Characterization of Two Hair Cell Proteins in the Zebrafish Lateral Line

CHARACTERIZATION OF TWO HAIR CELL PROTEINS IN THE ZEBRAFISH LATERAL LINE

BY ROBIN WOODS DAVIS

Submitted in partial fulfillment of the requirements

For the degree of Master of Science

Thesis Advisor: Dr. Brian M. McDermott Jr.

Department of Biology

CASE WESTERN RESERVE UNIVERSITY

August 2016

CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Robin Woods Davis

candidate for the degree of Master of Science *.

Committee Chair

Ryan Martin

Committee Member

Brian M. McDermott Jr.

Committee Member

Hillel Chiel

Committee Member

Ruben Stepanyan

Date of Defense

May 23, 2016

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents

List of Tables ...... 2 List of Figures ...... 3 Acknowledgments ...... 4 Abstract ...... 5 Introduction ...... 6 Hearing and the Cochlea ...... 6 The Hair Cell ...... 8 The Mechanotransduction Channel ...... 12 Potential Channel Proteins ...... 14 Zebrafish as a Model Organism ...... 24 Materials and Methods ...... 29 Zebrafish strains and husbandry ...... 29 Microphonic potential recording ...... 29 Results ...... 31 Tmc2b is differentially required in lateral line neuromasts ...... 31 Microphonic potentials in the lateral line neuromasts of Piezo1 mutants ...... 37 Discussion ...... 40 Appendix ...... 46 Model for Piezo1 Effect on Mechanotransduction ...... 46 Microphonic Potential Example Traces ...... 47 Creation of Tmc1 CRISPR mutant ...... 51 References ...... 54

List of Tables

Table 1…………………………………………………………………………...53

List of Figures

Figure 1….………………………………………………………………………..7 Figure 2………………………………………………………………………….10 Figure 3………………………………………………………………………….11 Figure 4………………………………………………………………………….16 Figure 5………………………………………………………………………….20 Figure 6………………………………………………………………………….22 Figure 7………………………………………………………………………….26 Figure 8………………………………………………………………………….27 Figure 9………………………………………………………………………….32 Figure 10………………………………………………………………………...33 Figure 11………………………………………………………………………...34 Figure 12………………………………………………………………………...35 Figure 13………………………………………………………………………...36 Figure 14………………………………………………………………………...37 Figure 15………………………………………………………………………...39 Figure 16………………………………………………………………………...46 Figure 17………………………………………………………………………...47 Figure 18………………………………………………………………………...47 Figure 19………………………………………………………………………...48 Figure 20………………………………………………………………………...48 Figure 21………………………………………………………………………...49 Figure 22………………………………………………………………………...49 Figure 23………………………………………………………………………...50 Figure 24………………………………………………………………………...52 Figure 25………………………………………………………………………...53

Acknowledgments

First and foremost, I would like to thank my advisor Dr. Brian M. McDermott Jr. for his mentorship and support, for his enthusiasm, and for letting me work on such an awesome project. I would also like to thank my former lab members and friends Victoria (Shih-

Wei Chou), for her guidance and insightful thoughts (even from California), Jiaqi Hu,

Nick Sarn, and Lana Pollock for their sheparding me through my early days of learning

CRISPR and zebrafish work, and Nilay Gupta, for his artistic talents and moral support; as well as Carol Fernando, our ever-knowledgeable lab manager; and current lab members Sara (Shaoyuan) Zhu and Kevin (Zongwei) Chen for their support and bonhomie. I also must thank Dr. Ruben Stepanyan for sharing with me his expertise in electrophysiology and for his very patient troubleshooting when things went wrong. And finally, my completing this program would not have been possible without the love and encouragement from my husband, Zach Davis, who steady presence and support as I went from a theater administrator to scientist was invaluable.

Characterization of Two Hair Cell Proteins in the Zebrafish Lateral Line

ROBIN WOODS DAVIS

Abstract

Mechanotransduction is an important mechanism found in several sensory systems. It is the act of transforming a mechanical stimulus into an electrical response, the language of the nervous system. In the auditory, vestibular, and lateral line system, the sensory receptor of mechanosensation is the hair cell, a cell so named because of the bundle of stereocilia on its apical surface. When the stereocilia are deflected as a result of the movement of the fluid surrounding them, ion channels located at their tips open and cations enter, creating an electrical current. This thesis examines the function of two proteins found in hair cells, using gene-specific knockout zebrafish lines. The experiments performed help to elucidate the complex diversity of proteins involved in the hair cell.

Introduction

Hearing and the Cochlea

At about 20 weeks’ gestation, human hearing begins to develop, giving us one of our first interactions with the outside world (Hepper and Shahidullah 1994). Our hearing develops, and we are able to perceive sound from 20 Hz to 20 kHz. As we grow older, our hearing begins to decline; many of us losing the highest range of pitches beginning at around 20 years old (National Institute of Deafness and Other Communication

Disorders). One in three adults over 65 has disabling hearing loss, and one in eight people over 12 have some hearing loss (NIDCD). Hearing loss can be genetic, due to a mutation of one of the many genes that are involved in hearing, but can also be caused by such triggers as loud noise or illness. One of the goals of hearing research is to determine the proteins involved in the auditory system so that therapies to treat or prevent deafness can be developed.

The job of the auditory system is to convert sound waves — compressions and rarefactions of air — into the electrical signals understood by the brain. This is done through the process of mechanotransduction. Sound waves enter the outer ear and transfer their energy to vibrations of the eardrum and middle ear bones, which amplify the sound (Figure 1a). The last of these bones, the stapes, contacts the oval window,

sending vibrations into the fluid-filled inner ear. It is here, in the cochlea, where mechanotransduction takes place.

The cochlea is divided into three fluid filled compartments: the scala tympani, the scala media, and the scala vestibuli (Figure 1b). Inside the scala media which, as the name suggests, lies between the scala tympani and vestibuli, is found the organ of Corti

(Figure 1c). The organ of Corti contains around 16,000 hair cells arranged in four rows surrounded by supporting cells, all of which rest on a basilar membrane.

Figure 1. (A) The mammalian ear showing the outer ear, or pinna, the middle ear, consisting of the tympanum, malleus, incus, and stapes, and the inner ear, which is the snail-shaped cochlea and circular vestibular labyrinth. (B) A cross-section of the cochlea showing the three compartments, the scala vestibuli, scala media, and scala tympani. (C) The scala media showing the locations of the inner and outer hair cells, as well as the tectorial and basilar membranes. Reprinted from Principles of Neural Science 5th Ed. Kandel et al. (Hudspeth 2013).

Hair cells are named after the bundles of hundreds of stereocilia — tall, thin actin- based processes — found on their apical ends. In the ear, there are two groups of hair cells. The outer hair cells, found closer to the outside of the cochlea, lie in three rows, and their hair bundles are embedded in the tectorial membrane, a gelatinous membrane which rests over the top of the organ of Corti. The inner hair cells form one row, and their hair bundles are free-standing. When the basilar membrane oscillates in response to a sound, the hair bundles are deflected, either by the tectorial membrane, in the case of the outer hair cells, or by the endolymph fluid which fills the scala media, in the case of the inner hair cells.

The basilar membrane, the hair cells upon it, and the nerves that innervate those cells have a tonotopic organization scheme — each sound wave stimulates an area of the basilar membrane that corresponds to its frequency. The base of the membrane reacts to high frequency waves while the apex reacts to low frequency waves. In this way, a complex sound is deconstructed into pure tones which are carried on different nerve fibers to the brain (Kandel 2013).

The Hair Cell

The hair cells are the sensory receptor of the auditory system. They are generally columnar in shape and innervated by afferent and/or efferent nerves on the basal side

(Figure 2). The hair cells are connected to the surrounding supporting cells by tight junctions, which sequester the endolymph fluid bathing the apical surface from the perilymph fluid that surrounds the basolateral surface of the cell. The stereocilia that protrude from the hair cells’ apical surfaces are made of bundled F-actin, and taper at the

base to insert into a cuticular plate, found just under the apical membrane. Hair bundles also have microtubule-based kinocilia as their tallest process, although this true cilium regresses during development in the adult mammalian cochlea. The number and height of stereocilia vary widely in different species and organs. This affects bundle stiffness and sensitivity to different frequencies (Fettiplace and Kim 2014).

The stereocilia are arranged in rows, and each row is taller than the one before it, giving the bundles a staircase-like appearance. Each stereocilium is connected to the two stereocilia in front of and behind it by tip links, protein chains which attach the tip of one stereocilium to the proximal side of the next taller stereocilium. At the tip of each stereocilia, except the tallest, are a small number of gated ion channels. At rest, approximately 10% of these channels are open, causing a small inward current of potassium (Kandel 2013). When the hair bundles are deflected in response to a sound, deflection towards the tallest stereocilia transfers tension to the tip links, inducing the ion channels to open further. The increased potassium ion current causes the cell to depolarize and release the neurotransmitter glutamate. Deflection in the opposite direction causes the channels to close, stopping the current. Glutamate release triggers depolarization in the post-synaptic membrane of the nerve cells, and so the signals are sent to the brain where they can be perceived as sound.

Figure 2. The hair cell. Stereocilia on the apical surface are arranged into a staircase-like array. The stereocilia insert into an actin-based cuticular plate. The hair cell synapses with both afferent and efferent nerves. Reprinted from Principles of Neural Science 4th Ed. Kandel et al. (A. J. Hudspeth).

The stereocilia of a hair bundle are linked together by two main types of links.

Lateral links connect each stereocilium to several stereocilia around it and can include top links, shaft links, and ankle links (Furness and Hackney 1985). Tip links, composed of the proteins Protocadherin 15 (PCDH15) at the lower end and Cadherin 23 (CDH23) at the upper end, connect the tip of one stereocilium to the proximal side of the next taller stereocilium. While lateral links serve to provide stiffness to the hair bundle and allow the bundle to move as one when perturbed (Furness and Hackney 1985), tip links are more directly involved in mechanotransduction (Figure 3). Mice with mutated copies of

PCDH15 and CDH23 were found to have abnormal mechanotransduction currents

(Alagramam et al. 2011). When the hair bundle is deflected, tension transferred by the tip links opens the mechanotransduction channel. The gating spring model posits that this

force is transferred through an elastic element. However, the specific way in which tip links interact with the mechanotransduction channel has yet to be elucidated. Several models have been proposed (Effertz et al. 2015). One model posits that the tip link could be connected to the mechanotransduction channel, either directly or through an accessory protein. In another model, the tip links are tethered to the membrane and transmit their force to the ion channel through deformation of the lipid bilayer. In both of these scenarios, it is possible that the mechanotransduction channel is also tethered to the cytoskeleton (Effertz et al. 2015).

Figure 3. (A) The stereocilia, which are graded in height, are connected to one another through ankle links, top connections and tip links. (B) View of stereocilia tip. PCDH15 and CDH23 connect tip of one stereocilia to proximal lateral side of the next tallest

stereocilia. (C) Tension through the tip link opens the ion channel, allowing entry of potassium and calcium ions. Reprinted from Kazmierczak and Müller 2012.

The Mechanotransduction Channel

The mechanotransduction channel is a very important piece of the puzzle, but the proteins that make up the channel are still being elucidated. While the identity and number of proteins involved has yet to be conclusively determined, many of the channel's biophysical and pharmacological properties have been identified. The mechanotransduction channel is a non-selective cation channel. The transduction current is carried primarily by potassium ions, the ion of highest concentration in the endolymph

(Hudspeth 1989). The channel has been theorized to have an asymmetric pore, larger on the extracellular side than it is on the intracellular side (Pan et al. 2012). An electronegative vestibule on the extracellular side of the channel helps to concentrate cations, increasing conductance (Pan et al. 2012). It is unknown whether this vestibule is part of the same protein which forms the pore or a separate accessory protein. The mechanotransduction channel could instead be a mechanotransduction complex, with different proteins acting as pore forming element (which itself could be a multimer of different proteins), conductance influencing vestibule, and tip link force transmitter.

The conductance of the channel, i.e. its ability to pass an electric current, can vary widely, depending on the organism and location of the hair cell (vestibular system, auditory system, or lateral line system). In fact, variations in channel conductance have been found even within the cochlea. Like the basilar membrane, hair cells also have a tonotopic gradient. Hair cells near the apex, where the basilar membrane is most sensitive to low frequencies, have been found to have a higher conductance than hair cells closer to

the base, where the basilar membrane is most sensitive to high frequencies (Beurg et al.

2006). It has been suggested that these differences in conductance are due to changes in the composition or form of the vestibule (Beurg et al. 2014). A change from electronegative to neutral residues could decrease conductance (Beurg et al. 2006). These changes in composition could be accomplished by several means. Both low and high conductance isoforms of the channel or proteins of different conductance could be available, and these could be combined in different configurations to provide the necessary tonotopic flexibility (Fettiplace and Kim 2014). Alternately, if the vestibule protein is separate from the pore forming protein, different numbers of vestibule proteins could be added to the pore protein to affect conductance (Fettiplace and Kim 2014).

While the transduction current is carried by the potassium ion, the calcium ion current also plays an important role. The ion channels were first definitively localized at the apical tips of stereocilia by fluorescence imaging of calcium currents (Lumpkin and

Hudspeth 1995). In addition, calcium ions are necessary for tip link formation, stabilizing the interaction between CDH23 and PCDH15 (Kazmierczak et al. 2007). Also, calcium is involved in adaptation, the process by which the open probabilities of the mechanotransduction channels are adjusted to remain sensitive to different levels of stimuli. Adaptation occurs on two time scales: fast and slow. During fast adaptation, calcium ions, acting as permeant blockers, are thought to decrease the potassium current entering the cell by binding to a site inside the channel (Corns et al. 2016). Calcium also plays a role in slow adaptation. Myosin motors found on the upper ends of tip links are hypothesized to slide down the side of the stereocilium to decrease tension on the tip links, thus decreasing the open probability of the mechanotransduction channel by

shifting the current-displacement curve to the left (Holt et al. 2002). Any candidate protein for the mechanotransduction channel will have to align with these previously discovered criteria.

Potential Channel Proteins

It has been known for decades that the mechanotransduction current of the hair cell is caused by mechanical action on an ion channel (Hudspeth 1982); however, the identity of this protein or proteins is still unknown. One important question still to be answered is how many proteins are involved in the mechanotransduction complex. It has yet to be discovered whether the pore forming subunit and the vestibule subunit are the same protein. Additionally, whether the lower tip link protein, PCDH15, is connected directly to the channel protein or to an accessory protein has not been determined.

Another obstacle that makes discovering the channel protein more difficult is the small volume of protein in each cell. It has been estimated that there are 1-2 channel proteins per stereocilia (Beurg et al. 2006). Such a small quantity of protein is difficult to isolate for further study. There are many criteria that must be fulfilled by a putative channel protein. Effertz et al. have organized the criteria into four categories: intrinsic properties, localization, genetic manipulation, and interaction partners (Effertz et al. 2015).

The Tmc superfamily

Several candidate proteins have been identified. One of the most promising candidate families is the transmembrane channel-like (Tmc) family of proteins, particularly Tmc1 and Tmc2. The Tmc superfamily was first discovered through its

correlation with deafness. Kurima et al. identified TMC1 in 2002, determining that it was the cause of nonsyndromic recessive deafness in several large North American, Indian, and Pakistani families, as well as the gene behind two deaf mouse strains, deafness (dn) and Beethoven (Bth) (Kurima et al. 2002). In all, 29 mutations of TMC1 have been discovered that cause deafness in humans (Holt et al. 2014). The authors were unable to ascertain its specific purpose through sequence analysis, but they were able to determine that there were six transmembrane domains (thus the name they originally gave to the protein: transmembrane cochlea-expressed gene). Tmcs are found in a wide variety of organisms, including Xenopus, Drosophila, C. elegans, and zebrafish (Kurima et al.

2003). The Tmc family has 8 members in mammals. Subfamily A is composed of Tmc1,

Tmc2, and Tmc3, which share 36%-56% identity (Keresztes 2003). In zebrafish, tmc2 has two paralogs: tmc2a and tmc2b. All Tmcs have a conserved domain, the Tmc domain, which is a 120 amino acid region in between the fourth and fifth transmembrane domains (Kurima et al. 2003) (Figure 4a). It has been suggested that the Tmc domain could be a pore loop because it contains two mildly hydrophobic areas which may cross the membrane (Labay et al. 2010).

Figure 4. (A) Amino acid sequence and topology of human TMC1. Human deafness- causing mutations are marked with upper case letters. TMC domain is shaded grey. Reprinted from Holt et al. 2014

Any putative channel protein will have to be localized correctly at both the macro

(system) and micro (organ) level. In situ hybridization of zebrafish has shown Tmc1,

Tmc2b, and Tmc2a localize at the adult inner ear and RT-PCR has localized the three proteins in the lateral line neuromasts (Maeda et al. 2014). Mouse TMC2 has been localized to the tips of the stereocilia using a GFP-tagged version of the protein

(Kawashima et al. 2011). In zebrafish, Tmc1 and Tmc2a have been found to interact with

Pcdh15, the lower tip link protein, using a split-ubiquitin two yeast hybrid screen. These results were verified in mice by co-immunoprecipitation (Maeda et al. 2014). Tmc2a's

interaction with Pcdh15 is important, in that it links a Tmc with a protein that is thought to be involved with opening and closing the channel. However, these results cannot definitively place Tmc as part of the ion channel. There are alternate models of channel opening that connect the tip links to an accessory protein, not the ion channel itself.

Along with the correct physical localization, the putative channel protein must also be expressed at the correct time: concurrently with the onset of mechanotransduction. Mice express both TMC1 and TMC2 in the cochlea. TMC2 expression is concurrent with the onset of mechanotransduction, which occurs at approximately postnatal day 0 (P0) in the basal region of the cochlea and P2 in the apical region of the cochlea, and then begins to decrease after the first postnatal week. TMC1 expression begins several days after the beginning of mechanotransduction and continues to rise for at least 3 weeks (Kawashima et al. 2011). These data led the authors to theorize that TMC2 is active in early hair cell development, but is later replaced by TMC1, suggesting different uses for TMC1 and TMC2 in hair cell mechanotransduction.

Most importantly, TMC1 and TMC2 have been shown to play a role in modulating the mechanotransduction current. Kawashima et al. found that mice that were homozygous for a Tmc1 mutation wherein the gene was truncated at the first transmembrane section had reduced mechanotransduction currents in the cochlear apical outer hair cells, leading to hearing loss at P5-P7 and hair bundle degeneration at P14.

Mice that were heterozygous for a Tmc2 mutation, constructed in the same manner as above, and with a Tmc1Δ/Δ background, had currents that were more reduced than

Tmc1+/+ Tmc2Δ/+ mice. Mice that were homozygous for the double deletion of both Tmc1 and Tmc2 had no hearing, no mechanotransduction currents, and showed even earlier

degeneration of their hair cells at days P5-P7 for outer hair cells and P9 for inner hair cells. To determine the sufficiency of TMC1/2, the authors attempted to rescue P0

Tmc1Δ/Δ Tmc2Δ/Δ mice using injections of either Tmc1 or Tmc2 expression vectors. They were able to rescue the phenotype, restoring measurable levels of mechanotransduction currents using either a vector with a promoter which expressed low levels of Tmc2 or another vector with a more highly expressed level of Tmc1 (Kawashima et al. 2011).

TMC1 and TMC2 have also been shown to be important in calcium permeability.

Pan et al. studied mice that had target deletions of TMC1 and TMC2 as well as

Beethoven (Bth) mice, who have a point mutation in the 412th amino acid residue of

TMC1 (M412K) (Pan et al. 2013). In one set of experiments, they calculated the conductance of the mechanotransduction channels in Tmc1Bth/Δ Tmc2Δ /Δ hair cells and compared that to the conductances of Tmc1+/Δ Tmc2Δ /Δ and Tmc1Bth/Δ Tmc2+/Δ hair cells at two different calcium concentrations. The lower calcium concentration was meant to mimic normal endolymph conditions, while the higher concentration was calcium’s concentration in extracellular fluid. The data showed that the mice with the Bth mutation had a 40% reduction in slope conductance when calcium was increased while the other two mice had a 30% reduction. This suggests that the Tmc1 point mutation makes it easier for calcium to block the channel. The authors then measured the calcium/cesium permeability ratio on the same mouse strains. They found that the hair cells that expressed TMC2 were more selective for calcium than the cells that expressed TMC1.

The cells with the Bth mutation had reduced calcium selectivity. With these data showing that TMC mutation altered the calcium permeability, the authors demonstrated the necessity of TMC to normal ion channel functions.

These experiments also suggest a way that Tmc could cause different conductances along the tonotopic gradient. Electrophysiology experiments on wild type mice demonstrated that outer hair cells increased in current and conductance as frequency increased (Beurg et al. 2006). It has been suggested that a heteromultimer containing different assemblies of TMC1 and TMC2 subunits could create the gradient (Pan et al.

2013). TMC1 and TMC2 may have that ability, but their physical interactions with one another have not yet been elucidated.

Despite these findings, the Tmc family members have not yet been proven to be a channel or channel pore in a mammalian species. But, in C. elegans, the tmc-1 ortholog has been suggested to be a sodium-sensitive channel used for chemosensation, with reduced calcium transients in TMC-1 mutants (Chatzigeorgiou et al. 2013). Additionally, the researchers were able to express tmc-1 in two other heterologous cell lines (HeLa and

HEK293T) and found that sodium-sensitive currents occurred there as well. While Labay et al. attempted to express TMC1 in COS-7 cell, they were unsuccessful in detecting

TMC1 in the plasma membrane (Labay et al. 2010). The protein was detectible in the ER membrane, but was unable to localize as expected, perhaps due to accessory proteins missing in the heterologous system. Therefore, we can still not rule out that Tmc is merely the vestibule protein, which is able to affect the channel permeation properties, but not the pore forming protein.

A critical finding that has advanced the argument for Tmc's role as only a vestibule protein was first reported in a paper by Kim et al. (Kim et al. 2013). As mentioned previously, the displacement of the hair bundle towards the tallest edge puts tension on the tip links, causing the mechanotransduction channels to open and an inward

current to occur (as shown in Figure 3, above). However, these authors have discovered a "reverse-polarity" current, which only occurs when the bundle is displaced towards the shortest stereocilia in the Tmc1-/- Tmc2 -/- double mutant mouse (Figure 5). The 0.5 - 0.8 nA current was primarily seen in the double mutant during days P4 - P6 — only a few mice cochlea retained the current through P10. Heterozygotes for either Tmc1 or Tmc2 had currents that occurred with normal deflection. Examining the ionic properties in these double mutants further, the reverse potential was found to be +6 mV, implying that the channel causing the anomalous current, like the normal mechanotransduction channel, is a nonselective cation channel (Kim et al. 2013).

Figure 5. Reverse-polarity current. In single mutants of Tmc1 and Tmc2, (3rd and 4th trace), inward current occurs when bundle is displaced in the positive direction (1st trace). In the double mutant (2nd trace) inward current occurs when bundle is displaced in the negative direction. Reprinted from Kim et al. 2013.

These reverse-polarity currents have also been seen in other experiments. When extracellular calcium is chelated using 1,2-bis(o-aminophenoxy) ethane-N,N,N9,N9-

tetraacetic acid (BAPTA), the tip links degrade quickly. Early postnatal wild type mouse hair cells that had been treated with BAPTA showed reverse-polarity currents after about

30 seconds of treatment (Kim et al. 2013). Mice that have tip link protein defects in

CDH15 or PCDH23 and develop disordered hair bundles with few tip links also display the reverse-polarity current (Alagramam et al. 2011). Additionally, Marcotti et al. found that hair bundles that had been damaged by repeated strong stimulation displayed these irregular anomalous currents (Marcotti et al. 2014).

There are two leading theories to explain this phenomenon. One theory is that

TMC1/2 are the vestibule proteins and/or couple the tip link to the channel, and the anomalous current is caused by the actual pore forming protein (Beurg et al. 2014). The other theory is that TMC1/2 are the channel protein, and removing them, and thus abolishing the main mechanotransduction current, unmasks the current caused by another channel (Marcotti et al. 2014). This other channel protein could be stretch activated, so that it would not need any type of intra-stereociliary link to be opened. It may also be located in a different area of the stereocilia, so that the force required to open it is in opposition to the forces required to open the mechanotransduction channel. Marcotti et al. suggests that this other channel may be the precursor to the normal mechanotransduction channel — not yet located at the tips of the stereocilia and lacking a vestibule, which may be formed by TMC1/2 (Marcotti et al. 2014).

Piezo: A stretch activated channel

One protein that was suggested as the progenitor of these currents, due to its biophysical properties, is Piezo1. The Piezos are a family of large stretch-activated cation channels found in many species ranging from plants to fish to humans, with most species having two members, Piezo1 and Piezo2 (Coste et al. 2010). The Piezos are gated by force transmitted directly through the lipid bilayer, without needing to be tethered to the cytoskeleton (Cox et al. 2016). They can also be activated by fluid shear stress (Ranade et al. 2014). Piezo1 was originally discovered in a mouse neuroblastoma line (Neur2A), where it produced a rapidly adapting current when pressure was applied to the cell using a pipette (Coste et al. 2010). Piezo1 and Piezo2 were also found to induce mechanically sensitive currents when transfected in three different cell types (Coste et al. 2010). Piezo1 has 14 transmembrane segments and forms a homotrimer (Ge et al. 2015). Piezos have a conserved PFEW domain that has been theorized to be involved in conductance or gating

(Bagriantsev et al. 2014). At least three orthologs have been found in zebrafish: piezo1, piezo2a, and piezo2b.

Figure 6. Topology of mouse Piezo1. Red transmembrane segments are putative central pore. Blue segments are peripheral helices. Reprinted from Zhao et al. 2016.

The role of Piezo proteins is very diverse and has been elucidated in several systems. In the sensory system of the zebrafish, piezo2b is expressed in Rohon-Beard neurons, which innervate the skin. Knockdown by morpholinos abolishes the light touch response (Faucherre et al. 2013). Piezo2 has also been found to be required for Merkel cell mechanotransduction in mice (Woo et al. 2014). Piezos play a very important role in the circulatory system. Piezo1 is vital in vascular endothelial cell morphology where their responsiveness to shear stress is necessary for proper vascular remodeling during embryonic development (Ranade et al. 2014). They are also important in erythrocyte homeostasis in zebrafish. Zebrafish embryos in which piezo1 had been knocked down by morpholino had reduced erythrocyte numbers (Faucherre et al. 2013). The authors conjectured that osmotic induced swelling normally leads to the opening of Piezo1 channel so that the water influx can be counteracted. However, the removal of these channels allows the swelling to lead to lysis, reducing the overall number of erythrocytes.

While the Piezo proteins do not match the characteristics of the mechanotransduction channel, RT-PCR (Erickson and Nicolson 2015) and microarray data (Liu et al. 2014) do place them in the hair cell. Kim et al. noted that the properties of a channel that would cause the reverse polarity current are similar to the properties of the Piezos, specifically with regard to their permeability to sodium and calcium ions, the effects of calcium ion concentration on their unitary conductance, and their inactivation profile (Kim et al. 2013). However, recent research suggests that Piezo may not be the cause of the anomalous current. Corns and Marcotti found that the anomalous current was still present in the cochlear outer hair cells of Piezo1 haploinsufficient mice (Corns and

Marcotti 2016).

Other possible mechanotransduction channel complex proteins

Another ion channel that has been put forth as the possible mechanotransduction channel is the zebrafish ortholog of Drosophila no mechanoreceptor potential C

(NompC). This gene encodes a channel from the transient receptor potential (TRP) superfamily, TRPN. In zebrafish, morpholino knockdown of this protein created morphants with no startle reflex and erratic swimming behavior, thought to be caused by vestibular and balance defects (Sidi et al. 2003). However, other studies performed on a mammalian member of the TRP family, TRPA1 show that, while TRPA1 does localize to the tips of the stereocilia in mice, mice with critical exons of the gene deleted showed no hearing deficit (Kwan et al. 2006). TRP channels may yet play a role in mechanotransduction, but more study is needed.

Zebrafish as a Model Organism

The zebrafish (Danio rerio) is an excellent tool for the study of the hair cell.

Zebrafish are small and easy to maintain. Females can lay clutches of 100-300 eggs weekly. Since eggs are fertilized externally, injections of transcription activator-like effector nucleases (TALEN) and clustered regularly interspaced short palindromic repeats (CRISPR) constructs can be done at the one-cell stage to create knockout zebrafish. Additionally, the short generation time of 2-4 months means that homozygous mutants can be bred relatively quickly once a founder has been identified. The ear is also readily accessible at the larval stage. Optical transparency at a young age also assists in visualizing fluorescence-tagged proteins or dyes and stains.

The zebrafish genome has been sequenced and annotated. Zebrafish and humans share about 70% of their genomes (Howe et al. 2013), and many of the genes which have been found to cause deafness in humans are also present in zebrafish. Due to a whole genome duplication, the zebrafish genome contains many paralogs; for every human gene, there are an average of 2.28 zebrafish genes (Howe et al. 2013). Tmc2 has 2 zebrafish paralogs: tmc2a and tmc2b, and likewise Piezo2 also has 2 paralogs: piezo2a and piezo2b. These duplications may make it necessary to knock out both paralogs to see results that are similar to those in other organisms. However it is also the case that duplicate genes can evolve to have different functions from one another, as may be the case with tmc2a and tmc2b.

The anatomy of the zebrafish confers some advantages to study of the hair cell. Like other fish and some amphibians, zebrafish have a lateral line system. This system, composed of the neuromast, the receptor organ formed from a cluster of hair cells, and the nerves that innervate it, provides information about water flow and thus is useful in predator evasion, object avoidance, schooling behaviors, and rheotaxis. In larval and juvenile zebrafish, the neuromast system is easily accessible in the live specimen, facilitating access to hair cells for electrophysiological study. While the ear is also readily accessible and visible, the membrane surrounding the ear must be punctured for microphonic potential recordings to be made.

Figure 7. The neuromast. In the posterior lateral line, neuromasts are circular viewed from above. Hair cell are innervated by both afferent and efferent fibers. Reprinted from Ghysen et al. 2004

The sensory organ of the lateral line system, the neuromast, is a rosette-shaped structure formed by a bundle of hair cells and supporting cells (Bleckmann and Zelick

2009) (Figure 7). The hair cells arise in pairs, with the axis of depolarization of each being 180 degrees from the other. This gives each neuromast sensitivity to displacement from two opposing directions (Bleckmann and Zelick 2009). Thus, when the bundle is deflected in one direction along its axis of mechanosensitivity, only 50% of the hair cells will depolarize, while the other 50% will hyperpolarize. The hair bundles are covered by a gel-like cupola and extend either into the environment, in the case of superficial neuromasts, or into a fluid filled canal embedded just underneath the skin, in the case of canal neuromasts. Every hair cell is innervated with both afferent and efferent neurons.

Each afferent neuron synapses upon multiple neuromasts, but only contacts hair bundles of the same polarity.

The zebrafish lateral line system has two branches: the anterior lateral line, whose neuromasts are located on the head, and the posterior lateral line, whose neuromasts are

on the trunk. In both of these branches, the neuromasts are arranged in a stereotyped pattern (Figure 8). Each branch of the lateral line originates from a primordium, a group of cells which develops from a cephalic placode. Each primordium migrates down the length of the fish, depositing proneuromasts, which relocate to the rear of the primordium and break off from the group of cells. The first primordium, primI, begins its movement around 20 hours post fertilization (hpf) and reaches the tail at about 48 hpf, having deposited neuromasts L1-L5, and itself fragmenting into two or three terminal neuromasts. Around the time it reaches the tail, primII, the second primordium, begins to migrate, developing from the same placode. PrimII deposits neuromasts from LII.1-LII.3 starting at 3 dpf, ending its journey near the anus. PrimII travels more slowly, taking one week to reach its end (Nuñez et al. 2009). The axis of mechanosensitivity for primI- derived neuromasts has anterior-posterior orientation, while the axis of primII-derived neuromasts is dorsal-ventral. The anterior lateral line is composed of the superorbital line

(SO), infraorbital line (IO), mandibular line (M), opercular line (OP), otic line (O), middle line (MI), and occipital line (OC). The first neuromasts for these lines develop between 34 and 72 hpf (Raible and Kruse 2000).

Figure 8. Illustration of the zebrafish lateral line system at 5 dpf. Red neuromasts are posterior lateral line, blue dots are anterior lateral line, and beige circles are ganglia. L1 – L5 neuromasts are deposited by primI, LII.1 – LII.2 neuromasts are deposited by primII.

The anterior lateral line has been shown to be important to foraging in larval zebrafish, particularly when vision is compromised. When the anterior lateral line neuromasts were ablated using the chemical neomycin, zebrafish were unable to send the water flow caused by prey, thus their feeding strikes occurred less often and were less accurate (Carrillo and McHenry 2016). The posterior lateral line assists larval zebrafish from themselves becoming prey. Zebrafish whose lateral line was ablated were significantly less able to avoid predator strikes (Stewart et al. 2013).

Through the work of several previous students, our lab has created several lines of zebrafish with putative ion channel protein knockouts. Our aim in the following studies is to characterize two of the proteins that may be involved in mechanotransduction of the hair cell in the zebrafish lateral line system, Piezo1 and Tmc2b, using electrophysiology and imaging techniques. A note on nomenclature: Originally, our lab referred to tmc2b as tmc2a and tmc2a as tmc2b. We have exchanged gene names to match those in literature that has since been published (Maeda 2014).

Materials and Methods

Zebrafish strains and husbandry

Zebrafish strains Tmc2b TL1 (ENSDARG00000030311), Piezo1 TL1

(ENSDARG00000076870), and Wild-type Tübingen (Tü) were maintained and bred in the Case Western Reserve Zebrafish Facility using standard procedures (Nüsslein-

Volhard, C. et al., 2002).

Microphonic potential recording

Zebrafish ranging from 5 to 8 dpf were anesthetized using MS-222 (Sigma-Aldrich,

St. Louis, MO) added to a standard bath solution containing 12 mM NaCl, 2 mM KCl, 10

mM HEPES, 2 mM CaCl2, 0.7 mM NaH2PO4 and adjusted to pH 7.3. Larvae were secured on a recording chamber with dental floss tie-downs (Ricci and Fettiplace 1997) and covered with standard bath solution. Observations were made with an Olympus

BX51WI microscope under 4x 0.1 NA and 100x 1 NA objectives. Images were captured with a Grasshopper3 CMOS camera (Point Grey, Richmond, BC, Canada). Neuromast hair bundles were deflected using a fluid jet from a pipette of borosilicate glass. The pipette tip of ~7 µm was placed approximately 50 µm from the bundle. The fluid jet was controlled by an HSPC-1 (ALA Scientific Instruments, Farmingdale, NY) which

delivered a sinusoidal stimulus of 50 Hz, generated by jClamp software (SciSoft, courtesy of Joseph Santos-Sacchi, Yale University, New Haven, CT). Microphonic potentials from the apical side of the hair cells were recorded using a borosilicate glass pipette with a resistance of 3-6 MΩ filled with standard bath solution. The potentials were recorded with jClamp in current clamp mode and amplified using a PC-505B amplifier (Warner Instruments, Hamden, CT), SIM983 scaling amplifier (Stanford

Research, Sunnyvale, CA) and PCI-6221 digitizer (National Instruments, Austin, TX).

The recordings were low-pass filtered at 200 Hz, and at least 500 trials per averaged to create each trace.

Results

Tmc2b is differentially required in lateral line neuromasts

Previous research had shown Tmc2b expression in lateral line neuromasts (Maeda et al. 2014) Using somatic transient transgenesis in zebrafish, GFP-tagged Tmc2b was found to localize to the tips of stereocilia in hair cells (unpublished data generated by

Shaoyuan Zhu in our lab). This places Tmc2b in a location where it could be a component of the mechanotransduction channel complex. To explore the role of Tmc2b in mechanotransduction in hair cells, TALEN-generated knockout zebrafish were created

(unpublished data by Shih-Wei Chou and Li Liu in our lab) which contain a 7 bp deletion

th in the 4 exon of tmc2b. Through a frame shift, which resulted in premature stop codon, this deletion is expected to create a truncated protein which contains none of the predicted transmembrane domains. Upon examination with SEM (unpublished data generated by Ruben Stepanyan), these mutants were found to have no visible structural defects either in the morphology of the hair bundles or in the tip links.

To determine the effect of Tmc2b on mechanotransduction currents, microphonic potentials were recorded from lateral line neuromasts. These potentials, used to assay the function of mechanotransduction, measure the extracellular potential changes due to the

influx of cations in the mechanically stimulated hair cell (Nicolson et al. 1998). The neuromasts were mechanically deflected with a 50-Hz sinusoidal stimuli delivered by a fluid jet. Extracellular recording of neuromasts produces a '2f' response wherein the alternating puff and suction from the fluid jet produce a response in oppositely oriented hair bundles (Corey and Hudspeth 1983) (Figure 9). Due to this response, the first and subsequent odd peaks of the trace can be attributed to the hair bundles activated by the puff, while the second and following even peaks can be attributed to the opposite subpopulation of cells.

Figure 9. (A) Example trace from wild-type fish. 8 peaks are seen, due to 2f response. (B) 50-Hz sinusoidal stimulus produced by fluid jet.

The primI-derived lateral line neuromasts were tested first, as they are the first to develop. Microphonic potential recordings showed that at 6 dpf, primI-derived neuromasts of the tmc2b-/- mutants had reduced microphonic potentials as compared to tmc2b+/- and tmc2b+/+ fish from the same clutch (Figure 10). In 60% of the tmc2b-/- fish tested, there was no response at all (n=15). Of the tmc2b-/- fish that did respond, the mean

potential was 5.2 ± 1.1 µV (mean ± SEM), 35% less that the tmc2b+/+ potential of 8.0 ±

0.81 µV. Intriguingly, the response when the neuromasts were deflected anteriorly was stronger than the response from posterior deflection (This series of experiments was performed by Shih-Wei Chou).

Figure 10. Microphonic potentials of PI neuromasts in tmc2b+/+, tmc2b+/-, and tmc2b-/- fish. tmc2b-/- fish showed a mean microphonic potential of 2.1 ± 0.80 µV overall.

To determine whether the dorsal-ventral facing neuromasts of the anterior lateral line also showed a differential directional requirement for tmc2b, the microphonic potentials of primII-derived bundles (LII.1 – LII.2) were also recorded. In 100% of the tmc2b-/- mutants, there was no microphonic response (n=9). This is in contrast to the mean microphonic potential for tmc2b+/- controls of 5.85 ± 0.44 µV (n=7) (Figure 10).

Figure 11. Microphonic potentials of PII neuromasts in control and tmc2b-/- fish. tmc2b+/- control fish showed a mean microphonic potential of 5.85 µV. No tmc2b-/- fish had a microphonic potential.

To visualize the process of mechanotransduction so that the active hair bundles could be determined, neuromasts were treated with FM1-43FX, a dye which enters hair cells only through functional mechanotransduction ion channels, during mechanotransduction (Gale et al. 2001). The fish were then counter-stained with phalloidin, which labels actin, the main structural protein of stereocilia. Actin is also found in the cuticular plate, the structure into which hair cells are inserted. However, unlike stereocilia, the kinocilium inserts into the cuticular plate at an actin-free area, the fonticulus. Thus the orientation of a particular hair bundle can be discerned at the optical plane of the cuticular plate using confocal microscopy. Together, these stains show the location and orientation of all hair cells in the neuromast, and specifically label cells with functional mechanotransduction (This series of experiments was performed by Shih-Wei

Chou).

These labeled hair bundles showed that in the tmc2b-/- mutants only 35% of the primI-derived hair bundles loaded with FM1-43FX. More interestingly, 93% of those loaded hair bundles faced the posterior end of the fish, while in tmc2b+/- controls, dye

was taken up evenly by all hair cells (Figure 12a,b). This finding suggests that, at this stage of development, Tmc2b is required for mechanotransduction in anterior-facing hair bundles — the bundles that would be deflected with stimuli from the rostral end of the fish. Similar to the primI neuromast, in tmc2b-/- mutants, 35% of the primII-derived hair bundles loaded, and of those hair bundles, 98% of them were facing to the ventral side of the fish (Figure 12c,d).

Figure 12. Confocal images of lateral line neuromasts. Actin is labeled cyan, neuromasts loaded with FM1-43FX are labeled red. (a,c,e) Control fish neuromasts which uptake dye in both orientations of hair bundles equally in (a) PrimI, (c) PrimII, (e) IO4. (b,d,f) PrimI (b) and PrimII (d) neuromasts of tmc2b-/- fish uptake dye in only a subset of hair cells.

IO4 (f) neuromasts of tmc2b-/- fish have similar uptake patterns to control fish. Yellow circle diagrams in the corner of each image show the generalized loading pattern of each neuromast. Red circles are cells which uptake dye, blue circles are hair cells that do not uptake dye. Experiments performed by Shih-Wei Chou.

With the aim seeing how widespread the lateral line system's dependence on

Tmc2b was, a selection of the anterior lateral line neuromasts were also characterized by labeling (experiments performed by Shih-Wei Chou). MI1 from the middle line, M2 from the mandibular line, and IO4 from the infraorbital line, like primII, have dorsal-ventral orientations. The M2 neuromast of tmc2b-/- mutants shows a dorsal-facing cell preference for loading, while the more dorsally located MI1 neuromast shows a ventral preference

(Figure 13). Interestingly, unlike all other neuromasts visualized, the IO4 neuromast shows no preference (Figure 12e,f).

Figure 13. Map of tmc2a reliance in a selection of anterior and posterior lateral line neuromasts. All neuromasts with anterior-posterior orientation need tmc2b for mechanotransduction in their anterior-facing bundles. Tmc2b reliance is varied in bundles with dorsal-ventral orientation.

These IO4 findings were also examined by electrophysiology. In tmc2b-/- mutants there was no significant difference between microphonic potentials evoked from either dorsal or ventral bundle deflections (Dorsal peak mean microphonic potential 6.74 ± 1.1

(n=9) µV, ventral peak mean microphonic potential 5.04 ± 0.64 µV (n=9) p = 0.22)

(Figure 14b). There was also no significant difference between the mean microphonic potentials evoked in tmc2b-/- mutants and tmc2b+/- controls (tmc2b+/- mean microphonic potential 8.84 ± 1.1 µV (n=10), tmc2b-/- mean microphonic potential 9.08 ± 0.84 µV

(n=6) p = 0.88) (Figure 14a). This set of experiments has shown that while tmc2b is necessary for mechanotransduction in the zebrafish lateral line system, and that it is differentially required both between and within neuromasts.

Figure 14. (A) Microphonics potentials of IO4 neuromasts in control and tmc2b-/- fish. (B) Microphonics potentials by orientation of hair bundle.

Microphonic potentials in the lateral line neuromasts of Piezo1 mutants

Piezo1 is a mechanically sensitive ion channel which has been shown to be present in ear hair cells (Liu et al. 2014; Erickson and Nicolson 2015). To explore the

function of Piezo1 in the hair cell, Piezo1 mutant fish were created by TALEN (by Shih-

Wei Chou, Jaqui Hu, and Li Liu), which have a 7 bp mutation in exon 1. This is predicted to disrupt the reading frame and create a premature stop codon, truncating the 2538 AA

rd protein after the 53 amino acid.

Upon inspection, homozygous piezo1 knockout fish showed no obvious balance defects, and had normal startle reflexes at 5 dpf. To begin to characterize these fish, microphonic potentials were measured from piezo1-/-, piezo1+/-, and piezo1+/+ fish from the same clutch at 5 and 6 dpf. Surprisingly, the heterozygote (piezo1+/-) and homozygote

(piezo1-/-) groups had higher mean potentials than the wild type (piezo1+/+) group, with p values of 0.42 and 0.04, respectively. The mean potential of the wild-type controls was

6.9 ± 0.23 (SEM) µV (n=6), while the mean potential of heterozygotes was 8.13 ± 0.61

µV (n=20) and for homozygotes 10.31 ± 0.60 µV (n=5) (Figure 15a). There was no statistically significant difference between the number of hair bundles per neuromasts in any of the groups (piezo1-/- hair bundles per neuromast 12.4 ± 0.81, piezo1+/- hair bundles per neuromast 13.0 ± 0.7, and piezo1+/+ 13.5 ± 0.34) (Figure 15b). This suggests that the increased microphonic potential of the homozygous fish was not caused by an increase in the number of hair bundles per neuromast. This experiment uncovers an interesting phenomenon in which knockout of an ion channel leads to an increase in microphonic potential.

Figure 15. (A) Mean microphonic potential measured in the lateral line neuromasts of piezo1+/+, piezo1+/-, and piezo1-/- fish at 5-6 dpf. (B) Number of hair bundles per neuromast in the lateral line of piezo1+/+, piezo1+/-, and piezo1-/- fish at 5-6 dpf.

Discussion

The development of reverse genetics in the zebrafish model organism, combined with the ease of use introduced by new genetic technologies such as TALEN and

CRISPR, has the potential to increase our understanding of the proteins involved in hearing. While protein discovery previously came from forward genetic screens of individuals or animals with auditory or vestibular disorders, proteins of interest, which can be discovered by techniques like transcriptome analysis, can now be easily mutated and studied. Additionally, CRISPR technology facilitates the development of organisms with mutations in multiple gene loci simultaneously, so the complex interactions between groups of proteins can be elucidated without several rounds of genetic breeding. This collection of experiments demonstrates the utility of these new technologies, while also introducing new insights into mechanotransduction in the lateral line.

Our first study focuses on tmc2, which was first discovered as a paralog of tmc1, a deafness-causing gene (Kurima et al. 2002). Since then, it has been shown to have an important role in modulating conductance (Pan et al. 2013) and interacting with the tip link protein Pcdh15 (Maeda et al. 2014). While most research has examined the inner ear hair cells of the mammalian system, our study looks at the lateral line neuromast hair cells of the zebrafish, which are similar in structure and easy to access in the living and

intact organism. The structure of the neuromast does differ from that of the inner ear, particularly in that the hair bundles are arranged in two subpopulations of oppositely- oriented cells. Potential differences in these two subpopulations is brought to light through these experiments. Our series of experiments show that Tmc2b is differentially required both by different neuromasts and differently-oriented hair bundles in the same neuromast. The map created shows Tmc2b reliance in anterior-facing hair bundles of the primI-derived neuromasts in the PLL; dorsal-facing hair bundles in primII-derived neuromasts and the MI1 neuromast in the middle line; and ventral-facing hair bundles in the M2 neuromast of the mandibular line. In contrast, mechanotransduction of the infraorbital IO4 neuromast is unaffected by the knockout of Tmc2b.

These data suggest that while Tmc2b plays an important role in lateral line mechanotransduction in some, but not all hair cells, there are other proteins involved that, in the absence of Tmc2b, allow mechanotransduction to continue. The two most likely candidates are Tmc1 and Tmc2a. Previous RT-PCR experiments have shown tmc1, tmc2a, and tmc2b expression in the lateral line of the larval zebrafish, with stronger expression of tmc1 and tmc2b and weaker expression of tmc2a (Maeda et al. 2014).

While expression is similar, Tmc1 and Tmc2 may not be interchangeable. tmc1 has about

50% homology with both tmc2a and tmc2b. Several investigators have recorded differences in calcium ion permeability, conductance, and current amplitude between

Tmc1-/- and Tmc2-/- mutants (Kim et al. 2013; Pan et al. 2013). Pan et al. theorized that a heteromultimer ion channel of TMC1 and TMC2 could adjust conductance, creating the tonotopic gradient seen in the cochlea from base to apex, by changing the subunit composition (Pan et al. 2013). The differences between the biophysical properties of

Tmc1, Tmc2a, and Tmc2b have yet to be thoroughly investigated; however, further study may reveal a similar heteromultimerization. It is possible that this fine tuning of conductance and current is also useful in the context of the lateral line system. Swimming creates shear stress, deflecting the neuromasts against the direction of movement (Feitl et al. 2010). Additionally, through rheotaxis, zebrafish orient themselves towards oncoming current, causing running water to deflect their neuromasts in the posterior direction. The increased reliance of Tmc2b in the anterior-facing hair cells of the primI lateral line may be a way in which the sensory system has adapted to balance the increased force applied to hair cells with anterior-facing orientations. The dorsal-ventral neuromasts, whose

Tmc2b reliance is more varied in orientation, may base their reliance on their positioning on the dorsal-ventral axis of the fish. MI1 and the primII neuromasts are dorsally located, above the horizontal myoseptum, and their dorsal-facing hair bundles rely upon Tmc2b.

In contrast, the ventral-facing bundles of the ventrally located M2 neuromast rely upon

Tmc2b. IO4, which is located behind the eye, at the midline of the body, does not need

Tmc2b for normal mechanotransduction.

Future directions include studies of tmc2a and tmc1 mutants to determine if either of them are also involved in the mechanotransduction complex. Additionally, tmc2a/tmc2b double mutants and a tmc1/tmc2a/tmc2b triple mutant have been generated using CRISPR. Examination of these mutants will allow us to perceive a fuller picture of the complex spatiotemporal interaction of the Tmc proteins. This series of experiments begins to uncover the diversity of mechanotransduction-associated proteins between and within neuromasts of the lateral line. This is an exciting area of research with much left to discover.

Our second study focuses on understanding the function of Piezo1, a mechanically sensitive ion channel that has been detected in the hair cells of mice (Liu et al. 2014) and zebrafish (Erickson and Nicolson 2015). Our lab has previously created

Piezo1 TALEN knockout zebrafish, and my goal was to begin to characterize this protein by performing electrophysiology recordings from the posterior lateral line hair cells. I found that the microphonic potentials of homozygous piezo1 mutant fish were larger than those of the wild type fish. This was an unexpected result. Although most of the mutations in Piezo1 and Piezo2 that cause disorders are gain-of-function, these mutations alter the channel conductance while leaving the overall protein structure intact

(Bagriantsev et al. 2014). For example, in the disorder dehydrated hereditary stomatocytosis, a Piezo1 mutation causes slower deactivation of the ion channel, leading to increased cation permeability in red blood cells, causing erythrocyte dehydration

(Volkers et al. 2014). However, our knockout is designed and predicted to delete most of the protein, therefore the increased microphonic potential we observed is unlikely to be caused by a channel with increased conductance.

Alternatively, as a channel permeable to and with a slight preference for calcium

(Coste et al. 2010), Piezo1 may affect the mechanotransduction current by increasing the amount of intracellular calcium when the hair bundle is deflected. Previous work has shown that decreasing intracellular calcium through the use of the calcium buffer BAPTA abolished adaptation and increased the open probability of the mechanotransduction ion channel (Corns et al. 2014). Thus, removing Piezo1 may decrease the amount of intracellular calcium in hair cells, causing a larger potential difference across the hair cell membrane, and leading to an increased microphonic potential. Research has shown that

when myosin motor protein Myosin-XV, which transports cytoskeletal protein Whirlin to the tips of the stereocilia, is mutated, that fast adaptation and calcium sensitivity are altered in mouse inner hair cells (Stepanyan and Frolenkov 2009). These findings suggest that calcium sensitivity can be altered by elements extrinsic to the mechanotransduction channel.

It has also been conjectured that Piezo, in addition to acting as a channel, may also play a structural role, particularly in red blood cells (Faucherre et al. 2014). Piezo1 is a large protein of 900 kDa when in its trimeric form (Ge et al. 2015). It is possible that removal of Piezo1 may affect the membrane or cytoskeletal structure of the stereocilia in a way that would increase the open probability of the mechanotransduction channel, perhaps by reducing membrane tension, thus making it easier for the mechanotransduction channel to open.

This finding suggests several follow up experiments. Precise subcellular localization within the hair cell is necessary to determine the function of Piezo1. Creating a fluorescence tagged version of Piezo1 or immunolabeling with a Piezo1-specific antibody would allow us to determine the protein's location in the stereocilia, whether near the tip or at the base. This will provide insight into what forces may cause the Piezo1 channel to open. If Piezo1 is found at or near the tips of the stereocilia, then forces due to membrane stretch caused by the tip link during deflection might open the Piezo1 channel.

Alternately, if Piezo1 is found elsewhere, forces caused by the deflection of the stereocilia may affect the channel open probability. Patch clamping of hair cells in the

Piezo1 knockout would also provide more information on how Piezo1 affects the mechanosensitivity of the hair cell on the single-cell level. Further characterization using

electrophysiology experiments of the zebrafish ear could shed light on the role of Piezo1 in the auditory and vestibular systems, giving us more insight on the regulation of mechanotransduction in different sensory systems.

Appendix

Model for Piezo1 Effect on Mechanotransduction

Figure 16. (A) A model of the effect of Piezo1 on fast adaptation. Piezo1 channels, which may be opened by the same membrane tension that opens the mechanotransduction channels, allow in calcium ions, increasing the level of intracellular calcium, and thus increasing adaptation through interaction with the mechanotransduction channel. (B) A model of the effect of Piezo1 on slow adaptation. Piezo1 channels, perhaps opened by membrane tension at the upper end of the tip link, allow in calcium ions, which activates the myosin motor, decreasing tensions along the tip link, and closing the mechanotransduction channel.

Microphonic Potential Example Traces

Tmc2b

V) m (

response Microphonic

Stimulus (mV)

Sample number

Figure 17. Trace and stimulus from tmc2b+/- IO4 neuromast microphonic potential.

V) m (

response Microphonic

Stimulus (mV)

Sample number

Figure 18. Trace and stimulus from tmc2b-/- IO4 neuromast microphonic potential.

V) m (

response Microphonic

Stimulus (mV)

Sample number Figure 19. Trace and stimulus from tmc2b+/- PrimII neuromast microphonic potential.

V) m (

response Microphonic

Stimulus (mV)

Sample number

Figure 20. Trace and stimulus from tmc2b-/- PrimII neuromast microphonic potential.

Piezo1

V) m (

response Microphonic

Stimulus (mV)

Sample number

Figure 21. Trace and stimulus from piezo1+/+ neuromast microphonic potential.

V) m (

response Microphonic

Stimulus (mV)

Sample number

Figure 22. Trace and stimulus from piezo1+/- neuromast microphonic potential.

V) m (

response Microphonic

Stimulus (mV)

Figure 23. Trace and stimulus from piezo1Sample number-/- neuromast microphonic potential.

Creation of Tmc1 CRISPR mutant

The CRISPR (Clustered regularly interspaced short palindromic repeats) Cas9

(CRISPR associated protein 9) system allows for quick and efficient gene editing.

CRISPR uses a short guide RNA (sgRNA) to direct an enzyme first found in bacteria,

Cas9, to a specific genetic locus. There, Cas9 creates a double strand break, which is then repaired by the non-homologous end joining pathway. Indels created by this error-prone repair system can create frameshift mutations which disrupt the gene. Our lab uses a protocol developed by Gagnon et al. (2014) and adapted by previous students Shih-Wei

Chou, Jiaqi Hu, and Li Liu. Tmc1 was chosen as the focus of this study due to its importance in hair cell mechanotransduction.

The 20-nucleotide target sites for sgRNA were selected through the CHOPCHOP website (Montague et al. 2014). Sites in exons closer to the 5’ end of the gene were preferred, so as to increase the chance of creating a new stop codon. Target sites were checked for potential non-specific targeting using the NCBI nucleotide BLAST. Two sets of primers, one designed for HRMA which produce a 150-250 base pair (bp) PCR product and the other designed for sequencing which create a 300-600 bp product, were designed using NCBI Primer BLAST and synthesized by Integrated DNA Technologies.

Target sites were then sequenced to ensure that the in vivo sequence matched the predicted sequence.

sgRNA was created by annealing a gene-specific oligonucleotide consisting of the target site, a T7 promoter site, and an overlap region, with a constant oligonucleotide consisting of the complementary overlapping region and the sgRNA tail, which interacts with the Cas9. This created a 120 bp oligonucleotide whose length was verified by gel

electrophoresis. Next, the oligonucleotide was transcribed using the T7 Megascript kit

(Ambion). The RNA quality was checked by Tape Station (Agilent).

A mixture of sgRNA (120-150 ng/µL), Cas9 mRNA (350 ng/µL), phenol red

(0.08%) and Danieau’s buffer was injected into zebrafish embryos at the one to two cell stage. At 4-5 dpf, 8 embryos were collected, DNA was extracted using the HotShot method by adding 50 µL 1x Base buffer (25 mM NaOH, 0.2 mM Na2EDTA, pH 12), heating at 95 ºC for 30 minutes, and adding 50 µL Neutralization buffer (40 mM Tris-

HCL, pH 5). Extracted DNA was sent for HRM analysis (Georgia Genomics Facility) with the HRMA primers. Samples that had different melting curves as compared to the wild type control were amplified by PCR with the sequencing primer and sent for sequencing (Eurofins Genomics). Of the sequenced samples, those which had multipeaks in sequencing were subcloned into the pCR4 TOPO vector, transformed into One Shot

TOP10 bacteria (Invitrogen), and then sequenced.

Tmc1 CR11 induced somatic mutation in the tmc1 gene. The CRISPR 11 target site (TGGGCTGGTCATGGTTCCAGAGG) is found on the minus strand of the 4th exon.

Figure 24. CRISPR 11 is found in the 4th exon of tmc1.

Table 1. List of primers used for HRMA and sequencing.

Primer name Primer Target

HRM Forward Primer ATAGAGTCCACATGCAGAACGA

Tmc1 CR11 5’seq

HRM Reverse Primer ATTCTTGAGGTGGATGTATGGC

Tmc1 CR11 3’seq

Sequencing Forward Primer TCCACATGCAGAACGAAGACA

Tmc1 CR10-11 5’seq

Sequencing Reverse Primer GAGTCGCAGGAGTTTGTGGA

Tmc1 CR10-11 3’seq

Embryos injected with this construct had indels in the tmc1 gene. Two out of eight embryos tested in a single injection of Tmc1 CR11 had mutations: one had an 11 bp deletion, while the other had some cells with an 8 bp deletion and others with a 6 bp deletion.

A tmc1 CR11 seq f 480 GATGCCATACATCCACCTCAAGAATATGAAGTATGAAGCCACCGAAGAGCCAAAATGGCC 539 tmc1CR11 F17C 432 GATGCCATACATCCACCTCAAGAATATGAAGTATGAAGCCA------AAATGGCC 480 ***************************************** ******** B tmc1 CR11 seq f 488 ACATCCACCTCAAGAATATGAAGTATGAAGCCACCGAA------GAGCCAAAATGGCC 539 tmc1CR11 F18A 721 ACATCCACCTCAAGAATATGAAGTATGAAGCCACCAAAATGGCCAAGAGCCAAAATGGCC 780 *********************************** ** ************** C tmc1 CR11 seq f 478 TTGATGCCATACATCCACCTCAAGAATATGAAGTATGAAGCCACCGAAGAGCCAAAATGG 537 tmc1CR11 F18D 321 TTGATGCCATACATCCACCTCAAGAATATGAAGTATGAAGCCACCGATATGATA------374 *********************************************** * *

Figure 25. Mutations found in Tmc1 CR11 injected embryos. (A) Fish with an 11 bp deletion. (B,C) Fish with two mutations (B) 8 bp deletion and (C) 6 bp deletion.

References

Alagramam, Kumar N, Richard J Goodyear, Ruishuang Geng, David N Furness,

Alexander F J van Aken, Walter Marcotti, Corné J Kros, and Guy P Richardson.

2011. “Mutations in Protocadherin 15 and Cadherin 23 Affect Tip Links and

Mechanotransduction in Mammalian Sensory Hair Cells.” PloS One 6 (4): e19183.

doi:10.1371/journal.pone.0019183.

Bagriantsev, Sviatoslav N, Elena O Gracheva, and Patrick G Gallagher. 2014. “Piezo

Proteins: Regulators of Mechanosensation and Other Cellular Processes.” The

Journal of Biological Chemistry 289 (46): 31673–81. doi:10.1074/jbc.R114.612697.

Beurg, Maryline, Michael G Evans, Carole M Hackney, and Robert Fettiplace. 2006. “A

Large-Conductance Calcium-Selective Mechanotransducer Channel in Mammalian

Cochlear Hair Cells.” The Journal of Neuroscience 26 (43): 10992–0.

doi:10.1523/JNEUROSCI.2188-06.2006.

Beurg, Maryline, Kyunghee X Kim, and Robert Fettiplace. 2014. “Conductance and

Block of Hair-Cell Mechanotransducer Channels in Transmembrane Channel-like

Protein Mutants.” The Journal of General Physiology 144 (1): 55–69.

doi:10.1085/jgp.201411173.

Bleckmann, Horst, and Randy Zelick. 2009. “Lateral Line System of Fish.” Integrative

Zoology 4 (1): 13–25. doi:10.1111/j.1749-4877.2008.00131.x.

Carrillo, Andres, and Matthew J McHenry. 2016. “Zebrafish Learn to Forage in the

Dark.” The Journal of Experimental Biology 219 (4): 582–89.

doi:10.1242/jeb.128918.

Chatzigeorgiou, Marios, Sangsu Bang, Sun Wook Hwang, and William R Schafer. 2013.

“Tmc-1 Encodes a Sodium-Sensitive Channel Required for Salt Chemosensation in

C. Elegans.” Nature 494 (7435). Nature Publishing Group: 95–99.

doi:10.1038/nature11845.

Corey, David P, and A J Hudspeth. 1983. “Analysis of the Microphonic Potential of the

Bullfrog’s Sacculus.” Journal of Neuroscience 3 (5): 942–61.

Corns, Laura F, Stuart L Johnson, Corné J Kros, and Walter Marcotti. 2014. “Calcium

Entry into Stereocilia Drives Adaptation of the Mechanoelectrical Transducer

Current of Mammalian Cochlear Hair Cells.” Proceedings of the National Academy

of Sciences of the United States of America 111 (41): 14918–23.

doi:10.1073/pnas.1409920111.

———. 2016. “Tmc1 Point Mutation Affects Ca2+ Sensitivity and Block by

Dihydrostreptomycin of the Mechanoelectrical Transducer Current of Mouse Outer

Hair Cells.” The Journal of Neuroscience 36 (2): 336–49.

doi:10.1523/JNEUROSCI.2439-15.2016.

Corns, Laura F, and Walter Marcotti. 2016. “Piezo1 Haploinsufficiency Does Not Alter

Mechanotransduction in Mouse Cochlear Outer Hair Cells.” Physiological Reports 4

(3): e12701. doi:10.14814/phy2.12701.

Coste, Bertrand, Jayanti Mathur, Manuela Schmidt, Taryn J Earley, Sanjeev S Ranade,

Matt J Petrus, Adrienne E Dubin, and Ardem Patapoutian. 2010. “Piezo1 and Piezo2

Are Essential Components of Distinct Mechanically Activated Cation Channels.”

Science 330 (October): 7–12. doi:10.1126/science.1193270.

Cox, Charles D, Chilman Bae, Lynn Ziegler, Silas Hartley, Vesna Nikolova-Krstevski,

Paul R Rohde, Chai-Ann Ng, Frederick Sachs, Philip A Gottlieb, and Boris

Martinac. 2016. “Removal of the Mechanoprotective Influence of the Cytoskeleton

Reveals PIEZO1 Is Gated by Bilayer Tension.” Nature Communications 7. Nature

Publishing Group: 1–13. doi:10.1038/ncomms10366.

Effertz, Thomas, Alexandra L Scharr, and Anthony J Ricci. 2015. “The How and Why of

Identifying the Hair Cell Mechano-Electrical Transduction Channel.” Pflugers

Archiv : European Journal of Physiology 467 (1): 73–84. doi:10.1007/s00424-014-

1606-z.

Erickson, Timothy, and Teresa Nicolson. 2015. “Identification of Sensory Hair-Cell

Transcripts by Thiouracil-Tagging in Zebrafish.” BioMed Central Genomics 16 (1).

BMC Genomics: 842. doi:10.1186/s12864-015-2072-5.

Faucherre, Adèle, Karima Kissa, Joël Nargeot, Matteo E Mangoni, and Chris Jopling.

2013. “Piezo1 Plays a Role in Erythrocyte Volume Homeostasis.” Haematologica

99 (1): 70–75. doi:10.3324/haematol.2013.086090.

Faucherre, Adèle, Joël Nargeot, Matteo E Mangoni, and Chris Jopling. 2013. “piezo2b

Regulates Vertebrate Light Touch Response.” Journal of Neuroscience 33 (43):

17089–94. doi:10.1523/JNEUROSCI.0522-13.2013.

Feitl, Karla E, Victoria Ngo, and Matthew J McHenry. 2010. “Are Fish Less Responsive

to a Flow Stimulus When Swimming?” The Journal of Experimental Biology 213

(Pt 18): 3131–37. doi:10.1242/jeb.045518.

Fettiplace, Robert, and Kyunghee X Kim. 2014. “The Physiology of Mechanoelectrical

Transduction Channels in Hearing.” Physiological Reviews 94 (3): 951–86.

doi:10.1152/physrev.00038.2013.

Furness, David N, and Carole M Hackney. 1985. “Cross-Links between Stereocilia in the

Guinea Pig Cochlea.” Hearing Research 18 (2): 177–88. doi:10.1016/0378-

5955(85)90010-3.

Gagnon, James A, Eivind Valen, Summer B Thyme, Peng Huang, Laila Ahkmetova,

Andrea Pauli, Tessa G Montague, Steven Zimmerman, Constance Richter, and

Alexander F Schier. 2014. “Efficient Mutagenesis by Cas9 Protein-Mediated

Oligonucleotide Insertion and Large-Scale Assessment of Single-Guide RNAs.”

PloS One 9 (5): e98186. doi:10.1371/journal.pone.0098186.

Gale, J E, Walter Marcotti, H J Kennedy, Corné J Kros, and Guy P Richardson. 2001.

“FM1-43 Dye Behaves as a Permeant Blocker of the Hair-Cell Mechanotransducer

Channel.” The Journal of Neuroscience 21 (18): 7013–25. doi:10.1007/s00232-005-

0854-4.

Ge, Jingpeng, Wanqiu Li, Qiancheng Zhao, Ningning Li, Maofei Chen, Peng Zhi,

Ruochong Li, Ning Gao, Bailong Xiao, and Maojun Yang. 2015. “Architecture of

the Mammalian Mechanosensitive Piezo1 Channel.” Nature 527 (7576): 64–69.

doi:10.1038/nature15247.

Hepper, Peter G, and BS S Shahidullah. 1994. “Development of Fetal Hearing.” Archives

of Disease in Childhood 71 (May): 81–87. doi:10.1017/S0965539500001108.

Holt, Jeffrey R, Susan K H Gillespie, D. William Provance, Kavita Shah, Kevan M.

Shokat, David P Corey, John A. Mercer, and Peter G. Gillespie. 2002. “A Chemical-

Genetic Strategy Implicates Myosin-1c in Adaptation by Hair Cells.” Cell 108 (3):

371–81. doi:10.1016/S0092-8674(02)00629-3.

Holt, Jeffrey R, Bifeng Pan, Mounir a Koussa, and Yukako Asai. 2014. “TMC Function

in Hair Cell Transduction.” Hearing Research 311: 17–24.

doi:10.1016/j.heares.2014.01.001.

Howe, Kerstin, Matthew D Clark, Carlos F Torroja, James Torrance, Camille Berthelot,

Matthieu Muffato, John E Collins, et al. 2013. “The Zebrafish Reference Genome

Sequence and Its Relationship to the Human Genome.” Nature 496 (7446): 498–

503. doi:10.1038/nature12111.The.

Hudspeth, A J. 1982. “Extracellular Current Flow and the Site of Transduction by

Vertebrate Hair Cells.” The Journal of Neuroscience 2 (1): 1–10.

———. 1989. “How the Ear’s Works Work.” Nature 341 (6241): 397–404.

doi:10.1038/341397a0.

———. 2013. “The Inner Ear.” In Principles of Neural Science, edited by Eric R Kandel,

James H Schwartz, Thomas M Jessell, Steven A Siegelbaum, and AJ Hudspeth, 5th

ed, 654–81. New York City: McGraw-Hill.

Kawashima, Yoshiyuki, Gwenaëlle S Géléoc, Kiyoto Kurima, Valentina Labay, Andrea

Lelli, Yukako Asai, Tomoko Makishima, et al. 2011. “Mechanotransduction in

Mouse Inner Ear Hair Cells Requires Transmembrane Channel-like Genes.” The

Journal of Clinical Investigation 121 (12): 4796–4809. doi:10.1172/JCI60405.

Kazmierczak, Piotr, and Ulrich Müller. 2012. “Sensing Sound: Molecules That

Orchestrate Mechanotransduction by Hair Cells.” Trends in Neurosciences 35 (4):

220–29. doi:10.1016/j.tins.2011.10.007.

Kazmierczak, Piotr, Hirofumi Sakaguchi, Joshua Tokita, Elizabeth M Wilson-Kubalek,

Ronald a Milligan, Ulrich Müller, and Bechara Kachar. 2007. “Cadherin 23 and

Protocadherin 15 Interact to Form Tip-Link Filaments in Sensory Hair Cells.”

Nature 449 (7158): 87–91. doi:10.1038/nature06091.

Keresztes, Gabor, Hideki Mutai, and Stefan Heller. 2003. “TMC and EVER Genes

Belong to a Larger Novel Family, the TMC Gene Family Encoding Transmembrane

Proteins.” BioMed Central Genomics 4 (24): 1–12. doi:10.1186/1471-2164-4-24.

Kim, Kyunghee X, Maryline Beurg, Carole M Hackney, David N Furness, Shanthini

Mahendrasingam, and Robert Fettiplace. 2013. “The Role of Transmembrane

Channel-like Proteins in the Operation of Hair Cell Mechanotransducer Channels.”

The Journal of General Physiology 142 (5): 493–505. doi:10.1085/jgp.201311068.

Kurima, Kiyoto, Linda M Peters, Yandan Yang, Saima Riazuddin, Zubair M Ahmed,

Sadaf Naz, Deidre Arnaud, et al. 2002. “Dominant and Recessive Deafness Caused

by Mutations of a Novel Gene, TMC1, Required for Cochlear Hair-Cell Function.”

Nature Genetics 30 (3): 277–84. doi:10.1038/ng842.

Kurima, Kiyoto, Yandan Yang, Katherine Sorber, and Andrew J Griffith. 2003.

“Characterization of the Transmembrane Channel-like (TMC) Gene Family:

Functional Clues from Hearing Loss and Epidermodysplasia Verruciformis.”

Genomics 82 (3): 300–308. doi:10.1016/S0888-7543(03)00154-X.

Kwan, Kelvin Y., Andrew J. Allchorne, Melissa A. Vollrath, Adam P. Christensen, Duan

S. Zhang, Clifford J. Woolf, and David P. Corey. 2006. “TRPA1 Contributes to

Cold, Mechanical, and Chemical Nociception but Is Not Essential for Hair-Cell

Transduction.” Neuron 50 (2): 277–89. doi:10.1016/j.neuron.2006.03.042.

Labay, Valentina, Rachel M Weichert, Tomoko Makishima, and Andrew J Griffith. 2010.

“Topology of Transmembrane Channel-like Gene 1 Protein.” Biochemistry 49 (39):

8592–98. doi:10.1021/bi1004377.

Liu, Huizhan, Jason L Pecka, Qian Zhang, Garrett a Soukup, Kirk W Beisel, and David Z

Z He. 2014. “Characterization of Transcriptomes of Cochlear Inner and Outer Hair

Cells.” The Journal of Neuroscience 34 (33): 11085–95.

doi:10.1523/JNEUROSCI.1690-14.2014.

Lumpkin, Ellen A, and A J Hudspeth. 1995. “Detection of Ca2+ Entry through

Mechanosensitive Channels Localizes the Site of Mechanoelectrical Transduction in

Hair Cells.” Proceedings of the National Academy of Sciences of the United States

of America 92 (22): 10297–301. doi:10.1073/pnas.92.22.10297.

Maeda, Reo, Katie S Kindt, Weike Mo, Clive P Morgan, Timothy Erickson, Hongyu

Zhao, Rachel Clemens-Grisham, Peter G Barr-Gillespie, and Teresa Nicolson. 2014.

“Tip-Link Protein Protocadherin 15 Interacts with Transmembrane Channel-like

Proteins TMC1 and TMC2.” Proceedings of the National Academy of Sciences of

the United States of America 111 (35): 12907–12. doi:10.1073/pnas.1402152111.

Marcotti, Walter, Laura F Corns, Terri Desmonds, Nerissa K Kirkwood, Guy P

Richardson, and Corné J Kros. 2014. “Transduction without Tip Links in Cochlear

Hair Cells Is Mediated by Ion Channels with Permeation Properties Distinct from

Those of the Mechano-Electrical Transducer Channel.” The Journal of Neuroscience

34 (16): 5505–14. doi:10.1523/JNEUROSCI.4086-13.2014.

Montague, Tessa G., Jos?? M. Cruz, James A. Gagnon, George M. Church, and Eivind

Valen. 2014. “CHOPCHOP: A CRISPR/Cas9 and TALEN Web Tool for Genome

Editing.” Nucleic Acids Research 42 (Web Server issue): W401–7.

doi:10.1093/nar/gku410.

Nicolson, Teresa, Alfons Rüsch, Rainer W Friedrich, Michael Granato, Johann Peter

Ruppersberg, and Christiane Nüsslein-Volhard. 1998. “Genetic Analysis of

Vertebrate Sensory Hair Cell Mechanosensation: The Zebrafish Circler Mutants.”

Neuron 20 (2): 271–83. doi:10.1016/S0896-6273(00)80455-9.

Nuñez, Viviana A., Andres F. Sarrazin, Nicolas Cubedo, Miguel L. Allende, Christine

Dambly-Chaudière, and Alain Ghysen. 2009. “Postembryonic Development of the

Posterior Lateral Line in the Zebrafish.” Evolution and Development 11 (4): 391–

404. doi:10.1111/j.1525-142X.2009.00346.x.

Pan, Bifeng, Gwenaëlle S Géléoc, Yukako Asai, Geoffrey C Horwitz, Kiyoto Kurima,

Kotaro Ishikawa, Yoshiyuki Kawashima, Andrew J Griffith, and Jeffrey R Holt.

2013. “TMC1 and TMC2 Are Components of the Mechanotransduction Channel in

Hair Cells of the Mammalian Inner Ear.” Neuron 79 (3): 504–15.

doi:10.1016/j.neuron.2013.06.019.

Pan, Bifeng, J Waguespack, M E Schnee, C LeBlanc, and Anthony J Ricci. 2012.

“Permeation Properties of the Hair Cell Mechanotransducer Channel Provide Insight

into Its Molecular Structure.” Journal of Neurophysiology 107 (9): 2408–20.

doi:10.1152/jn.01178.2011.

Raible, David W, and Gregory J Kruse. 2000. “Organization of the Lateral Line System

in Embryonic Zebrafish.” The Journal of Comparative Neurology 421 (2): 189–98.

doi:10.1002/(SICI)1096-9861(20000529)421:2<189::AID-CNE5>3.0.CO;2-K.

Ranade, Sanjeev S, Zhaozhu Qiu, Seung-Hyun Woo, Sung Sik Hur, Swetha E Murthy,

Stuart M Cahalan, Jie Xu, et al. 2014. “Piezo1, a Mechanically Activated Ion

Channel, Is Required for Vascular Development in Mice.” Proceedings of the

National Academy of Sciences of the United States of America 111 (28): 10347–52.

doi:10.1073/pnas.1409233111.

Ricci, Anthony J, and Robert Fettiplace. 1997. “The Effects of Calcium Buffers on

Mechanoelectrical Transduction in Turtle Hair Cells.” Journal of Physiology 72 (2):

111–24. doi:10.1111/j.1469-7793.1997.111bo.x.

Sidi, Samuel, Rainer W Friedrich, and Teresa Nicolson. 2003. “NompC TRP Channel

Required for Vertebrate Sensory Hair Cell Mechanotransduction.” Science 301

(5629): 96–99. doi:10.1126/science.1084370.

Stepanyan, R., and G. I. Frolenkov. 2009. “Fast Adaptation and Ca2+ Sensitivity of the

Mechanotransducer Require Myosin-XVa in Inner But Not Outer Cochlear Hair

Cells.” Journal of Neuroscience 29 (13): 4023–34. doi:10.1523/JNEUROSCI.4566-

08.2009.

Stewart, William J, Gilberto S Cardenas, and Matthew J McHenry. 2013. “Zebrafish

Larvae Evade Predators by Sensing Water Flow.” Journal of Experimental Biology

216 (Pt 3): 388–98. doi:10.1242/jeb.072751.

Volkers, Linda, Yasmine Mechioukhi, and Bertrand Coste. 2015. “Piezo Channels: From

Structure to Function.” Pflugers Archiv : European Journal of Physiology 467 (1):

95–99. doi:10.1007/s00424-014-1578-z.

Woo, Seung-Hyun, Sanjeev S Ranade, Andy D Weyer, Adrienne E Dubin, Yoshichika

Baba, Zhaozhu Qiu, Matt J Petrus, et al. 2014. “Piezo2 Is Required for Merkel-Cell

Mechanotransduction.” Nature 509 (7502): 622–26. doi:10.1038/nature13251.

Zhao, Qiancheng, Kun Wu, Jie Geng, Peng Zhi, Mingmin Zhang, Bailong Xiao

Correspondence, Shaopeng Chi, Yanfeng Wang, and Bailong Xiao. 2016. “Ion

Permeation and Mechanotransduction Mechanisms of Mechanosensitive Piezo

Channels.” Neuron 89 (6): 1248–63. doi:10.1016/j.neuron.2016.01.046.