J. Indian Fish Assoc., 36: 65-82, 2009 65
Genetic Characterizr:~tion of three Ompok species using mitochondrial DNA sequences
2 1 1 3 A. K. Malakar\ W. S. lakra , M. Singh , M. Goswami and R. M. Mishra
1National Bureau of Fish Genetic Resources/ Canal Ring Road/ P.O. Dilkusha/ Lucknow 226002/ Uttar Pradesh/ India/ 2Centrallnstitute of Fisheries Education Versova/ Andheri (W)/ Mumbai 400061/ India 3School of Environmental Biolog'f; Awadhesh Pratap Singh Universit'f; Rewa 486003/ Madhya Pradesh India 1Corresponding Author e-mail: [email protected]
ABSTRACT
Partial sequences of cytochrome b (Cyt b) and 16S ribosomal RNA {16S rRNA} mitochondrial genes were used for species identification and estimating phylogenetic relationship among three commercially important Ompok species viz. 0. pabda/ 0. pabo & 0. bimaculatus. The sequence analysis of Cyt b {1118bp) and 16S rRNA {569 & 570bp) genes revealed that 0. pabda1 0. pabo & 0. bimacu/atus were genetically distinct species and they exhibited identical phylogenetic relationship. The present study discussed usefulness of mtDNAgenes {Cyt b & 16S rRNA) in resolving taxonomic ambiguity and estimating phylogenetics relationship.
Keywords: Ompok; mtDNA gene; Cyt b; 16S rRNA; Genetic variation.
INTRODUCTION Identification and characterization of fish species are usually based on The diverse Eurasian catfish Family morphological characters that are sometimes Siluridae (Order Siluriformes) is widely bound to be erroneous. Synonymous citation distributed throughout the world with in FishBase indicates the possibility of approximately 437 genera and more than ambiguous taxonomic identifications of 2700 species representing 32% of all Ompok species. Hence, it is required to freshwater fishes (Teugels, 2003}. The catfish examine systematic relationships among the genus Ompok (Lacepede, 1803} refers to species using molecular marker to provide medium-sized Silurids that are usually found supplementary information for taxonomic in lakes and large rivers throughout South and identification. Southeast Asia (Heok, 2003}. Four species belonging to genus Ompok ( 0. pabda/ 0. pabo, Mitochondrial DNA markers 0. bimaculatus and 0. malabaricus) have been cytochrome b {Cyt b) and 16S ribosomal RNA reported from India (Froese and Pauly, 2005}. {16S rRNA} genes are excellent markers for Among them, 0. pabda, 0. pabo and 0. examining biogeographical events and bimacu/atus have been categorized as phylogenetics. Cyt b gene has been widely endangered fish species in India (Lakra and used to study genetic variation, phylogenetic Sarkar, 2006}. relationships and taxonomy in many fishes and invertebrates (McVeigh et a/., 1991; Cavender and Coburn, 1992; Groves and 66 A. 1<. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA
Shields, 1996; Gilles eta/., 1998; Perdices et GACTTGAARAACCAYCGTTG-3' and H15915- a/., 2004; Xiao et a/., 2001; Burridge, 1999; 5'-CTCCGATCTCCGGATTACAAGAC-3' (Irwin et Peng eta/., 2002; Tang eta/., 2003; He eta/., a/., 1991). The thermal regime consisted of an 2004; Xiang eta/., 2004). The mtDNA 16S rRNA initial denaturation step of 3 min at 94QC gene has been used for establishing the followed by 35 cycles of 45 s at 94QC, 50 s at evolutionary relationship of lineages of similar S4QC and 1 min 20 sat 72QCfollowed in turn by divergence in many fishes (Alves-Gomes eta/., a final extension of 10 min at 72QC. 1995; Farias et a/., 1999; Tinti et a/., 1999; 16S rRNAgene was also amplified in a Tringali et a/., 1999; Hanel and Sturmbauer, 50 Ill reaction volume with 5 Ill of lOx Taq 2000). The present study was aimed to resolve polymerase buffer, 21.!1 of MgCI (25 mM), 0.25 taxonomic ambiguity along with intraspecific 2 Ill of each dNTP (0.05 mML 0.5 Ill of each & interspecific genetic diversity of the three primer (0.01 mM), 1.2 U of Taq polymerase Ompok species and to infer phylogenetic and 2 Ill of genomic DNA (SOng/Ill). The relationship among them. primers used for the amplification of the 16S rRNA gene were 16SAR 5' CGCCTGTTTATCAAAA ACAT-3' and 16SBR 5' MATERIALS AND METHODS CCGGTCTGAA CTCAGATCACGT-3' (Palumbi et. Sampling a/., 1991). The thermal regime consisted of an initial denaturation step of 2 min at 94QC A total of 106 samples from three followed by 35 cycles of 30 s at 94QC, 40 s at species 0. pabda, 0. pabo and 0. bimaculatus 47QC and 1 min at 72QC followed in turn by a were collected from eight sampling sites of final extension of 10 min at 72QC. seven Indian Rivers. Sampling details are given in Table 1. Approximately 100 mg of fin clips PCR products were visualized on and muscle tissue from each fish sample were 1.0% agarose gels after staining with ethidium taken and preserved in 95% ethanol. bromide. Products were labeled using the BigDye Terminator V.3.1 Cycle sequencing Kit DNA Isolation (Applied Biosystems, Inc) and sequenced The DNA was isolated following bidirectionally using an ABI 3730 capillary Ruzzante et a/. (1996) with minor sequencer following manufacturer's modifications. The concentration of the instructions. isolated DNA was estimated at wave length of Sequence analysis 260 nm using UV spectrophotometer. The DNA was diluted to get a final concentration of Sequences were edited using 50 ng/lll. DNASTAR software (DNASTAR, inc.). Multiple sequence alignments were done using Amplific<:~tion and sequencing ClustaiW (Thompson et a/., 1997). The The mtDNA Cyt b gene was amplified sequences were bidirectionally aligned and in a 50 Ill reaction volume with 5 Ill of lOx Taq primers were removed and consensus
polymerase buffer, 21.!1 of MgCI 2 (25 mM), 0.25 sequences of Cyt b (1118bp) and 16S rRNA Ill of each dNTP (0.05 mM), 0.5 Ill of each (569 & 570bp) were used for data analysis. The primer (0.01 mML 1.2 U of Taq polymerase sequences were submitted to NCBI for and 2 Ill of genomic DNA (SOng/Ill). The GenBank accession numbers (Table 1). primers used for the amplification of the Cyt b Pairwise genetic distance (K2P) (Kimura, gene were L14724 5' 1980), polymorphic sites, nucleotide Genetic Characterization of three Ompok species using mitochondrial 67 DNA sequences composition and number of transition and intraspecific genetic distance (0.4%) was transversion between species were estimated as following 1<2P distance model. performed using MEGA 4.0 (Tamura et a!., Ompol The sequencing of 16SrRNA gene yielded 569 bp of sequence per individual in 0. RESULTS pabo. There were 565 (99.2%) conserved A total of 106 sequences of each sites, 4 (0.70%) variable sites and 1 (0.17%) mtDNA genes (Cyt b and 165 rRNA) were parsimony informative sites respectively. The generated from three species of Ompok. transitional/transversional ratio was Twenty haplotypes of Cyt b gene (seven in 0. estimated as 1.0 (si =2; sv =2). The average pabda, five in 0. pabo and eight in 0. intraspecific genetic distance (0.3%) was bimacu!atus) and thirty haplotypes of 165 estimated as following 1<2P distance model. rRNA gene (four in 0. pabda, five in 0. pabo Ompok bimaculatus and four in 0. bimacu!atus) were observed. Simplicity and un-ambiguity were observed The sequence alignment of Cyt b among all the sequences. gene yielded 1118 bp per individual in 0. bimacu!atus. There were 1105 {98.8%) Ompokpabda conserved sites, 13 (J .. l%) variable sites and The sequence alignment of Cyt b 13 (1.1%) parsimony informative sites gene yielded 1118 sites per individual in 0. respectively. The transitional/transversional pabda. There were 1075 (96.1%) conserved ratio was estimated as 1.2 (si =4; sv =3). The sites, 43 (3.8%) variable sites and 41 (3.6%) average intraspecific genetic distance (0.5%) parsimony informative sites respectively. The was estimated as following K2P distance transitional/transversional ratio was model. estimated as 3.7 (si ""17; sv =5). The average The sequencing of 16SrRNA region intraspecific genetic distance {2.0%) was yielded 570 bp of sequence per individual in 0. estin1ated as following K2P distance model. Bimacu!atus. There were 567 (99.4%) The sequencing of 16SrRNA region conserved sites, 3 (0.52%) variable sites and 1 yielded 570 bp of sequence per individual in 0. (0.17%) parsimony informative sites pabda. There were 565 {99.1%) conserved respectively. The transitional/transversional sites, 5 (0.87%) variable sites and 1 (0.17%) ratio was estimated as 1.0 {si =2; sv =2). The parsimony informative sites respec;tively. The !;:1Verage intraspecific genetic distance (o.z:~) transitional/transversional ratio was Was estimated as following K2P dista:nce estimated as 1.3 (si =4; sv "'3). The average model. 68 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA Interspecific Genetic Variation Fig. 2. The average transitional pairs (si = 14) was more frequent than transversional pairs The mean number of nucleotide (sv = 6) in three Ompok species. Average frequencies, haplotype diversity, nucleotide nucleotide differences from the Ompok diversity and transitional/transversional ratio species was 20.3%. Intraspecific nucleotide of Cyt b and 16S rRNA genes in 0. pabda, 0. differences ranged from 1 to 4 and pabo and 0. bimacu!atus are given in Table 2. interspecific nucleotide difference ranged A total of 274 nucleotide from 19 to 32 respectively. substitutions (20 synonymous and 254 Pair wise genetic distance values nonsynonymous substitutions) were (K2P) and Standard error estimates (above observed in Cyt b sequences obtained from diagonals) are given in Table 4. The average the three Ompok species. The polymorphic intraspecific sequence divergence was 0.3% sites are given in Fig. 1. The content of A+ Tin whereas, the average interspecific sequence 0. pabda (54.1%), 0. pabo (53.8%) and 0. divergence was 3.7%. The highest interspecific bimaculatus (56.6%) were higher than the C + sequence divergence (5.8%) was between 0. Gin 0. pabda (45.9%), 0. pabo (46.1%) and 0. pabo and 0. pabda whereas, the lowest (3.4%) bimacu/atus (43.4%). GC content were be was between 0. bimacu!atus and 0. pabda. used three Ompok species for differentiation. 0. pabda and 0. pabo are closer and both fairly Phylogenetic relationships diverged from 0. bimacu/atus. It exhibited a Neighbor-Joining (NJ) tree was strong bias anti-G. The average transitional constructed using K2P distance model with pairs (si = 78) was more frequent than 1000 pseudoreplications. The Maximum transversional pairs (sv = 14) in Ompok Parsimony (MP) tree was constructed using species. Average nucleotide difference from Close-Neighbor-Interchange algorithm (Nei the Ompok species was 119.0%. Intraspecific and Kumar, 2000) in which the initial trees nucleotide differences ranged from 1 to 32 were obtained with the random addition of and interspecific nucleotide difference ranged sequences (10 replicates).The bootstrap from 141 to 184 respectively. values were given above the branch node (Fig. Pair wise genetic distance values 3a, b & 4a, b). Two major clusters were (K2P) and Standard error estimates (above observed in both NJ & MP tree. The first diagonals) are given in Table 3. The average cluster was consist of individuals of 0. pabo & intraspecific sequence divergence was 1.0% 0. bimaculatus and the second cluster was whereas, the average interspecific sequence consist of individuals of 0. pabda in Cyt b divergence was 12.0%. The highest sequences whereas, the first cluster was interspecific sequence divergence (18.8%) consist of individuals of 0. pabda & 0. was between 0. pabda and 0. pabo whereas, bimacu/atus and the second cluster consisted the lowest (13.9%) was between 0. pabo and of individuals ofO. pabo in 16S rRNAgene. 0. bimacu!atus. In 16S rRNA gene, the content of A+ T DISCUSSION in 0. pabda (53.7%), 0. pabo (53.4%) and 0. bimaculatus (54.0%) were higher than that of Mitochondrial DNA has been C +Gin 0. pabda (46.2%), 0. pabo (46.6%) and extensively studied in fish phylogenetics since 0. bimaculatus (46.1%). It exhibited a strong mitochondriai16S rRNA gene and the protein anti-G bias. The polymorphic sites are given in coding COl gene are highly conserved. These Genetic Characterization of three Ompol< species using mitochondrial 69 DNA sequences mitochondrial genes have been sequenced in representative taxa from the family Cichlidae, various invertebrate and vertebrate taxa suggesting that transitions at third position (Brown, 1985; Bermingham & Lessios, 1993; would not be reliable indicators of Santos eta/., 2003; Munasinghe eta/., 2004; evolutionary relationships for the whole Vinson eta/., 2004; Ward eta!., 2005; An eta/., family, although they could be informative 2005, Lakra et a/., 2008). Pairwise among closely related groups of species. The comparisons, sequence alignment, sequence GC content of the 569 & 570bp 16Sr RNA divergence and sequence analysis of the Cyt b {46.3%) and 1118bp Cyt b {45.1%) regions and 16S rRNA genes revealed lower level of were on relatively higher side in all Ompok intraspecific and interspecific genetic species. Ward eta/. {2005) reported an overall divergence in the three Ompok species. higher GC content in fishes based on complete Usually, 16S rRNA is formed to be more conse mtDNA genome ranging from 38.4 to 43.2%, than COl, Cyt b genes and is used to investigate which was mostly attributable to 3rd base the relationship among different species and variation. In our study also, the Ompok genera. The results revealed a very close exhibited more nucleotide changes at 3rd genetic relationship among three Ompok position. Phylogenetic relationships based on species at the nucleotide sequence level. The morphological characters and molecules are majority of the nucleotide differences were of mostly concordant {Ward et a/., 2005; transitions (si) and only two amino acid Bernardi eta/., 2000). The Ompok species 0. changes were observed. Transitions pabo and 0. bimaculatus that are outnumbered transversions in the present morphologically and meristically more closer study in accordance with the previous reports formed one cluster whereas, 0. pabda formed {Santos et a/., 2003; Vinson et a/., 2004). separate cluster in the phylogeny tree Generally in mtDNA, a much larger excess of constructed based on Cyt band 165 rRNA gene transitions related to transversion is typically sequences. The higher interspecific sequence observed {Ward eta/., 2005). Relatively low divergence was found between 0. pabda and values for first and second positions suggest 0. bimacu/atus whereas, the lower that most sites have either very low interspecific sequence divergence was substitution rates or are invariable, whereas a observed between 0. pabo and 0. few sites exist with very high rates {Saitou and bimaculatus in Cyt b gene whereas, the higher Nei, 1987; Yang, 1996; Voelker and Edwards, interspecific sequence divergence was found 1998). Third codon position however, has between 0. pabda and 0. pabo and the lower been shown a higher value of substitution, interspecific sequence divergence was suggesting a more uniform distribution; in observed between 0. pabda and 0. which most sites have intermediate rates and bimacu/atus in 16S rRNA gene, which indicate few sites have very low or very high rates its ability to adequately describe (Yang, 1996; Lakra et a/., 2008). This interrelationships of Ompok species. transition/transversion bias and a small Estimates of genetic divergence with Cyt band number of amino acid changes are 16S rRNA genes were sufficient enough to characteristic of the species that have resolve species discrimination among Ompok diverged recently from a common ancestor species. The present study has strongly {Barlett and Davidson, 1991; Kocher et a/., supported the utility of mitochondrial genes in 1989; McVeigh eta/., 1991; Orti eta/., 1994). resolving of taxonomic ambiguity and Meyer (1993) found the same pattern of establishing phylogenetic relationship among saturation in Cyt b sequences for a few the three Ompok species. It is concluded that 70 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA the partial sequence of the mitochondrial identification and estimating phylogenetic genes {Cyt b and 165 rRNA) can be used as a relationship. diagnostic molecular marker in fish species Table 1. locality information, sample size and accession numbers for samples of Ompok species used in the current study Sample River, Geographical Taxon Cytochrome b 16S rRNA Size Sampling site Position (Lat./long) Tons, Chak Ghat 25° 01' N & 81° 44' 13 (Madhya E Pradesh) Ompokpabda Gomti, Lucknow 26Q 52' N & 80Q 54' FJ711226-FJ711258 GQ46953 7 -GQ469569 6 (Uttar Pradesh) E Gomti, Mishrikh 27Q 25' N & 80Q 31' 14 (Uttar Pradesh) E Ganga, Maida 24Q 57' N & 88Q 06' 15 (West Bengal) E Ompokpabo Bramhaputra, FJ711259-FJ711294 GQ469570-GQ469605 26Q 11' N & 91Q 44' 21 Guwahati E (Assam) Hoogly, Kolkatta 22Q 56' N & 88Q 24' 10 (West Bengal) E Ompok Girwa, Bahraich 27Q 34' N & 81Q 34' E 13 bimacu/atus (Uttar Pradesh) FJ711295-FJ711331 GQ469606-GQ469642 Betwa, Bhopal 23Q 32' N & 77Q 48' E 14 (Madhya Pradesh) Table 2. Haplotype, Haplotype diversity (Hd) and Nucleotide diversity (Pi), Nucleotide frequencies and Transitionsal (si) &Transversional (sv) ratio of Cyt b and 165 rRNA genes for all Haplotypes of Ompok species Cytochrome b 165 rRNA O.pabda O.pabo 0. bimacu/atus O.pabda O.pabo 0. bimaculatus Haplotypes No. 7 5 8 4 5 4 Haplotype Diversity 2.2 2.3 2.5 2.0 1.8 1.9 (Hd) Nucleotide Diversity 0.45 0.46 0.42 0.32 0.30 0.31 (Pi) A 26.9 28.8 29.3 30.6 30.9 31.1 T 27.2 25.0 27.3 23.1 22.5 22.9 c 31.0 32.8 30.2 23.9 23.9 23.6 G 14.9 13.3 13.2 22.3 22.7 22.5 Transitional/ Transversional 1.9 2.4 (si/sv) Ratio Table 3. Pair wise genetic distances (Kimura 2. - parameter) (below diagonal) and Standard error (above diagonal} in Cyt b sequences from three Ompok species (H: Haplotype, OP8038 & OPD: Ompok pabda, OPB & OP8072.: Ompok pabo, OB: Ompok bimaculatus) Cl I'D ::l I'D ..... 1 2 5 6 8 12 13 16 17 18 19 20 n· 3 4 7 9 10 11 14 15 n ::l" OPD_H1 - 0.0018 0.0031 0.0052 0.0051 0.0048 0.0045 0.0147 0.0147 0.0147 0.0146 0.0145 0.0141 0.0142 0.0142 0.0141 0.0140 0.0140 0.0141 0.0140 Q) OPD_H2 0.0036 0.0026 0.0049 0.0048 0.0050 0.0049 0.0147 0.0147 0.0147 0.0146 0.0145 0.0141 0.0141 0.0141 0.0140 0.0140 0.0139 0.0140 0.0140 Ql ~ OPD_H3 0.0108 0.0072 0.0041 0.0042 0.0051 0.0052 0.0145 0.0146 0.0145 0.0146 0.0144 0.0144 0.0145 0.0144 0.0143 0.0142 0.0142 0.0142 0.0142 I'D... ;::;· Q) OPD_H4 0.0293 0.0256 0.0181 - 0.0009 0.0044 0.0051 0.0142 0.0145 0.0143 0.0144 0.0143 0.0147 0.0147 0.0146 0.0145 0.0146 0.0145 0.0145 0.0144 ..... o· OPD_H5 0.0284 0.0246 0.0191 0.0009 - 0.0043 0.0050 0.0142 0.0145 0.0143 0.0144 0.0143 0.0146 0.0146 0.0145 0.0144 0.0145 0.0144 0.0144 0.0144 ::l 0 OPD_H6 0.0246 0.0265 0.0284 0.0209 0.0200 0.0024 0.0144 0.0146 0.0145 0.0146 0.0145 0.0142 0.0142 0.0141 0.0140 0.0141 0.0141 0.0141 0.0141 o...,. Z::l"- OPD_H7 0.0218 0.0256 0.0293 0.0275 0.0265 0.0063 0.0141 0.0143 0.0142 0.0143 0.0141 0.0140 0.0140 0.0139 0.0138 0.0139 0.0139 0.0139 0.0139 l>(ti V> I'D OPB_H1 0.1885 0.1885 0.1850 0.1791 0.1791 0.1827 0.1767 - 0.0025 0.0018 0.0027 0.0024 0.0125 0.0125 0.0124 0.0122 0.0124 0.0127 0.0127 0.0127 I'D 0 -g 3 OPB_H2 0.1884 0.1884 0.1873 0.1839 0.1839 0.1874 0.1814 0.0072 - 0.0018 0.0016 0.0020 0.0127 0.0127 0.0127 0.0126 0.0127 0.0129 0.0129 0.0129 I'D-c ::l 0 OPB_H3 0.1885 0.1885 0.1850 0.1816 0.1816 0.1851 0.1790 0.0036 0.0036 - 0.0024 0.0027 0.0126 0.0126 0.0125 0.0124 0.0125 0.0128 0.0128 0.0128 @ ;I;" V> V> "C OPB_H4 0.1872 0.1872 0.1861 0.1827 0.1827 0.1862 0.1802 0.0081 0.0027 0.0063 0.0013 0.0126 0.0127 0.0127 0.0125 0.0126 0.0129 0.0129 0.0128 I'D !2. OPB_H5 0.1849 0.1849 0.1838 0.1803 0.1803 0.1839 0.1779 0.0063 0.0045 0.0081 0.0018 - 0.0125 0.0126 0.0126 0.0124 0.0125 0.0128 0.0128 0.0127 I'D V> OB_H1 0.1752 0.1740 0.1812 0.1851 0.1838 0.1756 0.1720 0.1441 0.1484 0.1464 0.1473 0.1451 0.0027 0.0025 1: 0.0009 0.0009 0.0018 0.0024 0.0027 !!!. ::l OB_H2 0.1763 0.1751 0.1823 0.1862 0.1849 0.1767 0.1731 0.1452 0.1495 0.1474 0.1484 0.1461 0.0009 0.0013 0.0020 0.0022 0.0029 0.0025 0.0027 (JQ 3 OB_H3 0.1764 0.1752 0.1799 0.1838 0.1826 0.1744 0.1708 0.1430 0.1496 0.1452 0.1484 0.1462 0.0009 0.0018 0.0016 0.0022 0.0025 0.0025 0.0024 ;::;: 0 OB_H4 0.1742 0.1730 0.1777 0.1816 0.1804 0.1723 0.1687 0.1397 0.1463 0.1420 0.1452 0.1430 0.0036 0.0045 0.0027 - 0.0016 0.0030 0.0030 0.0029 n ::l" 0 OB_H5 0.1731 0.1719 0.1766 0.1827 0.1815 0.1733 0.1697 0.1419 0.1485 0.1442 0.1474 0.1452 0.0063 0.0054 0.0054 0.0027 - 0.0029 0.0029 0.0030 ::l c.. OB_H6 ::::!. 0.1719 0.1707 0.1754 0.1815 0.1803 0.1746 0.1709 0.1486 0.1531 0.1509 0.1520 0.1497 0.0081 0.0090 0.0072 0.0099 0.0090 0.0013 0.0009 Q) OB_H7 0.1741 0.1729 0.1776 0.1815 0.1803 0.1746 0.1709 0.1486 0.1531 0.1509 0.1520 0.1497 0.0081 0.0072 0.0072 0.0099 0.0090 0.0018 0.0009 OB_H8 0.1730 0.1718 0.1765 0.1804 0.1792 0.1735 0.1698 0.1475 0.1520 0.1498 0.1509 0.1487 0.0072 0.0081 0.0063 0.0090 0.0099 0.0009 0.0009 ...... g N Table 4. Pairwise genetic distances (Kimura 2-parameter} (below diagonal} and Standard error (above diagonal) in 165 rRNA sequences from three Ompok species (H: Haplotype, OP8038 & OPD: Ompok pabda, OPB & OP8072: Ompok pabo, OB: Ompok bimaculatus} 1 2 3 4 5 6 7 8 9 10 11 12 13 ?> :0::: OPD_H1 - 0.0018 0.0035 0.0031 0.0104 0.0102 0.0105 0.0104 0.0104 0.0086 0.0088 0.0088 0.0088 :s: )> .... OPD_H2 0.0018 - 0.0031 0.0025 0.0102 0.0100 )> 0.0104 0.0102 0.0102 0.0084 0.0086 0.0086 0.0086 :::<:: )> OPD_H3 0.0071 0.0053 - 0.0031 0.0104 0.0102 0.0106 0.0104 0.0104 0.0086 0.0088 0.0088 0.0088 ?J ~ !" OPD H4 0.0053 0.0035 0.0053 - 0.0102 0.0100 0.0104 0.0102 0.0102 0.0079 0.0081 0.0081 0.0081 .... - )> :::<:: OPB_H1 0.0568 0.0549 0.0569 0.0549 - 0.0018 0.0018 0.0025 0.0025 0.0100 0.0102 0.0098 0.0098 ;;tJ }> OPB_H2 0.0549 0.0530 0.0549 0.0530 0.0018 - 0.0025 0.0031 0.0031 0.0098 0.0100 0.0096 0.0096 :s: t' !!! z OPB_H3 0.0587 0.0569 0.0588 0.0569 0.0018 0.0035 - 0.0018 0.0018 0.0102 0.0104 0.0100 0.0100 Cil ~:X: OPB_H4 0.0568 0.0549 0.0569 0.0549 0.0035 0.0053 0.0018 - 0.0025 0.0100 0.0102 0.0098 0.0102 :s: Cil 0 OPB_KS 0.0568 0.0549 0.0569 0.0549 0.0035 0.0053 0.0018 0.0035 - 0.0100 0.0102 0.0102 0.0098 V> ~ OB_Hl 0.0398 0.0380 0.0398 0.0342 0.0532 0.0513 0.0551 0.0532 0.0532 - 0.0018 0.0018 0.0018 :s: )> OB H2 0.0417 0.0398 0.0417 0.0361 0.0551 0.0532 0.0571 0.0551 0.0551 0.0018 - 0.0025 0.0025 z 0 ?' OB_H3 0.0417 0.0398 0.0417 0.0361 0.0513 0.0493 0.0532 0.0513 0.0551 0.0018 0.0035 - 0.0025 :s: - :s: OB_H4 0.0417 0.0398 0.0417 0.0361 0.0513 0.0493 0.0532 0.0551 0.0513 0.0018 0.0035 0.0035 iii :X: ;;tJ )> Fig. 1. Alignment of partial DNA sequences of the mitochondrial gene, Cyt b of Ompok species (only variable sites are reported) {H: Haplotype, OP8038 & OPD; Ompok pabda, OPB & OP8072: Ompok pabo, OB: Ompok bimaculatus) 11111111111111122 2222222222 2222222223 3333333333 3333333444] G'l I'D 2222333444 4555666778 8990000444 56778899011223334444 5567778890 0123455566 7888999122] ::. I'D !:!". 1478069258 92483692514362359178 3547072813 6591470369 2546795840 3510212713 5147069136] n n OPD1H1 TTGCACTTGT TGCTCCGCCTACTTCACGCT ACCCCTACCCATCCTCTATT CGTCCCCTAC AGCGCCCCTA CCTATTTGCC ::. QJ OPD5H2 ...... T...... A .. -.: QJ n OPD6H3 ...... T.T ...... A .. r+ I'D OP8038AH4 ...... GT...... T.T ...... C.. A ...... A.T ""'N. OP8038BH5 ...... GT...... T ...... C.. A ...... A.T ....QJ o· OP8038DH6 ...... GT...... C.. C...... C.. A ...... T ::. OP8038EH7 ...... C .. C...... A ...... C.. A ...... T o::0 OPB1H1 CAATCT.CCCCATCATC.TC .. CC.G.ATC CA.AAAC.TT GC..C.CCCCTAC.ATAC.A CCTAT.TGC..TACCCAAAT z::. l> iti OP8072AH2 CAATCT.CCCCATCATC.TC .. CC.G.ATC CA.AA.C.TT GC..C.CCCCTAC.ATAC.A CCTAT.TGC..TACCCAAAT "' I'D 0 OP8072BH3 CAATCT.CCCCATCATC.TC .. CC.G.ATC CA.AAAC.TT GC..C.CCCCTAC.ATAC.A CCTAT.TGC..TACCCAAAT z s:::: 3 tD-c OP8072DH4 CAATCT.CCCCATCATC.TC .. CC.G.ATC CA.AA.C.TT GC..C.CCCCTAC.ATAC.A CCTA.. TGC. .TACCCAAAT ::. 0 OP8072EH5 CAATCT.CCCCATCATC.TC .. CC.G.ATC CA.AA.C.TT GC..C.CCCCTAC.ATAC.A CCTA.. TGC. .TACCCAAAT 2 " "' "C"' C.ATTIC.C. CATCA.AT..... CT.TA.CC.TAAACT CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A.T. I'D OB1H1 ... n OB2H2 C.ATTIC.C. CATCA.AT..... CT.TA.C C.TAAACT.. .CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A.T. n;· OB11H3 C.ATTTC.C. CATCA.AT..... CT.TA.CC.TAAACT ... CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A.T. "'s:::: !!!. ::. OB13H4 C.ATTTC.C. CATCA.AT..... CT.TA.CC.TAAACT ... CTT.T.CCCTACTATTC.T CAAA.A.ACC T.C.C.A.T. at! OB14H5 C.ATTTC.C. CATCA.AT..... CT.TA.CC.TAAACT ... CTT.T.CCCTACTATTC.T CAAA.A.ACC T.C.C.A.T. 3 ;::;: OB21H6 CCATTTC.C. CATCA.AT..... CT.TA.CC.TAA.CT ... CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A .. . 0 n ::.- OB22H7 CCATTTC.C. CATCA.AT..... CT.TA.CC.TAA.CT ... CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A .. . 0 ::. OB23H8 CCATTTC.C. CATCA.AT..... CT.TA.CC.TAA.CT ... CTT.T.TCCTACTATTC.T CAAA.A.ACC T.C.C.A.. . c.. ::::!. QJ 4444444444 4444444444 4444555555 5555555555 5555555566 6666666666 6666666666 6666666777 ] 3333444555 6666777888 8999000111 2345556666 7788899900 0112222233 3555667788 8899999000] 12582580692359458026925814703924925924670602514503958134782392473627124503579025] OPD1H1 GGTGCTGTCCTGCGCTGTAA TAGCTCATTC CCCTCGGTCACTCACCTTTG CTCGCACCGCCCATGCAATT GTCCCCGCCC ...... w OPD5H2 ...... c...... " """ OPD6H3 ... A ...... C.. T...... T ...... OP8038AH4 ... A ..T ...... A ... C...... C.C T...... CA ..T ...... T .... A ...... C... A ... . OP8038BH5 ... A ..T ...... A ... C...... C.C T...... CA ..T ...... T .... A ...... C... A ... . OP8038DH6 T.. A ..T ..... T ...... C...... CC.A ..T ...... T .... A ...... A ... . OP8038EH7 T.. A ..T ..... T ...... CC.A ...... T .... A ...... A ... . OPB1H1 TA.A.CTAAG CA. .. C.A.G C.AA.TCCC. .. AC..A.T. TA.C..CCCA AC.A.C..A. TTCCA..TCC AC..TAA.A. "!> OP8072AH2 TA ... CTAAG CA... C.ATG C.AA.TCCC. .. AC..A.T. TA.C..CCCA AC.A.C..A. TT.CA..TCC AC..TAA.A. ?' OP8072BH3 TA.A.CTAAG CA... C.A.G C.AA.TCCC. .. AC..A.T. TA.C..CCCA AC.A.C..A. TT.CA.. TCC AC..TAA.A. :5: )> OP8072DH4 TA ... CTAAG CA... C.ATG C.AA.TCCC. .. AC..A.T. TA.C..CCCA AC.A.C..A. TTCCA.. TCC AC..TAA.A. .-- )> ;:>::: OP8072EH5 TA ... CTAAG CA... C.ATG C.AA.TCCC. .. AC..A.T. TA.C..CCCA AC.A.C..A. TTCCA.. TCC AC..TAA.A. )> OB1H1 TAC.TCT.AA .AT.T..A.. CGC.C..C.A TTAAAAACT.. AT.TA.C.A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT ?' OB2H2 TAC.TCT.AA .AT.T.CA.. CGC.C..C.A TTAAAAACT.. AT.TA.C.A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT ~ !" OB11H3 TACATCT.AA .AT.T..A.. CGC.C..C.A TTAAAAACT.. AT.TA.C.A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT ); ;:>::: OB13H4 TACATCT.AA .AT.T.. A .. CGC.C..C.A TTAAAAACT.. AT.TA.C.A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT ::0 OB14H5 TACATCT.AA .AT.T.CA.. CG.. C..C.A TTAAAAACT.. AT.TA.C.A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT }> :5: OB21H6 TACATCT.AA .AT.T.. A .. CG.. C..C.A TTAAAAACT.. AT.TA... A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT !!! OB22H7 TACATCT.AA .AT.T.CA.. CG.. C..C.A TTAAAAACT.. AT.TA... A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT 2 G'l 0B23H8 TACATCT.AA .AT.T..A.. CG.. C..C.A TTAAAAACT.. AT.TA... A .C.ATTTTA. TT.CCTC.CCA.ATTACTAT ~ :5: G'l 1111111111111111111] 0 77777777777777777777888888888888888888899999999999999999999990000000000000000000] VI 0111222333 4455888999 0002223446 6777788890 0001112233 4455577799 9001112223 4556667888 ] ~ :5: 9578034256 5703369258 1472587694 7067905883 5692581702 2545768946 9281470365 7460381469] )> 2 OPD1H1 CAAATTGTAC CGACACTCACTACATCCATA AAACCCTATA TTCCGGCCGA TCCTGGGCCATAATTCGCTA TGTTGATAAT 0 0PD5H2 ...... A...... ::0 :5: OPD6H3 ...... C ...... G ...... A...... A...... C.. . :5: OP8038AH4 G...... C...... G...... CT.... T.AA ...... A ...... C.. . iii :I: OP8038BH5 G...... C...... G...... CT.... T.AA ...... A ...... C.. . ::0 )> OP8038DH6 G...... T ...... G.C...... G.... C..... T.A ...... OP8038EH7 G...... A.T...... G.C...... G...... T.A ...... OPB1H1 GGC.CA.CC. TAT.C.ATC. C.A.CA.CCC .C.TATCCCGC.TAAT.AA . .A.CAACT.. CG.CAAAAC. CAC.A.CCCC OP8072AH2 GGC.CA.CCG TAT.C.ATC. C.A.CA.CCC .CTTATCCCGC.TA.T.AA . .A.CAACT.. CG.CAAAAC. CAC.A.CCCC OP8072BH3 GGC.CA.CCG TAT.C.ATC.C.A.CA.CCC .C.TATCCCGC.TA.T.AA . .A.CAACT.. CG.CAAAAC. CAC.A.CCCC OP8072DH4 GGC.CA.CCG TAT.C.ATC. C.A.CA.CCC .CTTATCCCGC.TA.T.AA . .A.CAACT.. CG.CA.AAC. CAC.A.CCCC OP8072EH5 GGC.CA.CC. TAT.C.ATC. C.A.CA.CCC .CTTATCCCGC.TA.T.AA . .A.CAACT.. CG.CA.AAC. CAC.A.CCCC OB1H1 G .. GCC.C. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC OB2H2 G .. GCC.C. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC OB11H3 G .. GCC.C. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC OB13H4 G .. GCC.C. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTA. CTTCA.C.AG CGGCA .. ACG CAC..GCCCC OB14HS ... GCC.C. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTA. CTTCA.C.AG CGGCA .. ACG CAC..GCCCC OB21H6 ... GCCAC. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC OB22H7 G .. GCCAC. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC G) .. It) j OB23H8 G .. GCCAC. .. AC..TAA.T .. AC.ATT.. C. .. A.CCC. .A .. AATTAT CTTCA.C.AG CGGCA .. ACG CACA.GCCCC It) .... r:;· n 11111111111111] =:; !).) .... 00011111111111] !).) n .... 9990000011 2222] It) 0481478915 2367] ...""' !).) .... OPD1H1 TGCGAAACCA AACC o· OPDSH2 ...... j 0 OPD6H3 ...... c2=> -.... OP8038AH4 ...... )> (6 (I) It) OP8038BHS ...... It) 0 OP8038DH6 ...... g 3 ro-c OP8038EH7 ...... j 0 g ~ OPB1H1 CAAAC.CT.T GTTT (I) (I) "C It) OP8072AH2 CAAAC.CTTT GTTT n n;· OP8072BH3 CAAAC.CTTT GTTT (I) !: OP8072DH4 CAAAC.CTTT GTTT !!!. j OP8072EHS CAAAC.CT.T GTTT O'Q OB1H1 CA.A.C.T... T.T 3 ;:::;: 0 OB2H2 CA.A.C.T... T.T n =s OB11H3 CA.A.C.T... T.T o j c. OB13H4 CA.A.C.T... T.T .... Qj" OB14HS CA.A.C.T... T.T OB21H6 CA.A.C.T... T.. OB22H7 CA.A.C.T... T.. OB23H8 CA.A.C.T. .. T.. -....! U'1 76 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA Fig. 2. Alignment of partial DNA sequences of the mitochondrial gene, 165 rRNA of Ompok species (only variable sites are reported} (H: Haplotype, OP8038 & OPD; Ompok pabda, OPB & OP8072: Ompok pabo, OB: Ompok bimacu/atus} 111122222 2222222222 2333333333 3333334444 444] 1455900446 6677788889 9124455555 5567790001 234] 4557902040 6904503673 7890612456 7875843459 136] OPD1H1 AACTATTTTG TCCCCTAATA CATCCGCTTA AACGCTTTTC CGT OPD31H2 ...... A...... OP8038AH3 ..T.G.A ...... A. OP8038CH4 .GT... A ...... OPB1H1 C.T..CA.CA AA.T.AGGCG AGCTAAT.AT GTTA .. ACCT ... OPB11H2 C.T.. .A.CA AA.T.AGGCG AGCTAAT.AT GTTA .. ACCT ... OP8072AH3 C.TC.CA.CA AA.T.AGGCG AGCTAAT.AT GTTA .. ACCT .. . OP8072BH4 C.TC.CA.CA AA ... AGGCG AGCTAAT.AT GTTA .. ACCT .. . OP8072DH5 C.TC.CA.CA AA.T.AGGCG AGCTAA .. AT GTTA .. ACCT .. . OB1H1 .GT... AC.A AAT.A .. GC. TG ..T .. CAC .C.ATC .... A .. OB5H2 .GT... AC.A AAT.A .. GC. TG ..T .. CAC .C.ATC .... A.C OB11H3 .GT... AC.A AAT.A .. GC. TG .. T.TCAC .C.ATC .... A .. OB21H4 .GT... AC.A AATTA .. GC. TG ..T .. CAC .C.ATC .... A .. Genetic Characterization of three Ompok species using mitochondrial 77 DNA sequences B_"Hl BJB )B_H~ Ontpok bimacula.tus BCH5 B_I16 Fig. 3a. Neighbor-Joining {NJ) phylogenetic tree of Indian Ompok species inferred from DNA sequences of mitochondrial Cyt b gene I I. 10 ~ I 62 I 101~ I I 10~ J I Fig. 3b. Neighbor-Joining {NJ) phylogenetic tree of Indian Ompok species inferred from DNA sequences of mitochondriai16S rRNA gene 78 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA Fig. 4a. Maximum Parsimony (MP) phylogenetic tree of Indian Ompok species inferred from DNA sequences of mitochondrial Cyt b gene Fig. 4b. Maximum Parsimony (MP) phylogenetic tree of Indian Ompok species inferred from DNA sequences of mitochondrial 165 rRNA gene Genetic Characterization of three Ompok species using mitochondrial 79 DNA sequences ACKNOWLEDGMENTS parrotfish genus Sparisoma. Mol. Bioi. Eva/., 15: 292-300. The authors are thankful to Director, National Bureau of Fish Genetic Resources Brown, W. M., 1985. The mitochondrial {NBFGRL Lucknow for the providing support genome of animals: molecular and laboratory facility. evolutionary genetics. In: Macintyre RJ (ed) Molecular evolutionary genetics. Plenum Press New York. pp 95-130. REFERENCES Burridge, C. P., 1999. Molecular phylogeny of Alves-Gomes, J. A., Orti, G., Haygood, M., Nemadactylus and Acantholatris heiligenberg, W. and Ameyer, A., 1995. {Perciformes: Cirrhitoides: Phylogenetic analysis of the sourth CheilodactylidaeL with implications for american electric fishes {Order taxonomy and biogeography. Mol. Phyl. Gymnotiformes) and the evolution of Eva/., 13 {1}:93-109. their electrogenic system: a sinthesis based on morphology electrophysiology, Cavender, T. M. and Coburn, M. M., 1992. and mitochondiral sequence data. Mol. Phylogenetic relationships of North Bioi. Eva/., 12:298-318. American Cyprinidae. In Mayden, R. L. {ed.L Systematics, Historical Ecology and An, H. S., Jee, Y. J., Min, K. S., Kim, B. L. and North American Freshwater Fishes. Han, S. J., 2005. Phylogenetic analysis of Stanford Univ. Press, Stanford, pp. 293- six pacific abalone {Haiotidae) based on 327. DNA sequences of 16S rRNA and cytochrome c oxidase subunit I Eck, R. V. and Dayhoff, M. 0., 1966. Atlas of mitochondrial genes. Mar. Bioi., 7:373- Protein Sequence and Structure. National 380. Biomedical Research Foundation. Silver Springs, Maryland. Barlett, S. E. and Davidson, W. S., 1991. Identification of tuna species in the genus Farias, I. P., Orti, G., Sampaio, 1., Schneider, H. Thunnus by the polymerase chain and Meyer, A., 1999. Mitochondrial DNA reaction and direct sequence analysis of phylogeny of the family their mitochondrial cytochrome b genes. Cichlidae:monophyly and fast molecular Can. J. Fish. Aquat. Sci., 48:309-317. evolution of the neotropical assemblage. J. Mol. Eva/., 48:703-711. Bermingham, E. and Lessios, H. A., 1993. Rate variation of protein and mtDNA evolution Felsenstein, J., 1993. PHYLIP {Phylogeny as revealed by sea urchins separated by Inference Package) Version 3.50 the Isthmus of Panama. Proc. Indiana Distributed by the author. Department of Acad. Sci., 90:2734-2738. Genetics, University of Washington, Seattle, USA. Bernardi, G., Robertson. D. R., Clifton, K. E. and Azurro, E., 2000. Molecular Froese, R. and Pauly, D., 2005. Fish Base World systematics, zoogeography and Wide Web electronic publication. evolutionary ecology of the Atlantic www.fishbase.org, version {07 /2005}. 80 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA Gilles, A., Lecointre, G., Faure, E., Chappaz, R. Kocher, T. D., Thomas, W. K., Meyer, A., and Brun, G., 1998. Mitochondrial Edwards, S. V., Paabo, S., Villablanca. F. phylogeny of the European cyprinids: X. and Wilson, A. C., 1989. Dynamics of Implications for their systematics, mitochondrial DNA evolution in animals: reticulate evolution, and colonization amplification and sequencing with time. Mol. Phyl. Evol., 10:132-143. conserved primers. Proc. Nat/. Acad. Sci., USA86: 6196-6200. Groves, P. and Shields, G. F., 1996. Phylogenetics of the Caprinae on Lakra, S. W., Goswami, M. and cytochrome b sequence. Mol. Phyl. Evo!., Gopalakrishnan, A., 2008. Molecular 5(3): 467-476. identification and phylogenetic relationships of seven Indian Sciaenids Hanel, R. and Sturmbauer, C., 2000. Multiple (Pisces: Perciformes, Sciaenidae} based recurrent evolution of trophic types in on 16S rRNA and cytochrome c oxidase Northeastern Atlantic and subunit I mitochondrial genes. Mol. Bioi. Mediterranean seabreams (Sparidae, Rept., 36:831-839. Percoidei).J. Mol. Eva/., 50:276-283. Lakra, W. S. and Sarkar, U. K., 2006. He, S. P., Liu, H. Z., Chen, Y. Y., Kuwahara, M., Freshwater fish diversity of central India. Nakajima, T. and Zhong, Y., 2004. Edited and published by National Bureau Molecular phylogenetic relationships of of Fish Genetic Resources. Lucknow, pp Eastern Asian Cyprinidae (Pisces: 1200. Cypriniformes) inferred from cytochrome b sequences. Sci. China. C. Life. Sci., 47(2): McVeigh, H. P., Barlett, S. E. and Davidson, W. 130-138. S., 1991. Polymerase chain reaction/direct sequence analysis of the Heok H., 2003. A review of the Ompok cytochrome b gene in Salmo salar. hypophtha!mus group of silurid catfishes Aquaculture., 95: 225-233. with the description of a new species from South-East Asia. J. Fish Bioi., 62: Meyer, A., 1993. Evolution of mitochondrial 1296-1311. doi:10.1046/j.1095- DNA in fishes. In Biochemistry and 8649.2003.00107. Molecular Biology of fishes. Vol.2 (Mochachka, P.W. and Mommsen, T.P. Irwin, D. M., Kocher, T. D. and Wilson, A. C., Eds.) pp.1-38. Amsterdam/New York: 1991. Evolution of cytochrome b in Elsevier. mammals.J. Mol. Eva!., 32:128-144. Munasinghe, H., Burridge, C., Austin, C., Kimura, M. A., 1980. Simple method for 2004. The systematics of freshwater estimating rate of base substitutions crayfish of the genus Cherax Erichson through comparative studies of (Decapoda: Parastacidae) in eastern nucleotide sequences. J. Mol. Eva!., Australia re-examined using nucleotide 16:111-120. sequences from 12S rRNA and 16S rRNA genes. Invertebrate Systematics. Aust. J. Sci., 18: 215-225. Genetic Characterization of three Ompok species using mitochondrial 81 DNA sequences Nei, M. and Kumar, S., 2000. Molecular Saitou, N. and Nei, M., 1987. The neighbor Evolution and Phylogenetics. Oxford joining method: A new method for University Press, New York. reconstructing phylogenetic trees. Mol. Bioi. Eva/., 4: 406-425. Orti, G., Bell, M. A., Retmchen, T. E. and Meyer, A., 1994. Global survey of Santos, S., Schneider, H. and Sampaio, 1., mitochondrial DNA sequences in the 2003. Genetic differentiation of three spine stickleback: evidence for Macrodon ancylodon (Sciaenidae, recent migrations. Evolution., 48: 608- Perciformes) populations in Atlantic 622. coastal waters of South America as revealed by mtDNA analysis. Genet. Mol. Peng, Z. G., He, S. P. and Zhang, Y. G., 2002. Bioi., 26(2}: 151-161. Mitochondrial cytochrome b sequence variation and phylogeny of the East Asian Tamura, K., Dudley, J., Nei, M. and Kumar, S. bagrid catfishes. Prog. Nat. Sci., 12 (6}: ,2007. MEGA4: Molecular Evolutionary 596-600. Genetics Analysis (MEGA) software version 4.0. Mol. Bioi. Eva/., 24: 1596- Perdices, A., Cunha, C. and Coelho, M., 2004. 1599. Phylogenetic structure of Zacco platypus (Teleostei, Cyprinidae) populations on Tang, Q. Y., Yang, X. P. and Liu, H. Z., 2003. the upper and middle Chang Jiang Biogeographical process of spinibarbus (Yangtze) drainage inferred from caldweli revealed by sequence variations cytochrome b sequences. Mol. Phy/. Eva/., of mitochondrial cytochrome b gene. 31(1}:192-203. Acta. Hydrobiol. Sin., 27(4}: 352-356 (in Chinese). Palumbi, S. R., Martin, A., Romano, S., McMillan, W.O. and Stice, L., 1991. The Teugels, G. G. 2003. State of the art of recent Simple Fool's Guide to PCR. Department siluriform systematics, p., 317-352. In: of Zoology and l Rozas, J., Sanchez-Del Barrio, J. C., Messeguer, Thompson, J. D., Gibson, T. J., Plewniak, F., X. and Rozas, R., 2006. DNA sequence Jeanmougin, F. and Higgens, D. G., 1997. polymorphism version 4.10.9 31. The Clustal X windows interface: flexible strategies for multiple sequence Ruzzante, D. E., Taggart, C. T., Cook, C. and alignment aided by quality analysis tools. Goddard, S., 1996. Genetic Nucleic Acids Res., 24:4876-4882. differentiation between inshore and offshore Atlantic cod {Gadus morhua) off Tinti, F., Colombari, A., Vallisneri, M., New found land: microsatellite DNA Piccinetti, C. and Stagni, A. M., 1999. variation and antifreeze level. Can. J. Fish. Comparative analysis of a mitochondrial Aquat. Sci., 53:634-645. DNA control region fragment amplified from three Adriatic flatfihs speices and 82 A. K. MALAKAR, W. S. LAKRA, M. SINGH, M. GOSWAMI AND R. M. MISHRA molecular phylogenesis of Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. Pleuronectiformes. Mar. Biotechnol., 1: R. and Hebert, P. D. N., 2005. DNA 20-24. barcoding Australia's fish species. Philos. Trans. R. Soc. Land., 360: 1847-1857. Tringali, M. D., Bert, T. M., Seyoum, S., Bermingham, E. and Bartolacci, D., 1999. Xiang, F., Zou, J. X., Deng, F. J., Liu, S. Y. and Molecular phylogentics and ecological Sui, Y., 2004. The molecular taxonomy diversification of the transisthmian fish and phylogeny of zebrafish ( Dania genus Centropomus (Perciformes: rerio)based on the Cytb partial Centropomidar). Mol. Phylogenet. Evol., sequences. Chinese J. Zoo/., 39(5}: 13-18 13: 193-197. (in Chinese). Vinson, C., Grazielle, G., Schneider, H., Xiao, W., Zhang, Y. and Liu, H., 2001. Sampaio, 1., 2004. Sciaenidae fish of the Molecular systematics of Xenocyprinae Caete river estuary, Northern Brazil: (Teleostei: Cyprinidae): Taxonomy, mitochondrial DNA suggests explosive biogeography, and coevolution of a radiation for the Western Atlantic special group restricted in East Asia. Mol. assemblage. Genet. Mol. Bioi., 27(2): 174- Phyl. Evo/. 18 (2}:163-173. 180. Yang, Z., 1996. Among-site rate variation and Voelker, G. and Edwards, S. V., 1998. Can its impact on phylogenetic analyses. weighting improve bushy trees? Models Trends Ecol. Evo/.11:367-372. of cytochrome b evolution and the molecular systematics of pipits and wagtails (Aves: Motacillidae). Syst. Bioi., 47(4}: 589-603.