DOCSLIB.ORG

Kidneyseq V4 Gene List.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

KidneySeq™ v4 – 312 Genes Ciliopathies/tubulointerstitial diseases Disorders of tubular ion transport CAKUT Autosomal dominant tubulo interstitial disease (AD) Cystinosis Branchiooculofacial syndrome AD: HNF1B, REN, UMOD AR: CTNS AD: TFAP2A Bardet-Biedl syndrome (BBS) Cystinuria Branchio-oto-renal syndrome AR: ARL6, BBIP1, BBS2, BBS4, BBS5, BBS7, BBS10, BBS12, C8orf37, AD & AR: SLC3A1, SLC34A1, SLC7A9 AD: EYA1, SIX1, SIX5 CEP290, IFT27, IFT74, LZTFL1, MKKS, PTHB1, SDCCAG8, TRIM32, Dent disease CAKUT with VACTERL TTC8, WDPCP XLR: CLCN5, OCRL AR: TRAP1 AR & DR: BBS1 Familial juvenile hyperuricemic nephropathy – 4 CHARGE syndrome COACH syndrome (JN+) AD: SEC61A1 AD: CHD7, SEMA3E AR: CC2D2A, RPGRIP1L, TMEM67 Fanconi-Bickel syndrome Cogan oculomotor apraxia HANAC syndrome AR: SLC2A2 AR: NPHP1 AD: COL4A1 Fanconi syndrome, generalized proximal defect Common CAKUT Hypokalemic-alkalotic salt-losing nephropathy AD: EHHADH, HNF4A AD: ACTG1, AGTR1, CHD1L, DLG1, DSTYK, ETV4, EYA1, FOXP1, CLDN10 AR: ATP7B, CTNS, FAH, GATM, SLC34A1 GATA3, GDNF, GREB1L, HNF1B, KAT6B, KIF12, KMT2D, NRIP1, Interstitial nephritis, karyomegalic XLR: CLCN5 PAX2, PBX1, RET, ROBO2, SALL1, SIX2, SIX5, SLIT2, SRGAP1, AR: FAN1 Gitelman syndrome TBX18, Jeune syndrome (JN+) AR: CLCNKB, SLC12A3 AR: CTU2, FAT4, HPSE2, TRAP1, TRPS1 AR: IFT80, IFT140, DYNC2H1, NEK1, TTC21B Glucosuria, renal Fraser syndrome Joubert syndrome (JN+) AR & AD: SLC5A1, SLC5A2 AR: FRAS1, FREM1, FREM2, GREM1, GRIP1 AR: AHI1, ARL13B, ARMC9, ATXN10, C2CD3, C5orf42, CC2D2A, Hypoaldosteronism, congenital Genitopatellar syndrome CEP104, CEP290, CEP41, CFAP410, CSPP1, IFT172, INPP5E, AR: CYP11B2 AD: KAT6B KIAA0556, KIF7, NPHP1, OFD1, RPGRIP1L, TCTN1, TCTN3, Hypomagnesemia, renal Hypoparathyroidism, sensorineural deafness, and renal dysplasia TMEM138, TMEM216, TMEM237, TMEM67, TTC21B AD: CNNM2, FXYD2 AD: GATA3 AD & AR: ZNF423 AR: CLDN16, CLDN19, EGF, HNF1B, TRPM6 Isolated renal hypo-dysplasia Juvenile nephronophthisis (JN) Hyperaldosteronism, familial AD: BMP4, DSTYK, HNF1B, PAX2, RET, SALL1, SIX2 AR: AHI1, ANKS6, ATXN10, IQCB1, CEP164, CEP290, CEP83, DCDC2, AD: CACNA1D, CACNA1H, CLCN2, CYP11B1, KCNJ5 AR: DACH1, FGF20, ITGA8, GLIS2, INVS, MAGI2, MAPKBP1, NEK8, NPHP1, NPHP3, NPHP4, Hyperaldosteronism, glucocorticoid remediable RPGRIP1L, SLC41A1, TMEM67, TTC21B, WDR19, XPNPEP3 Isolated renal hypoplasia: renal adysplasia AD: CYP11B1-CYP11B2 fusion AD &AR: ZNF423 AR: RET, UPK3 Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis Meckel syndrome (MKS)/Meckel-Gruber syndrome (JN+) Hypogonadotropic hypogonadism with or without anosmia (Kallmann syndrome (HUPRAS) AR: B9D1, B9D2, CC2DA, CEP290, KIF14, MKS1, NPHP3, RPGRIP1L, syndrome) AR: SARS2 TCTN2, TMEM107, TMEM216, TMEM237, TMEM67 AD: CHD7, FGFR1 Hypercalciuria XL: ANOS1 Medullary cystic kidney disease 2 AD: ADCY10 AD: UMOD Mayer-Rokitansky-Küster-Hauser syndrome Hyperoxaluria, primary AD: WNT4 Orofaciodigital syndrome 1 AR: AGXT, GRHPR, HOGA1 XLD: OFD1 Multicystic dysplastic kidney Hypertension with hyperkalemia (Gordon's syndrome), AD: CHD1L, HNF1B, ROBO2, SALL1 Polycystic kidney disease, autosomal recessive (ARPKD) Pseudohypoaldosteronism II AR: DZIP1L, PKHD1 Posterior urethral valves AD: CUL3, WNK1, WNK4 AD: CHD1L, HNF1B, ROBO2, SALL1, SIX2 Polycystic kidney disease, autosomal dominant (ADPKD) AR: KLHL3 AD: GANAB, HNF1B, NOTCH2, OFD1, PKD1, PKD2 Renal-Coloboma syndrome Hypocalcemia, autosomal dominant AR: PAX2 Renal cysts and diabetes syndrome AD: CASR AD: HNF1B Renal cysts and diabetes syndrome Hypokalemic-alkalotic salt-losing nephropathy AD: HNF1B Serpentine fibula with polycystic kidney disease (SFPKS)/ Hajdu-Cheney AR: CLDN10 syndrome (HJCYS) Renal fibrosis Hypophosphatemic rickets AD: NOTCH2 AD: PARN AD: FGF23 Sensenbrenner syndrome/Cranioectodermal dysplasia (CED) Renal tubular dysgenesis AR: DMP1, CYP27B1, ENPP1, SLC34A3, VDR AR: IFT122, IFT43, WDR19, WDR35 AR: ACE, AGT, AGTR1, REN XLR: CLCN5, PHEX Senior-Loken syndrome- (JN with retinitis pigmentosa) Townes-Brocks syndrome Hypouricemia, renal AR: CEP290, IQCB1, NPHP1, NPHP3, NPHP4, SDCCAG8, WDR19 AD: SALL1 AD: SLC2A9 Unilateral renal agenesis Disorders of tubular ion transport AR: SLC22A12 AD: DSTYK, HNF1B, RET, SALL1 Adrenal hyperplasia, congenital (11b-OH deficiency) Liddle syndrome (AD) (pseudoprimary hyperaldosteronism) UPJ obstruction AR: CYP11B1 AD: SCNN1B, SCNN1G AD: DSTYK, EYA1, HNF1B, RET, ROBO2, SALL1 Apparent mineralocorticoid excess, syndrome of Nephrogenic diabetes insipidus UVJ obstruction AR: HSD11B2 AD & AR: AQP2 AD: CHD1L, PAX2, SIX5 APRT deficiency (stones and ESRD) XLR: AVPR2 Vesicoureteral reflux AR: APRT Nephrogenic syndrome of inappropriate antidiuresis AD: DSTYK, EYA1, GATA3, HNF1B, RET, ROBO2, SALL1, SOX17, Bartter syndrome XLR: AVPR2 TNXB, UPK3A AD: CaSR Nephrolithiasis/osteoporosis, hypophosphatemic Alagille syndrome AR: BSND, CLCNKA, CLCNKB, KCNJ1, MAGED2, SLC12A1 AD: SLC9A3R1 AD: JAG1, NOTCH2 Disorders of tubular ion transport Glomerular diseases Nephrolithiasis/nephrocalcinosis Pseudohypoaldosteronism I Focal segmental glomerulosclerosis (FSGS) with Duane retraction Nephrolithiasis/osteoporosis, hypophosphatemic AD: NR3C2 syndrome AD: SLC9A3R1 AR: SCNN1A, SCNN1B, SCNN1G AD: MAFB Renal tubular acidosis, distal Renal tubular acidosis, distal Galloway-Mowat syndrome AD & AR: ATP6V0A4, ATP6V1B1, SLC4A1 AD & AR: ATP6V0A4, ATP6V1B1, FOXI1, SLC4A1 AR: NUP133, OSGEP, TP53RK, TPRKB, WDR73 Renal tubular acidosis, proximal Renal tubular acidosis, proximal XLR: LAGE3 AD: EHHADH, HNF4A AD: EHHADH, HNF4A Glomerulopathy with fibronectin deposits AR: CTNS FAH, SLC34A1, SLC4A4 AR: ATP7B, CTNS, FAH, SLC34A1, SLC4A4 AD: FN1 XR: ATP7B, CLCN5 XLR: CLCN5 Infantile sialic acid storage disease Xanthine oxidase deficiency Renal tubular acidosis, type IV AR: SLC17A5 AR: XDH AD: CUL3, KLHL3, NR3C2, WNK1, WNK4 Lipodystrophy, familial, partial Other AR: SCNN1A, SCNN1B, SCNN1G AD: LMNA Arthrogryposis, renal dysfunction Renal tubular acidosis, with osteopetrosis Lipoprotein glomerulopathy AR: VIPAS39, VPS33B AR: CA2 APOE Charcot-Marie Tooth disease (CMTDIE) Renal tubular disease, hypertension related Muckle-Wells syndrome AD: INF2 NEDD4L AD: NLRP3 CHARGE syndrome SESAME syndrome / East syndrome Nail patella syndrome AD: CHD7, SEMA3E AR: KCNJ10 AD: LMX1B Duane-radial ray syndrome (Okihiro syndrome) Glomerular diseases Nephropathy with pretibial epidermolysis bullosa and deafness AD: SALL4 Alport syndrome AR: CD151 Finlay-Marks syndrome AR: COL4A4 Nephrotic syndrome - steroid sensitive AD: KCTD1 AD & AR: COL4A3 PLCG2 Lesch-Nyhan syndrome XLD: COL4A5 Pierson syndrome - nephrotic syndrome with microcoria XLR: HPRT1 XLR: COL4A6 AR: LAMB2 Hypercalcemia, infantile Alstrom syndrome Thin basement membrane disease (benign familial hematuria) AR: CYP24A1 AR: ALMS1 AD: COL4A3, COL4A4 Hyperuricemia, pulmonary hypertension, renal failure, and alkalosis Amyloidosis, hereditary Nephrolithiasis/nephrocalcinosis syndrome (HUPRAS) AD: APOA1, B2M, FGA, GSN, LYZ, NLRP3, TNFRSF1A, TTR APRT deficiency (stones and ESRD) AR: SARS2 Congenital lung disease, nephrotic syndrome and mild epidermolysis AR: APRT Mitochondrial cytopathies bullosa Bartter syndrome AR: COQ2 AR: ITGA3 AD: CaSR Pallister-Hall syndrome Congenital nephrotic syndrome (Finnish type) AR: KCNJ1, SLC12A1 AD: GLI3 AR: NPHS1 Cystinuria Rubinstein-Taybi syndrome COQ2 nephropathy AD & AR: SLC3A1, SLC34A1, SLC7A9 AD: CREBBP AR: COQ2 Dent disease Schimke immuno-osseus dysplasia Denys-Drash syndrome; Frasier syndrome XLR: CLCN5, OCRL AR: SMARCAL1 AD: WT1 Fanconi syndrome, generalized proximal defect SERKAL syndrome – 46XX sex reversal with dysgenesis of kidneys, Diffuse mesangial sclerosis AD: EHHADH, HNF4A adrenal and lungs AR: ARHGDIA, PLCE1, WT1 AR: ATP7B, CTNS, FAH, SLC34A1 AR: WNT4 Epstein/Fechtner - renal disease with macrothrombocytopenia XR: CLCN5 SESAME syndrome / East syndrome AD: MYH9 Hypomagnesemia with hypercalciuria AR: KCNJ10 Fabry disease AR: CLDN16, CLDN19 Simpson-Golabi-Behmel syndrome XL: GLA Hypercalcemia, infantile XLR: GPC3 Familial lecithin cholesterol acyltransferase (LCAT) deficiency AR: CYP24A1 Smith-Lemli-Optiz syndrome AR: LCAT Hypercalciuria AR: DHCR7 Familial Mediterranean Fever AD: ADCY10 Tuberous sclerosis AD&AR: MEFV Hyperoxaluria, primary AD: TSC1, TSC2 Focal segmental glomerulosclerosis (FSGS) AD/XL AR: AGXT, GRHPR, HOGA1 von Hippel-Landau syndrome – familial cancer syndrome AD: ACTN4, ANLN, ARHGAP24, CD2AP, CFI, COL4A3, COL4A4, E2F3, Hypocalcemia, autosomal dominant AD: VHL INF2, LMX1B, PAX2, TRPC6, WT1 AD: CASR Williams-Beuren syndrome XL: COL4A5 Hypophosphatemic rickets AD: 7q 11.23 Focal segmental glomerulosclerosis (FSGS) AR AD: FGF23 Xanthine oxidase deficiency AR: APOL1, COQ6, CRB2, ITGB4, LAMA5, MYO1E, NPHP4, NUP133, AR: DMP1, ENPP1, SLC34A3, VDR AR: XDH NUP160, NUP85, TTC21B XLR: CLCN5, PHEX Focal segmental glomerulosclerosis (AR)/SRNS Hypouricemia, renal AR: ADCK4, ALG1, ANKFY1, ARHGDIA, CUBN, DGKE, DHTKD1, DLC1, AD: SLC2A9 EMP2, FAT1, GAPVD1, LAMB2, NPHS1, NPHS2, NUP107, NUP205, AR: SLC22A12 NUP93, PLCE1, PDSS2, PMM2, PTPRO, SCARB2, SGPL1, XPO5, Lesch-Nyhan syndrome ZMPSTE24 XLR: HPRT1 .
Recommended publications
  • Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ

    Loss of Mafb and Maf Distorts Myeloid Cell Ratios and Disrupts Fetal Mouse Testis Vascularization and Organogenesisǂ

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Loss of Mafb and Maf distorts myeloid cell ratios and disrupts fetal mouse testis vascularization and organogenesisǂ 5 Shu-Yun Li1,5, Xiaowei Gu1,5, Anna Heinrich1, Emily G. Hurley1,2,3, Blanche Capel4, and Tony DeFalco1,2* 1Division of Reproductive Sciences, Cincinnati Children’s Hospital Medical Center, Cincinnati, 10 OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 3Department of Obstetrics and Gynecology, University of Cincinnati College of Medicine, Cincinnati, OH 45267 USA 15 4Department of Cell Biology, Duke University Medical Center, Durham, NC 27710 USA 5These authors contributed equally to this work. ǂThis work was supported by the National Institutes of Health (R37HD039963 to BC, R35GM119458 to TD, R01HD094698 to TD, F32HD058433 to TD); March of Dimes (1-FY10- 355 to BC, Basil O’Connor Starter Scholar Award 5-FY14-32 to TD); Lalor Foundation 20 (postdoctoral fellowship to SL); and Cincinnati Children’s Hospital Medical Center (Research Innovation and Pilot funding, Trustee Award, and developmental funds to TD). *Corresponding Author: Tony DeFalco E-mail: [email protected] 25 Address: Division of Reproductive Sciences Cincinnati Children’s Hospital Medical Center 3333 Burnet Avenue, MLC 7045 Cincinnati, OH 45229 USA Phone: +1-513-803-3988 30 Fax: +1-513-803-1160 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441488; this version posted April 26, 2021.
  • RBP-J Signaling − Cells Through Notch Novel IRF8-Controlled

    RBP-J Signaling − Cells Through Notch Novel IRF8-Controlled

    Sca-1+Lin−CD117− Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch −RBP-J Signaling This information is current as of September 25, 2021. Xingxia Liu, Shaoda Ren, Chaozhuo Ge, Kai Cheng, Martin Zenke, Armand Keating and Robert C. H. Zhao J Immunol 2015; 194:4298-4308; Prepublished online 30 March 2015; doi: 10.4049/jimmunol.1402641 Downloaded from http://www.jimmunol.org/content/194/9/4298 Supplementary http://www.jimmunol.org/content/suppl/2015/03/28/jimmunol.140264 http://www.jimmunol.org/ Material 1.DCSupplemental References This article cites 59 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/194/9/4298.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Sca-1+Lin2CD1172 Mesenchymal Stem/Stromal Cells Induce the Generation of Novel IRF8-Controlled Regulatory Dendritic Cells through Notch–RBP-J Signaling Xingxia Liu,*,1 Shaoda Ren,*,1 Chaozhuo Ge,* Kai Cheng,* Martin Zenke,† Armand Keating,‡,x and Robert C.
  • Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine Elizabeth B Torres 1,2,3* 1 Rutgers University Department of Psychology; [email protected] 2 Rutgers University Center for Cognitive Science (RUCCS) 3 Rutgers University Computer Science, Center for Biomedicine Imaging and Modelling (CBIM) * Correspondence: [email protected]; Tel.: (011) +858-445-8909 (E.B.T) Supplementary Material Sample Psychological criteria that sidelines sensory motor issues in autism: The ADOS-2 manual [1, 2], under the “Guidelines for Selecting a Module” section states (emphasis added): “Note that the ADOS-2 was developed for and standardized using populations of children and adults without significant sensory and motor impairments. Standardized use of any ADOS-2 module presumes that the individual can walk independently and is free of visual or hearing impairments that could potentially interfere with use of the materials or participation in specific tasks.” Sample Psychiatric criteria from the DSM-5 [3] that does not include sensory-motor issues: A. Persistent deficits in social communication and social interaction across multiple contexts, as manifested by the following, currently or by history (examples are illustrative, not exhaustive, see text): 1. Deficits in social-emotional reciprocity, ranging, for example, from abnormal social approach and failure of normal back-and-forth conversation; to reduced sharing of interests, emotions, or affect; to failure to initiate or respond to social interactions. 2. Deficits in nonverbal communicative behaviors used for social interaction, ranging, for example, from poorly integrated verbal and nonverbal communication; to abnormalities in eye contact and body language or deficits in understanding and use of gestures; to a total lack of facial expressions and nonverbal communication.
  • Ciliopathiesneuromuscularciliopathies Disorders Disorders Ciliopathiesciliopathies

    Ciliopathiesneuromuscularciliopathies Disorders Disorders Ciliopathiesciliopathies

    NeuromuscularCiliopathiesNeuromuscularCiliopathies Disorders Disorders CiliopathiesCiliopathies AboutAbout EGL EGL Genet Geneticsics EGLEGL Genetics Genetics specializes specializes in ingenetic genetic diagnostic diagnostic testing, testing, with with ne nearlyarly 50 50 years years of of clinical clinical experience experience and and board-certified board-certified labor laboratoryatory directorsdirectors and and genetic genetic counselors counselors reporting reporting out out cases. cases. EGL EGL Genet Geneticsics offers offers a combineda combined 1000 1000 molecular molecular genetics, genetics, biochemical biochemical genetics,genetics, and and cytogenetics cytogenetics tests tests under under one one roof roof and and custom custom test testinging for for all all medically medically relevant relevant genes, genes, for for domestic domestic andand international international clients. clients. EquallyEqually important important to to improving improving patient patient care care through through quality quality genetic genetic testing testing is is the the contribution contribution EGL EGL Genetics Genetics makes makes back back to to thethe scientific scientific and and medical medical communities. communities. EGL EGL Genetics Genetics is is one one of of only only a afew few clinical clinical diagnostic diagnostic laboratories laboratories to to openly openly share share data data withwith the the NCBI NCBI freely freely available available public public database database ClinVar ClinVar (>35,000 (>35,000 variants variants on on >1700 >1700 genes) genes) and and is isalso also the the only only laboratory laboratory with with a a frefree oen olinnlein dea dtabtaabsaes (eE m(EVmCVlaCslas)s,s f)e, afetuatruinrgin ag vaa vraiarniatn ctl acslasisfiscifiactiaotino sne saercahrc ahn adn rde rpeoprot rrte rqeuqeuset sint tinetrefarcfaec, ew, hwichhic fha cfailcitialiteatse rsa praidp id interactiveinteractive curation curation and and reporting reporting of of variants.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • GENETIC STUDY of RENAL DISEASES (Nephroref Global®) by MASSIVE SEQUENCING (NGS)

    GENETIC STUDY of RENAL DISEASES (Nephroref Global®) by MASSIVE SEQUENCING (NGS)

    Pablo Iglesias, 57 – Polígono Gran Via Sur 08908 L'Hospitalet de Llobregat (Barcelona) Tel. 932 593 700 – Fax. 932 845 000 GENETIC STUDY OF RENAL DISEASES (NephroRef Global®) BY MASSIVE SEQUENCING (NGS) Request No.: 000 Client: - Analysis code: 55580 Patient Name: xxx Date of Birth: N/A Patient Ref.: xxx Gender: Female Sample Type: Blood EDTA Sample Arrival Date: DD/MM/AAAA Date of Result: DD/MM/AAAA Clinical information: A 9-year-old patient with a nephrotic syndrome without response to corticosteroid therapy. She has nephrotic-range proteinuria with microhematuria, hypoalbuminemia with hypercholesterolemia and normal glomerular filtration. Paternal aunt with cortico-resistant nephrotic syndrome with evolution to end-stage renal failure that required renal transplantation at age 13. RESULT AND INTERPRETATION The presence of a heterozygous likely pathogenic variant has been identified. In addition, the presence of a heterozygous variant of uncertain clinical significance (VUS) has been identified.(See Interpretation and recommendations) The complete list of studied genes is available in Annex 1. (Methodology) The list of reported genes and coverage details is available in Table 1. (Methodology) Gene Variant* Zygosity Inheritance pattern Classification^ NPHS2 NM_014625.3: c.842A>C Heterozygosis Autosomal Recessive Likely Patogénica p.(Glu281Ala) INF2 NM_022489.3: c.67T>A Heterozygosis Autosomal Recessive VUS p.(Ser23Thr) * Nomenclature according to HGVS v15.11 ^ Based on the recommendations of the American College of Medical Genetics and Genomics (ACMG) Physician, technical specialist responsible for Clinical Analysis: Jaime Torrents Pont. The results relate to samples received and analysed. This report may not be reproduced in part without permission. This document is addressed to the addressee and contains confidential information.
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic

    Prox1regulates the Subtype-Specific Development of Caudal Ganglionic

    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
  • Clinical Utility of Recently Identified Diagnostic, Prognostic, And

    Clinical Utility of Recently Identified Diagnostic, Prognostic, And

    Modern Pathology (2017) 30, 1338–1366 1338 © 2017 USCAP, Inc All rights reserved 0893-3952/17 $32.00 Clinical utility of recently identified diagnostic, prognostic, and predictive molecular biomarkers in mature B-cell neoplasms Arantza Onaindia1, L Jeffrey Medeiros2 and Keyur P Patel2 1Instituto de Investigacion Marques de Valdecilla (IDIVAL)/Hospital Universitario Marques de Valdecilla, Santander, Spain and 2Department of Hematopathology, MD Anderson Cancer Center, Houston, TX, USA Genomic profiling studies have provided new insights into the pathogenesis of mature B-cell neoplasms and have identified markers with prognostic impact. Recurrent mutations in tumor-suppressor genes (TP53, BIRC3, ATM), and common signaling pathways, such as the B-cell receptor (CD79A, CD79B, CARD11, TCF3, ID3), Toll- like receptor (MYD88), NOTCH (NOTCH1/2), nuclear factor-κB, and mitogen activated kinase signaling, have been identified in B-cell neoplasms. Chronic lymphocytic leukemia/small lymphocytic lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, Burkitt lymphoma, Waldenström macroglobulinemia, hairy cell leukemia, and marginal zone lymphomas of splenic, nodal, and extranodal types represent examples of B-cell neoplasms in which novel molecular biomarkers have been discovered in recent years. In addition, ongoing retrospective correlative and prospective outcome studies have resulted in an enhanced understanding of the clinical utility of novel biomarkers. This progress is reflected in the 2016 update of the World Health Organization classification of lymphoid neoplasms, which lists as many as 41 mature B-cell neoplasms (including provisional categories). Consequently, molecular genetic studies are increasingly being applied for the clinical workup of many of these neoplasms. In this review, we focus on the diagnostic, prognostic, and/or therapeutic utility of molecular biomarkers in mature B-cell neoplasms.
  • Ciliopathy-Associated Gene Cc2d2a Promotes Assembly of Subdistal Appendages on the Mother Centriole During Cilia Biogenesis

    Ciliopathy-Associated Gene Cc2d2a Promotes Assembly of Subdistal Appendages on the Mother Centriole During Cilia Biogenesis

    ARTICLE Received 7 Apr 2014 | Accepted 23 May 2014 | Published 20 Jun 2014 DOI: 10.1038/ncomms5207 Ciliopathy-associated gene Cc2d2a promotes assembly of subdistal appendages on the mother centriole during cilia biogenesis Shobi Veleri1, Souparnika H. Manjunath1, Robert N. Fariss2, Helen May-Simera1, Matthew Brooks1, Trevor A. Foskett1, Chun Gao2, Teresa A. Longo1, Pinghu Liu3, Kunio Nagashima4, Rivka A. Rachel1, Tiansen Li1, Lijin Dong3 & Anand Swaroop1 The primary cilium originates from the mother centriole and participates in critical functions during organogenesis. Defects in cilia biogenesis or function lead to pleiotropic phenotypes. Mutations in centrosome-cilia gene CC2D2A result in Meckel and Joubert syndromes. Here we generate a Cc2d2a À / À mouse that recapitulates features of Meckel syndrome including embryonic lethality and multiorgan defects. Cilia are absent in Cc2d2a À / À embryonic node and other somatic tissues; disruption of cilia-dependent Shh signalling appears to underlie exencephaly in mutant embryos. The Cc2d2a À / À mouse embryonic fibroblasts (MEFs) lack cilia, although mother centrioles and pericentriolar pro- teins are detected. Odf2, associated with subdistal appendages, is absent and ninein is reduced in mutant MEFs. In Cc2d2a À / À MEFs, subdistal appendages are lacking or abnormal by transmission electron microscopy. Consistent with this, CC2D2A localizes to subdistal appendages by immuno-EM in wild-type cells. We conclude that CC2D2A is essential for the assembly of subdistal appendages, which anchor cytoplasmic microtubules and prime the mother centriole for axoneme biogenesis. 1 Neurobiology-Neurodegeneration and Repair Laboratory, National Eye Institute, NIH, Bethesda, Maryland 20892, USA. 2 Biological Imaging Core, National Eye Institute, NIH, Bethesda, Maryland 20892, USA.
  • Ciliopathies Gene Panel

    Ciliopathies Gene Panel

    Ciliopathies Gene Panel Contact details Introduction Regional Genetics Service The ciliopathies are a heterogeneous group of conditions with considerable phenotypic overlap. Levels 4-6, Barclay House These inherited diseases are caused by defects in cilia; hair-like projections present on most 37 Queen Square cells, with roles in key human developmental processes via their motility and signalling functions. Ciliopathies are often lethal and multiple organ systems are affected. Ciliopathies are London, WC1N 3BH united in being genetically heterogeneous conditions and the different subtypes can share T +44 (0) 20 7762 6888 many clinical features, predominantly cystic kidney disease, but also retinal, respiratory, F +44 (0) 20 7813 8578 skeletal, hepatic and neurological defects in addition to metabolic defects, laterality defects and polydactyly. Their clinical variability can make ciliopathies hard to recognise, reflecting the ubiquity of cilia. Gene panels currently offer the best solution to tackling analysis of genetically Samples required heterogeneous conditions such as the ciliopathies. Ciliopathies affect approximately 1:2,000 5ml venous blood in plastic EDTA births. bottles (>1ml from neonates) Ciliopathies are generally inherited in an autosomal recessive manner, with some autosomal Prenatal testing must be arranged dominant and X-linked exceptions. in advance, through a Clinical Genetics department if possible. Referrals Amniotic fluid or CV samples Patients presenting with a ciliopathy; due to the phenotypic variability this could be a diverse set should be sent to Cytogenetics for of features. For guidance contact the laboratory or Dr Hannah Mitchison dissecting and culturing, with ([email protected]) / Prof Phil Beales ([email protected]) instructions to forward the sample to the Regional Molecular Genetics Referrals will be accepted from clinical geneticists and consultants in nephrology, metabolic, laboratory for analysis respiratory and retinal diseases.
  • The Role of Primary Cilia in the Crosstalk Between the Ubiquitin–Proteasome System and Autophagy

    The Role of Primary Cilia in the Crosstalk Between the Ubiquitin–Proteasome System and Autophagy

    cells Review The Role of Primary Cilia in the Crosstalk between the Ubiquitin–Proteasome System and Autophagy Antonia Wiegering, Ulrich Rüther and Christoph Gerhardt * Institute for Animal Developmental and Molecular Biology, Heinrich Heine University, 40225 Düsseldorf, Germany; [email protected] (A.W.); [email protected] (U.R.) * Correspondence: [email protected]; Tel.: +49-(0)211-81-12236 Received: 29 December 2018; Accepted: 11 March 2019; Published: 14 March 2019 Abstract: Protein degradation is a pivotal process for eukaryotic development and homeostasis. The majority of proteins are degraded by the ubiquitin–proteasome system and by autophagy. Recent studies describe a crosstalk between these two main eukaryotic degradation systems which allows for establishing a kind of safety mechanism. If one of these degradation systems is hampered, the other compensates for this defect. The mechanism behind this crosstalk is poorly understood. Novel studies suggest that primary cilia, little cellular protrusions, are involved in the regulation of the crosstalk between the two degradation systems. In this review article, we summarise the current knowledge about the association between cilia, the ubiquitin–proteasome system and autophagy. Keywords: protein aggregation; neurodegenerative diseases; OFD1; BBS4; RPGRIP1L; hedgehog; mTOR; IFT; GLI 1. Introduction Protein aggregates are huge protein accumulations that develop as a consequence of misfolded proteins. The occurrence of protein aggregates is associated with the development of neurodegenerative diseases, such as Huntington’s disease, prion disorders, Alzheimer’s disease and Parkinson’s disease [1–3], demonstrating that the degradation of incorrectly folded proteins is of eminent importance for human health. In addition to the destruction of useless and dangerous proteins (protein quality control), protein degradation is an important process to regulate the cell cycle, to govern transcription and also to control intra- and intercellular signal transduction [4–6].
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line