Microbial Community in the High Canopy of the Bornean

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek.

Datum Unterschrift Student Unterschrift Student Datum Microbial community inMicrobial community the of the high tropicacanopy Bornean

Verfahrenstechnik, Umwelttechnik,Verfahrenstechnik, Technische Biowissenschaften und Dr.techn. Dipl.-Ing Komal Chenthamara Dr.techn. Dipl.-Ing Komal Chenthamara

Prof. Dr.rer.nat.Prof. S. IrinaDruzhinina der Technischen Universität Wiender Universität Technischen DI. Mohammad Javad Rahimi Javad DI. Mohammad Ausgeführt am Institut fürAusgeführt am Institut unter von Leitung der H.Oya AkyıldızH.Oya Albertplatz 5/2/1 Albertplatz Diplomarbeit Diplomarbeit 1080, Wien diversity 1429122 durch und

, BSc

l molecular rainforest: Unterschrift Betreuer

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Materials & Materials methods The aim of the Thesis The of Thesis aim the Introduction Introduction Abstract Contents DNA DNA Barcoding and construction of identification phylograms of Molecular techniques Leaves of Bodies of Nests of Materials Materials from the habitat of “exploding Bornean ants” Biodiversity of Borneo forests rain Fungi Fungi as a source of products natural Application of public databases for taxonomicthe assignment of the species Internal Internal transcribed spacers (ITS) of gene clusterrRNA and Abbreviations as a nuclear marker for DNA barcoding Identification of fungi Classification of fungi Table of Figures Diversity ofDiversity fungi List of Tables Construction of identification phylogram Sequence Alignment A A sequence searchsimilarity against public databases Sanger Sequencing PCR PurificationPCR Agarose gelAgarose electrophoresis Polymerase Chain Reaction (PCR) DNA DNA Extracti Isolation Isolation of pure fungal cultures and cultivation condition ...... Colobopsis explodensColobopsis C. C. explodens Shorea johorensis Shorea ...... on ......

...... and ...... C. C. bruneiensis and and ...... Ficus ...... C. C. bruneiensis ...... sp...... nom. prov...... nom. prov......

...... tef1 ...... (translation elongation factor-1 alpha) ......

......

18 17 27 27 27 27 26 26 26 24 23 23 20 20 20 18 18 15 14 13 11 10 . . 8 6 4 8 4 7 8

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Attachment 1 Curriculum Vitae Curriculum Vitae References Conclusion Conclusion TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit and Discussion Results TU Wien Phylogenetic Analysis Results DNA DNA Amplification Results The of diversity ant assosiated fungi: The ofDiversity Fungi in the Phyllosphere ...... 3

72 71 67 65 28 53 33 28 28

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure 12Figure Tree of S. johorensis and sp. epiphyticFicus Referencesfungi. were shown as Figure 14TreeFigure of S. johorensis and Ficus sp. endophytic Referencesfungi. were shown as b Figure 15Figure Tree of explodens fungi naturalfrom C. nest (YGFF). References were shown as bol Figure 13Figure the one-week old colony 6022.TUCIM of 6023 and 6 Figure 11Figure Tree of Fusarium species from Shorea Referencesphyllosphere. were shown as bold type. Penicillium sp. which were shown. References were shown as bold type. 10Figure Shorea 2014 phyllosphere excluded TheTrichoderma. highest parts Figure 9Figure Leaves of S. johorensis. the size of can reachthe to leaves more than 2 Fi Figure 7Figure Tree of fungi which belong to References Basidiomycota phylum. were that particular family. unknown Theremained. number next to name the representsof family the the num 6Figure Isolated 524 fungal strains totheir taxonomical order & family. artificial nestartificial C.(b), bruneiensis natural nest (c). 5Figure Natural explodensC. nest (YG-FF) was founda dead in branch of S. jo Figure 3Figure Schematic structure of Figure 4Figure Location theof KBFSC in Brunei Borneo,Darussalam, shown on Googl analyses [38]analyses Figure 2Figure Organization of the internal transcribed spacer (ITS) region[1] Maximum posterior probability support designated with an asterisk (*) [19]. MPI with a CAT +GTR Posterior model. probabilities shown on branches wi superalignment fromderived 72 ubiquitous fungal COG sampledfamilies in Gblo 1Figure of Phylogeny Fungi. Bayesian phylogeny of 84 fungal species from an Figures Table of Table 11 Fungi from of nest-2017.bruneiensis C. below below 95% are marked in red Table 10 diversity The isolated fungi from andinside outer oflayer the M Table 9 YGFF strainsnest their and phylogenic analysis with marker tef1- Table 7 ...... Table 8 YGFF strainsnest their and phylogenic analysis. The identity val red Table 6 Shorea johorensis and sp. epiphyticFicus Thefungi. v similarity Basidiomycota are cells green. marked in Table 5 Species from Shorea phyllosphere 2014. identity The below 95values Table 4 Program PCR Table 3 mixture componentsPCR and concentrations Table 2 primers' parametersPCR Table 1 Sourceof isolated strains gure gure 8 Trichoderma species based on tef1. were shownReferences as bold type...... List of Tables ofList Tables S. johorensis S...... and ...... Ficus ...... sp. endophytic Thefungi. identity below 95%values are marked in red. tef1 ...... gene in ...... Trichoderma ...... 1 Basidiomycota ...... spp. and location forprimers of phylogenetic 024 (from left to right) 024 to(from left right) ...... alues below 95% are marked in ues below 95% are marked in red Totally 26assigned, and order1 ...... α IT1 nest. IT1 The identity values

...... th 1000a of burn-in trees...... % are marked in red. horensis (a), C. explodenshorensis C. (a), belong belong to andArthrinium e Satellite. e Satellite. 8529-character 0 cm. cm. 0 shown as bold type. cks using PhyloBayes ...... ber of species in ...... bold type. bold type...... old type old type d type. d type......

......

54 43 50 51 47 42 34 32 30 29 19 19 11 13 61 58 54 53 48 52 35 25 25 25 22 9

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure 23Figure The fungi of boththe(2015& bruneiensis 2017)C. T nest. Figure 22Figure Tree of fungi from nest-2017.bruneiensis C. References were shown as bold Figure 21Figure Fungi from bruneiensisC. nest in microscopy on PDA plate. in Here this plate the strain at right the 7996)side (TUCIM formed yeasty 20Figure Some of thestrains fungi can switch form from tomycelial yeasty sample onsample PDA medium b) the culturespure from strainsthe isolated from pl 19Figure Fungi plate culture of 2015.bruneiensis C. c a) one-week is Figure 18Figure Tree of fungi from nestbruneiensis C. 2015 were shown References (MIT1). as (TUCIM 6192).(TUCIM b) One-week old culture the ofof brun interior C. culture of inner the part theof More nest. than 99% theof grown fung 17Figure a) Fungi plate culture of 2015bruneiensis C. nest. The left pl TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit (Pleosporales sp. TUCIM 6192) thecovered inner surface of nest the 16Figure microscopic of analysis the BBQ nest 2015: A patch of fungi TU Wien ...... 5 ...... eiensis nest. eiensis he black fungi are framed...... ulture plate nest of bruneiensis C. belong belong toPleosporales family ate towas belonging 4 days i i were belong to the same strain after one cultivationweek of after few days of cultivation...... ate (a). ate (a)...... type. type. bold type......

63 62 60 60 59 57 56 55

A α

I Y Polymerase Chain Reaction Polymerase Chain s

Potato Dextrose Agar PotatoDextrose Agar a National Center for Biotechnology Information Center National for Biotechnology Information T

gene gene alpha encoding translationfactor-1 theelongation

T ethylenediaminetetraacetic acid nd Abbreviations Abbreviations

Basic Local Alignment Search Tool Basic Local Alignment Tool Search Clusters of Groups Orthologous

2 Internal transcribedspacers 2thecluster and 1 rRNA of gene Multiple Alignment using Fast Fourier Transform Multiple AlignmentTransform Fourierusing Fast gene gene encoding Colobopsis cylindrica

RNA polymerase subunit RNA polymerase B

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. explodens’ collected and isolated. The ITS1 and 2 were combined with with combined were 2and ITS1 The isolated. and collected endophyte), and epiphyte (including phyllosphere leaves nest, differen a from samples reason, this For grounds. nesting or species and ants which spend most of their time on Dipterocarpacea Bo bioactive discover andofmetabolites. enzymes of new sources explore Identification fungi. like microorganisms and study remar a is rainforest Borneo Therefore, exploration. for available biod of amount significant has Borneo Borneo. Brunei, of exp poorly from fungi different identify to used were methods identification for applied efficiently be can methods molecular Analysis adaptations. environmental and interactions, fungal-fungal progressio the prevents fungi identify correctly to Failures of lots However, Earth. on organisms diverse most the are Fungi Abstract Eurotiales (f.e. (f.e. Eurotiales phyllosphere, epiphytic & endophytic fungi from fungi endophytic & epiphytic phyllosphere, according groups into divided were strains The Mucoromycota. 524 samples samples 524 phylogenetic parsimonyinference, maximum analysis was used by us 1 alpha) and used as markers for identification of fungi Trichoderma Debaryomyces te pbihd eune va CI BLAST NCBI via sequences published other fungi fromfungi taxonomic groups several h other On the than leaves. biodiversity possess a less nests nests and phylogenetic trees were constructed. Species from or

sp is and opsd f soyoa wie 4 ape bln t Basidiomyco to belong samples 14 while Ascomycota, of composed . Penicillium Fusarium , Candida

genera from Saccharomycetales order p) Xlrae (f.e. Xylariales sp.), sp ) ee on dominating found were .) .

. h sqecs ee lge va AF. For MAFFT. via aligned were sequences The Shorea Pestalotiopsis Pestalotiopsis . The DNA sequences were compared with sp. and sp. . of unknown fungi species can of tolead species unknown fungi and, nests are mostly home of black black home of are mostly nests and, n on the study of species diversity, species of study the on n tef1α Yeasts are mainly represented by by represented mainly are Yeasts t region of ant territories like their like territories ant of region t iversity that is understudied and and understudied is that iversity lored habitats such as rain forest forest rain as such habitats lored to their isolated area which are which area isolated their to of fungi. In this study molecular molecular study this In fungi. of and the ants themselves were themselves ants the and Ficus (translation elongation factor- elongation (translation p and sp. . The. study showed that, ants’ rneo is a home of dipterocarp a dipterocarp ofhomerneo is fungi are still not identified not still are fungi kable area for researcher to to researcher for area kable canopies, canopies, exploring for food ing MEGA X. A partMEGAlarge ing of X.

of data generated with with generated data of sp . ,

ders Hypocreales (f.e. Arthrinium C. brune ie nsis sp.) and and sp.) ta and and ta and and C. .

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. classification was modified by many researchers modified classification by was 15-19] ( [9, approach accurate more a is data molecular and morphological on based TU Wien Diplomarbeit H.Oya H.Oya Akyildiz millions several exceeding Diplomarbeit estima the describedtaxonomicallywith formally beenhave species eukaryotes of groups most diverse comprise Fungi the of one Introduction TU Wien as 2.2-3.8 million 2.2-3.8 million as culturable of number The [4]. species plant vascular than species and communities. For example in 2001, in the British Isles, th with plants in the specific geographic region and the number o lsiiain r Cyrdoyoa Zgmct, Ascomycota, Zygomycota, accor Chytridiomycota, (phyla) are groups classification main The 9]. to [8, according characteristics classified and biochemical defined were fungi 1990s, the Until been only investigated. poorly yet not have which Asia Southeastern like habitats specialised in world’s fungi have been described. These up to over 90% un million 12 (2019) research latest to better understanding of the structure and offunctioning eco ecolo of testing the facilitate also but sequencing DNA on based not methods Molecular fungi. organism sequences) DNA of analysis cryp of study the to approach practical and faster simpler, much no Because the phenotypic features may vary due to external factors, mor t reflect phylogenetic relationships relationships phylogenetic reflect t Diversity of fungi fungi ofDiversity Classification of fungi fungi of Classification [2] . However it can be larger, 5 million according to Blackwell Blackwell toaccording million 5 be larger, Howevercan it [2 - 4] [7] . The estimations obtained by comparing the number of fungi of number the comparing by obtained estimations The .

[6] [13] . As it can be seen, in the best case scenario just 8% of of 8% just scenario case best the in seen, be can it As . . The development of molecular tools has brought a a brought has tools molecular of development The . 8 described species may be discovered systems systems Figure 1). 1). Figure ere ere are about six times more fungus f fungi specific to the plant species [2] . Approximately 120,000 fungal Approximately . gical hypotheses and provide a a provide and hypotheses gical and Basidiomycota Basidiomycota and tic (species recognised only by by only recognised (species tic been explored at all, or have have or all, at explored been fungal species was estimated estimated was species fungal ted total number of species numberspecies of total ted [14] hi mrhlgcl and morphological their phological phological characters may only provide a database database a provide only ig o hs traditional this to ding . . A classification system . The phylogenetic phylogenetic The . [5] , or according or according , [10 - 12] .

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. iue 1 Figure H.Oya Akyildiz Diplomarbeit TU Wien aiimct, yoyee (uooyoa otiig Glomeromycot containing the closest relativesGlomeromycotina is [18]of Dikarya Basidiomycot and Ascomycota (Mucoromycota Chytridiomycota. and Zoopagomycota) phy Zygomycetes traditional the all Basidiomycota, 1), (Figure classification this In designatedwith asteriskan [19]. (*) tree 1000 of burn-in a with branches on shown probabilities Posterior ubiquitoussampledfungalCOG72familiesfromusiderived in Gblocks

hlgn o Fni Bysa pyoey f 4 ugl pce fo a 8529 an from species fungal 84 of phylogeny Bayesian Fungi. of Phylogeny 9 .

ng PhyloBayes MPI with a CAT +GTRmodel.CATangPhyloBayes with MPI s. Maximum posterior probability support probability posterior Maximum s. la are represented; Ascomycota, Ascomycota, represented; are la caatr superalignment -character a form the Dikarya. Dikarya. the form a

ina and and ina Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. the identification of such highly diverse groups of organ precis and simple reliable, most the as became barcoding DNA Nowadays by used taxa higher in sequences unknown placing meth standard a proposed colleagues his and Hebert 2003, In DNA fragments suitable for DNA barcoding barcoding DNA for suitable fragments DNA identify successfully to order in regions DNA of Selection co (g fragment DNA diagnostic a of sequences DNA on depend organisms all raels mtcodi o patd) O te te hn, h bar organisms of the group specific hand, other the prPCR universal developing for sites On conservedhave flanking plastids). or in (mitochondria present genes organelles or genes housekeeping of introns spacers clusters, intergenic as fragments such on relies molecul frequently for barcoding used be to unlikely are they conserved, highly are p most As variability. inter-specific high and intra-specific Second, loci. DNA-barcoding suitable are rRNA encoding genes all as Forinstance, organisms. targeted all of genomes in present First, criteria. strict several fulfill should barcoding o dniy ifrn ognsa gop b mas f barcodi c( oxidase cytochrome the For of a portion examined. instance, of means by groups organismal different identify To contain referencesufficient required for identificati sequences DNA barcoding their introductionsuitable markers, bemay ineffi public databases of DNA sequences. Thus, although advances in g community sequences for ofa broad a taxonomic givendiversity group scientific sh the in standardized or accepted be should F methods. and sequencing amplification for used be to enough TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien mparison with a reference library. mparisona referencewith library. Identification of fungi fungi of Identification Xu 2] cn e sd s to fr hlgntc nlss f pu of analysis phylogenetic for tool a as used be can [21], [23] . Third, the length of the barcode sequence should be short short be should sequence barcode the of length the Third, . [20] is limited. DNA loci that are appropriate for DNA DNA for appropriate are that loci DNA limited. 10 . They have shown that the COI gene, previously gene, COI the that shown have They .

uh rget sol b uiesl i.e., universal, be should fragments such isms isms rotein-coding sequences in eukaryotes eukaryotes in sequences rotein-coding species is crucial and the number of of number the and crucial is species [22] ould be sufficiently represented be ould in sufficiently imers to detect most or all intra- all or most detect to imers on. on. these fragments most have low low have most fragments these co1 . ng different gene regions are are regions gene different ng cient if public databases do not do if public cient databases not In In DNA barcoding identification enomics enomics may aid the search for ourth, the DNA barcoding loci loci barcoding DNA the ourth, od for identifying species and and species identifying for od genomes of endosymbiotic endosymbiotic of genomes living cells contain ribosomes, ribosomes, contain cells living r dniiain Tu, DNA Thus, identification. ar or or ad hrfr respective therefore and , cox1 f h uiesl gene universal the of blished DNA primers. primers. DNA blished e method suitable for suitable method e ) mitochondrial gene ) mitochondrial code marker must must marker code enetic barcode) and and barcode) enetic Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. is is the most known barcode for animals, and some protists. Besi In are 24]used [23, also rRNA, such as the 28 the as such rRNA, th on based identified H.Oya also Akyildiz were fungi prokaryotes, to Similar Diplomarbeit TU Wien maturase maturase K ( is angiosperms of genes coding variable most the of one that chloro the in found been have genes candidate few A barcoding. 29] t of2and ITS1 named barcode marker fungalDNA universal the as ( rRNA S 28 encoding gene the of area 5’ the in ending and (ITS2) th gene, rRNA S 5.8 the (ITS1), 1 spacer transcribed internal the proposed for DNA barcoding. The fragment spanning from the 3’ en polymorphism of these loci in most fungal genera, the other r three decades ago by White and h and White by ago decades three PC reliable highly The barcode. DNA appropriate an be to features public in marker dominant quantitatively a is rRNA 2 and ITS1 widely used in identification of bacteria and archaea used widely in identification ofbacteria archaea and subuni small 30S the of part the is gene rRNA 16S of Sequence ml sbnt iooa rbncec acid ribonucleic ribosomal subunit Small plants, however, plants, mitochondrial mutation exhibit rat genes low (Figure 2 (Figure Internal transcribed spacers (ITS) of rRNA gene cluster and and cluster gene rRNA of (ITS) spacers transcribed Internal elongation factor-1 alpha) as a nuclear marker for DNA barcoding barcoding for DNA marker aas nuclear alpha) factor-1 elongation Figure2 Organization theof internaltranscribed spacer ). matK

) [25] . S

. rRNA (LSU- Large subunit ribosomal ribonucleic acid) or 18 S rRNA (SSU rRNA S 18 or acid) ribonucleic ribosomal subunit Large (LSU- rRNA

is colleagues allow reliable and easy PCR amplification of the the of amplification PCR easy and reliable allow colleagues ) genes genes 11

[26] [27] (ITS) region[1] . . . However, due to an insufficient insufficient an to due However, egion egion of the rRNA gene cluster was de of this, COII, databases. ITS1 and 2 has all the all has 2 and ITS1 databases. e sequences of genes encoding encoding genes of sequences e chloroplast gene encoding the the encoding gene chloroplast es and es are not forsuitable DNA e internal transcribed spacer 2 2 spacer transcribed internal e plast genome. It is considered considered is It genome. plast t of a prokaryotic ribosome is is ribosome prokaryotic a of t Figure 2) is now standardized standardized now is 2) Figure he rRNA gene cluster [22, 28, 28, [22, cluster rRNAgene he d of the 18 S rRNA gene over R primers developed almost developed primers R

tef1 cytB (translation (translation and 12S 12S rR NA -

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. DNA barcoding of Hypocreales [30,DNA barcoding of 37]. Hypocreales lo polymorphic most the as accepted widely is intron (4th) large can be obtained if the large (4th) intron of theof (4th) intron large if the canobtained be fragment of 500 fragment of p the For introns. five by separated exons six of consists rnlto eogto fco 1a ( 1-a factor elongation Translation genes protein-coding to sequence or one more single-copy not might identification for alone ITS the using Therefore, since these insuffici genera in Hypocreales taxa and Eurotiales, identification level species at region suitable not is region g fungal individual for sequences 2 and referenceofITS1 databases h communities research several Moreover, identification. molecular included comprehensive sets of fungal ITS1 and 2 sequences that databases public Consequently, identification. helps together searc similarity sequence the makes and alignment sequence multiple aids ins gene rRNA S 5.8 theof sequence short but conserved highly copies in most fungal genomes and size, small making PCR typical th fact the by facilitated also is Amplification 31]. [30, fragment The sequence of the whole gene gene whole the of sequence The copysingle 36]in [35, the genome pr its for reason Another inferences. phylogenetic in preferred barcoding [30]. Regions of eukaryotic eukaryotic of Regions [30]. barcoding Tree of Life (AFTOL) project [33, 34] ( II polymerase H.Oya Akyildiz Diplomarbeit TU Wien rpb2 – 600 base-pairs is sufficient. However, it became it apparent that However, sufficient. is base-pairs 600 ) are the most common . tef1 .

tef1 tef1 gene is more than 2,000 base-pairs long (Figure 3). It It 3). (Figure long base-pairs 2,000 than more is gene with together ITS1 and 2 are using widely for fungi DNA α tef1 ly or used marker includedthe Fungalin the Assembling α tef1 tef1 gene are highly conserved and therefore are are therefore and conserved highly are gene 12

gene is used [37] The fragment spanning the the spanning fragment The [37] used is gene ) and the second largest subunit of RNA RNA of subunit largest second the and ) be sufficient and it may be necessary necessary be may it and sufficient be roe f N broig uuly a usually barcoding, DNA of urpose [28] in certain fungal clades like some some like clades fungal certain in ent ent in their ITS regions. variability eference is that it is present as a as present is it that is eference . . at the rRNA operon has multiple multiple has operon rRNA the at ide the ITS1 and 2 fragment also also fragment 2and ITS1 theide are suitable for comparison and of nucleotide sequences have have sequences nucleotide of ly successful. The presence of a cus that may also be used for for used be also may that cus roups [29, 32]. However, ITS ITS However, 32].[29, roups ave developed curated curated developed ave h reliable, which which reliable, h the best resu best the lt

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure 3 Schematic structure of tef1 length andlength [43]. ofcomposition query the sequence is strongly influenced by the completeness and correctness of The species identity is then assigned based on the scores of th GenBank forinclude DNA [40-42]. sequences for Biotechnology Information (NCBI). NCBI houses a series of important resource for bioinformatics tools in biotechnolog used. marker genetic the and group organism taxa. identified previously to assigned level. species by defined be can identification the with reference samples in the database). If the reference database cont B GenBank. NCBI as Alignment Search Tool is an online program used to identify by such databases public in deposited seq of sequences matching by achieves species the of assignment taxonomic The H.Oya Akyildiz Diplomarbeit TU Wien needs to be developed. From genomic studies, studies, genomic From developed. be to needs acd cniae 3, 3 38] 33, [30, candidate barcode alternative marker for fungal community analyses analyses markeralternative for fungal community is not universally present in order Hypocreales like like Hypocreales order in present universally not is Application of public databases for the taxonomic assignment of the speci the of assignment taxonomic the for databases public of Application tef1 gene in . hs the Thus, Trichoderma Several reference databases exist depending on the the on depending exist databases reference Several rpb 13 spp. and location of primers for phylogeneticanalyses [38] One of the most common database using as an as using database common most the of One gn i a utbe lentv mre a an as marker alternative suitable a is gene 2

tef1 [39] These databases contain the DNA barcodes DNA the contain databases These . . a caatrzd s snl universal single a as characterized was Trichoderma Trichoderma y and y biomedicine is National Center databases but the major databases e sequence similarity search, which the reference database and by the comparing comparing sequences of samples ains ains sequences of species, and LAST (The Basic Local Local Basic (The LAST Fusarium Fusarium ecs o reference to uences spp . , it still still it , es es Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. drought, disease and insect protection, are known group of of group known are protection, insect and disease drought, plant the give cases some in and it, damaging without plant the can use in different proposes between 2009 and 2013 shown the enormous potential of the by Schuefflerpublished A review and fungal natural Anke shown pr carbon [53] source grow to fungi to (PET)lead and terephthalate polyethylene degrade so by produced enzyme Esterase 54]. [53, plastics down break filamentous by produce cutinase and esterase, lipase, as such most important global problem and there is a lack of applicable app b produc petroleum and plastic the technology, Nowadays industries. chemical food as such areas in potential huge a have esterase biotechnology. in valuable potentially are others while recently etc. polysaccharides vitamins, enzymes, indust is fungi from products natural of usage other The H.Oya Akyildiz sources compounds the of can new beanti from potential fungi wor a already is it and increasing continually is resistance antitu or antifungal antibacterial, shown were 2001, and 1993 bee have that compounds the of half than More [48]. used been cyclosporine, and antihypercholesterolemic agents lovastatin fu [44] Diplomarbeit [47] r important an play still and drugs approved of source major N [44-46]. industry and agriculture care, health of aspects plants. These products are important source for human for th by-produ or metabolites derived naturally are products Natural TU Wien Fr bann o sm iprat eiain uh s antibioti as such medication important some of obtaining For . medicin the incorporated have practices health times, ancient Since . Fungi as a source of natural products products natural of source Fungi a as [55] . Endophytic fungi which Endophytic . maintain at least a part of thei [52] Sm o tee rdcs r wdl producing widely are products these of Some . 14

rial processes e.g. the production of of production the e.g. processes rial owadays natural products remain a a remain products natural owadays ousands ousands of years in the most critical ldwide problem, the antimicrobial antimicrobial the problem, ldwide ole in supplying chemical diversity chemical supplying in ole fungal secondary metabolites that ngal ngal secondary metabolites have biotics [50, 51] biotics fungi have a good potential to potential good a have fungi fungi as abundant and various various and abundant as fungi additional advantages such as as such advantages additional n isolated from fungi between between fungi from isolated n me t pollution become one of the the of one become pollution t cts from microorganisms and and microorganisms from cts mour activity activity mour Fungi produced lipases and and lipases produced Fungi roach for that. Some enzymes oducts that were discovered that wereoducts discovered in medium with PET as solo as PETwith medium in Fusarium oeia sine, and sciences, iomedical s immunosuppressant cs, al properties of fungi fungi of properties al . p. tan can strains spp.

[49] . Antibiotic Antibiotic . r life in Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. mostly Dipterocarp trees in the lowland rainforest. Minor rainforest. lowland the in trees Dipterocarp mostly nutrients nutrients exp grounds canopies, Dipterocarpacea on time their of most spend ants tr of components important and pervasive are mutualisms Ant-plant low of in the canopies family arthropod dominant areAnts the to [61, Dipterocarpaceae 62]. 138 species, of which 91 to are endemic the island and almost 2 is Borneo [60]. rainforests tropical world's the among trees an [59] endemic) (6,000 plants 15,000 and endemic), (19 fish 394 species of mammals (44 of which are endemic), 420 resident birds (3 H.Oya Akyildiz dipterocarp species dominate high the forest canopy [58]. a In particu by characterized are Asia Southeast in rainforests Tropical [7] research medical disproportionatebeto pressureturns under as areaof torainbe could explo forest interesting the virgin some tropical environments. Particular niches and/or poorly exp Diplomarbeit unders is that biodiversity of amount significant is There immunosuppressive and sourcesanticancer for compantibiotics, pep phenols, flavonoids, derivatives, isocoumarin quinines, producers metabolite secondary bioactive TU Wien In Borneo forest canopy, 70% of ants were found to belong to found were ants of 70%canopy, forest Borneo In different reason and the role of these symbionts are critical critical are symbionts these of role the and reason different provides the plant food (nectars) andAnts the toants. nest usi nutri a as microorganisms epiphytic or plant the by observed complex and are also nicknamed Borneo’s exploding ants ants exploding Borneo’s nicknamed also are and complex . . Biodiversity of Borneo rain forests forests rain Borneo of Biodiversity . Here, Here, ants deposit fecal droplets as a general excretion of waste on [66] or hygiene [67, or hygiene 68] [56] 15 . Isolated metabolites, i.e. alkaloids, terpenoids, alkaloids, i.e. metabolites, Isolated .

tudied and available for exploration at at exploration for available and tudied ring new taxa. These areas are likely to These ring areas new aretaxa. likely [69] the hotspot of of hotspot the to the to workers of this ants are known for for known are ants this of workers tides, and phenolic acids are good good are acids phenolic and tides, ng certain fungi and bacteria for a lar, lar, Borneo is home of at least 222 land tropical rain forests [63, 64] [63, forests rain land tropical ent [65]. On the other hand, the the hand, other the On [65]. ent . 0% of the trees in Borneo belongs Borneo’s exploding ants occupy occupy ants exploding Borneo’s for the ants. They can provide provide can They ants. the for lored lored h biodiverse areas for new drugs new drugs areas for biodiverse ounds [57] ounds d highest species diversity of diversity species highest d Colobopsis cylindricus Colobopsis 7 endemic), 100 amphibians, pce dvriy n the and diversity species loring for food or nesting nesting or food for loring opical ecosystems. These ecosystems. opical abitats abitats such deep as side Shor . leaves which will be

ea diversity with diversity (COCY) (COCY) . Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. its release[71 ofits glandular products in combat territorial thorax hypertrophyt through (MG) the to mandibular of glands first species first of ants, Borneo’s exploding species of exploding ants are known[72], most of them are prob Centr Studies Field Belalong Kuala the of surroundings the From TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien hi efadioae hm them. and their self isolated ep (including phyllosphere leaves nest, their like territories f samples the collected have they reason, this For ants. these of diversitymicrobial andon habitat determine their the possible To understand more about the ant’s activities and their Colobopsis explodens 16

physiology, other colleges investigate the ] .

iphyte and endophyte), and the ants ants the and endophyte), and iphyte [73] role of them the effectecological ably ably new to science. Recently the he end of the gaster [70] and for [70] for and hetheof gaster end e (KBFSC) in Brunei, at least 15 least at Brunei, in (KBFSC) e

rom a different region of ant ant of region different a rom Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Since the microbial diversity of Borneo rain forest remains lar remains of Since the diversity microbial Borneoforest rain Thesis of the The aim H.Oya Akyildiz Diplomarbeit TU Wien area for the researcher to explore microorganisms like area forexplore the like researcher microorganisms to phyllosphere of o exploringwas the biodiversity The of thesis major aim the metabolites. and bioactive enzymes aims the following tasks should aims be completed:

1) 2)

and based onMolecular b identification of fungi DNA the isolated database todatabase conserveand the use fungi them to further experiments. in a the collectionSave fungi strains and all informatio collect b. a. tef1

Construction of identification phylogram Construction ofphylogram identification search A public databases sequence similarity against . . Shorea spp. and other trees in lowland dipterocarp rain forest. T spp. dipterocarpandlowland rainother trees in forest.

fung al f the fungi isolated ffrom the fungi isolated the species new as sourcesof gely unknown,gely is this arcoding using ITS1 and using arcoding n themabout in a o achieve these o these achieve a remarkable remarkable 2 Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Materials & methods methods Materials & et from Nests H.Oya Akyildiz Diplomarbeit TU Wien This This research was based on the materials sampled during the WWTF LS1 South- 2014 in 2019and Microbiolof completed in the was Group f amu sbtne, n cnrbt t hgee Microbio hygiene. to contribute and substances, harmful of in help microbes mutualistic animals, In (autothysis). integument voluntar by “exploding” suicidal characteristic the via happens whererivalthis species arthropods. In kill toMGR enlarged sti the use ants worker combat, territorial In abdomen. the fill t proliferate that (MGR) reservoirs gland mandibular hypertrophied or ecosystem-forming considered are and forest rain tropical the Self-Sacrifice in in Exploding Self-Sacrifice Ants: a mechanism to defend mi co-evolved lowland dipterocarp rainforest at the Kuala Belalong Field Studies Studies Field Belalong Kuala the at rainforest dipterocarp lowland preparation and personal by Druzhinina, H. S. Zettel Drs. I. of fungi in in fungi of bruneiensis testlrn fni rm h eooia gop f lc yeast black bruneiensis of group ecological the from fungi stress-tolerant bacteria like environmental causing insect diseases. insect causing protection provide and nests COCY in grow can they environments, Materials from the habitat of Bornean “exploding ants” “exploding Bornean of habitat the from Materials Nests of of Nests East East Asian “exploding ants” (the C. explodens C. osse o bcei peet n h evrnet u lce te mos the lacked but environment the in present bacteria of consisted . . explodens C. It was proposed that due to the remarkable resistance of these f these of resistance remarkable the to due that proposed was It Colobopsis explodens Colobopsis nests mainly consisted of opportunistic and cosmopolitan cosmopolitan and opportunistic of consisted mainly nests

and Bacillus . brune C. spp., spp., Colobopsis cylindrica Colobopsis ie and and nsis nsis Clostridium C. brune C. o. rv (h fra seis ecito i in is description species formal (the prov. nom. 18

spp. and spp. ie nsis communication) were sampled in the werein the sampled communication) ogy and Applied Genomics, ICEBE. ICEBE.andogy Genomics, Applied or COCY group) in live the canopy of defensive behavior is advanced,this behaviordefensiveis nom. prov. prov. nom. Staphylococcus cky and irritant contents of their their of contents irritant and cky e of mes ganisms. They have distinctive have They ganisms. food digestion, detoxification detoxification digestion, food clnzd h nss of nests the colonized s y rupture of the abdominal abdominal the of rupture y Centre (KBFSC), Temburong (KBFSC), Centre hrough the entire body and and body entire the hrough

crobiomes gis microorganisms against 3- 048 048 Project “ . explodens C. spp. The diversityThe spp. ungi to extreme to ungi ” that started in molds, while while molds, t common common t Voluntary Voluntary and C. C. C. C. Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. (TU during Wien) District, Brunei Darussalam (4° 32' 35.5" N, 115° 09' 09.3 Figure 5 Natural 5. Figure artif and Natural scalpel. sterile a with separately off scraped surface stem and nest the inside from material structures, (carton condition. 1the sterile sections at cm Atthickness sterile lab transferredthe of the to were contained ants Pieces the nests 4Figure Locationthe of KBFSC Bruneiin Darussalam, H.Oya Akyildiz Diplomarbeit TU Wien (b) , a a C. brune C. ie nsis C. explodens natural nest(c). two sampling expeditions in 2015 expeditions 2017in and 4 (Figure sampling nest (YG-FF) was found in a dead branch of b Borneo,shown on GoogleSatellite. 19

" " E) by the field researcher A. Kopchinskiy condition, different areas of slices nest S. johorensis (a) icial nest in forest were shown in in shown were forest in nest icial c oratory. The nests were cut to to were cut nests The oratory.

of outside host tree) were were tree) host outside of ).

, , C. explodens artificial nest

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. - 2 in sterile ants the collected we nests, the cutting During hn w than 2 mL reaction tubes containing sterile ultrapure water at 700 at water ultrapuresterile containing tubes reaction mL 2 PA+ upeetd ih .1 Tio 10 ad . gL chl g/L 0.5 and 100X Triton 0.01% with supplemented (PDA)+ subjected to the standard serial diluted procedure and were shack WT80, mL 1 contain tubes mL 2 into transferred were they To the isolate pure fungal cultures from the(ant samples and times with rinsed five distilled water. sterile i min 1 for again submerging then and (v/v) peroxide hydrogen min 1 for (v/v) ethanol 70% in submerging by disinfected were endophyti the of isolation the to used were leaves cleaned The 2 in total min surfacesleaf andfor abaxial in a sterile Petri plate and collecting epiphytes by applying an microorganisms were removed by submerging a leaf in 20 mL sterile w H.Oya Akyildiz Diplomarbeit TU Wien ants’ steriliz surface were ants washed The collected. some facultatively endophytic organisms facultatively some werefalcon collected. Herepellets and tubes andwe c centrifuged crushed and mixed with sterile water. crushedwater. sterile with mixed and To naiig lns, h feh evs ee rnfre t te labo the to transferred were leaves fresh the plants), inhabiting 80 isolation isolation of the fungi from the o C until the use. Then washed their cuticle surface of the ant the of surface cuticle their Thenwashed use. the until C body the stereomicroscope(head were and separated using abdomen) an Bodies ofBodies Leaves of Leaves of as Isolation cultivation and of culturescondition pure fungal rnfre t aohr ue Te acn ue a centrifuged, was tube falcon The tube. another to transferred C. explodens C. Shorea johorensis Shorea and and Shorea Shorea johorensis C. brun C. and and . .

The resulting suspension of was centrifuged in 50 mL suspension in 50 mL centrifuged ofThe was resulting Ficus ei 20 ensis ed

sp and with 70% ethanol, the different part of the the of part different the ethanol, 70% with . . nom. prov. prov. nom. Ficus mL wells and preserved by freezingin by preservedand wells mL

electric toothbrush over the adaxial sp sp. sp. leaves (the two main COCY ant’s rpm for 20- for rpm nest materials nest and materials read read on the Potato Dextrose Agar c fungi. Therefore, leave surface leave Therefore, fungi. c oramphenicol , then 15 s in a solution of 15% 15% of solution a in s 15 then , s via submerging and shaking in shaking and submerging via s n 70% ethanol. The leave was was leave The ethanol. 70% n ed them for 2 min vigorously, vigorously, min 2 for them ed ollected mostly epiphytic and mostly epiphytic ollected ater containing 0.1% WT80 ratory 40 n te elt w pellet the and min. min. . . The phyllosphere phyllosphere The d sterile forcepsd sterile The plates were were plates The ph The ants’ body ants’ The yllosophere) yllosophere) as ,

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. (TWYE; 0.25containing g of yeast extract, 0.5 g of K TU Wien Diplomarbeit H.Oya H.Oya Akyildiz testing later purifiedfor in PDA isolated, maintained and and daily, checked wereand 25°C 30 days incubated dishes for at g prevent to un/mL) (100 Pen-Strep and Diplomarbeitg/l) (0.5 chloramphenicol 28 at incubated TU Wien cryotubes in 25% glycerol at - at glycerol 25% in cryotubes 1. an (TUCIM) numbers collection the got were strains pure the All until the plates pure obtained. cultures were cut them to 1 cm To isolate endophytic fungi, fungi, endophytic isolate To properties picked was morphophysiological andto transferred 2 pieces and placed on 9 Petri cm dishes containing tap water-yeas o ad hce diy for daily checked and C af

80 ter surface disinfection of the leaves, at the sterile conditi sterile the at leaves, the of disinfection surface ter o C. The strains and their origins of isolation were listed listed were isolation of origins their and strains The C. 21 two

2 HPO ek. vr nw ooy ih unique with colony new Every weeks. 4 . , , and 18 g of agar per liter of tap water+ The cultures were transferred to fresh The fresh cultures to were transferred the fresh PDA plates. plates. the fresh PDA all fungal colonies found were fungal foundcolonies were all rowth of bacteria of rowth d preserved preserved d t t extract agar in . duplicate duplicate The Petri Petri The in Table in on, we we on, Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek.

Ants nest Artificial MIT1 YGFF H.Oya Akyildiz Diplomarbeit 1Table Source isolatedof strains TU Wien Ants Nest leaves Ficus leaves Shorea Sourceisolation of 4 1 2

is C. explodens nest explodensnest C. is couldn’tdefined is C. bruneiensis nest 2015 bruneiensis C. 2015 is nest 4 sp.

sp. 3 of C. explodens explodens C. of

2017 bruneiensis C. 3 Artificialnest MIT1 YGFF Epiphytes

Endophythes Phyllosphere

Endophytes Epiphytes

1 2

inside outside outside outside carton carton inside inside number Total

56 8 54 19 20 25 13 8 51 28 39 38 55 280 18

5833, 5568 5497, 5488, 5502, 5501, 5491, 5490, 5493, 5499, 549 5958, 5974, 6240, 6238, 6083, 6076, 6245, 6074, 608 5969, 6004, 5979, 5996, 5966, 6001, 5973, 5955, 595 5970, 5968, 5982, 6000, 5967, 5988, 5992, 5951, 599 5961, 6231, 5986, 5962, 5997, 6239, 5949, 5954, 595 6051 6053, 6082, 6065, 6043, 6010, 6032, 6012, 6019, 6031, 6017, 6009, 6006, 601 6023, 6022, 6026, 6030, 6034, 6007, 6014, 6018, 602 Strains(TUCIM) 6265, 6267, 6256, 6263, 6008, 62326008, 6263, 6256, 6267, 6265, 6316330, 6329, 6327, 6320, 6319, 6318, 6316, 6229, 6336334, 6331, 6328, 6326, 6324, 6323, 6322, 6234, 62896286, 6174, 6191, 6185, 6096308, 6090, 6305, 6298, 6295, 6294, 6285, 6178, 6176095, 6188, 6288, 6173, 6250, 6251, 6249, 6246, 6296291, 6302, 7010, 7009, 7008, 7007, 7006, 7004, 6297 6171, 6100, 6168, 6099, 6097, 6169, 6165, 6246088, 6301, 6278, 6277, 6269, 6194, 6193, 6192, 628 6280, 6276, 6275, 6271, 6270, 6195, 7002, 7001, 6986986, 6985, 6984, 6983, 6981, 6980, 6979, 6975, 6252 6226, 6227, 6255, 6254, 6253, 6225, 6224, 61926102, 6309, 6297, 6286, 6289, 6290, 6310, 6311, 6312, 6306, 625 6185, 6181, 6191, 6174, 6189, 6291, 6292, 6304, 624 6176, 6175, 6246, 6173, 6188, 6095, 6179, 6186, 618 6099 6301, 6171, 6172, 6195, 6193, 6194, 6247, 6257, 6276, 628 61006248, 6273, 6167, 6164, 6170, 6165, 6169, 6168, 6243, 6091, 619 6194, 6090, 6300, 6097, 6092, 6088, 6089, 6302, 5489, 5488, 5490, 5491, 5492, 5493, 5494, 5506, 550 6216205, 6209, 6261, 6218, 6204, 6203, 6206, 6201, 6200 6262, 6260, 6198, 6197, 6199, 6087, 6086, 6485, 6486, 6487, 6488,5508, 5567, 5566, 5568, 55 6085, 6083, 6245, 6244, 6084, 6075, 6077, 6070, 607 6239, 5961, 5949, 5954, 5957, 5960, 5978, 5983, 600 6046049, 6036, 6050, 6044, 6042, 6039, 6058, 6051, 6011, 6032, 6035, 6038, 6057, 6055, 6045, 6052, 603 5746, 5729, 5723, 5738, 5742, 5743, 5728, 5739, 5730, 573 5648, 5766, 5649, 5650, 5651, 5652, 5653, 5710, 571 5645, 5632, 5633, 5634, 5635, 5636, 5637, 5638, 563 5749, 5748, 5616, 5617, 5619, 5618, 5620, 5621, 562 56 5841, 5843, 5844, 5845, 5846, 5984, 5640 5984, 5846, 5845, 5844, 5843, 5841, 5820, 5818, 5821, 5822, 5823, 5824, 5825, 5826, 582 5801, 5805, 5802, 5804, 5803, 5806, 5807, 5809, 580 5780, 5779, 5816, 5781, 5813, 5782, 5783, 5785, 578 5765, 5764, 5767, 5770, 5769, 5772, 5787, 5792, 579 07, 07, 5612, 5614, 5613, 5615 5609, 5608, 5610, 5611,

5503, 5508, 5567, 5566, 5568, 5569, 5570, 55 5571, 5747, 5750, 5751, 5752, 5753, 5754, 5755, 5756, 57 22

96, 96, 5643, 5775, 5791, 5818, 5984, 6065, 6082, 6303 5, 5, 5498, 5496, 5507, 5494, 5506, 5508, 5567, 5566, 0, 6063, 6484, 6485, 5492,6486, 5630 6487, 6488, 6003, 5971,0, 5952, 5985, 5977, 5993, 5987, 5980, 4, 6235, 5959, 5972, 5991, 6237, 5956, 6241, 6236, 7, 5960, 5978, 5983, 6002, 6066, 6073, 5995, 5965, 1, 6033, 6013, 6005, 6035, 6037, 6046, 6040, 6054, 0, 6024, 6025, 6029, 6027, 6015, 6056, 6028, 6021, 1, 1, 6187, 6303, 6305, 6308, 6093, 6096, 6098, 6313, 9, 6250, 6288, 6293, 6285, 6294, 6295, 6298, 6299, 4, 6178, 6182, 6094, 6180, 6183, 6177, 6012, 6242, 0, 6281, 6283, 6269, 6277, 6278, 6279, 6248, 6100, 3, 6247, 6257, 6275, 6270, 6282, 6271, 6272, 6274, 7, 5495, 5499, 5497, 5496, 5498, 5500, 5505, 5503, 4, 6080, 6068, 6071, 6067, 6064, 6072, 6063, 6484, 2, 6066, 6073, 5992, 6241, 6078, 6079, 6081, 5952, 6047, 6046, 7, 6040, 6054, 6043, 6065, 6082, 6053, 1, 1, 5732, 5733, 5734, 5735, 5736, 5737, 5744, 5745, 1, 5712, 5714, 5715, 5716, 5717, 5718, 5719, 5722, 5642, 9, 5643,5641, 5644, 5777, 5784, 5646, 5647, 4, 5625, 5626, 5627, 5713, 5768, 5628, 5629, 5631, 7, 7, 5828, 5829, 5831, 5836, 5837, 5838, 5839, 5840, 8, 5810, 5830, 5811, 5812, 5814, 5815, 5819, 5817, 5789, 6, 5790,5788, 5791, 5797, 5798, 5799, 5800, 3, 5794, 5795, 5771, 5773, 5774, 5775, 5776, 5778, 5, 6317, 6230, 6325, 6259, 6228, 6332, 6207, 6228, 6259, 6325, 6230,6332, 6317, 5, 6268, 6258, 6321, 6233, 6337,6264, 6336, 5, 6098, 6299, 6177, 6183, 6096,6102, 6094, 3, 6180, 6293, 6303, 6184, 6187,6182, 6186, 9, 6279, 6092, 6091, 6248, 6257,6274, 6247, 3, 6999, 6997, 6996, 6995, 6991,6998, 6990, 9, 6200 6208, 6219, 6217, 6, 1 6048 6059, 2, 6304, 6310, 6311, 6312, 6306, 6175, 6176, 6306, 6312, 6311, 6310,6175, 6304, 2, 1, 6282, 6283, 6089, 6164, 6167, 6170, 6172, 6167, 6164, 6089, 6283,6170, 6282, 1, 5622, 5623, 5622, 5724, 5623, 5725, 5727, 5726, 5741,5740, 57, 5758, 5759, 5760, 5761, 5763, 5796, 5762, 72, 5594, 5595, 5596, 5597, 5598, 5599, 5606, , ,

Molecular techniques techniques Molecular The for tube at 65 10 min incubated minute. The mixture cooled down and 150 µL of potassium acetate were added.The acetate down cooled150 mixture potassium of µL and ls bas (2 beads glass 50 Standard equipment for agarose gel electrophoresis Standard electrophoresis for agarose gel equipment Nanodrop spectrophotometer (Thermo Scientific, Nanodrop ONE NanoDrop Scientific, (Thermo spectrophotometer 28.5 mL of distilled water [pH 4.8]) 28.5 water of[pH mL distilled 4.8]) buffer11.5Potassium acetate of ofacetate, mL M potassium 5 g (60 mL dodecyl sulfate) dodecyl sulfate) Lysing buffer (400 [pH Tris-HCl mM 8.0], 60 mM EDTA [pH Young (36-72 hours) cultures of the fungi strain Young cultures theof fungi strain (36-72 hours) pellet wereafterstep. visible this pellet supernatan the and speed, high at min 5 for spun is tube The Vortexed briefly andVortexed1 spun rpm for min. briefly at 10000 min min and the were supernatant discarded. Spun ethanol. 70% of µL 300 adding by washed were pellet DNA The rpm1 for min. NanoDrop ONE spectrophotometer Nanodrop concentration DNA the quantify To An equal ofvolume The supernatant carefully was transferred to a new 1 h DA elt ee i did rm eiu ehnl n wr dissolv deionized H were and ethanol residue from dried air were pellet DNA The Method - 100 mg of fresh fungal mycelia were transferred to sterile 2 sterile to transferred were mycelia fungal fresh of mg 100 - 2 O.

c mm)

) were used. used. ) were 100% n ad 0 µ o lss ufr Vree vgrul for vigorously Vortexed buffer. lysis of µL 500 add and isopropyl were alcohol added by andmixed is inversion bri

.C. ֯C 23

.5 -mL -mL tube and centrifuged at 10000 8.0], 150 mM NaCl, 1% sodium t were discarded. The DNA DNA The discarded. were t mL tube contain 4 small small 4 contain tube mL c ) ) at 10000 rpm for 1 1 for rpm 10000 at (Thermo Scientific, Scientific, (Thermo

lacial acetic acid, lacial

ed in 50 µL of of µL 50 in ed at least least at efly. efly. 1

TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien • • • • • • •

carried on. electropho gel agarose DNA, genomic detectable the presence the check To Arranged Sanger sequencing service for PCR products forArranged service Sanger PCR products sequencing Oligonucleotide primers for Oligonucleotide Balgach, (Microsynth, Switzerland) PCR Standard forand PCR reagents disposables Standard equipment for DNA quantification Standard for DNA equipment quantification Standard equipment for agarose gel electrophoresis Standard electrophoresis for agarose gel equipment PCR PCR thermocycler Peqstar thermal cycler) (Peqlab, o o o o

MgCl dNTP (Promega) Buffer 10× Flexi GoTaq (Promega) (Promega, Madison,polymerase USA) GoTaqG2Wisconsin, Flexi

2 (Promega)

(Table 2) ei was resis Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. H.Oya Akyildiz 3Table PCRmixture components and concentrations Diplomarbeit 2Table PCR primers'parameters TU Wien TablePCR4 Program DNA sample PCR water Promega GoTaq 1 reverse Primer 6.25 µM² forward Primer 6.25 µM² MgCl Promega Nucleotides 2 mM Promega buffer 10x CR Mastermix rpb tef1 ITS 1&2 pause final extension initial denaturation PCR Step PCR program 30 cycles Gene Gene • • 2 2

2 25mM

summarized at below table (Table 4 (Table at below summarized table t run upand PCR thermocycler we set the loci, Depend the on (Table 3): us protocol standard the to according reaction PCR the Prepare Method fRPB2-7cR fRPB2- TEF1-LLE rev EF1 728 f LR1 SR6R Name

5F 72 50 94

CCCATRGCTTGTYYRCCCAT GAYGAYMGWGATCAYTTYGG AACTTGCAGGCAATGTGG CATCGAGAAGTTCGAGAAGG GGTTGGTTTCTTTTCCT AAGWAAAAGTCGTAACAAGG 1

Temp. [°C] [°C] 72 90 60 60 94 4

ITS ITS 1 & 2 ITS1 and ITS1 2 and Time [sec] ). 420 72 56 94 60 ∞

20.9 Sequence Sequence 5’– 0.1

10 50

25 4 5 2 2 6

Temp. [°C] [°C] 74 50 60 60 94 4

3’ tef1

tef1 10 20 50 4 5 1 2 2 6

Temp.

420 [°C] 50 60 60 60 ∞

he machine. The programs programs Thehe machine. ing following reagents reagents following ing Temp. [°C] [°C] 25.90 rpb2 72 90 90 60 95 4 0.1 2.5 2.5 50 1 5 5 5

rpb2 [76] [75] [74] Reference Reference

Time [sec] 420 300 90 90 60 ∞

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Sanger Sanger Sequencing speed toDNA. elute th and min 10 for stand was column The column. the of center buffers (WN and WS Buffer) and finally finally and Buffer) WS and buffers (WN to the silicon filter in the column. At the next steps, the centrifugation for 1 min After the PCR, products were analyzed Agarose gel electrophoresis h PR rdc ad X ufr ee ie ad transferred and mixed were buffer PX and product PCR The below:protocol summarized (Met Kit Purification mi-PCR PCR, from fragments amplicons purify To sent to Microsynth (Switzerland) forto(Switzerland) sent Microsynth sequencing. were measured DNA samples for Nanodropusing concentration d and H.Oya Akyildiz Diplomarbeit the by G DNAwere examined bands in the gel for 400mA 100V/ at electrophoresis the run and Standard) Agarose 1% and to loaded were Scientific) Fisher (Thermo ladder DNA 1kb Ruler TU Wien andand dimers high primerprovide purify procedure purification DNA The followed. be should purificatio PCR quantification DNA sequencing Sanger for samples After the presentation of by the nucleic acid amplicon g confirmed PCR Purification at high speed, the flow through was discarded. In this step er yield of the amplicon. amplicon. of the yield by 20 gel electrophoresis. the PCR products and marker gene -25 µL water or Elution Buffer were added directly on on directly added were Buffer orElution water -25µL el 26 -D

oc system. system. bind DNA were washed with two whishing the amplicon from the PCR reagents reagents PCR the from amplicon the en centrifuged for 5 min at high high at min 5 for centrifuged en to the GP Column tubes. After After tubes. Column GP the el electrophoresisel to send the n or gel extraction protocol protocol extraction gel or n 20 min. The appearance of of appearance The min. 20 iluted to 10-12 ng/µL and ng/µL and to 10-12 iluted abion) was used and the the and used was abion) agarose (Rotiphorese, agarose the DNA bind Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. (attached to the work with a CD) and aligned with our andwith reference(attached seq to a aligned CD) thewith work identit high a with sequences All determined. were score identity t tool BLAST online (NCBI) Information Biotechnology for Center search similarity sequence Tool) Search Alignment Local (Basic BLAST obtai were sequences barcode DNA identification molecular the For A sequence similarity search databases publicagainst TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien The sequences were explored using Aliview program. Later, n program. Later, Aliview The using sequences wereexplored too shortbe aligned. to of the sequences were excluded due to their poor quality, meanin For the first investigation, the sequences were aligned using Alignment Sequence were obtained by the random addition of sequences (10 replicates). replicates). (10 sequences of addition random the by obtained were using the Subtree-Pruning-Regrafting (SPR) algorithm with search parsimo maximum The X. MEGA in conducted were analyses Evolutionary Construction of identification phylogram GBlocksparameters with using selected forstringent co less reproduced in less than reproduced 50% were less collapsed bootstrapreplicates in analyses taxa the of history evolutionary the represent treeinferred was bootstrap Theconsensus nucleotide sequences.

DNA Barcoding and construction of identification of phylograms phylograms of of identification construction and Barcoding DNA

. Branches corresponding to partitions partitions to corresponding Branches nditions. nditions. MAFFT with accurate settings. Some on -conserved region was removed regionremoved -conserved was he 100 species with the highest highest the with species 100 he . g g the sequences amplified were level 1 in which the initial trees

y were saved as FASTA format format FASTA as saved were y from 1000 replicates taken to taken to replicates 1000 from uence uence ( ned with PCR. Based on a a on Based PCR. with ned The analysis involved 5 involved analysis The done using the National National the using done ny tree was obtained obtained was tree ny Attachment 1 ).

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. amplification. amplification. 2 and ITS1 using by level genus the at them of identification phy and species of level at family Hypocreales to belong fungi D suitable a not are sequences 2 and ITS1 strains. 456 for ants) and their collection numbers listed listed numbers their ants) and collection totally study, this In Discussion and Results isolation sources isolation st All publications. respective their considering reliability parameter following the 10 first using The (linear). costs gap and (1,-2) scores match/mismatch database (NCBI) GenBank the against to subjected first were sequences homologous study, our In for all isolated for isolated all TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien necessary, necessary, and we did not sequence it for The sunburst chart here shows the precise summary of the compos the of summary precise the shows here chart sunburst The program SPR algorithm. using by analysed were they aligned, were sequences DNA the After analysis. such as strains strains precisely, plant pathogens such as as such pathogens plant precisely, Xylariales Hypocreales, orders from species Ascomycota, Within one to belongs strain Mucoromycota collection this of 2.6% only and the group, Ascomycota DNA Amplification Results Results Amplification DNA Phylogenetic Analysis Results Results Analysis Phylogenetic to Penicillium Penicillium their taxonomical family (Figure 6). As can be seen, the majority the seen, be can As 6). (Figure family taxonomical their Trichoderma Trichoderma . As a result, six separate taxonomic groups were generated for phy for generated were groups taxonomic separate six result, a As sp 524 . and strains were isolated from the different samples (leaves, ant ne ant (leaves, samples different the from isolated were strains Trichoderma is belonging to the order Hypocreales order the to belonging is (89) strains Fusarium .

. sp.

in Trichoderma Trichoderma are abundant. These three genera together constitute Table 1. ITS 1,2 regions were successfully sequenced sequenced were successfully regions 1,2 1. ITS Table spp., species of high biotechnological application biotechnological high of species spp., 28

strains., therefore we performed only belongs to the group Basidiomycota and and Basidiomycota the group to belongs rains were divided according to their their to according divided were rains NA barcode for identification of the the of identification for barcode NA eune, e performed we sequences, logenic studies; therefore, after therefore, studies; logenic and Eurotiales dominate. More dominate. Eurotiales and h sqec smlrt search similarity sequence the 0 best hits were examined for examined were hits best 0 . Therefore, ITS PCR were not not were PCR ITS Therefore, ition of isolated isolated of ition MP method in MEGA X MEGA in method MP of species belongs to belongs species of : hehl (10), threshold s: 52 logenetic logenetic 4 fungal fungal 4 sts and sts tef1 tef1 s

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure 6Figure Isolated5 number next tothe thename of familyrepresents thenumber o almost almost Saccharomycetales order.Saccharomycetales TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 22 3 isolates. Yeasts are mainly represented by by represented mainly are Yeasts isolates. 3 24 fungalstrains totheir taxonomical order &family. To

fspecies in that particular family. Debaryomyces

tally26 order assigned,and1 unknown remained. The and Candida

genera from genera

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. of Hypocreales and most important families andand of ord genera most important within Hypocreales families different of genera fungi different isolated we ourstudy, In such as plant materials, insects, or other fungi to causing i Hypocreales species are notable for their toability derive nutr Hypocreales to belongs fungi isolated the of part largest The phylogenic tree is placed in Figure placed tree in 8. phylogenic is on based analysis phylogenic i expected to get unsufficient results with level species at region suitable not is region ITS the Since 7Figure Treefungiof which belongBasidiomycotato p H.Oya Akyildiz separatel analyzed were strains 14 Diplomarbeit phyla, different their of Because TU Wien the final dataset. dataset. final the There Mucoromycota. to belongs 1 and Basidiomycota to belong they belong they to same Cryptococcus

Tremellomycetes class. ( class. Tremellomycetes tef1 sp.

sequences carried on for the the for on carried sequences and Trichosporon dermatis Trichosporon Trichoderma Figure 7 hylum. Referenceshylum. wereshown astype. bold 30

strains based on ITS1,2 Therefore analysis. ) ) nfection in human and other mammals. origins from all characterized family family characterized fromall origins ition ition from diverse nutrient sources within the class Sordariomycetes. Sordariomycetes. class the within

etfcto i Hypocreales in dentification are sharing same clade because because clade same sharing are was a total of 536 positions in in positions 536 of total a was er Hypocreales. er Trichoderma Trichoderma y. As a result, result, a As y. strains and the the and strains

Trichosporonales Trichosporonales 13 Sporidiobolales Sporidiobolales Agaricales Agaricales Polyporales Agaricales Tremellales strains strains , we

Microbotryomycetes

Agaricomycetes Agaricomycetes Tremellomycetes Tremellomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 31

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure 8Figure H.Oya Akyildiz Diplomarbeit TU Wien Trichoderma speciesbased on tef1 . . Referenceswere shown as type.bold 32

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. stress stress as such stressors abiotic to resistance influence herbivores, fung phytopathogenic limit can fungi phyllosphere example, For endophytic fungi can co-exist in a single host plant. Thes diversity species high exhibit and leaves of (ep (endophyte) surface the on living fungi phyllosphere The organisms. a for habitat multifaceted large, a forms generally phyllosphere The The DiversityPhyllosphere in of Fungi the genus. nohts r mc mr kon o rdc a ies rne f nat of range diverse a produce to known more much are endophytes p to ability have fungi endophytic and epi both The host. causing without life their of part least at and cotyledons Trichoderma Trichoderma antioxidant, acti antidiabeticantioxidant, insecticide, and immunosuppressive antibacterial, showing studies Invitro antibio compounds. anticancer as such drugs new of sources good are acids phenolic alkaloids, like fungi endophitic by produced Metabolites f significant a have species assemblages. Results of host some studies were found that The closely related host. plant the is factor neighbo a from originate that fungi endophytic by colonized comp community endophyte influence greatly location geographic fung endophytic of composition the determining roles Several order Hypocreales, Hypocreales, order othermarker using scientist the study biodiversity the and sequences. 2 andITS1 their in polymorphisms intraspecies low colleagues’ his and Schoch at described was it As TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien oliar endophytic fungi (FEF) patterns [82] patterns (FEF) fungi endophytic oliar [78] . Endophytes enter inside the living plant tissues such as l as such tissues plant living the inside enter Endophytes strains based on their their on based strains tef gn i ms sial mre. bv w gntcly analyzed genetically we Above marker. suitable most is gene 1 tef 1 sequences. From them 43 were belong to belong were 43 Fromthem sequences. 1 . A recent study on 46 species of species 46 on study recent A 33

research [28], some groups of fungi have the have fungi of groups some [28], research e fungi play important roles in host plant. any apparent disease symptoms in the in symptoms disease apparent any roduce secondary metabolites but the the but metabolites secondary roduce flavonoids, peptides, phenols and and phenols peptides, flavonoids, s. For example, the genus belongs to belongs genus the example, For s. [77] drought, high temperature water water temperature high drought, r plant [81]. Another important important Another [81]. plant r niugl atcne, antiviral, anticancer, antifungal, . Both endophytic bacteria and and bacteria endophytic Both . Therefore, to their identification identification their to Therefore, iphyte) and the interior tissue tissue interior the and iphyte) vities vities tics, immunosuppressant and and immunosuppressant tics, i assemblages. For example, example, For assemblages. i effect on endophytic fungal fungal endophytic on effect , eit dfne against defense mediate i, host species to have distinct eaves, flowers, stems and stems flowers, eaves, sto. pat a be can plant A osition. [80] vast diversity of living living of diversity vast . . ural products products ural Ficus spp. sampled spp. T. harzianum T. [79] 89 .

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 62] belongs to Dipterocarpaceae and 91 species of 138 Dipterocarpaceae tree was treethe host was of on 2014 and 2015. Borneo is the hotspot ofhotspot the is Borneo 2015. and2014on trees t two of communities fungal the analyzed and investigated we Here [83]. fungal endophytein shaping population from same geographic environment shown both evolutionary and ecol Red List of Threatened Species (Figure 9) Figure 9Figure Leaves of H.Oya Akyildiz Diplomarbeit TU Wien opportunity to grow. to opportunity the temperature, low in incubation long of Because plates. new for one year at +4 at year one for supplemented with choloramphenicol to prevent the growth of

johorensis protocols. basedstandard on isolated were fungi endophytic h frt ape were samples first The . . S. S. johorensis Shorea johorensis Shorea and Ficus S.johorensis

is is only found in Sumatra, Malaysia Peninsular and Borneo and i o C and the single colonies from epiphyte and endophyte were trans were endophyte and epiphyte from colonies single the and C sp.). C. C. explodens

The second sampling carried on at 2015 and this time the epiphyt the time this and 2015 at on carried sampling second The and Ficus .thesize theof leaves canreach to more20 thanc Shorea Ficus spp. are one of the most important trees in most tropical r nest and its leavesand nest visited was its daily by the ants. sp. leaves. The samplings were carried on at two time periods time two at carriedon were samplings The leaves. sp.

evs utvtd y uig h lae o PA medium PDA on leaves the puting by cultivated leaves . The The size of the trees are typically to 65 m tall. The tested Shorea 34

diversity. Almost 20% of the trees in Borneo Borneo in trees theof 20% Almost diversity. Two type of leaves were tested ( tested were leaves of type Two bacteria bacteria and the plates incubated slow growing fungi had more more had fungi growing slow m. he exploding ants habitant ants exploding he in in Borneo are [61, endemic

ogical ogical factors are involved s s in the Nature’s ainforest ainforest fered to to fered ic and and ic S.

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Shorea reach COCY visito ants andextrafloral nectar theof one main also rainforest. tropical asia southeast in present frequently and in NCBI database (Table database NCBI in TU Wien Diplomarbeit H.Oya H.Oya Akyildiz 5Table Speciesfrom Diplomarbeit TU Wien based on their ITS1, 2 (for all isolates) or isolates) all (for 2 ITS1, their on based 195 colected at 2014. In Table 5 cells markedare in green. 5742 5722 5733 5652 5642 5639 5638 5624 5618 5616 5740 5623 5609 5625 5617 5748 5725 5724 5611 5614 5613 5606 5612 5595 5598 5599 5597 5594 5569 5497 5488 5640 5755 5753 fungi strain strain fungi ------5743 5723 5734 5731 5653 5637 5741 5727 5610 5619 5749 5726 5622 5608 5615 5607 5641 5754 phyllosphere

------4 4 4 1 1 3 1 1 6 7 5 4 1 1 1 1 1 1 1 1 1 2 3 of Shorea Trichoderma harzianum harzianum Trichoderma Trichoderma harzianum Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma Trichoderma Trichoderma CBS:135585 Trichoderma aggregatum Trichoderma HMAS:248863 aggregatum Trichoderma Trichoderma Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma 2014

65 species isolated from the phyllosphere of of phyllosphere the from isolated species G phyllosphere 2014. The identity valuesbelow 95% are ma

e 6) n u . s , sp. sp. sp. sp. sp. sp. sp sp sp.

s Table 6 Table

ci e s

the isolated strain listed. The identification of the strain 95%, 99% 99% 95%, 99% 95%, 97%, 100% 100% 97%, 94% 98%, 99% 96%, 96% 99%, 100% 95%, 93% 97%, 96% 98%, 99% 97%, 92% 97%, 99% 96%, 93% 98%, 100% 98%, 100% 96%, 99% 98%, 94% 98%, 99% 96%, 93% 98%, 100% 97%, 100% 96%, 99% 96%, Id e tef1 n t / C o

(for (for v

and species produce carbohydrate produce carbohydrate species rs in Brunei rainforest. rs in Brunei rainforest. S. johorensis S. Fusarium Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales rked red.in Basidiomycota O r d e r strains) sequence strains)

leaves samples samples leaves Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes s s were C l a s s

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 5498 5499 5828 5629 5846 5765 5493 5490, 5492 5844 5633 5628 5503 5491 5634 5843 5794 5792 5772 5795 5762 5796 5760 5761 5649 5746 5744 5643 5845 5501 5502 5570 5620 5571 5500 5758 5756 5751 5736 5735 5730 5739 5729 - , 5630 ------5495 5833 5793 5787 5769 5763 5759 5747 5745 5621 5505 5757 5752 5732 5736 5738

------

1 1 2 1 1 1 1 2 2 1 1 1 2 1 1 1 7 1 5 1 4 1 1 1 1 1 2 1 2 1 4 1 3 4 CBS 125579 CBS 125579 caraganae Stromatonectria 454.70 Simplicillium CBS 737.84 arxii Leucosphaerina CBS_403.89 sp. Ovicillium Fusicolla Paracremonium CBS 315.73 inflatum Paracremonium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium ovalisporum Trichoderma koningiopsis Trichoderma harzianum Trichoderma atrobrunneum Trichoderma paraviridescens Trichoderma sparsum Trichoderma sinuosum Trichoderma CBS 881.96 ressei Trichoderma koningiopsis Trichoderma Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma Pestalotiopsis Pestalotiopsis Pestalotiopsis Ilyonectria Verticillium Trichothecium Trichothecium Trichothecium CBS CBS 482.78 sp sp. sp.

. . sp. CBS sp.748.73 CBS sp CBS 634.76 CBS sp sp sp sp sp sp sp . .

sp . . . CBS CBS . . .

. .

95%, 100% 100% 95%, 96% 93%, 100% 100%, 98% 86%, 99% 97%, 99% 98%, 100% 98%, 100% 97%, 100% 96%, 100% 97%, 100% 96%, 91% 97%, 100% 96%, 91% 98%, 100%, 97% 97% 100%, 95% 100%, 97% 100%, 97% 100%, 96% 95%, 96% 95%, 96% 95%, 86% 99%, 97% 100%, 99% 88%, 87% 99%, 80% 96%, 99% 87%, 99% 98%, 74% 99%, 97% 99%, 99% 97% 99%, 100% 93%, , 99%

Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Sporocadaceae Sporocadaceae Sporocadaceae Nectriaceae s Hypocrealesincertaesedi s Hypocrealesincertaesedi s Hypocrealesincertaesedi s Hypocrealesincertaesedi Bionectriaceae Cordycipitaceae sedis incertae Hypocreales Bionectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Hypocreaceae Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Xylariales Xylariales Xylariales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 5808 5780 5506 5507 5631 5719 5839 5836 5786 5811 5635 5771 5840 5814 5803 5776 5837 5827 5822 5817 5807 5799 5797 5813 5781 5816 5773 5717 5715 5711 5646 5714 5712 5829 5788 5783 5784 5644 5636 5632 5572 5496

------5494 5809 5798 5777 5645 5806 5823 5779

- - - - 3 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 2 2 1 1 1 3 1 1 1 1 1 1 1 1 1 1 3 1 2 1 1 CBS CBS 579.71 velutina Coniochaeta Coniochaeta Coniochaeta lagerstroemiae Chrysomorbus Pestalotiopsis Arthrinium CBS:200.57 marii Arthrinium Arthrinium CBS:200.57 marii Arthrinium Arthrinium Arthrinium phragmites Arthrinium Arthrinium Arthrinium rasikravindrae Arthrinium Arthrinium sp Valsaceae sp. Plectosphaerella cucumerina Plectosphaerella sp Valsaceae Xylaria Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis clavispora Neopestalotiopsis Penicillium Penicillium CBS111530 Lasiodiplodia Cladosporium mucilaginosis Lophiotrema mucilaginosis Lophiotrema Setophoma cucumerina Plectosphaerella Tolypocladium crassa Neurospora sp . .

sp. sp. sp. CBS:200.57 872.73 CBS sp. sp. sp. sp. sp sp sp. sp.

sp. . . sp. sp sp sp sp sp sp sp sp

......

100%, 94% 100%, 95% 100%, 93% 83%, 95% 100%, 100% 100%, 97% 100%, 96% 96%, 97% 99%, 99% 100%, 97% 100%, 96% 100%, 95% 100%, 97% 100%, 97% 100%, 97% 100%, 97% 100%, 96%, 99% 99% 96%, 99% 98%, 98% 100%, 95% 100%, 40% 90%, 90% 100%, 97% 100%, 95% 97%, 91% 100%, 100% 90%, 100% 90%, 98% 99%, 96% 86%, 97% 100%, 95% 98%, 96% 97%, 94% 100%, 95% 98%, 95% 97%, 94% 100%, 98% 91%, 95% 100%,

Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Valsaceae Plectosphaerellaceae Plectosphaerellaceae Valsaceae Xylariaceae Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Aspergillaceae Aspergillaceae Botryosphaeriaceae Cladosporiaceae Lophiotremataceae Lophiotremataceae Phaeosphaeriaceae Plectosphaerellaceae Ophiocordycipitaceae Sordariaceae Coniochaetaceae Coniochaetaceae Coniochaetaceae Cryphonectriaceae Sporocadaceae Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Apiosporaceae Xylariales Xylariales Xylariales Xylariales Diaporthales Glomerellales Glomerellales Diaporthales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Eurotiales Eurotiales Botryosphaeriales Capnodiales Pleosporales Pleosporales Pleosporales Glomerellales Hypocreales Sordariales Coniochaetales Coniochaetales Coniochaetales Diaporthales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Eurotiomycetes Eurotiomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. phyllosphere (150 strains from 195 total isolated strains). p. ad yails ( Xylariales and spp.) Genus Genus belong to Sordariomycetes class mostly from Hypocreales phylum 1- Basidiomycota H.Oya Akyildiz Diplomarbeit TU Wien 5790 5800 5782 5791 5778 5841 5824 5819 5838 5785 5812 5568 5826 5566 5508 5804 5801 5716 5825 5821 5831 5764 5767 5770 5648 5710 5810 5718 5651 5650 5766 5627 5713 ------5789 5805 5815 5567 5802 5820 5647 5768 5626 5774 5830

- -

2 2 2 1 1 1 1 1 2 1 1 1 1 1 1 2 3 2 1 2 1 1 1 1 1 1 2 1 1 1 2 4

Schizophyllum Schizophyllum 5841 TUCIM NEW TAXA 5824 TUCIM NEW TAXA fraxini Pseudocercosporella fraxini Pseudocercosporella Pseudocercosporella CBS:12037 guilliermondii Meyerozyma Candida orthopsilosis subglobosus Debaryomyces CBS 2334 nepalensis Debaryomyces fabryi Debaryomyces Infundichalara 46762 ATCC sclerotiorum Sclerotinia creber Aspergillus CBS 408.93 Talaromyces CBS 140573 robsamsonii Penicillium Penicillium rudallense Penicillium rudallense Penicillium 7861 ATCC expansum Penicillium echinulatum Penicillium Penicillium cairnsense Penicillium Penicillium CBS 125543 glabrum Penicillium polonicum Penicillium 7861 ATCC expansum Penicillium Phlebia acerina acerina Phlebia Hypholoma Hypholoma CBS:175.74 Pestalotiopsis

sp sp sp

sp sp

sp. sp. . .

sp .

spp.) were the most prevalence fungi isolated from the the from isolated fungi prevalence most the were spp.) 97%, 99% 99% 97%, 99% 100%, 99% 100%, 99% 99%, 95% 92%, 99% 100%, 100%, 99% 100%, 100% 100%, 99% 99%, 98% 100%, 100% 99%, 99% 100%, 99% 100%, 99% 100%, 99%, 99% 99% 99%, 99% 99%, 100% 99%, 99% 100%, 99% 100%, 98% 99%, 96% 99%, 97% 99%, 100% 100%, 99% 100%, 98% 100%, 99% 100%, 99% 100%, 95% 89%, 100%

Sclerotiniaceae Sclerotiniaceae Aspergillaceae Trichocomaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Aspergillaceae Meruliaceae Meruliaceae Strophariaceae Strophariaceae Schizophyllaceae Schizophyllaceae Mycosphaerellaceae Mycosphaerellaceae Mycosphaerellaceae Debaryomycetaceae Debaryomycetaceae Debaryomycetaceae Debaryomycetaceae Debaryomycetaceae Helotialesincertaesedis Seven Seven basidiomycetes strains were also ( Trichoderma Helotiales Helotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Eurotiales Polyporales Polyporales Agaricales Agaricales Agaricales Agaricales Capnodiales Capnodiales Capnodiales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Helotiales spp. and Leotiomycetes Leotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Dothideomycetes Dothideomycetes Dothideomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Leotiomycetes Fusarium

1 1 1 1 1

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. phylum or family or genus. phylum or or genus. family fungi some found also we investigation the During isolated. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 39

hc wr ptnily e as new potentially were which Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 40

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure wereshown. References were shown as type.bold 18 Trichoderma TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 10 8 fungal strains isolated from Shorea phyllosphere 2014 excluded sp. (89) were analyzed. As can be seen from the tree, tree, the from seen be can As analyzed. were (89) sp. S. johorensis Trichoderma. phyllosphere without Basidiomycota species (7) and The highestparts tobelong 42

Arthrinium Penicillium and and Penicillium Arthrinium sp. which

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. tree f.e. Maximum Likelihood. tree Maximum f.e. mistakes. For this to make new tree according to their order o neglecta pseudosulphurellum Incrucipulum abundant (Figure most are species belong to mostly belong to mostly whic strains The and(BLAST). identified areidentical alignment almost The H.Oya Akyildiz Diplomarbeit TU Wien Figure Fusarium 11 Tree of (CBS:627.94) with 80% similarity, respectively. Unfortunatel genus is the most numerous but not the most diverse genus, 1 genus, diverse most the not numerousbut most the is genus Fusariumspecies Fusarium Fusarium oxysporum from Shorea (TNS:F-81441) with 86% similarity, similarity, 86% with (TNS:F-81441) 10 ). TU CIM 5824 and TU CIM 5841 were found on BLAST as as BLAST on found were 5841 CIM TU 5824and CIM TU ). genus (Figuregenus phyllosphere. Referenceswereshown astype. bold 43

11 ) .

r to construct another phylogenetic y, y, in the tree there are many h isolated from epiphytes from isolated h epiphytes Paraphaeosphaeria 5 sequences in the the in sequences 5

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. S. S. johorensis colon shown trees tested both the of pattern fungi epiphytic The with thanthe less (Table strains 6).similarity 95% johorensis S. analphylogenicand strains theof the list see canyou Below TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien acaoyeae ad uoils ( Eurotiales and Saccharomycetales In In However, eachfrom plant leaves. plant strainboth had also the of very low ITS similarity (87% similarity to strain this identify were We to able leaves. the of from the surface spp and ( Saccharomycetales order to belong yeasts Real 2015). in KM231844 spp.) spp.) and were the next frequent isolated fungi from Some strains isolated Somefrom strains • • • 482.78) Some special Some special CBS 114747) • •

S. S. johorensis ie s. Genus belong to Hypocreales (like (like Hypocreales to belong Genus s. Hypocreales Hypocreales Hypocreales Readeriella Chaetothyriales Readeriella Debaryomyces Geotrichum Geotrichum and and Ficus a genus belong to Hypocreales TUCIM 5984 were the more frequen Ficus Ficus epiphytic fungi isolates were fungi alsobelow: isolates epiphytic unique listed and sp. TUCIM 5968toTUCIM sp. strain similarity (98% sp. TUCIM 6000TUCIM sp. to strain similarity (90% sp. TUCIM 5984TUCIM sp. (87 sp. epiphytic fungi sp. TUCIM 5950 (87% similarity to strain strain to similarity (87% 5950 TUCIM sp. sp. frequentlysp. isolated from the sp. We used some type strains in phylogenic analysis to iden to analysis phylogenic in strains type some used We sp. sp.), Eurotiales ( sp. TUCIM 5967 (93% similarity to strain strain to similarity (93% 5967 TUCIM sp. Shorea epiphyte were probably new as family or were epiphyte probably new family as genus. Penicillium Penicillium % similarity to strain similarity S. S. johorensis 44

sp Pochonia Pochonia

)wr te ot rvlne tan isolated strains prevalence most the were .) sp . . and Fusarium Shorea epiphytic fungi. Capnodiales ( sp. sp. CBS 892.72 with accession number Talaromyces Readeriella Readeriella nontingens Readeriella Pochonia ysis of epiphytic fungi isolated from fungi isolated epiphyticof ysis strain to the level of order because because order of tostrain the level leaves butleaves not from similar but mostly from different different from mostly but similar

its specific fungi. fungi. specific its sp Paracremonium inflatum inflatum Paracremonium Cladophialophora chaetospira Cladophialophora , and ., CBS 892.72)sp.

Geotrichum sp.) and guyanensis Trichoderma

Readeriella Readeriella t t isolated fungi Ficus CPC:14444) sp., CBS 117550) CBS 117550) tification of of tification Readeriella Readeriella . . Candida

sp spp. CBS .),

Pleosporales Hypocreales sp TUCIM 6064 (88% similarity to strain similarity (88% sp 6064 TUCIM sp 6082to TUCIM strain similarity (81% S. johorensis S. and Ficus sp. epiphytic fungi was shown below Figure Figure shown fungi was below epiphytic sp. 45

Coccinonectria pachysandricola pachysandricola Coccinonectria Corynespora Corynespora smithii L133) 12 . . CBS CBS Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 46

Dothideomycetes Dothideomycetes Chaetothyriales Pleosporales Pleosporales

Capnodiales Capnodiales

Saccharomycetales Saccharomycetales Eurotiales Eurotiales

Dothideomycetes Dothideomycetes Saccharomycetes Saccharomycetes Eurotiomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure H.Oya Akyildiz Diplomarbeit TU Wien 12 Tree of S.johorensis and Ficus s.eihtcfni eeecswr hw sbl ye sp.epiphytic fungi. References wereshown as type.bold 47

Diaporthales Diaporthales Microascales Microascales Xylariales Xylariales Hypocreales Hypocreales Xylariales Xylariales

Sordariomycetes Sordariomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit 6Table TU Wien 5973 5994 6001 5996, 5966, 5959 6237 5956 6082 6000 5982 5991 5972, 5970 5968 5965, 5951 5971 6004 5969 6070 6077 6075 5992 6080 6074 5995 6065 6064 6072 6003 5997 5962, 6085 5950 6067 5979 6076 6231, 5986 6083 5961, 6073 6066, 6002, 5983, 5978, 5960, 5957, 5954, 5984, TUCIM TUCIM No.

Shorea 3 3 1 1 1 1 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 2 1 2 9 1 1 1 total

johorensis Shorea Shorea Shorea Shorea Shorea Shorea Shorea Ficus Shorea Shorea Shorea Shorea Shorea Shorea Shorea Shorea Shorea Ficus Ficus Ficus Ficus Shorea/ Ficus Shorea/ Ficus Shorea/ Shorea Ficus Ficus Ficus Shorea Shorea Ficus Shorea Ficus Shorea Shorea Shorea Ficus Shorea/ Shorea Epi Epi Epi Epi Epi Epi Epi Epi Epi Epi Epi origin origin EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI / EPI EPI EPI Ficus and

EPI EPI EPI EPI EPI EPI EPI Ficus Aureobasidium melanogenum melanogenum Aureobasidium CBS 124987 patrickii Readeriella CBS 117550 guyanensis Readeriella crateriforme Acrodontium Pestalotiopsis theae Pseudopestalotiopsis CBS 225.30 piceana Neopestalotiopsis Seiridium Wardomyces Valsaceae Valsaceae Xylaria CBS 131712 pluriloculosa Phialemoniopsis Xylaria pluriloculosa Phialemoniopsis sp. Coccinonectria Trichoderma harzianum Trichoderma Xenoacremonium Xenoacremonium Paracremonium Fusarium Fusarium Fusarium solani Fusarium Fusarium Pochonia Penicillium cinnamopurpureum cinnamopurpureum Penicillium Penicillium Penicillium CBS 391.48 wortmannii Talaromyces melanogenum Aureobasidium Pleosporales Cladosporium nontingens Readeriella 124987 patrickii Readeriella sp.epiphytic fungi.

sp sp

Genus/Species Genus/Species sp. CBS 892.72 892.72 sp. CBS

sp. . . sp sp sp sp sp. sp.

sp sp . . . .

sp sp

sp. sp.

sp. sp. sp.

. sp. CBS 482.78 482.78 CBS sp.

sp. sp. CBS 476.92 476.92 CBS sp CBS

The similarityvalues below95% are marked redin 48

99%, 99% 99% 99%, 99% 98%, 87% 100%, 100% 99%, 100 100%, 98 100%, 100% 98%, 98 97%, 99%, 98%, 100% 100% 98%, 100% 97%, 99% 99%, 100% 98%, 100% 98%, 91% 51%, 99% 100%, 91% 96%, 91% 97%, 100% 98%, 91% 94%, 99% 99%, 99% 98%, 100% 97%, 100% 99%, 100% 98%, 98% 98%, 98% 97%, 91% 94%, 97% 96%, 99% 93%, 98%, 95 99% 96%, 89 98% 98%, 99% 99%, Cov/I %, 99% %, 99% %, % % ITS- ITS- 88 99% 92 dent %, % % % %

Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Nectriaceae Trichocomaceae Trichocomaceae Trichocomaceae Trichocomaceae Saccotheciaceae Cladosporiaceae ae Teratosphaeriace ae Teratosphaeriace Saccotheciaceae ae Teratosphaeriace ae Teratosphaeriace ae Teratosphaeriace Sporocadaceae Sporocadaceae Sporocadaceae Sporocadaceae Microascaceae Valsaceae Valsaceae Xylariaceae sedis incertae Xylariales Hypoxylaceae Togniniaceae Hypocreaceae Hypocreaceae

Family

Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Eurotiales Eurotiales Eurotiales Eurotiales Dothideales Pleosporales Capnodiales Capnodiales Capnodiales Dothideales Capnodiales Capnodiales Capnodiales Xylariales Xylariales Xylariales Xylariales Microascales Diaporthales Diaporthales Xylariales Xylariales Xylariales Diaporthales Hypocreales Hypocreales Hypocreales Order

Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Class

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. H.Oya Akyildiz Diplomarbeit TU Wien Compare to epiphytic fungi, there were few overlap between endoph between overlap few were there fungi, epiphytic to Compare h ms dmnn fni sltd from isolated fungi dominant most The (Table 7). belong to and classes Sordariomycetes Dothideomycetes fungi specific own shown mostly they and leaves) plants both and Gliocephalotrichum ITS low because their ofthem couldn’t identify (we Diaporthales • genus fungi genus isolated from the • • • 5987 5980, 5974, 5985, 5977, 5993, 5958, 5955 6071 6068 6240 6238 6236 6235 6244 6239 6245, 5988 5967 6303 6084 6081 6079, 6078, Diaporthales TUCIM 6029 (96% similarity to 6029TUCIM strain Diaporthales similarity (96% Diaporthales TUCIM 6026TUCIM Diaporthales ( 6022TUCIM Diaporthales ( 6025toTUCIM Diaporthales strain similarity (100% Ficus

1 1 2 4 1 1 1 1 1 1 1 1 2 1 1 1 1 3 S. S. johorensis sp. (Except sp. Shorea Shorea Shorea Shorea Shorea Ficus Ficus Shorea Shorea Shorea Shorea Ficus Ficus Shorea/ Shorea Shorea Ficus Ficus Ficus Epi Epi Epi Epi Epi Epi Epi Epi EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI EPI sp. and sp. and Trichoderma EPI EPI Ficus CBS 125543 CBS 125543 glabrum Penicillium Galactomyces Galactomyces pseudocandidus Galactomyces candidum Geotrichum Candida Candida Candida tropicalis ohmeri Kodamaea CBS:2193 Candida parapsilosis CBS:7869 Candida cylindracea CBS:12037 guilliermondii Meyerozyma CBS:12037 nepalensis Debaryomyces nepalensis Debaryomyces Exophiala CBS 114747 Cladophialophora adametzioides Penicillium Penicillium sp. endophytic fungi Trichoderma S. johorensis spp. and spp. sp. CBS:7869 CBS:7869 sp. 99 98 sp

sp. sp.

sp % similarity to strain % similarity to strain % similarity

sp. sp.

spp. below is the list of the potential new family or family new potential the of list the is below spp. endophyte: Shorea Pestalotiopsis

leaves belong to several species in order order in species several to belong leaves 100%, 99% 99% 100%, 90% 99%, 99% 98%, 100% 98%, 100% 99%, 100% 98%, 94% 96%, 100% 98%, 99% 98%, 99% 99%, 87% 98%, 93% 99%, 100% 99%, 100% 98%, 100% 99%, 99%, 93% 93% 99%, 93% 96%, Valsaceae Valsaceae eschscholtzii Daldinia Coniochaeta spp. which present at high quantity inquantity high at present which spp.

Purpureocillium lilacinum Purpureocillium

Dipodascaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae Saccharomycetaceae e Herpotrichiellacea Trichocomaceae Trichocomaceae Trichocomaceae Dipodascaceae Dipodascaceae

pattern. All the isolated strains isolated the All pattern. identity after blasting in NCBI), in blasting after identity

sp. GS52)sp. sp. BRO-2013) sp. ytic fungi of fungi ytic

Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Saccharomycetales Chaetothyriales Chaetothyriales Eurotiales Eurotiales Eurotiales Saccharomycetales Saccharomycetales JMRC:SF:11930)

S. johorensis S. Kw-

3411 Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes ) )

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. (Figure different showing pigmentation but morphology same Diaporthales strains TUCIM 6022, 6023 6023 6022, TUCIM strains Diaporthales • • • p (JMUR- sp. Trichoderma Figure H.Oya Akyildiz Diplomarbeit TU Wien endophyte of Capnodiales TUCIM 6021TUCIM to Capnodiales strain similarity (91% 6017TUCIM Myriangiales to strain similarity (82% Diaporthales TUCIM 6030toTUCIM Diaporthales strain similarity (100% 13 the one-week old colony TUCIMof6022. 6023 and6024 (f 2016 spp, spp, Ficus ) r rdnat ae o ter T sqecs u ter ae g col age same their but sequences ITS their on based redundant are Lasiodiplodia leaves (Figure leaves sp. and sp. 14 ). ). Coniochaeta Coniochaeta Clonostachys rosea Clonostachys 50

sp (BRO-2013 rom lefttoright) Readeriella Readeriella nontingens Anhellia nectandrae nectandrae Anhellia Phomopsis Phomopsis were the most isolated fungi from fungi isolated most the were 13 ) .

) and 6034 and

sp.

TW24) VIC VIC 31767) Sordariomycetes CPC:14444) onies

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. . Figure H.Oya Akyildiz Diplomarbeit TU Wien 14 Tree S.of johorensis andFicus sp. endophytic fungi. Referenceswere shownas bold type 51

Botryosphaeriales Myriangiales Capnodiales Hypocreales

Glomeralles Sordariales Diaporthales Diaporthales Xylariales Xylariales

Hypocreales

Sordariomycetes

Sordariomycetes Dothideomycetes

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 6021 6047 6052, 6045, 6032 6037 6017 6009 6006 6028 6015 6057 6055 6038, 6029 6030 6026 6034 6023, 6022, 6007 6018, 6014, 6020, 7 6024,602 6025 6056 6031 6019, 6012, 6010, 6032 6040, 6054 6046, 6043, 6048 6058 6059 6041 6050 6042 6044 6039, 6049 6036, 6005 6013 6033 6051 6011, TUCIM TUCIM No.

Table 7Table 1 1 3 1 1 1 1 1 1 1 1 2 1 1 1 1 2 1 2 1 2 1 1 4 2 3 1 1 1 1 1 1 2 2 1 1 1 2 total S.johorensis

Shorea Shorea Shorea Shorea Shorea Shorea Ficus Shorea/ Ficus Ficus Ficus Ficus Ficus Ficus Ficus Ficus Ficus Shorea Shorea Shorea Ficus Shorea/ Shorea Ficus Ficus Shorea/ Ficus Shorea/ Shorea Shorea Shorea Shorea Shorea Ficus Ficus Shorea Shorea Shorea Shorea Shorea Shorea Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo Endo origin Endo Endo Endo Endo Endo and

Endo Endo Endo Endo Endo Endo Ficus sp. endophyticfungi Phialemoniopsis curvata curvata Phialemoniopsis Phialemonium Valsaceae Phomopsis eschscholtzii Daldinia Sordariomycetes Coniochaeta primolutea Nemania Bipapillata Nemania cf. CBS 265.51 calospora Neurospora Cordyceps javanica lilacinum Purpureocillium Pestalotiopsis cylindrosporum Gliocephalotrichum rosea Clonostachys rosea Clonostachys atroviride Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma CPC:14444 CPC:14444 nontingens Readeriella CBS 456.78 parva Lasiodiplodia CBS 456.78 parva Lasiodiplodia pseudotheobromae Lasiodiplodia sp. VIC 31767 Anhellia Coniochaeta Coniochaeta scolyti Phaeoacremonium Pestalotiopsis Genus/Species

sp sp. sp.

sp sp. sp. sp. sp.

sp. sp sp. sp.

sp . .

. The identityThe valuesbelow95% are markedinred. 99%, 99% 99% 99%, 99% 97%, 100% 99%, 99% 99%, 99% 100%, 98 99% 98%, 97% 97%, 99% 99%, 99% 98%, 99% 99%, 99% 99%, 99% 99%, 99% 99%, 96%, 90% 90% 96%, 99% 92%, 99% 99%, 99% 99%, 82% 93%, 98% 97%, 100 98% 93%, 99% 98%, 97% 98%, 99% 98%, 96% 95%, 100 100 99% 100%, 86% 99%, 98% 100%, 95% 99%, 100% 94%, 99% 100%, 100% 92%, 100% 98%, 9 97%, 99% 98%, Cov/I %, 99% %, 99% %, 99% %, 99% % %, ITS-

dent 9%

Bionectriaceae Bionectriaceae Bionectriaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Teratosphaeriaceae Teratosphaeriaceae Botryosphaeriaceae Botryosphaeriaceae Botryosphaeriaceae Myriangiaceae Coniochaetaceae Glomerellaceae Togniniaceae Sporocadaceae sedis incertae Xylariales sedis incertae Xylariales Castanediellaceae Valsaceae Hypoxylaceae Coniochaetaceae Xylariaceae Xylariaceae Sordariaceae Cordycipitaceae e Ophiocordycipitacea Sporocadaceae Nectriaceae Family

Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Capnodiales Capnodiales Botryosphaeriales Botryosphaeriales Botryosphaeriales Myriangiales Coniochaetales Glomerellales Togniniales Xylariales Xylariales Xylariales Xylariales Diaporthales Xylariales Coniochaetales Xylariales Xylariales Sordariales Hypocreales Hypocreales Xylariales Hypocreales Order

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Class

, acaoye wr msl peet t ne pr o te et Bsd on Based nest. the of part inner at present (Figure mostly minority were in Saccharomyces were similarity) 92% with 126022 (CBS black fungi included Chaetothyriales (CBS 128948 with with 128948 (CBS Chaetothyriales included fungi black 9): analys phylogenic their and strains nest YGFF DAOM:233448).The h qatt o te ug fo isd of inside from fungi the of quantity The C. explodens The diversity ant assosiatedof fungi: part, theof populations the However, surface. outer the to compared identification, the identification, 8Table YGFF strainsnest andtheir phylogenic analysis H.Oya Akyildiz Diplomarbeit TU Wien e a seis n nt ecie yt 9% iia to similar (93% yet described not and species as new 1 4 1 2 1 1 1 1 1 1 1 4 total

Xenoacremonium Xenoacremonium recifei

Mucor vanrijiaevar. Schwanniomycesvanrijiae Penicillium citrinum Penicillium chrysogenum ATCC7861 Penicillium expansum CBS126022 Fonsecaea minima 128948 Chaetothyriales Penicillium citrinum pluriloculosa Phialemoniopsis Campylocarponfasciculare CBS541.89 Xenoacremoniumrecifei CBS541.89 Xenoacremoniumrecifei Genus/Species natural nest nest (YGFF)natural sp.

CBS131712

CBS:3024 Trichoderma CBSsp.

(CBS 541.89 with 96%, 98%96%, 100%96%, 100%97%, 99%, 99%, 92%98%, 86%99%, 100%97%, 99%95%, 90 99%98%, 99%99%, ITS-Cov/I strains isolated from the interior of the nest (TUCIM 6215) ar 6215) (TUCIM nest the of interior the from isolated strains %, 96 99 100 % % dent

. explodens C. Inside Inside/Out layer Outer layer Outer layer Outer Inside Inside Inside/Out Inside Inside Inside Inside/Out origin . Theidentity values below95% markedare in red 53 99

% % similarity) was the dominant taxon and other Mucoraceae Debaryomycetaceae Trichocomaceae Trichocomaceae Trichocomaceae Herpotrichiellaceae Trichocomaceae sedis Xylarialesincertae Nectriaceae Nectriaceae Nectriaceae Family natural nest (YGFF) were not diverse diverse not were (YGFF) nest natural 88

% similarity) and similarity) % . harzianum T. fungi were different. In carton carton In different. were fungi 15 is listed below (Table 8 (Table below listed is

) . Trichoderma Trichoderma Mucorales Saccharomycetales Eurotiales Eurotiales Eurotiales Chaetothyriales Chaetothyriales Eurotiales Xylariales Hypocreales Hypocreales Hypocreales Order culture-collection Fonsecaea minima Fonsecaea

tef 1 sequence sequence 1 eu and genus

, Mucoromycotina Saccharomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Class Table

e e

Figure H.Oya Akyildiz Diplomarbeit 9Table YGFF strainsnest andtheir phylogenic analysis TU Wien 3 4 2 1 total

15 Trichoderma Trichoderma Trichoderma Trichoderma Genus/Species Tree fungiof from

sp sp sp sp

. . . .

C.explodens 100%,99% 99%99%, 100%,99% 99%99%, ITS-Cov/I natural nest (YGFF). Referenceswere shown bold as type. dent

Inside Inside/Out out Inside origin

with marker

Hypocreaceae Hypocreaceae Hypocreaceae Hypocreaceae Family tef1

- α

Hypocreales Hypocreales Hypocreales Hypocreales Order

Saccharomycetales Hypocreales

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Class Xylariales

Eurotiales

Chaetothyriales

Saccharomycetes

Sordariomycetes Eurotiomycetes Eurotiomycetes Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure ( Pleosporales order the from fungi yeast-like In bruneiensisC. TUCIM6192) coveredthe surfaceinner theof nest (Figure area inner the the medium while we observed the medium the while conidiation in the nest. (Figure form mycelial to back switch PDA medium, the fungi colony switch from the to mycelial yeast material, nest culture of the at initial at 28°C rate plates PDA on 99 than (more diversity cultivable the dominated fungus This stages The werethe nest. never yeast-like observednest. in the sporulatin of patch the observed we analysis, microscopy In this funguscoidentify of andon (ITS1-2 genus family level a C. bruneiensis C. 16 microscopic analysis theofBBQ nest 2015: A patch o nest 2015 (MIT1) 2015 nest cavity wall and carton structures inside, a pat a inside, structures carton and wall cavity nest 2015 16 ) b . Based on ITS 1-2 and and 1-2 ITS on Based 17 ) . Interestingly, no evidence for conidiation was found in found in was forconidiation evidence no Interestingly, Pleosporales Pleosporales rpb ffungi belong to family Pleosporales( DA acdn aayi,w cud not could we analysis, barcoding DNA 2 verage 50%, Similarity 91%). Similarity 50%, verage sp. TUCIM 6192) covered especially especially covered 6192) TUCIM sp. g fungus covered all interior part of of partinterior all covered fungus g %). TUCIM 6192 has slow growth growth slow has 6192 TUCIM %). y but y oneafter week, the colony after four days of cultivation on on cultivation of days four after ch of black dimorphic dimorphic black of ch Pleosporales sp. Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. (Figure (Figure Table in listed were Figure culturetheof interior of were99%Morethefungigrownthethanof nest.belof part The fung The 17 18 a) Fungi plate culture of al ) diversity isolated from inside and outer layer of the MIT1 the of layer outer and inside from isolated diversity . C.bruneiensis 10 . The identification of these strains was based on ITS1-2 gene gene ITS1-2 on based was strains these of identification The . C. bruneiensis nest.

2015 nest. The left plate was belonging to 4 days culture of ong to the same strainsamethe(TUCIM 6192).old One-week b)to ong nest ( nest C. bruneiensis C. barcoding barcoding the inner 2015) 2015)

nest2015 (MIT1). References wereshown astype. bold

Botryosphaeriales Hypocreales Hypocreales Glomerellas

Xylariales

Hypocreales Saccharomycetales Saccharomycetales Eurotiales Chaetothyriales

Sordariomycetes Sordariomycetes Dothideomycetes

Eurotiomycetes Eurotiomycetes Sordariomycetes Saccharomycetes Saccharomycetes

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

6288, 6173 6173 6288, 6185 6188 6102 6098 6097 6305 The6302 approved6299 6177 original 6176 6175, 6306 6088, version6191 6309 of 6297 6174, this 6308 thesis6295 6178, is 6285, 6298, 6294, available 6292 6291, 6290 in print6100 6165 at TU 6168, Wien 6279 6274, 6272, 6292 6283, 6281, Bibliothek. 6280, 6271, 6270, 6282 6275, 6195, 6291 6276, 6304, 6286 6183 6096 6093 6181 6312 6311, 6310, 6301, 6278, 6277, 6269, 6194, 6172, 6170, 6167, 6164, 6089 No. TUCIM , 6169 , 6171 6192 6094 , 6193, , 6184 , 6184 Table are markedare redin 10 The fungi diversityisolated from insideand outerlayer 1 1 14 1 2 2 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 1 4 2 1 1 2 2 3 6 3 3 1 1 3 1

Penicillium multicolor multicolor Penicillium cucumerina Plectosphaerella viridistratum Annulohypoxylon anisopliae Metarhizium Hypocreales Tolypocladium Tolypocladium fasciculare Campylocarpon album Tolypocladium Sordariomycetes recifei Xenoacremonium recifei Xenoacremonium Trichoderma ovalisporum Trichothecium Trichoderma arxii Leucosphaerina Tolypocladium Tolypocladium Fusarium arxii Leucosphaerina caraganae Stromatonectria inflatum Tolypocladium Ijuhya corynospora inflatum Paracremonium Fusarium Fusarium Fusarium Cladosporium Capnodium guyanensis Readeriella patrickii Readeriella krabiensis Hermatomyces sp. Pleosporales yingyisheniae Setophoma

sp sp sp sp sp. sp. . . .

Genus/Species Genus/Species

sp harzianum harzianum virens sp. sp. sp. sp. sp.

sp.

CBS 342.77 CBS

CBS 124987

CBS 737.84 737.84 CBS CBS 737.84 CBS CBS 117550 CBS

CBS 541.89 CBS 541.89 CBS 541.89 CBS 482.78 482.78 CBS

CBS 125579 125579 CBS

99%, 98% 98% 99%, 98% 98%, 98% 97%, 100 95% 99%, 99% 99%, 91% 95%, 40% 91% 50%, 100% 89%, 98%, 99% 98%, 99% 97%, 95 87% 47%, 81% 67%, 100 99% 92%, 97% 94%, 94 8 99%, 98% 99%, 99% 100%, 99% 99%, 94% 96%, 99%, 89% 99%, 95% 97%, 97% 95%, 98% 97%, 88% 99%, 86% 95%, 99% 97%, 79 99 Cov/I %, 99% %, 97% %, %, 98% %, ITS- %, 99%%, %, , 90 90 99 dent dent 96 6% % % % %

Inside/Out Inside/Out Inside/Out Inside/Out Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Inside Inside Outer layer Outerlayer Outerlayer Outerlayer Inside/Out Inside/Out Inside/Out Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Inside/Out Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Inside/Out Inside/Out Inside Inside Inside Inside of theof MIT1 nest origin origin Nectriaceae Nectriaceae Nectriaceae Cladosporiaceae Capnodiaceae Mycosphaerellaceae Mycosphaerellaceae sedis incertae Pleosporales Phaeosphaeriaceae Aspergillaceae Aspergillaceae Plectosphaerellaceae Hypoxylaceae Clavicipitaceae Ophiocordycipitaceae Ophiocordycipitaceae Nectriaceae Ophiocordycipitaceae Nectriaceae Nectriaceae Hypocreaceae sedis incertae Hypocreales Hypocreaceae sedis incertae Hypocreales Ophiocordycipitaceae Ophiocordycipitaceae Nectriaceae sedis incertae Hypocreales Bionectriaceae Ophiocordycipitaceae Bionectriaceae Nectriaceae . Family Family The identity valuesbelow 95%

Hypocreales Hypocreales Hypocreales Hypocreales Capnodiales Capnodiales Capnodiales Capnodiales Pleosporales Pleosporales Pleosporales Eurotiales Glomerellales Xylariales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Order Order

Eurotiomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Dothideomycetes Class Class

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

The approved original version of this thesis is available in print at TU Wien Bibliothek. 6251 6249, 6246, 6289 6242 6187 6186, 6179, 6095, 6182 6180 6300 6293 6090

Figure H.Oya Akyildiz Like C. bruneiensis Diplomarbeit TU Wien but they grow in a filamentous formfilamentous a in grow they but Chaetothyriales order. Some of these black fungi show the y 20 (TUCIM 6997) can switch to a yeasty form after three weeks iopi fni (~10 fungi dimorphic symbionts is present in in present is symbionts PDA medium PDA ). ). C. bruneiensis C. 19

Fungi plateculture of 3 3 1 1 4 1 1 1 1 1 b) nest nest 2017 the purecultures from thestrains isolated from(a plate Debaryomyces nepalensis nepalensis Debaryomyces ohmeri Kodamaea guilliermondii Meyerozyma Endomelanconiopsis CBS 126871 immunda Cladophialophora reptans Cyphellophora pulvillorum Penicillium meleagrinum Penicillium glabrum Penicillium nest 2015, the interior of of interior the 2015, nest 8 ga ns) Or td sos ht hg gntc iest o diversity genetic high a that shows study Our nest). /gram CBS:2038 C.bruneiensis CBS 125543 125543 CBS sp. CBS 353.97 CBS sp. . bruneiensis C.

CBS 113.85 113.85 CBS CBS 2334 2334 CBS CBS:12037 CBS:12037

in vitro in

2015. 99%, 99% 99% 99%, 99% 99%, 99% 99%, 97% 97%, 97% 98%, 99 97% 97%, 100 99% 98%, 07 oprd o et 05 mil belong mainly 2015, nest to compared 2017

a) ( %, 89% %, Figure %, 99%%, C. bruneiensis C. is one-week culture plate of 59

19 Inside/Out Inside/Out Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer Outerlayer ) . The colony of strain strain ofcolonyThe of cultivation on PDA medium (Figure 2017 were dominated by the black black the by dominated were 2017 east-like east-like form only when in the nest, ). Debaryomycetaceae Debaryomycetaceae Metschnikowiaceae Debaryomycetaceae Botryosphaeriaceae Herpotrichiellaceae Cyphellophoraceae Aspergillaceae Aspergillaceae Aspergillaceae C.bruneiensis

Chaetothyriales Saccharomycetales Saccharomycetales Saccharomycetales Botryosphaeriales Chaetothyriales Chaetothyriales Eurotiales Eurotiales Eurotiales samplenest on

f fungal fungal f

sp. Saccharomycetes Saccharomycetes Saccharomycetes Dothideomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. Figure H.Oya Akyildiz Morphology from theof fungi the Figure Diplomarbeit TU Wien hyphae with individual and elongated to globose cells (Figur and to elongated hyphae cells globose individual with plate the plate strain attheright side (TUCIM7996)formed yeas 21 20 Some theof fungi strains canswitch from mycelial fo Fungi from C.bruneiensis

nest microscopyin C. C. bruneiensis 60 nest were shown thick-walled, dark werenest shownbrown thick-walled, ty week after one cultivationof PDAon plate.

rmto yeastyafter few days e 21 ).

of cultivation.Here in this Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. The fungal diversity isolated fromdiversity The and fungal ofinside outer layer t H.Oya Akyildiz Diplomarbeit Table TU Wien (Figure (Figure (Tablewere in listed 7010 7009 7001 6999 7007 6998 7002 6997, 6996, 6995 6991 7008 7006 7004, 6990 6989 6986 6985 6984, 6975 6332

11 Fungi from of 22 ). 1 1 1 1 1 1 1 3 1 1 1 2 1 1 1 2 1 1 ATCC 20566 20566 ATCC dermatis Trichosporon CBS 2334 nepalensis Debaryomyces 492.81 catenata Anthopsis UBC F23788 pieridicola Fumiglobus rubens Penicillium proteae Neophaeothecoidea sp. Chaetothyriales sp. Chaetothyriales immunda Cladophialophora CBS 541.89 recifei Xenoacremonium Trichoderma crousii Hawksworthiomyces apiosperma Pseudallescheria CBS 126074 virescens Chloridium CBS:3024 vanrijiae Schwanniomyces harzianum Trichoderma album Tolypocladium C.bruneiensis 11 Identification Identification

CBS 114129 114129 CBS ). The identification of these strains was based ofonwas strains identification ). gen The these ITS1-2 sp.

CBS CBS

nest-2017.

98%, 98% 98% 98%, 99% 98%, 84% 90%, 83% 96%, 100% 98%, 87% 99%, 98% 98%, 99% 99%, 91% 99%, 98% 99%, 99% 99%, 94% 89%, 99% 99%, 99% 95%, 100% 98%, 99% 98%, 96% 96%, Cov/Ident Cov/Ident 1 Basidiomycota

61 Inside Inside Inside Inside Inside Outer layer Outer layer Inside Inside Inside Inside Inside Inside Inside Inside Outer layer Inside Inside Outer layer

origin origin Teratosphaeriaceae Teratosphaeriaceae Herpotrichiellaceae Nectriaceae Hypocreaceae Ophiostomataceae Microascaceae Chaetosphaeriaceae Debaryomycetaceae Hypocreaceae Ophiocordycipitaceae Trichosporonaceae Trichosporonaceae Saccharomycetaceae Cyphellophoraceae Capnodiaceae Aspergillaceae he MIT1 nest ( nest he MIT1 Family Family

C. C. bruneiensis Capnodiales Capnodiales Chaetothyriales Chaetothyriales Chaetothyriales Hypocreales Hypocreales Ophiostomatales Microascales Chaetosphaeriales Saccharomycetales Hypocreales Hypocreales Tremellales Tremellales Saccharomycetales Chaetothyriales Capnodiales Eurotiales Order Order

e barcoding e barcoding

201 Tremellomycetes Tremellomycetes Saccharomycetes Eurotiomycetes Dothideomycetes Eurotiomycetes Dothideomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Saccharomycetes Sordariomycetes Sordariomycetes 7 ) Class Class

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. acaoyeaee aiy gener family, Saccharomycetaceae f entomopathogenic possibly and plant-pathogenic, potentially In In Figure respectively. The outer surface of the both Figure groups inside both nests. groupsboth inside nests. in frequent most the were classes different from fungi black The 22 Tree fungiof from 23 we compare the fungi species isolated both from C.bruneiensis C. bruneiensis C. bruneiensis nest- a Penicillium 2017 nest nest were dominated by saprotrophic, opportunistic . Referenceswere shown bold as type. , Trichoderma C. C. bruneiensis , ungi from the yeasts belong to to belong yeasts the from ungi Fusarium quantity and the most fungi most the and quantity and , nest 2017 and 2015 Tolypocladium Chaetosphaeriales Ophiostomatales Chaetothyriales Chaetothyriales

Hypocreales Hypocreales Microascales Eurotiales

Capnodiales

Saccharomycetales

. , Eurotiomycetes Dothideomycetes Eurotiomycetes Saccharomycetes

Sordariomycetes

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. colonies that clustered in various orders, but mostly belon mostly but orders, various in clustered that colonies undescri studies Recent (BY). yeasts black as to referred often are entirely are or cells budding produce genera Some metals. heavy and cli arid hot, in rocksurfaces on e.g. conditions, adverse habit foundare in species and versatility, ecological complex a Th environments. other extreme fromoligotrophicof or range a grou These system. ant-microbe theof symbionts described newly different in fungi carton these of colonization the shown Figure H.Oya Akyildiz Diplomarbeit TU Wien Presence of dimorphicfungi black in the ant the 23 fungiThe theof both C. bruneiensis (2015&2017) nest.The black fungiare framed. 63 ’s

nest is not a new finding. Several studies have have not studies is a nest Several new finding. mates, in toxic niches with hydrocarbons with niches toxic mates,in ant nests [68]. Black dimorphic fungi dimorphic Black [68]. nests ant g to of Chaetothyriales and recently recently and Chaetothyriales of to g ats characterized by extreme and extreme by characterized ats e members of this group exhibit exhibit group of this e members ps of fungi are mostly known known mostly are fungi of ps bed the black fungi from ant ant from fungi black the bed yeast-like, and therefore and yeast-like,

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. been found in the symbiotic association with ants 6 [67, ants with association the symbiotic been in found as phenolic and aromatic hydrocarbons [84], it has been sug been has it [84], hydrocarbons aromatic and phenolic as bacteria and treeproduce the ofhost diversity a large antimicr new to be appear species to Chaetothyriales of ofMost strains Ch of affiliation taxonomic the as well as association, the of TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien the fungi. [67,the fungi. 85-87] o inside Accumulation nest. the in circulation air no almost selected selected in ant nests because of resistan high their these chemical substances [67, 85, 86] 85, [67, substances chemical these . The nest chamber has few tiny entrances then there is is there then entrances tiny few has chamber nest The 64

ce to xenobiotics 8] . f the nest can be harmful to most of most to harmful be can nest the f However, the nature and the details details the the and nature However, aetothyriales, remained unknown. remained aetothyriales, gested that that gested obial secondary metabolites such secondaryobial metabolites science. Ants, the symbiotic nest nest the symbiotic Ants, science. or their to ability metabolize BY might be naturally naturally be might Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. population of in the species BY 99% than (more nest the in fungi dominant the were species BY such as as such specific. specific. species. Result of this work has shown that the of diversity clades. The inside of inside The clades. phylogenetic analyses, the BY (black yeast) fungi from all t as as a universal barcode and published sequences via NCBI BLAST NCBI via sequences r published ITS The obtained. were sample each of regions ITS the of sequences gene with morphological and anatomical results gave a cl the role of the BY in the nest. the role theof in theBY nest. critical role for the hosted ants, or probably in that case In In this study, Conclusion 2017) we isolated 11 species of black dimorphic fungi belong belong fungi dimorphic black of species 11 isolated we 2017) ( nests tested three all from study, our In in human other toinfection other causing mammals. and fungi sou nutrient diverse fromnutrition derive to ability their Hypoc Sordariomycetes. class the within Hypocreales to belong parsimony analysis was used. A large part of 524 samples samples 524 of part large A used. was analysis parsimony phylogenetic For MAFFT. via aligned were sequences The chosen. were for a correct identification. Therefore, identification. correct fora precisely, plant pathogens such as as such pathogens plant precisely, an Xylariales Hypocreales, orders from species Generally, diverse. The results Theshowed that, results haveleaves huge biodiversity. In trees were according arran phylogenetic and area to their isolated strains The Mucoromycota. and Basidiomycota to belong samples Penicillium In

C. explodens C. 524 fungal fungal strains were examined. As the morphology of fungi alone sp. and sp. C. bruneiensis C. nest, the BY fungi were in minority and seems that the BY the that seems and minority in were fungi BY the nest, tef1 Trichoderma - α C. C. bruneiensis was used for some nests were dominated were nests Fusarium . The reliable reliable The a sp. are abundant. The largest part of the isolated fungi fungi isolated the of part largest The abundant. are sp. molecular analysis method was preferred. ITS was used preferred.was ITS was method analysis molecular C. explodens, C. bruneiensis C. explodens, C. spp., species of high biotechnological applications biotechnological high of species spp., 2017 and were diverse nest contained 12 different re Trichoderma sults were found in GenBank Database and Database GenBank in found were sults the other type of symbiotic bacteria serve rces such as plant materials, insects, or or insects, materials, plant as such rces ested nests were dispersed in different BY species in the ant nests are not ant contrast, contrast, is BY composed of Ascomycota, while 14 14 while Ascomycota, composedof . In . egion was compared with other other with compared was egion o i orders. six to species. Examining and aligning of the cultivated fungi) but the the but fungi) cultivated the of , reales species are notable for for notable are species reales ged. ged. C. bruneiensis C. d Eurotiales dominate. More dominate. Eurotiales d C.explodens assification. DNA sequences were divided into groups groups into divided were 2015 and 2015 inference, maximum maximum inference, In

ants’ nest ants’ nest is le 2015 nest, one nest, 2015 cannot cannot be used h molecular the C. bruneiensis C. don’t have have don’t ss

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. hlgntc analy sho used be phylogenetic to genes of sequences the of reliability the etc), biotechnological potential of potential species studied biotechnological these should b The following studies should also include another region of nest. observed one inside the almost oftype fungi the fung these transfer can ants the and fungi entomopathogenic and Outside partOutside of andforest the nest, soil the plants TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien si s should be performed. On the other hand, researches on the the on researches hand, other the On performed. be should s 66

ph yllosphere are ofyllosphere full different saprotrophic s s for more specific results (f.e. e developed. e developed. uld be assured and different different and assured be uld i to their nest. But we only only we But nest. their to i tef1 , rpb 2 Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 11. 12. 10. 13. 5. 9. 7. 6. 8. 14. 4. 15. 2. 1. References 3. 16. 18. 19. 17. 20. 21. 22. 23. Blackwell, M., Blackwell, McLaughlin, D.J., et al., Hyde, K.D., Hyde, et al., Wu, B., et Wu, B., al., Seifert, K.A., Seifert, Hawksworth, Hawksworth, D.L., Hawksworth, Hawksworth, D.L. and R. Lucking, Baldwin, B.G., et al., Hawksworth, Hawksworth, D.L., Hawksworth, Hawksworth, D., et al., Alexopoulos, C. Alexopoulos, and C. C. Mims, Barr, D.J., Judd, Judd, W.S., et al., Taylor, Taylor, A., Hibbett, Hibbett, D.S., et al., Jones, M.D., Jones, et al., Spatafora, etJ.W., al., McCarthy, C.G. and Fitzpatrick,D.A. Powell, Powell, M.J. and Letcher,P.M. Hebert, Hebert, P.D., et al., Vrijenhoek, R., Vrijenhoek, Xu, J., Xu, Fiser Fiser Pecnikar, and Z. E.V. Buzan, 1992: p. 1- Mycological research, 2001. 17 novel. Sons, New York, USA, 869pp. 83 environmental DNA sequences of fungi. 426 18 Spectr, 2017. angiosperm phylogeny. 212. 2007. genome-scale genome-scale data. and Evolution fungus, fungus, 2011. fungal kingdom fungal Monoblepharidomycota and Neocallimastigomycota 0 Neocall Society of London. B:Series Sciences, 2003.Biological from diverse from metazoandiverse invertebrates. to application. (11):488-497. p. - - 89. 22. -

438. Fungal diversity, 2018. 111 Fungal DNA barcoding.

(5): p. 509-547. Evolution and kingdoms of organisms from the perspective of a 11. Recent advances in our understanding of fungal ecology. Progress towards DNA barcoding of fungi. 5 . . 2014, p. 141-Springer.

Current insights into speciesfungal diversity and perspective on 2 The Fungi: 1, 2, 3… 5.1species? million J Genet,Appl 2014. (4). (4). DNA primers amplification for of mitochondrial cytochrom (2): p. 173-175. , in , Thailand’s amazing diversity: to up 96% northof fungi in Plant systematics The magnitude of fungaldiversity: the 1· 5species est million The fascination of fungi: exploring diversity.fungal Validation and justification of the phylum name Cryptomycot Advances in Advances in genetics Biological identifications DNAthrough barcodes. Mycologia, 2016. A A higher-level phylogenetic classification of the Fungi. The ITS region of ribosomalnuclear DNA: a valuable source o A phylum-levelA phylogenetic classification of zygomycete fungi b Dictionary of the fungi Annals of the Missouri botanical 1995:garden, p. 247- The search the for fungal tree of life. 105 Genome, 2016. Blackwell. Blackwell. M. 1996. 93 6 Chytridiomycota 0 Chytridiomycota, Monoblepharidomyco (1): p. (1): 215- (12): p. 1422- 20 Fungal Diversity Revisited: 2.2 to 3.8Species. Million 55 . . 2002: Sinauer Sunderland. Multiple approaches to phylogenomic reconstruction of the years since theyears introduction of DNA barcoding: from theory (1): p. (1): 43-52. Mol Mar Biotechnol,Biol 1994. 175. 108 Mycology, 2019. . . 2017, Elsevier. p. 211- (5): (5): p. 1028-

239. . . 1995. 1432. 59

(11): 913- p. Introductory 4th Mycology. ed. &John Wiley

American journal of botany, 2011. 1046. 270 Molecular ecology resources, 2009. 10 (1512): p. 313- (3): p. 127-140.

Trends in microbiology, 2009. 932. imastigomycota 266.

Coolia, 2008.

Proceedings of the Royal Mycologist, 1997. 3 (5): p. (5): 294- 321. e c oxidase subunit I mycologist. Mycological research, ern Thailand may be

naming the 277. , in , imate revisited. a a phyl. nov. 51 f evidence on 9. Systematics Systematics

(4): p. (4): 197-

Mycologia, Microbiol ased ased on 11 98 (1): p. (1): (3): p. ta, ta, 0 IMA 9 : p. p. :

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 25. 24. 27. 26. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 28. 29. 30. 32. 31. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 44. 43. 45. 46. Group, C.P.W., et al., Wilson, J.J., Wilson, J.J., Stockinger, H., M. Kruger, and Schussler, A. Rossi-Tamisier, etM., al., Schoch, et al., C.L., Druzhinina, I.S., Druzhinina, etI.S., al., Stielow, J.B., Stielow, et al., Garnica, S., Garnica, etS., al., White, T.J., White, et al., James, James, T.Y., et al., Lutzoni, etF., al., Roger, A.J., Roger, et al., Baldauf, S.L. Baldauf, and Doolittle,W.F. Kopchinskiy, Kopchinskiy, A., et al., Irinyi, L.M., Irinyi, G. Kövics, andKaraffa, E.M. Tsang, Tsang, C.-C., et al., Benson, D.A., et al., Nilsson, R.H., Nilsson, etR.H., al., Nilsson, R.H., Nilsson, etR.H., al., Gould, Gould, K., Wheeler, D.L., Wheeler, etD.L., al., Atanasov, Atanasov, A.G., et al., Strobel, Strobel, G. and B. Daisy, Sciences, 2009. evolutionary microbiology, 2015. identification of human-associated bacterial species. Phytol, 2010.Phytol, barcode markerbarcode Fungi.for 6241 Hypocrea. Fungi, 2015.Fungi, potentialfor secondary fungal DNA barcodes. (Basidiomycota), a highly diverse widespreadand ectomycorrhiza ecology, 2016.ecology, phylogenetics. description of a new phylum (Blastocladiomycota). subcellular traits. eukaryotes. Proceedings of the National Academy of Sciences, 1997. identifications. marker. omics omics era fungal perspective.fungal Nucleic Nucleic acids research, 2006. Source code for andbiology 2009. medicine, Chemotherapy, 2016. products: A review. Microbiol. Mol. Mol. Microbiol. Biol. Rev., 2003. -6246. -6246.

2006. – Fungal Genet 2005. Biol, Antibiotics: from prehistory to the present day. past, present and future. Molecular biology and evolution, 1999. DNA barcodes insects.for 35 187

PCR protocols: a to guide methods applications, and1990. Mycological research, 2005. 92 : p. 242. 106 American journal of botany, 2004. (2): p. (2):p. 461-74. (4). (4). Assembling the fungal tree of progress, life: classification, and Amplification and direct sequencing ribosomalof fungal RNA g An evaluationAn of elongation factor 1 as alpha a phylogen Determining threshold values barcodingfor fungi: from lessons A A molecular phylogeny of the flagellated fungi (Chytridiomyco Taxonomy Taxonomy and evolution of Aspergillus, Penicillium and Ta PloS one, 2006. Nuclear ribosomalNuclear internal transcribed spacer (ITS) region a as Biotechnology advances, 2015. One One fungus, which genes? Development assessment and of universal p (31): (31): p. 12794-12797. Taxonomic reliability of DNA sequences public in sequence databases A A software pipeline processingfor identificationand of fungal GenBank. Database resources of the national center for biotechnology infor A A DNA barcode landfor plants. Discovery and resupply of pharmacologically plant-d active 71 An oligonucleotide barcode speciesfor identification Tricho in TrichoBLAST: databasea multilocus Trichodermafor and Hyp Bioprospecting microbialfor endophytes and naturaltheir (3): p. (3): 572- Cautionary Cautionary tale of using 16S gene rRNA sequence similarity va Proceedings of the National Academy of Sciences, 2012. 35 Nucleic acids research, 2003. (suppl_1): p. D5- Origin and evolution of(Mycetozoa). molds the slime 67 65 (4): p. 491- 1 Computational and Structural Biotechnology 2018. Journal, 42 575. (6): p. (6): 1929- (1): p. e59. Methods 2012.Mol Biol, (10): p. 813- Classification of species Phoma using phylogeneticnew

68 DNA barcoding of arbuscular mycorrhizal fungi. 109 4 Persoonia: Molecular and Phylogeny Evolution o

502. (1): p. 1. (1): p. 1. (6): p. 658- p. (6): 1934. D12. 28.

Mycologia, 2006. 33 16 Proceedings of the National Academy of International journal of systematic and 91

(8): p. 1582-1614.

(2): p. 218- (1 94 Journal of Antimicrobial 0): p. 1446-1480. 660. (22): p. 12007-12012. 31 (1): p. 23. p. (1): 23.

858 l l genus. 233. : p. 17-46. : 98

(6): p. 860- FEMS microbiology 18 etic marker for (1): p. 315-322. laromyces the in evolution of ta) and enes for erived natural Cortinarius ITS ITS sequences. universal DNA 871. products. 109 ocrea ocrea derma and

mation.

(16): (16): p. lues lues in : a rimers New

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 47. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit 48. TU Wien 49. 63. 50. 51. 52. 53. 62 64. 61. 65. 55. 54. 56. 66. 58. 57. 59. 67. 60. 68. 69. 70. . Slik, Slik, J.F., et al., . Aly, A., A. Aly, Debbab,A., A. and C. Chaidir, Hiestand, P.C., Hiestand, et al., An, Z., An, Davidson, Davidson, D. and L. Patrell-Kim, Keller, N.P., Keller, Organization, W.H., Foster, J.W., Nimchua, T., Nimchua, D.E. Eveleigh, and H. Punnapayak,

Slik, Slik, J., et al., Weiss, M.R., Schueffler, A. Schueffler, andA. T. Anke, S., Chen, et al., Higginbotham, S.J., et al., Defossez, E., Defossez, etE., al., Kamiya, Kamiya, K., et al., Clay, Clay, K., Pio, D. and Pio, R. D'Cruz, Teixeira, M.d.M., et al., Primack, R.B. Primack, and R.B. Hall,P. Voglmayr, Voglmayr, H., et al., Davidson, D., Davidson, D., Kamariah,A.S. and Billen,J. Maschwitz, andMaschwitz, U. E. 2011. 83 mechanism of action cyclosporine.for reviews. reviews. Microbiology, 2019. Geneva: World Health Organization. Biogeography, 2003. Borneo. microbiology & biotechnology, 2008. polyethylene terephthalate-hydrolyzing enzyme fabric for mod T. Ants of Ants of Amazonian Ecuador 1992. 2013. of of trees provide insight the on conservation and management of product 2014.reports, and the taxonomyand and distribution of their host plants. Ecology, 1988. (Dipterocarpaceae), the dominant treesSoutheast in Asian tropi 942 92 Indonesia, Jakarta,Indonesia, 2005. (Chaetothyriales, Ascomycota). world of world symbiotic interactions. Borneo’s ‘exploding ants’ sozialen Hautflüglern. Ryder Wilkie,A. K., Mertl, and Traniello,J. (8): p. 2599-2603. (5): p. 775- - 9. 50 42 31

Handbook of industrial mycology Diversity and Distributions, 2009. Fungal endophytes of grasses: mutualisma defensive between plants (11): p. 829-837. (11): p. 829-837. (8): (8): p. 1754-1767. : p. 3-19. Fungal secondary metabolism: regulation,d function and drug Chemical activities of fungi. Defecation behavior and ecology of insects. A A floristic analysis of the lowland dipterocarp forests of Born 88. 69 Environmental correlates for treetropical diversity and dist Cutinase: characteristics, preparation, application.and

(1): p. (1): 10-16. Phylogeny of PgiC gene Shoreain and its related closely gen Ant WHO WHO global strategy for containment of antimicrobial resistance The diversity of ant-associated black yeasts: insights a into 30 Prolactin a as modulator of responsivenesslymphocyte provide WWF: Borneo's Lost World: Newly Discovered SpeciesBorneo. on Oecologia, 1974. -plants fungi: and a threewaynew symbiosis. 31 (10): p. 1517- Exploring Exploring the genomic diversity yeasts of black and relatives . Biodiversity and Forest Change Malaysianin BorneoLong-term stu (10): (10): p. 1425-1448. Bioactivity of fungal endophytes a as function of endophyte taxo Vol. 93.Vol. 2011. Fungal productsnatural research in and development. . Vol. . 5. Vol. 2010. 17 Studies in mycology, 2017. Fungal Biology, 2011. (3): p. 167- Tropical arboreal ants: so Why abundant? Platzende Arbeiterinnen: ArtEine neue Feindabwehrder bei Fifty years of drug discovery from fungi. 1531. 35 Proceedings of National the Academy of Sciences, 1986. 14 . . 2004: Press. CRC (8): p. (8): 843. Chemical activities of fungi., 1949. Histology Histology of structures inused territorial combat by 15 (3): p. 289-294.

180. 69 (3): p. 523- Species Diversity and Distribution Patterns of the

Screening of tropical fungi producing 115 PloS one, 2013. 532. Annu Rev Entomol, 2006. (10): (10): p. 1077- 86

: p. 1-: ification. cal raincal forests. Asian rainforests.Asian 28. New Phytol, 2009. Biotechnology advances,

1091. Journal of industrial 8 (9): p. (9): e73192. eo. ribution patterns in Fungal Diversity,

1996. iscovery. Journal of

era and and fungi. newly discovered Am J Bot,J Am 2005.

Natural BioScience, 51 Nature s a possible s a possible . . 2001, : p. 635-: WWF 182

nomy (4): p. (4): dies dies 61.

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. 72. 71. TU Wien Diplomarbeit H.Oya H.Oya Akyildiz Diplomarbeit TU Wien 73. 77. 74. 79. 78. 75. 76. 80. 82. 81. 84. 83. 86. 85. 87. Davidson, Davidson, D.W., et al., Jones, T.H., Jones, et al., Laciny, Laciny, A., et al., Vorholt, J.A., Vorholt, J.A., Smolik, M., Smolik, etM., al., Bamisile, B.S., et al., Jaklitsch, W.M., et al., Zheng, L., Zheng, etL., al., Suryanarayanan, T., et al., Dastogeer, K.M., et al., B.K., Whitaker, Reynolds,H.L. and Clay,K. Berasategui, A., et al., Liu, J., et al., Zhao, J., Zhao, et al., etT., Jones, al., Deng, Deng, Y. and S. Lu, Journal Journal of Chemical Ecology, 2004. 2007. Colobopsis cylindrica group. (Hymenoptera, Formicidae), with biological notes and first ill 2017. between between microbial individuals and the plant host. Remus‐Emsermann, M.N. and R.O. Schlechter, 828. Puccinia striiformisPuccinia f. sp. tritici, the causal agent of whea Notulae Botanicae Horti Agrobotanici Cluj-Napoca, 2011. microbiology, microbiology, 2018. phylogenetic clade Hypocrea/Trichoderma.in 23 p. p. 2703-2711. Ficus. arid regions of Northern Australia. environmentby but not host ecotype in Panicum virgatum (s microbiology and biotechnology, 2016. of chemical 2004.ecology, monoaromatic hydrocarbons. 34. (1

-2):9- p. Ecology and Evolution, 2019. 39 8 : p. 71. p. 71. : (4): (4): p. 468- Host identity and phylogeny the foliarshape endophytic fung 19. Microbial life the in phyllosphere. Isolation Isolation and identification of black yeasts enrichment by on The chemistry of exploding ants, Camponotus spp.(cylindricus compl

Identification of a novel Alternaria alternata strain a Colobopsis explodens sp. n., model species studiesfor on “exploding rDNA variability assessed in PCR reactions of selected accessions of The Chemistry of Exploding CamponotusAnts, SPP. (Cylindricus Biosynthesis Biosynthesis and Regulation of Phenylpropanoids in Plants 475. 9 Fungal endophytes:Fungal beyond herbivore management. : p. 544. Potential Potential applications of insect symbionts in biotechnology. Hypocrea voglmayrii sp. fromnov. the Alps represents Austrian The Tropical The Tropical Ant Mosaic a Primaryin Bornean Rain Forest. Host Host specificity of endophytic mycobiota of wild Nicotiana pl

Fungal endophytes and bioprospecting. 30 ZooKeys, 2018. (8): p. 1479-1492. Microb 2010.Ecol, Microbial ecology, 2018. 30 (8): p. (8): 1479-1492. 100 Foliar fungalFoliar communitiesendophyte structuredare 70 (4): p. (4): 1567- 751 Mycologia, 2005.

Nature Reviews Microbiology, 2012. Phyllosphere Phyllosphere microbiology: at the interface . . New Phytologist, 2018. 60 (1): (1): p. 149- 1577. t rust.stripe 39 75 (1): p. (1):p. 260-266. witchgrass). ustrations of males of the

(1): p. (1): 74-87. 56. 97 Fungal biology reviews, 2009.

(6): p. (6): 1365-1378. ble to ble hyperparasitize Frontiers in microbiology, Ecology, 2018. Frontiers in 218 al assemblagesal of atmospheres of . . Vol. 36. 2017. 1- (4): (4): p. 1327-1333. Biotropica, COMPLEX). Applied ants from ex). 10 ants” Acer. a a new (12): (12): p. Journal 99

(12):

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. The approved original version of this thesis is available in print at TU Wien Bibliothek. ♀ Vitae Curriculum Thesis: “Alkylation of Active Methylene Compounds in Acidic Mediu Istanbul Technical ChemistryUniversity- Bachelor Scienceof (2009-2014) Vienna Vienna Technology University-Technical Chemistry Master Scienceof (2016- 2019) Tennis, Piano,Tennis, Travelling, Puzzles Interests English (Advanced), Deutsch (B2), Turkish Russian(native), (Beginner) Language Biofarma Pharmaceuticals Quality Control Intern June 2012 Pharma Era Solutions Quality Control Intern June 2013 Bayer Bayer Production Intern July 2013 Istanbul University/ Fundamental and Industrial Microbiology Laborat Microbiology Intern 2017 Summer Technische ResearchWien/ Universität Group forand Microbiology Applied Microbiology Intern April 20 SaffetMustafa Anatolian High School (2005-2009) “Microbial community in the high canopy theof Bornean tropical

20.06.1991 Turkey [email protected] Albertplatz 5/2/1 1080 Vienna OyaH. Akyıldız – Pharmaceuticals

17 -April 20-April

– Biotechnology and Bioanalytic rainforest: molecular diversity” m” ory Intern ory Intern

Genomics Genomics Work experience experience Work Qualifications Qualifications Education Education

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5643 CIM TU 5642 CIM TU 5640 CIM TU 5571 CIM TU 5570 CIM TU 5569 CIM TU 5502 CIM TU 5501 CIM TU 5505 CIM TU 5500 CIM TU 5497 CIM TU 5488 CIM TU 5844 CIM TU 6073 CIM TU 6066 CIM TU 6002 CIM TU 5984 CIM TU 5983 CIM TU 5978 CIM TU 5960 CIM TU 5957 CIM TU 5954 CIM TU 5949 CIM TU 6171 CIM TU 6168 CIM TU 6100 CIM TU 5630 CIM TU 5628 CIM TU 5492 CIM TU 7010 CIM TU 7018 CIM TU 7024 CIM TU 7023 CIM TU 6208 CIM TU 6241 CIM TU 5790 CIM TU 5789 CIM TU 5775 CIM TU 5791 CIM TU 5778 CIM TU 5805 CIM TU 5800 CIM TU 5782 CIM TU TU CIM 5746 CIM TU 5745 CIM TU 5744 CIM TU 5649 CIM TU

The approved original version of this thesis is available in print at TU Wien Sample Bibliothek.

ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2

Mark

SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R

tahet1 1 Attachment

Primers

TACATTC ATTACCGAGTTTAC ATTACCGAGTTTAC CCGAGTTTACAACT TTACCGAGTTTACA ACCGAGTTTACAAC AACTCCCAAACCCA TACCGAGTTTACAA TTACCGAGTTTACA CAACTCCCAAACCCCAA TTACCGAGTTTACA ATTACCGAGTTTAC CCGAGTTTACAACT ATTACCGAGTTTAC ATTACCGAGTTTAC CATTACCGAGTTTACAACTCCCAAACCCAATG CCGAGTTTACAACT ACGAGTTATACAAC ATTACCGAGTTTAC ATTACCGAGTTTAC CAACTCCCAAACCCTTTG NCATTACCGAGTTT TTACCGAGTTTACA ATTACCGAGTTTAC CCAAACCCTTTGTG CCGAGTTTACNACT TTACCGAGTTTACA TTACCGAGTTTACA CATTACCGAGTTCTTG TCCCCGCCCCGGCG TTACCGAGTTTACA CAACTCCCAAACCCTTTG ATTATCGAGTTCTA TTACCGAGTTTACA TTAGTGAATTGCTC TTAGTGAATTGCTC NCATTAGTGATTGC TGTTGCTCTGCAAC NNTAATTTGAGTAT ATTAGTGATATAGG CATTATCGAGTTTTG AACGGGTTGTAGCT TTGAATGAACTTGG CAAGTTCATCTTGTT TAACGAATCAAACA ATTATTGAATAAAT CATTATTGAATAAATCTG ATTATTGAATAAAT

Sequenc

length, length,

581 581 577 580 582 582 602 579 599 593 579 580 603 608 597 591 587 568 573 554 569 569 567 599 570 558 561 582 506 624 564 563 581 518 507 520 454 619 853 631 607 688 605 617 677 678 669

Trichoderma Trichoderma Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Cryptococcus Rhodotorula Hypholoma Hypholoma Hypholoma

Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma harzianum Trichoderma aggregatum Trichoderma koningiopsis Trichoderma sinuosum Trichoderma harzianum Trichoderma strigosum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Simplicillium lamellicola Ijuhya corynospora Ijuhya corynospora Stromatonectria caraganae Stromatonectria caraganae Ovicillium subglobosum Stromatonectria caraganae Trichosporon dermatis Trichosporon dermatis Trichosporon dermatis Mucor irregularis Phlebia acerina Phlebia acerina mutabilisKuehneromyces Schizophyllum commune Schizophyllum commune

p ohnas.Hypocreales sp. Pochonia Hypocreales sp. Pochonia Hypocreales sp. Pochonia Hypocreales sp. Pochonia Hypocreales sp. Pochonia Hypocreales sp. Pochonia Hypocreales sp. sp. Pochonia Hypocreales sp. sp. Pochonia Hypocreales sp. sp. Pochonia Hypocreales sp. sp. Pochonia sp. sp. sp. sp. sp. sp.

pce Genus Species

s.HpooaAgaricales Hypholoma Agaricales Hypholoma Agaricales Hypholoma sp. sp. sp.

s.Rhodotorula sp.

p rcoem Hypocreales Trichoderma sp. sp

p rpoocsTremellales Cryptococcus sp.

Putative identificationPutative

Stromatonectria Stromatonectria Stromatonectria Cutaneotrichos Cutaneotrichos Cutaneotrichos Kuehneromyces Schizophyllum Schizophyllum

rcoem Hypocreales Trichoderma

Hypocreales Hypocreales Hypocreales Trichosporonales Trichosporonales Trichosporonales Sporidiobolales Agaricales Agaricales Agaricales

Order Class Taxon name Strain ID Strain name Taxon Class Order

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Tremellomycetes Tremellomycetes Tremellomycetes Tremellomycetes Mucoromycetes Microbotryomyc Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes Agaricomycetes

Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma koningiopsis Trichoderma Trichoderma harzianum Trichoderma aggregatum Trichoderma koningiopsis Trichoderma sinuosum Trichoderma harzianum Trichoderma Trichoderma strigosum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Simplicillium lamellicola Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Pochonia Ijuhya corynospora Ijuhya corynospora Stromatonectria caraganae Stromatonectria caraganae Ovicillium subglobosum Stromatonectria caraganae Trichosporon dermatis Trichosporon dermatis Trichosporon dermatis Cryptococcus Mucor irregularis Rhodotorula Phlebia acerina Phlebia acerina mutabilisKuehneromyces Schizophyllum commune Schizophyllum commune Hypholoma fasciculare Hypholoma fasciculare Hypholoma fasciculare

sp. CBS 892.72 CBS 892.72 CBS 892.72 CBS 892.72 CBS 892.72 CBS 892.72 CBS 892.72 CBS sp. 892.72 CBS sp. 892.72 CBS sp. 892.72 CBS sp. sp. sp. sp. sp. sp. sp.

s.Y1DQ186608 Y11 sp.

p 7BO21 F654 9.7 0 99.17% KF367564 17 BRO-2013 sp. sp

p TMS-2011 sp.

AM243 U814 91%0 99.13% EU280114 234231 DAOM

AM214 U817 9.8 0 99.48% EU280117 231245 DAOM

MS286 R148 9.9 0 98.29% NR_154582 248863 HMAS

CS438 U827 9.8 0 98.58% KU382207 CBS_403.89

TC256H823 89%0 0 98.90% HM802130 20566 ATCC HM802130 99.42% 20566 ATCC HM802130 20566 ATCC

B 259H128 8.2 6e-172 2e-167 85.62% HQ112288 86.13% 125579 CBS HQ112288 125579 CBS HQ112288 125579 CBS

...21 J680 96%0 99.66% FJ860840 2011 C.P.K.

B 5.0M899 96%0 99.65% MH859793 454.70 CBS 79% 4e-163 1e-144 85.62% 90.44% KY607539 342.77 CBS KY607539 342.77 CBS 0 95.92% MH855190 209.31 CBS

PXF1 R994 9.3 0 0 0 0 99.83% KR296904 99.83% KR296904SPXX-FS18 99.83% KR296904SPXX-FS18 99.83% KR296904SPXX-FS18 SPXX-FS18 KR296904 SPXX-FS18 0 0 99.83% KX958030 99.51% KX958030 15R-5-F01 15R-5-F01

P 66F422 93%0 0 99.31% FJ412026 CPK 2616 99.66% FJ412026 CPK 2616

BC4 N1039.0 0 0 99.20% 99.01% LN611083 LN611083 FBCC345 FBCC345

C32 F401 9.6 0 0 0,00E+00 98.96% 98.82% FJ430716 98.95% FJ430716 CCF3827 FJ430716 CCF3827 CCF3827

e-4K900 98%0 99.83% KX960805 Cef-B4

V6 P664 96%09% 2 97% 0 0 99.66% KP263604 99.66% KP263604 TV96 TV96

5012

IDENTIFICATION

KM231844 KM231844 KM231844 KM231844 KM231844 KM231844 KM231844 KM231844 KM231844 KM231844 HQ631024

G3389.6 0 99.66% MG738308 0 98.51% HM639972

Accession Accession

Number

GB GB

77%6,00E-177 3,00E-179 9,00E-170 1,00E-178 87.79% 3,00E-179 87.67% 6,00E-177 87.50% 1e-154 87.61% 8e-1518 87.65% 6e-177 87.79% 7e-176 84.85% 3.42% 87.79% 87.74% 0 98.65%

99% 100%

100%

Similarity, % E-value Coverage, % Coverage, E-value % Similarity,

99%

e14 86.39% 3e-174

100%

0%85 68 100% 100%

100%

0%81 100%

97%

98% 98% 98%

99%

8 69 71 69 71 98% 71 99% 69 98% 99% 95 99% 98% 69 99% 99% 97%

98%

99% 96%

97% 85 99% 99% 28 98% 99% 99% 99% 99% 99% 99% 99%

99% 6 10 96%

98% 99% 87%

99%

99% 99%

5 88 95%

Number of of Number

SNPs

2 Jaklitsch,W.M 2009 Jaklitsch,W.M 2

1 Gujjari et al 2011 et al Gujjari 2011 et al Gujjari 1 3 2

5 Guatemala 5

1 Shrestha et al 2011 et al Shrestha 1

Mexico 3 2

2 soil India Sharma et al 2018 et al Sharma India soil 2 2011 et al Wang 9 0 soil Singapore Ottenheim et al 2015 et al Ottenheim Singapore soil 0

2 USA: Georgia Vu et al 2019 Vu et al Georgia USA: 2 2011 et al Gujjari 0 1 soil Singapore Ottenheim et al 2015 et al Ottenheim 2015 et al Ottenheim Singapore 2015 et al Ottenheim Singapore 2015 et al Ottenheim Singapore Singapore soil 1 soil 1 soil 1 soil 1 2016 Shan,T China 1 1 3

4 2010 et al Hujslova 7

5 Kuuskeri et al 2015 et al Kuuskeri 2015 et al Kuuskeri 5 6 7 Forest soil Zare et al 2016et al Zare soil Forest 7

0 Yuan et al 2005 et al Yuan 0

7 Hujslova et al 2010 et al Hujslova 2010 et al Hujslova 7 8

nrae rn drin untreated rh plant coffee rh plant coffee Phormium tenax Phormium tenax below sediment below sediment

Arcyria sp. Arcyria sp. Arcyria

Arcyria sp. Arcyria sp. Arcyria sp. Arcyria sp. Arcyria sp. Arcyria sp. Arcyria sp. Arcyria sp. Arcyria

Colutea arborescens

Substrate

Portugal Oliveira et al 2013 et al Oliveira 2010 et al Mulaw Portugal Ethiopia 2010 et al Mulaw Ethiopia Bar Venezuela: Bar Venezuela: 2017 et al Ashrafi Zealand New 2017 et al Ashrafi Zealand New Shimoki Japan: Shimoki Japan:

Netherlands Lombard et al 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands

Netherlands Lombard et al 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands 2015 et al Lombard Netherlands

Biogeograph

ic region

Vu et al 2019Vu et al

Jaklitsch et al 2010 et al Jaklitsch

Robbertse et al 2017et al Robbertse

Jaklitsch et al 2010 et al Jaklitsch

Hoyos-Carvajal et al 2010 et al Hoyos-Carvajal 2009 et al Hoyos-Carvajal 2015et al Pavone 2015et al Pavone 2016 etLiu al 2016 etLiu al

Jaklitsch et al 2011 et al Jaklitsch

References Ref Sequence Ref References

CTGCGGAGGGATCATTA CTGCGGAGGGATCATTA CTGCGGAGGGATCATTA CTGCGGAGGGATCATTA ACTCGGTCATTTAGAGG GACATTACCGAGTTTACA CCGAGTTTACAACTCCCA CTGCGGAGGGATCATTA CATTACCGAGTTTACAAC GACATTACCGAGTTTACA TGGAAGTAAAAGTCGTA TGGAAGTAAAAGTCGTA TTGGTGACCAGCGGAGG TTGGTGACCAGCGGAGG GGAAGTAAAAGTCGTAA CTTCCGTAGGTGAACCTG AACAAGGTCTCCGTTGG CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT GTACACACCGCCCGTCG GTACACACCGCCCGTCG CTACTACCGATTGAATGG CTACTACCGATTGAATGG ACGAGGATACTTATCGA CTACTACCGATTGAATGG GTTTCCGTAGGTGAACCT GTTTCCGTAGGTGAACCT GTTTCCGTAGGTGAACCT TCTTGGTCATTTAGAGGA GAAAAAAGTTTGAGTTG ATCATTAGTGATATAGG AAGGATCATTATCGAGTT AAGGATCATTATCGAGTT AACAAGGTTTCCGTAGG ACGAATCAAACAAGTTC ACGAATCAAACAAGTTC GAACCTGCGGAAGGATC GAACCTGCGGAAGGATC GAACCTGCGGAAGGATC Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar. TU CIM 6178 CIM TU 6177 CIM TU 6165 CIM TU 6099 CIM TU 6098 CIM TU 6097 CIM TU 5633 CIM TU 6317 CIM TU 6308 CIM TU 6290 CIM TU 6092 CIM TU 6091 CIM TU 5846 CIM TU 5765 CIM TU 5629 CIM TU 5493 CIM TU 5490 CIM TU 6309 CIM TU 7006 CIM TU 7004 CIM TU 6981 CIM TU 6980 CIM TU 6979 CIM TU 6975 CIM TU 6230 CIM TU 6191 CIM TU 6297 CIM TU 6174 CIM TU 6072 CIM TU 6063 CIM TU 6059 CIM TU 6050 CIM TU 6058 CIM TU 6048 CIM TU 6042 CIM TU 6041 CIM TU 6044 CIM TU 6039 CIM TU 6049 CIM TU 6036 CIM TU 6013 CIM TU 6033 CIM TU 6273 CIM TU 6051 CIM TU 6011 CIM TU 6005 CIM TU 6003 CIM TU 5747 CIM TU TU CIM 6169 CIM TU 6102 CIM TU The approved original version of this thesis is available in print at TU Wien Bibliothek. ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2

TU Wien SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R TACATAC ATTACCGAGTTATC NCATTACCGAGTTT CATTACCGAGTTTTCACTCCCAAACCCCTG CATTACCGAGTTTTCTG CCGAGTTTTCTGAC NCATTACCGAGTTT GNNATTACCGAGTT TGTGAACATACCTC CAAACTCCAAACCA CAAACTCCAAACCA CATTATAGAGTCTTCTG CATTATAGAGTTACAAACTCCAAACCACTG TTATAGAGTTACAA ACAAACTCCAAACC CAAACTCCCAACCCTTTG CATTACCGAGTTTACACAAACTCCCAACCCTTTG TTATCGAGTTATTCA CACAAACTCCCAACCCTTTG NCATTACCGAGTTT TTACCGAGTTTACA CATTACCGAGTTTACAACW TTACCGAGTTTACA TCATTACCGAGTTTA TACCGAGTTTACAA ATTACCGAGTTTAC TTACCGAGTTTACA TTACTGAGTGTTAA ATTACCGAGTTTAC CAACTCCCAAACCCAA TACCGAGTTTACAA AACTCCCAAACCCA CATTACCGAGTTTACAACTCCCAAACCCAATG ACAACTCCCAAACC ACTCCCAAACCCAA CATTACCGAGTTTACAACTCCCAAACCCAATG ANGGTGAACCATAC GASSAACCAAAACT ACAACTCCCAAACC GTCATTACCGAGTT TTACCGAGTTTACA ACCGAGTTTACAAC NCATTACCGAGTTT ACTCCCAAACCCAA TTACCGAGTTTACA CAACTCCCAAACCCAA CAACTCCCAAACCCAA CAACTCCCAAACCCAA ATTACCGAGTTTAC CAACTCCCAAACCCAA ATTACCGAGTTTAC 560 561 569 613 425 580 621 512 513 513 527 520 521 513 558 582 551 561 577 584 589 609 607 593 610 609 551 595 581 587 593 159 588 594 600 375 502 595 610 606 597 612 589 602 595 590 591 148 593 581 Hypocreales Hypocreales Tolypocladium Trichoderma Trichoderma Trichoderma Acremonium Trichoderma Trichoderma Trichoderma Tolypocladium inflatum Tolypocladium inflatum Tolypocladium inflatum Unclear Metarhizium anisopliae Unclear Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Trichothecium ovalisporum Trichothecium ovalisporum Leptobacillium leptobactrum Trichothecium ovalisporum Trichothecium ovalisporum Trichothecium ovalisporum Trichoderma hamatum Trichoderma virens Trichoderma harzianum Trichoderma harzianum Trichoderma virens Trichoderma virens Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma atroviride Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma koningiopsis s.Tihdra Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma sp. sp. sp. Hypocreales Trichoderma sp. Hypocreales Trichoderma Hypocreales Trichoderma sp. sp. p Hypocreales sp. p ceoimHypocreales Acremonium sp. sp. eahzu Hypocreales Metarhizium Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Leptobacillium Trichothecium Trichothecium Trichothecium Tolypocladium Tolypocladium Tolypocladium Tolypocladium Tolypocladium Leucosphaerina Leucosphaerina Leucosphaerina Leucosphaerina Leucosphaerina Leucosphaerina Trichothecium Trichothecium Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Trichoderma harzianum Trichoderma harzianum Trichoderma Trichoderma harzianum Trichoderma koningiopsis Tolypocladium inflatum Tolypocladium inflatum Tolypocladium inflatum Metarhizium anisopliae Hypocreales Tolypocladium Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Leucosphaerina arxii Trichothecium ovalisporum Trichothecium ovalisporum Leptobacillium leptobactrum Trichothecium ovalisporum Trichothecium ovalisporum Trichothecium ovalisporum Trichoderma hamatum Trichoderma Trichoderma virens Trichoderma Trichoderma Trichoderma harzianum Acremonium Trichoderma harzianum Trichoderma virens Trichoderma virens Trichoderma Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma atroviride Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma harzianum Trichoderma Diplomarbeit s.C80K723 78%2-1 53 95% 2e-61 97.89% KU702333 CK850 sp. s.A-03K763 95%0 0 0 0 99.50% KF746133 99.33% AE-2013 KF746133 99.01% 0 KF746133 AE-2013 91.02% KM215633 AE-2013 G246 sp. 98.46% sp. KF367525 sp. BRO-2013 sp. sp. GQ497168 SQR037 sp. sp. s.D3 Y335 63%0 96.32% KY432335 DS35 sp. 73

B1b0852P152CC66 PANM200T9ZM1D PANM200T9ZM1D PANM200T9ZM1D AM164 R112 9.5 0 0 0 0 0 95.25% NR_111321 186447 DAOM 94.87% NR_111321 186447 DAOM 95.25% NR_111321 186447 DAOM 94.87% NR_111321 186447 DAOM 94.85% NR_111321 186447 DAOM U -05A873 94%0 99.49% AY857234 F-1005 TUB B 3.4N_400 8.4 0 5,00E-172 4e-172 88.40% NR_145040 4e-173 88.40% 737.84 CBS NR_145040 0 1e-173 89.34% 737.84 CBS NR_145040 2e-171 88.22% 737.84 CBS NR_145040 88.13% 737.84 CBS NR_145040 88.38% 737.84 CBS NR_145040 737.84 CBS 20 Vu et al 99.63% Switzerland EF641867 748.73 CBS 0 96% 2e-72 100.00% MH860095 243.71 CBS IXF2 R9879.3 0 99.33% KR296867 0 JIXX-FM26 99.83% KR296867 JIXX-FM26 U -3 Y528 94%0 0 99.49% AY857228 99.83% KR296904 F-834 TUB SPXX-FS18 U -4 F944 73%0 97.33% EF593404 F-947 TUB P 66F422 96%0 0 99.66% 99.66% FJ412026 FJ412026 CPK 2616 CPK 2616 P 66F422 94%0 99.49% 0 FJ412026 CPK 2616 0 0 99.49% 0 0 FJ412026 CPK 2616 0 99.32% 0 99.50% FJ412026 99.67% FJ412026 CPK 2616 99.16% FJ412026 CPK 2616 FJ412026 CPK 2616 99.66% FJ412026 CPK 2616 99.67% FJ412026 CPK 2616 FJ412026 CPK 2616 CPK 2616 aD8M430 71% 7,00E-65 87.19% MH483706 MaGD58 TM3E812 9.3 0 99.83% EU871021 3TSMC3 KR868399 ZNAF13 TM U708 96%0 99.67% EU871018 3TSM2 R3 Q009 98%0 TR090 99.83% HQ608079 TR039 F900 58%0 0 0 95.88% 99.10% JF796050 99.10% JF796050 1,00E-88 JF796050 81.50% JQ411375 HQ608116 80%0 98.09% 100% 100% 99% 0 0 0 0%50 100% 100% 100% 0%19 100% 0%64 100% 8 23 98% 98% 97% 79 67% 9 61 61 58 63 99% 99% 61 99% 99% 99% 97% 7 26 47% 99% 7 11 97% 99% 99% 98% 98% 97% 99% 99% 99% 99% 98% 98% 98% 99% 99% 99% 99% 99% 99% 7 13 97% 98% 98% 6 29 29 26 96% 29 96% 29 96% 96% 96% 97% 99% 5 5 2 4 3 Druzhinina et al 2005 et al Druzhinina 3 0 3 6 9 6 0 Yang et al 2011 et al Yang 0 2 2 2 Zachow et al 2009 et al Zachow 2 3 3 4 3 2 5 2 2 3 Druzhinina et al 2005 et al Druzhinina 2015 et al Ottenheim Singapore 3 soil 1 1 Zachow et al 2009 et al Zachow 1 1 1 1 Haliclona Haliclona Haliclona marine sponge lepidopter living s Trachymyrmex Bradypus varieg sur mushroom Bradypus varieg Bradypus varieg rh plant coffee s Trachymyrmex sur mushroom drin untreated rh plant coffee fo Aquaculture rh plant coffee rh plant coffee rh plant coffee rh plant coffee rh plant coffee rh plant coffee rh plant coffee rh plant coffee rh plant coffee with baiting soil milk thistle Raja et al 2015 et al Raja thistle milk roots Wang et al 2017 et al Wang roots Megachile rotundata Megachile rotundata Megachile rotundata Megachile rotundata Megachile rotundata sp. sp. sp. Panama Bolanos et al 2015 et al Bolanos Panama 2008et al Zare Ghana 2011 et al Rodrigues 2014 et al Higginbotham Texas USA: 2015 et al Ottenheim Panama 2014 et al Higginbotham Singapore 2014 et al Higginbotham Panama Panama 2011 et al Mulaw Ethiopia 2011 et al Rodrigues 2015 et al Ottenheim Texas USA: 2013 et al Oliveira Singapore Portugal 2011 et al Mulaw Ethiopia China 2011 et al Mulaw 2011 et al Mulaw Ethiopia 2011 et al Mulaw Ethiopia 2011 et al Mulaw Ethiopia 2011 et al Mulaw Ethiopia 2011 et al Mulaw Ethiopia 2011 et al Mulaw Ethiopia Ethiopia 2011 et al Mulaw 2010 et al Mulaw Ethiopia Ethiopia Car North USA: USA Giraldo et al 2012 et al Giraldo 2012 et al Giraldo 2012 et al Giraldo 2012 et al Giraldo USA USA 2012 et al Giraldo USA USA USA China Niu et al 2019 et Niu al China USA Giraldo et al 2012 et al Giraldo USA aalr-eree l21 201 et al Caballero-George 201 et al Caballero-George 201 et al Caballero-George 2016 et al Saravanakumar 2016et al Hesse Schoch et al 2014 et al Schoch 2014 et al Schoch 2014 et al Schoch 2014 et al Schoch 2014 et al Schoch Nagy et al 2007Nagy et al H.Oya H.Oya Akyildiz 19 ATTACCGAGTTTTCACTC ATTACCGAGTTTTCACTC ATTACCGAGTTTTCACTC GGGGAATCGGTTCCACT CTCCCAAACCCCTGTGAA TGCGGTAGTTACTCCTCC TTATAGAGTCTTCTGAAC TTATAGAGTCTTCTGAAC TTATAGAGTCTTCTGAAC TTATAGAGTCTTCTGAAC TTATAGAGTCTTCTGAAC TTATAGAGTCTTCTGAAC TCTCCGTTGGTGAACCAG TCTCCGTTGGTGAACCAG ACGGGATATTATCGAGT TCTCCGTTGGTGAACCAG TCTCCGTTGGTGAACCAG TCTCCGTTGGTGAACCAG GGAAGTAAAAGTCGTAA TTACCGAGTTTACAACTC CTGCGGAGGGATCATTA TTACCGAGTTTACAACTC TTACCGAGTTTACAACTC GGGACATTACCGAGTTT TTAACTCAGAACAGGTA GACATTACCGAGTTTACA GGAAGTAAAAGTCGTAA CTGCGGAGGGATCATTA GGGCAACTACCACTCAG ACACCGGAAGTAATAAA TTTACAACTCCCAAACCC GACATTACCGAGTTTACA AGGACATTACCGAGTTT TTGAAGTAAAAAATCGT AATCCCAATCGTGAGAC GACATTACCGAGTTTACA GACATTACCGAGTTTACA GACATTACCGAGTTTACA GACATTACCGAGTTTACA GACATTACCGAGTTTACA GACATTACCGAGTTTACA GACATTACCGAGTTTACA AATTCGTTAGGGTGTACC GACATTACCGAGTTTACA GACATTACCGAGTTTACA AGGGATCATTACCGAGT TTTACAACTCCCAAACCC CTGCGGAGGGATCATTA

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5795 CIM TU 5794 CIM TU 5793 CIM TU 5792 CIM TU 5787 CIM TU 5772 CIM TU 5769 CIM TU 5762 CIM TU 5796 CIM TU 5763 CIM TU 5761 CIM TU 5760 CIM TU 5759 CIM TU 5634 CIM TU 5833 CIM TU 5503 CIM TU 5491 CIM TU 6305 CIM TU 6299 CIM TU 6295 CIM TU 6298 CIM TU 6294 CIM TU 6285 CIM TU TU CIM 6088 CIM TU 6204 CIM TU 6203 CIM TU 6087 CIM TU 6086 CIM TU 6085 CIM TU 6231 CIM TU 6076 CIM TU 6067 CIM TU 6064 CIM TU 6054 CIM TU 6046 CIM TU 6032 CIM TU 6040 CIM TU 6031 CIM TU 6019 CIM TU 6012 CIM TU 6010 CIM TU 5986 CIM TU 5997 CIM TU 5962 CIM TU 6083 CIM TU 5961 CIM TU 5950 CIM TU 5843 CIM TU 5828 CIM TU

The approved 6043 CIM TU original version of this thesis is available in print at TU Wien Bibliothek.

TU Wien

TACATAC ATTACCGAGTTATC ATCAACTCCCAAAC ATTACCGAGTTATC ATTACCGAGTTATC AACTCCCAAACCCC TTACCGAGTTATCA TTACCGAGTTATTCA CAACTCATCAACCCTG TTACCGAGTTTACA CATTACCGAGTTATCAACTCCCAAACCCCTG AACTCCCAAACCCA ACAACTCCCAAACC NCATTACCGAGTTT CATTACCGAGTT TTACCGAGTTTACA ATTACCGAGTTTAC AACCCATGTGAATC TTTACAACTCCCAAA TTACCGAGTTTACA ACCGAGTTATTCAA CCGAGTTATCAACT ACCGAGTTATCAAC TTACCGAGTTATTCA ATTCAACTCATCAA CATTACAGAGTGTAAAAACTCCCTAAACCCCTG TTACCGAGTTTACA TTACCGAGTTTACA CCGAGTTTACAACT CATTACCGAGTTTACAACTCCCAAACCCCTG ATTACCGAGTTTAC TTACCGAGTTTACA TTACCGAGTTTACA CCGAGTTTACAACT AACCCCTGTGAACA ATTACCGAGTTTAC CATTACCGAGTTTACAACTCCCAAACCCCTG ATTACCGAGTTTAC GGNCATTACCGAGT CCGAGTTTACAACT GGNCATTACCGAGT TTTACAACTCCCAAA AACTCCCCAACCCC AACTCCCCAACCCC WCATTACAGAGTG TTACCGAGTTTTCAA TTACCGAGTTATCA CAACTCCCAAACCCCTG TCCCAAACCCCTGT CAACTCCCAAACCCCTG TTACCGAGTTATCA

551 539 569 529 527 548 539 552 555 548 538 709 522 541 547 535 535 544 687 525 535 536 536 549 531 548 533 535 668 550 554 575 561 534 565 574 541 530 555 543 528 549 541 543 519 729 531 543 557 530

Fusarium Fusarium Fusarium Coccinonectria pachysandricola Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Fusarium Fusarium Tolypocladium Tolypocladium Tolypocladium

Clonostachys rosea Fusarium solani Xenoacremonium recifei Xenoacremonium recifei Paracremonium inflatum Fusarium oxysporum Ilyonectria palmarum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium decemcellulare Fusicolla violacea Fusicolla violacea Paracremonium inflatum Tolypocladium album Tolypocladium album Tolypocladium album Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Clonostachys rosea Clonostachys rosea Clonostachys rosea Lasiodiplodia parva

sp sp sp sp sp

sp. sp. sp.

Fsru Hypocreales Hypocreales Fusarium Hypocreales Fusarium Fusarium Hypocreales Hypocreales Fusarium Fusarium

lnsahs Hypocreales Clonostachys Hypocreales Fusarium Hypocreales Hypocreales Fusarium Hypocreales Ilyonectria Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusicolla Fusicolla lnsahs Hypocreales Clonostachys Hypocreales Clonostachys Hypocreales Clonostachys Lasiodiplodia

eoceoi Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu Coccinonectria Gliocephalotrich Gliocephalotrich Gliocephalotrich Gliocephalotrich Xenoacremoniu Xenoacremoniu Paracremonium Paracremonium Tolypocladium Tolypocladium Tolypocladium Tolypocladium Tolypocladium Tolypocladium

Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Botryosphaeria Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Dothideomycet Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes

Tolypocladium album Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Fusarium Fusarium Fusarium Coccinonectria pachysandricola Clonostachys rosea Clonostachys rosea Clonostachys rosea Lasiodiplodia parva Clonostachys rosea Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Gliocephalotrichum cylindrospor Fusarium solani Xenoacremonium recifei Xenoacremonium recifei Fusarium Fusarium Paracremonium inflatum Fusarium oxysporum Ilyonectria palmarum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium decemcellulare Fusicolla violacea Fusicolla violacea Paracremonium inflatum Tolypocladium Tolypocladium album Tolypocladium Tolypocladium album Tolypocladium

Diplomarbeit

s E21 F4119.1 0 0 0 99.81% 98.31% 98.34% MG838039 KF746131 EF453216 MICMW-30.1 NRRL 43873 AE-2013 sp sp 0 sp 0 98.34% 98.33% EF453216 NRRL 43873 EF453216 NRRL 43873 sp sp

p PB771M282 9.1 0 0 0 99.61% MH268124 97.59% PNB17_7A1 KP216881 97.59% S3-Z-2-10 KP216881 S3-Z-2-10 sp. sp. sp. 74

B 4.9K213 92%0 0 0 0 0 0 99.26% KM231834 99.43% KM231834 99.45% 541.89 CBS KM231834 99.44% 541.89 CBS KM231834 99.43% 541.89 CBS KM231834 99.26% 541.89 CBS KM231834 541.89 CBS 541.89 CBS 0 0 99.07% KM231834 99.27% KM231834 541.89 CBS 541.89 CBS

ieABA F3499.0 0 99.80% HF937429 DiGeSA-BRA1

UL156N_4009.1 0 0 0 99.81% NR_145030 99.80% 18576 MUCL NR_145030 99.81% 18576 MUCL NR_145030 18576 MUCL NR_145030 18576 MUCL

B 7.2K217 8.9 0 88.69% KM231775 476.92 CBS

MM3 F3979.1 0 456.78 CBS MH861166 99.81% KF030977 LMMM135 1,00E-168 87.11% KM231830 482.78 CBS 0 0 0 98.49% KM231809 96.07% 3e-169 315.73 CBS NR_137617 95.74% 634.76 CBS NR_137617 86.83% 634.76 CBS KM231830 482.78 CBS

P 70 L765 94%0 99.43% LT746253 27702 CPC

H0 C8579.2 0 97.62% LC386577 BH-06 H0 C8579.2 0 0 97.62% LC386577 94.16% BH-06 LC386577 BH-06

o5 J632 86%09% soil 7 0 0 0 97% 0 0 0 0 99.81% 0 KJ562373 99.81% KJ562373 99.81% Fox56 0 0 KJ562373 99.25% Fox56 0 KJ562373 99.44% Fox56 0 KJ562373 97.73% Fox56 98.63% 0 KJ562373 Fox56 99.81% KJ562372 Fox56 KJ562372 99.81% Fox59 99.81% KJ562373 Fox59 99.81% KJ562372 Fox56 99.81% KJ562372 Fox59 99.81% KJ562372 Fox59 KJ562372 Fox59 Fox59

AH AH AH AH

R0199.4 0 0 0 0 99.24% 99.25% KR909139 99.26% KR909139 KR909139 99.45% KR909139

100%

99%

0 99.05% 5 Colombia Vu et al 2019 Vu et al Colombia 5 99.05% 0

100% 100% 100%

100%

0%71 100%

2 63 92%

5 13 95% 4 13 31 94% 99%

97% 97% 12 99% 99% 97% 77% 99% 97% 99% 97% 99% 97% 99% 97% 97% 98%

98% 97% 21 23 74 99% 99% 80% 99% 5 13 92% 13 95% 95% 74%

99% 99% 99% 98% 99%

99% 97% 97% 98%

97% 99% 11 97% 97%

4 soil Brazil Lombard et al 2015 et al Lombard 2015 et al Lombard Brazil Brazil soil 4 soil 3 2016 et al Travadon 2016 et al Travadon 2016 et al Travadon 2016 et al Travadon wood 4 wood 4 wood 4 2015 et al Lombard wood 3 Brazil soil 5 soil 1 soil 1 soil 1 soil 4 soil 3 soil 1 soil 1 soil 1 soil 1 soil 1 soil 1

1 peritoneal fluid da Silva-Rocha et al 2015 et al Silva-Rocha da fluid peritoneal 1 1 8 Italy:Siracusa 3 9

3 soil Brazil Lombard et al 2015 et al Lombard 2015 et al Lombard 2015 et al Lombard Brazil 2015 et al Lombard Brazil Brazil Brazil soil 3 soil 3 soil 3 soil 4 2015 et al Lombard Brazil soil 4 9

1 Decock et al 2006 et Decock al 2006 et Decock al 2006 et Decock al 2006 et Decock al 1 1 1 0

9 O'Donnell et al 2007 et al O'Donnell 9 1 2007 et al O'Donnell 9

soil South Korea Das et al 2018 et al Das Korea South soil soil South Korea Das et al 2018 et al Das Korea South 2018 et al Das Korea South soil soil

soil

soil Colombia Lombard et al 2015 et al Lombard Colombia soil

rdpsvre Bradypus varieg Pachysandra ter Brahea armata Theobroma caca Diaspidiotus per Diaspidiotus per guianensHevea H of sediments H of sediments

Panama Higginbotham et al 2014 et al Higginbotham Panama 2015 et al Lombard Netherlands Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: Tyr South Italy: 2015 et al Lombard Tyr South Italy: 2015 et al Lombard 2015 et al Lombard Tyr South Italy: Malaysia Iran 2019 et al Skaltsas Iran 2015 et al Man Peru 2015 et al Man China China

aa tmr ro stem basal

O'Donnell et al 2007 et al O'Donnell

atla-edz ta 0 20 et al Santillan-Mendoza 2017 et al Sandoval-Denis 2014 et al Aiello 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo 2015 et al Caputo

H.Oya H.Oya Akyildiz

CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CATTACCGAGTTATTCAA TTATTCAACTCATCAACC TTACCGAGTTTACAACTC AGTAAAAGTCGTAACAA TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTTGGTGAACCAGC TCCGTTGGTGAACCAGC TCCGTTGGTGAACCAGC TCCGTTGGTGAACCAGC GGCAACTACCACCCAGG CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT TTATTCAACTCATCAACC TTATTCAACTCATCAACC CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT GCGCCTTACGGCTCTCGT GCGCCTTACGGCTCTCGT GCGCCTTACGGCTCTCGT GCGCCTTACGGCTCTCGT GCGCCTTACGGCTCTCGT GCGCCTTACGGCTCTCGT AAGTCGTAACAAGGTCT AAGTCGTAACAAGGTCT GCGCCTTACGGCTCTCGT AAGTCGTAACAAGGTCT AAGTCGTAACAAGGTCT AAGTCGTAACAAGGTCT AAGTCGTAACAAGGTCT AGTAAAAGTCGTAACAA CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT TTACCGAGTTTTCAACTC TGCGGAGGGATCATTAC CCCCTGTGAACATACCTG TGCGGAGGGATCATTAC CCCCTGTGAACATACCTG TGCGGAGGGATCATTAC

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 6234 CIM TU 6225 CIM TU 6224 CIM TU 6218 CIM TU 6201 CIM TU 6199 CIM TU 6198 CIM TU 6197 CIM TU 6292 CIM TU 6291 CIM TU 6283 CIM TU 6282 CIM TU 6281 CIM TU 6280 CIM TU 6304 CIM TU 6276 CIM TU 6275 CIM TU 6271 CIM TU 6270 CIM TU 6195 CIM TU 6176 CIM TU 6175 CIM TU 6306 CIM TU TU CIM 5809 CIM TU 5807 CIM TU 5799 CIM TU 5798 CIM TU 5797 CIM TU 5781 CIM TU 5780 CIM TU 5779 CIM TU 5773 CIM TU 5717 CIM TU 6332 CIM TU 7008 CIM TU 6337 CIM TU 6336 CIM TU 6335 CIM TU 6334 CIM TU 6331 CIM TU 6328 CIM TU 6326 CIM TU 6325 CIM TU 6324 CIM TU 6323 CIM TU 6322 CIM TU 6302 CIM TU 6279 CIM TU 6274 CIM TU

The approved original version of this 6272 CIM TU thesis is available in print at TU Wien Bibliothek.

TU Wien

AACCCTC TACAACTCCCATAC TACAACTCCCATAC GAGTTATACAACTC TACCATTTGTCAACT CTACTTCAAACCATCG GAGTTATACAACTC ATACCATTTGTCAA GAGTTATACAACTC CTGAGTTCTAAAAA CGAGTACAGGGGTC TTACCGAGTTATCA TTACCGAGTTATCA TTACCGAGTTATTCA TTCAACTCATCAACC ATTCAACTCATCAA TTACCGAGTTATTCA TTCAACTCATCAACC TTACCGAGTTATTCA ATTACCGAGTTATT CAACTCCCAAACCCCTG TTACCTAAACGTTG TTCAACTCATCAACC CAACTCATCAACCCTG CATTACCGAGTCTCG ATTACCGAGTTTAC CTCCCAAACCCCTG TTACCGAGTTTACA TCAACTCATCAACC CAACTCCCAAACCCCTG TTATCAACTCCCAAA ATCAACTCCCAAAC CATTACCGAGTCTCG CCCCTGTGAACATA TACCTTTTGTTGCCT CAACTCCCAAACCCCTG TTACCGAGTTATTCA TTACCGAGTTATTCA TTACCGAGTTATTCA CAACTCATCAACCCTG TTACCTAAACGTTG CATTACCGAGTTATTCAACTCATCAACCCTG CTTCGGCGGGAATA CCGAGTTATTNAAC TTCAACTCATCAACC ATTACCGAGTTATT ATTACCGAGTTATT AACTCATCAACCCT TGTGAACATACCTT AACTCCCAAACCCC TTACCGAGTTATCA

541 556 536 542 548 530 511 539 537 861 541 532 537 529 543 540 544 626 528 504 542 542 548 547 536 506 552 479 546 537 545 549 533 518 533 549 894 580 587 646 548 813 648 805 964 584 571 553 550 540

Annulohypoxylon viridistratum Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium

Paracremonium inflatum Campylocarpon fasciculare Paracremonium inflatum Paracremonium inflatum Paracremonium inflatum Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Campylocarpon fasciculare Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Arthrinium marii Arthrinium sp. Arthrinium sp. Arthrinium marii Coniochaeta angustispora Arthrinium sp. Arthrinium sp. Arthrinium sp. Anhellia nectandrae Tolypocladium album Xenoacremonium recifei

sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp sp

Fsru Hypocreales Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Fusarium Hypocreales Hypocreales Fusarium Hypocreales Fusarium Fusarium Hypocreales Fusarium Hypocreales Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Fusarium

rhiim Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Coniochaeta Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Myriangiales Anhellia

nuoyoyoAnnulohypoxylo Tolypocladium Xenoacremoniu Paracremonium Campylocarpon Paracremonium Paracremonium Paracremonium Xenoacremoniu Xenoacremoniu Xenoacremoniu Campylocarpon Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu Xenoacremoniu

Hypocreales Coniochaetales Xylariales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales Hypocreales

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Dothideomycet Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes

Xenoacremonium recifei Arthrinium marii Arthrinium Arthrinium Arthrinium marii Coniochaeta angustisporaArthrin Arthrinium Arthrinium Arthrinium Annulohypoxylon viridistratum Anhellia nectandrae Tolypocladium album Xenoacremonium recifei Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Paracremonium inflatum Fusarium Fusarium Fusarium Campylocarpon fasciculare Paracremonium inflatum Paracremonium inflatum Paracremonium inflatum Fusarium Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Campylocarpon fasciculare Xenoacremonium recifei Xenoacremonium recifei Xenoacremonium recifei Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Fusarium Xenoacremonium recifei Xenoacremonium recifei

Diplomarbeit

s RL451 F510 9.2 0 0 0 0 0 0 97.82% 97.98% EF453110 0 98.32% NRRL 43511 EF453216 NRRL 43873 0 EF453216 0 98.19% 98.14% NRRL 43873 0 EF453110 NRRL 43511 EF453216 NRRL 43873 98.34% MG838039 98.34% MICMW-30.1 MG838039 sp MICMW-30.1 98.31% 0 97.06% sp MG838039 98.31% EF453216 sp MICMW-30.1 NRRL 43873 EF453216 sp NRRL 43873 sp sp sp 98.31% EF453216 sp NRRL 43873 sp 0 sp 0 0 0 0 0 0 sp 98.34% 98.34% 0 MG838039 EF453110 MICMW-30.1 0 98.31% NRRL 43511 98.34% MG838039 EF453216 0 MICMW-30.1 NRRL 43873 98.02% 0 0 MG838039 98.54% 98.35% MICMW-30.1 MG838039 EF453204 MICMW-30.1 97.81% 98.14% NRRL 43811 EF453110 sp NRRL 43511 EF453216 sp NRRL 43873 98.34% sp MG838039 98.30% 98.18% sp MICMW-30.1 MG838039 EF453216 sp MICMW-30.1 NRRL 43873 sp sp sp sp sp sp sp

s.HU1L189 9.3 0 0 0 98.13% 0 97.47% LC158595 0 AF455414 HKU41 99.82% wb558 KP689231 96.63% SL6 96.72% HQ630967 HQ630967 TMS-2011 sp. TMS-2011 sp. sp. sp. sp. 75

B 4.9K213 92%0 99.27% KM231834 541.89 CBS B 4.9K213 85%0 98.55% KM231834 541.89 CBS 0 0 0 0 0 99.07% 0 KM231834 99.43% KM231834 99.07% 541.89 CBS KM231834 541.89 CBS 99.42% 541.89 CBS KM231834 98.21% KM231834 98.88% 541.89 CBS KM231834 541.89 CBS 541.89 CBS 0 0 97.28% KM231834 99.24% KM231834 541.89 CBS 541.89 CBS

B:0.7K140 9.1 0 0 98.51% KF144900 CBS:200.57 97.90% KF144900 CBS:200.57

B 7.3MH860817 872.73 CBS

B 8.8K213 9.3 0 0 99.03% 0 KM231830 0 482.78 CBS 98.52% KM231830 98.67% 482.78 CBS KM231830 99.06% 482.78 CBS KM231830 482.78 CBS

Bi5LK539 9.6 0 97.16% KJ573392 MBAi45CL 0 96.41% KJ573392 MBAi45CL

I 16 R110 8.2 e14 93% 1e-124 82.62% NR_111700 31767 VIC

K41 X7359.8 0 99.68% KX376325 EK14010

H0 C857 63%0 96.37% LC386577 BH-06

100%

0%11 100% 11 100% 11 100% 100% 100%

100%

6 20 96%

94%

9 11 99% 99%

97% 99% 98%

5 12 95% 95% 19 19 95% 97% 99%

95%

4 15 94% 19 90%

9 14 99% 99% 99% 98% 99% 97% 99% 14 99% 98%

9 12 10 99% 10 98% 98% 99% 15 98% 99% 98% 98% 10 97% 98% 98% 12 99% 10 98% 11 10 99% 99% 99% 99% 98%

0 Suriname Vu et al 2019 Vu et al Suriname 0

9 2015 et al Lombard Brazil soil 9

5 soil Colombia Lombard et al 2015 et al Lombard Colombia soil 5 2015 et al Lombard 2015 et al Lombard Colombia Colombia soil 7 soil 5

9 toenail Hong Kong Tsang et al 2019 et al Tsang Kong Hong toenail 9 1

3 Thailand Kuhnert et al 2017 et al Kuhnert Thailand 3

8 soil Brazil Lombard et al 2015 et al Lombard Brazil soil 8 2015 et al Lombard 2015 et al Lombard 2015 et al Lombard Brazil Brazil 2015 et al Lombard Brazil 2015 et al Lombard soil 5 Brazil soil 3 soil 5 Brazil soil 3 soil 6 2015 et al Lombard Brazil soil 4 7 O'Donnell et al 2007 et al O'Donnell 9 7

8 soil Colombia Lombard et al 2015 et al Lombard Colombia soil 8

9 O'Donnell et al 2007 et al O'Donnell 2007 et al O'Donnell 2007 et al O'Donnell 9 9 9 9 2007 et al O'Donnell 2007 et al O'Donnell 9 2007 et al O'Donnell 9 9 9 9

soil South Korea Das et al 2018 et al Das Korea South soil

Miscanthus giganteus Miscanthus giganteus

Vitis vinifera Vitis vinifera

soil Brazil Lombard et al 2015 et al Lombard Brazil soil soil Brazil Lombard et al 2015 et al Lombard Brazil soil

Beta vulgaris Beta vulgaris serrat Huperzia Nectandra retic

Netherlands Crous et al 2013 et al Crous Netherlands 2016 et al Wang 2013 et al Crous Netherlands China 2014 et al Schoch Brazil M Salihli, Turkey: M Salihli, Turkey:

e lea lea

Buzina et al2003 Buzina 2011 et al Shrestha 2011 et al Shrestha

O'Donnell et al 2007 et al O'Donnell 2007 et al O'Donnell

O'Donnell et al 2007 et al O'Donnell 2007 et al O'Donnell 2007 et al O'Donnell 2007 et al O'Donnell 2007 et al O'Donnell

atla-edz ta 0 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 2014 etAkgul al 2014 etAkgul al 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza 20 et al Santillan-Mendoza

H.Oya H.Oya Akyildiz

CTAAGTTCTGTTTGTACACACCGCCCGT AGGGATCATTACAGAGT AGTCGTAACAAGGTCTC TTTGTACACACCGCCCGT AACAAGGTCTCCGTTGG GAACGGGCTTTACACTCC TCTTGGTCATTTAGAGGA TCTTGGTCATTTAGAGGA CAGCGGAGGGATCATTA TCGTAACAAGGTTTCCGTAG TGCGGAGGGATCATTAC CGTAACAAGGTCTCCGTT CCGAGTTATTCAACTCAT TTATTCAACTCATCAACC TTATTCAACTCATCAACC CCGAGTTATTCAACTCAT TTATTCAACTCATCAACC CATTACCGAGTTATTCAA CATTACCGAGTTATTCAA CGTAACAAGGTCTCCGTT CATTACCGAGTTATTCAA TTATTCAACTCATCAACC TTATTCAACTCATCAACC TTGGAAGTAAAAATCGT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT TTATTCAACTCATCAACC CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT TTGGAAGTAAAAATCGT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CATTACCGAGTTATTCAA CCGAGTTATTCAACTCAT CATTACCGAGTTATTCAA TTATTCAACTCATCAACC CATTACCGAGTTATTCAA CATTACCGAGTTATTCAA CCGAGTTATACAACTCAT CCGAGTTATTCAACTCAT TTATTCAACTCATCAACC CATTACCGAGTTATTCAA CATTACCGAGTTATTCAA TTATTCAACTCATCAACC CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT CGTAACAAGGTCTCCGTT

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 7016 CIM TU 6990 CIM TU 6017 CIM TU 6177 CIM TU 5776 CIM TU 6034 CIM TU 6030 CIM TU 6026 CIM TU 6023 CIM TU 6022 CIM TU 6006 CIM TU 6008 CIM TU 6009 CIM TU 5840 CIM TU 5814 CIM TU 5803 CIM TU 5827 CIM TU 5823 CIM TU 5822 CIM TU 5818 CIM TU 5817 CIM TU 5816 CIM TU 5813 CIM TU TU CIM 5788 CIM TU 5784 CIM TU 5783 CIM TU 5777 CIM TU 5645 CIM TU 5644 CIM TU 5636 CIM TU 5632 CIM TU 5572 CIM TU 5499 CIM TU 5498 CIM TU 5496 CIM TU 5495 CIM TU 6004 CIM TU 5971 CIM TU 5969 CIM TU 5771 CIM TU 6056 CIM TU 6027 CIM TU 6025 CIM TU 6024 CIM TU 6020 CIM TU 6018 CIM TU 6014 CIM TU 6007 CIM TU 6185 CIM TU

The approved original version of this 5811 CIM TU thesis is available in print at TU Wien Bibliothek.

TU Wien

CCCACAG ACTCCCAACCCATG TTATAGAGTTTTCTA GWWCATTATAGAG ATTATAGAGTTTTCT NTTATAGAGTTTTC ATTATAGAGTTTTCT TTATAGAGTTTTCTA GGGNCATTATAGAG ATTATAGAGTTTTCT TATAGAGTTTTCTAA GAGTTTTCTAAACT TATAGAGTTTTCTAA TTATAGAGTTTTCTA ATTATAGAGTTTTTT NCATTATAGAGTTT TTATAGAGTTTTCTA TTATAGAGTTTTCTA ATTATAGAGTTTTCT CTCCCTAACCCTTTG GTTATACAACTCCC GAGTTTTTTCAACTC TTACAGAGTTGCAA TTAGAGAGTCTAAA AACTCCCAAACCCA TTTCTACAACTCCCA GNCATTACTGAGTA ACTGAGTACTACAC CATTAGAGAGAGCC CATTAGAGAGTCTA CGAGTACAGGGGTC NNNATTGCTGGACT AGATACCCTATGTG CATTGCTGGACTGC ATTCAGTGAATCAT CATTACTGAGTTATCTAAACTCCAACCCTATG ATTATTACAAGCCG ATTACAAGCCGAAA TTACAAGAAGCCGA TTACTGAGTTTACG CTACTTCAAACCATCG TTATAGAGTTTTCTA ATTATAGAGTTTAT ACTCCCATACCATTT TACAACTCCCATAC TACAACTCCCATAC GAGTTATACAACTC TACAACTCCCATAC ATTATAGAGTTTAT NCATTATAGAGTTT TTACAGAGTTATAC

829 811 578 560 546 575 575 560 556 537 546 541 529 534 556 584 602 379 597 295 836 563 547 552 552 548 814 544 597 555 894 583 756 552 551 591 522 537 543 853 773 838 803 818 537 533 827 885 529 828

Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pseudopestalotiopsis Pestalotiopsis Pestalotiopsis lagerstroemiae Chrysomorbus Phomopsis Coniochaeta Coniochaeta Coniochaeta Colletotrichum gloeosporioides Coniochaeta Pestalotiopsis

Neopestalotiopsis piceana Pseudopestalotiopsis theae javanica Cordyceps Purpureocillium lilacinum javanica Cordyceps calosporaNeurospora Nemania Bipapillata cf. Nemania Bipapillata cf. Nemania primolutea Plectosphaerella cucumerina Plectosphaerella cucumerina Nemania bipapillata Nemania Bipapillata cf. Anhellia nectandrae sp. Sordariomycetes sp. Sordariomycetes Daldinia eschscholtzii Castanediella couratarii Arthrinium marii Arthrinium sp. Arthrinium marii Arthrinium sp. Arthrinium sp. Arthrinium sp. Arthrinium sp. Arthrinium phragmites Neopestalotiopsis clavispora Pseudopestalotiopsis theae

s.Pooss Diaporthales Phomopsis sp.

sp. Coniochaeta Coniochaeta Coniochaeta Coniochaeta Coniochaeta sp. sp. sp. sp.

sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. sp. Xylariales Pestalotiopsis sp. sp. sp

Cryes Hypocreales Cordyceps Hypocreales Cordyceps Sordariales Xylariales Neurospora Xylariales Nemania Xylariales Nemania Nemania Xylariales Xylariales Nemania Myriangiales Nemania Anhellia Xylariales Daldinia Xylariales Castanediella Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium Xylariales Arthrinium

Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Neopestalotiop Pseudopestalot Pseudopestalot Pestalotiopsis Neopestalotiop Pseudopestalot Purpureocillium Plectosphaerell Plectosphaerell Chrysomorbus Colletotrichum Pestalotiopsis

Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Xylariales Hypocreales Glomerellales Glomerellales Diaporthales Coniochaetales Coniochaetales Coniochaetales Glomerellales Coniochaetales Xylariales

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Dothideomycet Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes

Arthrinium phragmites Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Pestalotiopsis Neopestalotiopsis clavispora Pseudopestalotiopsis Pseudopestalotiopsis theae Pestalotiopsis Neopestalotiopsis piceana Pseudopestalotiopsis theae Pestalotiopsis javanica Cordyceps Purpureocillium lilacinum javanica Cordyceps 1,00E-124 calosporaNeurospora Nemania Bipapillata cf. Nemania Bipapillata cf. 82.62% NR_111700 Nemania primolutea 31767 VIC Plectosphaerella cucumerina Plectosphaerella cucumerina Nemania bipapillata Nemania Bipapillata cf. nectandrae Anhellia sp. Sordariomycetes lagerstroemiae Chrysomorbus sp. Sordariomycetes Phomopsis Daldinia eschscholtzii Coniochaeta Coniochaeta Coniochaeta Colletotrichum gloeosporioides Coniochaeta Castanediella couratarii Pestalotiopsis Arthrinium marii Arthrinium Arthrinium marii Arthrinium Arthrinium Arthrinium Arthrinium

Diplomarbeit

s.T2 MH930425 TW24 sp.

s.HU1L189 9.3 0 0 0 97.93% 0 LC158595 0 97.25% HKU41 97.25% AF455415 AF455414 wb559 wb558 99.81% MH397130 99.81% RM3.30.06 MH397130 RM3.30.06 sp. sp. sp. sp. sp.

s.BO21 F6529.8 0 0 0 0 98.58% 98.91% 98.91% KF367562 MF942883 KF367562 BRO-2013 98.87% BRO-2013 1M35 MF942883 1M35 sp. sp. sp. sp.

s.ES1 Y1718.6 0 89.96% KY413701 ERS017 sp.

p 09 F2519.0 0 0 99.80% EF423541 EF423541 99.81% EF423541 EF423541 P089 EF423541 P089 P089 KF746095 EF423541 P089 EF423541 AE-2013 P089 sp. sp. HQ607806 P089 sp. KF746095 ATT035 P089 0 sp. KF746154 AE-2013 sp. AE-2013 sp. sp. sp. KF746154 sp. AE-2013 99.37% sp. sp. KY413714 ERS031 sp. sp.

76 sp

MCS:13 U0359.4 0 99.64% KU304335 JMRC:SF:11930

MR21 X045 63%0 0 86.37% KX908495 JMUR-2016 86.72% KX908495 JMUR-2016

EC81 K993 62%4,00E-109 86.24% KY929339 8812 CERC

BC294AB625438 20944 BCC AB625438 20944 BCC AB625438 20944 BCC 0 99.16% KF144900 CBS:200.57

B 6.1M864 98%0 MH855130 225.30 CBS 0 99.82% MH856849 265.51 CBS 99.81% MN523140 2014_1556 1e-173 90.31% NR_145250 579.71 CBS -W21 C1079.2 0 99.02% LC114037 3-KW-2016

P 80 R117 08%0 90.85% NR_111873 18900 CPC

S479 M831 86%0 98.64% MH873913 BS 497.90

91102001

Y24 N468 9.1 0 99.81% JN942618 MY02949 JN942618 MY02949

w31 FR822391 Kw 3411

380408

P5 F253 9.2 0 99.62% EF423553 P156 EF423553 P156

5100

W H346 90%0 99.09% MH930406 TW4

J9839.2 0 99.62% AJ492873 JX875595 9 0 95.42% EF026121 99.02% JQ862661

100% 100% 100% 100% 100% 100% 100% 100% 100% 100%

100% 100% 100% 100% 100% 100%

100% 100%

100%

7e-151

0 0 0 0 0 0 0 0 0 0

0 0 0 0 0 0

0 0

100%

100% 100%

100%

100% 47 100% 100%

6 52 96%

99%

98%

97% 97% 98% 97% 9 25 99% 95% 99%

97% 54 98% 97% 96% 97% 95% 97% 97% 97% 95% 97% 97% 96% 95%

5 10 13 13 95% 96% 97% 94% 94%

98% 9 83 81 99% 99% 97% 98% 94% 94% 94%

91% 92%

99% 3 97 93%

99% 97%

5 Leung et al 2018 et Leung al 5

8 Spain Vu et al 2019 Vu et al Spain 8

2 1 1 3 2013 et al Chen 5 5

1 0 0 2017 et al Nozawa 0 0 0 0 0 2012 et al Schoch 0 0 5 0 1 2

1 Hamzah et al 2018 et al Hamzah 2018 et al Hamzah 1 1

0 Vu et al 2019 Vu et al 0 0 Khan et al 2012 et al Khan 0 0 0 0 0 6 6

0 Schoch et al 2012 et al Schoch 0 0 0 Leung et al 2018 et Leung al 0

1 USA Vu et al 2019 Vu et al USA 1 8 6

toenail Hong Kong Tsang et al 2019 et al Tsang Kong Hong toenail

Mangifera indicaMangifera

dnoei u Odontodenia pu Odontodenia pu Odontodenia pu Odontodenia pu Odontodenia pu Bradypus varieg Odontodenia pu Odontodenia pu Atta texana Bradypus varieg Bradypus varieg Faramea occide Bradypus varieg Faramea occide Trichilia tubercu of Schizosta leaf of Schizosta leaf potato nem cyst cucurbita stem of Schizosta leaf Nectandra retic montan Quercus Lagerstroemia s montan Quercus Paphiopedilum drin untreated drin untreated Dicranum scopa Dicranum scopa Virola suriname Beta vulgaris Phragmites aus

dead trunk Taiwan Hsieh et al 2010 et al Hsieh Taiwan trunk dead

ns nes

Panama Gilbert et al 2007 et al Gilbert 2007 et al Gilbert Panama 2007 et al Gilbert Panama 2007 et al Gilbert Panama 2007 et al Gilbert Panama 2015 et al Higginbotham Panama 2007 et al Gilbert Panama 2007 et al Gilbert Panama Panama 2011 et al Rodrigues 2015 et al Higginbotham Texas USA: 2014 et al Higginbotham Panama Panama 2007 et al Gilbert 2014 et al Higginbotham Panama Panama 2007 et al Gilbert 2017 Spear,E.R Panama Panama 2014et al Okane 2014et al Okane Thailand 2013 et al Atkins 2019 et al Rivedal Thailand Jersey USA 2014et al 2014 et Okane al Schoch 2016 et al U'Ren Thailand 2018 et al Chen 2016 et al U'Ren Brazil USA China USA 2013 et al Oliveira Chian Thailand: 2013 et al Oliveira Portugal Portugal Fores Duke USA: Fores Duke USA: 2017 Spear,E.R Panama 2013 et al Crous Netherlands 2014 et al Schoch Italy

e lea

Buzina et al2003 Buzina et al2003 Buzina

Ismail et al 2013 et al Ismail

Barnes et al 2016 et al Barnes 2018 et al Chen 2018 et al Chen 2 et al Hernandez-Restrepo

H.Oya H.Oya Akyildiz

TCTGGAAGTAAAAGTCG TCTGGAAGTAAAAGTCG TCTGGAAGTAAAAGTCG TCTGGAAGTAAAAGTCG TCTGGAAGTAAAAGTCG GTAACAAGGTCTCCGTT TCTGGAAGTAAAAGTCG TCTGGAAGTAAAAGTCG TGGAAGTAAAAGGTCGT GTAACAAGGTCTCCGTT TTATAGAGTTTTCTAAAC CTGCGGAGGGATCATTA TCTCCGTTGGTGAACCAG GGACATTATAGAGTTTTC TTATAGAGTTTTCTAAAC GTCGTAACAAGGTCTCC GGACATTATAGAGTTTTC GGATCATTATAGAGTTTT TCCGTTGGTGAACCAGC TCCGTAGGTGAACCTGC TCCGTTGGTGAACCAGC ATGGCTCAGTGAGGCTT TCTCCGTTGGTGAACCAG TCTCCGTTGGTGAACCAG TCCGTAGGTGAACCTGC GGAAGTAAAAGTCGTAA TTACTGAGTACTACACTC TTGCGTACGCGCTAGAG TCTCCGTTGGTGAACCAG TCGTAACAAGGTTTCCGT GGATCATTGCTGGAACT ATCATTGCTGGAACTGTG GGATCATTGCTGGAACT GGAAGTAAAAGTCGTAA AGGGATGGAACCGTGAC CTATCCAAACTCGGTCAT CTATCCAAACTCGGTCAT GCGGRGGATCATTACAA GGAAGTAAAAGTCGTAA GCGGRGGATCATTACAA GGAGGGATCATTATAGA ATCATTATAGAGTTTTCT ATGGCTCAGTGAGGCTT AGGGATCATTACAGAGT TTTGTACACACCGCCCGT AGTCGTAACAAGGTCTC AGTCGTAACAAGGTCTC AAGTCGTAACAAGGTCT AAGTCGTAACAAGGTCT GCGGAGGGATCATTACA

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 6075 CIM TU 6074 CIM TU 6070 CIM TU 6029 CIM TU 5992 CIM TU 7080 CIM TU 5715 CIM TU 5714 CIM TU 5712 CIM TU 5711 CIM TU 5646 CIM TU 5635 CIM TU 6207 CIM TU 6065 CIM TU 7081 CIM TU 6057 CIM TU 6055 CIM TU 6038 CIM TU 6035 CIM TU 6028 CIM TU 6015 CIM TU 5837 CIM TU 5829 CIM TU TU CIM 5994 CIM TU 5973 CIM TU 5966 CIM TU 5959 CIM TU 5831 CIM TU 5830 CIM TU 5825 CIM TU 5810 CIM TU 5770 CIM TU 5768 CIM TU 5767 CIM TU 5766 CIM TU 5764 CIM TU 5718 CIM TU 5713 CIM TU 5750 CIM TU 5651 CIM TU 5650 CIM TU 5648 CIM TU 5647 CIM TU 5627 CIM TU 5626 CIM TU 5507 CIM TU 5506 CIM TU 5995 CIM TU 6080 CIM TU

The approved original version of this 6077 CIM TU thesis is available in print at TU Wien Bibliothek.

TU Wien

ATCGGGG CATTACCGAGTGAG GAGTGAGGGCCCTC GNCATTACCGAGTG GNCATTACCGAGTG AGTGAGGGCCCTTT ATTACCGAGTGAGG GNCATTACCGAGTG TTACCGAGTGAGGG GTGAGGGCCCTCTG NCATTACCGAGTGA TGAGTGAGGGCCCT CGAGTGAGGGCCCT GNGTTTATTTACCTC TTACTGAGTGAGGG NCATTACCGAGTGA GAGTGAGGGCCCTC TTACTGAGTGAGGG GGCCCTCTGGGTCC ATTACCGAGTGAGG CATTACCGAGTGAG ATTACCGAGTGAGG CATTACCGAGTGAG TTNCTGAGTGAGGG ATTACTGAGTGAGG AAGAGTTCTATAAC AGAGTTTATCATAA GAGTTTATAAAACT CATTGCTGGAAGCG GAGTTGCAAAACTC ATTACAGAGTTTTC GCTGGAGCGTCTCA TTGCTGGAGCGTCT NCATTAGAGAGTCT TTGCTGGAGCGTCT NGTAAACTCCCCCA AGAGTTTATCATAA ACTGAGTACTACAC GNCATTACTGAGTA ATTACCGAGTTATC TTAAAGAGTTGCAA GCAAAACTCCCAAA TTTTCTAAACTCCCA GAGTTGCAAAACTC TTAAAGAGTTGCAA AGTTGCAAAACTCC AGAGTTTCGTACTC TTACAGAGTTTCGT ATTATAGAGTTTTCT ATTATAGAGTTTTCT CATTATAGAGTTTTCTAAACTCCCAACCCATG

563 556 561 540 568 561 560 561 561 541 550 559 543 592 528 551 591 597 565 590 499 559 529 541 560 541 525 539 528 536 535 579 587 853 700 549 627 558 568 589 566 572 547 577 547 562 551 567 521 566

Penicillium Penicillium cinnamopurpureum Penicillium Penicillium Penicillium Penicillium Penicillium Penicillium Penicillium Penicillium Xylaria Xylaria Wardomyces Valsaceae Valsaceae Valsaceae Nemania Valsaceae Valsaceae Xylaria Plectosphaerella Tolypocladium Pestalotiopsis Phialemonium Phialemonium Phaeoacremonium tardicrescens Pestalotiopsis Pestalotiopsis Pestalotiopsis

Penicillium expansum Penicillium echinulatum Penicillium glabrum Penicillium expansum Penicillium polonicum Penicillium expansum Phialemoniopsis pluriloculosa Seiridium sp. Plectosphaerella cucumerina Phialemoniopsis pluriloculosa Phialemoniopsis pluriloculosa Phialemoniopsis curvata Phaeoacremonium scolyti Talaromyces wortmanniiTalaromyces Penicillium robsamsonii creber Aspergillus Penicillium rudallense Penicillium expansum Penicillium rudallense Penicillium polonicum Penicillium cairnsense

sp sp sp

p eai Xylariales Nemania sp.

p asca Diaporthales Valsaceae Diaporthales Diaporthales Valsaceae Valsaceae Diaporthales sp. Diaporthales Valsaceae Valsaceae sp. sp. sp. sp.

p eiilu Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium sp. Eurotiales Penicillium sp. sp. Eurotiales Penicillium sp. Eurotiales Penicillium sp. Eurotiales Penicillium Eurotiales sp. Penicillium Eurotiales Penicillium sp. sp. sp.

sp. sp.

p admcs Microascales Wardomyces sp. sp. sp. sp. sp.

sp.

yai Xylariales Xylariales Xylaria Xylaria Xylariales Xylaria

eiilu Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium aaoye Eurotiales Talaromyces Eurotiales Penicillium Eurotiales Aspergillus Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium

eiilu Eurotiales Penicillium Phialemoniopsis Seiridium Plectosphaerell Plectosphaerell Tolypocladium Phialemoniopsis Phialemoniopsis Pestalotiopsis Phialemonium Phialemonium Phialemonium Phaeoacremon Phaeoacremon Pestalotiopsis Pestalotiopsis Pestalotiopsis

sp.

Xylariales Xylariales Glomerellales Glomerellales Hypocreales Xylariales Xylariales Xylariales Sordariales Sordariales Sordariales Togniniales Togniniales Xylariales Xylariales

Xylariales

Sordariomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes

Pestalotiopsis Penicillium Penicillium cinnamopurpureum Penicillium wortmanniiTalaromyces Penicillium robsamsonii Penicillium creber Aspergillus Penicillium Penicillium rudallense Penicillium expansum Penicillium rudallense Penicillium polonicum Penicillium Penicillium cairnsense Penicillium expansum Penicillium echinulatum Penicillium Penicillium glabrum Penicillium expansum Penicillium polonicum Penicillium expansum Penicillium Penicillium Penicillium Xylaria Xylaria Wardomyces Valsaceae Phialemoniopsis pluriloculosa Seiridium Valsaceae Valsaceae Nemania Valsaceae Valsaceae Xylaria Plectosphaerella Plectosphaerella cucumerina Tolypocladium Phialemoniopsis pluriloculosa Phialemoniopsis pluriloculosa Pestalotiopsis Phialemoniopsis curvata Phialemonium Phialemonium Phaeoacremonium tardicrescens Phaeoacremonium scolyti Pestalotiopsis Pestalotiopsis

p R20-5 Q8349.2 0 99.62% DQ480344 NR-2006-A59 sp. sp. sp.

Diplomarbeit

p 18 U4809.4 0 99.44% KU747850 F1982 sp.

p 2 N9579.4 0 98.54% JN198507 2 Z28 sp.

s.51P-53K226 98%0 0 99.82% KM232463 0 5H1-P0-P5-3 99.30% 0 KM232463 5H1-P0-P5-3 99.30% sp. KM232463 0 5H1-P0-P5-3 sp. 92.15% KF367506 sp. BRO-2013 sp. 99.29 0 KF367536 BRO-2013 0 sp. KM249071 F731 0 98.34% 0 LC315644 sp. KSM-F532 91.24% 0 AB334109 GS52 96.64% sp. AB334109 96.65% sp. AB334109 sp. GS52 96.65% GS52 AB334109 GS52 sp. GS52 sp. sp. sp. sp.

s.AB65 H6159.2 0 99.62% MH268155 AHB16_5A sp.

p R07K430 94%0 99.45% KY413701 ERS017 sp. p E21 F412 90%0 0 99.06% KF746122 2 AE-2013 99.81% EF423541 sp. KF746095 AE-2013 P089 sp. sp.

p R-03K373 9.6 0 0 95.86% 95.54% KF367530 KF367530 BRO-2013 BRO-2013 sp. sp.

p S0K421 68%0 96.81% KY432313 DS10 sp. p H2 J375 96%0 99.62% FJ430715 MH727 sp. 77

B1a0283EM2CC388 B1a0283EM2CC388

CGMCC 3.18178 CGMCC

Be21A2KM115166 NBPen2013A12 0 97.71% EU035984 06-4324 UTHSC

TS 069LN898690 10-639 UTHSC

B 153 H6859.4 0 98.24% MH862865 110573CBS

B 453N_486 85%0 98.58% NR_144866 140573 CBS 0 99.82% NR_121508 124325 CBS MH863551 125543 CBS 0 99.22% MH865904 131712 CBS 0 0 99.22% MH865904 99.21% 131712 CBS MH865904 131712 CBS

T- 95E183 85%0 98.55% EU128034 5955 STE-U

B 9.8M861 98%0 99.83% MH856412 391.48 CBS

TC76 NR_077154 7861 ATCC 0 NR_077154 7861 ATCC 99.82% NR_077154 7861 ATCC NR_077154 7861 ATCC

5--0 X5079.2 0 99.82% KX958077 25R-4-F02 KX958077 25R-4-F02

RL12N_2379.2 0 99.82% NR_121327 NRRL 162

I69 LT558912 DI16-90 LT558912 DI16-90

380408

FF7

X6249.9 0 0 95.89% KX961214 99.08% KP306964 0 99.08% KP306964

J9839.2 0 99.62% AJ492873

J7839.4 0 97.54% FJ379813

100%

64%0 96.48%

100%

100% 100% 100% 100% 100%

100% 100% 100% 100%

100%

0 0 0 0 0

0 0 0 0

100% 100% 100%

100% 100%

100%

98%

5 13 95%

99% 97% 97%

99% 97% 99% 98% 99% 93%

98% 5 17 95% 97% 9 14 99% 99% 99% 98% 95% 96%

95% 8 21 24 98% 99%

99% 99% 99% 99%

7 10 97%

99% 99% 99% 8 12 98% 97% 99% 11 99% 50 19 94% 19 19 95% 96% 95% 6 17 96%

97% 99%

98%

1 Schoch et al 2014 et al Schoch 1

3 Shibata et al 2017 et al Shibata 2015 et al Bolanos 3 sponge marine 5 2015 et al Bolanos sponge marine 5

2 3 4 Redou et al 2015 et al Redou 4 2014 et al Schoch 2017 et al Shibata 4 1 9 2008 et al Damm 5 8 1

1 Denmark Vu et al 2019 Vu et al Denmark 1 8 mouse dung Denmark Houbraken et al 2016 et al Houbraken Denmark dung mouse 2014 et al Schoch 8 1 2019 Vu et al USA 4 2019 Vu et al 2019 Vu et al USA USA 4 4 0

2 Phongpaichit et al 2006 et al Phongpaichit 2 0 0

1 2015 et al Banjara cheese Wensleydale 0 0 Siqueira et al 2016 et al Siqueira 0 0 0

0 Schoch et al 2014 et al Schoch 2014 et al Schoch 0 2014 et al Schoch 0 0 1 Redou et al 2015 et al Redou 2015 et al Redou 1 4 2010 et al Hujslova 2

2 0

8 Wu et al 2013 et al Wu 8

Dendrobium sinense Dendrobium sinense

poodle pleural fluid Sutton et al 2008 et al Sutton fluid pleural poodle

Beta vulgaris

oak forest soil forest oak below sediment drin untreated drin untreated below sediment pauciflor Hevea Campyloneurum potato nem cyst Bradypus varieg drin untreated drin untreated Odontodenia pu Bradypus varieg Virola suriname

USA: Texas Vu et al 2019 Vu et al Texas USA:

Japan Osono et al 2008 et al Osono Japan 2008 et al Osono 2008 et al Osono Japan 2008 et al Osono Japan 2008 et al Osono Japan Japan

USA: Idaho Strausbaugh et al 2015 et al Strausbaugh Idaho USA:

Czech Republic Czech 2016 et Liu al 2013 et al Oliveira Japan Portugal 2013 et al Oliveira Portugal 2016 et Liu al Japan 2019 et al Skaltsas Peru 2017 et al Olmo-Ruiz Del Panama 2013 et al Atkins Jersey 2014 et al Higginbotham Panama 2013 et al Oliveira 2013 et al Oliveira Portugal Portugal 2007 et al Gilbert 2015 et al Higginbotham Panama 2017 Spear,E.R Panama Panama

roots Wang et al 2017 et al Wang roots

Vu et 2019

Baldrian et al 2011 et al Baldrian 2016 et al Guevara-Suarez 2016 et al Guevara-Suarez

H.Oya H.Oya Akyildiz

GTAACAAGGTTTCCGTA AAGGATCATTACCGAGT TGCGGAGGATCATTACC TCAGGGAGGTTGGCAAC CTTGGGATTGGCTTAGG GTAACAAGGTTTCCGTA AAGTCGTAACAAGGTTT GTAACAAGGTTTCCGTA AAGTAAAAAGTCTAACA TCCGTAGGTGAACCTGC AAGTAAAAAGTCTAACA CATTACCGAGTGAGGGC TGCATTGATGGCTCAGT ACCCCCCAGAGCCGGAA TCCGTAGGTGAACCTGC TTACCGAGTGAGGGCCC TGATGGCTCAGTGAGGC TTACTGAGTGAGGGCCC TCCGTAGGTGAACCTGC CATTACCGAGTGAGGGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GGAAGTAAAAGTCGTAA GGAAGTAAAAGTCGTAA GGTAACAAGGTCTCCGT AACTCCCAAACCCATGTG GTAAAAAGTCGTAACAA AGTAAAGTCGTAACAAG AACAAGGTTTCCGTTGGT GCGGTAATGAGACGCCG AGTAAAGTCGTAACAAG AGTAAAGTCGTAACAAG CTCCCAACCCACTGTGAA AGTAAAGTCGTAACAAG AGTAAAGTCGTAACAAG AACTCCCAAACCCATGTG ATTACAAAGCGAAACTG GGAAGTAAAAGTCGTAA TGTCATTGAGTTCACTCC AACAAGGTTTCCGTTGGT AACAAGGTTTCCGTTGGT GATCATTATAGAGTTTTC AAAGTTATATTTCTCGCT GATGGCTCAGTGAGGCT GATGGCTCAGTGAGGCT GAGGTCTCCGTTGGTGA AGGGATCATTAACGAGT TCTGGAAGTAAAAGTCG GTAACAAGGTCTCCGTT ATCATTATAGAGTTTTCT

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 6313 CIM TU 6303 CIM TU 6300 CIM TU 6293 CIM TU 6288 CIM TU 6232 CIM TU 6229 CIM TU 6228 CIM TU 6227 CIM TU 6226 CIM TU 6219 CIM TU 6217 CIM TU 6216 CIM TU 6209 CIM TU 6188 CIM TU 6173 CIM TU 6084 CIM TU 6081 CIM TU 6079 CIM TU 6078 CIM TU 6001 CIM TU 5996 CIM TU TU CIM 5631 CIM TU 7002 CIM TU 6997 CIM TU 6996 CIM TU 6995 CIM TU 6991 CIM TU 5821 CIM TU 5820 CIM TU 6205 CIM TU 6200 CIM TU 6182 CIM TU 5988 CIM TU 5967 CIM TU 6180 CIM TU 9319 CIM TU 7036 CIM TU 7035 CIM TU 7014 CIM TU 7007 CIM TU 6330 CIM TU 6329 CIM TU 6327 CIM TU 6320 CIM TU 6319 CIM TU 6318 CIM TU 6316 CIM TU 6315 CIM TU

The approved original version of this thesis is available in print at 6090 CIM TU TU Wien Bibliothek.

TU Wien

CTACATC NCATTACCGAGTTC AGCCTATTTCCTGCG CATTATCGAGTTAG ATTATCGAGTTAGG TCTTTTGGCCCAACC NCATTAACGAGTTA NCATTACCGAGTGC NCATTACCGAGTGC CATTACCGAGTTAG NCATTAACGAGTTA CATTAACGAGTTAG NNCATTACCGAGTT NCATTAACGAGTTA ATTACCGAGTTAGG ATTACTGAGTGAGG NCATTACTGAGTGA GNCATTACTGAGTG GNCATTACCGAGTG NCATTACCGAGTGA NCATTACTGAGTGA GNCATTACTGAGTG CATTACTGAGTGAG NCATTACTGAGTGA ATTACTGAGTGAGG ATTACTGAGTGAGG GNCATTACTGAGTG CGGGNTCCAACCTC NCATTACCGAGTGC CATTACTGAGTGAG GCGCGATGGACGCT CATTACTGAGTGAG CATTACTGAGTGAG CATTACTGAGTGAG ATTACTGAGTGAGG NCATTACCGAGTGA ATTACCGAGTGAGG CATTACCGAGTGAG NCATTACCGAGTGA GNCATTACCGAGTG CATTACCGAGTGAG NCATTACCGAGTGC CTGAGTTCTAAAAA NCATTACTGAGTGA CATTACTGAGTGAG GNCATTACTGAGTG TTACTGAGTGAGGG ATTACTGAGTGAGG GNCATTACTGAGTG GAGCCCGCCTCACG GGGCCCTCTGGGTC

1020

570 569 562 546 578 573 575 566 533 570 566 564 563 587 562 576 570 572 576 587 579 570 564 570 542 964 571 571 582 563 568 564 495 556 520 646 585 583 569 618 567 561 621 609 615 605 608 612

Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Exophiala Cladophialophora chaetospira Penicillium Penicillium Vir meleagrinum var. Penicillium Vir meleagrinum var. Penicillium Penicillium Paecilomyces Annulohypoxylon viridistratum Penicillium Penicillium Penicillium

Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium citrinum Penicillium rubens Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium multicolor niger Aspergillus Penicillium adametzioides Penicillium multicolor Penicillium multicolor Penicillium simplicissimum Penicillium chrysogenum Penicillium expansum Penicillium chrysogenum Penicillium citrinum Penicillium multicolor Penicillium glabrum Penicillium glabrum Penicillium glabrum Penicillium glabrum Lasiodiplodia theobromae Cladophialophora immunda stolliiTalaromyces stolliiTalaromyces Fonsecaea minima Cladophialophora immunda Cyphellophora reptans

Penicillium pulvillorum

p eiilu Eurotiales Penicillium sp. Eurotiales Penicillium Eurotiales Penicillium sp. sp. Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium sp. sp. sp.

p aclmcs Eurotiales Paecilomyces sp.

sp. sp. sp. sp. sp.

sp.

Exophiala

eiilu Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Aspergillus Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Eurotiales Penicillium Lasiodiplodia Eurotiales Talaromyces Eurotiales Talaromyces Fonsecaea

Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Cladophialopho Chaetothyriales Cladophialopho Cladophialopho Cyphellophora Eurotiales Penicillium Eurotiales Penicillium Annulohypoxylo

eiilu Eurotiales Penicillium

oroparaBotryosphaeria Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Xylariales

Eurotiomycetes ohdoye Dothideomycet Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Sordariomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes

Penicillium Lasiodiplodia theobromae Chaetothyriales Chaetothyriales Chaetothyriales Chaetothyriales Cladophialophora immunda stolliiTalaromyces stolliiTalaromyces Chaetothyriales Fonsecaea minima Cladophialophora immunda Exophiala Cladophialophora chaetospira Cyphellophora reptans Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium citrinum Penicillium rubens Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium multicolor Penicillium Penicillium multicolor Penicillium multicolor Penicillium Vir meleagrinum var. niger Aspergillus Penicillium adametzioides Penicillium pulvillorum Penicillium Vir meleagrinum var. Penicillium multicolor Penicillium Penicillium multicolor Penicillium Paecilomyces Penicillium simplicissimum Penicillium chrysogenum Penicillium expansum Penicillium chrysogenum Penicillium citrinum Annulohypoxylon viridistratum Penicillium multicolor Penicillium glabrum Penicillium Penicillium glabrum Penicillium glabrum Penicillium glabrum Penicillium

Diplomarbeit

s.P7J264 87%0 98.72% JN246044 P17 sp. s.JK21 M6499.8 0 sp. LC315644 99.48% KSM-F532 HM469409 JJK-2011 0 0 sp. sp. 99.65% LC373146 CLJ-3 98.78% JN246044 P17 sp. sp.

p C 24 B1889.6 0 99.66% AB217858 12546 JCM sp.

p MC1H645 09%0 0 0 0 90.98% 98.11% HQ634653 98.11% HQ634653 0 MACP1 HQ634653 MACP1 99.65% MACP1 HQ634648 KhNk2-2b sp. 86.78% sp. sp. KX822492 128948 CBS sp. sp. 78

CGMCC 3.18178 CGMCC

H-0P- M3458.4 0 87.54% KM232445 2H5-S0-P7-3

B 177E050 30%0 93.09% EU035403 114747 CBS

B 150F109 84%0 0 98.46% FJ150695 111530 CBS 0 0 91.59% MH864253 126871 CBS 0 92.03% MH863890 97.23% 126022 CBS MH864253 126871 CBS 89.56% NR_121346 113.85 CBS 0 0 0 0 99.82% MH863551 125543 CBS 99.82% MH863551 99.47% 125543 CBS MH863551 99.82% 125543 CBS MH863551 125543 CBS

B 0.3N_1719.5 0 0 99.65% NR_111781 99.82% 408.93 CBS NR_111781 408.93 CBS 0 99.63% MH858380 117.64 CBS

TC76 NR_077154 7861 ATCC

U12 M6489.0 0 0 0 0 99.30% 0 HM469408 99.11% 0 HM469408 KUC1627 98.93% 0 HM469407 KUC1627 KUC1626 0 99.30% 0 HM469407 99.30% HM469407 KUC1626 99.46% HM469407 KUC1626 99.81% HM469407 KUC1626 KUC1626 99.46% HM469407 99.64% 0 HM469407 KUC1626 KUC1626 0 0 99.47% HM469407 KUC1626 99.30% HM469407 KUC1626 0 99.82% HM469430 KUC5153 99.47% HM469407 KUC1626

U17 M6429.6 0 0 98.76% HM469412 KUC1678 99.65% HM469412 KUC1678

S 3 F7579.1 0 97.01% AF178527 239 WSF

K41 X7359.8 0 99.68% KX376325 EK14010

I65 T5849.3 0 99.83% LT558874 DI16-52 0 0 99.65% LT558876 99.82% DI16-54 LT558876 DI16-54

4-2K641 96%0 0 99.66% 99.82% KX664417 KX664354 F48-02 F25-01

R MH427065 OR1

X6249.0 0 95.80% KX961214

100%

3e-39

100% 100%

98% 99% 99%

9 24 99%

3 15 11 93% 99% 98% 99% 83 99% 99% 99% 7 30 97%

8 78 98%

9 42 99%

99% 99% 99% 99% 53 99% 49 17 98% 64 98% 99% 98% 99% 98% 99%

95%

99% 98% 99% 98% 98% 98% 99% 98% 98% 98% 99% 98% 98% 97%

98% 99% 98% 99% 98% 99%

97%

1 0 1

1 2 2016 et al Mayer 2016 et al Mayer USA surface floor 2 USA surface floor 1

7 Jang et al 2011 et al Jang 2011 et al Jang 7 2

2 Schoch et al 2014 et al Schoch 2014 et al Schoch 2 1 2019 Vu et al 2 8 1 1 3 1

3 Thailand Kuhnert et al 2017 et al Kuhnert Thailand 3

4 Jang et al 2011 et al Jang 2011 et al Jang 2011 et al Jang 2011 et al Jang 2011 et al Jang 2011 et al Jang 2011 et al Jang 4 2011 et al Jang 5 2011 et al Jang 6 4 4 3 2011 et al Jang 1 2011 et al Jang 3 2 2011 et al Jang 3 2011 et al Jang 4 1 3 0 orange natural infection Shie et al 2019 et al Shie infection natural orange 0

Nitta 2005 et al 2 2012 et al Daynes Australia soil field 7 3 Jang et al 2011 et al Jang 3 2 2012 et al Daynes Australia soil field 6

0 Shibata et al 2017 et al Shibata 0

Leucospermum Cladomyrma petalae Cladomyrma petalae Cladomyrma petalae Crematogaster Tetrathylacium macrophyllum Phyllostachys ba Cinchona ledger

Brazil Vu et al 2019 Vu et al Brazil 2019 Vu et al 2019 Vu et al Brazil Brazil

USA: Hawaii Marincowitz et al 2008 et al Marincowitz Hawaii USA: 2007 et al Crous China 2019 et al Maehara Japan

p n oa doma ant sp.

atdm dom ant dom ant dom ant

Shibata et al 2017 et al Shibata

Tuthill et al 2001 et al Tuthill

Redou et al 2015 et al Redou

Schoch et al 2014 et al Schoch

Vu et 2019 Vu et 2019 Vu et 2019 Vu et 2019

Schoch et al 2014 et al Schoch

Voglmayer et al 2011 et al Voglmayer 2011 et al Voglmayer 2011 et al Voglmayer 2011 et al Voglmayer 2017et al Vasse 2016 et al Guevara-Suarez 2016 et al Guevara-Suarez 2016 et al Guevara-Suarez

H.Oya H.Oya Akyildiz

ATGGCTTAGTGAGGCCT CACACCGCCCGTCGCTAC CACACCGCCCGTCGCTAC CACACCGCCCGTCGCTAC CATTATCGAGTTAGGGTC TCACACCTGTGTCCCTAG AAGGATCATTACCGAGT AAGGATCATTACCGAGT CTAAGTATAAGCAATCAT GCTTTGTACACACCGCCC TCACACCTGTGTCCCTAG AACAAGGTCTTCGTAGG AGAGGAAGTAAAAGTCG GGATCATTACCGAGTTA TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GGCTCAGTGAGGCCTTC ATGGAAGTAAAAAATCG TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GGAAGTAAAAGTCGTAA TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GTGACCTGCGGAGGATC AGGATCATTACTGAGTG TAATGCGTCCTTCCGCAG TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GGAAGTAAAAGTCGTAA TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC GGAAGTAAAAGTCGTAA TCCGTAGGTGAACCTGC GTAAAAATCGTAACAAG TCCGTAGGTGAACCTGC GTAAAAATCGTAACAAG CCTGCGGAAGGATCATT CAGCGGAGGGATCATTA TCCGTAGGTGAACCTGC TTACTGAGTGAGGGCCC TTACTGAGTGAGGGCCC TTACTGAGTGAGGGCCC TTACTGAGTGAGGGCCC TCCGTAGGTGAACCTGC TCCGTAGGTGAACCTGC

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5965 CIM TU 5951 CIM TU 5838 CIM TU 5819 CIM TU 5815 CIM TU 5785 CIM TU 5839 CIM TU 5836 CIM TU 6181 CIM TU 6082 CIM TU 6286 CIM TU 5719 CIM TU 7077 CIM TU 7015 CIM TU 6183 CIM TU 6187 CIM TU 6186 CIM TU 6179 CIM TU 6095 CIM TU 6052 CIM TU 6047 CIM TU 6045 CIM TU 6037 CIM TU TU CIM 6278 CIM TU 6277 CIM TU 6269 CIM TU 6233 CIM TU 6206 CIM TU 6194 CIM TU 6193 CIM TU 6192 CIM TU 6172 CIM TU 6167 CIM TU 6170 CIM TU 6164 CIM TU 6089 CIM TU 5808 CIM TU 5806 CIM TU 5786 CIM TU 6999 CIM TU 6998 CIM TU 6184 CIM TU 6096 CIM TU 6094 CIM TU 6093 CIM TU 6021 CIM TU 6000 CIM TU 5982 CIM TU 5970 CIM TU

The approved original version of this 5968 CIM TU thesis is available in print at TU Wien Bibliothek.

TU Wien

GCAAGTC GGTCGAGATGATCC CGNGGTCGAGATG TCGAGATGATCCTT GCTCGTCCGCGAGG GGGAMAGCTCGTC NGCTCGTCCGCGAG NNGCTCGTCCGCGA GCTCGTCCGCGAGG NNGCTCGTCCGCGA TCGTCCGCGAGGTC NGCTCGTCCGCGAG AGCTCGTCCGCGAG AATTTCTTGGGCGT TTAAATTTCTTGGG ATTAAATTTCTTGGG ATTAAATTTCTTGGG NNCATTATCGAGTG CATTACTGAGTGAG NCATTACTGAGAAG GGGCCTTCGGGTCC AAGGGCCTTCGGGT CTGAGTGAGGGCCC GNCATTACTGAGTG CTGAGTGAGGGCCC GNCATTACTGAGTG GNCATTACTGAGTG NNCATTACTGAGTG NCATTACTGAGAAG NCATTACTGAGTGA CATTACTGAGTGAG CATTACTGAGTGAG TACTGAGTGAGGGC TTACAACAAGGCTC CATTACAGTTGGGG CCTTATGGATGGGA CCTTATGGATGGGA ACTACGGAAGCC CCCGGTTTACCACC CCCCGGTCTAACCA ATTAACGAGCGAAG ATTANGAGCGAAGG CCTCCGTGGCCCGA TCACACCCTATGTG NCTCNTCACACCCT ATTACTGAGTTACC ATTACTGAGTTACC NGNCATTACCGAGT GNCATTACCGAGTT GNCATTACCGAGTT GNCATTACCGAGTT

1036 1041 1040 1050 1059 1043 1056 1048 1041 1048 1047 1041 1005 1005

563 563 560 524 526 507 508 525 538 538 521 535 526 526 531 526 518 516 567 544 912 513 526 558 558 506 535 542 569 573 536 821 570 824 569 564

Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Cladosporium Capnodium Endomelanconiopsis Endomelanconiopsis Endomelanconiopsis microspora Endomelanconiopsis Lasiodiplodia pseudotheobromae

Setophoma yingyisheniae Setophoma yingyisheniae Fumiglobus pieridicola Neophaeothecoidea proteae guyanensis Readeriella guyanensis Readeriella guyanensis Readeriella patrickii Readeriella nontingensReaderiella nontingensReaderiella patrickii Readeriella patrickii Readeriella guyanensis Readeriella guyanensis Readeriella Acrodontium crateriforme fraxini Pseudocercosporella fraxini Pseudocercosporella fraxini Pseudocercosporella Periconia byssoides Lophiotrema mucilaginosis smithii Corynespora Cladosporium tenuissimum spongiosaScorias spongiosaScorias Lasiodiplodia parva Lasiodiplodia parva Lasiodiplodia parva Setophoma yingyisheniae Setophoma yingyisheniae

Hermatomyces krabiensis Hermatomyces krabiensis Hermatomyces

s Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales sp Pleosporales sp Pleosporales sp sp sp sp sp sp sp sp sp sp

sp.

sp. sp. sp.

andu Capnodiales Capnodium

eohm Pleosporales Setophoma Pleosporales Setophoma Capnodiales Fumiglobus Capnodiales Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Capnodiales Readeriella Readeriella Capnodiales Acrodontium Pleosporales Periconia Pleosporales Lophiotrema Pleosporales Corynespora Capnodiales Capnodiales Scorias Scorias Lasiodiplodia Lasiodiplodia Lasiodiplodia eohm Pleosporales Setophoma Pleosporales Setophoma

epaohc Neophaeotheco Pseudocercospo Pseudocercospo Pseudocercospo Hermatomyces Hermatomyces Cladosporium Cladosporium Endomelanconio Endomelanconio Endomelanconio Endomelanconio Lasiodiplodia

oroparaBotryosphaeria Capnodiales Capnodiales Capnodiales Capnodiales Pleosporales Pleosporales Capnodiales Capnodiales Botryosphaeria Botryosphaeria Botryosphaeria Botryosphaeria Botryosphaeria Botryosphaeria Botryosphaeria

ohdoye Dothideomycet ohdoye Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet

Lasiodiplodia pseudotheobromae Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Setophoma yingyisheniae Setophoma yingyisheniae Setophoma yingyisheniae Setophoma yingyisheniae Fumiglobus pieridicola Neophaeothecoidea proteae guyanensis Readeriella guyanensis Readeriella guyanensis Readeriella patrickii Readeriella nontingensReaderiella nontingensReaderiella patrickii Readeriella patrickii Readeriella guyanensis Readeriella guyanensis Readeriella Acrodontium crateriforme fraxini Pseudocercosporella fraxini Pseudocercosporella fraxini Pseudocercosporella NR_164039 255437 HMAS Periconia byssoides mucilaginosis Lophiotrema krabiensis Hermatomyces krabiensis Hermatomyces smithii Corynespora Cladosporium Cladosporium tenuissimum spongiosaScorias spongiosaScorias Capnodium Endomelanconiopsis Endomelanconiopsis Endomelanconiopsis microspora Endomelanconiopsis Lasiodiplodia parva Lasiodiplodia parva Lasiodiplodia parva

Diplomarbeit

s. C11p18H614 52%0 95.27% HQ631045 SC11d10p11-8 sp.

sp sp sp sp sp sp sp sp sp sp sp sp

s.L-5E441 94%0 99.42% EF424419 LD-N5 sp.

s.F13K773 86%0 0 0 98.68% 97.98% KU747730 KU747730 F1133 97.86% F1133 KU747730 F1133 sp. sp. sp. 79

MFLUCC:160249b MFLUCC:160249b

CGMCC 3.19527 CGMCC 3.19527 CGMCC 3.19527 CGMCC 3.19527 CGMCC MUT:4372

B 278 R138 8.2 1e-133 83.82% NR_153985 F23788UBC

T:2-6M430 98%0 99.81% MF473304 DTO:324-C6

B 150E770 98%0 0 6,00E-166 0 0 87.36% 99,81% EU707898 0 114129 CBS 99,60% EU707900 0 117550 CBS 100,00% 0 EU707900 117550 CBS 0 EU707900 91,12% 117550 CBS MH863439 124987 CBS 91,02% MH863439 91,02% 124987 CBS 98,85% MH863439 124987 CBS 98,85% EU707900 117550 CBS EU707900 117550 CBS

B:2.3G249 8.9 5,00E-137 3,00E-134 83.69% GU214696 83.70% CBS:325.33 GU214696 CBS:325.33

B 5.7K766 9.5 0 96.45% KF766165 353.97 CBS

B 5.8M816 88%0 0 0 98.87% MH861166 99.05% 456.78 CBS MH861166 99.05% 456.78 CBS MH861166 456.78 CBS

P:44 Q5769,8 0 0 90,58% 0 90,58% GQ852786 CPC:14444 GQ852786 CPC:14444 99,81% GU214682 11509 CPC

M40 X6009.2 0 99.42% JX464090 CMM4008

R3F1K984 90%0 0 99,02% 99,02% KX958044 KX958044 3R-3-F01 3R-3-F01

E17J893 14%0 0 0 0 0 0 91.43% 0 91.62% 0 JN859337 91.36% 0 JN859337 REF117 91.45% 0 JN859337 REF117 91.36% 0 JN859337 REF117 91.17% 0 JN859337 REF117 91.38% JN859337 REF117 91.53% JN859337 REF117 91.46% JN859337 REF117 91.53% JN859337 REF117 91.34% JN859337 REF117 90.98% JN859337 REF117 JN859337 REF117 REF117

50338

13K949 13%0 81.36% KY984299 L133

NR_164602 NR_164602 NR_164602 NR_164602 0 99,59% 1,00E-147 KC339227 1,00E-147 90.36% KX525750 90.36% KX525750

C5179.0 0 99.10% KC954157

100% 100% 100% 100%

100%

0 0 0 0

100% 100%

99%

8 20 98%

9 11 12 98% 99% 97%

0 40 95% 40 40% 40%

97% 90 90 96% 96%

98% 99% 92% 9 68 99% 45 98% 49 99% 49 46 95% 46 96% 96% 97% 94% 99% 99% 98%

89% 90% 90% 90%

6 88 96% 9 24 99%

8 176 98%

95%

1 45 45 47 40 51% 47 51% 47 52% 47 50% 45 51% 46 50% 45 51% 46 50% 48 50% 50% 50% 50% 98%

96% 98%

6 Vu et al 2019 Vu et al 2019 Vu et al 2019 Vu et al 6 5 5 1 leaf litter leaf 1 litter leaf 2 2009 et al Crous Korea South litter leaf 6 litter leaf 6 1

0 0 0 0

0 dead wood China Phookamsak et al. 2018 et al. Phookamsak China wood dead 0

1 Indoor air China Bensch et al 2018 et al Bensch China air Indoor 1

5 5 0 leaf litter leaf 0 2018 et al Ding 3

forest soil Thailand Tibpromma et al 2016 et al Tibpromma 2016 et al Tibpromma Thailand Thailand soil forest soil forest

aphid Crous et al 2009 et al Crous 2009 et al Crous aphid aphid

Saccharum officinarum

uieu om comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus comm Juniperus Camellia sinens Camellia sinens Camellia sinens Camellia sinens japonicaPieris Protea repens o material type Eucalyptus oblo Eucalyptus oblo Angelica syslves Fagus sylvatica Campyloneurum Campyloneurum Campyloneurum indic Mangifera

Australia Vu et al 2019 Vu et al 2019 Vu et al Australia Australia

Hungary Knapp et al 2012 et al Knapp 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp 2019 et Liu al Hungary 2019 et Liu al Hungary 2019 et Liu al China 2019 et Liu al China 2014et al Bose China China Canada 2008 et al Crous Africa South Guiana French Guiana French Vu et al2019 Guiana French 2009 Crous,P.W., Australia 2009 Crous,P.W., Australia Australia Guiana French Guiana French Shimoki Japan: Shimoki Japan: 2014 et al Markovskaja Ligury, Pu Italy: Lithuania 2017 et al Voglmayer Austria 2017 et al Olmo-Ruiz Del 2017 et al Olmo-Ruiz Del Panama Panama 2017 et al Olmo-Ruiz Del Panama 2014 et al Marques Brazil

Slippers et al 2013 et al Slippers

Shrestha et al 2011 et al Shrestha

Crous et al 2008 et al Crous 2008 et al Crous 2008 et al Crous 2018 et al Crous 2018 et al Crous 2016 etLiu al 2016 etLiu al 2013 et al Panno

H.Oya H.Oya Akyildiz

TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG GGGTCGTGTGTCATAAC GGGTCGTGTGTCATAAC GGGTCGTGTGTCATAAC GGGTCGTGTGTCATAAC CCGTAGGTGAACCTGCG ATGGCTCAGTGAGGCCT ATGGCTCAGTGAGGCCT ATGGCTCAGTGAGGCCT ATGGCTCAGTGAGGCCT ACAAGGTCTCCGTAGGT GGGCCGGAAAGTTCGTC GGGCCGGAAAGTTCGTC ACAAGGTCTCCGTAGGT ACAAGGTCTCCGTAGGT ATGGCTCAGTGAGGCCT ATGGCTCAGTGAGGCCT GCAACTATACGGTGAAA CCGAAGTGAGGGCCTCG CCGAAGTGAGGGCCTCG AAAAGTCGTAACAAGGT GGAAGTAAAAGTCGTAA CCTTCCGTAGGGTGACCT CCGCGAGGTTGGGTTGA CCGCGAGGTTGGGTTGA CTACCGATTGAATGGCTC TCCGTAGGTGAACCTGC ATTGAATGGCTCGGTGA AAGTATAAGCAATCTATA AAGTATAAGCAATCTATA TCTTGGTCATTTAGAGGA CGAGTTTTGGGGGCTCT CGAGTTTTGGGGGCTCT AACAAGGTTTCCGTAGG CGAGTTTTGGGGGCTCT ATAACAAGGTTTCCGTA ATAACAAGGTTTCCGTA ATAACAAGGTTTCCGTA TGAACCTGCGGAAGGAT

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5508 CIM TU 5710 CIM TU 5494 CIM TU 6983 CIM TU 5841 NEW CIM TU 5824 NEW CIM TU 5774 CIM TU 5716 CIM TU 5804 CIM TU 5802 CIM TU 5801 CIM TU 7032 CIM TU 7029 CIM TU 5991 CIM TU 5972 CIM TU 6237 CIM TU 5956 CIM TU 6321 CIM TU 6312 CIM TU 6311 CIM TU 6310 CIM TU 6301 CIM TU TU CIM 6263 CIM TU 6262 CIM TU 6261 CIM TU 6260 CIM TU 5987 CIM TU 5980 CIM TU 5974 CIM TU 5985 CIM TU 5977 CIM TU 5993 CIM TU 5958 CIM TU 5955 CIM TU 6071 CIM TU 6068 CIM TU 6240 CIM TU 6238 CIM TU 6236 CIM TU 6235 CIM TU 6244 CIM TU 6239 CIM TU 6245 CIM TU 5979 CIM TU 5826 CIM TU 5566 CIM TU 5812 CIM TU 5568 CIM TU 5567 CIM TU

The approved original version of this thesis 7001 CIM TU is available in print at TU Wien Bibliothek.

TU Wien

TCGATTT TTACAGTATTCTTTT AGTATTCTTTTTGCC GTATTCTTTTTGCCA ATTACAGTATTCTTT TATTGATATTTATTA TATTGATATTTATTA CNANTTTTTTAATCA TAATATTTGTGAAA TTAAGAATTGATAA AATATTTGTGAAAT ACAGCAAACAATAA GTATTCTTCGGTGG AGTTTAGGCGTGTG TTTGCTTAATTGCAC ATAATATTCTTACAC GAATGAAAAGTGCT GNCATTACAGTTTT TTACAGTATTCTTTT ACAGTATTCTTTTTG AGTATTCTTTTTGCC GTATTCTTTTTGCCA CATTACCGAGTTTACAACTCCCAAACCCCTG TACAGTATTCTTTTT TTCTTTTTGCCAGCG TACAGTATTCTTTTG TTACAGAATGAAAG TTCTTTTTGCCAGCG TTACAGTATTCTTTT GAGTGAGGGCCCTC TTACTGAGTGAGGG CACGCTCTGCGGCC ACCTCCTTTCTAAGG ACAGTAGCTCAGCG ATTACAGAATTCCT GAGTTCATGCCCGA AGAGTTCATGCCCG ATTATAGAGAATAC ATACCGCCCTCCGG ATTATAGAGAATAC GCGCAACACTTGCC TATCGTGGGGGCTC TTAAAGAGTAAGGG AGTAAGGGTGCTCA TTAAAGAGTAAGGG GCTCGTCCGCGAGG GCTCGTCCGCGAGG GCTCGTCCGCGAGG TCGTCCGCGAGGTC ATGATCCTTCCGCG CTCGTCCGCGAGGT

1128 1054 1049 1045 1048 1049

381 498 538 587 627 614 609 536 620 607 581 488 616 616 556 560 586 951 505 510 519 529 518 538 967 520 566 561 566 799 628 613 618 630 344 344 289 336 347 344 327 597 522 508

cwnimcsvniievr Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Galactomyces Galactomyces Galactomyces pseudocandidus Candida Fusarium Penicillium Incrucipulum pseudosulphurellum Preussia Aureobasidium melanogenum Aureobasidium melanogenum Aureobasidium melanogenum Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales

Kodamaea ohmeri Candida parapsilosis Candida cylindracea guilliermondii Meyerozyma nepalensis Debaryomyces nepalensis Debaryomyces nepalensis Debaryomyces fabryi Debaryomyces nepalensis Debaryomyces guilliermondii Meyerozyma Candida orthopsilosis fabryi Debaryomyces fabryi Debaryomyces Penicillium echinulatum Anthopsis catenata Unclear Sclerotinia sclerotiorum Sclerotinia sclerotiorum Infundichalara microchona Infundichalara microchona Infundichalara microchona Teichospora quercus Geotrichum candidum Geotrichum candidum Geotrichum candidum Geotrichum candidum Candida cylindracea Candida tropicalis

Paraphaeosphaeria neglecta

p rusa Pleosporales Preussia sp.

s uaimHypocreales Fusarium sp

p eiilu Eurotiales Penicillium sp.

s Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales sp sp sp sp sp sp

sp. sp.

Candida Candida

Kodamaea Candida Candida Meyerozyma Meyerozyma Candida Eurotiales Penicillium Anthopsis Helotiales Helotiales Sclerotinia Sclerotinia Pleosporales Teichospora Candida Candida Candida

Schwanniomyces Schwanniomyces Schwanniomyces Schwanniomyces Galactomyces Galactomyces Galactomyces Galactomyces Galactomyces Galactomyces Galactomyces Debaryomyces Debaryomyces Debaryomyces Debaryomyces Debaryomyces Debaryomyces Debaryomyces Paraphaeospha Helotiales Incrucipulum Infundichalara Infundichalara Infundichalara Aureobasidium Aureobasidium Aureobasidium

acaoyeaSaccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Chaetothyriales Pleosporales Helotiales Helotiales Helotiales Dothideales Dothideales Dothideales

ohdoye Dothideomycet Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes sordariomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Eurotiomycetes Eurotiomycetes Eurotiomycetes Dothideomycet Leotiomycetes Leotiomycetes Leotiomycetes Leotiomycetes Leotiomycetes Leotiomycetes Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet Dothideomycet

Pleosporales Pleosporales cwnimcsvniievr Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. Galactomyces Galactomyces Galactomyces pseudocandidus Galactomyces candidum Galactomyces candidum Galactomyces candidum Galactomyces candidum Candida Candida cylindracea Candida tropicalis Kodamaea ohmeri Candida parapsilosis Candida cylindracea guilliermondii Meyerozyma nepalensis Debaryomyces nepalensis Debaryomyces nepalensis Debaryomyces Fusarium fabryi Debaryomyces nepalensis Debaryomyces guilliermondii Meyerozyma Candida orthopsilosis fabryi Debaryomyces fabryi Debaryomyces Penicillium echinulatum Penicillium Anthopsis catenata Paraphaeosphaeria neglecta Incrucipulum pseudosulphurellum Sclerotinia sclerotiorum Sclerotinia sclerotiorum Infundichalara microchona Infundichalara microchona Infundichalara microchona Teichospora quercus Preussia Aureobasidium melanogenum Aureobasidium melanogenum Aureobasidium melanogenum Pleosporales Pleosporales Pleosporales Pleosporales Pleosporales

s.C297 X1268.5 4,00E-173 88.65% KX710256 CF279773 sp. sp

Diplomarbeit

s.KMF3 C1649.2 0 98.92% LC315644 KSM-F532 sp.

sp sp sp sp sp sp

sp. sp. 80

UFMG-CM- Y3177 UFMG-CM- Y3177 UFMG-CM-

Be21A2KM115166 NBPen2013A12

PM018LKP132356 PMM10-1288L

N:-14 C3508.8 3e-154 86.98% LC438570 TNS:F-81441

O_ES F1039.0 9e-172 1e-175 99.40% 3e-176 1e-155 99.14% KF112073 99.42% TOM_YEAST KF112072 96.94% TOM_YEAST KF112071 TOM_YEAST KF112070 TOM_YEAST

N1F59L060 9.0 0 90.40% LC076104 VN11-F0569

TC472J680 74%0 0 97.45% 97.30% JX648201 46762 ATCC JX648201 46762 ATCC

B:436N_509 03%e15 52%2 e-175 90.33% NR_159069 CBS:143396

B:2.4J460 02%4,00E-73 80.24% 97% JX496101 96% CBS:627.94 3e-179 95% 2e-176 3e-179 89.23% NR_154074 89.53% CBS:175.74 NR_154074 89.23% CBS:175.74 NR_154074 CBS:175.74

B 9.1N_56344%2e-141 84.44% NR_159623 492.81 CBS

B:23 J0039.0 0 99.20% KY104257 KJ705003 CBS:12037 CBS:12037 KY104257 CBS:12037

B:07 Y0489.8 2,00E-117 92.88% KY103458 CBS:10073

M-Y3H502 9.1 0 99.81% HM560021 EML-GYP3

B:04KY105408 KY105408 CBS:3024 KY105408 CBS:3024 KY105408 CBS:3024 CBS:3024

B:30K123 94%0 0 99.42% KY102038 CBS:6330 93.73% KY102320 0 KY102039 CBS:2193 CBS:7869 KJ705003 KJ705003 2334 CBS 2334 CBS 99.50% KJ705003 2334 CBS

C46AY391846 MCO456

A54 Y5519.2 0 99.82% KY659501 KY659501 KAS5840 KY659501 KAS5840 KAS5840

-71 J004 95%0 KJ705004 Y-17914 99.51% KJ705004 KJ705004 Y-17914 Y-17914

E17J893 14%0 91.48% JN859337 REF117 E17J893 13%0 0 0 0 91.36% 91.31% JN859337 91.23% JN859337 REF117 91.31% JN859337 REF117 JN859337 REF117 REF117

13 T64890%30E1986% 3,00E-129 89.00% KT268448 P1130

G921 9.0 3,00E-137 3,00E-137 92.80% MG599261 92.80% MG599261

U816 9.0 0 99.60% EU288196

100% 100% 100% 100%

100% 100% 100% 100% 100% 100% 100%

100% 100% 100%

100% 100%

0 0 0 0

0 0 0 0 0 0 0

0 0 0

0 0

100% 100%

100%

0%10 100% 100% 100% 100%

9 25 25 99% 99%

8 59 98%

99% 81 35%

0 84 90% 99% 99%

96% 98% 97% 96%

98%

9 13 14 99% 99% 99% 98% 98% 99% 99%

98% 99% 99%

6 20 96%

9 58 99%

1 46 51% 1 47 47 46 47 51% 51% 51% 51%

9 66 99%

98% 98%

96% 33 96% 99%

56 53 56

3 2014 et Feng al 5

0 soil South Africa Vu et al 2016 Vu et al Africa South 2016 Vu et al Africa South 2016 Vu et al Africa South 2016 Vu et al Africa South soil 0 soil 0 soil 0 soil 0

0 Feng et al 2014 et Feng al 2016 Vu et al 0 0

1 house dust Humphries et al 2017 et al Humphries dust house 1

0 Wensleydale cheese Banjara et al 2015 et al Banjara cheese Wensleydale 0 0 Vu et al 2016 Vu et al 2015 et al Irinyi France 2014 et Feng al 0 0 2004 et al Rycovska 4 0

Lee 2012 et al 2014 et Feng al 2014 et Feng al 1 0 0 6 Shibata et al 2017 et al Shibata 6

2 2 2014 et Feng al 3

0 house dust Humphries et al 2017 et al Humphries 2017 et al Humphries dust house 0 dust house 0

3 soil Vu et al 2016 Vu et al soil 3 2014 et Feng al 3

rotting wood Brazil Lopes et al 2018 et al Lopes 2018 et al Lopes Brazil rotting wood Brazil rotting wood

soil Vu et al 2016 Vu et al soil

food Portugal Vu et al 2016 Vu et al Portugal food

oau yoe Solanum lycope Solanum lycope Solanum lycope Solanum lycope of leaf gale var Myrica olerace Brassica olerace Brassica Pinus sylvestris Pinus sylvestris Pinus sylvestris Quercus Retama sphaero comm Juniperus comm Juniperus comm Juniperus comm Juniperus Microthlaspi pe comm Juniperus

Mlso Melastom

s.b br sp.

Canada Verkley et al 2014 Verkley et al Canada

Germany Vu et al 2019 Vu et al Germany

USA Bourret et al 2013 et al Bourret 2013 et al Bourret 2013 et al Bourret 2013 et al Bourret USA USA USA 2015 et al Luong USA Vietnam 2019 et al Tochihara 2013 et al Naumann Japan 2013 et al Naumann Australia Australia 2016 et al Chen Netherlands 2016 et al Chen 2018 et al Crous Netherlands 2016 et al Chen Netherlands France Spain 2012 et al Knapp 2012 et al Knapp Hungary 2012 et al Knapp Hungary 2012 et al Knapp 2016 et al Glynou Hungary Hungary 2012 et al Knapp France Hungary

Vu et al 2016Vu et al

Desnos-Ollivier et al 2008 et al Desnos-Ollivier 2 et al Gonzalez-Menendez

H.Oya H.Oya Akyildiz

CGTAACAAGGTTTCCGTA CGTAACAAGGTTTCCGTA CGTAACAAGGTTTCCGTA CGTAACAAGGTTTCCGTA TATTGATATTTATTATTT TATTGATATTTATTATTT GTACACACCGCCCGTCG TCCCTTTGTACACACCGC TCCCTTTGTACACACCGC TCCCTTTGTACACACCGC TCCCTTTGTACACACCGC AAGGATCATTAAAGTATT TCGTAACAAGGTTTCCGT GGGGGCAACTCCATTCT GAGGCATCGGGATGGAA CTGCCCTTTGTACACACC TTTGTACACACCGCCCGT TTTAAGTCCCCTGCCCTT AAGGATCATTACAGTATT AAGGATCATTACAGTATT AAGGATCATTACAGTATT GGTCTGTGACGCGGAGG AAGGATCATTACAGTATT AAGGATCATTACAGTATT TTTAAGTCCCCTGCCCTT GTCGTAACAAGGTTTCC AAGGATCATTACAGTATT AAGGATCATTACAGTATT TTACCGAGTGAGGGCCC GGAAGTAAAAGTCGTAA GTAACAAGGTTTCCGTA GCCTTTGCAGCTGGAGA TCTTGGTCATTTAGAGGA AGTTCATGCCCGAAAGG AGTTCATGCCCGAAAGG GTAACAAGGTTTCCGTA GTAACAAGGTTTCCGTA GTAACAAGGTTTCCGTA GTAACAAGGTTTCCGTA GGATCATTATCGTGGGG AGTGAGGCCTTCGGACT AGTGAGGCCTTCGGACT AGTGAGGCCTTCGGACT TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCTTGGTCCATTTAGAGG TCGACCGCAAGGTCGAG TCTTGGTCCATTTAGAGG

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5796 CIM TU 5794 CIM TU 5629 CIM TU 6215 CIM TU 6033 CIM TU 5643 CIM TU 6058 CIM TU 5596 CIM TU 5845 CIM TU 6295 CIM TU 6178 CIM TU 6298 CIM TU 7009 CIM TU 6990 CIM TU 6989 CIM TU 6986 CIM TU 6985 CIM TU 6984 CIM TU 6251 CIM TU 6249 CIM TU 6246 CIM TU 6289 CIM TU 6242 CIM TU TU CIM 5748 CIM TU 5652 CIM TU 5733 CIM TU 5625 CIM TU 5619 CIM TU 5752 CIM TU 5641 CIM TU 5640 CIM TU 5753 CIM TU 5754 CIM TU 5755 CIM TU 5644 CIM TU 5491 CIM TU 5824 CIM TU 5841 CIM TU 6040 CIM TU 5793 CIM TU 5787 CIM TU 5761 CIM TU 5763 CIM TU 5760 CIM TU 5759 CIM TU 5762 CIM TU 5792 CIM TU 5772 CIM TU 5769 CIM TU

The approved original version of this 5795 CIM TU thesis is available in print at TU Wien Bibliothek.

tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2 ITS1&2

TU Wien

α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α

EF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R SR6R

TCATTCC ATTCAATTGTGCCC ACGTTCAATTGTGC ACATTCAATTGTGC ACATTCAATTGTGC AATTTTCGCGTCGA AATTGTGCCCGACA CYCCGCTTTCCATTA ATTCAATTGTGCTCG WTCAATTGTGCTCG CATTCAATTGTGCTCG CATTCAATTGTGCTCG AGCGTCATGATTTT TCTGGTCACTAGCG GGATTTTCCCCTCAC CTCGCAGGATCTGC ACCGACCTGTCCAG TTTTCCCTACGATTCG TTGGTGGGGCATTT TTCCCCTACGACTCG TCGNAACGTGCCCG TCGATTTTCCCCTAC TCGATTTTCCCCTAC NATNTTCCCCTACG GATTTTCCCTACGA GATNTTCCCTACGA CNATTTTCCCTACGA CGTGCCCGCTACCC CATCGATTTTCCCCT ATTTTCCCTACGATT GCAACGTACTGACA CGTTCATTGTGCCC CCGACAATTCTGCA ATTGTGNCCGACAA ATTCAATTGTGCCC AGCCGGCACCGACC ACATTCAATTGTGC TTTCCTAGGCGCCA CATCCTCGTACCCTTTCCCTAG ATCCTCGTACCCTTT CATTACAGTATTCTTTT ACTCCCAACCCTGT TTACAGAGTTACTA AGGGNCATTACAGG AGTATTCTTTTTGCC AGTATTCTTTTTGCC ACAGTATTCTTTTTG GTATTCTTTTTGCCA GNCATTACAGTATT NGTTTTTTTACAACA CAGTATTCTTTTGCC

1125 1132 1133 1338 1101 1126 1077 1059 1132 1051 1125 1135 1156 1088 1143 1095 1149 1084 1167 1146 1159 1125 1154 1106 1160 1107 1139 1176 1158 1000 1186 1151 1090 1145 1176 1193 1117

597 162 631 535 607 555 622 616 623 610 626 360 586

rcoem azau Hpc Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Metarhizium guizhouense (Meta vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. Trichoderma Trichoderma Trichoderma Chlam var. Chloridium virescens Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var.

Trichoderma harzianum Trichoderma harzianum nepalensis Debaryomyces crousii Hawksworthiomyces apiosperma Pseudallescheria nepalensis Debaryomyces nepalensis Debaryomyces nepalensis Debaryomyces Kodamaea ohmeri guilliermondiiMeyerozyma

Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Neopestalotiopsis clavispora lozoyensis Glarea asturiensis Atrocalyx Trichoderma barbatum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum bassiana Beauveria Trichoderma simmonsii Trichoderma simmonsii Trichoderma simmonsii Trichoderma atrobrunneum

s rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma sp sp sp

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Kodamaea Meyerozyma

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Neopestalotiop Hypocreales Metarhizium Hypocreales Hypocreales Fusarium Fusarium Hypocreales Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Fusarium Hypocreales Fusarium Debaryomyces Hawksworthiom Pseudallescheria Chloridium Schwanniomyces Schwanniomyces Debaryomyces Debaryomyces Debaryomyces

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Helotiales Pleosporales Glarea Atrocalyx Hypocreales Trichoderma Hypocreales Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Hypocreales Fusarium Fusarium Hypocreales Fusarium Hypocreales Beauveria Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma

acaoyeaSaccharomyceta Xylariales Saccharomyceta Ophiostomatales Microascales Chaetosphaeria Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta Saccharomyceta

Saccharomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycet Sordariomycetes Leotiomycetes Dothideomycet Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Saccharomycetes Sordariomycetes Sordariomycetes Sordariomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes Saccharomycetes

Meyerozyma guilliermondiiMeyerozyma Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Trichoderma aggregatum Neopestalotiopsis clavispora Metarhizium guizhouense (Meta lozoyensis Glarea asturiensis Atrocalyx Trichoderma barbatum vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum Fusarium oxysporum 0 Fusarium oxysporum 0 vasin sp. Fusarium oxysporum f. 0 vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. vasin sp. Fusarium oxysporum f. Fusarium oxysporum 90.68% vasin sp. Fusarium oxysporum f. MF371223 91.42% bassiana Beauveria MF371223 91.71% TC278 Trichoderma simmonsii MF371223 TC278 Trichoderma harzianum TC278 Trichoderma harzianum Trichoderma simmonsii Trichoderma simmonsii Trichoderma atrobrunneum sp Trichoderma sp Trichoderma sp Trichoderma nepalensis Debaryomyces crousii Hawksworthiomyces apiosperma Pseudallescheria Chlam var. virescens Chloridium Schwanniomyces v vanrijiae var. Schwanniomyces v vanrijiae var. nepalensis Debaryomyces nepalensis Debaryomyces nepalensis Debaryomyces Kodamaea ohmeri Diplomarbeit 81

CS289 U4828,8 0 0 89,88% 0 EU248862 97,84% MFLUCC12-0280 97,99% CBS:258.90 0 KT323873 0 KT323873 0 AuSeed14 0 AuSeed14 97,67% 0 97,60% 97,84% KT323869 97,82% KT323873 97,86% CDR1072 KT323874 AuSeed14 KT323874 AuK24232 AuK24232 KT323873 AuSeed14

MS286 Y8029,2 0 0 0 0 0 95,72% 94,52% 95,23% 0 96,19% KY688062 HMAS:248863 95,91% KY688062 HMAS:248863 KY688062 0 HMAS:248863 KY688062 0 90,96% HMAS:248863 KY688062 0 HMAS:248863 0 MF095877 0 97,28% 97,06% 20868 ATCC 97,09% OF MH828020 97,18% TC700 MH828020 97,07% MH828020 0 MH828020 MS15 MH828020 MS15 MS15 96,96% MS15 MS15 MH828020 MS15

W 641E697 91%0 99.17% EF639871 06.471 WM

B 204M846 90%0 99.06% MH864069 126074 CBS

M351K365 40%0 94.02% KX396551 CMW37531

B:23 Y0279.3 0 99.83% KY104257 CBS:12037

B:04KY105408 KY105408 CBS:3024 CBS:3024

PCS3F579 11%0 91.12% FJ577790 0 PPRC S23 99.36% 0 KJ705003 0 2334 CBS 0 99.84% KJ705003 99.68% KJ705003 2334 CBS 99.72% KJ705003 2334 CBS KY103876 2334 CBS CBS:2038

EF4 T7019.7 1,00E-56 93.17% KT279021 LESF343

34K651 9.1 0 2922 97.91% KJ665714 S314 KJ665393 S414

8 J6719.2 0 0 96.22% KJ665721 S86 97.60% KJ665721 S86

X9049,6 0 99,06% JX399044 XM_008087493

F2249,8 0 0 0 0 0 97,38% 0 98,03% 98,03% 97,84% KF923284 97,49% KF923284 97,36% KF923284 KF923284 KF923284 KF923284 0 93,63% MG912916 0 90.58% AY531920

30%0 93,07%

100% 100%

0 0

0%25 22 100% 100% 26 28 25 100% 100% 25 100% 100%

0%58 40 46 100% 100% 100% 32 34 34 32 100% 100% 100% 100% 36 100%

0%24 100% 100% 100%

0%53 100%

75%

4 28 21 21 23 94% 26 94% 28 94% 92% 93% 93% 73 99% 93 96%

95%

99% 6 11 96% 29 89%

97% 98%

9 45 99% 26 99%

7 92 77% 24 99%

9 46 54 99% 99% 90 90% 34 99%

3 93 85 81 83% 82% 82% 99%

98% 99% 99% 99%

79%

5 Vu et al 2019 Vu et al 5

1 Vu et al 2016 Vu et al 1

0 soil South Africa Vu et al 2016 Vu et al Africa South 2016 Vu et al Africa South soil 0 soil 0

0 Spain Jaklitsch et al 2015 et al Jaklitsch Spain 0 2014 et Feng al 0

5 Australia Delhaes et al 2008 et al Delhaes Australia 5

4 Feng et al 2014 et Feng al 2014 et Feng al 2014 et Feng al 4 2016 Vu et al 1 2 food 1

wilted cotton plant Bell,A.A., et al 2019 et al Bell,A.A., 2019 et al Bell,A.A., 2019 et al Bell,A.A., plant cotton wilted 2019 et al Bell,A.A., plant cotton wilted plant cotton wilted plant cotton wilted 2019 et al Bell,A.A., plant cotton wilted

Lepidoptera China Bischoff,J.F., et al 2009 et al Bischoff,J.F., China Lepidoptera

wilted cotton plant Bell,A.A., et al 2019 et al Bell,A.A., plant cotton wilted

odwtrfo ma plant dead fro water pond Atta capiguara

China Zhu,Z.X. et al 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China China China Spain

Crotia Jaklitsch et al 2015 et al Jaklitsch Crotia

Italy Jaklitsch et al 2015 et al Jaklitsch Italy 2015 et al Jaklitsch Italy

Spain Chen,L., et al 2019 et Chen,L., al China Spain Fazenda Brazil:

Rehner et al 2005 et al Rehner

de Beer et al 2016 et al Beer de

Ortiz,C.S., et al 2017 et al Ortiz,C.S., 2017 et al Ortiz,C.S., 2017 et al Ortiz,C.S., 2017 et al Ortiz,C.S., 2017 et al Ortiz,C.S., 2017 et al Ortiz,C.S.,

Chen,K., et al 2017 etChen,K., al 2017 etChen,K., al 2017 etChen,K., al

Ortiz,C.S., et al 2017 et al Ortiz,C.S.,

Chen,K., et al 2017 etChen,K., al 2017 etChen,K., al 2017 etChen,K., al

Druzhinina et al 2010 et al Druzhinina Chen et al 2017 et al Chen 2017 et al Chen 2017 et al Chen

aaahhkmuaSS Maharachchikumbura,S.S. 2018 et al Jaklitsch,W.M., 2016 et al Montoya

H.Oya H.Oya Akyildiz

CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CCTGATTCTCCCTCCACA CCTGATTCTCCCTCCACA CCTGATTCTCCCTCCACA CCTGATTCTCCCTCCACA CCTGATTCTCCCTCCACA CTTGATCTACAAGTGCG TATCGTAAGTCGCCTGCC ATGCACATTAACGTGGTC TGAGCGCACACGTTTCCT ATCTCTTCTTCGCACTCA GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG GGCCACGTCGACTCTGG AGGACAAGACTCACATC TCGATTCTCCTCCACATT GCCCGACAATTCTGCAG CAACGAAATCTCCCTCCT TCGGATTCTCCCTCCACA TCGATTCTCCTCCACATT CTCGATTCTTCCTCCTTCA CTTTTTGCATCAATCTCTT CTTTTTGCATCAATCTCTT CTTTTTGCATCAATCTCTT AAGGATCATTACAGTATT TGAACCAGCGGAGGGAT TAACAAGGTCTCCGTTG GTTGTACACACCGCCCGT CGTAACAAGGTTTCCGTA CGTAACAAGGTTTCCGTA AAGGATCATTACAGTATT AAGGATCATTACAGTATT AAGGATCATTACAGTATT TCGTAACAAGGTTTCCGT TTTAAGTCCCCTGCCCTT

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5740 CIM TU 5726 CIM TU 5725 CIM TU 5749 CIM TU 5741 CIM TU 5736 CIM TU 5609 CIM TU 5594 CIM TU 5599 CIM TU 5505 CIM TU 5731 CIM TU 5734 CIM TU 5618 CIM TU 5739 CIM TU 5738 CIM TU 5729 CIM TU 5615 CIM TU 5613 CIM TU 5607 CIM TU 5617 CIM TU 5750 CIM TU 5728 CIM TU 5724 CIM TU TU CIM 5737 CIM TU 5608 CIM TU 5653 CIM TU 5612 CIM TU 5642 CIM TU 5611 CIM TU 5638 CIM TU 5598 CIM TU 5624 CIM TU 5622 CIM TU 5639 CIM TU 5614 CIM TU 5569 CIM TU 5756 CIM TU 5488 CIM TU 5730 CIM TU 5735 CIM TU 5497 CIM TU 5637 CIM TU 5743 CIM TU 5742 CIM TU 5723 CIM TU 5722 CIM TU 5616 CIM TU 5606 CIM TU 5758 CIM TU

The approved original version of this 5727 CIM TU thesis is available in print at TU Wien Bibliothek.

tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1-

TU Wien

α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α α

EF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1 728fEF1

TATGGCG TTCAATTGTGCCCG TCRACAATTTTTCAT TCNCGTTCAATTGT TCGACAAYTTTTCAT TCCACTCTCACTGCC NCGACNATTCTGCA MCCGCTTTGCATTA KCNNCCCGCTTTGC GTTTGNTTTTAGTG CWNMCCGCTTTGC CTTGWGMACCCCC CKMGTCGACAATTT CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CATTCAATTGTGCCCG CANATTTTTTTTGCT CAATTGTGCCCGAC ATTGTGNCCGACNA ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC ATTCAATTGTGCCC

1044 1095 1153 1010 1064 1113 1064 1008 1071 1092 1156 1150 1150 1136 1119 1134 1161 1137 1147 1156 1152 1109 1137 1061 1126 1126 1119 1051 1160 1134 1127 1045 1123 1120 1130 1162 1125 1162 1135 1119 1135 1134 1129 1124

261 890 903 262 993 815

rcoem azau Hpc Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr

Trichoderma harzianum Trichoderma harzianum

Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp.

rcoem Hypocreales Trichoderma Hypocreales Trichoderma

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma

Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes Sordariomycetes

Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea S610 Trichoderma sp. S610 Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea S610 Trichoderma sp. S610 Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea S610 Trichoderma sp. S610 Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. S610 Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum lixii) (Hypocrea Trichoderma harzianum (Hypocr Diplomarbeit 82

FM42M962 66%8,00E-118 96,60% MG986725 CFAM-422

B:355K653 67%0 0 0 0 96,72% 0 96,79% 0 96,53% KJ665737 0 96,41% KJ665737 CBS:135585 96,53% CBS:135585 0 KJ665737 0 95,54% KJ665737 CBS:135585 96,72% KJ665737 CBS:135585 0 CBS:135585 0 96,79% KJ665737 0 97,06% KJ665737 CBS:135585 0 CBS:135585 0 96,88% KJ665737 0 96,57% KJ665737 CBS:135585 0 96,70% CBS:135585 0 96,84% KJ665737 0 96,14% KJ665737 CBS:135585 97,19% KJ665737 CBS:135585 97,04% KJ665737 CBS:135585 97,06% KJ665737 CBS:135585 97,31% 4,00E-121 KJ665737 CBS:135585 KJ665737 97,70% CBS:135585 KJ665737 CBS:135585 KJ665737 CBS:135585 AB558912 CBS:135585 Th203

F2249,6 0 97,66% KF923284 F2249,2 0 0 97,42% 0 98,22% KF923284 0 KF923284 98,48% 0 99,36% KF923284 KF923284 97,53% KF923284 0 0 0 0 98,31% 0 98,31% 0 0 97,42% KF923284 0 97,64% KF923284 0 97,94% 0 98,13% KF923284 0 96,91% KF923284 0 97,91% KF923284 0 97,46% KF923284 0 97,77% KF923284 0 98,11% KF923284 0 98,21% KF923284 0 98,19% KF923284 0 97,84% KF923284 0 98,03% KF923284 0 97,65% KF923284 0 98,22% KF923284 0 98,22% KF923284 0 98,22% KF923284 0 98,31% KF923284 98,40% KF923284 98,31% KF923284 97,74% KF923284 97,46% KF923284 KF923284 KF923284 KF923284

100%

0%36 100% 45 100% 34 39 100% 37 36 45 100% 32 100% 34 100% 33 100% 31 100% 100% 100% 100% 100%

0%27 18 100% 100% 26 100% 23 25 100% 100% 21 100% 19 100%

4 25 94% 9 15 99% 96% 18 18 96% 93% 22 20 33 94% 27 94% 20 95% 20 19 91% 99% 23 93% 21 94% 25 19 94% 19 95% 19 93% 18 91% 17 94% 18 91% 24 93% 27 95% 93% 93% 94%

9 37 37 40 99% 37 99% 99% 35 99% 35 99% 36 99% 99%

5 China Zhu,Z.X. et al 2015 et Zhu,Z.X. al China 5 2013 Smith,A., et al Colombia 6

Amazon forest Amazon

China Zhu,Z.X. et al 2015 et Zhu,Z.X. al China Greece Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et Greece 2015 et Zhu,Z.X. al 2015 al Jaklitsch,W.M.,et China Greece 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece 2015 et Zhu,Z.X. al Greece 2015 et Zhu,Z.X. al Greece China China 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China China China

Greece Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et Greece Greece Greece 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et Greece Greece 2015 al Jaklitsch,W.M.,et Greece

China Zhu,Z.X. et al 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China China 2015 et Zhu,Z.X. al China 2015 et Zhu,Z.X. al China

Brazil enne eSuaM,e et Souza,M., de Fernandes

H.Oya H.Oya Akyildiz

CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA TTATCCCTTCTTCACGTT CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA TAAGCTTCAACTCATTTT CTCGATTCTCCCTCCACA

Die approbierte gedruckte Originalversion dieser Diplomarbeit ist an der TU Wien Bibliothek verfügbar.

TU CIM 5649 CIM TU 5501 CIM TU 5502 CIM TU 5570 CIM TU 5620 CIM TU 5621 CIM TU 5744 CIM TU 5746 CIM TU 5745 CIM TU 5571 CIM TU 5610 CIM TU 5623 CIM TU 5597 CIM TU 5757 CIM TU 5500 CIM TU 5732 CIM TU 5595 CIM TU

The approved original version of this thesis is available in print at TU Wien Bibliothek. 5751 CIM TU

tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1- tef1-

TU Wien

α α α α α α α α α α α α α α α α α α

EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f EF1 728f

ACTTCAA AATCGTGTCCGACA CTCTTGCCCGACTG CCTTTGGACACAAT TNTTTCCCGCTCAAT TGTGCCGACACGAT AAATTTTTTTTTGNT GGCACAATCGTGTC CAATCGTGTCCGAC ACAATCGTGTCCGA CACAATCGTGTCCG YCCCGCTTTGCATTA TTTTTTTTGCTGTCG TTGTGNCCGACNAT TTCAATTGTGCCCG TTCAATTGTGCCCG TTCAATTGTGCCCG TTCAATTGTGCCCG TTCAATTGTGCCCG

1137 1106 1179 1141 1167 1126 1135 1106 1148 1123 1130 1133

460 904 707 708 926 918

Trichoderma sparsum Trichoderma sinuosum S610Trichoderma sp. S610Trichoderma sp. S610Trichoderma sp. S610Trichoderma sp. S610Trichoderma sp.

Trichoderma ovalisporum Trichoderma paraviridescens Trichoderma reesei Trichoderma reesei

rcoem oigoss(yo Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr Trichoderma harzianum (Hypocr

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma

rcoem Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma Hypocreales Trichoderma

Trichoderma harzianum lixii) (Hypocrea S610Trichoderma sp. Trichoderma harzianum lixii) (Hypocrea S610Trichoderma sp. S610Trichoderma sp. S610Trichoderma sp. S610Trichoderma sp. Trichoderma ovalisporum Trichoderma paraviridescens Trichoderma sparsum Trichoderma sinuosum Trichoderma reesei Trichoderma reesei Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma koningiopsis (Hypo Trichoderma harzianum lixii) (Hypocrea Diplomarbeit 83

39K654 51%0 0 0 0 95,10% 95,10% 95,30% 97,70% KJ665546 KJ665546 KJ665546 KJ665546 S359 S359 S359 S359

B:355K653 66%0 0 0 96,65% 0 0 96,96% 96,62% KJ665737 96,73% CBS:135585 96,13% KJ665737 KJ665737 CBS:135585 KJ665737 CBS:135585 KJ665737 CBS:135585 CBS:135585 S6 C8688,6 0 0 86,86% 0 0 93,29% 0 KC285678 98,03% EU280004 94,80% 232078 DAOM 91,81% S36 10122 KF729983 GQ354369 252541 HMAS GQ354369 881.96 CBS 881.96 CBS

U2169,1 0 97,01% KU529136 0 0 97,69% 97,37% KF923284 KF923284 F2249,5 0 97,95% KF923284

0%58 55 26 100% 100% 100%

0%35 38 37 44 100% 100% 100% 100% 0%31 100% 37 58 100% 100%

9 34 99% 21 28 98% 96% 9 19 99%

9 56 99%

9 38 99% 8 120 22 98% 99%

China Qin,W.T., et al 2016 et al Qin,W.T., China 2015 et Zhu,Z.X. al 2015 et Zhu,Z.X. al China China China Zhu,Z.X. et al 2015 et Zhu,Z.X. al China

France Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et France

Greece Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et Greece Italy Jaklitsch,W.M.,et al 2013 al Jaklitsch,W.M.,et 2015 et Zhu,Z.X. al Italy China

France Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et France 2015 al Jaklitsch,W.M.,et France France

Greece Jaklitsch,W.M.,et al 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et 2015 al Jaklitsch,W.M.,et Greece 2015 al Jaklitsch,W.M.,et Greece Greece Greece Brazil

oo-avjlL,e l20 200 et al Hoyos-Carvajal,L., 2010 et al Druzhinina,I.S., 2010 et al Druzhinina,I.S.,

H.Oya H.Oya Akyildiz

GAGAAGACTCACATCAA TACGCTTTCTTGACACAA TTTTTTCGTTACACCTTTC TAAGCTCAATCAACTGAT CAATCTTCCTTTGCCCAT CAATCTTCCTTTGCCCAT TTTTTCACACGCTTGGCA TTTTTCACACGCTTGGCA TTTTTCACACGCTTGGCA TTTTTCACACGCTTGGCA CTCGATTCTCCCTCCACA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA CTCGATTCTCCCTCCACA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA GATTCTCTTCACATTCAA