TAXONOMIC STUDIES on INSECTS of FAMILY COCCINELLIDAE By

TAXONOMIC STUDIES ON INSECTS OF FAMILY COCCINELLIDAE

JAMILA YAHYA MOHAMMED ATIF B.Sc. Agric. Sci. (Plant Protection), Fac. Agric., Sana’a Univ., 2000 M.Sc. Agric. Sci. (Economic Entomology), Fac. Agric., Sana’a Univ., 2009

THESIS Submitted in Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Agricultural Sciences (Economic Entomology)

Department of Economic Entomology and Pesticides Faculty of Agriculture Cairo University EGYPT

2016

Name of Candidate: Jamila Yahya Mohammed Atif Degree: Ph.D. Title of Thesis: Taxonomic Studies on Insects of Family Coccinellidae Supervisors: Dr. Monir Mohmmed El-Husseini Dr. Hany Abdelaziz El-Shemy Dr. Sayeda Sayed Ahmed Department: Economic Entomology and Pesticides Branch: Economic Entomology Approval: 04/08/2016

ABSTRACT Ladybird beetles (Coleoptera: Coccinellidae) were collected from the fields of wheat, barley, alfalfa, beans, mustard, vegetable crops, and ornamental plants from Experiment Station in the Faculty of Agriculture, Cairo University-Giza, during two years 2013-2014. Six species (Coccinella undecimpunctata, Exochomus nigripennis, Hyperaspis marmottani, Rodolia cardinalis, Scymuns syriacus, and Hippodamia variegata) belong to six genera, from five tribes and three subfamilies; were recorded throughout the study and were morphologically identified and a taxonomic key was also given. Using molecular tools based on 28S r DNA, this study aimed to show the relationship among five species: Coccinella undecimpunctata, C. septempunctata, Cydonia vicina isis, C. v. nilotica, and Hippodamia variegata, collected from Giza region throughout the years 2013 and 2014. Results revealed that the species C. undecimpunctata, C. septempunctata and H. variegata were identical to the same specimen species in the Gene Bank. Meanwhile, a monophyletic relationship appeared between the species C. v. isis and C. v. nilotica compared to the species Cheilomenes sexmaculata. The sequences obtained in this study were deposited in the Gene Bank. Analysis of phylogenetic relationships tree database was performed using UPGAMA method by MEGAV6. software. Key words: Coccinellidae, Morphology, molecular study, Phylogeny tree, 28S r DNA gene.

INTRODUCTION

Ladybirds, otherwise called ladybugs or ladybird beetles, belong to the family Coccinellidae. These beetles are part of the chitins winged insects (Order: Coleoptera) located above the super- family Cucujoidea and under the sub order Polyphaga (Kovar, 1996; Hunt et al., 2007). The family spreads in most countries of the world. This family comprises 360 genera and approximately 6000 species worldwide (Vandenberg, 2002). Predatory ladybirds play a significant role in development of biological control strategies (Honk and Hodek, 1996).

Most ladybird species, both adults and larvae, are predators (entomophagous). They feed on small insects such as aphids, whiteflies, scale insects, mealybugs and mites (Moreton, 1969; Hawkeswood, 1987; Majerus, 1994, Salehi et al., 2011). The larval and adult stages suppress the number of their preys in agricultural environment (Honk and Hodek, 1996).

Egypt is one of the countries concerns with mass-rearing of coccinellids to be used for the control of many pests in field crops (Afifi et al., 2010; Mandour et al., 2011). Therefore, it is important to identify the widely spread species in the Egyptian environment, particularly the newly introduced species. There are previous studies on the classification of coccinellids in Egypt e.g., Ibrahim (1953); EL-Akkad (1979) and Badrawy et al., (2009). Ladybird beetles (family Coccinellidae) are rich in species, with ecological diversity of substantial agricultural significance, yet have been consistently problematic to classify, with evolutionary relationships poorly understood. In order to identify major clads within Coccinellidae, it worth to evaluate the current classification system, and identify likely drivers of diversification in this polyphagous group. Seago et al., (2011) conducted the first simultaneous Bayesian analysis of morphological and multi-locus molecular data for any beetle family. They mentioned that addition of morphological data significantly improved phylogenetic resolution and provided support for early diverging lineages; thereby better resolving evolutionary relationships than either data type alone.

In the mid-seventeenth century, Linnaeus began the classification of the lady bug species, depending on the pattern and genitalia. Later, Fabricius, Degger, Thunberg, Herbst, and Mulsant began the classification of other types of insects; including ladybirds (Gordon, 1985). Many authors have suggested new classifications, created or redefined the subdivisions, transferred genera or tribes from one subfamily to another (Sasaji, 1968; Chazeau et al., 1989; Kovarˇ, 1996; Fursch, 1990, 1996; Slipinski, 2013), the latter only for Australian species. Few studies attempted to reconstruct the phylogeny of the whole group rather than make intuitive reconstructions (Sasaji, 1968; Kovarˇ, 1996) or preliminary morphological cladistic analyses (Yu, 1994). The intuitive trees differ in the number of recognized subfamilies (six or seven) and the tribal or generic component of each subfamily, but agree on the relationships between the subfamilies Chilocorinae and Scymninae, and Coccinellinae and Epilachninae. Yu (1994) suggested, based on morphological characters, the paraphyly of the Coccidulinae and Scymninae.

A recent molecular phylogeny of 20 species in the family Coccinellidae, based on the 18S and 28S r DNA genes, indicated that the Scymninae and Chilocorinae are paraphyletic, although there is incongruence between analyses and low statistical support (Robertson et al., 2008).

Different classification systems have been used to classify members of the family Coccinellidae depending on the taxonomists and many attempts have been made concerning the phylogenetic relationships among the subfamilies from different viewpoints. However, the subdivision of the family has given rise to much controversy (Aruggoda et al., 2010). Very few molecular studies have been reported on Coccinellidae, compared to other insect groups in the world (Kobayashi et al., 1998).

In order to identify the coccinellid species within the Agricultural Experiment Station at Faculty of Agriculture, Cairo University in Giza, the present study aimed to conduct a simultaneous analysis of morphological and molecular data for the collected beetles for better identification through morphological and molecular data that could significantly better resolve their identification and evolutionary relationships than either data type alone.

Aims of this study are:

1. Identifying the morphological features amongst the collected genera and species 2. Identifying the molecular features amongst the collected genera and species. 3. Constructing identification morphological key and molecular key for collected species.

REVIEW OF LITERATURE

1. Field Studies on Surveying the Coccinellids

Ibrahim (1953) studied the Coccinella undecimpunctata as one of the best known and most widely distributed coccinellids in Egypt that has attracted the attention of both entomologists and laymen because of its beneficial habits and abundance. He added that beetles are very common on cotton plants in early summer months, but they gradually decrease in numbers with the rise of temperature, the increase of plant growth and the decline in aphid infestation. Also he found two species of parasitoid from order Hymenoptera on Coccinella undecimpunctata.

El Akkad (1979) surveyed coccinellids from Egypt , and revealed the presence of 59 species, 5 subspecies and 51 aberrations belong to 3 tribes 9 genera, e.g. Adonia variegata, Bulaea lichatschovi, Adalia decempunctata, C. undecimpunetata, C. sepetempunctata , Chilocorus bipustulatus, Exochomus nigripennis and Ex. pubescens.

Abd Allah (1988) recorded that coleopterous predators feed on soft scales infesting citrus, mango and ledge plants in Mansoura region, Egypt were Cydonia vicina isis Cr., Cy. v. nilotica Muls., Coccinella septempunctata L., C. undecimpunctata, Scymnus interruptus Goez, S. cyriacus, Exochomus flavipes Thunb., Rodolia cardinalis and Paederus alfierii Koch.

Ferran et al., (1989) reported that in this peculiar a grobiocoenose, adults of A. variegata, C. septempunctata and Propylea quatuordecimpunctata arrived generally from a southward direction and, to be more precise, from 2 main directions; south-westward and south-eastward. These colonizing flights are upwind and of low altitude. The study results are discussed in relation to some biotic features of cornfield (crop and aphid densities, coccinellid distribution), to its environment (hill, alfalfa field, cypress hedge).

Gordon and Vandenberg (1991) recorded the six species of predaceous Coccinellidae that are being released for biological control of the Russian wheat aphid, Diuraphis noxia (Mordvilko) in North America. They stated that 3 species are now established: Hippodamia (Adonia) variegata (Goeze), P. quatuordecimpunctata (L.), and C. septempunctata L. whearas Hi. (Semiadalia) undecimnotata (Schneider), Oenopia conglobata (L.), and S. frontalis (F.) are not known to be established. Two additional species of predaceous Coccinellidae are recent adventives additions to the North American fauna, Harmonia axyridis (Pallas) in Louisiana, Mississippi, and Georgia, and Ha. quadripunctata (Pontopiddian) in New Jersey and New York. They revised the key to North American genera of Coccinellini.

Alvis et al. (2002) the identity, abundance and seasonal trend of Coccinellidae in citrus orchards in Valencia (Spain). Samples were collected every 15 days during 1999-2001 from 10 commercial citrus plantations. A total of 5,259 adults belonging to 16 species were identified. More than 90% of the adults belonged to the genus Scymnus, with S. interruptus and S. subvillosus being the most abundant species during the 3 years in all the orchards. Five more frequent species appeared more irregularly, i.e. Stethorus punctillum, P. quatuordecimpunctata, R. cardinalis, Clitostethus arcuatus and Cryptolaemus montrouzieri. The relative abundance of the different species was rather stable during the 3 years at the 10 orchards. S. interruptus, S. subvillosus and Pr. quatuordecimpunctata were abundant between May and October, with a maximum population in spring and sometimes in autumn. The 3 species used to appear together in the same orchards. R. cardinalis was abundant in June and July, and S. punctillum at the end of summer and in autumn. The most abundant Scymnus species can play an important role as biological control agents for aphids, as they are found associated with the aphidophagous Pr. quatuordecimpunctata, and for Planococcus citri. Of all collected coccinellids, Oe. conglobata had the highest occurrences in year-round collection with 34.1 percentages and accounted as dominant species. The figures for this species in summer, autumn and winter seasons of 2010 were 49, 22 and 84 percent of all collected specimens. Population density of seven spotted lady beetle; C. septempunctata was 33 percent in the spring of the same year.

Kindlmann, and Dixon (2003) considered the predators generally to be less effective biological control agents than parasitoids. The famous exception is the control of the cottony-cushion scale, Icerya purchasi Maskell, by the ladybird beetle R. cardinalis (Mulsant). This outstanding success resulted in the widespread and haphazard introduction of ladybird beetles. However, aphidophagous species of ladybird beetles have generally proved ineffective biological control agents.

Khalil and Mourad (2006) conducted a survey for ladybirds (Coccinellidae) on coniferles trees in south of Syria from August 2001 until August 2003.The results revealed the presence of 20 species belonging to 5 subfamilies and 7 tribes. Four species were first recorded in Syria: Rhyzobius lophantae (Blaisdell), Nephus (Bipunctatus) bipunctatus (Kugelann), S. abietis Paykull, Pharoscymnus ovoideus Sicard. All of the listed species were found to be predatory beetles on arthropod pests including aphids, scale insects and mites. The investigation included their common and distribution in south of Syria.

MATERIALS AND METHODS

Specimens of the ladybird beetles were collected from the Experimental Station at the Faculty of Agriculture, Cairo University, Giza during the seasons 2013-2014. The specimens were randomly collected from different field crops, trees, and ornamental plants. The specimens were collected using a sweep- net and hand picking, and were placed in test tubes (Sadeghi, 1991; Ansari pour et al., 2011 and Farahi and Sadeghi namghi, 2009). The collected ladybirds were transferred to the laboratory and preserved in 70% ethanol with a few drops of glycerin for identification (Ruttner et al., 1978). Each specimen was labeled by the recorded information of the crop, associated prey, and collecting date.

1. Taxonomy and Morphological Identification

Microscopic Preparations of the Specimens: Body parts of each specimen were macerated in warm 10% NaOH solution for 5 minutes, washed with water, dehydrated through successive dilutions of ethyl alcohol (50, 70, 80, 90, 95, 100) for 5 minutes each, and then cleared in Xylene, followed by Clove oil for another 5 minutes, each separately. The body parts were separated removed using fine needles under a stereomicroscope. The parts were mounted in Canada Balsam and dried in oven at 40°C. They were examined under a stereomicroscope. Each specimen was measured in 20 replicates. Measurements of the body parts were carried out by means of a stereoscope and transmitted-light microscope using an ocular micrometer (Kovar, 2005). Taxonomy of the specimens: It followed their morphological characteristics and genitalia, according to available keys of North American Coccinellidae (Gordon, 1972, 1985, Gordon and Vandenberg, 1991) and Australian ladybird beetles (Slipinski, 2013). Photos of these body parts were taken using SONY Digital 20.1 M.P (Milleo and Meira, 2012).

2. Molecular Identification

The collected specimens of lady bird were placed in test tubes and preserved; stored at -20°C until DNA extraction (Hall, 1995).

DNA was extracted from multiple individuals per morphologically similar specimens. Whole adult bodies were grinded by a mortar and pestle in liquid nitrogen. DNeasy Blood and Tissue Kit (Qiagen) were applied according to the manufacturer’s instructions. For 28S r DNA detection, the following primers were used according to Magro et al., (2010): The 5′−3′ sequence of the forward and reverse primer 28Sr DNA are F (GACCCGTCTTGAAACACGGA) R (TCGGAAGGAACCAGCTACTA).

PCR was performed in a total volume of 25µl contained the following 5µl master mix, 0.5µl primer F and R, 16µl water nuclease free and 3µl genomic DNA. The PCR profile consisted of the following parameters: denaturation of 5 min at 95 ˚C, followed by 35 cycles of 60s at 95˚C, 1 min at 50 - 52 ˚C 60s at 72˚C and 10 min extension at 72˚C. Detection of DNA occurred using Electrophoresis. Cycling sequence was performed with Big Dye Terminator version 3.1 kit. The sequencer was the “3500 Genetic Analyzer” (Applied Bio systems).

The phylogenic tree was constructed using the Un-weighed pair group method with Arithmetic Mean (UPGMA) in MEGAV6. software, ( Molecular Evolutionary Genetics Analysis ,(Tamura et al., 2013 and El-Atroush et al., 2015) based on the multiply aligned sequence data of five species of insects and comparatives of similarity on the species using BLAST in the Gene Bank. The sequences obtained in this study were then deposited in the Gene Bank.

SUMMARY

This study was carried out in order to identify the coccinellid species within the Agricultural Experiment Station at Faculty of Agriculture, Cairo University in Giza. The present study aimed to conduct a simultaneous analysis of morphological and molecular data for the collected beetles for better identification through morphological and molecular data that could significantly better resolve their identification and evolutionary relationships. Aims of the study are:

Results indicted the following:

1. Field Surveyed on Coccinellids

Ladybird species collected from different crops associated with insect preys at the Agricultural Experimental Station, Faculty of Agriculture, Cairo University, Giza, Egypt during 2013-2014 were recorded. The study revealed 6 species belong to 6 genera from 5 tribes in 3 subfamilies. Subfamily Coccinellinae (Coccinella undecimpunctata (Linnaeus 1758), Hippodamia variegata (Goeze 1777) and Rodolia cardinalis (Mulsant, 1850); subfamily Chiolocorinae (Cydonia vicina isis (Crotch), Cydonia vicina nilotica (Mulsant), Exochomus nigripennis (Goeze 1777)); Subfamily Scymninae (Hyperaspis marmottani and Scymnus syriacus (Marseul 1868)).

2. Morphology, Morphological Identification and taxonomic key

The collected six coccinellid species, were identified and recorded according to their external morphological characters and measurements of antennae, mouthparts, pronotum, abdomen, legs, elytra and hind wing in addition to male genitalia and female spermatheca which showed clear differences between the different genera of the collected species.

3. Molecular Differentiation and Phylogenic Dendrogram

Phylogenetic tree (Fig. 9) showed the relationship among three clads. Clade (1) included two specimens; the first (2e: C. undecimpunctata) was identical to C. undecimpunctata in Gene Bank number (FJ621327) and the second (9e: C. septempunctata) was similar to C. septempunctata in Gene Bank number (FJ621328) and (DQ 202668). Clade (2) included two specimens (7e) and (8e) Cydonia vicina isis and C y. v. nilotica which was identical to Cheilomenes sexmaculata in Gene Bank number (GU073735). Clade (3) included one specimen (3e: Hippodamia variegata which was identical to Hi. varigeata in Gene Bank number (EU145667) and (GU073743). Each sequence of the five specimens obtained in this study was deposited into the Gene Bank with the accession numbers: (2e: KU050099), (3e: KU050100), (7e: KU050101), (8e: KU050102), (9e: KU050103), respectively (Appendix).