(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/203532 Al 30 November 2017 (30.11.2017) W !P O PCT

(51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, A61K 45/06 (2006.01) A61K 31/5377 (2006.01) CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, A61K 31/00 (2006.01) G01N 33/574 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, A61K 31/506 (2006.01) A61P 35/00 (2006.01) HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, KP, KR, A61K 31/517 (2006.01) KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (21) International Application Number: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, PCT/IL2017/050586 SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, TR, (22) International Filing Date: TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. 25 May 2017 (25.05.2017) (84) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (26) Publication Language: English UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (30) Priority Data: TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, 245861 25 May 2016 (25.05.2016) IL EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, (71) Applicant: YEDA RESEARCH AND DEVELOPMENT TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, CO. LTD. at the Weizmann Institute of Science [IL/IL]; KM, ML, MR, NE, SN, TD, TG). P.O. Box 95, 7610002 Rehovot (IL).

(72) Inventors: LEV, Sima; 19 Grofit Street, 5296000 Ra- Declarations under Rule 4.17: mat-Efal (IL). MUELLER, Anna; c/o YEDA RESEARCH — of inventorship (Rule 4.1 7(iv)) AND DEVELOPMENT CO. LTD. at the Weizmann Insti Published: tute of Science, P.O. Box 95, 7610002 Rehovot (IL). VER- — with international search report (Art. 21(3)) MA, Nandini; c/o YEDA RESEARCH AND DEVELOP — before the expiration of the time limit for amending the MENT CO. LTD. at the Weizmann Institute of Science, claims and to be republished in the event of receipt of P.O. Box 95, 7610002 Rehovot (IL). KOTHARI, Charu; amendments (Rule 48.2(h)) c/o YEDA RESEARCH AND DEVELOPMENT CO. LTD. — with sequence listing part of description (Rule 5.2(a)) at the Weizmann Institute of Science, P.O. Box 95, 7610002 Rehovot (IL). (74) Agent: EHRLICH, Gal; G.E. EHRLICH (1995) LTD., 11 Menachem Begin Road, 5268104 Ramat Gan (IL). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM,

(54) Title: AGENTS FOR USE TREATING DRUG RESISTANT TUMORS AND TRIPLE NEGATIVE BREAST CANCER

FIG. 2A BT-20 MDA-468 HCC1937 HCC38 HCC1143 SUM1 59 Hs578T MDA-231 BT-549 FAK s RNA : PYK2 shRNA: + Control shRNA: + PYK2

a - Tubulin o (57) Abstract: Combination therapies comprising an agent which downregulates an amount and/or activity of a receptor which is expressed on the surface of tumor cells of a subject and an agent which specifically downregulates an amount and/or activity of at least one member of the Fak family for use in treating cancer, more specifically breast cancer, and most specifically triple negative breast o cancer, are disclosed. Pharmaceutical compositions comprising the agents of the combination therapies are also disclosed, as well as an ex vivo method of predicting prognosis of triple negative breast cancer, and a kit for determining said prognosis. USE OF AGENTS FOR TREATING DRUG RESISTANT TUMORS

FIELD AND BACKGROUND OF THE INVENTION The present invention, in some embodiments thereof, relates to methods and compositions for treating drug resistant tumors, and more specifically to treatment of triple negative breast cancer (TNBC). Triple-negative breast cancer is a highly aggressive breast cancer subtype, defined by the absence of both estrogen and progesterone receptors as well as of HER2 amplification, and characterized by high heterogeneity and lack of effective treatment or therapeutic targets. EGFR is highly expressed in approximately 50 % of TNBC patients, is implicated in cancer progression and metastasis and considered as a therapeutic target. However, single agent therapy against EGFR did not improve outcome of TNBC patients, possibly due to activation of compensatory signaling pathway(s). Recent studies suggest that signaling by the cMet receptor, HER3 (ErbB3) and AXL can compensate for EGFR inhibition, and that upregulation of HER3 is associated with reduced response to EGFR antagonists in TNBC patients. Upregulation of HER3 was also observed in response to HER2 antagonists in HER2-positive breast cancer and is generally associated with drug resistance to EGFR and HER2-targeted therapies. Receptor upregulation could be regulated at transcriptional and posttranslational levels, including receptor degradation. Knocking down of the ubiquitin ligase NEDD4, for example, induced upregulation of HER3 and enhanced breast cancer cell proliferation in vitro and tumor growth in vivo, while enhanced AXL degradation can overcome resistance to EGFR antagonists in non-small cell lung cancer. Thus, agents that prevent the upregulation of receptor tyrosine kinases (RTKs) in response to EGFR antagonists may offer an efficient therapeutic strategy to improve treatment and overcome resistance. Consistent with this concept, previous studies suggest that dual targeting of EGFR and other RTKs that heterodimerize or cross-talk with EGFR signaling, could potentiate drug response and/or overcome resistance. Combined targeting of both EGFR and cMet receptors, for example, was proposed as an effective therapeutic strategy for TNBC. The non-receptor tyrosine kinase PYK2 is a common downstream effector of EGFR, cMet and their cross-talk signalling in certain TNBC cell lines. PYK2 and its closely related focal adhesion kinase (FAK) are key mediators of various mitogenic and migratory pathways triggered by RTKs, cytokine receptors and integrin clustering. Both PYK2 and FAK have been implicated in the progression and invasion of diverse human cancers, including breast cancer (Felty, 2011, Front Biosci 16, 568-577; Golubovskaya, 2010, Anti-cancer agents in medicinal chemistry 10, 735-741; Lipinski and Loftus, 2010, Expert Opin Ther Targets 14, 95-108; Sulzmaier et al., 2014, Nature reviews Cancer 14, 598-610). Small molecule inhibitors to FAK/PYK2 suppressed tumor growth and metastasis in several preclinical models and have initial clinical activity in patients with limited adverse effects (Sulzmaier et al., 2014). Recent studies suggest that FAK is frequently highly expressed in TNBC and could be a potential therapeutic target (Glenisson et al., 2012; Genes Cancer 3, 63-70

Yom et al., 2011, Breast cancer research and treatment 128, 647-655), while proteomic analysis suggests that activated PYK2 is mainly found in basal-like breast carcinomas and correlates with high levels of EGFR and activated Erkl/2 (Boyd et al., 2008, Molecular cancer therapeutics 7, 3695-3706). Additional background art includes International Application Nos. WO2016029002 and WO201 1088149.

SUMMARY OF THE INVENTION According to an aspect of the present invention there is provided a method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or activity of: (i) a receptor which is expressed on the surface of tumor cells of the subject, wherein the amount of the agent which targets the receptor is below the minimum dose required for therapeutic effectiveness when used as a single therapy; and (ii) an agent which specifically downregulates an amount and/or an activity of at least one member of the Fak family. According to an aspect of the present invention there is provided a method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising analyzing the amount of EGF-R expression in a tumor of the subject, and when the amount is above a predetermined level administering to the subject a therapeutically effective amount of: (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK. According to an aspect of the present invention there is provided a method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising analyzing the amount of EGF-R expression in a tumor of the subject, and when the amount is above a predetermined level administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or activity of EGF-R together with: (i) an agent which specifically downregulates an amount and/or an activity of PYK2; or (ii) an agent which specifically downregulates an amount and/or an activity of FAK, and when the amount is below the predetermined level, administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or activity of EGF-R together with: (i) an agent which specifically downregulates an amount and/or an activity ofPYK2; and (ii) an agent which specifically downregulates an amount and/or an activity of FAK. According to an aspect of the present invention there is provided a method of treating a drug-resistant tumor in a cancer patient in need thereof comprising administering to the patient a therapeutically effective amount of: (i) an agent which downregulates an amount and/or an activity of a receptor that is expressed on the surface of the tumor; and (ii) an agent which specifically downregulates an amount and/or an activity of at least one member of the Fak family, wherein the drug of the drug-resistant tumor targets the receptor that is expressed on the surface of the tumor. According to an aspect of the present invention there is provided a method of predicting prognosis of TNBC in a subject, the method comprising determining a level and/or activity of a tyrosine kinase receptor that is expressed on tumor cells of the subject and at least one member of the FAK family in a sample derived from the breast of the subject, wherein an amount of the receptor and the member of the FAK family above a predetermined level is indicative of poor prognosis of TNBC. According to an aspect of the present invention there is provided a kit for determining prognosis of TNBC in a subject comprising (i) an agent which specifically binds to a tyrosine kinase receptor; and (ii) an agent which specifically binds to at least one member of the FAK family. According to an aspect of the present invention there is provided an article of manufacture comprising an agent which downregulates an amount and/or an activity of a tyrosine kinase receptor; and (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK. According to an aspect of the present invention there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an agent which downregulates an amount and/or an activity of a tyrosine kinase receptor; and (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK. According to embodiments of the present invention the receptor is epidermal growth factor receptor (EGF-R). According to further embodiments of the present invention the at least one member of the Fak family is Proline-rich tyrosine kinase 2 (PYK2) or FAK (focal adhesion kinase). According to further embodiments of the present invention the TNBC is a basal TNBC. According to further embodiments of the present invention the agent which downregulates an amount and/or activity of epidermal growth factor receptor is a small molecule. According to further embodiments of the present invention the agent which downregulates an amount and/or activity of epidermal growth factor receptor is an antibody. According to further embodiments of the present invention the small molecule is selected from the group consisting of Gefitinib and Erlotinib. According to further embodiments of the present invention the method further comprises analyzing the amount of EGF-R expression in a tumor of the subject. According to further embodiments of the present invention the agent which specifically downregulates the at least one member of the Fak family is a small molecule agent. According to further embodiments of the present invention the small molecule agent inhibits PYK2 to a greater extent than FAK. According to further embodiments of the present invention the agent which specifically downregulates an amount and/or activity of the at least one member of the Fak family is a polynucleotide agent. According to further embodiments of the present invention the subject is classified as being resistant to EGF-R inhibitors. According to further embodiments of the present invention the receptor is a tyrosine kinase receptor and the drug-resistant tumor is a tyrosine kinase inhibitor resistant tumor. According to further embodiments of the present invention the disease is cancer. According to further embodiments of the present invention the cancer is selected from the group consisting of breast cancer, lung cancer and glioblastoma. According to further embodiments of the present invention the tyrosine kinase receptor is selected from the group consisting of EGF-R, cMET, Axl, human epidermal growth factor receptor 3 (Her3). According to further embodiments of the present invention the at least one member of the Fak family is Proline-rich tyrosine kinase 2 (PYK2). According to further embodiments of the present invention the lung cancer is non-small cell lung cancer. According to further embodiments of the present invention the breast cancer is TNBC. According to further embodiments of the present invention the agent which specifically downregulates an amount and/or activity of PYK2 is a small molecule agent. According to further embodiments of the present invention the agent which specifically downregulates an amount and/or activity of FAK is a small molecule agent. According to further embodiments of the present invention the small molecule agent inhibits PYK2 to a greater extent than FAK. According to further embodiments of the present invention the agent which specifically downregulates an amount and/or activity of PYK2 is a polynucleotide agent. According to further embodiments of the present invention the agent which specifically downregulates an amount and/or activity of FAK is a polynucleotide agent. According to further embodiments of the present invention the agent which targets the tyrosine kinase receptor is formulated in a unit dosage which is below the minimum dose required for therapeutic effectiveness when used as a single therapy. According to further embodiments of the present invention the tyrosine kinase receptor is EGF-R. According to further embodiments of the present invention the article of manufacture is for use in treating a drug-resistant tumor. According to further embodiments of the present invention the pharmaceutical composition is for use in treating a drug-resistant tumor. According to further embodiments of the present invention the agent is an antibody. According to further embodiments of the present invention the antibody is a monoclonal antibody. According to further embodiments of the present invention the antibody comprises a detectable label selected from the group consisting of a radioactive label, a fluorescent label, a chemiluminescent label and an enzyme. According to further embodiments of the present invention the enzyme is horseradish peroxidase or alkaline phosphatase. Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced. In the drawings: FIGs.lA-F illustrate the expression of PYK2 and EGFR in TNBC clinical samples. (A) PYK2 mRNA expression in breast cancer subtypes and grades. PYK2 gene expression was obtained from microarray dataset of 4467 clinical breast cancer samples (Affymetrix probeset 203111_s_at) and split into high and low expression levels. The correlation between high/low expression of PYK2 and the indicated clinical parameters as well as breast cancer subtype was evaluated by -test. P values are indicated. (B) Kaplan-Meier plots of event-free survival of TNBC patients with either low (n=291) or high (n=180) PYK2 expression, which express either high (green) or low (blue) EGFR levels. Strong correlation was obtained between high PYK2/high EGFR expression and reduced event-free survival in TNBC patients (p = 0.026). (C) Quantitative analysis of 77 TNBC tissue samples for PYK2 and EGFR expression was carried out applying H-score as described in the Methods section, and accordingly, samples were grouped into low (0-2.5) and high (2.5 (+)-4(+)) staining intensity. (D, E) PYK2 (D) and EGFR (E) expression levels in TNBC tissue sections were analyzed by immunohistochemistry. Representative images displaying high and low staining intensity are shown. Scale bar, 50 µΜ . Number of lymph node positive (LNP) tumors that display high or low staining for PYK2 (D) and EGFR (E), are shown in the corresponding graphs. (F) Serial sections of high grade-LNP TNBC tissue with high levels of both PYK2 and EGFR. Number of tumors with LNP is shown in the graphs. The correlation between the expression levels (high/low) of PYK2, EGFR or both PYK2 and EGFR, and LNM status is depicted. Statistical analysis was performed applying χ -test. FIGs. 2A-I illustrate that inhibition of PYK2/FAK affects cell proliferation, anchorage independent growth and synergizes with EGFR inhibition in basal-like TNBC. (A) Levels of PYK2, FAK and EGFR proteins in control and PYK2- or FAK- depleted TNBC cell lines. (B) Cell viability of control, PYK2- or FAK-depleted TNBC cell lines was assessed by MTT assay and presented as percentage of control. Data represents mean values + s.d. of three independent experiments. (C, D) PYK2 or FAK knockdown potentiates the effect of Gefitinib (C, D) and Erlotinib (C) on MDA-MB-

468 or BT-20 cell death, as determined by IC 50 values (C) and by the colony staining assay (D). (E) The IC 50 values of the indicated basal-like TNBC cell lines to FAK (PF573228) and FAK/PYK2 (PF4313196) small molecule inhibitors was determined in three independent experiments and mean values + s.d. are shown. (F) Colony formation assay was used to demonstrate the stimulatory effect of PF4313196 on Gefitinib- induced MDA-MB-468 or BT-20 cell death. Representative images of crystal violet staining of control and drug-treated cells (72 h) are shown in the left panels. MTT assay results of dose response matrix of Gefitinib and PF4313196 drug combinations are shown on the right. Cell viability is presented as percentage of control (untreated cells) and labeled by blue (high)-to-red (low) color code. (G) IC50 values for Gefitinib, PF4313196 and their combined effects in the indicated basal-like TNBC cell lines. Drug synergy was assessed by the CI values. (H) Colony formation assays of the five basal- like TNBC cell lines upon Gefitinib and/or PF396 treatment demonstrate the potent combined effects of the drugs. (I) Anchorage-independent growth of control, PYK2- or FAK-knockdown MDA-MB-468 and BT-20 cells in the absence or presence of 1 or 10 µΜ Gefitinib, respectively. The colonies were grown for two weeks and then for an additional three weeks in the absence or presence of Gefitinib. Quantitative evaluation of total number of colonies, average colony size and overall area covered with colonies from two independent experiments is shown as percentage of control. Data represent mean + s.d. Representative colonies were photographed using an inverted light microscope. Scale bar, 100 µΐη. FIGs. 3A-D illustrate that combined inhibition of PYK2 and EGFR markedly reduces tumor size in mouse xenograft models. (A) Tumor xenograft growth of control and PYK2-depleted TNBC cells. Control and PYK2-depleted luciferase-expressing MDA-MB-468 cells were implanted into the fourth inguinal mammary glands of six- week-old nude mice (n = 50). Six weeks later (arrow), each group was randomly divided into two; one was treated orally with vehicle (placebo) and the second with Gefitinib 100 mg/kg/day for a period of 39 days. Tumor volume (cm ) and body weight (g) (B) were measured at the indicated time points (-weekly). The value at each time point represents the mean volume of 8-12 tumors; error bars represent SEM. Student's i-test, **P<0.01. (C) Representative bioluminescent images (IVIS instrument, Living Image 3.0 software) of mice of the four groups described above. Bioluminescent images were acquired once a week throughout the experiment. Pictures shown correspond to the end of the experiment, day 39 post-treatment. (D) Representative histological photomicrographs of xenograft tumors (control and PYK2 knockdown) treated with vehicle or Gefitinib and stained with Haematoxylin and Eosin (H&E) and for PCNA, as a marker for proliferating cells. Percentages of PCNA-positive cells were quantitated by counting -500 cells from 5 highly nucleated, equal microscopic fields for each tumor of the three depicted groups. Data are expressed as mean + s.d. Student's i-test, *P<0.05, **P<0.01. FIGs. 4A-F illustrate the effects of PYK2/FAK and EGFR inhibition on multiple survival/proliferative signaling pathways and on HER3 levels. (A, B) Effect of PYK- or FAK-knockdown (A), as well as PYK2/FAK inhibitors (B) on the protein levels and activation states of the indicated signaling proteins in the five basal-like TNBC cell lines. Shown are representative Western blotting (WB) results of reproducible experiments using antibodies against the indicated proteins and their phosphorylated form. Quantification of protein bands intensities was performed using ImageJ software. Levels of HER3, pS6K, pERKl/2, pSTAT3 and pAKTS473 in PYK2- (P) and FAK- (F) knockdown cells (A) or in inhibitor-treated cells (PF228 left; PF396 right) (B) relative to control (fold change) are shown in the accompanying blue (high)-to-red (low) colored tables. (C) Gefitinib inhibits ERK1/2 activation in basal-like TNBC. The indicated cell lines were treated with Gefitinib (IC 25) for 72 h and ERK activation was assessed by WB using anti-pERKl/2 antibody. Relative pERKl/2 was quantitated as described above. (D) Inhibition of PYK2/FAK together with Gefitinib affects predominant survival/proliferative signaling pathways. Quantitation of WB results is shown in the bar graph. (E) Effect of Gefitinib on HER3 levels in the five basal-like TNBC cell lines. (F) Effect of Gefitinib treatment for 3 or 5 days on the indicated signaling proteins and pathways. Representative WB results are shown. FIGs. 5A-D illustrate that PYK2/FAK inhibition reduces upregulation of HER3 and its associated resistance to EGFR antagonists. (A) Short-term Gefitinib treatment induces upregulation of HER3 in MDA-MB-468 and desensitizes the cells to Gefitinib treatment. Sensitivity to Gefitinib was determined by measuring the IC50 of Gefitinib in

Gefitinib-pretreated MDA-MB-468 cells. The cells were pretreated with Gefitinib (IC 25) for 72 h, Gefitinib was washed out, and then cells were incubated for 72 h with the indicated doses of Gefitinib in the absence or presence of PF396 as described in the dose matrix (lower panel). The IC50 values are shown in the table, and synergy was assessed by the CI. Combined effects of Gefitinib and PF396 on HER3 levels and downstream signaling pathways were assessed by WB as shown in the upper panel. Quantitation of protein band intensities is shown in the bar graph. (B) Gefitinib- or Erlotinib-resistant cell lines were established as described in Supplementary

Information. Levels of HER3, pSTAT3 and STAT3 are shown in the upper WB. IC50 to Gefitinib and synergy with PF396 was determined as described above. The bar graph on the right shows the influence of PYK2 knockdown on IC50 of Gefitinib in the Gefitinib- resistant MDA-MB-468 cells. (C) HER3 overexpression desensitizes MDA-MB-468 and BT-20 cells to Gefitinib, while knocking down of PYK2 restored sensitivity to Gefitinib (graph) and concomitantly reduced HER3 levels in HER3-overexpressed (OX) cells. WB analysis shows the effects of HER3-OX and subsequent PYK2 knockdown on the indicated signaling pathways. The influence of PYK2 knockdown on the IC50 of Gefitinib in HER3-OX MDA-MB-468 or BT-20 cells is shown in the accompanying bar graph. (D) IC50 values of Gefitinib in HER3-OX MDA-MB-468 and BT-20 cells are shown in the absence and presence of PF396 as indicated. IC50 values were calculated and displayed with GraphPad software. Synergism was evaluated by executing CompuSyn software. FIGs. 6A-H illustrate that depletion of PYK2 accelerates HER3 proteasomal degradation by upregulating NDRGl expression. (A) PYK2 depletion results in enhanced HER3 proteasomal degradation. Control and PYK2-depleted MDA-MB-468 cells were treated with chloroquine or MG132 for 12 h as indicated. The level of HER3 protein was assessed by WB. (B, C) Subcellular localization of HER3 and pPYK2 was examined by immunoflorescence (IF) analysis in control MDA-MB-468 cells (B) and/or PYK2-depleted cells as indicated. Colocalization with the indicated marker proteins, or with ubiquitin (C) appears in yellow. Shown are representative confocal images, and 2 fold magnified inserts. Scale bar, 10 µιη. (D) Effects of PYK2 or FAK knockdown on the protein and phosphorylation (Thr346) levels of NDRGl in the five basal-like TNBC cell lines. Shown are representative WB results. (E) The iron chelator Dn44mT induces upregulation of NDRGl and concurrent downregulation of HER3 protein. MDA-MB-468 cells were treated with the indicated concentrations of Dn44mT for 24 h. The level of the indicated proteins was assessed by WB. (F) NDRGl expression induces proteasomal degradation of HER3. HEK293 cells were transfected with expression vectors encoding HER3 or Myc-tagged NDRGl and 16 h later were treated with MG132 (3µΜ) for 24 h as indicated. The levels of transfected proteins were assessed by WB. (G) NDRGl enhances the ubiquitination of HER3. HEK293 cells were transfected with the indicated DNA constructs and 16 h later the cells were treated with MG132 (3µΜ) as described above. HER3-V5 was immunoprecipitated (IP) by anti-V5 antibody and its ubiquitination was assessed by WB (IB) using anti-ubiquitin antibody. Input; 10% of total cell lysate used for IP. (H) Knockdown of NDRGl results in upregulation of HER3, opposite to PYK2-knockdown effects. Two different shRNAs were used to knockdown NDRGl. WB analysis shows the influence of NDRGl shRNAs as well as of PYK2-knockdown on HER3, EGFR and cMet, and on PYK2 and FAK protein levels. FIGs. 7A-I illustrate the interplay between HER3, PYK2, NDRGl and NEDD4. (A, B) NDRGl depletion restores HER3 expression in PYK2 knockdown MDA-MB- 468 cells. Shown are representative WB (A) and IF analysis demonstrating the distribution of HER3 and its colocalization with Rabll in PYK2 KD, NDRGl KD and PYK2/NDRG1 double KD cells. (B). (C) The influence of PYK2 or NDRGl depletion on HER3, NEDD4 and NDRGl distribution. The left four panels (two rows) demonstrate the distribution and colocalization in control cells. The four right panels demonstrate the effects of PYK2 or NDRG1 depletion on HER3 distribution and its colocalization with NEDD4. Colocalization appears in yellow. Scale bar, 10 µιη. Zoomed sections are magnified by two folds. (D) HER3-NEDD4 interaction is enhanced by NDRG1 and inhibited by PYK2. HEK293 cells were transfected with the indicated DNA constructs. Cells were treated with MG132 as described in Fig. 6. Cells were lysed and HER3 was immunoprecipitated (IP) by anti-HA antibody and its interaction with NEDD4 was determined by WB using anti-V5 antibody. Expression levels of the transfected proteins are shown in the input (10% of total lysate). (E) PYK2 interacts with NEDD4-1/2 as demonstrated by co-IP studies. HEK293 cells were transfected with the indicated DNA constructs. Interactions were assessed by co-IPs as describe in panel A. (F) HER3 and NDRG1 interfere with NEDD4-PYK2 interaction. HEK293 cells were transfected with the indicated DNA constructs. Interactions with NEDD4-V5 were assessed by anti-V5 co-IP studies. (G) PYK2 and NEDD4 compete for HER3 binding. HEK293 cells were transfected with the indicated DNA constructs. Interactions with HER3-HA were assessed by anti-HA co-IP studies. (H) NDRG1 and/or NEDD4 affect HER3-PYK2 interaction. HEK293 cells were transfected with the indicated DNA constructs. Interactions with HER3-HA were assessed by anti-HA co-IP studies. (I) Schematic representation of the protein-protein interactions results shown in panels D-H. Strong interactions (black), no/week interactions (white). FIGs. 8A-D illustrate analysis of PYK2 and EGFR gene expression in human breast cancer samples. (A) Cutoff selection for PYK2 mRNA expression based on the distribution in 1096 TNBC samples. We used Cutoff Finder (Budczies et al., 2012) to fit a mixture model of two Gaussian distributions (red lines) to the mRNA expression data of PYK2 (Affymetrix probeset 203111_s_at). The optimal cutoff from the mixture model (-0.007 in the graph) was selected to stratify samples into high and low PYK2 expression. (B, C) Cutoff selection for EGFR mRNA expression in 1096 TNBC samples. (B) Two probesets for EGFR (211607_x_at and 210984_x_at) displayed a strong correlation in 1096 TNBC samples (A). Samples with expression values below - 0.005 for both probesets were defined as "EGFR low" (blue dots). (C) The distribution of the mean values of both probesets is displayed by green and blue colors for high and low EGFR, respectively. (D) Kaplan-Meier analysis of event free survival of TNBC patients according to EGFR expression. Survival analysis was performed for 471 patients with follow-up information from the cohort of 1096 TNBC. Patients were stratified into groups with 'high' or 'low' EGFR expression according to the combined cutoff from Affymetrix probesets (21 1607_x_at and 210984_x_at) for EGFR. FIGs. 9A-E illustrate the effects of FAK or PYK2/FAK inhibition on basal-like TNBC growth either alone or in combination with EGFR antagonists. (A) Effects of FAK inhibitor on survival of basal-like TNBC cell lines in the absence or presence of Gefitinib. The indicated basal-like TNBC cell lines were treated with increasing doses of PF228, Gefitinib or combinations of both for 72h and cell viability was assessed by

MTT assay. IC 50 values and synergism (CI<1) are shown in the table. Representative matrices of combined drug treatment of MDA-MB-468 and BT-20 cells are shown in the middle panels and numbers indicate percentage of viable cells as compared to non- treated control cells. Color gradient displays fraction of surviving cells (dark blue; high, dark red; low). Right panels show representative pictures of crystal violet staining of MDA-MB-468 and BT-20 cells, 72 h following treatment with the indicated concentrations of Gefitinib and/or PF228. (B) Effect of Erlotinib and/or PYK2/FAK dual inhibitor on basal-like TNBC survival. The indicated basal-like TNBC cell lines were treated with increasing doses of PF396, Erlotinib or combinations of both for 72 h and cell viability was assessed by MTT assay. IC 50 values and synergism (CI<1) are shown in the table. (C) Effect of double knockdown of both PYK2 and FAK in

HCC1937, HCC1143 and HCC38 on the IC50 values of Gefitinib. PYK2/FAK-depleted cells were treated with Gefitinib for 72 h and IC 50 values were determined by MTT assay. Mean values + s.d. from three independent experiments are shown. Knockdown efficiency was assessed by WB using anti-PYK2 and anti-FAK antibodies. (D) Effect of Gefitinib either with cMet inhibitor (EMD12140; left table) or MEK inhibitor (GSK1 12021; right table) on the survival of MDA-MB-468 and BT-20 cells. Survival was assessed by MTT assay, as described above. IC 50 values and synergism (CI<1) are shown in the tables. (E) Influence on anchorage-independent growth of MDA-MB-468 and BT-20 cells treated with a combination of Gefitinib and PF396. Representative images of cell colonies grown in soft agar for two weeks followed by a three weeks treatment with Gefitinib, PF396 or their combination (MDA-468: 1 µΜ each, BT-20: 5 µΜ and 1 µΜ, respectively). Scale bar, 100 µη . Quantitative evaluation shows number of colonies, colony size and area as percentage of non-treated control. FIGs. 10A-B illustrate that combined inhibition of PYK2/FAK and EGFR enhances pro-apoptotic signals and reduces pro-survival signals. (A) Effects of PYK2/FAK and EGFR inhibition on survival/proliferative pathways in BT-20 cells. µΜ BT-20 cells were treated with Gefitinib (IC 25), PF431396 (0.5 ) or combination of both for 24 h. The influence of these treatments on the indicated signaling pathways was assessed by WB. The effects were quantified based on protein bands intensities using ImageJ software and are presented in the graph as fold changes of non-treated control. (B) Effects of PYK2 or FAK knockdown as well as PYK2/FAK dual inhibitor PF396, with or without Gefitinib treatment on the activation of major pro-apoptotic proteins as determined by PARP and Caspase 9 cleavage. For MDA-MB-468 and BT-20 knockdown cells, we used 0.5 µΜ and 10 µΜ Gefitinib, respectively. For drug combinations, we used 1 µΜ and 5 µΜ Gefitinib for MDA-MB-468 and BT-20, respectively, whereas ΙµΜ PF396 was used for both the cell lines. Cells were treated with drugs for 24 h following WB analysis.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION The present invention, in some embodiments thereof, relates to methods and compositions for treating drug resistant tumors, and more specifically to treatment of triple negative breast cancer (TNBC). Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways. TNBC accounts for -20% of all breast cancers and is frequently associated with high mitotic indices, high rates of metastasis, and poor prognosis. TNBC is a highly heterogeneous disease comprising distinct molecular subtypes with different clinicopathologic features, metastatic patterns, and therapeutic requirements. Six different subtypes possessing unique gene expression patterns and gene ontologies have been identified (Lehmann et al., 2012). The high expression of EGFR in basal-like TNBC and its oncogenic role in these tumors, suggest that targeting of EGFR could be an efficient therapeutic approach for basal-like TNBC patients. However, targeting of EGFR alone failed to improve survival in clinical trials. The present inventors have now identified a promising combination therapy for basal-like TNBC, which concomitantly targets EGFR and the PYK2/FAK kinases (Figures 2A-I). By using multiple basal-like TNBC cell lines they showed that combined targeting of EGFR and PYK2/FAK synergistically induces cell death in vitro (Figures 2A-I) and remarkably affects tumor growth in animal models (Figures 3A-D). Analysis of multiple signaling pathways critical for cell growth and survival suggest that co-targeting of EGFR and PYK2/FAK complementarily inhibits these key pathways and consequently induces cell death (Figures 4A-F). Most strikingly, PYK2 knockdown as well as PYK2/FAK inhibition was found to affect the steady-state levels of different RTKs, including EGFR (Figure 2A), cMet, and HER3 (Figure 4A, B). The effect on HER3 was obtained in all five basal-like cell lines that were examined (Figure 4A). Systematic analysis of HER3 levels in control and PYK2-depleted cells revealed that PYK2 depletion enhanced the proteasomal degradation of HER3 (Figure 6A) and concomitantly induced upregulation of NDRGl, a marker which has been identified as a metastasis suppressor in prostate, colon and breast cancers (Figure. 6D). It has further been proposed that NDRGl regulates the endosomal recycling and degradation of different receptors including LDL receptor and E-Cadherin and that it interacts with proteins of the vesicular trafficking machinery. As HER3 constitutively undergoes endocytosis in a clathrin-dependent manner and subsequently recycles to the plasma membrane, the present inventors hypothesized that PYK2 somehow affects HER3 recycling and inhibits its degradation. Indeed, they found that pPYK2 is localized at both early and recycling endosomes (Figure 6B), that HER3 is localized to recycling endosomes and that HER3 and pPYK2 colocalize on vesicular-like structures, most likely recycling endosomes Figure 6B). In addition, colocalization between pPYK2 and NEDD4 and between HER3 and NEDD4 was detected (Figure 7C). The present inventors further demonstrated that both PYK2 and HER3 interact with NEDD4-1 and NEDD4-2 (Figure7D,E), as well as with one another. Finally, they showed that PYK2 interferes with NEDD4-HER3 binding (Figure 7E, G). These findings not only revealed a new protein-protein interactions network but also suggest that PYK2 inhibits receptor degradation by sequestering its ubiquitin ligase NEDD4 and/or by regulating NDRGl expression (Figure 6D). The effect of NDRGl on NEDD4-HER3 binding (Figure 7D, F, H) supports this hypothesis, and strongly suggests that the PYK2-NDRG 1-NEDD4 axis plays a key role in regulating HER3 fate, thereby affecting drug response and resistance mechanism (Figure 5). The present inventors propose that this axis not only regulates HER3 trafficking and degradation, but most likely controls the degradation of other cell surface receptors and/or transporters employing similar trafficking/degradation routes. Many membrane proteins have been shown to bind or to be ubiquitinated by NEDD4-1/2 including EGFR, ErbB4, TGFpRl and various ion channels. The present finding that PYK2 interacts with NEDD4-1/2 (Figure 7E), suggests that PYK2 could regulate the fate of many membrane proteins and thus could modulate multiple properties of cancer cells, including drug resistance. Importantly, PYK2 depletion affects EGFR levels in a subset of TNBC lines (Figure 2A) and also the levels of cMet (Figure 4A,B). These two RTKs are also involved in drug resistance and can mediate bidirectional compensatory responses. This suggests that inhibition of PYK2 not only circumvents HER3-associated drug resistance, but may also overcome EGFR- or cMet-associated drug resistance in specific TNBC or response to different targeted therapies. The potency of PYK2/FAK as therapeutic targets for TNBC, in particular of PYK2, which has not been extensively investigated compared to FAK, is consistent with its high expression in TNBC (Figure 1A) and the correlation between its expression and LNM (Figure ID). Furthermore, the present results strongly suggest that inhibition of PYK2, rather than FAK, is prone to overcome drug resistance due to its remarkable effect on the steady state-levels of both RTKs and key intermediate signaling components such as S6K (Figure 4A). Drugs that efficiently inhibit both PYK2 and FAK are expected to have significant clinical benefit. In summary, the present inventors not only identified potent combination therapy for basal-like TNBC, but also introduced a new regulatory circuit that plays a major role in drug response and resistance mechanisms. Given that there is no effective treatment for TNBC, and that drug resistance is a major problem of targeted therapies, the present invention provide a new and promising therapeutic strategy for this aggressive disease. Thus, according to a first aspect of the present invention, there is provided a method of treating a drug-resistant tumor in a cancer patient in need thereof comprising administering to the patient a therapeutically effective amount of: (i) an agent which downregulates an amount and/or activity of a receptor that is expressed on the surface of the tumor; and (ii) an agent which specifically downregulates an amount and/or an activity of at least one member of the Fak family, wherein the drug of the drug-resistant tumor targets the tyrosine kinase receptor that is expressed on the surface of the tumor. Non-limiting examples of disorders to be treated herein include benign and malignant tumors; leukemias and lymphoid malignancies; neuronal, glial, astrocytal, hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoelic disorders; and inflammatory, angiogenic and immunologic disorders. The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer (NSCLC), gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial carcinoma, salivary gland. According to a specific embodiment, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, renal carcinoma, gastrointestinal/colon cancer, lung cancer, clear cell sarcoma and prostate cancer. According to specific embodiments, the cancer is an NSCLC. According to another embodiment, the cancer is triple negative breast cancer (TNBC). According to still other embodiments, the cancer is a glioblastoma. In one embodiment, the TNBC is a basal-like TNBC. A basal-like TNBCs generally expresses specific marker proteins including at least one of cytokeratins 5, 6 (CK5/6), P-cadherin, p63, and EGFR. In another embodiment, the TNBC is a BL1 or BL2 subtype. According to specific embodiments, the cancer is a tyrosine kinase inhibitor (TKI) resistant cancer. As used herein, the phrase "resistance to a tyrosine kinase inhibitor (TKI)" refers to non-responsiveness to TKI treatment as may be manifested by tumor size, in-vitro activity assays and/or patient survival. According to a specific embodiment, resistance refers to no amelioration in disease symptoms or progression according to a regulatory agency guidelines (e.g., FDA) for the specific TKI used. Resistance to treatment can be primary resistance or acquired resistance. According to specific embodiments the resistance is an acquired resistance. As used herein the term "acquired resistance" refers to progression of resistance following initial positive response to therapy. The present invention contemplates administering the same tyrosine kinase receptor inhibitor which was responsible for causing the acquired resistance. Alternatively, the present invention contemplates administering a different tyrosine kinase receptor inhibitor to the one that was responsible for causing the acquired resistance. In this case, the different tyrosine kinase receptor inhibitor preferably targets the same receptor type to the receptor type that was initially targeted by the tyrosine kinase receptor inhibitor which was responsible for causing the acquired resistance. Thus, for example if a tumor shows resistance to gefitinib, the present inventors contemplate treating with gefitinib or another inhibitor which targets EGF-R such as erlotinib. It will be appreciated that selection of a particular tyrosine kinase receptor to be targeted will depend on the type of tumor and what it expresses. Thus, for example in the case of triple negative breast cancer, the tumors thereof express EGF-R. Thus, the TKI selected for treating TNBC should target EGF-R. As used herein "inhibiting" refers to at least 10%, 20%, 30%, 50%, 60%, 70%, 80%, 90% or even complete blockade of the biological activity. In one embodiment, the receptor which is targeted (and downregulated) is a tyrosine kinase receptor, e.g. an ErbB family member. Tyrosine kinase receptors which may be inhibited according to this aspect of the invention include, but are not limited to EGF-R, cMET, Axl, human epidermal growth factor receptor 3 (Her3), human epidermal growth factor receptor 2 (Her2) and human epidermal growth factor receptor 3 (Her4). In one embodiment, the tyrosine kinase receptor which is inhibited is selected from the group consisting of EGF-R, cMET and Axl, human epidermal growth factor receptor 3 (Her3). In a particular embodiment, the tyrosine kinase receptor which is inhibited is EGF-R. As used herein "EGF-R" refers to a receptor tyrosine kinase (RTK) of the epidermal growth factor receptor family, also referred to as HER1, mENA and ErbB-1. According to a specific embodiment the EGFR is human EGFR i.e., EGFR_HUMAN, P00533. As used herein "HER2" refers to a receptor tyrosine kinase (RTK) of the epidermal growth factor receptor family, also referred to as ErbB-2, NEU and pl85erbB- 2. According to a specific embodiment the HER2 is human HER2 i.e., ERBB2_HUMAN, P04626. As used herein, the term "HER4" refers to a receptor tyrosine kinase (RTK) of the epidermal growth factor receptor family, also referred to as ErbB-4. According to a specific embodiment the HER4 is human HER4 i.e., ERBB4_HUMAN, Q15303. As used herein "HER3" refers to a receptor tyrosine kinase (RTK) of the epidermal growth factor receptor family, also referred to as ErbB-3. According to a specific embodiment the HER3 is human HER3 i.e., ERBB3_HUMAN, P21860. As used herein "c-MET" refers to a receptor tyrosine kinase (RTK), also referred to as hepatocyte growth factor receptor (HGFR). According to a specific embodiment the c-MET is human c-MET i.e., c-MET_HUMAN, P08581. As used herein "Axl" refers to a receptor tyrosine kinase (RTK), also referred to as AXL Receptor Tyrosine Kinase. According to a specific embodiment the Axl is human Axl i.e., Axl HUMAN, P30530. In one embodiment, the agent which targets the receptor tyrosine kinase is a small molecule "tyrosine kinase inhibitor (TKIs)". Typically, TKIs contemplated herein may be categorized to four groups: (1) ATP-competitive inhibitors, which bind predominantly to the ATP-binding site of the kinase when this site is in the active conformation; (2) inhibitors that recognize and bind to the non-active conformation of the ATP-binding site of the kinase, thus making activation energetically unfavorable; (3) allosteric inhibitors, that bind outside of the ATP-binding site, modifying the tridimensional structure of the receptor and disrupting the interaction between the ATP and the kinase pocket; and (4) covalent inhibitors, that bind irreversibly by covalently bonding to the ATP-binding site of the target kinase. The TKI can be specific to a specific ErbB family member or can inhibit multiple ErbB family members. The TKI can recognize wild type ErbB family member and/or a mutated ErbB family member. Non limiting examples of TKI include erlotinib HCL (OSI-774; Tarceva®; OSI

Pharma), caretinib (CI- 033 } gefitinib (Iressa®, AstraZeneca and Teva), lapatinib (Tykerb®, GlaxoSmithKline), canertinib (CI- 1033, PD183805; Pfizer), PKI-166 (Novartis); PD158780; pelitinib; and AG 1478 (4-(3-Chloroanillino)-6,7- dimethoxyquinazoline), vandetanib (Zactima, ZD6474), imatinib mesylate (STI571; Gleevec), semaxinib (SU5416), vatalanib (PTK787/ZK222584), sorafenib (BAY 43- 9006), sutent (SU11248), leflunomide (SU101), perlitinib (EKB-569), neratinib (HKI- 272), afatinib, dacomitinib, AZD9291, rociletinib (CO-1686), HM61713 and WZ4002. According to a specific embodiment, the TKI is pan-ErbB inhibitor, i.e., inhibiting more than one receptor in the family, such as lapatinib. According to specific embodiments, the TKI is an irreversible TKI. Non- limiting examples of irreversible TKIs include perlitinib (EKB-569), neratinib (HKI- 272), canertinib (CI-1033), vandetanib (ZD6474), afatinib and dacomitinib. According to specific embodiments, the TKI is selected from the group consisting of perlitinib (EKB-569), neratinib (HKI-272), canertinib (CI-1033), vandetanib (ZD6474), afatinib, dacomitinib, AZD9291, rociletinib (CO-1686), HM61713 and WZ4002. According to other embodiments, the small molecule TKI is one which targets EGF-R - e.g. gefitinib or erlotinib. According to other embodiments, the small molecule TKI is one which targets c- MET. The c-MET inhibitor may be a class I (SU-11274-like) or class II (AM7-like) inhibitor. Alternatively, the c-MET inhibitor may be a non-competitive ATP inhibitor. The cMET inhibitor may be specific to c-MET or may have a broad selectivity. The c- MET inhibitors may either be ATP competitive or non-competitive. Exemplary class I inhibitors include JNJ-38877605 or PF-04217903. Exemplary class II inhibitors include GSK 1363089 (XL880, foretinib) and AMG 458. Tivantinib is an example of a non-competitive ATP inhibitor. Cabozantinib (XL184) is another example of a c-MET inhibitor. According to other embodiments, the small molecule TKI is one which targets Axl.

Examples of AXL inhibitors under development are provided in Table 1, herein below. Table 1 Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

breast cancer.

Treating HCC cells AXL, with Src Bosutinib SKI-606 Kinase, NCTOO195260 Phase 1 Pfizer decreased the (Bosutinib) Abl, NCT003 19254 Phase 2 AXL specific TGFB, invasiveness BMP of HCC cell lines.

AXL, Phase 1 NCT00697632 Phase 2 MGCD 265 MET, and 2 Mirati Inc. NCT00975767 NSCLC VEGFR Phase 1

MET, AXL, RET, TRK, Phase 1 MGCD516 DDR2, Preclinical Mirati Inc. planned KDR, PDGFR A, or KIT

AXL, Phase 1 Astellas A novel ASP2215 NCT02014558 FLT3/AXL Flt3 and 2 Pharma. inhibitor: Preclinical Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

evaluation in acute myeloid leukemia

Medullary AXL, c- Thyroid MET, cancer, Brain VEGFR cancer, -2, c- NSCLC and XL184 Phase 2 KIT, Fit NCT01639508 Exelixis randomizatio (Cabozantinib) and 3 1/3/4, n Tie2 discontinuati and on trial in RET various solid tumors

Selective small Asian molecule AXL, Pharma. and BMS-777607 kinase Mer and NCT01721148 Phase 1 Inventive (ASLAN 002) inhibitor MET Health against AXL, Clinical Mer, and Met.

AXL, Restores GSK1363089/X cMET, GlaxoSmithK lapatinib NCT02034097 Phase 2 L880 (Foretinib) VEGFR line sensitivity in 2 lapatinib- resistant breast cancer Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

cells with AXL over expression.

Decreased malignant properties in inflammatory breast cancer. Combination of SGI-7079 with erlotinib reversed SGI-7079 AXL NCT00409968 Phase 2 Astex Pharma erlotinib resistance in mesenchymal cell lines, xenograft model of mesenchymal NSCLC and patients.

Preclinical AXL, ISRCTN00759 activity in S49076 MET, Phase 1 Servier 419 colon EGFR carcinoma.

European Resensitized R428 (BGB324) AXL Phase la BerGen BIO Clinical trial HN5-ER cells to erlotinib in Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

head and neck cancer, reduced migration and invasion in melanomas, induced CLL B-cell apoptosis, reduced invasion and migration in EAC cell lines, reduced metastatic burden and extended survival in metastatic breast cancer.

Inhibited cell migration and Deciphera DP3975 AXL Preclinical proliferation Biotech in mesotheliom as.

AXL, NPS-1034 Preclinical NeoPharma Newly MET developed drug that Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

targets both MET and AXL in NSCLC cells with acquired resistance to gefitinib or erlotinib.

Induces NK cells to kill tumor cells in AXL, mouse LDC1267 Tyro, Preclinical metastatic Mer breast cancer and melanoma model

Inhibits AXL phosphorylati on, cell NA80xl AXL Preclinical motility, and invasion in MDA-MB- 435 cells.

Receptor Monoclonal Antibody Functions in a disease Clinical Phase of indication Known Compound Trials.gov Developm Sponsor and other Targets identifier ent preclinical research details

Anti-AXL YW327.6S2 AXL Preclinical monoclonal antibody.

Nucleotide Aptamer

Binds to the extracellular domain of AXL to GL21.T AXL Preclinical inhibit its catalytic activity in lung cancer.

As mentioned, the agents of this aspect of the present invention (e.g. receptor TKI inhibitor or FAK family inhibitor) of this aspect of the present invention may also be an antibody. The term "antibody" as used herein includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, and Fv that are capable of binding to macrophages. These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab')2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (5) Single chain antibody ("SCA"), a genetically engineered molecule containing the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. As used herein, the terms "complementarity-determining region" or "CDR" are used interchangeably to refer to the antigen binding regions found within the variable region of the heavy and light chain polypeptides. Generally, antibodies comprise three CDRs in each of the VH (CDR HI or HI; CDR H2 or H2; and CDR H3 or H3) and three in each of the VL (CDR LI or LI; CDR L2 or L2; and CDR L3 or L3). The identity of the amino acid residues in a particular antibody that make up a variable region or a CDR can be determined using methods well known in the art and include methods such as sequence variability as defined by Kabat et al. (See, e.g., Kabat et al., 1992, Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, NIH, Washington D.C.), location of the structural loop regions as defined by Chothia et al. (see, e.g., Chothia et al., Nature 342:877-883, 1989.), a compromise between Kabat and Chothia using Oxford Molecular's AbM antibody modeling software (now Accelrys®, see, Martin et al., 1989, Proc. Natl Acad Sci USA. 86:9268; and world wide web site www.bioinf-org.uk/abs), available complex crystal structures as defined by the contact definition (see MacCallum et al., J. Mol. Biol. 262:732-745, 1996) and the "conformational definition" (see, e.g., Makabe et al., Journal of Biological Chemistry, 283:1156-1166, 2008). As used herein, the "variable regions" and "CDRs" may refer to variable regions and CDRs defined by any approach known in the art, including combinations of approaches. According to a specific embodiment, the "variable regions" and "CDRs" refer to variable regions and CDRs defined by the IMGT approach. Methods of producing polyclonal and monoclonal antibodies as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference). According to specific embodiments the antibody is a recombinant antibody. As used herein, the term "recombinant antibody" refers an antibody produced by recombinant DNA techniques, i.e., produced from cells transformed by an exogenous DNA construct encoding the antibody. According to specific embodiments the antibody is a monoclonal antibody. In cases where target antigens are too small to elicit an adequate immunogenic response when generating antibodies in vivo, such antigens (referred to as "haptens") can be coupled to antigenically neutral carriers such as keyhole limpet hemocyanin (KLH) or serum albumin (e.g., bovine serum albumin (BSA)) carriers (see, for example, US. Pat. Nos. 5,189,178 and 5,239,078). Coupling a hapten to a carrier can be effected using methods well known in the art. For example, direct coupling to amino groups can be effected and optionally followed by reduction of the imino linkage formed. Alternatively, the carrier can be coupled using condensing agents such as dicyclohexyl carbodiimide or other carbodiimide dehydrating agents. Linker compounds can also be used to effect the coupling; both homobifunctional and heterobifunctional linkers are available from Pierce Chemical Company, Rockford, Illinois, USA. The resulting immunogenic complex can then be injected into suitable mammalian subjects such as mice, rabbits, and others. Suitable protocols involve repeated injection of the immunogen in the presence of adjuvants according to a schedule designed to boost production of antibodies in the serum. The titers of the immune serum can readily be measured using immunoassay procedures which are well known in the art. The antisera obtained can be used directly or monoclonal antibodies may be obtained, as described hereinabove. Antibody fragments according to some embodiments of the invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment. Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. For example, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab')2. This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments. Alternatively, an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647, and references contained therein, which patents are hereby incorporated by reference in their entirety. See also Porter, R. R. [Biochem. J. 73: 119-126 (1959)]. Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody. Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nat'l Acad. Sci. USA 69:2659-62 (19720]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker. These single-chain antigen binding proteins (sFv) are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by an oligonucleotide. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing sFvs are described, for example, by [Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety. Another form of an antibody fragment is a peptide coding for a single complementarity-determining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)]. Thus, antibodies of the present invention are preferably at least bivalent (e.g., of the IgG subtype) or more (e.g., of the IgM subtype). It will be appreciated that monovalent antibodies may be used however measures should be taken to assemble these to larger complexes such as by using secondary antibodies (or using other cross- linkers which are well known in the art). According to specific embodiments the antibodies are from IgGl subtype. According to specific embodiments antibody is a humanized or partially humanized antibody. Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)]. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co- workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323- 327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(l):86-95 (1991)]. Similarly, human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio/Technology 10,: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995). The antibodies can be mono-specific (i.e., binding a distinct antigen) or multi- specific (i.e. binding at least two different epitopes, e.g., bi-specific or tri-specific). According to specific embodiments, the antibody is a mono-specific antibody. According to specific embodiments, the antibody is bi-specific antibody. According to specific embodiments, the antibody is a tri-specific antibody. According to other specific embodiments, the antibody is a multi-specific antibody. Cetuximab and panitumumab are examples of monoclonal antibody inhibitors which target EGF-R. Other monoclonals in clinical development are zalutumumab, nimotuzumab, and matuzumab which target EGF-R. MetMAb is a monovalent monoclonal antibody directed against c-MET, which prevents HGF from binding to the c-MET receptor. Down-regulation of tyrosine kinase receptors and/or FAK family members at the nucleic acid level may be effected using a nucleic acid agent, having a nucleic acid backbone, DNA, RNA, mimetics thereof or a combination of same. The nucleic acid agent may be encoded from a DNA molecule or provided to the cell per se. Thus, downregulation of tyrosine kinase receptors and/or FAK family members can be achieved by RNA silencing. As used herein, the phrase "RNA silencing" refers to a group of regulatory mechanisms [e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co- suppression, and translational repression] mediated by RNA molecules which result in the inhibition or "silencing" of the expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi. As used herein, the term "RNA silencing agent" refers to an RNA which is capable of specifically inhibiting or "silencing" the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and/or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs. In one embodiment, the RNA silencing agent is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression. According to an embodiment of the invention, the RNA silencing agent is specific to the target RNA (e.g., tyrosine kinase receptor and/or FAK family member) and does not cross inhibit or silence other targets or a splice variant which exhibits 99% or less global homology to the target gene, e.g., less than 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology to the target gene; as determined by PCR, Western blot, Immunohistochemistry and/or flow cytometry. RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs). Other exemplary polynucleotide agents contemplated by the present invention include miRNAs, antisense RNAs and agents which introduce nucleic acid alterations to a gene of interest (using CRISPR system). As mentioned, the method of the present invention contemplates administration of an agent which downregulates expression and/or an activity (e.g. kinase activity) of at least one member of the Fak family together with the administration of the TKI (i.e. combination therapy). Exemplary members of the Fak family include Focal adhesion kinase (Fak; Uniprot Q05397) and CAKp/Pyk2/RAFTK (Uniprot Q14289). Exemplary inhibitors of Fak family are small molecule agents or polynucleotide agents that target the protein (e.g. siRNA agents). In one embodiment, the FAK family inhibitor is selected from the group of a dominant negative mutant S1034-FRNK; a metabolite FTY720 from Isaria sinclarii, and FAK antisense oligonucleotide ISIS 15421. In another embodiment, the FAK family inhibitor is PF-573,228 (PF-228), PF- 562,271 (PF-271), NVP-226, Y15 (1,2,4,5-benzenetetraamine tetrahydrochloride), PND- 1186, VS-6063, VS-4718 or GSK2256098. It will be appreciated that the Fak family inhibitor specifically inhibits its target. As used herein, the term "specifically inhibits" refers to a selective inhibition of a Fak family member over at least one kinase. The Fak family inhibitor should preferably selectively inhibits its target over other kinases such as insulin-like growth factor I receptor (IGF-IR) or insulin receptor (INSR or IR). In other embodiments the Fak family inhibitor is more selective towards fak family members than other kinases such as LRRK2, ALK, FER, FES/FPS, IRR/INSRR, INSR, STK22D/TSSK1, FLT3, IGF1R, EGFR, ERBB4/HER2, JAK3 and ERBB2/HER2. In one embodiment, the Fak family inhibitor downregulates the activity of the member of the Fak family at least two fold more than it downregulates the activity of IGF-1R. In one embodiment, the Fak family inhibitor downregulates the activity of the member of the Fak family at least two fold more than it downregulates the activity of INSR. In still another embodiment, the Fak family inhibitor binds to the member of the Fak family at least two fold hgher than it binds to IGF-1R. In one embodiment, the Fak family inhibitor binds to the Fak family at least two fold higher than it binds to INSR. In one embodiment, the Fak family inhibitor downregulates the activity of the member of the Fak family at least five fold more than it downregulates the activity of IGF-1R. In one embodiment, the Fak family inhibitor downregulates the activity of the member of the Fak family at least five fold more than it downregulates the activity of INSR. In one embodiment, the Fak family inhibitor downregulates the activity of the member of the Fak family at least 10 fold more than it downregulates the activity of the IGF-1R. In one embodiment, the Fak family inhibitor downregulates the activity of member of the Fak family at least 10 fold more than it downregulates the activity of INSR. The Fak family inhibitor may be selective towards Pyk2 (at least 2 times higher affinity towards Pk2 over FAK), selective towards FAK (at least 2 times higher affinity towards FAK over Pyk2 - e.g. PF573228; PF228) or a dual PYK2/FAK inhibitor (PF431396 (PF396)). In the context of a combination therapy, combination therapy compounds may be administered by the same route of administration (e.g. intrapulmonary, oral, enteral, etc.) that the described compounds are administered. In the alternative, the compounds for use in combination therapy with the herein described compounds may be administered by a different route of administration. The FAK family inhibitor can be administered immediately prior to (or after) the TK receptor inhibitor, on the same day as, one day before (or after), one week before (or after), one month before (or after), or two months before (or after) the TK receptor inhibitor, and the like. The FAK family inhibitor and the TK receptor inhibitor can be administered concomitantly, that is, where the administering for each of these reagents can occur at time intervals that partially or fully overlap each other. The FAK family inhibitor and the TK receptor inhibitor can be administered during time intervals that do not overlap each other. For example, the FAK family inhibitor can be administered within the time frame of t=0 to 1 hours, while the TK receptor inhibitor can be administered within the time frame of t=l to 2 hours. Also, the FAK family inhibitor can be administered within the time frame of t=0 to 1 hours, while the TK receptor inhibitor can be administered somewhere within the time frame of t=2-3 hours, t=3-4 hours, t=4-5 hours, t=5-6 hours, t=6-7 hours, t=7-8 hours, t=8-9 hours, t=9-10 hours, and the like. Moreover, the TK receptor inhibitor can be administered somewhere in the time frame of t=minus 2-3 hours, t=minus 3-4 hours, t=minus 4-5 hours, t=5-6 minus hours, t=minus 6-7 hours, t=minus 7-8 hours, t=minus 8-9 hours, t=minus 9-10 hours. The TK receptor inhibitors of the present invention and the FAK family inhibitor are typically provided in combined amounts to achieve therapeutic, prophylactic and/or pain palliative effectiveness. This amount will evidently depend upon the particular compound selected for use, the nature and number of the other treatment modality, the condition(s) to be treated, prevented and/or palliated, the species, age, sex, weight, health and prognosis of the subject, the mode of administration, effectiveness of targeting, residence time, mode of clearance, type and severity of side effects of the pharmaceutical composition and upon many other factors which will be evident to those of skill in the art. The TKI will be used at a level at which therapeutic, prophylactic and/or pain palliating effectiveness in combination with the FAK family inhibitor will be observed. The TKI may be administered at a gold standard dosing as a single agent, below a gold standard dosing as a single agent or above a gold standard dosing as a single agent. According to specific embodiments, the TKI is administered below gold standard dosing as a single agent. As used herein the term "gold standard dosing" refers to the dosing which is recommended by a regulatory agency (e.g., FDA), for a given tumor at a given stage. According to other specific embodiments the TKI is administered at a dose that does not exert at least one side effect which is associated with the gold standard dosing. Non-limiting examples of side effects of a TKI treatment include skin rash, diarrhea, mouth sores, paronychia, fatigue, hyperglycemia, hepatotoxicity, kidney failure, cardiovascular effects, electrolytes anomalies and GI perforations. Thus, in one preferred embodiment, the amount of the TKI is below the minimum dose required for therapeutic, prophylactic and/or pain palliative effectiveness when used as a single therapy (e.g. 10-99%, preferably 25 to 75% of that minimum dose). This allows for reduction of the side effects caused by the TKI but the therapy is rendered effective because in combination with the FAK family inhibitor, the combinations are effective overall. In a further preferred embodiment the, or each of the FAK family inhibitor is used at a level below the minimum normal therapeutic dose, for example 10-99% of the normal minimum therapeutic dose, preferably 25 to 75% of their normal therapeutic dose. This again serves to reduce the danger of side effects and allows a higher level of total effectiveness without exposing the subject to unacceptable side effects. As well as lowering the dose of the TKI, the present inventors contemplate that the amount of time over which the TKI is administered may be reduced and/or the frequency of dosing may also be reduced. Exemplary doses are provided herein below. It will be appreciated that the dose of the agent may change according to the disease being treated, the age of the patient and the severity of the disease. Exemplary adult doses (e.g. oral doses) of erlotinib contemplated by the present invention include 20-140 mg daily, 20-120 mg daily, 20-100 mg daily, 20-80 mg daily. Preferably, the dose of erlotinib does not exceed more than 150 mg daily, 140 mg daily, 130 mg daily, 120 mg daily, 110, mg daily, 100 mg daily, 90 mg daily, 80 mg daily, 70 mg daily, 60 mg daily or even 50 mg daily. Exemplary adult doses (e.g. oral doses) of gefitinib contemplated by the present invention include 20-240 mg daily, 20-220 mg daily, 20-200 mg daily, 20-180 mg daily or 20-150 mg daily. Preferably, the dose of gefinitib does not exceed more than 250 mg daily, 240 mg daily, 230 mg daily, 220 mg daily, 210 mg daily, 200 mg daily, 190 mg daily, 180 mg daily, 170 mg daily, 160 mg daily or even 150 mg daily. Exemplary adult doses of lapatinib contemplated by the present invention include 50-1500 mg daily, 50-1400 mg daily, 50-1300 mg daily, 50-1200 mg daily, 50- 1100 mg daily, 50-1000 mg daily, 50-900 mg daily, 50-800 mg daily, 50-700 mg daily, 50-600 mg daily, 50-500 mg daily. Preferably, the dose of lapatinib does not exceed more than 1500 mg daily, 1400 mg daily, 1300 mg daily, 1200 mg daily, 1110 mg daily, 1000 mg daily, 900 mg daily, 800 mg daily, 700 mg daily, 600 mg daily or even 500 mg daily. Exemplary adult doses of canertinib contemplated by the present invention include 5-50 mg daily, 5-40 mg daily, 5-30 mg daily, 5-20 mg daily, 5-10 mg daily. Preferably, the dose of canertinib does not exceed more than 50 mg daily, 40 mg daily, 30 mg daily, 20 mg daily or even 10 mg daily. Exemplary adult doses of imatinib mesylate contemplated by the present invention include less than 800 mg per day, less than 700 mg day, less than 600 mg day, less than 500 mg per day, less than 400 mg day or even less than 200 mg per day. Preferably, the dose of imatinib mesylate does not exceed more than 70 mg daily, 600 mg daily, 500 mg daily, 400 mg daily or even 300 mg daily. Exemplary adult doses of vatalanib contemplated by the present invention include 50-1500 mg daily, 50-1400 mg daily, 50-1300 mg daily, 50-1200 mg daily, 50- 1100 mg daily, 50-1000 mg daily, 50-900 mg daily, 50-800 mg daily, 50-700 mg daily, 50-600 mg daily, 50-500 mg daily. Preferably, the dose of vatalanib does not exceed more than 1500 mg daily, 1400 mg daily, 1300 mg daily, 1200 mg daily, 1110 mg daily, 1000 mg daily, 900 mg daily, 800 mg daily, 700 mg daily, 600 mg daily or even 500 mg daily. Exemplary adult doses of sorafenib contemplated by the present invention include 800 mg per day, less than 700 mg day, less than 600 mg day, less than 500 mg per day, less than 400 mg day or even less than 200 mg per day. Preferably, the dose of sorafenib does not exceed more than 70 mg daily, 600 mg daily, 500 mg daily, 400 mg daily or even 300 mg daily. Exemplary adult doses of sutent contemplated by the present invention include 5-50 mg daily, 5-40 mg daily, 5-30 mg daily, 5-20 mg daily, 5-10 mg daily. Preferably, the dose of sutent does not exceed more than 50 mg daily, 40 mg daily, 30 mg daily, 20 mg daily or even 10 mg daily. Exemplary adult doses of leflunomide contemplated by the present invention include 20-140 mg daily, 20-120 mg daily, 20-100 mg daily, 20-80 mg daily. Preferably, the dose of leflunomide does not exceed more than 150 mg daily, 140 mg daily, 130 mg daily, 120 mg daily, 110, mg daily, 100 mg daily, 90 mg daily, 80 mg daily, 70 mg daily, 60 mg daily or even 50 mg daily. Exemplary adult doses of perlitinib contemplated by the present invention include 20-140 mg daily, 20-120 mg daily, 20-100 mg daily, 20-80 mg daily. Preferably, the dose of perlitinib does not exceed more than 150 mg daily, 140 mg daily, 130 mg daily, 120 mg daily, 110, mg daily, 100 mg daily, 90 mg daily, 80 mg daily, 70 mg daily, 60 mg daily or even 50 mg daily. Exemplary adult doses of neratinib contemplated by the present invention include 20-240 mg daily, 20-220 mg daily, 20-200 mg daily, 20-180 mg daily or 20-150 mg daily. Preferably, the dose of neratinib does not exceed more than 250 mg daily, 240 mg daily, 230 mg daily, 220 mg daily, 210 mg daily, 200 mg daily, 190 mg daily, 180 mg daily, 170 mg daily, 160 mg daily or even 150 mg daily. Cetuximab is typically administered at a loading initial dose of about 400 mg/m2 rV infused over 2 hr and then maintained at a dose of about 250 mg/m2 IV infusion over 60 min. The present invention contemplates lowering this dose by 10 , 20 , 30 , 40 % or even 50 . Alternatively, or additionally, the cetuximab may be administered at the dose specified above, but for fewer days, or less frequently. Panitumumab is typically administred at a dose of 6 g g IV over 60 minutes every 14 days. The present invention contemplates lowering this dose by 10 , 20 , 30 , 40 % or even 50 . Alternatively, or additionally, the panitumumab may be administered at the dose specified above, but for fewer days, or less frequently. In one preferred aspect of the present invention, the TKI and the FAK family inhibitor are synergistic with respect to their dosages. That is to say that the effect provided by the compound of the present invention is greater than would be anticipated from the additive effects of the TKI and the FAK family inhibitor when used separately. In an alternative but equally preferred embodiment, the TKI of the present invention and the FAK family inhibitor are synergistic with respect to their side effects. That is to say that the side-effects caused by the FAK family inhibitor in combination with the TKI are less than would be anticipated when the equivalent therapeutic effect is provided by either the TKI or by the FAK family inhibitor when used separately. According to another aspect of the present invention there is provided a method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or activity of: (i) epidermal growth factor receptor (EGFR), wherein the amount of the agent which targets EGFR is below the minimum dose required for therapeutic effectiveness when used as a single therapy; and (ii) at least one member of the Fak family. Examples of EGFR inhibitors are provided herein above. Exemplary doses of agents that target EGFR are provided herein above. In one embodiment, an agent which downregulates at least one member of the Fak family is only provided when the expression level of EGFR on the tumor is above a predetermined amount. Thus, according to still another aspect of the present invention there is provided a method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising analyzing the amount of EGF-R expression in a tumor of the subject, and when the amount is above a predetermined level administering to the subject a therapeutically effective amount of: (i) an agent which downregulates an amount and/or activity of PYK2; and/or (ii) an agent which downregulates an amount and/or activity of FAK. Agent which downregulates an amount and/or activity of PYK2 and/or FAK are described herein aboe. In one embodiment, selection of the FAK inhibitor is made on the basis of the amount of EGFR expression on the tumor. Thus, prior to treatment the present inventors contemplated analyzing a level of EGFR on a tumor sample of the subject (e.g. a biopsy). Methods of analyzing the level of EGF-R on the tumor may be effected on the protein level or RNA level. The analyzing may be effected on cell extracts (e.g. protein extracts or polynucleotide extracts) or in situ. Determining expression of EGF-R on the protein level is typically effected using an antibody capable of specifically interacting with same. Methods of detecting the above described proteins include immunoassays which include but are not limited to competitive and non-competitive assay systems using techniques such as Western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, and immunoprecipitation assays and immunohistochemical assays. In order to detect expression of EGFR on the RNA level, typically polynucleotide probes (e.g. oligonucleotides or primers) are used that are capable of specifically hybridizing to RNA encoding EGFR or cDNA generated therefrom. Preferably, the oligonucleotide probes and primers utilized by the various hybridization techniques described hereinabove are capable of hybridizing to their targets under stringent hybridization conditions. When the amount of EGFR is above a predetermined level (i.e. very high levels, e.g. due to gene amplification 3-4 fold higher than average levels in healthy subject) the present inventors contemplate administering an agent which downregulates an amount and/or activity of EGFR together with an agent which downregulates an amount and/or activity of PYK2; or an agent which downregulates an amount and/or activity of FAK. When the amount of EGFR is below that predetermined level (i.e. less high levels, e.g. due to gene amplification 1.5-2.5 fold higher than average levels in healthy subject), the present inventors contemplate administering an agent which downregulates an amount and/or activity of EGFR together with an agent or agents which downregulates an amount and/or activity of both PYK2 and FAK. The agents of the present invention may be formulated each in a different formulation, two in one formulation and the other one in a separate formulation, or all in the same formulation (co-formulation). Thus, according to yet another aspect of the present invention there is provided an article of manufacture comprising an agent which downregulates an amount and/or activity of a tyrosine kinase receptor (e.g. epidermal growth factor receptor (EGFR)); and (i) an agent which downregulates an amount and/or activity of PYK2; and/or (ii) an agent which downregulates an amount and/or activity of FAK. According to another aspect of the present invention there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an agent which downregulates an amount and/or activity of a tyrosine kinase receptor (e.g. epidermal growth factor receptor (EGFR)); and (i) an agent which downregulates an amount and/or activity of PYK2; and/or (ii) an agent which downregulates an amount and/or activity of FAK. As used herein, a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism. As used herein, the term "active ingredient" refers to the agent accountable for the intended biological effect (e.g., TKI, or FAK family inhibitor). Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier", which may be used interchangeably, refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases. Herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols. Techniques for formulation and administration of drugs may be found in the latest edition of "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, which is herein fully incorporated by reference. Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal, or parenteral delivery, including intramuscular, subcutaneous, and intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injections. Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries as desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, and sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate, may be added. Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses. Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration. For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane, or carbon dioxide. In the case of a pressurized aerosol, the dosage may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base, such as lactose or starch. The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with, optionally, an added preservative. The compositions may be suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents. Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water-based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides, or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the active ingredients, to allow for the preparation of highly concentrated solutions. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., a sterile, pyrogen-free, water-based solution, before use. The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, for example, conventional suppository bases such as cocoa butter or other glycerides. Pharmaceutical compositions suitable for use in the context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a "therapeutically effective amount" means an amount of active ingredients (e.g., a nucleic acid construct) effective to prevent, alleviate, or ameliorate symptoms of a disorder (e.g., ischemia) or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. For any preparation used in the methods of the invention, the dosage or the therapeutically effective amount can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans. Since administration of the disclosed combination is expected to produce improved results over the administration of single agents, the therapeutically effective dose of each of the agents in the combined treatment may be for example less than 50 , 40 , 30 , 20 % or even less than 10 % the of the FDA approved dose. For example, therapeutically effective dose of the TKI in the combined treatment may be for example less than 50 , 40 , 30 , 20 % or even less than 10 % the of the FDA approved dose. Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration, and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g.,

Fingl, E. et al. (1975), "The Pharmacological Basis of Therapeutics," Ch. 1, p.l.) Dosage amount and administration intervals may be adjusted individually to provide sufficient plasma or brain levels of the active ingredient to induce or suppress the biological effect (i.e., minimally effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations. Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations (e.g., weekly or bi-weekly administrations) with course of treatment lasting from several days to several weeks, or until cure is effected or diminution of the disease state is achieved. The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. Typically used models for analyzing the effect of the agents described herein on tumors are provided infra. Suitable cells for use in animal models and in vitro analyses include but are not limited to: Lung cancer: LKR - 13, LKR - 10, NSCLC, H1437, H1299, H3255, H1819, H4006, HCC827, HCC2279; An animal lung tumor model expressing a T790M mutated EGFR is described e.g. in Regales et al. PLoS ONE (2007) 2:e810 and Politi et al. Genes Dev. (2006) 20:1496-1510. Suitable cells for use in animal models and in vitro analyses include but are not limited to H1975, PC9ER, H820, HCC827 and H1650. Breast: BT-474; MDA-MB-468, MDA-MB-231, BT20, BT549, HCC1937, HCC1143, SUM159PT, Hs578T Head and Neck cancer: HN5, PCi 15B, PCI 37°, 4PCISSC 103; Ovarian cancer: OvCar3, SKOV, TOV112; Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA-approved kit, which may contain one or more unit dosage forms containing the active ingredient. According to a specific embodiment, there is provided a kit comprising the isolated polypeptide (e.g., having the CDRs of NG33 and optionally other antibodies as described herein) and optionally a pharmaceutical agent, as described herein. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser device may also be accompanied by a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions for human or veterinary administration. Such notice, for example, may include labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a pharmaceutically acceptable carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as further detailed above. According to specific embodiments, the article of manufacture or kit further comprises antibodies to other HER members e.g. EGFR, HER2. According to specific embodiments the article of manufacture or kit further comprises TKI. In the case of separate formulations, the TKI of the present invention may be packaged in a separate container to the FAK family inhibitor. As used herein, the term "separate containers" refers to at least two containers. The packaging material may comprise at least one, at least two or at least three containers for packaging the agents The combination therapy of the present invention can be administered along with analgesics, chemotherapeutic agents (e.g., anthracyclins), radiotherapeutic agents, hormonal therapy and other treatment regimens (e.g., surgery) which are well known in the art. Exemplary combinations contemplated by the present invention include: Gefitinib and PF228; Gefitinib and PF396; Erlotinib and PF228; Erlotinib and PF396; Erlotinib with PF-562271 (VS-6062) Gefitinib and PF-562271 (VS-6062) Erlotinib and VS-6063 Gefitinib and VS-6063 Erlotinib and TAE226 (NVP-226) Gefitinib and TAE226 (NVP-226) According to still another aspect of the present invention there is provided a method of predicting prognosis of TNBC in a subject, the method comprising determining a level and/or activity of a tyrosine kinase receptor (e.g. EGF-R) that is expressed in tumor cells of the subject and at least one member of the FAK family in a sample derived from the breast of the subject, wherein an amount of the receptor and the member of the FAK family above a predetermined level is indicative of poor prognosis of TNBC. According to still another aspect of the present invention there is provided a kit for determining prognosis of TNBC in a subject comprising (i) an agent which specifically binds to a tyrosine kinase receptor (e.g. EGFR); and (ii) an agent which specifically binds to at least one member of the FAK family. Determining an expression of a tyrosine kinase receptor (e.g. EGF-R) that is expressed in tumor cells of the subject FAK family members may be effected on the RNA or protein level as detailed above. Thus, the use of antibodies (e.g. monoclonal or polyclonal antibodies) that target the particular proteins is contemplated. The antibodies may comprise a detectable label selected from the group consisting of a radioactive label, a fluorescent label, a chemiluminescent label and an enzyme (e.g. horseradish peroxidase or alkaline phosphatase). Alternatively, the kit may comprise a secondary antibody which comprises a detectable label. For diagnosis (e.g. determining prognosis), the cell sample may comprise cells of the primary tumor and/or metastatic effusion thereof. The predetermined level may be established based on results from control (non- diseased) cells. The control cell sample typically depends on the patient sample being analyzed. Thus, for example, in the case of TNBC, the control sample may comprise breast cells of a healthy individual (or at least one not suffering from breast cancer) or from a known stage of breast cancer (e.g. non-metastatic stage). The control cells are typically normally differentiated, non-senescent cells, preferably of the same tissue and specimen as the tested cells. Typically, the amount of change in expression of the polypeptides is statistically significant. Preferably, the difference is at least 10 , 20 , 30 , 40 , 50 , 80 , 100 % (i.e., two-fold), 3 fold, 5 fold or 10 fold different as compared to the control cells. It will be appreciated that the control data may also be taken from databases and literature. On obtaining the results of the analysis, the subject is typically informed. Additional diagnostic tests may also be performed so as to corroborate the results of the prognosis (e.g. gold standard tests, assessing the aggressiveness of the tumor, the patient's health and susceptibility to treatment, etc.). Imaging studies such as CT and/or MRI may be obtained to further diagnose the disease. In addition, when the disease is cancer, the choice of therapy may be determined by further assessing the size of the tumor, or the lymph node stage or both, optionally together or in combination with other risk factors. The present inventors propose that based on the results of the prognosis, a suitable therapy may be selected. It is expected that during the life of a patent maturing from this application many relevant PKIs will be developed and the scope of the term PKI is intended to include all such new technologies a priori. As used herein the term "about" refers to ± 10 % The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". The term "consisting of means "including and limited to". The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts. As used herein, the term "treating" includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements. Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference. MATERIALS AND METHODS Antibodies, Reagents and Chemicals: The following antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA): rabbit polyclonal antibodies against pPYK2 (Y402, sc-101790, 1:1,000 WB, 1:250 IF), STAT3 (C-20, 1:1,000 WB), FAK (sc-558, 1:1,000 WB), ERK1/2 (sc-93, 1:1,000 WB), pERKl/2 (pT202/ pY204.22A, sc- 136521, 1:500 WB), AKT (sc-8312, 1:1,000 WB), HER3 (sc-285, 1:500 WB, 1:100 IF), pHER3 (Y1328, sc-135654, 1:500 WB), NEDD4-1 (sc-25508, 1:1,000 WB, 1:100 IF), cMet (sc-10, 1:1000 WB) and caspase 9 (sc-8355, 1:1,000 WB), as well as mouse monoclonal antibodies against HER3 (sc-415, 1:100 IF), NDRG1 (sc-100786, 1:75 IF), anti-hemagglutinin (HA, sc-57592, 1:500 WB) and anti-myc (sc-40, 1:500 WB). Protein A/G PLUS-Agarose beads (sc-2003) were also purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit polyclonal antibody against PYK2 (P3902, 1:50) used in IHC, mouse monoclonal antibodies against a-Tubulin (T6074, 1:10,000 WB) and pPYK2 (1:500 WB, 1:300 IF) were purchased from Sigma-Aldrich Israel (Rehovot Israel). Antibodies against pAKT (T308, #2965 and S473, #9271, 1:1,000 WB), pSTAT3 (Y705, #9145, 1:1,000 WB), pc-Met (Y1234/5, #3077, 1:1,000 WB), pFAK (Y397, #8556, 1:1,000 WB), pEGFR (Y1068, #2234, 1:1,000 WB), pNDRGl (T346, #5482, 1:1,000 WB, 1:250 IF) and cleaved PARP (D214, #9541, 1:1,000 WB) were purchased from Cell Signaling Technologies (Danvers, MA, USA). Rabbit polyclonal antibodies NEDD4-2 (ab46521, 1:1,000 WB, 1:500 IF) and EEA1 (ab2900, 1:1,000 IF) were purchased from Abeam (Cambridge, MA, USA). Monoclonal antibodies against EGFR (clone 111.6, 1:5,000 WB, 1:1,000 IF, 1:50 IHC) and against V5-tag (Hybridoma, 1:100 WB). Polyclonal anti-PYK2 (1:500 WB) antibody was prepared as described previously (Litvak et al., 2000). Furthermore, monoclonal antibodies EEA1 (610457, 1:300 IF) and RAB11 (610657, 1:100 IF) were obtained from BD Transduction Laboratories (San Jose, CA, USA), LAMP-1 (1D3B, 1:50 IF) from DSHB (University of Iowa) and anti-ubiquitin (MAB1510, 1:100 IF) from Chemicon (Merck Millipore, USA). Rabbit polyclonal anti-Rabll (1:300 IF).Anti- Alexa 488 donkey anti-mouse and anti-rabbit IgGs were purchased from Invitrogen (Carlsbad, CA). Cyanine Cy3-conjugated goat anti-rabbit and goat anti-mouse IgGs were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA, USA). Hoechst 33342, PF431396 (PZ0185), Chloroquine (C6628) and Dp44MT (SML0186) were obtained from Sigma-Aldrich Israel (Rehovot Israel). PF573228 (324878) and MG132 (474790) were purchased from Calbiochem (Merck Millipore, USA) and Gefitinib (G-4408) and Erlotinib (10483-250) from LC Laboratories (Woburn, MA, USA) and Cayman Chemical Company (Ann Arbor, MI USA) respectively. EMD1214063 (A3388) and GSK 1120212B (1187431-43-1) were purchased from Apexbio Technology, Houston and Pekag Chemicals International Corp., China respectively. Cell Culture: MDA-MB-468, MDA-MB-231, BT20, BT549, HCC1937, HCC1143, SUM159PT, Hs578T and Human embryonic kidney (HEK293) cells were obtained from ATCC (Manassas, VA, USA). MDA-MB-468, HCC-1937, HCC-1143, HCC-38, MDA-MB-231, BT-549 and Hs578T cells were grown in RPMI (Gibco BRL; Grand Island, NY, US). BT549 medium was supplemented with Insulin (0.023 IU ml-1) and Hs578T medium with 2 mM L-glutamine. BT-20 cells were grown in Eagle's Minimum Essential Medium (MEM-Eagle's) supplemented with 1mM sodium pyruvate and 2 mM L-glutamine. HEK293 cells were grown in DMEM (Gibco BRL; Grand Island, NY, US). SUM159PT cells were cultured in DMEM/F12 Ham's Mixture (1:1) (Gibco BRL; Grand Island, NY, US) medium supplemented with 5% FCS, Insulin (0.144 IU ml 1) and hydrocortisone (5 µg ml 1). All media preparations were supplemented with 10% fetal bovine serum (Gibco BRL, Grand Island, NY, US), and a penicillin- streptomycin mixture (100 U ml- 1; 0.1 mg ml- 1; Beit Haemek, IL) unless specified. Establishment of Gefitinib and Erlotinib resistant cell lines: Gefitinib and Erlotinib resistant cells were established as described elsewhere (Ware et al., 2013). In brief, cells were exposed to increasing concentrations of Gefitinib or Erlotinib starting with IC 10-25· Medium containing drug was changed every three days with an increase of 10 to 25% in concentration. Cells were designated as drug resistant once they grew exponentially in the presence of high concentrations of the drugs. The Gefitinib and Erlotinib resistant MDA-MB-468 were established within 1.5 months and were continuously grown in the presence of 2 or 4 µΜ of Gefitinib and 4.5 µΜ of Erlotinib. shRNA lentivirus production and infection: Two different lentiviruses encoding shRNAs targeting PYK2 were used for PYK2 knockdown as we described previously (Selitrennik and Lev, 2015). Two FAK specific lentiviruses shRNAs were purchased from Sigma and validated for specificity and efficiency (TRCN0000196310 and TRCN0000 194984). To knockdown NDRG1 expression two previously described shRNA sequences were used; 1-GCACATTGTGAATGAC ATGAA (SEQ ID NO: 1), 2- GCACATTGTGAATGACATGAA (SEQ ID NO: 2) (Tschan et al., 2010). The NDRG1 shRNAs were cloned into the pLKO.l-puro lentiviral vector. Lentivirus production and infection were performed as described previously (Kim et al., 2010). HA-tagged wild- type PYK2 was subcloned into the pRK5 vector. NDRGl-myc was established by subcloning the NDRG1 cDNA from the pCMV-NDRG 1-DsRed vector into the pcDNA3.1-myc-his vector. pcDNA3-V5-hNEDD4-WT and pcDNA3-V5-hNEDD4L- WT were kindly provided by Daniela Rotin (University of Toronto, CAN). Cell viability and Proliferation: Cell proliferation was assessed by MTT (3- (4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) colorimetric assay and by crystal violet (CV) staining. For cell viability assays, cells were plated at 7,000 cells per well were plated in 96-well plates in triplicates. Cell viability was assessed 72 h later by: (a) MTT (3-(4,5- dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide) colorimetric assay. The cell were incubated with medium containing MTT solution (0.5 mg/ml; Sigma) for 2 h at

37°C. Cell were lysed with 100 µΐ lysis buffer (0.4% NP-40 in 0.04 mol/1 HC1- isopropanol), and absorbance was measured at 570 nm with a 680 nm reference wavelength using ELISA microplate reader (Corning, NY, US). Cell viability is depicted as percentage of control. Data is represented as the mean values of three independent biological replicates (b) Crystal Violet staining. The cells were washed with PBS, and 50µ1of 0.2% crystal violet in 4% formalin was added to each well for 10 min. The cells were then washed with distilled water, dried, and plates were scanned using HP Scanjet G4010. Pictures are representative of three independent experiments.

IC50 values and Drug synergism: Cells in 96-well plates were treated with different drug concentrations as indicated, and dose matrices were applied for drug combination analysis. The cells were treated with drugs for 72 h and cell viability was measured by MTT. IC 50 values were determined by the nonlinear regression method using GraphPad Prism version v.5.0 (GraphPad Software, San Diego California USA). CIs were calculated by CompuSyn software (CompuSyn.Inc, Paramus, NJ, US) and accordingly, synergistic (CI < 1), additive (CI = 1) and antagonistic (CI > 1) effects were defined. Breast Cancer Mouse Xenografts: All procedures for mouse xenograft experiments were carried out in accordance with the Guidelines for the Care and Use of Research Animals at the Weizmann Institute. A suspension of 3 x 106 luciferase- expressing MDA-MB-468 breast cancer cells infected with shRNA-Control or shRNA- PYK2 lentiviruses in PBS was implanted into the fourth inguinal mammary gland of female Nu/Nu mice of matching age, 4- to 6-week-old (N=48). Six weeks later, mice were randomly divided into two equally sized groups before oral administration of either vehicle or Gefitinib. Gefitinib was dissolved in 0.5% Methylcellulose/0.2% Tween-80, and administered by oral gavage for 39 days. Tumor size was monitored weekly; the gross tumor dimensions were measured by caliper and bioluminescence images were acquired by the IVIS instrument with the Living Image 3.0 software (Xenogen Caliper Life Sciences) once weekly. Tumor volumes were calculated (width x length/ ), and 11.5 weeks post implantation, mice were sacrificed. Tumors were excised and processed for immunohistochemistry and protein extraction. Student's i-test was applied for statistical analysis. Western Blotting: Performed as described previously (Kim et al., 2013; Verma et al., 2015). Briefly, cells were lysed in cold lysis buffer (0.1% Triton-X-100, 50 mM β Hepes pH 7.5, 100 mM NaCl, 1 mM MgCl2, 50 mM NaF, 0.5 mM NaV0 3, 20 mM - glycerophosphate, 1 mM phenylmethylsulphonyl fluoride, 10 g ml- 1 leupeptin,

10 g ml- 1 aprotinin), vortexed for 30 seconds and incubated on ice for 15 min. Cleared cell extracts were obtained by centrifuging at 14,000 rpm for 20 min at 4 °C. Protein concentration in each sample was estimated by Bradford assay (Bio-Rad, Hercules, CA) and equal protein amounts (40-60 g) were analyzed by SDS-polyacrylamide gel electrophoresis and WB using standard procedures. Blocking buffer containing 5% nonfat dry milk in TBS-Tween (0.05%) was used. For densitometric analysis, the intensity of protein bands was measured using the Image J software (NIH, USA). Immunofluorescence staining: Immunofluorescence (IF) staining was performed as described previously (Verma et al., 2015). Briefly, cells were grown on coverslips in 24-well plates and cultured for 48 h. After washing with PBS, cells were fixed with 4% paraformaldehyde (PFA) in PBS for 20 min at room temperature. The cells were then incubated for 15 min in 0.1 M glycine in PBS, followed by 30 min incubation in blocking buffer (10 n M Tris, pH 7.5, 150 n M NaCl, 10% goat serum, 2% bovine serum albumin in Tris-buffered saline and 0.1% Triton-X-100). Primary antibody (dilution prepared in blocking buffer) was applied for 1 h at room temperature and cells were washed 3 times with PBS and subsequently incubated with fluorescence- labelled secondary antibodies for 1 h. Cells were washed with PBS and incubated for 5 min with 2 ng µ 1 Hoechst 33342, washed again and then mounted on microscopic slides using mounting media (10 mM phosphate buffer, pH 8.0, 16.6% w/v Mowiol 4- 88 and 33 % glycerol). A confocal laser-scanning microscope (LSM 510; Carl Zeiss) equipped with a 63 A/1.4 oil differential interference contrast M27 objective lens (Plan Apochromat; Carl Zeiss) was used to analyze the IF staining using the 488-, 543- and either 405- or 633-nm excitation for fluorescein, Cy3 epifluorescence and either 4,6- diamidino-2-phenylindole (Hoechst) or Cy5, respectively. Images were acquired using the LSM 510 software. Immunoprecipitation: Immunoprecipitation studies were performed as described previously (Kim et al., 2010). Briefly, cells were washed with cold PBS and lysed using cold lysis buffer described above, centrifuged at 15,000 g for 20 minutes to obtain cleared lysates. Protein concentration was estimated for each sample using Bradford reagent and subsequently, 90% of the supernatants were incubated for 3 h at 4°C with the indicated primary antibody bound to protein A/G Sepharose beads and the remaining lysates were used as inputs. The beads were then washed three times with cold lysis buffer. Pulled down proteins were released by adding 15 µΐ 3 x SDS sample buffer and boiled for 5 min. The resulting samples (excluding beads) were loaded directly into protein SDS-PAGE gels and subject to Western blot as described above. Immunohistochemistry staining and analysis: Tissue samples of invasive breast cancer cases were obtained with institutional review board approval (Ethik- Kommission Fachbereich Medizin der Goethe-Universitat Frankfurt, DE) and written informed consent from patients undergoing surgical resection at the Department of Gynecology and Obstetrics at the Goethe-University in Frankfurt am Main (DE). TNBC samples were identified according standard pathological criteria, including estrogen receptor, progesterone receptor and HER2 status. Formalin-fixed paraffin-embedded sections were mounted on Superfrost Plus slides, and were processed for immunohistochemistry as previously described (Verma et al., 2015). The intensity of the immunohistochemistry staining was evaluated semiquantitatively and classified as low (0 - 2.5) and high (2.5+ - 4+) intensity. H-Score was calculated for each sample essentially as we described previously (Keinan et al., 2014). Tumor grade was evaluated according to clinical and pathological data. Statistics were performed using χ -analysis. Soft agar colony formation assay: Cells were suspended in complete medium containing 0.3% agar and seeded in 24-well plates pre-coated with 0.5% agar (5,000 cells/well). The cells were grown for up to 5 weeks. When indicated, drugs were added two weeks post seeding and replaced every 3-4 days. Photographs were taken by Nikon Eclipse TS100 microscope. Images are representative of two biological replicates. Quantitation was performed by ImageJ software (NIH, USA).

EXAMPLE 1 High expression ofEGFR and PYK2 correlates with poor prognosis in TNBC patients Previously, 92 clinical breast cancer samples tissues were analyzed for PYK2 expression by immunohistochemistry (IHC) and it was shown that PYK2 is highly expressed in high-grade breast tumors and is significantly correlated with lymph node metastasis (LNM) (Verma et al., 2015). In silico analysis further support these findings and demonstrated significantly upregulation of PYK2 in invasive human breast carcinomas (Wendt et al., 2012). To better characterize the expression pattern of PYK2 in the four breast cancer subtypes: luminal A, luminal B, HER2 and TNBC (Bertos and Park, 2011), and to evaluate its prognostic significance, the present inventors analyzed a microarray dataset of 4467 clinical breast cancer samples as described previously (Hanker et al., 2013). A conservative median split according to PYK2 gene expression (Affymetrix probeset 203 11l_s_at) was applied to stratify all patients into two equally sized groups with either 'low' or 'high' PYK2 expression. Chi square test was used to evaluate the correlation between clinical characteristics and the two PYK2 expression groups (Figure 1A). This analysis revealed a significant correlation of high PYK2 expression with positive lymph node status (P<0.001), age >50 years (P=0.033) and poor histological grade (P=0.044). Highest expression of PYK2 was observed in the TNBC subgroup (P<0.001). Next, the expression of PYK2 and its association with EGFR was analyzed, using the 1096 TNBC patients from the microarray dataset described above. PYK2 mRNA levels were obtained from Affymetrix probeset 203 11l_s_at. A cutoff for 'high' PYK2 expression was derived from its bimodal mRNA distribution using the Cutoff Finder application (Budczies et al., 2012) (Figure 8A). EGFR mRNA levels were obtained from Affymetrix probe sets 211607_x_at and 210984_x_at applying a cutoff of -0.005 for both probesets to separate 'high' and 'low' EGFR expressing tumors (Figure 8B, C). Kaplan-Meier analysis demonstrated that EGFR alone did not have prognostic value in this TNBC sample set (Figure 8D). However, when TNBC was first stratified according to PYK2 expression, a significantly reduced event-free survival of TNBC patients with high EGFR and high PYK2-expressing tumors (P=0.026) was observed but not in those who express low levels of PYK2 (P=0.45) (Figure IB). These data suggest that high expression of EGFR together with high PYK2 expression results in reduced survival of TNBC patients, and thus, a poor prognosis. To further assess the expression of PYK2 in TNBC and its correlation with EGFR, IHC analysis of 77 TNBC tissue samples was carried out using specific EGFR and PYK2 antibodies. The IHC staining intensity was scored as described in the Experimental Procedures section and classified as 'high' or 'low' expression. Representative images are shown in Figures 1D-F. Of the total 77 TNBC samples, -77% (59/77) were high-grade and -34% (26/77) were lymph node positive (LNP) (Figure 1C). High PYK2 expression was observed in -80% (47/59) of high-grade tumors, and -96% (25/26) of the LNP samples. Significant correlation between LNM status and high PYK2 expression was determined by Chi square analysis. As shown in Figure ID, PYK2 expression is strongly correlated (P=0.009) with LNM status. In contrast, no significant correlation between EGFR levels and LNM status (P=0.414) in the 77 TNBC samples was observed (Figure IE). However, when sections were analyzed for high expression of both PYK2 and EGFR, a very strong correlation (P=0.005) with LNM was found; all the 19 LNP TNBC samples that exhibit high EGFR also exhibit high PYK2 (100%) (Figure IF). Collectively, these results suggest that high expression of both PYK2 and EGFR in TNBC is significantly associated with LNM and reduced survival, and thus has a high prognostic value. EXAMPLE 2 PYK2/FAK inhibition attenuates the proliferation of basal-like TNBC cell lines. The correlation between PYK2 expression and LNM (Figure ID), led the present inventors to further characterize the role of PYK2 in TNBC. They screened a panel of 20 commonly studied TNBC cell lines for PYK2 and FAK protein expression, and further analyzed their influence on growth of nine selected cell lines. Five of the nine TNBC cell lines have been classified as basal-like (BT-20, MDA-MB-468, HCC1937, HCC38, HCC1143), whereas the other four as mesenchymal or mesenchymal-stem like cell lines (SUM159, Hs578T, MDA-MB-231, BT-549) (Lehmann et al., 2012). As shown in Figure 2A, all nine TNBC cell lines express moderate-high levels of PYK2 and FAK as well as EGFR. Depletion of either PYK2 or FAK expression using corresponding lentiviral shRNAs (Selitrennik and Lev, 2015; Verma et al., 2015), reduced the expression of PYK2 or FAK kinases, and in few cell lines also decreased the steady-state level of EGFR. Depletion of PYK2 or FAK reduced cell growth by 10-70% in the TNBC cell lines. Profound growth inhibitory effects were obtained in basal-like cell lines compare to mesenchymal lines (Figure 2B), particularly in PYK2 knockdown (KD) cells which express high levels of EGFR, including BT-20, MDA-MB-468 and HCC1937 (Figure 2B). Importantly, MDA-MB- 468 and BT-20 cell lines harbor amplification of EGFR gene (deFazio et al., 2000), express high levels of EGFR, and are driven by oncogenic EGFR signaling (Lee et al., 2012). Together this analysis suggests that basal-like TNBC cell lines with high EGFR expression are more susceptible to PYK2 inhibition.

EXAMPLE 3 PYK2 and/or FAK inhibition synergizes with EGFR antagonists in basal-like TNBC The poor prognosis of TNBC patients with high EGFR and PYK2 expression levels and the profound effect of PYK2 depletion on the proliferation of BT-20, MDA-MB-468 and HCC1937 cell lines, suggest that inhibition of PYK2 together with EGFR antagonists could have synergistic effects, and thus, a potential clinical benefit. To explore this possibility, the present inventors examined whether PYK2 or FAK depletion could potentiate the effects of EGFR antagonists. The effect of Gefitinib and Erlotinib, selective small molecule EGFR tyrosine kinase inhibitors (Corkery et al., 2009; Hegedus et al., 2012), on cell viability in the five basal-like TNBC cell lines was determined in control and PYK2- or FAK-depleted cells. As shown in Figure 2C, depletion of PYK2 or FAK substantially (3.5-9 fold) reduced the half maximal inhibitory concentration (IC 50) of either Gefitinib or Erlotinib in MDA-MB-468 and BT-20 cells, but had less profound effects in the other basal-like cell lines (1.1-1.5 fold). Consistent with these results, PYK2 or FAK depletion remarkably reduced viability of Gefitinib-treated MDA-MB-468 and BT-20 cells, as demonstrated by crystal violet staining (Figure 2D). To determine whether PYK2 and/or FAK inhibition synergize with EGFR inhibitors, two commercially available FAK inhibitors; PF573228 (PF228), a selective FAK inhibitor (Slack-Davis et al., 2007) and PF431396 (PF396), a dual PYK2/FAK inhibitor (a commercial, selective PYK2 inhibitor is currently not available) (Han et al., 2009) were used. These two inhibitors have been previously used in various experimental settings, including preclinical trials (Porporato et al., 2014; Sulzmaier et al., 2014). Their IC50 values were determined in the five basal-like TNBC cell lines (Figure 2E), and subsequently their synergistic effect with EGFR antagonists using the Chou-Talalay method to calculate their combination index (CI) (Chou, 2010). As seen, PF228 synergized with Gefitinib in MDA-MB-468 and BT-20 cell lines (Figure 9A), as indicated by the CI values (<1). The dual PF396 inhibitor also synergized with Gefitinib in MDA-MB-468 and BT-20 and markedly reduced cell growth in Gefitinib-treated cells (Fig. 2F). In fact, PF396 potentiated the inhibitory effect of Gefitinib on cell viability and synergized with either Gefitinib (Figure 2G, H) or Erlotinib (Figure 9B) in all the five basal-like TNBC cell lines that were examined. Consistent with these results, concurrent knockdown of both PYK2 and FAK significantly enhanced the inhibitory effect of Gefitinib on viability of HCC1937, HCC1134 and HCC38 cells (Figure 9C). Collectively these results suggest that inhibition of EGFR together with PYK2 and FAK could be an efficient treatment for basal-like TNBC patients with a moderate-high expression level of EGFR, while combination of EGFR inhibitors with either PYK2 or FAK inhibition could be sufficient for those with very high EGFR expression, such as MDA-MB-468 and BT-20. Noteworthy, the synergistic effects of Gefitinib and the dual PYK2/FAK inhibitor PF396 in MDA-MB-468 and BT-20 cells were stronger compared to previously described drug combinations targeting EGFR and cMet (EMD 12 14063) (Sohn et al., 2014) in the same cell lines, or EGFR and MEK (Maiello et al., 2015) (Figure 9D), further emphasizing the potency of EGFR-PYK2/FAK drug combination and its potential clinical implication. To further demonstrate the potency of combined targeting of EGFR, PYK2 and/or FAK, the present inventors examined the effects of Gefitinib (IC 25) on the anchorage independent growth of control, PYK2- or FAK-depleted MDA-MB-468 or BT-20 cells using soft-agar assays. As seen in Figure 21, although Gefitinib, PYK2- or FAK-knockdown reduced colony number and size, their combined effects were much more profound and almost abolished growth in soft agar. Similarly, combination of Gefitinib and PF396 remarkably affected the anchorage independent growth of these cell lines (Figure 9E), consistent with their synergistic effects (Fig. 2G).

EXAMPLE 4 Inhibition of EGFR together with PYK2 abrogates tumor growth in mouse xenograft model In light of the profound effect of PYK2 depletion on Gefitinib-induced MDA- MB-468 cell death and anchorage independent growth in soft-agar (Figures 2C, D, I), it was hypothesized that PYK2 depletion could potentiate the effect of Gefitinib on tumor growth in vivo. To explore this possibility, an MDA-MB-468 xenograft model was established using control or PYK2-depleted luciferase-expressing MDA-MB-468 cells. The cells were implanted into the mammary fat pads of athymic nude mice (n=25 of each group). Tumor growth was monitored weekly by whole-body bioluminescence imaging, while gross tumor size was measured by caliper. As shown in Figure 3A, PYK2 knockdown significantly attenuated tumor growth, and six weeks after cell implantation, the average tumors volume reached -75 mm in PYK2-depleted cells, whereas -130 mm in the control MDA-MB-468 cells. At this time, the mice were randomly divided into two groups (n = 12), of which, one group was treated with Gefitinib (100 mg/kg/day) and the second with a vehicle control. The mice were treated for 39 days with Gefitinib and tumor growth was monitored weekly for five weeks. The treatments had no obvious effects on body weight (Figure 3B), but markedly affected tumor growth (Figure 3A). As seen in the representative images of mice at the end of the experiment (11.5 weeks) (Figure 3C), PYK2-KD as well as Gefitinib treatment reduced tumors size (by -30-40%). Immunohistochemical staining for proliferating cell nuclear antigen (PCNA), a marker for cell proliferation (Kubben et al., 1994), further demonstrated their inhibitory effects (Figure 3D). Interestingly, PYK2 knockdown as compared to Gefitinib had a stronger effect on PCNA staining. Most importantly, Gefitinib substantially reduced the size of PYK2-depleted MDA-MB-468 tumors, and in most cases, the tumors apparently disappeared. These remarkable effects strongly suggest that combined targeting of EGFR and PYK2 could be an efficient therapeutic strategy for a subset of basal-like TNBC patients with high EGFR-expressing tumors.

EXAMPLE 5 Effects of EGFR antagonist and PYK2/FAK inhibition on HER3 receptor, intracellular signaling and apoptotic pathways The remarkable effects of EGFR, PYK2 and/or FAK inhibition on cell growth in vitro and tumor growth in murine models, led the present inventors to investigate the underlying mechanism of their potent combined effects. The influence of PYK2 and FAK knockdown on predominant survival and proliferative signaling pathways, including the PI3K/AKT, mTOR/S6K, STAT3, and Ras/MAPK pathways, was analyzed in the five basal-like TNBC cell lines using phospho-specific antibodies against activated AKT, S6-kinase, STAT3, and ERK1/2. The levels of cMet and HER3 receptors, which heterodimerize with EGFR were also assessed. The results showed striking differences between PYK2 and FAK-knockdown (Figure 4A). In PYK2- knockdown cells, the phosphorylation of S6-kinase and its protein level were markedly reduced in all five basal-like TNBC cell lines, while FAK knockdown influenced AKT activation in a subset of the lines such as MDA-MB-468, HCC38 and HCC1143. PYK2-KD also inhibited STAT3 phosphorylation in all the lines except HCC1143. Remarkably, PYK2-KD substantially reduced the level of HER3 in all the five cell lines, while FAK-KD reduced HER3 levels in only a subset of them (BT-20, HCC1143 and HCC38). However, neither knockdown of PYK2 nor of FAK had a significant effect on ERK1/2 phosphorylation (Figure 4A). Likewise, the FAK inhibitor or the dual PYK2/FAK inhibitor, PF228 and PF396, respectively, had also minor effect on pERKl/2 (Figure 4B). In fact, the dual FAK/PYK2 inhibitor affected most of the pathways altered by PYK2/FAK knockdown (Figure 4A), including the influence on HER3 and/or cMet levels (Figure 4B). In a marked contrast, Gefitinib significantly inhibited ERK1/2 phosphorylation in all five basal-like cell lines (Figure 4C), but apparently had no effect on pERKl/2 in the mesenchymal cell lines that were tested (MDA-MB-231, BT-549), consistent with the crucial role of EGFR signaling in basal- like TNBC (Ueno and Zhang, 2011). The strong effects of PYK2/FAK inhibition on STAT3, S6K and in a few cases AKT phosphorylation together with the inhibitory effect of Gefitinib on the ERK pathway suggested that combined targeting of EGFR and PYK2/FAK could block key oncogenic pathways that regulate cell survival and growth and consequently could effectively induce cell death. To explore this possibility, the combined effects of the two drugs, Gefitinib and the dual PF396 inhibitor on the above signaling pathways was examined. Due to their synergistic effects (Figure 2G), lower concentrations of drugs as compared to the individual drug concentrations tested were used (Figure 4B), and their effects were assessed 24 h later (Figure 4D, Figure 10A). A representative analysis of the affected pathways in MDA-MB-468 (Figure 4D) as well as BT-20-treated cells (Figure 10A) demonstrates the influence of the drug combination on the AKT, S6K, STAT3 and ERK1/2 pathways, and consequently their complementary influence on multiple critical signaling pathways. The combined drugs also significantly induced caspase-9 and PARP cleavage. Similarly, PYK2 or FAK knockdown enhanced the effect of Gefitinib on these apoptotic pathway proteins (Figure 10B). Collectively, these results suggest that combined targeting of EGFR and PYK2/FAK complementarily blocks crucial signaling pathways that regulate growth and survival thereby potentiating apoptotic cell death. While combined targeting of PYK2/FAK with EGFR can influence multiple downstream signaling pathways (Figure 4D, Figure 10A), inhibition of PYK2 also substantially affects the level of HER3 receptor (Figure 4A). As upregulation of HER3 is frequently associated with drug resistance (Jiang et al., 2012; Ma et al., 2014), the influence of Gefitinib treatment for 72 h on the level of HER3 receptor in the five basal- like TNBC cell lines was examined using Western blotting and qRT-PCR. As shown in Figure 4E, an -2-3.5 fold upregulation of HER3 protein was detected in all these lines, with minor effects on its mRNA levels (1-1.5 fold, not shown). Further analysis of predominant signaling pathways in Gefitinib-treated MDA-MB-468 cells for 3 or 5 days demonstrated upregulation of HER3 as well as pSTAT3 (-2.5-4.5 fold) (Figure 4F). Strikingly, both HER3 and pSTAT3 levels are markedly reduced by PYK2 knockdown or inhibition (Figure 4A, B) in these five basal-like TNBC lines. These observations together with the established link between HER3 upregulation and resistance to EGFR antagonists in TNBC patients (Tao et al., 2014), imply that inhibition of PYK2/FAK not only synergizes with EGFR inhibitors, but could also circumvent HER3-associated resistance in basal-like TNBC.

EXAMPLE 6 PYK2 inhibition circumvents HER3-associated resistance to EGFR antagonists As upregulation of HER3 attenuates antitumor effects of EGFR inhibitors (Tao et al., 2014), the present inventors asked whether its upregulation in basal-like TNBC lines could desensitize the cells to EGFR antagonists, and whether inhibition of PYK2/FAK could circumvent these effects. The present inventors focused on representative lines, MDA-MB-468 and/or BT-20, and applied three different approaches: short-term treatment with Gefitinib for 72 h (Figure 5A), long-term treatment with Gefitinib (-1.5 months, Figure 5B), and ectopic overexpression of HER3 (Figures 5C,D). As shown in the corresponding Western blots, HER3 was upregulated by the three different approaches (-2.5-10 fold), and concomitantly pSTAT3 levels were increased (Figures 5A-C). The upregulation of HER3 level was accompanied by reduced sensitivity to Gefitinib, and thus, an increase in the IC 50 (-2-6 fold) in the three different lines (Figures 5A,B, D gray tables). Short-term treatment with Gefitinib (72 h, µΜ µΜ Figure 5A) markedly increased the IC 50 (from - 6 to - 42 ) of Gefitinib in MDA- MB-468 cells, and combined inhibition of PYK2/FAK using the dual PF396 inhibitor abolished the upregulation of HER3 as well as of pSTAT3, and concomitantly inhibited S6K, AKT and ERK activation (Figure 5A). These results suggest that this drug combination effectively blocks predominant survival and proliferative pathways. Likewise, knocking down of PYK2 in Gefitinib-resistant MDA-MB-468 cells (Fig. 5B) or HER3-overexpressed MDA-MB-468 or BT-20 cells (Figure 5C) effectively reduced the IC 50 of Gefitinib as well as the activation of S6K, AKT and STAT3 pathways (Figure 5C). Furthermore, the dual inhibitor PF396 synergized with Gefitinib in the three 'resistant' cell lines as determined by the calculated CIs (Fig.5A, B, D). These results suggest that combined inhibition of EGFR and PYK2/FAK could be an efficient strategy to overcome HER3-associated resistance, possibly due to the substantial effect of PYK2 on HER3 levels (Figures 4A, B).

EXAMPLE 7 PYK2 depletion enhances proteasomal degradation ofHER3 and concomitantly increases NDRG1 level The involvement of HER3 in resistance to EGFR antagonists (Figure 5) together with the profound effect of PYK2 knockdown as well as the PYK2/FAK dual inhibitor on the steady-state level of HER3 protein in basal-like TNBC cell lines (Figures 4A,B), led the present inventors to investigate the mechanisms by which PYK2 inhibition affects the steady-state level of HER3. They chose to characterize MDA-MB-468 as a representative cell line, as it is highly sensitive to PYK2 inhibition both in vitro and in vivo (Figures 3A, 4). MG132, a proteasome inhibitor, restored the steady-state level of HER3 in PYK2-depleted MDA-MB-468 cells, whereas the lysosomal degradation inhibitor chloroquine had no obvious effect (Figure 6A), suggesting that PYK2 depletion enhances the proteasomal degradation of HER3. To further characterize this effect, the subcellular localization of HER3 in control and PYK2-depleted MDA-MB- 468 cells was examined. As seen in Figure 6B, HER3 was localized to multiple punctuated structures under steady-state conditions, many of which were co-stained with the recycling endosomal marker Rabll. Interestingly, pPYK2, which is clearly localized to focal adhesions, was also detected in early and recycling endosomes colocalized with EEA-1 and Rabll, respectively (Figure 6B). Colocalization between pPYK2 and HER3 was also observed (Figure 6B). Depletion of PYK2 remarkably reduced HER3 immunostaining and the few punctuated HER3-positive structures that were observed appeared as Rabll -positive enlarged recycling endosomes (Fig. 6C). Co- staining of HER3 and ubiquitin suggests that only a subpopulation of HER3 is ubiquitinated in the control MDA-MB-468 cells. In contrast, HER3 appeared to be highly ubiquitinated in PYK2 knockdown cells and MG132 treatment markedly increased the number of HER3-positive structures, further suggesting that PYK2 depletion enhances HER3 ubiquitination and its subsequent degradation (Figure 6C). The present inventors explored a potential link between PYK2 and NDRGl. First, they examined the influence of PYK2 or FAK knockdown on the steady-state level of NDRGl as well as its Thr346 phosphorylation (an SGK1, serum/glucocorticoid regulated kinase 1, phosphorylation site) in the five basal-like TNBC lines. It was found that PYK2 depletion strongly induced upregulation of NDRGl and its phosphorylation in all five lines (Fig. 6D). FAK knockdown also affects NDRGl level and its Thr346- phosphorylation but in most cases to a lesser extent. Next, they examined whether NDRGl expression affects the steady-state level of HER3 either by treating MDA-MB-468 cells with di-2-pyridylketone 4,4-dimethyl-3- thiosemicarbazone (Dp44mT) (Fig. 6F) or by ectopic expression of NDRGl and HER3 in HEK293 cells (Fig. 6E). Dp44mT sequesters cellular iron and induces upregulation of NDRGl (Lane et al., 2013; Le and Richardson, 2004). As seen in Figure 6E, Dp44mT substantially increased the level of NDRGl as well as its Thr346- phosphorylation in MDA-MB-468 cells and concomitantly reduced the level of HER3. Likewise, ectopic co-expression of NDRGl with HER3 in HEK293 cells markedly reduced the level of HER3 (Figure 6F). Strikingly, however, treatment with MG132 abolished the effect of NDRGl on HER3, suggesting that similar to PYK2 depletion, NDRGl expression also enhances HER3 degradation. This influence on HER3 degradation was accompanied by enhanced receptor ubiquitination as shown in Figure 6G. To further demonstrate the influence of NDRGl on HER3 level in MDA-MB- 468 cells, the present inventors knocked down its expression using two different shRNAs. The results shown in Figure 6H, clearly demonstrate the reciprocal effects of NDRGl and PYK2 on HER3 level. While PYK2 knockdown increased the level of NDRGl and decreased the level of HER3, NDRGl knockdown increased the level of HER3 and slightly of PYK2 as well. Collectively these results establish a functional link between HER3 degradation, PYK2 and NDRGl.

EXAMPLE 8 The PYK2-NDRG1-NEDD4 axis regulates HER3 degradation The upregulation of NDRGl levels in PYK2 depleted cells concomitant with the reciprocal effects of NDRGl and PYK2 on HER3 levels, suggest that the effects of PYK2 on HER3 levels are mediated by NDRG1. To explore this possibility, NDRG1 was knocked down in control and PYK2-depleted MDA-MB-468 cells and its influence on the protein level and subcellular distribution of HER3 was assessed by Western blotting (Figure 7A) and immunofluorescence analysis (Figure 7B), respectively. As seen in Figures 7A,B, knockdown of NDRG1 markedly increased the level of HER3 in PYK2-depleted MDA-MB-468 cells. Remarkably, in NDRG1-depleted cells the number and size of HER3-associated punctuated structures were increased and many of them colocalized with Rabll, while in the double NDRGl/PYK2-knockdown cells, the number, size and colocalization of HER3 with Rabll returned to basal conditions observed in control cells (Figures 7B, 6B), suggesting that depletion of NDRG1 rescued the effects of PYK2 inhibition on HER3 degradation. Next, the present inventors asked how PYK2-NDRG1 regulates HER3 degradation. Previous studies suggest that HER3 ubiquitination and its subsequent proteasomal degradation is regulated by two different ubiquitin ligases; Nrdpl, a RING finger E3 ligase (Diamonti et al., 2002; Qiu and Goldberg, 2002) and NEDD4, a HECT E3 ligase (Huang et al., 2015). Further studies have shown a direct link between NDRG1 and NEDD4-2 expression (Kovacevic et al., 2013). NEDD4-1 and NEDD4-2 are two closely related ubiquitin ligases that regulate the ubiquitination of multiple receptors including ErbB4 (Carraway, 2010). Colocalization studies of HER3 with NEDD4-1 and -2 showed stronger colocalization with NEDD4-2 in MDA-MB-468 cells (Figure 7C). Interestingly, colocalization between pPYK2 and NEDD4-2 was also observed, suggesting that these two proteins might interact with one another. Most importantly, strong colocalization between HER3 and NEDD4-2 as well as HER3 and NDRG1 was observed in PYK2- depleted MDA-MB-468 cells, and all HER3-positive structures apparently co-stained with NEDD4-2 or NDRG1 (Figure 7C). In contrast, depletion of NDRG1 substantially reduced HER3-NEDD4-2 colocalization, suggesting that NDRG1 enhances HER3- NEDD4-2 colocalization and possibly their physical interaction. To explore this possibility, the present inventors examined the possible interactions of HER3 with NEDD4-1/2 by ectopically expressing them in HEK293 cells in the absence or presence of NDRG1 and/or PYK2. The transfected cells were incubated with MG132 for 24 h and their interaction was examined by co- immunoprecipitations (Co-IPs). As shown in Figure 7D, expression of NDRG1 together with either NEDD4-1 or NEDD4-2 markedly enhanced their interaction with HER3. Furthermore, NDRG1 was detected in the same immunocomplexes, implying for possible ternary complexes. Expression of PYK2, however, substantially reduced the effect of NDRG1 and apparently abolished the interactions between HER3 and NEDD4-1/2. These results suggest that PYK2 interferes with NEDD4-HER3 binding. Based on the localization results (Figure 7C), the present inventors speculated that PYK2 can interact with NEDD4-1/2 and examined this possibility by Co-IP experiments. As shown in Figure 7E, PYK2 and NEDD4-1/2 could be detected in the same immunocomplexes. Similar results were obtained for the endogenous proteins in MDA-MB-468 (not shown). These results suggest that both NEDD4-1 and -2 can interact with PYK2 (Figure 7E) as well as with HER3 (Fig. 7D). However, the interaction of NEDD4 with PYK2 is reduced in the presence of NDRG1, while NEDD4-HER3 interaction is enhanced by NDRG1 (Figure 7F). Furthermore, PYK2 inhibits the binding of NEDD4 to HER3 (Figure 7F), whereas NEDD4 and NDRG1 reduce the binding of HER3 to PYK2 (Figure 7H). These multiple protein-protein interactions and the complex interplay between PYK2, NDRG1, NEDD4 and HER3, as summarized in Figure 71, introduce a new regulatory circuit that affects HER3 fate. Overall, the present findings introduce the PYK2-NDRG1-NEDD4 axis as a key regulator of HER3 degradation, and demonstrate its impact on drug response and resistance mechanisms. Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. WHAT IS CLAIMED IS:

1. Use of agents for preparation of a medicament for treating triple negative breast cancer (TNBC) wherein said agents comprise: (i) an agent which downregulates an amount and/or activity of a receptor which is expressed on the surface of tumor cells of the subject, wherein the amount of said agent which targets said receptor is below the minimum dose required for therapeutic effectiveness when used as a single therapy; and (ii) an agent which specifically downregulates an amount and/or an activity of at least one member of the Fak family.

2. The use of claim 1, wherein said receptor is epidermal growth factor receptor (EGF-R).

3. The use of claim 1, wherein said at least one member of the Fak family is Proline-rich tyrosine kinase 2 (PYK2) or FAK (focal adhesion kinase).

4. The use of claim 1, wherein said TNBC is a basal TNBC.

5. The use of claim 2, wherein said agent which downregulates an amount and/or activity of epidermal growth factor receptor is a small molecule.

6. The use of claim 2, wherein said agent which downregulates an amount and/or activity of epidermal growth factor receptor is an antibody.

7. The use of claim 5, wherein said small molecule is selected from the group consisting of Gefitinib and Erlotinib.

8. The use of claim 1, further comprising analyzing the amount of EGF-R expression in a tumor of the subject. 9. The use of claim 1, wherein said agent which specifically downregulates said at least one member of the Fak family is a small molecule agent.

10. The use of claim 9, wherein said small molecule agent inhibits PYK2 to a greater extent than FAK.

11. The use of claim 1, wherein said agent which specifically downregulates an amount and/or activity of said at least one member of the Fak family is a polynucleotide agent.

12. The use of claim 1, wherein said subject is classified as being resistant to EGF-R inhibitors.

13. Use of agents for preparation of a medicament for treating a drug- resistant tumor, wherein said agents comprise: (i) an agent which downregulates an amount and/or activity of a receptor that is expressed on the surface of the tumor; and (ii) an agent which specifically downregulates an amount and/or activity of at least one member of the Fak family, wherein the drug of the drug-resistant tumor targets said receptor that is expressed on the surface of the tumor.

14. The use of claim 13, wherein said receptor is a tyrosine kinase receptor and said drug-resistant tumor is a tyrosine kinase inhibitor resistant tumor.

15. The use of claim 13, wherein the disease is cancer.

16. The use of claim 15, wherein said cancer is selected from the group consisting of breast cancer, lung cancer and glioblastoma.

17. The use of claim 14, wherein said tyrosine kinase receptor is selected from the group consisting of EGF-R, cMET, Axl, human epidermal growth factor receptor 3 (Her3). 18. The use of claim 13, wherein said at least one member of the Fak family is Proline-rich tyrosine kinase 2 (PYK2).

19. The use of claim 13, wherein said lung cancer is non-small cell lung cancer.

20. The use of claim 16, wherein said breast cancer is TNBC.

21. A method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising analyzing the amount of EGF-R expression in a tumor of the subject, and when said amount is above a predetermined level administering to the subject a therapeutically effective amount of: (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK.

22. A method of treating triple negative breast cancer (TNBC) in a subject in need thereof comprising analyzing the amount of EGF-R expression in a tumor of the subject, and when said amount is above a predetermined level administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or an activity of EGF-R together with: (i) an agent which specifically downregulates an amount and/or an activity ofPYK2; or (ii) an agent which specifically downregulates an amount and/or an activity of FAK, and when said amount is below said predetermined level, administering to the subject a therapeutically effective amount of an agent which downregulates an amount and/or an activity of EGF-R together with: (i) an agent which specifically downregulates an amount and/or an activity ofPYK2; and (ii) an agent which specifically downregulates an amount and/or an activity of FAK. 23. The method of claim 2 1 or 22, wherein said agent which specifically downregulates an amount and/or an activity of PYK2 is a small molecule agent.

24. The method of claim 2 1 or 22, wherein said agent which specifically downregulates an amount and/or aan ctivity of FAK is a small molecule agent.

25. The method of claim 23, wherein said small molecule agent inhibits PYK2 to a greater extent than FAK.

26. The method of claim 2 1 or 22, wherein said agent which specifically downregulates an amount and/or activity of PYK2 is a polynucleotide agent.

27. The method of claim 2 1 or 22, wherein said agent which specifically downregulates an amount and/or an activity of FAK is a polynucleotide agent.

28. An article of manufacture comprising an agent which downregulates an amount and/or activity of a tyrosine kinase receptor; and (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK.

29. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an agent which downregulates an amount and/or activity of a tyrosine kinase receptor; and (i) an agent which specifically downregulates an amount and/or an activity of PYK2; and/or (ii) an agent which specifically downregulates an amount and/or an activity of FAK.

30. The article of manufacture or pharmaceutical composition of claims 28 or 29, wherein said agent which targets said tyrosine kinase receptor is formulated in a unit dosage which is below the minimum dose required for therapeutic effectiveness when used as a single therapy.

31. The article of manufacture or pharmaceutical composition of claims 28 or 29, wherein said tyrosine kinase receptor is EGF-R.

32. The article of manufacture of claim 28, for use in treating a drug-resistant tumor.

33. The pharmaceutical composition of claim 29, for use in treating a drug- resistant tumor.

34. An ex vivo method of predicting prognosis of TNBC in a subject, the method comprising determining a level and/or activity of a tyrosine kinase receptor that is expressed on tumor cells of the subject and at least one member of the FAK family in a sample derived from the breast of the subject, wherein an amount of said receptor and said member of the FAK family above a predetermined level is indicative of poor prognosis of TNBC.

35. A kit for determining prognosis of TNBC in a subject comprising (i) an agent which specifically binds to a tyrosine kinase receptor; and (ii) an agent which specifically binds to at least one member of the FAK family.

36. The kit of claim 35, wherein said agent is an antibody.

37. The kit of claim 36, wherein said antibody is a monoclonal antibody.

38. The kit of claim 36, wherein said antibody comprises a detectable label selected from the group consisting of a radioactive label, a fluorescent label, a chemiluminescent label and an enzyme. 39. The kit of claim 38, wherein said enzyme is horseradish peroxidase or alkaline phosphatase.

40. The method or kit of claims 34 or 35, wherein said tyrosine kinase receptor is EGF-R.

A . CLASSIFICATION O F SUBJECT MATTER INV. A61K45/06 A61K31/00 A61K31/506 A61K31/517 A61K31/5377 G01N33/574 A61P35/00 ADD.

According to International Patent Classification (IPC) o r t o both national classification and IPC

B . FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) A61K G01N

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)

EPO-Internal , WPI Data, BIOSIS, EMBASE, SCISEARCH , CHEM ABS Data

C . DOCUMENTS CONSIDERED T O B E RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

VITA GOLUBOVSKAYA ET AL: "Dual Inhi bi t 1-8,22 , of Focal Adhesi on Ki nase and Epi dermal 24,27-31 Growth Factor Receptor Pathways Cooperati el y Induces Death Receptor-medi ated Apoptosi s i n Human Breast Cancer Cel l s" , JOURNAL OF BIOLOGICAL CHEMISTRY, vol . 277 , no. 4 1 , 11 October 2002 (2002-10-11) , pages 38978-38987 , XP055401370, US ISSN : 0021-9258, D0I : 10. 1074/jbc.M205002200 abstract 3 , 10, 11 , page 38979 , col umn 1, paragraph 1-3 22 ,23 , page 38984, col umn 2 , paragraph 3-4 25 ,26, page 38985 , col umn 1, paragraph 3 28,29 f i gure 7 page 38987 , col umn 1, paragraph 2 -/--

X| Further documents are listed in the continuation of Box C . X See patent family annex.

* Special categories of cited documents : "T" later document published after the international filing date o r priority date and not in conflict with the application but cited to understand "A" document defining the general state of the art which is not considered the principle o r theory underlying the invention to be of particular relevance "E" earlier application o r patent but published o n o r after the international "X" document of particular relevance; the claimed invention cannot be filing date considered novel o r cannot b e considered to involve a n inventive "L" documentwhich may throw doubts o n priority claim(s) orwhich is step when the document is taken alone cited to establish the publication date of another citation o r other "Y" document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve a n inventive step when the document is "O" document referring to a n oral disclosure, use, exhibition o r other combined with one o r more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior to the international filing date but later than the priority date claimed "&" document member of the same patent family

Date of the actual completion of the international search Date of mailing of the international search report

4 September 2017 07/11/2017

Name and mailing address of the ISA/ Authorized officer European Patent Office, P.B. 5818 Patentlaan 2 N L - 2280 HV Rijswijk Tel. (+31-70) 340-2040, Fax: (+31-70) 340-3016 Ci el en , El si e C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

CHEN I -HUA ET AL: "HPW-RX40 restores 1-9 , anoi ki s sensi t i v i t y of human breast cancer 12-17 , cel l s by i nhi b i t i ng i ntegri n/FAK 20,28-33 si gnal i ng" , TOXICOLOGY AND APPLI ED PHARMACOLOGY, vol . 289 , no. 2 , December 2015 (2015-12) , pages 330-340, XP002773249 , ISSN : 0041-008X abstract 3 , 10, 11 , page 331 , col umn 2 , paragraph 2 13 , 18, page 334, col umn 2 , l ast paragraph - page 22 ,23 , 335 , col umn 1 , paragraph 2 25 ,26, page 339 , col umn 1 , paragraph 1-2 28,29

CHRISTOPHER A LI PINSKI ET AL: "Targeti ng 3 , 10, 11 , Pyk2 for therapeuti c i nterventi on" , 13 , 18, EXPERT OPINION ON THERAPEUTIC TARGETS, 22 ,23 , vol . 14, no. 1 , 25 ,26, 9 December 2009 (2009-12-09) , pages 28,29 95-108, XP055401654, UK ISSN : 1472-8222 , D0I : 10. 1517/14728220903473194 abstract page 96, col umn 2 , paragraph 2 page 100, col umn 1 , l ast paragraph - col umn 2 , paragraph 1

0 2011/069962 Al (BOEHRINGER INGELHEIM 1-3 , 5 ,8, INT [DE] ; HASLINGER CHRISTIAN [DE] ; SOLCA 9 ,22 ,24, FLAVI0) 16 June 2011 (2011-06-16) 28-31 page 1 , paragraph 1 c l aims 1 , 4 , 6 , 11

A. VULTUR ET AL: "SKI -606 (bosuti n i b ) , 1 , 3 , 5 ,8, novel Src ki nase i nhi b i tor, suppresses 9 ,28,29 mi grati on and i nvasi on of human breast cancer cel l s " , MOLECULAR CANCER THERAPEUTICS, vol . 7 , no. 5 , 1 May 2008 (2008-05-01) , pages 1185-1194, XP055401719 , US ISSN : 1535-7163 , D0I : 10. 1158/1535-7163 . MCT-08-0126 abstract page 1186, col umn 1 , paragraph 2 f i gure 1 page 1192 , col umn 2 , paragraph page 1193 , col umn 1 , paragraph 3 -I C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

X GRANT A . HOWE ET AL: " Focal Adhesi on 28-31 Ki nase Inhi b i tors i n Combi nati on wi t h Erl oti n i b Demonstrate Enhanced Anti -Tumor Acti v i t y i n Non-Smal l Cel l Lung Cancer" , PLOS ONE, vol . 11 , no. 3 , 10 March 2016 (2016-03-10) , page e0150567 , XP055401150, D0I : 10. 1371/journal .pone. 0150567 A abstract 13 page 2 , paragraphs 2 , 4 page 6 , paragraph 3 page 8 , paragraph 2 f i gure 2 page 12 , paragraph 2 page 14, paragraph 3 page 17 , paragraph 2

X EP 1 228 766 Al (MAX PLANCK GESELLSCHAFT 28-30 [DE] ) 7 August 2002 (2002-08-07) col umn 5 , paragraph [0022] - [0023]

X , P NANDINI VERMA ET AL: "Targeti ng of PYK2 1-18,20, Synergi zes wi t h EGFR Antagoni sts i n 22-33 Basal - l i ke TNBC and Ci rcumvents HER3-Associ ated Resi stance v i a the NEDD4-NDRG1 Axi s " , CANCER RESEARCH , vol . 77 , no. 1 , 28 October 2016 (2016-10-28) , pages 86-99 , XP055401145 , US ISSN : 0008-5472 , D0I : 10. 1158/0008-5472 . CAN-16-1797 abstract page 4 , paragraph 2 - page 5 , paragraph 1 page 5 , l ast paragraph page 9 , paragraph 2 - page 10, paragraph 1 page 22 , paragraph 2 INTERNATIONAL SEARCH REPORT

Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet)

This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons:

□ Claims Nos.: because they relate to subject matter not required to be searched by this Authority, namely:

□ Claims Nos.: because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent that no meaningful international search can be carried out, specifically:

3 . □I I Claims Nos.: because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a).

Box No. Ill Observations where unity of invention is lacking (Continuation of item 3 of first sheet)

This International Searching Authority found multiple inventions in this international application, as follows:

see addi t i onal sheet

□ As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims.

□ As all searchable claims could be searched without effort justifying an additional fees, this Authority did not invite payment of additional fees.

As only some of the required additional search fees were timely paid by the applicant, this international search report covers ' ' only those claims for which fees were paid, specifically claims Nos. :

4 . I I No required additional search fees were timely paid by the applicant. Consequently, this international search report is restricted to the invention first mentioned in the claims; it is covered by claims Nos. :

1-12 , 20, 22 , 28-31 (compl etely) ; 13-18, 23-27 , 32 , 33 (parti al ly)

Remark on Protest The additional search fees were accompanied by the applicant's protest and, where applicable, the ' ' payment of a protest fee. The additional search fees were accompanied by the applicant's protest but the applicable protest ' ' fee was not paid within the time limit specified in the invitation.

I INo protest accompanied the payment of additional search fees.

Form PCT/ISA/21 0 (continuation of first sheet (2)) (April 2005) International Application No. PCTV I L2017/ 050586

FURTHER INFORMATION CONTINUED FROM PCT/ISA/ 210

Thi s Internati onal Searchi ng Authori t y found mul t i pl e (groups of) i nventi ons i n thi s i nternati onal appl i cati on , as fol l ows :

1. cl aims : 1-12 , 20, 22 , 28-31 (compl etely) ; 13-18, 23-27 , 32 , 33 (parti al ly)

Use of agents for preparati on of a medi cament for treati ng tri pl e negati ve breast cancer (TNBC) wherei n sai d agents compri se: ( i ) an agent whi ch downregul ates an amount and/or acti v i t y of a receptor whi ch i s expressed on the surface of tumor cel l s of the subject, wherei n the amount of sai d agent whi ch targets sai d receptor i s bel ow the mi nimum dose requi red for therapeuti c effecti veness when used as a si ngl e therapy; and(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of at l east one member of the Fak fami ly. Use of agents for preparati on of a medi cament for treati ng a drug-resi stant tumor, whi ch i s TNBC, wherei n sai d agents compri se: ( i ) an agent whi ch downregul ates an amount and/or acti v i t y of a receptor that i s expressed on the surface of the tumor; and(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or acti v i t y of at l east one member of the Fak fami ly, wherei n the drug of the drug-resi stant tumor targets sai d receptor that i s expressed on the surface of the tumor. A method of treati ng TNBC i n a subject i n need thereof compri si ng analyzi ng the amount of EGF-R expressi on i n a tumor of the subject, and when sai d amount i s above a predetermi ned l evel admi ni steri ng t o the subject a therapeuti cal l y effecti ve amount of an agent whi ch downregul ates an amount and/or an acti v i t y of EGF-R together wi t h: ( i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; or(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK, and when sai d amount i s bel ow sai d predetermi ned l evel , admi ni steri ng t o the subject a therapeuti cal l y effecti ve amount of an agent whi ch downregul ates an amount and/or an acti v i t y of EGF-R together wi t h: ( i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; and(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK. An arti cl e of manufacture or a pharmaceuti cal composi t i on compri si ng an agent whi ch downregul ates an amount and/or acti v i t y of a tyrosi ne ki nase receptor; and(i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; and/or(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK, and i t s use i n treati ng a drug-resi stant tumor, whi ch i s TNBC.

2 . cl aims : Incompl etely) ; 13-18, 23-27 , 32 , 33 (parti al ly)

Use of agents for preparati on of a medi cament for treati ng a drug-resi stant tumor, i n as far as not compri sed i n i nventi on 1, wherei n sai d agents compri se: ( i ) an agent whi ch downregul ates an amount and/or acti v i t y of a receptor that International Application No. PCTV I L2017/ 050586

FURTHER INFORMATION CONTINUED FROM PCT/ISA/ 210

i s expressed on the surface of the tumor; and(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or acti v i t y of at l east one member of the Fak fami ly, wherei n the drug of the drug-resi stant tumor targets sai d receptor that i s expressed on the surface of the tumor. An arti cl e of manufacture compri si ng an agent whi ch downregul ates an amount and/or acti v i t y of a tyrosi ne ki nase receptor; and(i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; and/or(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK, for use i n treati ng a drug-resi stant tumor, i n as far as not compri sed i n i nventi on 1. A pharmaceuti cal composi t i on compri si ng a pharmaceuti cal l y acceptabl e carri er and an agent whi ch downregul ates an amount and/or acti v i t y of a tyrosi ne ki nase receptor; and(i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; and/or(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK, for use i n treati ng a drug-resi stant tumor, i n as far as not compri sed i n i nventi on 1.

3 . cl aim: 2 1

A method of treati ng tri pl e negati ve breast cancer (TNBC) i n a subject i n need thereof compri si ng analyzi ng the amount of EGF-R expressi on i n a tumor of the subject, and when sai d amount i s above a predetermi ned l evel admi ni steri ng t o the subject a therapeuti cal l y effecti ve amount of: ( i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of PYK2 ; and/or(i i ) an agent whi ch speci f i cal l y downregul ates an amount and/or an acti v i t y of FAK.

4 . cl aims : 34-40

An ex v i vo method of predi cti ng prognosi s of TNBC i n a subject, the method compri si ng determi ni ng a l evel and/or acti v i t y of a tyrosi ne ki nase receptor that i s expressed on tumor cel l s of the subject and at l east one member of the FAK fami l y i n a sampl e deri ved from the breast of the subject, wherei n an amount of sai d receptor and sai d member of the FAK fami l y above a predetermi ned l evel i s i ndi cati ve of poor prognosi s of TNBC. A ki t for determi ni ng prognosi s of TNBC i n a subject compri s ng ( ) an agent whi ch speci f i cal l y bi nds t o a tyrosi ne ki nase receptor; and(i i ) an agent whi ch speci f i cal l y bi nds t o at l east one member of the FAK fami ly. Patent document Publication Patent family Publication cited in search report date member(s) date

W0 2011069962 Al 16-06-2011 EP 2509592 Al 17 -10 -2012 P 2013512882 A 18 -04 -2013 US 2013012465 Al 1 -01 -2013 O 2011069962 Al 16 -06 -2011

EP 1228766 Al 07-08-2002 AT 503488 T 15 -04 -2011 CA 2436266 Al 08 -08 -2002 EP 1228766 Al 07 -08 -2002 EP 1355658 Al 29 -10 -2003 ES 2364128 T3 25 -08 -2011 P 5652982 B2 14 -01 -2015 P 2004517941 A 17 -06 -2004 US 2004082510 Al 29 -04 -2004 O 02060470 Al 08 -08 -2002