Supplemental Material 1 (PDF)

A B C M S nsn s nsn s

1100 22000 0 11.0.0 e

u e

8 00.8.8 g

11505 0 C

6 R 00.6.6

2 c

2r = 0.22 11000 0 e RIN

r = 0 .2 2 d 4 m 0.4 4 ns n 0 .4 a

n s n

5500

dynamic range dynamic a

2 D 00.2.2 e

area under under area the curve A 0 00 00.0.0 0.0 0.1 0.2 0.3 0.4 neg pos neg pos 0 .0 0 .1 0 .2 0 .3 0 .4 g s g s e o e o collected cells (x10^6) NCD154 statusP N CD154 statusP C D 1 5 4 s ta tu s C D 1 5 4 s ta tu s

Supplementary Figure 1. Analysis of microarray quality CD154+ and CD154- cells from M. bovis BCG-vaccinated mice were sorted using FACS. RNA isolated from these cells were amplified and resulting ssDNA was used to probe Affymetryx Gene 1.0 ST chips. A. Quality of isolated RNA was assessed by Bioanalyzer; An electropherogram showing marker (M) and a representative sample (S). B). Relationship between the number of collected cells and quality of RNA isolated. RNA quality is represented as RNA integrity number (RIN). Empty circles represent CD154+ cells and filled circles represent CD154- cells. C) Comparison of quality metrics between arrays performed in this study and arrays performed by Immunological Genome Project (ImmGen). Dynamic range is the ratio of intensity of 95th to 5th feature on a chip. The median dynamic range of microarrays in the ImmGen database is shown as dotted line. Area Under the Curve, a measure of signal to noise ratio, is calculated based on positive and negative control features on the microarrays. The cut-off used by ImmGen database is shown as dotted line. Coefficient of variation is calculated for each gene among three replicate arrays followed by calculation of median value for CD154 status. The median coefficient of variation obtained in the current study (0.029) was lower than that obtained in arrays from ImmGen database (0.102; not depicted). *p < 0.05, ns, not significant. A

0.30 .3 5 **

10 ) 4

0.13 D 4 C

10 % 0 .2

0.2(

s l

e -

3 c 10

IL + e

n 0 .1 0.1i

requency (%CD4) requency

f y

0 c 0.00 .0 0 103 104 105 unsu n s stimM tb CD44

0.80 .8

105 ** )

0.37 4

D 0 .6

4 0.6C

10 % (

l e

17A 0 .4

0.4c - 3

10 + IL e

n i

k 0 .2 o

requency (%CD4) requency 0.2

t f 0 y c 0.00 .0 0 103 104 105 unsu n s stimM tb CD44

+ 1 5 0

808 0 ns 150

+ )

) 4

CD4

D *

6 C

CD4 6 0

60C

6 1 0 0 %

100(

(

s l

e e

4 0 c c

+ e

n 5 0

i 50

k k

2 0 o o

20 t

4 SFC / 10 SFC 4

- 17A SFC / 10 / 17A SFC c

- IL 00 IL 0 n aNiv e BCGB C G n Na iv e BCGB C G

Supplementary Figure 2. Analysis of IL-4 and IL-17A producing CD4+ T cells cells during BCG vaccination. A). Single cell suspensions made from inguinal lymph nodes isolated from BCG-vaccinated mice were stimulated with Mtb lysate for 6 hours in the presence of monensin and brefeldin. Cells were fixed and intracellular cytokine staining was performed for IL-4. The cells shown are single cells from the lymphocyte gate that were positive for CD4 and negative for Live/Dead stain, CD8α, B220 and MHC-II. Barplot on the right summarizes the frequencies of cytokine producing CD4+ T cells either without stimulation (uns) or with stimulation (stim). B). Experiments were performed as in panel A. IL-17A expressing CD4+ T cells are shown. C). IL-4 (left) and IL-17A (right) ELLISPOT assays were performed using purified CD4+ T cells isolated from BCG-vaccinated mouse splenocytes. The frequency of spot forming cells (SFC) are shown for naïve (N) and BCG mice. The data represents pooled data from 3 independent experiments. * p < 0.05; ** p < 0.005 for Student’s t-tests ns, not significant. Supplementary Table 1. List of differentially expressed genes

Fold change Percentage false Affymetrix ID Transcript name** (CD154+/CD154-) positive (pfp)* 10482795 10.8 0.00000 ermin, ERM-like protein (Ermn), mRNA 10389231 7.3 0.00000 chemokine (C-C motif) ligand 3 (Ccl3), mRNA

10385837 7.0 0.00000 interleukin 13 (Il13), mRNA 10353415 6.8 0.00000 interleukin 17F (Il17f), mRNA 10497886 6.2 0.00000 interleukin 21 (Il21), mRNA 10379721 5.6 0.00000 chemokine (C-C motif) ligand 4 (Ccl4), mRNA

10545154 5.6 0.00000 interleukin 23 receptor (Il23r), mRNA 10385918 5.1 0.00030 interleukin 3 (Il3), mRNA 10345032 4.7 0.00020 interleukin 17A (Il17a), mRNA 10389064 4.4 0.00020 chemokine (C-C motif) ligand 1 (Ccl1), mRNA

10475965 4.4 0.00030 polymerase (RNA) I polypeptide B (Polr1b), mRNA 10482448 4.2 0.00020 zinc finger E-box binding homeobox 2 (Zeb2), transcript variant 2, mRNA 10373918 4.2 0.00030 leukemia inhibitory factor (Lif), transcript variant 1, mRNA 10345762 4.1 0.00030 interleukin 1 receptor, type I (Il1r1), transcript variant 1, mRNA 10376054 3.9 0.00130 interleukin 5 (Il5), mRNA 10515943 3.9 0.00040 cytidine 5'-triphosphate synthase (Ctps), mRNA

10385912 3.9 0.00070 colony stimulating factor 2 (granulocyte- macrophage) (Csf2), mRNA 10583496 3.6 0.00080 peter pan homolog (Drosophila) (Ppan), mRNA

10516064 3.6 0.00070 major facilitator superfamily domain containing 2A (Mfsd2a), mRNA 10555041 3.6 0.00060 asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase) (Alg8), mRNA 10366796 3.6 0.00070 methyltransferase like 1 (Mettl1), mRNA 10599802 3.6 0.00080 CD40 ligand (Cd40lg), mRNA 10497878 3.6 0.00130 interleukin 2 (Il2), mRNA 10467653 3.5 0.00070 ribosomal RNA processing 12 homolog (S. cerevisiae) (Rrp12), mRNA 10363173 3.4 0.00130 gap junction protein, alpha 1 (Gja1), mRNA 10582020 3.4 0.00080 glycine cleavage system protein H (aminomethyl carrier) (Gcsh), nuclear gene encoding mitochondrial protein, mRNA

10510391 3.4 0.00120 spermidine synthase (Srm), mRNA 10562169 3.4 0.00120 hepcidin antimicrobial peptide (Hamp), mRNA

10360934 3.4 0.00080 ribosomal RNA processing 15 homolog (S. cerevisiae) (Rrp15), mRNA 10347888 3.3 0.00080 chemokine (C-C motif) ligand 20 (Ccl20), transcript variant 1, mRNA 10366586 3.3 0.00200 interferon gamma (Ifng), mRNA 10363735 3.3 0.00120 early growth response 2 (Egr2), mRNA 10523138 3.2 0.00200 chemokine (C-X-C motif) ligand 3 (Cxcl3), mRNA

10385832 3.2 0.00130 interleukin 4 (Il4), transcript variant 1, mRNA

10600485 3.2 0.00130 dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1), mRNA 10549222 3.2 0.00120 branched chain aminotransferase 1, cytosolic (Bcat1), transcript variant 1, mRNA

10450501 3.2 0.00220 tumor necrosis factor (Tnf), mRNA 10604076 3.1 0.00130 small nucleolar RNA, H/ACA box 69 (Snora69), small nucleolar RNA. 10582275 3.1 0.00180 solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 (Slc7a5), mRNA 10572928 3.1 0.00470 RASD family, member 2 (Rasd2), mRNA 10421737 3.1 0.00180 tumor necrosis factor (ligand) superfamily, member 11 (Tnfsf11), mRNA 10365983 3.1 0.00350 lumican (Lum), mRNA 10427035 3.0 0.00230 nuclear receptor subfamily 4, group A, member 1 (Nr4a1), mRNA 10378088 3.0 0.00190 MYB binding protein (P160) 1a (Mybbp1a), mRNA 10352813 2.9 0.00360 ncrna:snRNA chromosome:NCBIM37:1:194571765:19457188 0:1 gene:ENSMUSG00000064881 10530269 2.9 0.00220 RNA binding motif protein 47 (Rbm47), transcript variant 1, mRNA 10502949 2.9 0.00700 ncrna:snoRNA chromosome:NCBIM37:3:153574574:15357465 4:-1 gene:ENSMUSG00000065738 10576216 2.9 0.00430 small nucleolar RNA, C/D box 68 (Snord68), small nucleolar RNA. 10586170 2.8 0.00600 ncrna:snoRNA chromosome:NCBIM37:9:64023678:64023748: 1 gene:ENSMUSG00000064918 10588522 2.8 0.00370 RRP9, small subunit (SSU) processome component, homolog (yeast) (Rrp9), mRNA

10569017 2.8 0.00570 interferon induced transmembrane protein 3 (Ifitm3), mRNA 10512308 2.8 0.00370 sigma non-opioid intracellular receptor 1 (Sigmar1), mRNA 10446713 2.8 0.00370 small nucleolar RNA, C/D box 53 (Snord53), small nucleolar RNA. 10558655 2.8 0.00370 olfactory receptor 46 (Olfr46), mRNA 10544644 2.8 0.00430 fibroblast growth factor inducible gene 15 (FIN15) mRNA, complete cds. 10408762 2.8 0.00360 eukaryotic translation elongation factor 1 epsilon 1 (Eef1e1), mRNA 10389865 2.7 0.00350 non-metastatic cells 1, protein (NM23A) expressed in (Nme1), mRNA 10515423 2.7 0.00790 ncrna:snoRNA chromosome:NCBIM37:4:116826698:11682676 7:-1 gene:ENSMUSG00000064542 10495794 2.7 0.00700 phosphodiesterase 5A, cGMP-specific (Pde5a), mRNA 10551891 2.7 0.00500 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta (Nfkbid), mRNA 10441811 2.7 0.00420 cdna:known chromosome:NCBIM37:17:13109315:13117428 :1 gene:ENSMUSG00000068039 10373695 2.7 0.00430 interleukin 22 (Il22), mRNA 10366572 2.7 0.00470 interleukin 22 (Il22), mRNA 10461158 2.7 0.00420 9 days embryo whole body cDNA, RIKEN full- length enriched library, clone:D030060F23 product:U22 snoRNA host gene (UHG) gene, complete sequence, full insert sequence.

10463535 2.7 0.00470 nucleolar and coiled-body phosphoprotein 1 (Nolc1), transcript variant 1, mRNA

10409338 2.7 0.00460 NOP16 nucleolar protein homolog (yeast) (Nop16), mRNA 10371676 2.6 0.00470 UTP20, small subunit (SSU) processome component, homolog (yeast) (Utp20), mRNA

10441530 2.6 0.00460 synaptotagmin-like 3 (Sytl3), transcript variant 1, mRNA 10552406 2.6 0.00430 natural killer cell group 7 sequence (Nkg7), mRNA 10383756 2.6 0.00750 interferon induced transmembrane protein 2 (Ifitm2), mRNA 10459905 2.6 0.00620 SET binding protein 1 (Setbp1), mRNA 10375880 2.6 0.00540 NHP2 ribonucleoprotein homolog (yeast) (Nhp2), mRNA 10435075 2.6 0.00520 transferrin receptor (Tfrc), mRNA 10501164 2.6 0.01030 colony stimulating factor 1 (macrophage) (Csf1), transcript variant 1, mRNA 10476102 2.6 0.00500 cdna:known chromosome:NCBIM37:2:130102036:13010330 6:1 gene:ENSMUSG00000027405 10558580 2.6 0.00770 undifferentiated embryonic cell transcription factor 1 (Utf1), mRNA 10439845 2.5 0.00810 Putative uncharacterized protein gene:ENSMUSG00000075038 10403511 2.5 0.00620 HEAT repeat containing 1 (Heatr1), mRNA 10528507 2.5 0.00620 pseudouridylate synthase 7 homolog (S. cerevisiae) (Pus7), mRNA 10461156 2.5 0.00610 9 days embryo whole body cDNA, RIKEN full- length enriched library, clone:D030060F23 product:U22 snoRNA host gene (UHG) gene, complete sequence, full insert sequence.

10441813 2.5 0.00560 small nucleolar RNA, H/ACA box 20 (Snora20), small nucleolar RNA. 10525271 2.5 0.00620 N(alpha)-acetyltransferase 25, NatB auxiliary subunit (Naa25), mRNA 10467344 2.5 0.00610 nucleolar complex associated 3 homolog (S. cerevisiae) (Noc3l), mRNA 10392098 2.5 0.00620 FtsJ homolog 3 (E. coli) (Ftsj3), mRNA 10407126 2.5 0.00610 polo-like kinase 2 (Drosophila) (Plk2), mRNA

10476301 2.5 0.00700 spermine oxidase (Smox), transcript variant 1, mRNA 10563411 2.5 0.00610 glutamate-rich WD repeat containing 1 (Grwd1), mRNA 10446907 2.5 0.00890 tetratricopeptide repeat domain 27 (Ttc27), mRNA 10600355 2.5 0.00750 small nucleolar RNA, H/ACA box 70 (Snora70), small nucleolar RNA. 10556244 2.5 0.01150 small nucleolar RNA, H/ACA box 23 (Snora23), small nucleolar RNA. 10369630 2.5 0.00680 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 (Ddx21), mRNA 10398717 2.5 0.00720 tRNA methyltransferase 61 homolog A (S. cerevisiae) (Trmt61a), transcript variant 1, mRNA 10586168 2.4 0.01030 small nucleolar RNA, C/D box 16A (Snord16a), small nucleolar RNA. 10548565 2.4 0.00700 mago-nashi homolog B (Drosophila) (Magohb), mRNA 10365286 2.4 0.00780 EP300 interacting inhibitor of differentiation 3 (Eid3), mRNA 10463517 2.4 0.00720 peroxisome proliferative activated receptor, gamma, coactivator-related 1 (Pprc1), mRNA

10584827 2.4 0.01350 myelin protein zero-like 2 (Mpzl2), mRNA 10396610 2.4 0.00900 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase (Mthfd1), mRNA

10507137 2.4 0.00780 PDZK1 interacting protein 1 (Pdzk1ip1), transcript variant 1, mRNA 10543067 2.4 0.01160 asparagine synthetase (Asns), mRNA 10357191 2.4 0.00910 protein tyrosine phosphatase, non-receptor type 4 (Ptpn4), mRNA 10553299 2.4 0.01180 interferon induced transmembrane protein 2 (Ifitm2), mRNA 10424400 2.4 0.00820 myelocytomatosis oncogene (Myc), transcript variant 1, mRNA 10475648 2.4 0.00900 DTW domain containing 1 (Dtwd1), mRNA 10568956 2.4 0.01270 olfactory receptor 60 (Olfr60), mRNA 10421981 2.3 0.01040 DIS3 mitotic control homolog (S. cerevisiae) (Dis3), mRNA 10360173 2.3 0.01280 SLAM family member 7 (Slamf7), mRNA 10428837 2.3 0.01800 ncrna:snRNA chromosome:NCBIM37:15:58650878:58651033 :-1 gene:ENSMUSG00000065049 10475517 2.3 0.01930 expressed sequence AA467197 (AA467197), mRNA 10346634 2.3 0.01150 NOP58 ribonucleoprotein homolog (yeast) (Nop58), mRNA 10539592 2.3 0.01290 SET and MYND domain containing 5 (Smyd5), mRNA 10461152 2.3 0.01190 9 days embryo whole body cDNA, RIKEN full- length enriched library, clone:D030060F23 product:U22 snoRNA host gene (UHG) gene, complete sequence, full insert sequence. 10503202 2.3 0.02630 chromodomain helicase DNA binding protein 7 (Chd7), mRNA 10466848 2.3 0.01330 DNA segment, Chr 19, Brigham & Women's Genetics 1357 expressed (D19Bwg1357e), mRNA 10503723 2.3 0.01290 midasin homolog (yeast) (Mdn1), mRNA 10375234 2.3 0.01920 NudC domain containing 2 (Nudcd2), mRNA

10521913 2.3 0.01140 recombination signal binding protein for immunoglobulin kappa J region (Rbpj), transcript variant 1, mRNA 10535852 2.3 0.01430 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA 10568863 2.3 0.02890 microRNA 202 (Mir202), microRNA. 10345752 2.3 0.01310 interleukin 1 receptor, type II (Il1r2), mRNA

10512701 2.3 0.01290 translocase of outer mitochondrial membrane 5 homolog (yeast) (Tomm5), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA 10447589 2.3 0.01430 fibrillarin (Fbl), mRNA 10378508 2.2 0.01630 TSR1, 20S rRNA accumulation, homolog (yeast) (Tsr1), mRNA 10374840 2.2 0.02900 0 day neonate lung cDNA, RIKEN full-length enriched library, clone:E030034G19 product:unclassifiable, full insert sequence.

10420035 2.2 0.01640 importin 4 (Ipo4), mRNA 10607738 2.2 0.02490 carbonic anhydrase 5b, mitochondrial (Car5b), nuclear gene encoding mitochondrial protein, mRNA 10545135 2.2 0.01430 interleukin 12 receptor, beta 2 (Il12rb2), mRNA

10513739 2.2 0.01360 tenascin C (Tnc), mRNA 10564960 2.2 0.01460 furin (paired basic amino acid cleaving enzyme) (Furin), transcript variant 1, mRNA

10565570 2.2 0.02450 RIKEN cDNA 4632434I11 gene (4632434I11Rik), mRNA 10450365 2.2 0.02620 ncrna:snoRNA chromosome:NCBIM37:17:35088958:35089020 :-1 gene:ENSMUSG00000064662 10586174 2.2 0.02000 ncrna:snoRNA chromosome:NCBIM37:9:64024930:64025000: 1 gene:ENSMUSG00000064514 10500114 2.2 0.01590 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 (Mllt11), mRNA

10451580 2.2 0.01480 bystin-like (Bysl), mRNA 10361787 2.2 0.02000 --- 10530806 2.2 0.02060 phosphoribosyl pyrophosphate amidotransferase (Ppat), mRNA 10423629 2.2 0.02010 processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae) (Pop1), transcript variant 1, mRNA 10569014 2.2 0.02300 interferon induced transmembrane protein 2 (Ifitm2), mRNA 10539882 2.2 0.01780 RuvB-like protein 1 (Ruvbl1), mRNA 10592471 2.2 0.01890 GRAM domain containing 1B (Gramd1b), mRNA

10440929 2.2 0.02080 phosphoribosylglycinamide formyltransferase (Gart), mRNA 10485483 2.2 0.01600 N-acetyltransferase 10 (Nat10), mRNA 10384474 2.2 0.01660 partner of NOB1 homolog (S. cerevisiae) (Pno1), mRNA 10596543 2.2 0.01880 RAD54 like 2 (S. cerevisiae) (Rad54l2), mRNA

10388782 2.2 0.04370 ncrna:snoRNA chromosome:NCBIM37:11:77994801:77994865 :-1 gene:ENSMUSG00000064540 10575102 2.2 0.01790 cirrhosis, autosomal recessive 1A (human) (Cirh1a), mRNA 10504838 2.2 0.01920 nuclear receptor subfamily 4, group A, member 3 (Nr4a3), mRNA 10373778 2.2 0.01990 microrchidia 2A (Morc2a), transcript variant 1, mRNA 10476093 2.2 0.01920 NOP56 ribonucleoprotein homolog (yeast) (Nop56), mRNA 10528143 2.1 0.01710 protein phosphatase 1, regulatory (inhibitor) subunit 14B (Ppp1r14b), mRNA 10349239 2.1 0.01910 Mki67 (FHA domain) interacting nucleolar phosphoprotein (Mki67ip), mRNA 10394538 2.1 0.01900 acetyl-Coenzyme A carboxylase alpha (Acaca), mRNA 10572897 2.1 0.02090 heme oxygenase (decycling) 1 (Hmox1), mRNA

10395225 2.1 0.01990 Putative uncharacterized protein gene:ENSMUSG00000073133 10378453 2.1 0.01920 RIKEN cDNA 1300001I01 gene, mRNA (cDNA clone MGC:99410 IMAGE:5705116), complete cds. 10361887 2.1 0.03010 PERP, TP53 apoptosis effector (Perp), mRNA

10355967 2.1 0.02420 adaptor-related protein complex AP-1, sigma 3 (Ap1s3), mRNA 10600566 2.1 0.02550 ncrna:snRNA chromosome:NCBIM37:X:74824826:74824998: 1 gene:ENSMUSG00000088278 10362674 2.1 0.02470 U3A small nuclear RNA (Rnu3a), small nuclear RNA. 10368277 2.1 0.02200 clone MBI-42 H/ACA box snoRNA, partial sequence. 10359917 2.1 0.02000 hydroxysteroid (17-beta) dehydrogenase 7 (Hsd17b7), mRNA 10588707 2.1 0.01980 interferon-related developmental regulator 2 (Ifrd2), mRNA 10558600 2.1 0.01920 mitochondrial GTPase 1 homolog (S. cerevisiae) (Mtg1), nuclear gene encoding mitochondrial protein, mRNA 10362350 2.1 0.02060 thymocyte selection associated (Themis), mRNA

10418480 2.1 0.02120 guanine nucleotide binding protein-like 3 (nucleolar) (Gnl3), transcript variant 1, mRNA

10507473 2.1 0.02060 NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630046N03 product:unclassifiable, full insert sequence. 10346914 2.1 0.02530 FAST kinase domains 2 (Fastkd2), mRNA 10545588 2.1 0.02540 hexokinase 2 (Hk2), mRNA 10357133 2.1 0.02440 --- 10415640 2.1 0.02010 small nucleolar RNA, H/ACA box 65 (Snora65), small nucleolar RNA. 10574023 2.1 0.04970 metallothionein 2 (Mt2), mRNA 10345824 2.1 0.02190 interleukin 18 receptor accessory protein (Il18rap), mRNA 10520650 2.1 0.02360 carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad), mRNA 10584712 2.1 0.03260 hypoxia up-regulated 1 (Hyou1), mRNA 10346074 2.1 0.02540 WD repeat domain 75 (Wdr75), mRNA 10582376 2.1 0.02870 family with sequence similarity 38, member A (Fam38a), mRNA 10372730 2.1 0.03010 interleukin 10-related T cell-derived inducible factor beta (Iltifb), mRNA 10585778 2.1 0.02440 sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (Sema7a), mRNA 10361091 2.1 0.02620 activating transcription factor 3 (Atf3), mRNA

10405094 2.1 0.02630 isoleucine-tRNA synthetase (Iars), mRNA 10461160 2.1 0.03150 ncrna:snoRNA chromosome:NCBIM37:19:8800084:8800150:1 gene:ENSMUSG00000065305 10414522 2.1 0.02520 apurinic/apyrimidinic endonuclease 1 (Apex1), mRNA 10454807 2.1 0.03260 small nucleolar RNA, H/ACA box 74A (Snora74a), small nucleolar RNA. 10591423 2.1 0.02900 ferredoxin 1-like (Fdx1l), nuclear gene encoding mitochondrial protein, mRNA 10388018 2.1 0.03100 DEAH (Asp-Glu-Ala-His) box polypeptide 33 (Dhx33), mRNA 10388914 2.1 0.02450 kinase suppressor of ras 1 (Ksr1), mRNA 10519183 2.1 0.04170 ATPase family, AAA domain containing 3A (Atad3a), nuclear gene encoding mitochondrial protein, mRNA 10476104 2.0 0.03190 cdna:known chromosome:NCBIM37:2:130100180:13010504 8:1 gene:ENSMUSG00000027405 10461022 2.0 0.02460 protein phosphatase 1, regulatory (inhibitor) subunit 14B (Ppp1r14b), mRNA 10525741 2.0 0.02740 small nuclear ribonucleoprotein 35 (U11/U12) (Snrnp35), mRNA 10494023 2.0 0.02870 RAR-related orphan receptor gamma (Rorc), mRNA 10564938 2.0 0.02440 feline sarcoma oncogene (Fes), mRNA 10507418 2.0 0.03960 eukaryotic translation initiation factor 2B, subunit 3 (Eif2b3), transcript variant 1, mRNA

10461164 2.0 0.02650 WD repeat domain 74 (Wdr74), mRNA 10462346 2.0 0.03670 RNA terminal phosphate cyclase-like 1 (Rcl1), mRNA 10450640 2.0 0.03070 mitochondrial ribosomal protein S18B (Mrps18b), nuclear gene encoding mitochondrial protein, mRNA 10377429 2.0 0.03550 small nucleolar RNA, C/D box 118 (Snord118), small nucleolar RNA. 10399428 2.0 0.03550 small nucleolar RNA, C/D box 118 (Snord118), small nucleolar RNA. 10414711 2.0 0.04330 similar to T-cell receptor alpha-chain gene:ENSMUSG00000076762 10417798 2.0 0.02890 potassium channel, subfamily K, member 5 (Kcnk5), mRNA 10539042 2.0 0.02760 polymerase (RNA) I polypeptide A (Polr1a), mRNA 10493343 2.0 0.04160 ncrna:snRNA chromosome:NCBIM37:3:88666841:88667002: 1 gene:ENSMUSG00000064738 10567589 2.0 0.04920 ubiquitin specific peptidase 31 (Usp31), mRNA

10388010 2.0 0.03260 complement component 1, q subcomponent binding protein (C1qbp), nuclear gene encoding mitochondrial protein, mRNA

10583312 2.0 0.04810 8 days embryo whole body cDNA, RIKEN full- length enriched library, clone:5730443E18 product:weakly similar to PNAS-104 [Homo sapiens], full insert sequence.

10502146 2.0 0.02960 GAR1 ribonucleoprotein homolog (yeast) (Gar1), mRNA 10517706 2.0 0.03140 MRT4, mRNA turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10440800 2.0 0.03100 URB1 ribosome biogenesis 1 homolog (S. cerevisiae) (Urb1), mRNA 10541845 2.0 0.03250 NOP2 nucleolar protein homolog (yeast) (Nop2), mRNA 10345025 2.0 0.03830 isoleucine-tRNA synthetase (Iars), mRNA 10538150 2.0 0.04160 transmembrane protein 176A (Tmem176a), transcript variant 1, mRNA 10508420 2.0 0.03260 tyrosyl-tRNA synthetase (Yars), mRNA 10355464 2.0 0.03250 peroxisomal trans-2-enoyl-CoA reductase (Pecr), mRNA 10471550 2.0 0.02910 ribosomal protein L12, mRNA (cDNA clone IMAGE:6511935), partial cds. 10356329 2.0 0.04100 small nucleolar RNA, H/ACA box 75 (Snora75), small nucleolar RNA. 10471880 2.0 0.04950 microRNA 181b-2 (Mir181b-2), microRNA. 10535904 2.0 0.03090 heat shock 105kDa/110kDa protein 1 (Hsph1), mRNA 10429197 2.0 0.03830 microRNA 30b (Mir30b), microRNA. 10439130 2.0 0.03530 uridine monophosphate synthetase (Umps), mRNA 10361651 2.0 0.04330 nucleoporin 43 (Nup43), mRNA 10367931 2.0 0.03980 LTV1 homolog (S. cerevisiae) (Ltv1), mRNA

10425799 2.0 0.03530 RNA U12, small nuclear (Rnu12), small nuclear RNA. 10417070 2.0 0.03540 importin 5 (Ipo5), mRNA 10535502 2.0 0.04600 aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 1, mRNA 10399636 2.0 0.03690 MRT4, mRNA turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10471457 2.0 0.03540 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1, 3)-N-acetylgalactosaminide alpha- 2,6-sialyltransferase 4 (St6galnac4), mRNA

10371002 2.0 0.03460 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm7), mRNA 10389114 2.0 0.04870 notchless homolog 1 (Drosophila) (Nle1), mRNA

10368730 2.0 0.04180 ribosome production factor 2 homolog (S. cerevisiae) (Rpf2), transcript variant 1, mRNA

10469070 2.0 0.04890 nudix (nucleoside diphosphate linked moiety X)- type motif 5 (Nudt5), mRNA 10545152 2.0 0.04350 cdna:Genscan chromosome:NCBIM37:6:67286340:67365006:- 1 10606689 2.0 0.04100 translocase of inner mitochondrial membrane 8 homolog a1 (yeast) (Timm8a1), nuclear gene encoding mitochondrial protein, mRNA

10497209 2.0 0.04340 mitochondrial ribosomal protein S28 (Mrps28), nuclear gene encoding mitochondrial protein, mRNA 10507557 1.9 0.03780 EBNA1 binding protein 2 (Ebna1bp2), mRNA

10410776 1.9 0.04300 cdna:novel chromosome:NCBIM37:13:81168294:81168638 :-1 gene:ENSMUSG00000070318 10563014 1.9 0.04330 protein arginine N-methyltransferase 1 (Prmt1), mRNA 10531383 1.9 0.04450 SDA1 domain containing 1 (Sdad1), mRNA 10499639 1.9 0.04930 CDC28 protein kinase 1b (Cks1b), mRNA 10605431 1.9 0.04760 RAB39B, member RAS oncogene family (Rab39b), mRNA 10517236 1.9 0.04650 zinc finger protein 593 (Zfp593), mRNA 10355037 1.9 0.04320 WD repeat domain 12 (Wdr12), mRNA 10468292 1.9 0.04100 programmed cell death 11 (Pdcd11), mRNA

10607933 1.9 0.03680 holocytochrome c synthetase (Hccs), mRNA

10421774 1.9 0.04770 diacylglycerol kinase, eta (Dgkh), mRNA 10361760 1.9 0.04110 translocase of inner mitochondrial membrane 8 homolog a1 (yeast) (Timm8a1), nuclear gene encoding mitochondrial protein, mRNA 10551464 1.9 0.04310 fibrillarin (Fbl), mRNA 10568217 1.9 0.03690 dCTP pyrophosphatase 1 (Dctpp1), mRNA 10373454 1.9 0.04410 proliferation-associated 2G4 (Pa2g4), mRNA

10507471 1.9 0.04330 cdna:pseudogene chromosome:NCBIM37:4:116821511:11682189 7:1 gene:ENSMUSG00000070834 10503643 1.9 0.04640 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 (Ndufaf4), nuclear gene encoding mitochondrial protein, mRNA 10364249 1.9 0.04920 --- 10364239 1.9 0.04440 solute carrier family 19 (sodium/hydrogen exchanger), member 1 (Slc19a1), mRNA

10461587 1.9 0.04310 PREDICTED: membrane-spanning 4-domains, subfamily A, member 4A (Ms4a4a), mRNA

10407543 1.9 0.04790 GTP binding protein 4 (Gtpbp4), mRNA 10575144 1.9 0.04650 nuclear import 7 homolog (S. cerevisiae) (Nip7), transcript variant 1, mRNA 10364373 1.9 0.04630 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm7), mRNA 10455961 1.9 0.04980 interferon inducible GTPase 1 (Iigp1), transcript variant 2, mRNA 10373202 1.9 0.04670 serine hydroxymethyltransferase 2 (mitochondrial) (Shmt2), nuclear gene encoding mitochondrial protein, mRNA 10399882 1.9 0.04630 dihydrouridine synthase 4-like (S. cerevisiae) (Dus4l), mRNA 10398996 1.9 0.04270 cysteine rich protein 2 (Crip2), mRNA 10405971 1.9 0.04750 NOL1/NOP2/Sun domain family member 2 (Nsun2), mRNA 10438308 1.9 0.04460 RAN binding protein 1 (Ranbp1), mRNA 10351037 1.9 0.04890 growth arrest specific 5 (Gas5), non-coding RNA. 10354732 1.9 0.04640 heat shock protein 1 (chaperonin) (Hspd1), nuclear gene encoding mitochondrial protein, mRNA 10375240 1.9 0.04660 heat shock protein 1 (chaperonin) (Hspd1), nuclear gene encoding mitochondrial protein, mRNA 10427744 1.9 0.04310 retinoic acid induced 14 (Rai14), transcript variant 1, mRNA 10569200 1.9 0.04960 polymerase (RNA) II (DNA directed) polypeptide L (Polr2l), mRNA 10538420 1.9 0.04960 glycyl-tRNA synthetase (Gars), mRNA 10408557 1.9 0.04580 serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a), mRNA 10587554 1.9 0.04820 trophoblast glycoprotein (Tpbg), transcript variant 1, mRNA 10521555 1.9 0.04660 Ly1 antibody reactive clone (Lyar), mRNA 10581547 1.9 0.04670 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) (Nob1), mRNA 10485607 -1.9 0.04600 glutamine and serine rich 1 (Qser1), mRNA

10413012 -1.9 0.04810 adult male diencephalon cDNA, RIKEN full- length enriched library, clone:9330166H09 product:unclassifiable, full insert sequence.

10525553 -1.9 0.04460 ncrna:snRNA chromosome:NCBIM37:5:123810841:12381100 9:1 gene:ENSMUSG00000065191 10547976 -1.9 0.04250 TAP binding protein-like (Tapbpl), mRNA 10574656 -1.9 0.04330 F-box and leucine-rich repeat protein 8 (Fbxl8), mRNA 10552252 -1.9 0.04710 RIKEN cDNA 1600014C10 gene (1600014C10Rik), transcript variant 1, mRNA

10434743 -1.9 0.04450 cdna:known chromosome:NCBIM37:16:23110306:23111699 :1 gene:ENSMUSG00000022884 10490302 -1.9 0.04480 RIKEN cDNA 2810021G02 gene (2810021G02Rik), mRNA 10456492 -1.9 0.04470 DNA segment, Chr 18, ERATO Doi 653, expressed, mRNA (cDNA clone MGC:106263 IMAGE:3583946), complete cds.

10608718 -1.9 0.04250 peptidoglycan recognition protein 2 (Pglyrp2), mRNA 10508992 -1.9 0.04590 progestin and adipoQ receptor family member VII (Paqr7), mRNA 10538187 -2.0 0.03950 glycoprotein (transmembrane) nmb (Gpnmb), mRNA 10362811 -2.0 0.04410 sestrin 1 (Sesn1), transcript variant 1, mRNA

10526191 -2.0 0.04310 GATS-like protein 2 gene:ENSMUSG00000015944 10364650 -2.0 0.04380 histocompatibility (minor) HA-1 (Hmha1), transcript variant 1, mRNA 10590983 -2.0 0.04120 pannexin 1 (Panx1), mRNA 10531952 -2.0 0.04720 ATP-binding cassette, sub-family G (WHITE), member 3 (Abcg3), mRNA 10559248 -2.0 0.04210 tetraspanin 32 (Tspan32), transcript variant 2, mRNA 10450872 -2.0 0.04400 olfactory receptor 99 (Olfr99), mRNA 10472860 -2.0 0.03780 Rap guanine nucleotide exchange factor (GEF) 4 (Rapgef4), mRNA 10428081 -2.0 0.04390 heat-responsive protein 12 (Hrsp12), mRNA

10375667 -2.0 0.03450 ring finger protein 130 (Rnf130), mRNA 10445909 -2.0 0.03460 K(lysine) acetyltransferase 2B (Kat2b), transcript variant 1, mRNA 10449652 -2.0 0.03510 dynein, axonemal, heavy chain 8 (Dnahc8), mRNA 10406334 -2.0 0.04380 multiple C2 domains, transmembrane 1 (Mctp1), mRNA 10546685 -2.0 0.03780 eukaryotic translation initiation factor 4E member 3 (Eif4e3), mRNA 10354521 -2.0 0.03520 inositol polyphosphate-1-phosphatase (Inpp1), mRNA 10447275 -2.0 0.03150 RIKEN cDNA 1700106N22 gene, mRNA (cDNA clone MGC:169896 IMAGE:8861291), complete cds. 10360631 -2.0 0.04230 aarF domain containing kinase 3 (Adck3), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA 10412537 -2.0 0.04940 predicted gene 3002 (Gm3002), non-coding RNA. 10555862 -2.0 0.03800 tripartite motif-containing 34 (Trim34), mRNA

10476939 -2.0 0.04620 predicted gene 4979 (Gm4979), mRNA 10368486 -2.0 0.03220 ring finger protein 146 (Rnf146), transcript variant 1, mRNA 10577226 -2.0 0.03000 RIKEN cDNA 2610019F03 gene (2610019F03Rik), mRNA 10528090 -2.0 0.03240 RUN domain containing 3B (Rundc3b), mRNA

10505008 -2.1 0.03460 solute carrier family 44, member 1 (Slc44a1), transcript variant 1, mRNA 10390186 -2.1 0.02700 ABI gene family, member 3 (Abi3), transcript variant 1, mRNA 10475502 -2.1 0.03140 predicted gene 14085 (Gm14085), mRNA 10360684 -2.1 0.04220 epoxide hydrolase 1, microsomal (Ephx1), mRNA 10383152 -2.1 0.04250 hypothetical protein gene:ENSMUSG00000070327 10417226 -2.1 0.04460 predicted gene 3002 (Gm3002), non-coding RNA. 10601416 -2.1 0.02470 purinergic receptor P2Y, G-protein coupled 10 (P2ry10), mRNA 10489055 -2.1 0.02670 Src-like-adaptor 2 (Sla2), mRNA 10365344 -2.1 0.02540 t-complex 11 (mouse) like 2 (Tcp11l2), mRNA

10566585 -2.1 0.02500 hypothetical protein LOC434223 isoform 1 gene:ENSMUSG00000073902 10538979 -2.1 0.03230 CD8 antigen, beta chain 1 (Cd8b1), mRNA 10406270 -2.1 0.03240 glutaredoxin (Glrx), mRNA 10422598 -2.1 0.02530 selenoprotein P, plasma, 1 (Sepp1), transcript variant 1, mRNA 10606369 -2.1 0.02500 integral membrane protein 2A (Itm2a), mRNA

10455954 -2.1 0.02560 predicted gene 4951 (Gm4951), mRNA 10490150 -2.1 0.02710 Z-DNA binding protein 1 (Zbp1), transcript variant 1, mRNA 10567355 -2.1 0.02860 G protein-coupled receptor, family C, group 5, member B (Gprc5b), transcript variant 2, mRNA

10515690 -2.1 0.02570 seizure threshold 2 (Szt2), mRNA 10566346 -2.1 0.02420 RIKEN cDNA 9230105E10 gene (9230105E10Rik), transcript variant 1, mRNA

10381809 -2.1 0.02550 integrin beta 3 (Itgb3), mRNA 10446771 -2.1 0.02540 lysocardiolipin acyltransferase 1 (Lclat1), transcript variant 1, mRNA 10416566 -2.1 0.03810 epithelial stromal interaction 1 (breast) (Epsti1), transcript variant a, mRNA 10592515 -2.1 0.02900 ubiquitin associated and SH3 domain containing, B (Ubash3b), mRNA 10464443 -2.1 0.02370 --- 10535938 -2.1 0.02470 NEDD4 binding protein 2-like 1 (N4bp2l1), mRNA 10507040 -2.1 0.02240 spermatogenesis associated 6 (Spata6), mRNA

10362426 -2.1 0.03250 triadin (Trdn), mRNA 10572089 -2.1 0.02320 N-acetyltransferase 2 (arylamine N- acetyltransferase) (Nat2), transcript variant 1, mRNA 10360373 -2.1 0.02690 RIKEN cDNA E030037K03 gene (E030037K03Rik), transcript variant 1, mRNA

10399973 -2.1 0.02250 histone deacetylase 9 (Hdac9), mRNA 10399710 -2.1 0.04210 radical S-adenosyl methionine domain containing 2 (Rsad2), mRNA 10383206 -2.1 0.04200 hypothetical protein gene:ENSMUSG00000070327 10447056 -2.1 0.03040 glutaminyl-peptide cyclotransferase (glutaminyl cyclase) (Qpct), mRNA 10502205 -2.1 0.03570 hydroxyacyl-Coenzyme A dehydrogenase (Hadh), nuclear gene encoding mitochondrial protein, mRNA 10366407 -2.1 0.02220 Putative uncharacterized protein gene:ENSMUSG00000074742 10524310 -2.1 0.02230 tetratricopeptide repeat domain 28 (Ttc28), mRNA 10356866 -2.1 0.02300 programmed cell death 1 (Pdcd1), mRNA 10473356 -2.1 0.02160 ubiquitin-conjugating enzyme E2L 6 (Ube2l6), mRNA 10406551 -2.2 0.02040 single-stranded DNA binding protein 2 (Ssbp2), transcript variant 2, mRNA 10462623 -2.2 0.03510 interferon-induced protein with tetratricopeptide repeats 1 (Ifit1), mRNA 10545130 -2.2 0.02320 growth arrest and DNA-damage-inducible 45 alpha (Gadd45a), mRNA 10582821 -2.2 0.02880 ncrna:snoRNA chromosome:NCBIM37:8:129468747:12946888 0:-1 gene:ENSMUSG00000065637 10572772 -2.2 0.03010 hematopoietic SH2 domain containing (Hsh2d), mRNA 10427628 -2.2 0.01990 interleukin 7 receptor (Il7r), mRNA 10373502 -2.2 0.02530 IKAROS family zinc finger 4 (Ikzf4), mRNA 10417302 -2.2 0.03260 predicted gene 3002 (Gm3002), non-coding RNA. 10497031 -2.2 0.03850 ncrna:misc_RNA chromosome:NCBIM37:3:154754982:15475509 2:1 gene:ENSMUSG00000064765 10466837 -2.2 0.03790 ncrna:snoRNA chromosome:NCBIM37:19:25240575:25240706 :-1 gene:ENSMUSG00000065634 10434778 -2.2 0.02500 receptor transporter protein 4 (Rtp4), mRNA

10427454 -2.2 0.01830 caspase recruitment domain family, member 6 (Card6), mRNA 10375634 -2.2 0.02050 mitogen-activated protein kinase 9 (Mapk9), transcript variant alpha1, mRNA 10444229 -2.2 0.02120 histocompatibility 2, class II, locus DMa (H2- DMa), mRNA 10571214 -2.2 0.02200 ring finger protein 122 (Rnf122), mRNA 10353844 -2.2 0.01800 neuralized homolog 3 homolog (Drosophila) (Neurl3), mRNA 10404840 -2.2 0.02510 CD83 antigen (Cd83), mRNA 10354563 -2.2 0.02060 dynein, axonemal, heavy chain 7B (Dnahc7b), mRNA 10586781 -2.2 0.03100 myosin IE (Myo1e), mRNA 10542993 -2.2 0.02030 paraoxonase 3 (Pon3), mRNA 10497149 -2.2 0.02220 wntless homolog (Drosophila) (Wls), mRNA

10583286 -2.2 0.01820 G protein-coupled receptor 83 (Gpr83), mRNA

10378286 -2.2 0.02500 integrin alpha E, epithelial-associated (Itgae), transcript variant 1, mRNA 10524229 -2.2 0.01850 cdna:known chromosome:NCBIM37:5:110950181:11095499 9:1 gene:ENSMUSG00000048215 10373542 -2.2 0.02050 diacylglycerol kinase, alpha (Dgka), mRNA 10420483 -2.2 0.02170 PHD finger protein 11 (Phf11), mRNA 10600235 -2.2 0.01670 ATP-binding cassette, sub-family D (ALD), member 1 (Abcd1), mRNA 10606184 -2.2 0.04420 microRNA 374 (Mir374), microRNA. 10361338 -2.2 0.01830 interaction protein for cytohesin exchange factors 1 (Ipcef1), transcript variant 4, mRNA

10412495 -2.2 0.02310 predicted gene 3002 (Gm3002), non-coding RNA. 10532339 -2.2 0.01840 peroxisomal membrane protein 2 (Pxmp2), mRNA 10360370 -2.3 0.01840 cDNA sequence BC094916 (BC094916), mRNA

10383196 -2.3 0.02650 hypothetical protein gene:ENSMUSG00000070327 10523134 -2.3 0.01790 platelet factor 4 (Pf4), mRNA 10571984 -2.3 0.02490 DEAD (Asp-Glu-Ala-Asp) box polypeptide 60 (Ddx60), mRNA 10349081 -2.3 0.01600 PH domain and leucine rich repeat protein phosphatase 1 (Phlpp1), mRNA 10383208 -2.3 0.02330 hypothetical protein gene:ENSMUSG00000070327 10357488 -2.3 0.01630 CD55 antigen (Cd55), mRNA 10596148 -2.3 0.02550 transferrin (Trf), mRNA 10450675 -2.3 0.01980 histocompatibility 2, T region locus 24 (H2-T24), mRNA 10588007 -2.3 0.01810 transcription factor Dp 2 (Tfdp2), transcript variant 1, mRNA 10451879 -2.3 0.01450 zinc finger protein 119a (Zfp119a), mRNA 10555510 -2.3 0.02480 phosphodiesterase 2A, cGMP-stimulated (Pde2a), transcript variant 1, mRNA 10379615 -2.3 0.02570 schlafen 5 (Slfn5), mRNA 10512487 -2.3 0.01940 RNA component of mitochondrial RNAase P (Rmrp), RNase MRP RNA. 10347948 -2.3 0.02040 nuclear antigen Sp100 (Sp100), mRNA 10485622 -2.3 0.01240 glutamine and serine rich 1 (Qser1), mRNA

10499108 -2.3 0.01800 glycosyltransferase 28 domain containing 2 (Glt28d2), mRNA 10383198 -2.3 0.02520 hypothetical protein gene:ENSMUSG00000070327 10501586 -2.3 0.01210 sphingosine-1-phosphate receptor 1 (S1pr1), mRNA 10518761 -2.3 0.01850 cdna:pseudogene chromosome:NCBIM37:4:149689286:14968954 5:-1 gene:ENSMUSG00000085787 10437224 -2.4 0.02180 myxovirus (influenza virus) resistance 2 (Mx2), non-coding RNA. 10601354 -2.4 0.02010 ncrna:snRNA chromosome:NCBIM37:X:103015222:10301540 4:1 gene:ENSMUSG00000084678 10524312 -2.4 0.01060 tetratricopeptide repeat domain 28 (Ttc28), mRNA 10407792 -2.4 0.01170 G protein-coupled receptor 137B, pseudogene (Gpr137b-ps), non-coding RNA.

10383212 -2.4 0.02050 hypothetical protein gene:ENSMUSG00000070327 10351873 -2.4 0.01390 pyrin and HIN domain family, member 1 (Pyhin1), mRNA 10382449 -2.4 0.01160 RAB37, member of RAS oncogene family (Rab37), transcript variant 1, mRNA 10389581 -2.4 0.01790 yippee-like 2 (Drosophila) (Ypel2), mRNA 10362861 -2.4 0.00960 sex comb on midleg-like 4 (Drosophila) (Scml4), mRNA 10462613 -2.4 0.01460 interferon-induced protein with tetratricopeptide repeats 2 (Ifit2), mRNA 10472649 -2.4 0.01200 myosin IIIB (Myo3b), mRNA 10494001 -2.4 0.01180 TD and POZ domain containing 4 (Tdpoz4), mRNA 10547985 -2.4 0.00940 CD27 antigen (Cd27), transcript variant 1, mRNA 10445767 -2.4 0.00950 triggering receptor expressed on myeloid cells- like 2 (Treml2), mRNA 10462621 -2.4 0.01900 RIKEN cDNA I830012O16 gene (I830012O16Rik), mRNA 10406982 -2.4 0.01140 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 (Adamts6), mRNA 10587639 -2.4 0.00970 5' nucleotidase, ecto (Nt5e), mRNA 10589994 -2.5 0.00940 eomesodermin homolog (Xenopus laevis) (Eomes), transcript variant 1, mRNA 10412517 -2.5 0.01400 predicted gene 3002 (Gm3002), non-coding RNA. 10417269 -2.5 0.01430 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330002D23 product:unclassifiable, full insert sequence.

10464754 -2.5 0.00970 ras homolog gene family, member D (Rhod), mRNA 10580752 -2.5 0.00810 Putative uncharacterized protein gene:ENSMUSG00000074153 10559261 -2.5 0.00830 CD81 antigen (Cd81), mRNA 10511416 -2.5 0.01030 thymocyte selection-associated high mobility group box (Tox), mRNA 10360367 -2.5 0.01200 cdna:known chromosome:NCBIM37:1:175398640:17540420 6:-1 gene:ENSMUSG00000037849 10514892 -2.5 0.01430 RIKEN cDNA 2210012G02 gene (2210012G02Rik), mRNA 10576639 -2.5 0.01130 neuropilin 1 (Nrp1), mRNA 10499095 -2.5 0.00850 family with sequence similarity 160, member A1 (Fam160a1), mRNA 10549162 -2.5 0.00830 ST8 alpha-N-acetyl-neuraminide alpha-2,8- sialyltransferase 1 (St8sia1), mRNA 10542911 -2.5 0.01180 sterile alpha motif domain containing 9-like (Samd9l), mRNA 10506058 -2.6 0.00770 InaD-like (Drosophila) (Inadl), transcript variant 1, mRNA 10597279 -2.6 0.00830 chemokine (C-C motif) receptor-like 2 (Ccrl2), mRNA 10498599 -2.6 0.00790 intraflagellar transport 80 homolog (Chlamydomonas) (Ift80), mRNA 10484888 -2.6 0.00810 protein tyrosine phosphatase, receptor type, J (Ptprj), transcript variant 1, mRNA 10417235 -2.6 0.01160 predicted gene 2897 (Gm2897), transcript variant 1, mRNA 10417315 -2.6 0.01160 predicted gene 2897 (Gm2897), transcript variant 1, mRNA 10412491 -2.6 0.00840 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330002D23 product:unclassifiable, full insert sequence.

10383799 -2.6 0.00610 transcobalamin 2 (Tcn2), transcript variant 1, mRNA 10577190 -2.7 0.00550 RAS p21 protein activator 3 (Rasa3), mRNA 10582888 -2.7 0.00850 cdna:known chromosome:NCBIM37:9:3001070:3002330:1 gene:ENSMUSG00000074566 10518524 -2.7 0.01160 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full- length enriched library, clone:9430038G21 product:Transitional EPITHELIA response protein homolog, full insert sequence.

10607870 -2.8 0.00630 toll-like receptor 7 (Tlr7), mRNA 10532301 -2.8 0.00630 Uncharacterized protein gene:ENSMUSG00000072763 10591614 -2.8 0.00620 dedicator of cytokinesis 6 (Dock6), mRNA 10349603 -2.8 0.00770 interleukin 10 (Il10), mRNA 10603328 -2.8 0.00500 coiled-coil domain containing 22 (Ccdc22), mRNA 10404132 -2.8 0.00410 cytidine monophospho-N-acetylneuraminic acid hydroxylase (Cmah), transcript variant 2, mRNA

10590974 -2.8 0.00510 folate receptor 4 (delta) (Folr4), transcript variant 2, mRNA 10468309 -2.9 0.00560 SH3 and PX domains 2A (Sh3pxd2a), transcript variant 1, mRNA 10565775 -2.9 0.00510 diacylglycerol O-acyltransferase 2 (Dgat2), mRNA 10556280 -2.9 0.00490 SWA-70 protein (Swap70), mRNA 10355312 -3.0 0.00400 IKAROS family zinc finger 2 (Ikzf2), mRNA 10502791 -3.0 0.00520 interferon-induced protein 44 (Ifi44), mRNA

10472235 -3.2 0.00310 death associated protein-like 1 (Dapl1), mRNA

10420497 -3.2 0.00460 predicted gene 6907 (Gm6907), mRNA 10506108 -3.2 0.00640 ncrna:miRNA chromosome:NCBIM37:4:98328328:98328423: 1 gene:ENSMUSG00000076294 10497689 -3.3 0.00180 guanine nucleotide binding protein (G protein), beta 4 (Gnb4), mRNA 10491952 -3.3 0.00180 microsomal glutathione S-transferase 2 (Mgst2), mRNA 10480238 -3.5 0.00120 ST8 alpha-N-acetyl-neuraminide alpha-2,8- sialyltransferase 6 (St8sia6), mRNA 10459866 -3.6 0.00120 solute carrier family 14 (urea transporter), member 1 (Slc14a1), transcript variant 1, mRNA

10603551 -3.7 0.00190 cytochrome b-245, beta polypeptide (Cybb), mRNA 10403229 -3.8 0.00130 integrin beta 8 (Itgb8), mRNA 10351197 -3.9 0.00100 selectin, lymphocyte (Sell), transcript variant 1, mRNA 10462618 -4.2 0.00120 interferon-induced protein with tetratricopeptide repeats 3 (Ifit3), mRNA 10408689 -4.3 0.00110 neuritin 1 (Nrn1), mRNA 10598292 -4.5 0.00080 forkhead box P3 (Foxp3), mRNA 10598289 -4.8 0.00030 RIKEN cDNA 4930524L23 gene (4930524L23Rik), non-coding RNA. 10598152 -5.1 0.00080 2-cell-stage, variable group, member 3-like (LOC625360), mRNA 10506820 -5.8 0.00050 ncrna:snRNA chromosome:NCBIM37:4:108170649:10817075 1:1 gene:ENSMUSG00000065299 10555174 -8.7 0.00000 leucine rich repeat containing 32 (Lrrc32), mRNA

* represents false discovery rate ** generated by analysis software, Expression Console, may not always map to a known gene Supplementary Table 2. Sequences of primers used for qPCR

Product ID NCBI RefSeq Forward Primer Reverse Primer size Cd40lg NM_011616 TGCAGCATCCGTTCTACAGTGGG TGGGCGTTGACTCGAAGGCT 166 Cx3cr1 NM_009987 TGCTCAGGACCTCACCATGTCCAC ACGAGGGCGTAGAAGACGGACA 141 Fcgr2b NM_001077189 TGGCTGCTGTCACTGGGATTGC CAGGGTTTCCTGGGAGAGCTGGAA 102 Csf2 NM_009969 TGCCTGTCACGTTGAATGAAGAGGT AGGCGCCCTTGAGTTTGGTGA 135 Ifng NM_008337 TGCCAAGTTTGAGGTCAACAACCCA ACCCCGAATCAGCAGCGACT 129 Il17a NM_010552 ACCCTGGACTCTCCACCGCAAT TGGTCCAGCTTTCCCTCCGCAT 108 Il17f NM_145856 ACCCGTGAAACAGCCATGGTCA AGCCTTCTGCAAGGCAGGAACC 117 Il1r2 NM_010555 GCTCAGGAAGTTGGTGCGGACA TCTCCATGGACTGTGGGCTTCTCC 141 Il2 NM_008366 ACTTGCCCAAGCAGGCCACA GCACTCAAATGTGTTGTCAGAGCCC 185 Il22 NM_016971 TGGAGAGATCAAGGCGATTGGGG AAGGCAGGAAGGAGCAGTTCTTCG 110 Il3 NM_010556 TCTGCGAATGACTCTGCGCTGC AGATGCGGGCTGAGGTGGTCTA 135 Itga4 NM_010576 ACCAGACCTGCGAACAGCTCCA CACCTGTGCCCACAAGTCACGA 151 Rorgt NM_011281 TCCTAGCCAAGCTGCCACCCAA AAGGCGGCTTGGACCACGAT 109 Tbet NM_019507 CAGCATGCCAGGGAACCGCTTA AGCCCCCTTGTTGTTGGTGAGC 115 Tnf NM_013693 AGCCCACGTCGTAGCAAACCA AATCGGCTGACGGTGTGGGT 207 Ywhaz NM_011740 ACTTTTGGTACATTGTGGCTTCAG CCGCCAGCACACACCAATAT 95