M., and W. Messer. 1999. DnaA proteins of Escherichia coli and Bacillus subtilis: coordinate actions with single-stranded DNA-binding protein and interspecies inhibition during open complex formation at the replication origins. Gene. 228:123-132.
Labib, K., J. A. Tercero, and J. F. X. Diffley. 2000. Uninterrupted MCM2-7 function required for DNA replication fork progression. Science 288:1643-1647.
Lanzetta, P. A., L. J. Alvarez, P. S. Reinach, and O. A. Candia. 1979. An improved assay for nanomole amounts of inorganic phosphate. Anal. Biochem. 100:95-97.
Lee, C. K., and D. M. Knipe. 1985. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8. J. Virol. 54:731-738.
176 Lee, D. G., A. M. Makhov, R. D. Klemm, J. D. Griffith, and S. P. Bell. 2000. Regulation of origin recognition complex conformation and ATPase activity: differential effects of single-stranded and double-stranded DNA binding. EMBO J. 19:4774-4782.
Lee, S. S. -K., and I. R. Lehman. 1997. Unwinding of the box 1 element of a herpes simplex virus type 1 origin by a complex of the viral origin binding protein, single-strand DNA binding protein, and single-stranded DNA. Proc. Natl. Acad. Sci. USA 94:2838- 2842.
Lee, S. S. K., and I. R. Lehman. 1999. The interaction of herpes simplex virus type 1 origin-binding protein (UL9 protein) with box 1, the high affinity element of the viral origin of DNA replication. J. Biol. Chem. 274:18613-18617.
Levin, M. K., and S. M. Patel. 1999. The helicase from Hepatitis C virus is active as an oligomer. J. Biol. Chem. 274:31839-31846.
Levin, M. K., and S. M. Patel. 2003. Helicases as Molecular Motors, p 170-198. In M. Schliwa (ed.), Molecular Motors, Wiley-VCH Verlag GmbH, Weinheim, Germany.
Lockshon, D., and D. A. Galloway. 1988. Sequence and structural requirements of a herpes simplex viral DNA replication origin. Mol. Cell. Biol. 8:4018-4027.
Makhov, A. M., P. E. Boehmer, I. R. Lehman, and J. D. Griffith. 1996. Visualization of the unwinding of long DNA chains by the herpes simplex virus type 1 UL9 protein and ICP8. J. Mol. Biol. 258:789-799.
Makhov, A. M., P. E. Boehmer, I. R. Lehman, and J. D. Griffith. 1996. The herpes simplex virus 1 origin-binding protein carries out origin specific DNA unwinding and forms stem-loop structures. The EMBO Journal 15:1742-1750.
Makhov, A. M., S. S.- K. Lee, I. R. Lehman, and J. D. Giffith. 2003. Origin-specific unwinding of herpes simplex virus 1 DNA by the viral and ICP8 proteins: visualization of a specific preunwinding complex. Proc. Natl. Acad. Sci. USA 100:898-903.
Malik , A. K., R. Martinez, L. Muncy, E. P. Carmichael, and S. K. Weller. 1992. Genetic analysis of the herpes simplex virus type 1 UL9 gene: isolation of a lacZ insertion mutant and overexpression in eukaryotic cells. Virology 190:702-715.
Marcy, A. I., P. D. Olivo, M. D. Challberg, and D. M. Coen. 1990. Enzymatic activities of overexpressed herpes simplex virus DNA polymerase purified from recombinant baculovirus-infected cells. Nucleic Acids Res. 18:1207-1215.
177 Marincheva, B., and S. K. Weller. 2001. Residues within the conserved helicase motifs of UL9, the origin-binding protein of herpes simplex virus-1, are essential for helicase activity but not for dimerization or origin binding activity. J. Biol. Chem. 276:6605-6615.
Marsden, H. S., G. W. McLean, E. C. Barnard, G. J. Francis, K. MacEachran, M. Murphy, G. McVey, A. Cross, A. P. Abbotts, and N. D. Stow. 1997. The catalytic subunit of the DNA polymerase of herpes simplex virus type 1 interacts specifically with the C terminus of the UL8 component of the viral helicase-primase complex. 71:6390- 6397.
Marsden, H. S., M. E. M. Campbell, L. Harr, M. C. Frame, D. S. Parris, M. Murphy, R. G. Hope, M. T. Muller, and C. M. Preston. 1987. The 65,000-Mr DNA- binding and virion trans-inducing proteins of herpes simplex virus type 1. J. Virol. 61:2428-2437.
Martin, D. W., R. M. Munoz, D. Oliver, M. A. Subler, and S. Deb. 1994. Analysis of the DNA-binding domain of the HSV-1 origin-binding protein. Virology 198:71-80.
Martinez, R., L. Shao, and S. K. Weller. 1992. The conserved helicase motifs of the herpes simplex virus type 1 origin-binding protein UL9 are important for function. J. Virol. 66:6735-6746.
Mastrangelo, I. A., P. V. C. Hough, J. S. Wall, M. Dodson, F. B. Dean, and J. Hurwitz. 1989. ATP-dependent assembly of double hexamers of SV40 T antigen at the viral origin of DNA replication. Nature 338:658-662.
McGeoch, D. J., and P. A. Schaffer. 1992. Herpes simplex virus, p. 147-156. In S. J. O’Brien (ed.), Genetic maps: locus maps of complex genomes, 6th ed., Cold Spring Harbor Laboratory Press, Plainview, NY.
McGeoch, D. J., M. A. Dalrymple, A. Dolan, D. McNab, L. J. Perry, P. Taylor, and M. D. Challberg. 1988. Structures of herpes simplex virus type 1 genes required for replication of virus DNA. J. Virol. 62:444-453.
McLean, G. W., A. P. Abbotts, M. E. Parry, H. S. Marsden, and N. D. Stow. 1994. The herpes simplex virus type 1 origin-binding protein interacts specifically with the viral UL8 protein. J. Gen. Virol. 75:2699-2706.
Mechanic, L. E., B. A. Frankel, and S. W. Matson. 2000. Escherichia coli MutL loads DNA helicase II onto DNA. J. Biol. Chem. 275:38337-38346.
Messer, W. 2002. The bacterial replication initiator DnaA. DnaA and oriC, the bacterial mode to initiate DNA replication. FEMS Microbiol. Rev. 26:355-374.
178 Monahan, S. J., L. A. Grinstead, W. Olivieri, and D. S. Parris. 1998. Interaction between the herpes simplex virus type 1 origin-binding and DNA polymerase accessory proteins. Virology 241:122-130.
Morrison, J. M., and H. M. Keir. 1968. A new DNA-exonuclease in cells infected with herpes virus: partial purification and properties of the enzyme. J. Gen. Virol. 3:337-347.
Moss, H. 1986. The herpes simplex virus type 2 alkaline DNase activity is essential for replication and growth. J. Gen. Virol. 67:1173-1178.
Neet, K. E. 1980. Cooperativity in enzyme function: equilibrium and kinetic aspects. Methods Enzmol. 64:139-192.
Nimonkar, A. V., and P. E. Boehmer. 2002. In vitro strand exchange promoted by the herpes simplex virus type-1 single strand DNA-binding protein (ICP8) and DNA helicase-primase. J. Biol. Chem. 277:15182-15189.
Nimonkar, A. V., and P. E. Boehmer. 2003. The herpes simplex virus type-1 single- strand DNA-binding protein (ICP8) promotes strand invasion. J. Biol. Chem. 278:9678- 9682.
Nishitani, H., Z. Lygerou, T. Nishimoto, and P. Nurse. 2000. The Cdt1 protein is required to license DNA for replication in fission yeast. Nature 404:625-628.
O’Donnell, M. E., P. Elias, B. E. Funnell, and I. R. Lehman. 1987. Interaction between the DNA polymerase and single-stranded DNA-binding protein (infected cell protein 8) of herpes simplex virus 1. J. Biol. Chem. 262:4260-4266.
Olivo, P. D., N. J. Nelson, and M. D. Challberg. 1988. Herpes simplex virus DNA replication: the UL9 gene encodes an origin-binding protein. Proc. Natl. Acad. Sci. USA 85:5414-5418.
Parris, D. S., A. Cross, L. Haarr, A. Orr, M. C. Frame, M. Murphy, D. J. McGeoch, and H. S. Marsden. 1988. Identification of the gene encoding the 65-kilodalton DNA- binding protein of herpes simplex virus type 1. J. Virol. 62:818-825.
Parsons, R. E., J. E. Stenger, S. Ray, R. Welker, M. E. Anderson, and P. Tegtmeyer. 1991. Cooperative assembly of simian virus 40 T-antigen hexamers on functional halves of the replication origin. J. Virol. 65:2798-2806.
Perry, H. C., D. J. Hazuda, and W. L. McClements. 1993. The DNA binding domain of herpes simplex virus type 1 origin binding protein is a transdominant inhibitor of virus replication. Virology 193:73-79.
179 Poffenberger, K. L., and B. Roizman. 1985. A noninverting genome of a viable herpes simplex virus 1: presence of head-to-tail linkages in packaged genomes and requirements for circularization after infection. J. Virol. 53:587-595.
Podust, V. N., L. M. Podust, F. Müller, and U. Hübscher. 1995. DNA polymerase δ holoenzyme: action on single-stranded DNA and on double-stranded DNA in the presence of replicative DNA helicases. Biochemistry 34:5003-5010.
Powell, K. L., E. Littler, and D. J. M. Purifoy. 1981. Nonstructrual proteins of herpes simplex virus. II. Major virus-specific DNA-binding protein. J. Virol. 39:894-902.
Preston, V. G., J. W. Palfreyman, and B. M Dutia. 1984. Identification of a herpes simplex virus type 1 polypeptide which is a component of the virus-induced ribonucleotide reductase. J. Gen. Virol. 65:1457-1466.
Purifoy, D. J. M., and K. L. Powell. 1976. DNA-binding proteins induced by herpes simplex virus type 2 in HEp-2 cells. J. Virol. 19:717-731.
Purifoy, D. J. M., R. B. Lewis, and K. L. Powell. 1977. Identification of the herpes simplex virus DNA polymerase gene. Nature 269:621-623.
Quinn, J. P., and D. J. McGeoch. 1985. DNA sequence of the region in the genome of herpes simplex virus type 1 containing genes for DNA polymerase and the major DNA binding protein. Nucleic Acids Res. 13:8143-8163.
Raney, K. R., T. E. Carver, and S. J. Benkovic. 1996. Stoichiometry and DNA unwinding by the bacteriophage T4 41:59 helicase. J. Biol. Chem. 271:14074-14081.
Reddig, P. J., L. A. Grinstead, S. J. Monahan, P. A. Johnson, and D. S. Parris. 1994. The essential in vivo function of the herpes simplex virus UL42 protein correlates with its ability to stimulate the viral DNA polymerase in vitro. Virology 200:447-456.
Reha-Krantz, L. J., S. Stocki, R. L. Nonay, E. Dimayuga, L. D. Goodrich, W. H. Konigsberg, and E. K. Spicer. 1991. DNA polymerization in the absence of exonucleolytic proofreading: in vivo and in vitro studies. Proc. Natl. Acad. Sci. USA 88:2418-2421
Roizman, B. 1979. The structure and isomerization of herpes simplex virus genomes. Cell 16:481-494.
Roizman, R., and D. M. Knipe. 2001. Herpes simplex viruses and their replication, p. 2399-2459. In D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 4th ed. Lippincott Williams and Wilkins., Philadelphia, PA.
180 Roizman, R., and P. E. Pellet. 2001. The family herpesviridea: a brief introduction, p. 2381-2397. In D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 4th ed. Lippincott Williams and Wilkins., Philadelphia, PA.
Rowles, A., S. Tada, and J. J. Blow. 1999. Changes in association of the Xenopus origin recognition complex with chromatin on licensing of replication origins. J. Cell Sci. 112:2011-2018.
Ruyechan, W. T. 1983. The major herpes simplex virus DNA-binding protein holds single-stranded DNA in an extended configuration. J. Virol. 46:661-666.
Ruyechan, W. T. and A. C. Weir. 1984. Interaction with nucleic acids and stimulation of the viral DNA polymerase by the herpes simplex virus type 1 major DNA-binding protein. J. Virol. 52:727-733.
Salinas, F., and S. J. Benkovic. 2000. Characterization of bacteriophage T4- coordinated leading- and lagging-strand synthesis on a minicircle substrate. Proc. Natl. Acad. Sci. USA 97:7196-7201.
Sandri-Goldin, R. M. 2003. Replication of the herpes simplex virus genome: does it really go around in circles? Proc. Natl. Acad. Sci. USA 100:7428-7429.
Schaper, S., and W. Messer. 1995. Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem. 270:17622-17626.
Schwacha, A., and S. P. Bell. 2001. Interactions between two catalytically distinct MCM subgroups are essential for coordinated ATP hydrolysis and DNA replication. Mol. Cell 8:1093-1104.
Sherman, G., J. Gottlieb, and M. D. Challberg. 1992. The UL8 subunit of the herpes simplex virus helicase-primase complex is required for efficient primer utilization. J. Virol. 66:4884-4892.
Simonsson, S., T. Samuelsson, and P. Elias. 1998. The herpes simplex virus type 1 origin binding protein: specific recognition of phosphates and methyl groups defines the interacting surface for a monomeric DNA binding domain in the major groove of DNA. J. Biol. Chem. 273:24633-24639.
Skaliter, R., A. M. Makhov, J. D. Griffith, and I. R. Lehman. 1996. Rolling circle DNA replication by extracts of herpes simplex virus type 1-infected human cells. J. Virol. 70:1132-1136.
Skaliter, R., and I. R. Lehman. 1994. Rolling circle DNA replication in vitro by a complex of herpes simplex virus type 1-encoded enzymes. Proc. Natl. Acad. Sci. USA 91:10665-10669.
181
Smelkova, N. V., and J. A. Borowiec. 1997. Dimerization of simian virus 40 T-antigen hexamers activates T-antigen DNA helicase activity. J. Virol. 71:8766-8773.
Spaete, R. R., and N. Frenkel. 1982. The herpes simplex virus amplicon: a new eukaryotic defective-virus cloning amplifying vector. Cell 30:295-304.
Spaete, R. R., and N. Frenkel. 1985. The herpes simplex virus amplicon: analysis of cis-acting replication functions. Proc. Natl. Acad. Sci. USA 82:694-698.
Stabell, E. C., and P. D. Olivo. 1993. A truncated herpes simplex virus origin binding protein which contains the carboxyl terminal origin binding domain binds to the origin of replication but does not alter its conformation. Nucleic Acids Res. 21:5203-5211.
Stillman, B. 1994. Smart machines at the replication fork. Cell 78:725-728.
Stow, N. D. 1982. Localization of an origin of DNA replication within the TRs/IRs repeated region of the herpes simplex virus type 1 genome. EMBO J. 1:863-867.
Stow, N. D. 1992. Herpes simplex virus type 1 origin-dependent DNA replication in insect cells using recombinant baculoviruses. J. Gen. Virol. 73:313-321.
Stow, N. D., and E. C. McMonagle. 1983. Characterization of the TRs/IRs origin of DNA replication of herpes simplex virus type 1. Virology 130:427-438.
Stow, N. D., O. Hammarsten, M. I. Arbuckle, and P. Elias. 1993. Inhibition of herpes simplex virus type 1 DNA replication by mutant forms of the origin-binding protein. Virology 196:413-418.
Sutton, M. D., K. M. Carr, M. Vicente, and J. M. Kaguni. 1998. Escherichia coli DnaA protein. The N-terminal domain and loading of DnaB helicase at the E. coli chromosomal origin. J. Biol. Chem. 273:34255-34262.
Tabor, S., and C. C. Richardson. 1989. Selective inactivation of the exonuclease activity of bacteriophage T7 DNA polymerase by in vitro mutagenesis. J. Biol. Chem. 264:6447-6458.
Tanaka, H., K. Tanaka, H. Murakami, and H. Okayama. 1999. Fission yeast Cdc24 is a replication factor C- and proliferating cell nuclear antigen-interacting factor essential for S-phase completion. Mol. Cell. Biol. 19:1038-1048.
Tanguy Le Gac, N., G. Villani, J.-S. Hoffmann, and P. E. Boehmer. 1996. The UL8 subunit of the herpes simplex virus type-1 DNA helicase-primase optimizes utilization of DNA templates covered by the homologous single-strand DNA binding protein, ICP8. J. Biol. Chem. 271:21645-21651.
182
Tanguy Le Gac, N., and P. E. Boehmer. 2002. Activation of the herpes simplex virus type-1 origin-binding protein (UL9) by heat shock proteins. J. Biol. Chem. 277:5660- 5666.
Tenney, D. J., A. K. Sheaffer, W. W. Hurlburt, M. Bifano, and R. K. Hamatake. 1995. Sequence-dependent primer synthesis by the herpes simplex virus helicase-primase complex. J. Biol. Chem. 270:9129-9136.
Tenney, D. J., W. W. Hurlburt, P. A. Micheletti, M. Bifano, and R. K. Hamatake. 1994. The UL8 component of the herpes simplex virus helicase-primase complex stimulates primer synthesis by a subassembly of the UL5 and UL52 components. J. Biol. Chem. 269:5030-5035.
Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354.
Uprichard, S. L., and D. M. Knipe. 1997. Assembly of herpes simplex virus replication proteins at two distinct intranuclear sites. Virology 229:113-125.
Valle, M., C. Gruss, L. Halmer, J. M. Carazo, and L. E. Donate. 2000. Large T- antigen double hexamers image at the simian virus 40 origin of replication. Mol. Cell. Biol. 20:34-41.
Villani, G., M.- J. Pillaire, and P. E. Boehmer. 1994. Effect of the major DNA adduct of the antitumor drug cis-diamminedichloroplatinum(II) on the activity of a helicase essential for DNA replication, the herpes simplex virus type-1 origin-binding protein. J. Virol. 269:21676-21681.
Vlazny, D. A., and N. Frenkel. 1981. Replication of herpes simplex virus DNA: localization of replication recognition signals within defective virus genomes. Proc. Natl. Acad. Sci. USA 78:742-746.
Wahle, E., R. S. Lasken, and A. Kornberg. 1989a. The dnaB-dnaC replication protein complex of Escherichia coli: I. Formation and properties. J. Biol Chem. 264:2463-2468.
Wahle, E., R. S. Lasken, and A. Kornberg. 1989b. The dnaB-dnaC replication protein complex of Escherichia coli: II. Role of the complex in mobilizing dnaB functions. J. Biol. Chem. 264:2469-2475.
Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1982. Distantly related sequences in the α- and β-subunits of ATP synthase, myosin, kinases, and other ATP- requiring enzymes and a common nucleotide binding fold. EMBO J. 1:945-951.
183 Weir, H. M., and N. D. Stow. 1990. Two binding sites for the herpes simplex virus type 1 UL9 protein are required for efficient activity of the oris replication origin. J. Gen. Virol. 71:1379-1385.
Weir, H. M., J. M. Calder, and N. D. Stow. 1989. Binding of the herpes simplex virus type 1 UL9 gene product to an origin of viral DNA replication. Nucleic Acids Res. 17:1409-1427.
Weir, J. P. 1998. Genomic organization and evolution of the human herpesviruses. Virus Genes 16:85-93.
Weisshart, K., C. S. Chow, and D. M. Coen. 1999. Herpes simplex virus processivity factor UL42 imparts increased DNA-binding specificity to the viral DNA polymerase and decreased dissociation from primer-template without reducing the elongation rate. J. Virol. 73:55-66.
Weller, S. K., A. Spadaro, J. E. Schaffer, A. W. Murray, A. M Maxam, and P. A. Schaffer. 1985. Cloning, sequencing, and functional analysis of oriL, a herpes simplex virus type 1 origin of DNA synthesis. Mol. Cell. Biol. 5:930-942.
Wessel, R., J. Schweizer, and H. Stahl. 1992. Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of DNA replication. J. Virol. 66:804-815.
Whitley, R. J. 2001. Herpes simplex viruses, p. 2461-2509. In D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 4th ed. Lippincott Williams and Wilkins., Philadelphia, PA.
Wu, C. A., N. J. Nelson, D. J. McGeoch, and M. D. Challberg. 1988. Identification of herpes simplex virus type 1 genes required for origin-dependent DNA synthesis. J. Virol. 62:435-443.
Zhong, L., and G. S. Hayward. 1997. Assembly of complete, functionally active herpes simplex virus DNA replication compartments and recruitment of associated viral and cellular proteins in transient contrasfection assays. J. Virol. 71:3146-3160.
Zhu, L., and S. K. Weller. 1992. The six conserved helicase motifs of the UL5 gene product, a component of the herpes simplex virus type 1 helicase-primase, are essential for its function. J. Virol. 66:469-479.
Zhu, Y., K. S. Trego, L. Song, and D. S. Parris. 2003. 3’-5’ exonuclease activity of herpes simplex virus type 1 DNA polymerase modulates its strand displacement activity. J. Virol. In press.
184
Zou, L., and B. Stillman. 2000. Assembly of a complex containing Cdc45p, replication protein A, and Mcm2p at replication origins controlled by S-phase cyclin-dependent kinases and cdc7p-Dbf4p kinase. Mol. Cell. Biol. 20:3086-3096.
185