Integrin Β1 Mediates Vaccinia Virus Entry Through Activation of PI3K/Akt Signaling

Integrin β1 Mediates Vaccinia Virus Entry through Activation of PI3K/Akt Signaling

Roza Izmailyan, Jye-Chian Hsao, Che-Sheng Chung, Chein-Hung Chen, Paul Wei-Che Hsu, Chung-Lin Liao and Wen Chang J. Virol. 2012, 86(12):6677. DOI: 10.1128/JVI.06860-11. Downloaded from Published Ahead of Print 11 April 2012.

Updated information and services can be found at: http://jvi.asm.org/ http://jvi.asm.org/content/86/12/6677

These include: REFERENCES This article cites 70 articles, 45 of which can be accessed free at: http://jvi.asm.org/content/86/12/6677#ref-list-1 on May 30, 2012 by Life Science Library, Academia Sinica

CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more»

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Integrin ␤1 Mediates Vaccinia Virus Entry through Activation of PI3K/Akt Signaling

Roza Izmailyan,a Jye-Chian Hsao,a Che-Sheng Chung,a Chein-Hung Chen,b Paul Wei-Che Hsu,a Chung-Lin Liao,b and Wen Changa Institute of Molecular Biology,a and The Genomics Research Center,b Academia Sinica, Taipei, Taiwan, Republic of China Downloaded from Vaccinia virus has a broad range of infectivity in many cell lines and animals. Although it is known that the vaccinia mature virus binds to cell surface glycosaminoglycans and extracellular matrix proteins, whether additional cellular receptors are required for virus entry remains unclear. Our previous studies showed that the vaccinia mature virus enters through lipid rafts, suggesting the involvement of raft-associated cellular proteins. Here we demonstrate that one lipid raft-associated protein, integrin ␤1, is important for vaccinia mature virus entry into HeLa cells. Vaccinia virus associates with integrin ␤1 in lipid rafts on the cell surface, and the knockdown of integrin ␤1 in HeLa cells reduces vaccinia mature virus entry. Additionally, vaccinia mature virus infection is reduced in a mouse cell line, GD25, that is deficient in integrin ␤1 expression. Vaccinia mature virus infection triggers the activation of phosphatidylinositol 3-kinase (PI3K)/Akt signaling, and the treatment of cells with inhibitors to http://jvi.asm.org/ block P13K activation reduces virus entry in an integrin ␤1-dependent manner, suggesting that integrin ␤1-mediates PI3K/Akt activation induced by vaccinia virus and that this signaling pathway is essential for virus endocytosis. The inhibition of integrin ␤1-mediated cell adhesion results in a reduction of vaccinia virus entry and the disruption of focal adhesion and PI3K/Akt activation. In summary, our results show that the binding of vaccinia mature virus to cells mimics the outside-in activation process of integrin functions to facilitate vaccinia virus entry into HeLa cells. on May 30, 2012 by Life Science Library, Academia Sinica accinia virus is the prototype of the orthopoxvirus genus of of 18 different ␣ and 8 different ␤ subunits (35). Integrin ␤1 is Vthe family Poxviridae. It has a broad host range, producing known to associate with multiple ␣ subunits, including ␣1-11 and multiple infectious forms of virus particles, e.g., mature virus ␣V, and is widely distributed in virtually all mammalian cell types (MV), wrapped virus (WV), and extracellular virus (EV) (14). (35, 38, 39, 60). Through interactions with the extracellular ma- Vaccinia MV particles are produced in large quantities in infected trices, integrin ␤1 regulates multiple intracellular kinase activa- cells and contain ϳ80 viral proteins in viral particles (10, 51, 69). tion pathways. Our results demonstrate that integrin ␤1 mediates The large number of viral proteins in the MV composition con- MV entry in both mouse embryonic fibroblast (MEF) and HeLa tributes to its complex viral entry processes. First, vaccinia MV cells and that vaccinia virus-induced phosphatidylinositol 3-ki- binds to multiple cell surface components, such as glycosamino- nase (PI3K)/Akt requires integrin ␤1. glycans (11, 29, 42), extracellular matrix laminin (9), and sulfati- (R. Izmailyan conducted this research in partial fulfillment of des (49). Furthermore, vaccinia MV contains an entry fusion the requirements for a Ph.D. from Academia Sinica, Taipei, Tai- complex (EFC) of 12 viral envelope proteins that are evolution- wan, Republic of China.) arily conserved and essential for membrane fusion (6, 7, 33, 47, 52, 56, 68). Additionally, different strains of vaccinia MV harboring MATERIALS AND METHODS mutations in the viral envelope proteins A25 and A26 enter cells differently (8). Finally, vaccinia MV entry pathways also vary Cells and viruses. Two mouse cell lines, GD25 and GD25␤1A, were among different cell lines (66), and multiple kinases, such as ex- kindly provided by Reinhard Fässler (Max Planck Institute of Biochemis- ␤ tracellular signal-regulated kinase (ERK), protein kinase A (PKA), try, Germany). The GD25 cell line was derived from integrin 1 knockout (KO) embryonic stem cells (20). The stably transformed cell line protein kinase C (PKC), and PAK1, have been shown to be acti- GD25␤1A resulted from the electroporation of GD25 cells with wild-type vated upon virus entry (18, 43, 45). However, the cellular receptor human integrin ␤1 cDNA (48). HeLa, BSC40, GD25, and GD25␤1A cells mediating vaccinia MV entry and signal transduction remains un- were cultured in Dulbecco’s modified Eagle medium (DMEM) supple- known. Our previous work showed that cell-bound MV particles mented with 10% fetal bovine serum (FBS) and 2% penicillin-streptomy- were clustered at the plasma membrane lipid rafts prior to virus cin (Gibco) in a 5% CO2 incubator at 37°C. The Western Reserve strain of entry and that the interruption of lipid raft integrity with m-␤- vaccinia MV (WR-VV) was purified through 25 to 40% sucrose gradients cyclodextran significantly reduced vaccinia MV entry into HeLa as previously described (32, 37). A recombinant WR-VV was also used in cells (12). Since lipid rafts on the plasma membrane are known to this study (8). It was constructed previously to express a dual gene cassette act as platforms for receptor clustering, endocytosis, and signal inserted into the thymidine kinase (tk) locus containing the luciferase transduction, we hypothesized that cellular proteins within plasma membrane lipid rafts mediate vaccinia MV entry into HeLa cells. Therefore, we isolated detergent-resistant domains Received 26 November 2011 Accepted 3 April 2012 from HeLa cells upon vaccinia MV infections and extracted pro- Published ahead of print 11 April 2012 teins for quantitative proteomic analyses (55). Here, we investi- Address correspondence to Wen Chang, [email protected]. gated one of the raft-associated proteins, integrin ␤1 (ITG␤1), for Copyright © 2012, American Society for Microbiology. All Rights Reserved. its role in vaccinia MV entry. doi:10.1128/JVI.06860-11 Integrins are a large family of cell surface receptors composed

June 2012 Volume 86 Number 12 Journal of Virology p. 6677–6687 jvi.asm.org 6677 Izmailyan et al.

(luc) gene driven by a viral early promoter and the lacZ gene driven by a Confocal immunofluorescence microscopy. (i) Copatching experi- viral late promoter (8). ments. The experiments for the copatching of integrin ␤1 and vaccinia Antibodies and reagents. Anti-integrin ␤1 monoclonal antibodies MV were performed as previously described (30, 58). In brief, HeLa cells (MAbs) Ts2/16 and 12G10 were purchased from Santa Cruz Biotechnol- seeded onto glass coverslips were infected with MV at an MOI of 50 PFU ogy and Abcam, respectively, and 9EG7 and Mab13, rat MAbs, were ac- per cell for 1 h at 4°C, washed, and transferred to 12°C, where the cells quired from BD Pharmingen. Anti-transferrin receptor (TfR) antibody were incubated with anti-VV antibody (1:500) and anti-integrin ␤1 MAb (CD71) was obtained from AbD Serotec. Anti-paxillin antibody was pur- (12G10) (1:1,000) for 1 h. Tetramethylrhodamine-conjugated goat anti- chased from BD Transduction Laboratories. Alexa Fluor 647-phalloidin rabbit IgG (1:1,000) and fluorescein isothiocyanate (FITC)-conjugated was purchased from Invitrogen. Anti-phospho-Akt (Ser473) and anti-Akt goat anti-mouse IgG (1:1,000) were subsequently added for another 1 h of antibodies were purchased from Cell Signaling Technology. Anti-phos- incubation prior to cell fixation for confocal microscopy. Cells were Downloaded from pho-focal adhesion kinase (FAK) (pY397) antibody was purchased from mounted in Vectashield medium (Vector Laboratories, Burlingame, CA), Invitrogen. Anti-FAK antibody was purchased from BD Biosciences. and images were collected with an LSM510 Meta confocal laser scanning Anti-cyclophilin B (CypB) antibody was obtained from Santa Cruz microscope (Carl Zeiss) using a 63ϫ objective lens. Biotechnology. Anti-␤-actin antibody was purchased from Sigma-Al- (ii) Surface staining of integrin ␤1 with virus in GD25␤1A cells. drich. Anti-A4 and anti-vaccinia MV (anti-VV) rabbit antibodies were GD25␤1A cells were seeded (1.2 ϫ 105 cells) onto glass coverslips in previously described (30). Mouse MAb clone 2D5 against the vaccinia 12-well plates. The next day, cells were cooled at 4°C for 20 min and virus L1 protein was obtained from Y. Ichihashi (31). Bafilomycin A1 subsequently infected with vaccinia MV at an MOI of 60 PFU per cell for (BFLA), cycloheximide (CHX), and blebbistatin (Bleb) were pur-

1 h, washed 3 times in phosphate-buffered saline (PBS), fixed, and incu- http://jvi.asm.org/ chased from Sigma-Aldrich. The PI3K inhibitor (LY294002) and Akt bated with primary anti-integrin ␤1 MAb (12G10) (1:1,000) and anti-VV inhibitor (Akt IV) were purchased from Calbiochem. Laminin-1 (LN), rabbit antibody (1:500) for 1 h. Tetramethylrhodamine-conjugated goat fibronectin (FN), and poly-L-lysine (PLL) were purchased from Sig- anti-rabbit IgG (1:1,000) and FITC-conjugated goat anti-mouse IgG (1: ma-Aldrich. The CypB small interfering RNA (siRNA) duplex and the 1,000) were subsequently added for 30 min, and cells were analyzed by integrin ␤1siRNAduplex(AAUGUAACCAACCGUAGCAUU) were confocal microscopy. purchased from Dharmacon Inc. Outside-in integrin signaling activation assay. Outside-in integrin Biological network analysis. Cellular proteins identified in lipid rafts signaling activation assays were performed as follows. (i) Glass coverslips isolated from HeLa cells (55) were subjected to subcellular localization in 24-well plates were coated with FN (10 ␮g/ml), LN (20 ␮g/ml), or PLL on May 30, 2012 by Life Science Library, Academia Sinica analyses with NCBI Gene Ontology. The “integrin ␤1 (ITG␤1) signaling (100 ␮g/ml) in PBS at 4°C. After 24 h, the dishes were blocked with 1% network” contains cellular proteins that are known to physically interact bovine serum albumin (BSA) in PBS at 37°C for 1 h. Serum-starved HeLa with integrin ␤1 and was constructed by using ARIADNE Pathway Studio cells were seeded at a density of 8 ϫ 104 cells into each well in serum-free 7.0 software, which uses automated text-mining engines to extract infor- DMEM; incubated at 37°C for 20, 30, 45, and 90 min; and lysed in cold mation (Ariadne Genomics). Plasma membrane proteins identified in lysis buffer (10 mM Tris [pH 7.4], 150 mM NaCl, 0.5% NP-40, 1% sodium lipid rafts were compared with those in the integrin ␤1 signaling network deoxycholate, 0.1% SDS, 1% Triton X-100, 1 mM EGTA, and 1 mM and were displayed in a graphical network by using the open-source soft- EDTA with 1ϫ protease inhibitor cocktail [tablets purchased from Roche ware Cytoscape (57). Applied Science]). Samples were then prepared for immunoblot analyses Virus entry assays. Several cell-based biological assays were used to with anti-phospho-Akt (1:1,000), anti-phospho-FAK (1:1,000), anti-Akt quantify vaccinia MV entry into host cells based on previously established (1:1,000), and anti-FAK (1:1,000) antibodies. Alternatively, cells were methods (8, 24, 61–63). MV particles bound to cells were quantified by fixed after 90 min of plating, permeabilized, and stained with anti-paxillin vaccinia MV virion binding assays at 4°C for 60 min with anti-L1 antibody (2D5) (63). Viral core numbers present in the cytoplasm after membrane antibody (1:1,000). (ii) HeLa cells seeded for 90 min, as described above, fusion were quantified by viral core-uncoating assays using an antibody were subsequently infected with vaccinia MV at an MOI of 5 PFU per cell against A4 (62). Luciferase assays driven by a viral early promoter were at 37°C for 1.5 h and harvested for luciferase assays. (iii) HeLa cells were performed with cell lysates harvested at 2 h postinfection (p.i.), as de- seeded, as described in above, for 15 min at 37°C. DMSO or blebbistatin scribed previously (8, 61). Acid bypass treatment, which forced cell- (25 and 50 ␮M) was added to cells, and the cells were incubated for bound MV to fuse with the plasma membrane, was performed as previ- another 45 min. The cells either were fixed, permeabilized, and stained ously described (24). In brief, HeLa cells were pretreated with 25 nM with anti-paxillin antibody (1:1,000) or were infected with vaccinia MV at bafilomycin A1 or 50 ␮M PI3K inhibitor at 37°C for 30 min, cooled at 4°C an MOI of 5 PFU per cell for 1.5 h and harvested for luciferase assays. for 20 min, and subsequently infected with vaccinia MV at a multiplicity Flow cytometry. Cells were detached from the dishes with 20 mM of infection (MOI) of 20 PFU per cell for 1 h. After washing, the infected EDTA, washed, and stained with anti-integrin ␤1 MAb (9EG7) (1:1,000) cells were treated with neutral (pH 7.2) or acidic (pH 5) buffer for 5 min, in PBS containing 150 mM NaCl and 1% BSA for 1 h at 4°C. Samples were incubated in growth medium, and fixed at 2 h p.i. These infected cells were then washed 3 times, followed by incubation with FITC-conjugated goat permeabilized and stained with anti-core A4 antibody for confocal mi- anti-rat secondary antibody for 1 h at 4°C. Following a final wash, the cells croscopy analyses as described previously (62). were analyzed by fluorescence-activated cell sorting (FACS). Plaque formation on GD25␤1A and GD25 cells. Freshly confluent Vaccinia MV infections activated Akt phosphorylation. HeLa cells 4 5 cells were infected with WR-VV (approximately 300 PFU per well in a (7.5 ϫ 10 cells/well) or GD25␤1A cells (1 ϫ 10 cells/well) were cultured 6-well plate) at 37°C for 1 h; washed and cultured in growth medium in 12-well plates for 24 h. Cells were serum starved at 37°C for 2 h (for containing 1% agarose; fixed at 2 days p.i.; and stained with X-Gal (5- HeLa cells) or 18 h (for GD25␤1A cells) and then stimulated with medium bromo-4-chloro-3-indolyl-␤-D-galactopyranoside) as previously de- containing 20% FBS or purified vaccinia MV (at MOIs of 40 PFU per cell scribed (4). Alternatively, cells were pretreated with dimethyl sulfoxide for HeLa cells and 60 PFU per cell for GD25␤1A cells) at 37°C for various (DMSO) or LY294002 (25 or 50 ␮M) in serum-free DMEM prior to times. Cell lysates were prepared with cold lysis buffer (10 mM Tris [pH infection, and the inhibitors remained in cultures after infection until cell 7.4], 150 mM NaCl, 0.5% NP-40, 1% sodium deoxycholate, 0.1% SDS, fixation and X-Gal staining as described above. 1% Triton X-100, 1 mM EGTA, and 1 mM EDTA with 1ϫ protease Integrin ␤1 siRNA. HeLa cells were either mock transfected (si-con- inhibitor cocktail [tablets purchased from Roche Applied Science]) for trol) or transfected with siRNA duplexes (20 nM) targeting either cyclo- immunoblot analysis. philin B (si-CypB) or integrin ␤1 (si-ITG␤1) using the Lipofectamine Statistical analysis. Statistical analyses were performed by using Stu- 2000 reagent (Invitrogen) as described previously (30). dent’s t test with Prism software (GraphPad).

6678 jvi.asm.org Journal of Virology Integrin ␤1 Mediates Vaccinia Virus Entry Downloaded from http://jvi.asm.org/ on May 30, 2012 by Life Science Library, Academia Sinica

FIG 1 Integrin ␤1 was identified in lipid rafts and is associated with vaccinia MV on HeLa cells. (A) The hierarchical ITG␤1 network, constructed by ARIADNE Pathway Studio 7.0 software (see Materials and Methods), shows integrin ␤1 and its direct and indirect interacting membrane proteins. The nodes are labeled with gene symbols, and the red nodes represent the cellular proteins identified in the lipid raft fractions upon vaccinia MV infections (55). ITG␤1, integrin ␤1; TLN1, talin-1; EZR, ezrin; CAV1, caveolin-1; SLC3A2, CD98. (B) Vaccinia MV colocalizes with ITG␤1 at the surface of HeLa cells. HeLa cells were infected with vaccinia MV at an MOI of 50 PFU per cell for 1 h at 4°C, washed, and transferred to 12°C, where the cells were incubated with rabbit anti-VV antibody (1:500) (red) and anti-integrin ␤1 MAb (12G10) (1:1,000) (green) for 1 h for copatching as previously described (30). Alternatively, anti-VV antibody was incubated with anti-transferrin receptor (TfR) (green) MAb as a control. Tetramethylrhodamine-conjugated goat anti-rabbit IgG (1:1,000) and FITC-conjugated goat anti- mouse IgG (1:1,000) were subsequently added, and cells were fixed for confocal microscopy. DNA was visualized by 4 -6-diamidino-2-phenylindole (DAPI) staining (blue). =

June 2012 Volume 86 Number 12 jvi.asm.org 6679 Izmailyan et al. Downloaded from http://jvi.asm.org/ on May 30, 2012 by Life Science Library, Academia Sinica

6680 jvi.asm.org Journal of Virology Integrin ␤1 Mediates Vaccinia Virus Entry

RESULTS mined by actin and paxillin staining in si-ITG␤1KDHeLacells Integrin ␤1 associates with vaccinia MV on HeLa cells. In order (Fig. 2C), confirming the specificity of si-ITG␤1. We then in- to identify cellular proteins within lipid raft microdomains, we fected these HeLa KD cells with vaccinia MV at an MOI of 5 previously performed stable isotope labeling for quantitative pro- PFU per cell and harvested the cells at 2 or4hp.i.forviralearly teomic analyses and identified 570 cellular proteins. Those pro- luciferase activity assays. The results showed that the rates of teins with altered levels after vaccinia virus infection constitute vaccinia virus infection of si-ITG␤1KDHeLacellswerere- about 3% of the total candidates and were described elsewhere duced to 40% (at2hp.i.) and 38% (at4hp.i.)oftheinfection previously (55). To complement the above-mentioned study, here rates seen for the si-control and si-CypB KD HeLa cells (Fig. we analyzed the remaining 97% of the “constitutive” raft-associ- 2D), suggesting that the reduction was not due to delayed ki- Downloaded from ated proteins whose quantifications fell within the range of a ratio netics. Finally, we performed vaccinia MV binding assays and of 1.0 Ϯ 0.5, i.e., a ratio that was considered not significantly virus core-uncoating assays as previously described (62, 63). changed by virus infection. These proteins were analyzed through The results showed that the rate of MV attachment was reduced biological network analyses in order to identify specific signaling to 52% in si-ITG␤1KDHeLacells(Fig. 2E)andthattherateof complexes resident in the rafts. As described in Materials and MV penetration was reduced to 32% (Fig. 2F), indicating that Methods, biological network analyses (Fig. 1A) revealed the pres- integrin ␤1isimportantforvacciniavirusentryatboththe ence of integrin ␤1 and its associated proteins, such as CD9, attachment and penetration steps.

CD47, CD59, CD98, talin, ezrin, and Fyn/yes/lyn, suggesting a Vaccinia virus entry is reduced in mouse cells lacking integ- http://jvi.asm.org/ possibility that integrin ␤1-mediated biological signaling may rin ␤1 expression. In addition to HeLa cells, we obtained a mouse participate in vaccinia MV entry. We thus investigated whether cell line, GD25␤1A, derived from an integrin ␤1 KO cell line, integrin ␤1 associates with vaccinia MV on the surface of infected GD25 (20), which expresses only human integrin ␤1(48). Indeed, HeLa cells. HeLa cells were infected with the vaccinia MV WR integrin ␤1 was detected on the surface of GD25␤1A cells but not strain at an MOI of 50 PFU per cell for 60 min at 4°C and then on the surface of GD25 cells by FACS analyses (Fig. 3A). washed and transferred to a temperature of 12°C. Anti-integrin ␤1 GD25␤1A and GD25 cells were infected with vaccinia MV at an (ITG␤1) and anti-vaccinia MV (VV) antibodies were subse- MOI of 60 PFU per cell at 4°C for 60 min, washed, and fixed for quently added to cells for copatching (Fig. 1B), as previously de- immunofluorescence analyses. Abundant MV particles bound to on May 30, 2012 by Life Science Library, Academia Sinica scribed (30, 58). An anti-transferrin receptor (TfR) antibody was GD25␤1A cells and colocalized with surface integrin ␤1 concen- also included as a negative control. The results show that vaccinia trated at cellular protrusions, whereas fewer MV particles (ϳ34%) MV on HeLa cells copatched with cell surface integrin ␤1 but not bound to GD25 cells (Fig. 3B). In addition, both GD25␤1A and with the transferrin receptor on HeLa cells (Fig. 1B), suggesting a GD25 cells were infected with vaccinia WR-VV at different MOIs role of integrin ␤1 in vaccinia MV entry. from 10 to 40 PFU per cell and were harvested to measure the early Vaccinia virus entry is reduced upon integrin ␤1 knockdown luciferase activity at 2 h p.i. or the late ␤-galactosidase (␤-Gal) in HeLa cells. To test whether integrin ␤1 mediates vaccinia MV activity at 8 h p.i. (Fig. 3C). Data from both enzymatic activity entry into HeLa cells, control siRNA (si-control) or siRNA target- assays and the core-uncoating assay (data not shown) revealed ing integrin ␤1 (si-ITG␤1) or cyclophilin B (si-CypB) was trans- that vaccinia MV entry into GD25 cells was less efficient than entry fected into HeLa cells, followed by harvesting for immunoblot into GD25␤1A cells. We also performed plaque assays on analyses (Fig. 2A) and FACS analyses (Fig. 2B). The si-ITG␤1 and GD25␤1A and GD25 cells and stained the plaques with X-Gal. si-CypB constructs specifically knocked down (KD) the total Consistently, vaccinia MV produced fewer plaques (ϳ30%) in amounts of integrin ␤1 and cyclophilin B proteins, respectively GD25 cells than in GD25␤1A cells (Fig. 3D). Interestingly, plaques (Fig. 2A). In addition, integrin ␤1 expression on the cell surface formed in GD25 cells also appeared smaller than those formed in was effectively reduced in si-ITG␤1 KD HeLa cells but not in GD25␤1A cells, implying a role of integrin ␤1 in vaccinia virus si-control or si-CypB KD cells (Fig. 2B). si-ITG␤1 also affected spreading among cells, although we did not pursue it further. integrin ␤1-mediated cell adhesion, resulting in alterations in cell Taken together, the results show that cell surface integrin ␤1 me- morphology and a disorganization of focal adhesions, as deter- diates vaccinia MV infections.

FIG 2 Vaccinia virus entry is reduced in si-ITG␤1 KD HeLa cells. (A) Immunoblots of lysates prepared from mock-KD (si-Cont.1 and 2), si-ITG␤1 KD, and si-CypB KD HeLa cells using anti-ITG␤1 (Mab13), anti-CypB, or anti-␤-actin antibodies. (B) Cell surface expression of ITG␤1 determined by flow cytometry. The KD HeLa cells described above (A) were stained with anti-ITG␤1 MAb (9EG7), followed by FITC-conjugated goat anti-rat secondary antibody, and analyzed by FACS. si-control is shown in red, si-CypB is shown in blue, and si-ITG␤1 is shown in gray. The background staining (shown in black) represents the si-control cells that were stained with the secondary antibody only. (C) Immunofluorescence analysis of ITG␤1, paxillin, and actin proteins in KD HeLa cells. The KD HeLa cells described above (A) were fixed and stained with anti-ITG␤1 MAb (Mab13), followed by FITC-conjugated goat anti-rat secondary antibody (green). These cells were subsequently permeabilized and stained with Alexa Fluor 647-phalloidin (white) and anti-paxillin antibodies, followed by tetramethylrhodamine-conjugated goat anti-mouse IgG (red). (D) Viral early luciferase assays. The KD HeLa cells described above (A) were infected with VV-WR at an MOI of 5 PFU per cell and harvested at 2 and 4 h p.i. for luciferase assays as described in Materials and Methods. The luciferase activity in the si-control cells was defined as 100%. The bars represent the standard deviations from three independent experiments. (E) Immunofluorescence analyses of vaccinia virus binding assay. The KD HeLa cells described above (A) were infected with purified vaccinia MV particles at an MOI of 20 PFU per cell for 60 min at 4°C, fixed, and stained with anti-ITG␤1 Mab13 (green) and anti-L1 MAb 2D5 (red). The cell-bound virions were quantified as described previously (63). (F) Immunofluorescence analyses of vaccinia virus core-uncoating assays. The KD HeLa cells described above (A) were infected as described above, cultured in the presence of cycloheximide (10 ␮g/ml) for an additional 2 h at 37°C, fixed, and stained with anti-ITG␤1 MAb Mab13 as described above. These cells were subsequently permeabilized and stained with anti-A4 antibody, and internalized viral cores were quantified as described previously (62). Particle numbers counted in the si-control HeLa cells were used as 100%. The bars represent the standard deviations from five independent experiments. Statistical analyses in panels D to F were performed by using Student’s .(P Ͻ 0.0001 ,ءءء) t test in Prism software (GraphPad). The P value is shown

June 2012 Volume 86 Number 12 jvi.asm.org 6681 Izmailyan et al. Downloaded from http://jvi.asm.org/ on May 30, 2012 by Life Science Library, Academia Sinica

FIG 3 Vaccinia virus entry is reduced in mouse cells lacking integrin ␤1 expression. (A) Flow cytometry analyses of cell surface expression of ITG␤1. GD25␤1A (blue) and GD25 (red) cells were stained with anti-ITG␤1 MAb (9EG7), followed by FITC-conjugated goat anti-rat secondary antibody, and analyzed by FACS. The background staining (in gray) represents cell staining with the secondary antibody only. (B) Confocal immunofluorescence of vaccinia MV particles colocalized with integrin ␤1 in GD25␤1A and GD25 cells. GD25␤1A and GD25 cells were infected with purified vaccinia MV particles at an MOI of 60 PFU per cell at 4°C for 1 h, washed, and stained with anti-ITG␤1 (12G10) (green) and anti-VV (red) antibodies, followed by FITC-conjugated goat anti-mouse IgG and tetramethylrhodamine-conjugated goat anti-rabbit IgG. GD25 cells were negative for ITG␤1 staining and were subsequently permeabilized and stained with Alexa Fluor 647-phalloidin (white) to mark the cell body. (C) GD25␤1A and GD25 cells were infected with WR-VV at MOIs of 10, 20, and 40 PFU per cell and harvested at 2 h p.i. for luciferase assays (Early) and 8 h p.i. for ␤-Gal activity assays (Late). RLU, relative light units; OD 405, optical density at 405 nm. (D) Vaccinia MV formed more plaques in GD25␤1A cells than in GD25 cells. Both cell types were infected with ϳ300 PFU of WR-VV, fixed, and stained for X-Gal at 2 days p.i. to visualize the blue plaques.

6682 jvi.asm.org Journal of Virology Integrin ␤1 Mediates Vaccinia Virus Entry

Vaccinia MV binds to integrin ␤1 to induce PI3K/Akt activation, which leads to virus endocytosis in HeLa cells. Integrin ␤1 was shown previously to mediate multiple inside-out and outside-in signaling pathways that play crucial roles in cell-to-cell and cell-to-matrix communications (28, 38, 46). The clustering of integrin at the cell membrane leads to kinase activation, which is followed by alterations to the cytoskeleton and receptor endocytosis. Since it was shown previously that PI3K and Akt are critical

regulators downstream of integrin ␤1 on GD25␤1A cells (15, 48, Downloaded from 65), we wanted to test whether vaccinia MV binding to integrin ␤1 activates PI3K/Akt signaling in GD25␤1A cells and whether such kinase activation is critical for vaccinia MV entry. GD25␤1A cells were serum starved and subsequently infected with vaccinia MV at an MOI of 60 PFU per cell at 37°C for 5, 10, and 20 min and then harvested for immunoblot analyses with anti-phospho-Akt (Ser473) antibody. As shown in Fig. 4A, vac-

cinia MV stimulated the robust phosphorylation of Akt in http://jvi.asm.org/ GD25␤1A cells as early as 5 min after the addition of virus, compared to that in medium alone. The pretreatment of GD25␤1A cells with the PI3K inhibitor LY294002 completely abolished MV- induced Akt phosphorylation, showing that vaccinia MV infection triggered the activation of Akt through PI3K. To determine whether PI3K/Akt activation was required for vaccinia virus entry, we pretreated both GD25␤1A and HeLa cells with inhibitors that blocked PI3K (LY294002) and Akt (Akt IV) activities, subse- on May 30, 2012 by Life Science Library, Academia Sinica quently infected the cells with vaccinia MV, and measured viral early promoter luciferase activity at 2 h p.i. As shown in Fig. 4B, PI3K as well as Akt inhibitors readily reduced vaccinia MV infections in both GD25␤1A and HeLa cells in a dose-dependent manner, showing that PI3K/Akt signaling is crucial for vaccinia MV entry into both cell lines. It is worth noting that GD25 cells were not suited to kinase signaling studies because it was previously shown that this cell line contains altered kinase regulation that compensates for the loss of integrin ␤1 and that multiple tyrosine kinases are activated without integrin ␤1(3). Thus, in order to demonstrate that MV-induced PI3K activation requires integrin ␤1, we infected si-control and si-ITG␤1 KD HeLa cells with vaccinia MV and harvested the cells at 0, 60, and 90 min for phospho- Akt immunoblot analyses. When these cells were infected with vaccinia MV, the phosphorylation of Akt was also induced in si- FIG 4 PI3K/Akt activation induced by WR-VV is required for virus entry. (A) control HeLa cells although with slower kinetics than in WR-VV induced phosphorylation of Akt in GD25␤1A cells. GD25␤1A cells GD25␤1A cells (Fig. 4C). Most importantly, the phosphorylation were serum starved, pretreated with DMSO or the PI3K inhibitor (LY294002), of Akt was significantly reduced in si-ITG␤1 KD HeLa cells. Fi- and either mock infected or infected with medium containing purified MV particles (WR-VV) at an MOI of 60 PFU per cell at 37°C. Cells were harvested nally, GD25␤1A cells were pretreated with 25 and 50 ␮M at 0, 5, 10, and 20 min after the addition of virus for immunoblot analyses with LY294002 and infected with vaccinia MV for plaque formation anti-phospho-Akt (pAkt) (S473), anti-Akt, and anti-␤-actin antibodies. (B) assays, which showed a dosage-dependent reduction of plaque Viral early luciferase activity in GD25␤1A and HeLa cells was blocked by PI3K/ numbers with LY294002 and not the DMSO control (Fig. 4D), Akt inhibitors. Cells were pretreated with DMSO; the PI3K inhibitor consistent with the data from the luciferase assays (Fig. 4B). Taken (LY294002) at a concentration of 12, 25, or 50 ␮M; or the Akt inhibitor (Akt IV) at a concentration of 2.5 or 5 ␮M and subsequently infected with WR-VV together, these results demonstrate that vaccinia MV-induced at MOIs of 10 PFU (for GD25␤1A cells) and 5 PFU (for HeLa cells) per cell and PI3K/Akt activation is mediated through integrin ␤1 and that harvested at 2 h p.i. for luciferase assays as described above. The luciferase activity present in the DMSO-treated samples was used as 100%. The bars represent the standard deviations from three independent experiments. Sta- tistical analyses were performed by using Student’s t test in Prism software (P Ͻ 0.0001). (C) WR- cells stimulated with medium containing 20% fetal bovine serum (MϩFBS ,ءءء ;P Ͻ 0.001 ,ءء) GraphPad). P values are shown) VV-induced phosphorylation of Akt requires integrin ␤1 in HeLa cells. The for 30 min were used as a control. (D) Vaccinia virus plaque formation was si-control and si-ITG␤1 KD HeLa cells, as described in the legend of Fig. 2A, reduced with the PI3K inhibitor LY294002 in GD25␤1A cells. GD25␤1A cells were serum starved, pretreated with or without inhibitors of PI3K (LY294002) were pretreated with DMSO or the inhibitor LY294002 at concentrations of 25 or Akt (Akt IV), and subsequently infected with purified MV particles (WR- and 50 ␮M for 1 h at 37°C and subsequently infected with WR-VV (ϳ300 VV) at an MOI of 40 PFU per cell at 37°C. Cells were harvested at 0, 60, and 90 PFU/well), cultured in medium containing inhibitors, fixed at 2 days p.i., and min after the addition of virus for immunoblot analyses with anti-phospho- stained with X-Gal to visualize the blue plaques. After photography, cells were Akt (pAkt) (S473), anti-Akt, and anti-␤-actin antibodies. The si-control HeLa subsequently stained with crystal violet to reveal the monolayer of cells.

June 2012 Volume 86 Number 12 jvi.asm.org 6683 Izmailyan et al. Downloaded from http://jvi.asm.org/

FIG 5 PI3K/Akt activation is required for vaccinia MV endocytosis. (A) Immunoﬂuorescence analyses of virus-uncoating assays with HeLa cells. HeLa cells were

pretreated with DMSO (a), 25 nM BFLA (b and d), or 50 ␮M PI3K inhibitor (LY294002) (c and e) and subsequently infected with purified MV particles at an MOI on May 30, 2012 by Life Science Library, Academia Sinica of 20 PFU per cell for 60 min at 4°C. Cells were then treated with neutral (pH 7.4) (a to c) or acidic (pH 5) (d and e) buffer for 5 min, washed, cultured at 37°C in medium containing 10 ␮g/ml cycloheximide for an additional 2 h, and analyzed by virus core-uncoating assays using anti-A4 antibody, as described in the text. (B) Quantification of viral core numbers per cell from each group (30 cells/group) described above (A). Statistical analyses were performed by using Student’s t .(P Ͻ 0.0001 ,ءءء) test in Prism software (GraphPad). The P value is shown such an activation is required for vaccinia virus entry and plaque ity, migration, and growth suggests that vaccinia MV exploits the formation. integrin/PI3K/Akt signaling pathway to modulate cellular envi- To determine whether the PI3K inhibitor specifically blocks ronments preferable for viral entry and growth. We thus per- viral endocytic entry, we performed acid bypass experiments in formed outside-in activation experiments to turn on the integrin- which the cell-bound viruses were briefly treated with acidic buf- dependent signaling pathway in HeLa cells. HeLa cells were plated fer to force viral entry through plasma membrane fusion, as de- onto dishes precoated with the extracellular matrix proteins fi- scribed previously (24). HeLa cells were pretreated with DMSO, bronectin (FN) and laminin (LN) for only a short time so that few bafilomycin A (a drug known to inhibit endosomal acidification), extracellular matrix proteins were secreted from cells to induce or the PI3K inhibitor LY294002 and infected with vaccinia MV at integrin-mediated cell adhesion. As a negative control, HeLa cells 4°C for 1 h. The unbound virions were washed, and the infected were plated onto dishes precoated with poly-L-lysine (PLL), which cells were briefly exposed to either neutral (pH 7.4) or acidic (pH mediates cell attachment through electrostatic interactions and is 5) buffer for 5 min at 37°C. The cultures were then maintained for independent of integrins (53, 54). Cells were allowed to adhere another 2 h in growth medium prior to fixation for viral core- and spread for 20, 30, 45, and 90 min before they were harvested uncoating assays as previously described (8). As shown in Fig. 5A, for immunoblot analysis. As shown in Fig. 6A, the integrin-medi- control HeLa cells treated with DMSO (Fig. 5Aa) were successfully ated phosphorylation of FAK and Akt was detected as early as 20 infected, and abundant viral cores were detected in the cytoplasm. min after cell plating onto FN and LN but not onto PLL, showing BFLA pretreatment significantly reduced viral core numbers in a specific activation of integrin/PI3K/Akt through cell-matrix in- cells, confirming virus entry through a low-pH-dependent endo- teractions. As expected, immunofluorescence staining with anti- cytic process (Fig. 5Ab). The pretreatment of HeLa cells with paxillin antibody revealed the formation of focal adhesions in cells LY294002 also reduced numbers of viral cores in cells, suggesting plated onto FN and LN but not onto PLL (Fig. 6B). When these that PI3K/Akt is important for vaccinia virus uncoating (Fig. cells were infected with vaccinia MV, the early luciferase activity 5Ac). Most importantly, the exposure of these cells to a low-pH level was higher in HeLa cells plated onto FN and LN than in those buffer rendered MV entry through plasma membrane fusion re- plated onto PLL (Fig. 6C). Altogether, these results demonstrate sistant to inhibition by BFLA (Fig. 5Ad) and LY294002 (Fig. 5Ae). that the outside-in activation of integrin ␤1-mediated PI3K sig- Quantifications of viral uncoated cores in each sample are shown naling is important for vaccinia MV entry into HeLa cells. in Fig. 5B. Taken together, these results demonstrate that PI3K/ Integrin adhesome formation induced by outside-in activation Akt activation induced by vaccinia MV is important for virus en- was shown previously to be disrupted upon blebbistatin treatment docytosis in HeLa cells. (53). When the above-described outside-in activation procedures Outside-in activation of integrin ␤1 facilitates vaccinia MV were performed with HeLa cells in the presence of 25 and 50 ␮M entry. The fact that the integrin network is essential for cell viabil- blebbistatin, the formation of focal adhesions was completely dis-

6684 jvi.asm.org Journal of Virology Integrin ␤1 Mediates Vaccinia Virus Entry Downloaded from

FIG 7 Current model of integrin ␤1 in vaccinia MV entry. The vaccinia MV http://jvi.asm.org/ WR strain binds to cell surface glycosaminoglycans (GAGs) and laminin, which induce further interactions between MV and cellular surface receptor integrin in lipid rafts. The subsequent recruitment of the cellular membrane protein CD98 and the activation of downstream kinases such as PI3K/Akt and ERK lead to the endocytosis of vaccinia MV.

persed (Fig. 6D). These drug-treated HeLa cells were subsequently on May 30, 2012 by Life Science Library, Academia Sinica infected with vaccinia MV, and a dosage-dependent reduction of viral entry was observed, compared with the mock-treated cells (Fig. 6E). These results suggested that the recruitment of cellular proteins to form integrin adhesomes, which was blocked by blebbistatin treatment, is important for vaccinia MV entry.

DISCUSSION In this study, we demonstrated the role of the cellular protein integrin ␤1 in vaccinia MV entry by several experimental criteria. First, we showed that integrin ␤1 and vaccinia MV colocalized on plasma membrane lipid rafts and that the knockdown of integrin ␤1 in HeLa cells and the knockout of integrin ␤1 in mouse cells FIG 6 Outside-in integrin activation enhances vaccinia MV entry. (A) Cell adhesion to the extracellular matrix activates FAK and Akt phosphorylation. reduced vaccinia MV attachment. Second, we showed that the Serum-starved HeLa cells in suspension (Ϫ) were seeded onto fibronectin requirement of integrin ␤1 is not limited to virus attachment, (FN), laminin-1 (LN), and poly-L-lysine (PLL) at 37°C and harvested at 20, 30, since integrin ␤1 also mediated the activation of PI3K/Akt for 45, and 90 min for immunoblot analysis with anti-phospho-FAK (pFAK) subsequent MV endocytosis. We further showed that adhesome (Y397), anti-phospho-Akt (pAkt) (S473), anti-FAK, and anti-Akt antibodies. formation activated by the interaction of the extracellular matrix (B) Immunofluorescence staining of paxillin in HeLa cells seeded onto a different extracellular matrix. HeLa cells were seeded onto FN, LN, and PLL, as and integrin is also critical for vaccinia MV entry. Taken together, described above, for 90 min; fixed; permeabilized; and stained with anti-pax- these data demonstrated that cell surface integrin ␤1 in lipid rafts illin antibody, followed by FITC-conjugated goat anti-mouse IgG. (C) Viral serves as a signaling platform which activates downstream kinases early luciferase assays. HeLa cells were seeded as described above (B), infected and cellular adhesome formation, both of which are important for with WR-VV at an MOI of 5 PFU per cell, and harvested at 1.5 h p.i. for luciferase assays as described in Materials and Methods. The luciferase activity vaccinia MV entry. in HeLa cells seeded onto FN was defined as 100%. The bars represent the Vaccinia virus infection is known to activate multiple kinases, standard deviations from three independent experiments. (D) Immunofluo- including ERK (18), PKC, and PAK1 (43, 45). However, the virus- rescence staining of paxillin in HeLa cells treated with blebbistatin. HeLa cells induced upstream signal that leads to kinase activation remains were seeded onto FN and LN as described above (A) and incubated with 50 ␮M unknown. Our study shows that the binding of vaccinia MV to blebbistatin (ϩBleb) or DMSO (ϪBleb) (see Materials and Methods) for 60 min. Cells were fixed and permeabilized, and the focal adhesions were stained integrin ␤1 activated the PI3K/Akt kinase pathway. We also found with anti-paxillin antibody (red). Cell nuclei were stained with DAPI (blue). In that the KD of integrin ␤1 led to a reduction of ERK activity in panels B and D, white arrows identify areas of focal adhesion. (E) HeLa cells HeLa cells and that the addition of the ERK inhibitor PD98059 seeded as described above were treated with DMSO or blebbistatin (25 and 50 interfered with vaccinia MV entry (R. Izmailyan, unpublished re- ␮M) and subsequently infected with WR-VV at an MOI of 5 PFU per cell and harvested at 1.5 h p.i. for luciferase assays. The luciferase activity in DMSO- sults). Although we did not investigate PAK1 activation in this treated HeLa cells was defined as 100%. The bars represent the standard devi- study, interestingly, PAK1 was previously shown to be activated by ations from three independent experiments. Statistical analyses in panels B, C, integrin ␤1(50). Taking these findings together, we conclude that and E were performed by using Student’s t test in Prism software (GraphPad). vaccinia MV interacts with integrin ␤1 to activate a downstream ,P Ͻ 0.0001). kinase network to induce viral endocytosis (Fig. 7). At this point ,ءءء) The P value is shown

June 2012 Volume 86 Number 12 jvi.asm.org 6685 Izmailyan et al. we have not been able to identify any viral envelope protein spe- ACKNOWLEDGMENTS cifically associated with integrin ␤1 in coimmunoprecipitation We thank Reinhard Fässler (Max Planck Institute of Biochemistry, Ger- experiments. It could be that vaccinia MV interacts with multiple many) for providing GD25␤1A and GD25 cells and Jyrki Heino for sug- cellular receptor proteins during virus entry and that each recep- gestions and comments on the manuscript. We also thank Sue-Ping Lee tor interaction is transient and dynamically regulated (see below). for assistance with confocal microscopy. Although our study focused primarily on integrin ␤1, the sig- This work was supported by grants from Academia Sinica and the National Science Council of the Republic of China (NSC-100-2320-B- nificance of the involvement of integrin in vaccinia virus entry 001-006). goes beyond this molecule. Blebbistatin, an inhibitor of myosin II light-chain ATPase (41), was recently shown to interrupt integrin Downloaded from REFERENCES adhesome formation (53), and in our experiments, blebbistatin- 1. Agerer F, et al. 2005. Cellular invasion by Staphylococcus aureus reveals treated HeLa cells lost the outside-in activation of integrin and a functional link between focal adhesion kinase and cortactin in integrin- reduced vaccinia virus endocytosis. This finding implies that other mediated internalisation. J. Cell Sci. 118:2189–2200. components of the integrin adhesome may be involved in vaccinia 2. Akula SM, Pramod NP, Wang FZ, Chandran B. 2002. Integrin alpha 3 virus endocytosis. Indeed, a recent study conducted in our labo- beta 1 (CD 49c/29) is a cellular receptor for Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV-8) entry into the target cells. Cell 108:407–419. ratory by Schroeder et al. (55) demonstrated that CD98, a type II 3. Armulik A, Svineng G, Wennerberg K, Fassler R, Johansson S. 2000. membrane protein found in lipid rafts (55) and a component of Expression of integrin subunit beta 1B in integrin beta 1-deficient GD25 the integrin adhesome (53), is required for vaccinia MV endocy- cells does not interfere with alpha V beta 3 functions. Exp. Cell Res. 254: http://jvi.asm.org/ 55–63. tosis (55). The KD of CD98 does not affect vaccinia MV binding to 4. Bair CH, Chung CS, Vasilevskaya IA, Chang W. 1996. Isolation and cells but reduces virus endocytosis and core uncoating (55), sug- characterization of a Chinese hamster ovary mutant cell line with altered gesting that it participates in vaccinia virus entry at a step subse- sensitivity to vaccinia virus killing. J. Virol. 70:4655–4666. quent to integrin ␤1. It is worth noting that CD98 was reported 5. Bergelson JM, Shepley MP, Chan BMC, Hemler ME, Finberg RW. 1992. Identification of the integrin Vla-2 as a receptor for echovirus-1. Science previously to promote integrin-dependent signaling, leading to 255:1718–1720. the activation of FAK, PI3K, Akt, and Rac (22, 23, 70). Currently, 6. Bisht H, Weisberg AS, Moss B. 2008. Vaccinia virus L1 protein is re- our model proposes that vaccinia MV binds to integrin ␤1, required for cell entry and membrane fusion. J. Virol. 82:8687–8694. on May 30, 2012 by Life Science Library, Academia Sinica 7. Brown E, Senkevich TG, Moss B. 2006. Vaccinia virus F9 virion mem- cruits CD98 in rafts, activates kinases, and induces cytoskeleton brane protein is required for entry but not virus assembly, in contrast to rearrangements to trigger MV endocytosis in cells (Fig. 7). Finally, the related L1 protein. J. Virol. 80:9455–9464. we noticed that vaccinia MV formed smaller plaques on GD25 8. Chang SJ, Chang YX, Izmailyan R, Tang YL, Chang W. 2010. Vaccinia cells than those on GD25␤1A cells. The KD of integrin ␤1 in HeLa virus A25 and A26 proteins are fusion suppressors for mature virions and determine strain-specific virus entry pathways into HeLa, CHO-K1, and L cells also reduced MV and EV production in a low-MOI infection, cells. J. Virol. 84:8422–8432. implying that vaccinia virus spreading among cells may also re- 9. Chiu WL, Lin CL, Yang MH, Tzou DL, Chang W. 2007. Vaccinia virus quire integrin ␤1 (data not shown). Further studies are needed to 4c (A26L) protein on intracellular mature virus binds to the extracellular explore this possibility. cellular matrix laminin. J. Virol. 81:2149–2157. 10. Chung CS, et al. 2006. Vaccinia virus proteome: identification of proteins Integrins are involved in the entry of many viruses (2, 5, 19, 21, in vaccinia virus intracellular mature virion particles. J. Virol. 80:2127– 26, 34, 36, 44, 59, 64) and bacteria (16, 27, 40). The pathogen-host 2140. interaction may promote the clustering of integrins and focal ad- 11. Chung CS, Hsiao JC, Chang YS, Chang W. 1998. A27L protein mediates vaccinia virus interaction with cell surface heparan sulfate. J. Virol. 72: hesion formation but subvert the downstream signaling network 1577–1585. to modify membrane traffic and cytoskeletal dynamics to meet 12. Chung CS, Huang CY, Chang W. 2005. Vaccinia virus penetration their own needs (1, 17). Several unique properties of integrins may requires cholesterol and results in specific viral envelope proteins associ- explain why they are so frequently targeted for bacterial and viral ated with lipid rafts. J. Virol. 79:1623–1634. 13. Collinet C, et al. 2010. Systems survey of endocytosis by multiparametric invasions. Integrins are ubiquitously expressed on virtually all image analysis. Nature 464:243–249. cells. They regulate both outside-in and inside-out signaling to 14. Condit RC, Moussatche N, Traktman P. 2006. In a nutshell: structure maintain important cell functions related to cell adhesion, migra- and assembly of the vaccinia virion. Adv. Virus Res. 66:31–124. 15. Cordes N, Seidler J, Durzok R, Geinitz H, Brakebusch C. 2006. Beta tion, and survival. Furthermore, integrins act as global regulators 1-integrin-mediated signaling essentially contributes to cell survival after of endocytosis, affecting the intracellular trafficking of growth fac- radiation-induced genotoxic injury. Oncogene 25:1378–1390. tor receptors and endosome localization in cells (67). A genome- 16. Cue D, Dombek PE, Lam H, Cleary PP. 1998. Streptococcus pyogenes wide screen of endocytosis regulators identified adhesion-medi- serotype M1 encodes multiple pathways for entry into human epithelial cells. Infect. Immun. 66:4593–4601. ated molecules that support cross talk between cell adhesion 17. de Curtis I. 2011. Host-pathogen interactions: cheating the host by mak- regulation and endocytic activity (13). The fate of endocytosed ing new connections. Curr. Biol. 21:R192–R194. vaccinia MV is not well understood. Recently, it was shown that 18. de Magalhães JC, et al. 2001. A mitogenic signal triggered at an early stage integrin internalization is mediated through macropinocytosis. of vaccinia virus infection—implication of MEK/ERK and protein kinase in a virus multiplication. J. Biol. Chem. 276:38353–38360. Internalized integrins were found to transit through early endo- 19. Dorner M, et al. 2010. Beta(1) integrin expression increases susceptibility somes to recycling endosomes and then back to the cell surface to of memory B cells to Epstein-Barr virus infection. J. Virol. 84:6667–6677. form new adhesions (25). Currently, we are investigating whether 20. Fassler R, et al. 1995. Lack of b1 integrin gene in embryonic stem cells affects morphology, adhesion, and migration but not integration into the integrin ␤1 regulates the intracellular trafficking of vaccinia viri- inner cell mass of blastocysts. J. Cell Biol. 128:979–988. ons through the same route prior to virus-cell membrane fusion. 21. Feire AL, Koss H, Compton T. 2004. Cellular integrins function as entry More studies will be needed in the future to dissect the structure- receptors for human cytomegalovirus via a highly conserved disintegrin- function relationship of integrins in vaccinia virus entry. like domain. Proc. Natl. Acad. Sci. U. S. A. 101:15470–15475. 22. Fenczik CA, Sethi T, Ramos JW, Hughes PE, Ginsberg MH. 1997.

6686 jvi.asm.org Journal of Virology Integrin ␤1 Mediates Vaccinia Virus Entry

Complementation of dominant suppression implicates CD98 in integrin gene I2L encodes a membrane protein with an essential role in virion activation. Nature 390:81–85. entry. J. Virol. 82:10247–10261. 23. Feral CC, et al. 2005. CD98hc (SLC3A2) mediates integrin signaling. 48. Pankov R, et al. 2003. Specific beta(1) integrin site selectively regulates Proc. Natl. Acad. Sci. U. S. A. 102:355–360. Akt/protein kinase B signaling via local activation of protein phosphatase 24. Gong S, Lai CF, Esteban M. 1990. Vaccinia virus induces cell-fusion at 2A. J. Biol. Chem. 278:18671–18681. acid pH and this activity is mediated by the N-terminus of the 14-kDa 49. Perino J, et al. 2011. Role of sulfatide in vaccinia virus infection. Biol. Cell virus envelope protein. Virology 178:81–91. 103:319–331. 25. Gu ZZ, Noss EH, Hsu VW, Brenner MB. 2011. Integrins traffic rapidly 50. Price LS, Leng J, Schwartz MA, Bokoch GM. 1998. Activation of Rac and via circular dorsal ruffles and macropinocytosis during stimulated cell Cdc42 by integrins mediates cell spreading. Mol. Biol. Cell 9:1863–1871. migration. J. Cell Biol. 193:61–70. 51. Resch W, Hixson KK, Moore RJ, Lipton MS, Moss B. 2007. Protein

26. Guerrero CA, et al. 2000. Integrin alpha(v)beta(3) mediates rotavirus cell composition of the vaccinia virus mature virion. Virology 358:233–247. Downloaded from entry. Proc. Natl. Acad. Sci. U. S. A. 97:14644–14649. 52. Satheshkumar PS, Moss B. 2009. Characterization of a newly identiﬁed 27. Gustavsson A, et al. 2002. Role of the beta1-integrin cytoplasmic tail in 35-amino-acid component of the vaccinia virus entry/fusion complex mediating invasin-promoted internalization of Yersinia. J. Cell Sci. 115: conserved in all chordopoxviruses. J. Virol. 83:12822–12832. 2669–2678. 53. Schiller HB, Friedel CC, Boulegue C, Fassler R. 2011. Quantitative 28. Harburger DS, Calderwood DA. 2009. Integrin signalling at a glance. J. proteomics of the integrin adhesome show a myosin II-dependent recruit- Cell Sci. 122:159–163. (Erratum, 122:1472.) ment of LIM domain proteins. EMBO Rep. 12:259–266. 29. Hsiao JC, Chung CS, Chang W. 1999. Vaccinia virus envelope D8L 54. Schottelndreier H, Mayr GW, Guse H. 1999. ␤1-integrins mediate protein binds to cell surface chondroitin sulfate and mediates the adsorp- Ca2ϩ-signalling and T cell spreading via divergent pathways. Cell. Signal. tion of intracellular mature virions to cells. J. Virol. 73:8750–8761. 11:611–619.

30. Huang CY, et al. 2008. A novel cellular protein, VPEF, facilitates vaccinia 55. Schroeder N, Chung CS, Chen CH, Liao CL, Chang W. 2012. The lipid http://jvi.asm.org/ virus penetration into HeLa cells through ﬂuid phase endocytosis. J. Virol. raft-associated protein CD98 is required for vaccinia virus endocytosis. J. 82:7988–7999. Virol. 86:4868–4882. 31. Ichihashi Y, Oie M. 1996. Neutralizing epitope on penetration protein of 56. Senkevich TG, Ojeda S, Townsley A, Nelson GE, Moss B. 2005. Poxvirus vaccinia virus. Virology 220:491–494. multiprotein entry-fusion complex. Proc. Natl. Acad. Sci. U. S. A. 102: 32. Izmailyan R, Chang W. 2008. Vaccinia virus WR53.5/F14.5 protein is a new 18572–18577. component of intracellular mature virus and is important for calcium- 57. Shannon P, et al. 2003. Cytoscape: a software environment for integrated independent cell adhesion and vaccinia virus virulence in mice. J. Virol. 82: models of biomolecular interaction networks. Genome Res. 13:2498– 10079–10087. 2504.

33. Izmailyan RA, Huang CY, Mohammad S, Isaacs SN, Chang W. 2006. 58. Spiegel S, Kassis S, Wilchek M, Fishman PH. 1984. Direct visualization on May 30, 2012 by Life Science Library, Academia Sinica The envelope G3L protein is essential for entry of vaccinia virus into host of redistribution and capping of fluorescent gangliosides on lymphocytes. cells. J. Virol. 80:8402–8410. J. Cell Biol. 99:1575–1581. 34. Jackson T, Mould AP, Sheppard D, King AMQ. 2002. Integrin alpha v 59. Stewart PL, Nemerow GR. 2007. Cell integrins: commonly used receptors beta 1 is a receptor for foot-and-mouth disease virus. J. Virol. 76:935–941. for diverse viral pathogens. Trends Microbiol. 15:500–507. 35. Johnson MS, Lu N, Denessiouk K, Heino J, Gullberg D. 2009. Integrins 60. Tarone G, et al. 1993. Expression of beta-1 integrin complexes on the during evolution: evolutionary trees and model organisms. Biochim. Bio- surface of unfertilized mouse oocyte. Development 117:1369–1375. phys. Acta 1788:779–789. 61. Townsley AC, Weisberg AS, Wagenaar TR, Moss B. 2006. Vaccinia virus 36. Jokinen J, et al. 2010. Molecular mechanism of alpha 2 beta 1 integrin entry into cells via a low-pH-dependent endosomal pathway. J. Virol. interaction with human echovirus 1. EMBO J. 29:196–208. 80:8899–8908. 37. Joklik WK. 1962. The purification of four strains of poxvirus. Virology 62. Vanderplasschen A, Hollinshead M, Smith GL. 1998. Intracellular and 18:9–18. extracellular vaccinia virions enter cells by different mechanisms. J. Gen. 38. Legate KR, Montanez E, Kudlacek O, Fassler R. 2006. ILK, PINCH and Virol. 79(Pt 4):877–887. parvin: the tIPP of integrin signalling. Nat. Rev. Mol. Cell Biol. 7:20–31. 63. Vanderplasschen A, Smith GL. 1997. A novel virus binding assay using 39. Lenter M, et al. 1993. A monoclonal antibody against an activation confocal microscopy: demonstration that the intracellular and extracellu- epitope on mouse integrin chain-beta(1) blocks adhesion of lymphocytes lar vaccinia virions bind to different cellular receptors. J. Virol. 71:4032– to the endothelial integrin-alpha(6)beta(1). Proc. Natl. Acad. Sci. U. S. A. 4041. 90:9051–9055. 64. Veettil MV, et al. 2008. Kaposi’s sarcoma-associated herpesvirus forms a 40. Leong JM, Fournier RS, Isberg RR. 1990. Identification of the integrin multimolecular complex of integrins (alphaVbeta5, alphaVbeta3, and binding domain of the Yersinia pseudotuberculosis invasin protein. alpha3beta1) and CD98-xCT during infection of human dermal micro- EMBO J. 9:1979–1989. vascular endothelial cells, and CD98-xCT is essential for the postentry 41. Limouze J, Straight AF, Mitchison T, Sellers JE. 2004. Specificity of stage of infection. J. Virol. 82:12126–12144. blebbistatin, an inhibitor of myosin II. J. Muscle Res. Cell Motil. 25:337– 65. Velling T, Nilsson S, Stefansson A, Johansson S. 2004. Beta1-integrins 341. induce phosphorylation of Akt on serine 473 independently of focal ad- 42. Lin CL, Chung CS, Heine HG, Chang W. 2000. Vaccinia virus envelope hesion kinase and Src family kinases. EMBO Rep. 5:901–905. H3L protein binds to cell surface heparan sulfate and is important for 66. Whitbeck JC, Foo CH, Ponce de Leon M, Eisenberg RJ, Cohen GH. intracellular mature virion morphogenesis and virus infection in vitro and 2009. Vaccinia virus exhibits cell-type-dependent entry characteristics. in vivo. J. Virol. 74:3353–3365. Virology 385:383–391. 43. Locker JK, et al. 2000. Entry of the two infectious forms of vaccinia virus 67. Wickstrom SA, Fassler R. 2011. Regulation of membrane traffic by in- at the plasma membrane is signaling-dependent for the IMV but not the tegrin signaling. Trends Cell Biol. 21:266–273. EEV. Mol. Biol. Cell 11:2497–2511. 68. Wolfe CL, Ojeda S, Moss B. 2012. Transcriptional repression and RNA 44. Maginnis MS, et al. 2006. Beta1 integrin mediates internalization of silencing act synergistically to demonstrate the function of the eleventh mammalian reovirus. J. Virol. 80:2760–2770. component of the vaccinia virus entry-fusion complex. J. Virol. 86:293– 45. Mercer J, Helenius A. 2008. Vaccinia virus uses macropinocytosis and 301. apoptotic mimicry to enter host cells. Science 320:531–535. 69. Yoder JD, et al. 2006. Pox proteomics: mass spectrometry analysis and 46. Morgan MR, Humphries MJ, Bass MD. 2007. Synergistic control of cell identification of vaccinia virion proteins. Virol. J. 3:10. adhesion by integrins and syndecans. Nat. Rev. Mol. Cell Biol. 8:957–969. 70. Zent R, et al. 2000. Class- and splice variant-specific association of CD98 47. Nichols RJ, Stanitsa E, Unger B, Traktman P. 2008. The vaccinia virus with integrin beta cytoplasmic domains. J. Biol. Chem. 275:5059–5064.

June 2012 Volume 86 Number 12 jvi.asm.org 6687