University of Ghana http://ugspace.ug.edu.gh
DETERMINATION OF ONCHOCERCA VOLVULUS STRAINS
PREVALENT IN THE NKWANTA NORTH DISTRICT OF GHANA
BY
ROWLAND ADUKPO
(10508507)
THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL
FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MPHIL
MICROBIOLOGY DEGREE
UNIVERSITY OF GHANA
COLLEGE OF HEALTH SCIENCES
FEBRUARY, 2019
University of Ghana http://ugspace.ug.edu.gh
DECLARATION
I hereby declare that this thesis is my original work and has not been presented for a degree in any other institution. I have duly acknowledged references made to other authors’ work in the reference section of this thesis
Signature………………………………. Date………………………………
ROWLAND ADUKPO
(STUDENT)
Signature……………………………… Date………………………………
DR. SIMON KWAKU ATTAH
(SUPERVISOR)
Signature……………………………… Date……………………………
DR. PATIENCE B. TETTEH-QUARCOO
(SUPERVISOR)
i
University of Ghana http://ugspace.ug.edu.gh
DEDICATION
To Hetty and Gabriella
ii
University of Ghana http://ugspace.ug.edu.gh
ACKNOWLEDGEMENTS
My sincere thanks and appreciation go to my supervisors, Dr. Simon K. Attah and Dr. Patience
B. Tetteh-Quarcoo for their patience, invaluable support and guidance throughout my course work and during the preparation of this thesis. Special appreciation also goes to Prof. Yaw
Afrane and Prof. Kwamena W. C. Sagoe for their encouragement.
I wish to also express my profound gratitude to Dr. Michael Osei-Atweneboana, Head of the
Biomedical and Public Health Research Unit of the Council for Scientific and Industrial
Research (CSIR) for his mentorship and direction and also for allowing us to use the laboratory for the bench work. Special thanks also go to the staff of the Biomedical and Public Health
Research Unit and the Molecular Biology Laboratory (CSIR) especially Dr. Samuel Armoo,
Edward Jenner Tettevi, Queenstar Naa Dedei Quarshie for their support. Special mention is to be made of Mr. Isaac Owusu Frimpong for whom I am eternally grateful to for his technical support and guidance during the molecular work. God bless you Ike for your sacrifice.
My appreciation also goes to Dr. Laud Boateng and his team at the Nkwanta North District
Health Directorate of the Ghana Health Service for facilitating the community entry and data collection. I want to thank especially Mr Amatus Nambagyira and Dominic Nanga both of
Nkwanta North District Health Directorate and Mr. Reuben Tettey Martey and Michael Dicko of the Pentecost Health Centre, Kpassa, for their support on the field. I also wish to thank all the chiefs, elders and community leaders in the study communities.
iii
University of Ghana http://ugspace.ug.edu.gh
Additionally, I am eternally indebted to my wife Ms. Henrietta Appiah who is always available to tell me in that sweet assuring voice “Rowland, you are capable, go for it”. To my siblings and family, I say thank you for your love and support. Also to my very good friends; Francis Dzidefo
Krampa of West African Centre for Cell Biology of Infectious Pathogens (WACCBIP), Israel
Mensah-Attipoe of the Department of Medical Microbiology, School of Biomedical and Allied
Health Sciences and Richard Kutame of the National Public Health and Reference Laboratory,
Korle-Bu for the diverse roles they played in making this work a success.
And finally, to God be the glory and great things He has done.
iv
University of Ghana http://ugspace.ug.edu.gh
TABLE OF CONTENTS
DECLARATION ...... i
DEDICATION ...... ii
ACKNOWLEDGEMENTS ...... iii
LIST OF FIGURES ...... ix
LIST OF ABBREVIATIONS ...... x
ABSTRACT ...... xi
CHAPTER ONE ...... 1
1.0 INTRODUCTION ...... 1
1.1 General introduction ...... 1
1.2 Research problem ...... 3
1.3 Justification ...... 5
1.4 Aim of the study ...... 5
1.5 Specific objectives ...... 5
CHAPTER TWO ...... 6
2.0 LITERATURE REVIEW ...... 6
2.1 Onchocerca volvulus ...... 6
2.2. The genome of Onchocerca volvulus ...... 8
2.2.1 The coding sequence ...... 8
2.2.2 The non-coding sequences ...... 9
2.3 Life cycle of Onchocerca volvulus ...... 10 v
University of Ghana http://ugspace.ug.edu.gh
2.4 Epidemiology and socioeconomic significance of Onchocerca volvulus ...... 12
2.5. Clinical manifestations and pathogenesis of onchocerciasis ...... 15
2.5.1 Ocular onchocerciasis ...... 15
2.6 Parasite, vector and host dynamics of onchocerciasis ...... 21
2.7 Laboratory diagnosis of Onchocerca volvulus ...... 24
2.7.1 Skin snip microscopy ...... 25
2.7.2 Mazzotti test ...... 25
2.7.3 Immunological tests ...... 26
2.7.4 Molecular techniques ...... 26
2.8 Onchocerciasis control ...... 27
CHAPTER THREE ...... 31
3.0 MATERIALS AND METHODS ...... 31
3.1 Study area and population ...... 31
3.2 Sample size calculation ...... 33
3.3 Sampling techniques ...... 33
3.3.1 Community selection and inclusion criteria ...... 33
3.3.2 Participants selection ...... 34
3.3.4 DNA extraction of O. volvulus from skin snips ...... 35
3.3.5 Onchocerca volvulus DNA amplification using diagnostic primer ...... 35
CHAPTER FOUR ...... 38
4.0 RESULTS ...... 38 vi
University of Ghana http://ugspace.ug.edu.gh
4.1 Analysis of skin snip microscopy and O. volvulus DNA PCR results ...... 38
4.1.2 Analysis of skin microscopy and DNA PCR results by occupation ...... 39
4.2 Analysis of results of Clinical manifestations of onchocerciasis ...... 39
4.2.1 Analysis of subjects manifesting onchocercal lesions by sex ...... 39
4.2.2 Analysis of subjects manifesting onchocercal lesions by age groups ...... 40
4.2.3 Analysis of subjects manifesting onchocercal lesions by occupation ...... 40
4.3 DNA results analysis ...... 41
4.3.1 Detection of O. volvulus using Diagnostic primers ...... 41
4.3.2 Analysis of PCR test results for determination of O. volvulus strain using forest strain
specific primers ...... 43
CHAPTER FIVE ...... 45
5.0 DISCUSSION, CONCLUSION AND RECOMMENDATIONS ...... 45
5.1 Discussion...... 45
5.2 Conclusion ...... 49
5.3 Limitations ...... 50
5.4 Recommendations ...... 50
REFERENCES ...... 51
APPENDICES ...... 75
APPENDIX 1 ...... 75
PARTICIPANT INFORMATION FORM ...... 75
APPENDIX 2 ...... 77
vii
University of Ghana http://ugspace.ug.edu.gh
INFORMED CONSENT FORM ...... 77
APPENDIX 3 ...... 78
ETHICAL CLEARANCE ...... 78
APPENDIX 4 ...... 79
QUESTIONNAIRE ...... 79
viii
University of Ghana http://ugspace.ug.edu.gh
LIST OF FIGURES
Figure 1. Adult female worms of Onchocerca volvulus ...... 7
Figure 2. Microfilaria of Onchocerca volvulus...... 7
Figure 3. Life cycle of Onchocerca volvulus ...... 11
Figure 4. Distribution of onchocerciasis worldwide, 2014...... 14
Figure 5. Sclerosing keratitis in onchocerciasis. © Ian Murdoch & Allen Foster, 2001 ...... 17
Figure 6. Lichnenified onchodermatitis in a young male ...... 20
Figure 7. Chronic onchodermatitis with Leopard spotting over lower legs ...... 20
Figure 8. Chronic onchodermatitis producing a Lizard skin appearance in a young patient...... 20
Figure 9. District map of Nkwanta North ...... 32
Figure 10. Agarose gel electrophoresis pattern for amplification products of samples from
Kabonwule (KA) in lanes 3, 4, 7, 8 and 9 by OV Diagnostic primers ...... 42
Figure 11. Agarose gel electrophoresis pattern for amplification products of samples from
Lemina (LM) in lanes 3, 4, and Controls from Agborlekame ABI, AB2 AB3 in lanes 6, 7, 8 and
Asubende ASU 1, ASU 2, ASU3 IN lanes9, 13, and 14 and forest controls in lane FSP 1,FSP 2,
FSP 3 and FSP 4 in lanes 5,10, 11, 12, by OV diagnostic primer...... 42
Figure 12. Agarose gel electrophoresis pattern of savannah controls in lanes 2, 3, 4, 6, 7, 8 and 9 showing no amplification with nested PCR primers. Lanes 5, 10, 11 and 12 amplified with the nested PCR producing amplicon size of 153 bp...... 44
ix
University of Ghana http://ugspace.ug.edu.gh
LIST OF ABBREVIATIONS
APOC – African Programme for Onchocerciasis Control
CDC – Centres for Disease Control and Prevention
CDTI – Community-Directed Treatment with Ivermectin
DALYs- Disability-Adjusted Life Years
DNA-Deoxyribonucleic acid
IVM – Ivermectin
LAMP- Loop Mediated Isothermal Amplification
L3- Infective stage larvae of O. volvulus
MDA – Mass Drug Administration
MF – Microfilariae
NTD - Neglected Tropical Disease
NTDCP – Neglected Tropical Disease Control Programme
OCP – Onchocerciasis Control Programme in West Africa
OEPA – Onchocerciasis Elimination Programme for the Americas
OSD- Onchocercal Skin Diseases
REMO- Rapid Epidemiology Mapping of Onchocerciasis
WHO – World Health Organization
x
University of Ghana http://ugspace.ug.edu.gh
ABSTRACT
Background
Onchocerca volvulus is a filarial parasite that causes onchocerciasis or ‘river blindness’. Two strains of the parasite exist in West Africa namely, savannah and forest strains. They differ significantly in epidemiology, disease severity and are specific to different vectors. The savannah strain found in West Africa is associated with blindness while the forest strain, on the other hand, causes less severe ocular diseases even in individuals with high parasite load. Information obtained from some workers of the Onchocerciasis Chemotherapy Research Centre who carried out some investigations in the Nkwanta North district suggested that the MF of the parasite appear morphologically longer, a character that is associated with the savannah strain. However, the preponderance of the ocular manifestations in patients that are usually associated with the savannah strain was absent in the patients. The lack of empirical data to address this issue calls for further investigation and research in this area. Therefore, this study was aimed at characterizing the strain types of O. volvulus present in these communities and evaluating clients for clinical lesions of onchocerciasis.
Methodology
Subjects who consented to participate in the study were physically examined for clinical signs of onchocerciasis, particularly; skin rashes, depigmentation (leopard skin), visible and palpable nodules as well as visual acuity assessment using the Snellen chart. Skin snips were collected and examined microscopically for O. volvulus MF. The residual skin snips were analyzed for O. volvulus DNA using conventional PCR. A nested-PCR was performed on positive samples with a forest strain specific primer to further characterize the strain type.
xi
University of Ghana http://ugspace.ug.edu.gh
Results
A total of 218 participants were enrolled. The most predominant clinical manifestations among the participants was rashes/itches 15.1% (33/218) followed by visual impairment (low vision, severe low vision and profound low vision) 8.3% (18/218). Palpable nodules were found in only
0.5% (1/218) of the study participants while lizard and leopard skin presentations were absent.
About 9.2% (20/218) participants were positive for O. volvulus DNA PCR as compared with
3.7% (8/218) by microscopy (p< 0.05). All the 20 O. volvulus samples were classified as savannah strains by the nested PCR analysis.
Conclusion
The results from this study suggest that the Nkwanta North district is endemic for savannah strains of O. volvulus. The prevalence of the savannah strains in these communities may indicate a changing trend in the vector population as a consequence of deforestation and climate change.
The prevalent clinical manifestations found among the study subjects were predominantly skin rashes/itches and ocular lesions with blindness in just 0.5% of the participants. The generally low prevalence of clinical manifestations and MF in skin snip microscopy is an indication of success of several years of control activities in these communities in spite of evidence of disease transmission in the area.
xii
University of Ghana http://ugspace.ug.edu.gh
CHAPTER ONE
1.0 INTRODUCTION
1.1 General introduction
Onchocerciasis or ‘river blindness’ is one of the neglected tropical diseases (NTDs) that causes both health and socio-economic problems in the affected communities (Crump et al., 2012). It is a chronic disease caused by the filarial nematode parasite, Onchocerca volvulus.
Onchocerciasis is endemic in 30 countries in Africa which accounts for over 99% of people infected worldwide. It is also present in small foci in 6 Latin American countries as well as
Yemen (WHO, 1995, 2010). It has been estimated that about 123 million people globally were at risk of contracting the infection with 18 million actually infected of whom 500,000 were severely visually impaired. In addition, 270,000 were completely blind due to the disease
(WHO, 1995). However, a more recent estimates indicated that about 37 million people are infected with at risk population in Africa standing at 90 million (Basáñez et al., 2006). In
Ghana, the disease is endemic in nine (9) out of the ten (10) regions with an estimated 3.2 million people in 3,204 communities in 66 districts at risk of the infection (Taylor et al., 2009).
Infection with O. volvulus results in relentless itching and debilitating skin lesions as well as visual impairment and ultimately blindness. Onchocerciasis has serious socio-economic consequences, which includes depopulation of arable lands along river valleys. It also leads to reduction in productivity of affected persons (Murdoch et al., 2002). The disease is second to trachoma as the leading cause of blindness due to infection in the developing world (Thylefors
1
University of Ghana http://ugspace.ug.edu.gh
et al., 1995; WHO, 2001). Onchocerciasis is least prevalent in individuals aged between 0 and
10 years, but highest in those aged between 20 and 30 years (Anosike & Onwuliri, 1995;
Michael, et al., 1996; Little, et al., 2004). The reason for the low prevalence in the 0 to 10 year old group who are of school going age is largely due to reduced bites from the blackflies whose biting activity is greatest in the mornings. The disease is generally more prevalent in males than in females (Anosike & Onwuliri, 1995; Hailu et al., 2002; Wogu & Okaka, 2008). This is due to increased exposure to blackfly bites in men as they go about their daily tasks that include fishing, farming and hunting (Little et al., 2004; Wogu & Okaka, 2008).
Onchocerciasis exhibits a wide range of clinical spectrum from an asymptomatic infection or generalized onchocerciasis to severe conditions such as blindness and chronic skin diseases
(Hoerauf et al., 2005). The host’s immune response to the dead or dying microfilariae (MF) is responsible for the eye damage and skin manifestations in onchocerciasis (Tamarozzi et al.,
2011). It has been proposed that an rickettsia-like endosymbiont bacterium of O. volvulus,
Wolbachia rather than the parasite itself is the driver of the immunopathology associated with the disease (Andre et al., 2002; Gillette-Ferguson et al., 2006).
There is no protective vaccine or chemoprophylactic drug against O. volvulus; therefore the control and elimination programmes being carried out currently depend on ivermectin (IVM) as the only safe and effective drug available for mass drug administration (Webster et al., 2014;
WHO, 2017). Ivermectin, as a single dose of 150 µg/kg body weight, is a highly microfilaricidal agent which clears MF from the skin for many months and also inhibits uterine release of MF by adult female worms (Schulz-Key, 1990; Basáñez et al., 2006; Lustigman & McCarter, 2007). 2
University of Ghana http://ugspace.ug.edu.gh
Simulium flies or blackflies are the obligate intermediate hosts of O. volvulus (Hall &
Pearlman, 1999), and many species of these flies have been involved in the transmission of the parasite (Crosskey, 1990.). The relative vectorial roles of the flies have contributed to shape the different transmission patterns across the endemic areas (Basáñez et al., 2006). Simulium damnosum sensu lato (s.l.) (species complex), consisting of about 60 cytoforms, is the vector responsible for more than 95 percent of onchocerciasis cases in Africa (Crosskey, 1990). The main vectors of O. volvulus in Latin America are S. ochraceum s.l. (the principal vector), S. metallicum s.l., S. guianense s.l. and S. exiguum s.l. (Boakye et al., 1998).
The blackflies breed in fast-flowing aerated rivers and the infective stage larvae (L3) of the parasites are released from infected blackflies when they take blood meal. In the human host, surviving infective stage larvae undergo two moults to develop into adult male and female worms which live inside thick fibrous nodules (Basáñez & Boussinesq, 1999).
1.2 Research problem
Prior to the implementation of the Onchocerciasis Control Programme (OCP), the risk of onchocercal blindness was very high in the West African savannah areas. In some communities, blindness reportedly affected up to 50% of adults and consequently for the fear of contracting the disease, people abandoned the fertile lands along river valleys. In the 1970s, a whopping
US$30 million was estimated as economic losses due to onchocerciasis, making it a major obstacle to socioeconomic development (WHO, 2016).
3
University of Ghana http://ugspace.ug.edu.gh
Despite almost four decades of onchocerciasis control in Ghana, the disease is still endemic in all regions of Ghana except the Greater Accra region with the at risk population of infection estimated at 3.2 million in 3,204 communities in 66 districts (Taylor et al., 2009).
There is evidence that in West Africa, at least two strains of O. volvulus exist (Cianchi et al.,
1985; Dadzie et al., 1989; Remme et al., 1989). These strains differ significantly in their transmission by Simulium vectors, their general epidemiology and the severity of clinical manifestation (Duke, 1976). The savannah strain found in West Africa is associated with blindness in large proportions of individuals it infects while the forest strain, on the other hand, has been found to be less likely to cause blindness, even in individuals with high parasite load
(Dadzie et al., 1989; Remme et al., 1989). Some reports indicated that the blindness rate among infected people in the savannah is up to a maximum of 15% which is higher than that in the forest where the rate is usually about 2%. In the forest areas severe eye problems such as sclerosing keratitis is mostly not common but, rather, skin manifestations predominate (Duke,
1981).
Information obtained from some workers of the Onchocerciasis Chemotherapy Research Centre
(OCRC) who carried out some investigations in the Nkwanta North district suggested that the
MF of the parasite appear morphologically longer, a character that is associated with the savannah strain. However, the prevalence of the ocular pathology that are usually associated with infection of the savannah strains is absent in these communities. This observation is casual and not based on any empirical data, warranting further research work. The present study therefore sought to identify the strain type present in these communities.
4
University of Ghana http://ugspace.ug.edu.gh
1.3 Justification
There is little evidence from available literature on the strain type present in the Nkwanta North district of Ghana. The study, if carried out, will add on to existing knowledge by providing information on the type(s) of strain present in that community. This information will be useful for disease mapping and treatment schedules and epidemiological investigation in the area. This information will also be useful in the search for chemotherapy and vaccine development since some drugs and vaccines could be strain specific. It will also be useful in monitoring drug resistance should this also be associated with a particular strain.
1.4 Aim of the study
The main objective of the study was to characterize the O. volvulus strains prevalent in the
Nkwanta North District.
1.5 Specific objectives
The specific objectives of the study are to determine the:
1. Onchocerca volvulus strains prevalent in the Nkwanta North district;
2. predominant clinical manifestation of onchocerciasis among the population in the
district.
5
University of Ghana http://ugspace.ug.edu.gh
CHAPTER TWO
2.0 LITERATURE REVIEW
2.1 Onchocerca volvulus
The genus Onchocerca consists of 28 parasite species of large hoofed animals (Anderson, 2000) except the dog parasite O. lupi (Eberhard et al., 2000; Egyed et al., 2002) and the human parasite O. volvulus (Hall & Pearlman, 1999). The matured adult male of O. volvulus measures up to 5 cm in length and diameter of 0.02 mm while the much larger females measure between
30 cm and 80 cm in length and diameter of 0.04 mm (Fig 2.1) (Forgione, 2002). The adult worms are normally found in subcutaneous nodules or onchocercomata which are most easily seen on bony prominences (Okulicz et al., 2004), where they live for up to 15 years
(Ranganathan, 2012). The adult female worms generally remain in the nodules while the itinerant adult male worms move between nodules inseminating the females (Brattig, 2004).
The much migratory unsheathed MF (Fig 2.2) which are usually associated with disease manifestations measure between 220 µm and 360 µm in length and diameter between 5 µm and
9 µm. The MF have a life span of up to 2 years (CDC, 2016).
6
University of Ghana http://ugspace.ug.edu.gh
Figure 2.1. Adult female worms of Onchocerca volvulus
Source; https://microbewiki.kenyon.edu/index.php/Onchocerciasis_ (Onchocerca_volvulus
Figure 2.2. Microfilaria of Onchocerca volvulus
Source; https://web.stanford.edu/group/parasites/ParaSites2006/Onchocerciais/parasite.htm
7
University of Ghana http://ugspace.ug.edu.gh
2.2. The genome of Onchocerca volvulus
2.2.1 The coding sequence
The nuclear genome of O. volvulus has been estimated to be approximately 1.5X 108 bp consisting of three pairs of autosomes and a pair of dimorphic sex chromosomes (Donelson et al., 1988; Post, 2005). Based on the analysis of RNAseg data from eight stages of O. volvulus life cycle the total number of protein-coding genes was predicted to be 12,143. Approximately
91% of these genes were shared with other nematodes with just 9% being specific for O. volvulus which shares little or no homology with other human nematodes (Cotton et al., 2016).
Structurally, these genes are compact averaging approximately 5 kbp in size and interrupted repeatedly by several small introns measuring between 100 and 300 bp. Similarly, the exons are small with median length of 124 bp (Unnasch & Williams, 2000).
There is a high level of variation observed in gene density, GC content and repeat density of O. volvulus genome which is relatively AT-rich with an overall AT content of 68% but with slight variation between the intron sequences (73%) and exons (61%) (Unnasch & Williams, 2000).
The intron-exon boundaries of these genes generally follow the GU-AG rule which is characteristic of the splice donor and acceptors of other vertebrate organisms except that there are some observed variations in the conserved GU and AG sequences at the 5´ and 3´ ends of the introns. It has also been observed from the genes examined so far that the most conserved positions in the intron are five nucleotides from each end. This conclusion was drawn from the finding that at the 5´ end of the intron, a purine is found at position +5 in 83% of the introns and at the 3´ end, a pyrimidine is found at position -5 in 88% of the introns (Aroian et al., 1993).
8
University of Ghana http://ugspace.ug.edu.gh
The mRNAs of O. volvulus contain 22-nucleotide spliced leader (SL) at their 5´ ends with the genes encoding the SL RNA encoded in the intragenic region of the spacer of the 5S rRNA gene cluster (Zeng et al., 1990).
2.2.2 The non-coding sequences
The best characterized non-coding sequence of O. volvulus is that of the O-150 family. It is a distinct, variable and tandemly repeated sequence with a unit length of approximately 150 bp which is organized into large tandem arrays (Erttmann et al., 1987; Meredith et al., 1989). Cross hybridization and PCR experiments using degenerate primers have shown that these sequences are found only in the genus Onchocerca but not in any other nematodes or the vectors. Thus, probes and primers can be used to identify specific sequences within the O-150 family to distinguish O. volvulus from other Onchocerca species as well as characterize the strains of O. volvulus (Erttmann et al., 1987 and 1990; Ogunrinade et al., 1999; Adewale et al., 2005).
2.2.3 The mitochondrial genome
The mitochondrial genome of O. volvulus is the smallest among the metazoan mitochondrial genomes described to date, only 13,747 bp in size (Keddie et al., 1998). In keeping with the compact nature of the genome, four gene pairs overlap, eight contain no intergenic regions and the remaining gene pairs are separated by small intergenic regions with sizes ranging from 1 to
46 bp. The genome contains two ribosomal RNA genes, genes for 12 mitochondrial proteins and genes for 22 transfer RNAs (Keddie et al.,1998). The protein-coding genes of the O. volvulus mitochondrial genome exhibit extreme codon bias, where for 15 out of the 20 amino acids, a single member of the codon is used more than 70% of the time. There is limited 9
University of Ghana http://ugspace.ug.edu.gh
intraspecific variation in both the nuclear and mitochondrial genomes of O. volvulus (Unnasch
& Williams, 2000).
2.3 Life cycle of Onchocerca volvulus
The life cycle of O. volvulus begins when the adult blackfly during a blood meal ingests the
MF. After ingestion, the MF which survive the peritropic membrane that forms around the blood meal penetrate the midgut and migrate to the thoracic muscles of the blackfly and differentiate into L1 larvae. By 96 hours the L1 undergo the first moult to form L2 larvae which after a second moult by day 7 differentiate into the third-stage infective larvae (L3) (Burnham,
1998). The L3 now move to the mouth parts of the blackfly. The cycle of transmission continues when during a blood meal, an infected blackfly introduces infective filarial larvae onto the skin of the human host, where they penetrate into the bite wound (Burnham, 1998;
CDC, 2016). Once in the subcutaneous tissues the larvae undergo moulting to L4 stage to reach adult stage in about one year (Bari & Rahman, 2007) and become encapsulated in the nodules
(Burnham, 1998). The female worm produces numerous oocytes which when not fertilized degenerate within the uterus (WHO, 1995). When the female is fertilized, MF develop in 3-12 weeks and are released from the uterus. MF move freely through the skin and connective tissue and ultimately reach the eye. They can be found also in the blood, cerebrospinal fluid, urine and internal organs (Duke, 1993).
10
University of Ghana http://ugspace.ug.edu.gh
Figure 2.3. Life cycle of Onchocerca volvulus https://www.cdc.gov/dpdx/onchocerciasis/index.html
11
University of Ghana http://ugspace.ug.edu.gh
2.4 Epidemiology and socioeconomic significance of Onchocerca volvulus
Onchocerciasis is endemic in 37 countries, of which 30 are in sub-Saharan Africa. The endemic area starts from Senegal in the west to Ethiopia in the east and extends to the south of the equator from Angola in the west to Tanzania in the east. Pockets of onchocerciasis exist in
Sudan and Yemen (WHO, 2008). The disease is also endemic in small foci in 6 Latin American countries. The disease burden of O. volvulus has been largely underestimated in earlier literature with just 18 million people reportedly infected with onchocerciasis (WHO, 1995). However, since then, the true extent of the disease burden has been determined by the Rapid
Epidemiology Mapping of Onchocerciasis (REMO), which uses the prevalence of palpable nodules as proxy for infection. Thus, by the end of 2005, using REMO, over 22,000 additional villages outside the OCP region have been surveyed leading to the discovery of a lot more endemic areas. As a result, the current prevalence of onchocerciasis globally is estimated at 37 million with about 90 million people in Africa at risk of infection (Basáñez et al., 2006).
Onchocerciasis is a clinical condition which is generally characterized by skin, eye, lymphatic and sometimes systemic manifestations with the most severe lesion being blindness (Nwoke,
1992). It has been estimated that approximately 270,000 people are blind and 500,000 suffer from visual impairment globally as a direct result of onchocerciasis (WHO, 1995). A further
40,000 new blind cases are added to these figures each year (Alonso et al., 2009).
In addition to the debilitating health problems, onchocerciasis have caused serious social and economic problems to individuals and entire communities. For example, Remme (1989) quoting from an unpublished document of Rolland and Balay (1986), stated that over 41,000 km2 of fertile land in river valleys in Burkina Faso was uninhabited as a result of onchocerciasis. 12
University of Ghana http://ugspace.ug.edu.gh
It has been reported that onchocerciasis contributed to the loss of an estimated 1 million DALYs annually globally, with severe itching accounting for 60% and visual impairment and blindness making up the remaining 40% (Remme, 2004). It has been documented that the presence of onchocercal skin lesions affected the ability of the patients to interact with peers thereby reducing their marriage prospects. Onchocercal skin disease (OSD) has also been blamed for poor school performance and a high dropout rates in affected communities. In addition, productivity of these individuals is affected as a result of time spent out of work and health related costs. Furthermore, victims of onchocerciasis suffer embarrassment, sleeplessness, and reduced concentration (Wagbatsoma & Okojie, 2004; Wogu & Okaka, 2008).
13
University of Ghana http://ugspace.ug.edu.gh
Figure 2.4. Distribution of onchocerciasis worldwide, 2014. (Source: WHO, 2015)
14
University of Ghana http://ugspace.ug.edu.gh
2.5. Clinical manifestations and pathogenesis of onchocerciasis
Previously, the view was held that filarial products were the major causes of the underlying inflammatory reactions, however, there is now a growing evidence to show that an obligatory endosymbiotic rickettsia-like bacteria, Wolbachia have been incriminated in the clinical manifestations of the disease and in adverse reactions after treatment (Hoerauf et al., 2003). The main clinical manifestation of the disease are mainly observed in the eyes and skin with troublesome itching being the most common early clinical symptom (Alonso et al., 2009).
Although the mechanisms are not fully understood, musculo-skeletal pains and reduced body mass index are the systemic conditions associated with onchocerciasis (Kale, 1998). In addition, there is evidence from available literature which links onchocerciasis to epilepsy (Marin et al.,
2006; Pion et al., 2009).
2.5.1 Ocular onchocerciasis
It is now understood that the migratory MF enter the cornea from the skin and the conjunctiva leading to ocular pathology which is generally classified into anterior and posterior eye diseases
(Abiose, 1998).
The posterior ocular onchocerciasis presents with atrophy of the retinal pigment epithelium which later becomes widespread. Evidence from experimental studies showed that autoimmune responses are involved in posterior ocular onchocerciasis. This was based on the observation that patients show persistent, low level, progressive pathologic changes of the retina and pigment epithelium even after treatment (Semba et al., 1990). The role of reactive antigens in posterior ocular onchocerciasis was demonstrated by McKechnie and colleagues (1997), who injected rats with 39 kDa O. volvulus protein and found that the antibodies cross-react with a 44 15
University of Ghana http://ugspace.ug.edu.gh
kDa, human retinal protein. They observed that the animals developed many pathological changes in the posterior region but none in the anterior region of the eye (McKechnie et al.,
1997).
The anterior segment onchocerciasis mostly affects the cornea even though other parts of the anterior segment can be affected. This is initiated by inflammatory reactions to dead or dying
MF and presents as completely separate areas of corneal opacification (punctate keratitis). As a result of heavy infection or continued exposure to the parasites, these opacities coalesce and sometimes become hyper pigmented (sclerosing keratitis) leading to visual impairment and ultimately to blindness. Blindness resulting from onchocerciasis is mainly due to this condition
(Pearlman & Hall, 2000).
16
University of Ghana http://ugspace.ug.edu.gh
Figure 5. Sclerosing keratitis in onchocerciasis. © Ian Murdoch & Allen Foster, 2001
Source: Community Eye Health Journal, Vol 14. No. 382001
17
University of Ghana http://ugspace.ug.edu.gh
Although onchocerciasis is associated with skin and eye lesions, the disease pattern varies considerably between geographical zones with ocular pathology being more common in hyper endemic localities within the savannah bioclimes while the forest communities are characterized by dermal manifestations of the disease (Dadzie et al., 1989; Murdoch et al., 2002). This difference in disease presentation has been attributed to many factors but evidence from clinical, epidemiological, and genetic studies have all shown that O. volvulus exists as two strains in
West Africa. Some researchers have attempted to link the differences in pathogenesis between the two strains of O. volvulus to the differences in their Wolbachia load. The evidence in support of this observation was provided by the quantitative measurement of the amount of
Wolbachia DNA per nuclear genome of adult O. volvulus and it was found to be significantly higher in savannah strains than in forest strains (Higazi et al., 2005). This correlation between
Wolbachia DNA copy number and blindness was disputed by Armoo et al, (2017). Much as
Armoo and colleagues also found significant heterogeneity in the Wolbachia DNA ratio between savannah and forest strains, they found the linkage problematic. They argued that because Higazi and colleagues used whole nodule for the analysis which means that there could be an unknown mix of parasites it is difficult to understand what the Wolbachia density actually means in the light of the findings of Higazi and colleagues. Armoo and colleagues held the opinion that histological data from studies conducted on Brugia malayi by Fischer, et al, (2011) suggest less variation in Wolbachia density in MF and therefore concluded that since the immunopathology is caused by the MF and not adult worms the Wolbachia density may not be the cause of the difference in pathology by the parasites in the two ecotypes.
18
University of Ghana http://ugspace.ug.edu.gh
2.5.1 Onchocercal skin disease
The skin is the main organ affected by onchocerciaisis with a variable spectrum of skin lesions
(Murdoch et al., 1993). The initial manifestations of cutaneous onchocerciasis which can occur anywhere include itching, scratching and alterations in skin pigmentation (Bari & Rahman,
2007). The mildest form of cutaneous onchocerciasis presents as itching with localized maculopapular rash which may disappear completely without any treatment or may progress to chronic papular dermatitis. In some cases, bleeding, ulceration and secondary infection may occur as a result of excessive scratching (Burnham, 1998). The pathology of onchocercal skin disease may be associated with generalized lichenified skin condition known as “leopard skin”
(Greene et al., 1983). With prolonged exposure to active infections, degenerative skin changes usually set in with the destruction of elastic fibres which leaves the skin very thin and wrinkled.
The atrophied skin begins to sag, resulting in the so-called “hanging groin” in extreme cases
(Greene et al., 1983); Brattig et al., 1994).
A less common and localized chronic papular dermatitis called Sowda is often confined to one extremity and is most commonly found in certain geographical regions such as Sudan and
Yemen. This condition is associated with local lymphadenopathy as a result of exceptionally strong IgG response (Cabrera et al., 1988; Murdoch et al., 1993).
19
University of Ghana http://ugspace.ug.edu.gh
Figure 6. Lichnenified onchodermatitis in a Figure 7. Chronic onchodermatitis with Leopard young male spotting over lower legs Source; : Arfan ul Bari & Simeen Ber Rahman. Source; : Arfan ul Bari & Simeen Ber Rahman.
Journal of Pakistan Ass. of Dermatologists,2007 Journal of Pakistan Ass. of Dermatologists,2007
Figure 8. Chronic onchodermatitis producing a Lizard skin appearance in a young patient Source: Arfan ul Bari & Simeen Ber Rahman.Journal of Pakistan Association of
Dermatologists, 2007 20
University of Ghana http://ugspace.ug.edu.gh
2.6 Parasite, vector and host dynamics of onchocerciasis
The clinical pattern of onchocerciasis with regards to the preponderance of blindness and skin lesions, varies considerably between geographical zones and even between different ecotypes within a single region (Remme et al., 1989). The most striking of these differences is mostly in the prevalence of more blindness due to onchocerciasis in the savannah than forest regions of
West Africa. Among the savannah populations, blindness is present in hyper endemic communities with little or no blindness found in forested communities with a comparable level of endemicity (Duke, 1981; Dadzie et al., 1989; Remme et al., 1989). These observations of greater severity and high preponderance of blindness in the savannah regions were the reasons why the Onchocerciasis Control Programme (OCP) was originally limited to the savannah regions of West Africa (WHO, 1987).
A number of hypotheses have been put forward to explain this difference in clinical manifestation of onchocerciasis in the savannah and forest regions but the most widely accepted hypothesis is that intrinsic differences exist among the strains of parasites occurring in the forest and savannah zones (Duke, 1981). Initial evidence to support this “strain difference” hypothesis was provided by vector switch experiment conducted in Cameroon (Duke, 1966; Duke et al.,
1966). They concluded from the findings that separate strains of O. volvulus exist in the forest zones of Cameroon and that of the Sudan savannah each of which is adapted for transmission by a different form(s) of S. damnosum s.l.
Also, this savannah-forest strain hypothesis was experimentally demonstrated by subconjunctival injection of forest and savannah strains into rabbits by Duke and colleagues
(1972). They observed that MF of the savannah strain induced a more severe inflammatory 21
University of Ghana http://ugspace.ug.edu.gh
response in the cornea compared to those of the rain forest strain (Duke & Anderson, 1972;
Garner et al., 1973). Another evidence in support of the strain difference hypothesis came from isoenzyme studies on adult O. volvulus obtained from representative bioclimatic zones in Zaire,
Ivory Coast and Mali (Cianchi et al., 1985). Even though they used a limited number of samples, Cianchi and colleagues concluded that there are genetic differences between the savannah and forest strains. Subsequent studies using oligonucleotide DNA probes led to the identification of DNA sequences specific for the two strains of the parasite (Erttmann et al.,
1987 and 1990) and classification of these strains based on sequence showed that strains from the forest zones are different from those from the savannah regions (Meredith et al., 1989;
Zimmerman et al., 1993).
However, this “two strain” hypothesis does not seem to apply to parasites from other regions of
Africa. For example, using the forest strain specific probes, Fischer et al. (1996) observed a pattern of hybridization which does not fit the classical savannah-forest categorization i.e. neither the forest nor savannah probes hybridized with the S. neivei-transmitted O. volvulus in
Uganda. Prior to this finding, Kron and Ali (1993), reported that the DNA sequence of O-150 family from O. volvulus isolates obtained from northern Sudan were different from those obtained from West Africa. This goes to support the preliminary hypothesis that there are differences in the parasites present in the western and eastern foci of onchocerciasis in Africa
(Kron & Ali, 1993). In another study conducted in Sudan by Higazi et al. (2001) in which O-
150 repeat analysis performed on DNA of parasites obtained from the three onchocerciasis hotspots in Sudan and other parts of Africa were compared, they found that sequences from isolates obtained from eastern Sudan and Yemen are genetically indistinguishable from those obtained from West Africa. However, they observed that clinical and epidemiological picture of 22
University of Ghana http://ugspace.ug.edu.gh
the disease seen in these foci in Sudan and Yemen do not resemble the pattern observed in West
Africa.
A complication of the forest savannah dichotomy is the rampant deforestation in the West
African sub-region which has allowed invasion by savannah flies in these areas which were previously not ecologically suitable for them (Baker et al., 1990). High levels of blindness (5.5
%) was reported in a deforested region of Sierra Leone (Zimmerman et al., 1992; Wilson et al.,
2002) This observation was attributed to the fact that the savannah species, S. damnosum s.s and
S. sirbanum are able to migrate over a distance of 500 km with the attendant possibility of reintroduction of O. volvulus into areas previously brought under control (Wilson et al., 2002).
Simulium damnosum Theobald complex are currently the only known vectors of human onchocerciasis of which nine species have been identified in the areas covered by the OCP.
These are S. damnosum s.s., S. squamosum, S. sanctipauli, S. leonense, S. soubrense, S. yahense, S. sirbanum, S. konkourense and S. dieguerense. Using chromosomal studies some variant forms have been identified within these species (Boakye, 1993).
According to the Onchocerca-Simulium complexes concept which involves savannah and forest strains of the parasite, the vectors also differed in these bioclimatic regions (Duke et al.,
1966). Evidence now abounds that forest vectors such as S. yahense and members of the S. sanctpauli sub-complex have higher average parasite loads than in savannah vectors such as S. damnosum and S. sirbanum. Furthermore, the number of infective larvae transmitted by S. damnosum and S. sirbanum are generally lower than those transmitted by S. yahense and by most members of the S. sanctipauli sub-complex (Cheke & Garms, 2013). The two strain hypothesis has been used to explain the observations that the savannah vectors transmit blinding 23
University of Ghana http://ugspace.ug.edu.gh
form of the parasite but Garms and Cheke (2013) countered with arguments that there were reports of blindness in forest areas where the vector was S. yahense. All these data put together led to Fischer and Buttner (2002) to suggest that there could be a spectrum of different strains of
O. volvulus and they stated that “It appears reasonable to conclude that several different strains of O. volvulus occur throughout its large distribution area, but strain differences are not sufficient to explain all the geographic variation of the disease. The human host, biting habit of the vector or environmental factors may also influence the clinical picture of onchocerciasis.”
The competence of a member of a particular vector species complex to transmit parasite strain was demonstrated through a number of cross-infection experiments in which flies were fed on
MF of the same and distant localities. These localities were as diverse as within West Africa, between West Africa and Guatemala (De Leon & Duke, 1966), West Africa and northern
Venezuela, Guatemala and northern Venezuela (Takaoka et al., 1986) and then between the northern and Amazonian foci within Venezuela (Basáñez et al., 2000). The conclusion drawn from the results of these experiments was that there is a strong local adaptation between the parasites and vectors within well-established endemic areas. Thus, regardless of location, these vectors have their own unique parasite transmission characteristics in that even if the “forest” and “savannah” flies are living together, they will transmit only their respective parasites
(Cheke & Garms, 2013).
2.7 Laboratory diagnosis of Onchocerca volvulus
The tools for diagnosis of onchocerciasis in the laboratory include examination of skin snips by microscopy for emergent MF, the Mazzotti test, detection of antibodies to onchocercal antigens
24
University of Ghana http://ugspace.ug.edu.gh
or use of highly sensitive polymerase chain reaction-based (PCR) techniques for detection of
MF DNA in skin snips (Udall, 2007; Winthrop et al., 2011).
2.7.1 Skin snip microscopy
Microscopic examination of skin snips is the most widely used standardized technique for onchocerciasis in many endemic regions. Samples are usually collected from the scapula, over the iliac crest or calf (Murdoch, 2012). It is prone to low sensitivity in light infection when MF tend to be more aggregated in host skin. Studies have shown that sensitivity of skin snip microscopy depends on the number of snips taken, the anatomic site from which samples are taken, the composition of the medium and the duration of snip incubation (Collins et al., 1980;
Taylor et al., 1987). Skin snip microscopy however, is very specific but is becoming gradually unacceptable for many people because of its invasiveness (Boatin et al., 1998).
2.7.2 Mazzotti test
This is an indirect method to demonstrate the presence of MF in the skin by the administration of diethylcarbamazine (DEC). The diethylcarbamazine inhibits neuromuscular transmission in nematodes leading to the death of O. volvulus to produce such reactions as itching, rash and sometimes lymphadenitis (often referred to as Mazzotti reactions) which demonstrates the presence of MF in the skin (Toè et al., 2000). In the initial method, one 50 mg oral dose of DEC was used. This test is sensitive but yields false negative and false positive results. The false positive results according to Awadzi et al. (2015) may be due to the presence of other skin dwelling MF, for example Mansonella streptocerca which are sensitive to DEC. The oral test is seldom used because of the potential adverse reactions such as vomiting, hypotension and, in rare cases, sudden death (Bari & Rahman, 2007). To avoid the systemic issues associated with 25
University of Ghana http://ugspace.ug.edu.gh
oral administration of DEC, a major modification of the test has been made where it is applied topically as a “patch” which produces a local reaction to the dying MF at the patch site (Bari &
Rahman, 2007).
2.7.3 Immunological tests
These tests cannot differentiate between previous and current infections but have found utility in control programmes as surveillance tool. Initial protocols suffered from cross reactivity with other nematodes but following the use of specific recombinant O. volvulus antigen, Ov16 towards the IgG4 subclass of antibodies, sensitivity and specificity of these tests have improved significantly. Many antibody tests have been identified as candidate tests for diagnosis of human infection and as surveillance tools for control programmes but the major drawback is the need for laboratory infrastructure to support performance of Enzyme Linked Immunosorbent
Assay (ELISA) tests (Weil et al., 2000). However, a rapid format immunochromatographic test which is a point of care test to detect antibodies to Ov16, a recombinant O. volvulus antigen has led to significant improvement in performance of these antibody tests (Chandrashekar et al,.
1996).
2.7.4 Molecular techniques
The direct skin snip microscopy for O. volvulus MF remains the gold standard but as has been discussed elsewhere are relatively not sensitive when MF densities are low (Taylor et al., 1987).
Amplification of the parasite DNA in skin snips by Polymerase Chain Reaction (PCR) techniques targeted at the O-150 repeat sequence provides high sensitivity for diagnosis of onchocerciasis (Boatin et al., 2002). The PCR technique can be conventional or quantitative. In the conventional method, PCR products are separated on 2% agarose gel and the results 26
University of Ghana http://ugspace.ug.edu.gh
determined as positive or negative based on the presence of a specific visible band sizes using
UV light. In the quantitative or the Real Time PCR the results are determined using automated measurements of fluorescence and so are less prone to contamination (Lloyd et al., 2015).
Another molecular technique which is currently being used in the detection of O. volvulus is the isothermal amplification method which in contrast to the PCR test does not require temperature cycles. The loop mediated isothermal amplification (LAMP), is one of the most commonly used isothermal amplification technologies currently in use. The principle is based on use of two primer sets that recognized six different sites on the DNA of interest and an optional third set of primers, often referred to as loop primers to accelerate the reaction (Notomi et al., 2015). The loop mediated isothermal amplification technology offers many advantages over other molecular diagnostic techniques because it is rapid, simple and very specific. Using LAMP on skin biopsies collected from endemic areas in Ghana, Lagatie et al. (2016) found the sensitivity of LAMP to be 88.2% and specificity of 99.2% compared with qPCR. Molecular techniques now provide the most sensitive tool for monitoring success of mass drug administration (MDA) using pool screening of blackflies (Lagatie et al., 2016).
2.8 Onchocerciasis control
In response to the rampant blindness in the savannah regions of West Africa, the World Health
Organization (WHO) in collaboration with other United Nations agencies launched the
Onchocerciasis Control Programme (OCP) in 1974 with the objective of eliminating onchocerciasis as a public health problem. This programme was initially carried out in 7 countries but was later expanded to cover 4 additional countries bringing the total number of countries covered by the OCP to 11. This was a vector control programme using weekly aerial 27
University of Ghana http://ugspace.ug.edu.gh
spraying of breeding sites of the blackflies with insecticides. This programme was phenomenally successful in reducing the transmission, incidence and blindness in these countries (Levine, 2007). In 1988, the OCP supplemented the aerial spraying with mass distribution of ivermectin (Molyneux et al., 1995; Boatin, 2008). By the end of the programme in 2002, it was estimated that 600,000 cases of blindness was averted with about 18 million children born in regions free from the risk of blindness. Also, about 25 million hectares of land have been reclaimed and safe for resettlement (Hopkins, 2005).
The success of OCP notwithstanding, the disease still remains uncontrolled in other countries endemic for onchocerciasis especially in the forest regions of West, Central and Eastern Africa where aerial spraying was not considered to be cost-effective or technically feasible (Levine,
2007). As a result, a second and much expanded control programme called the African
Programme for Onchocerciasis Control (APOC) was established in 1995 to extend treatment to the remaining 19 endemic countries in Africa based on annual or biannual mass administration of ivermectin in the affected communities (WHO, 2011). In 1992, the Onchocerciasis
Elimination Programme for the Americas (OEPA) was launched with the target to eliminate transmission and morbidity by 2012 through biannual large-scale treatment with ivermectin.
This programme has been largely successful in that Colombia (2013), Ecuador (2014), and
Mexico (2015) and Guatemala (2016) have all been certified by WHO as having successfully eliminated onchocerciasis (Carter Center, 2016).
Ghana was one of the initial countries that benefited from the OCP from its inception. The main strategy of this programme was to interrupt transmission of parasites by adopting vector control method for a period in excess of the maximum lifespan of adult O. volvulus in the human host 28
University of Ghana http://ugspace.ug.edu.gh
(Remme et al., 1989). Following the licensing of ivermectin for use in humans in 1987, Ghana became one of the countries to start mass drug administration (MDA) (Basáñez et al., 2008).
Onchocerciasis control is now being implemented under the Neglected Tropical Disease
Control Programme (NTDCP) whose control activities officially started in 5 regions in Ghana on pilot basis in 2007 (Taylor et al., 2009).
Despite all these years of onchocerciasis control activities in Ghana, the disease is still endemic in the country (Taylor et al., 2009). The persistence of onchocerciasis in these communities despite many years of control efforts has been attributed to poor response of the adult worms to ivermectin (Osei-Atweneboana et al., 2011). However, other researchers attributed the continued prevalence of onchocerciasis to poor ivermectin distribution coverage leading to residual transmission (Cupp et al., 2007; Mackenzie, 2007). In a recent epidemiological studies
(2014) in 56 onchocerciasis sentinel villages along the Black Volta, Tano ,Pru, ,Tain,
Asukawkaw, Oti, Daka,Bia, Densu, Birim and Densu river basins, the standard prevalence ranges from 0% to 17.2% with 14 out of the 56 villages having prevalence above 1% . Also, one significant observation from this study was a general reduction in the MF loads. It was concluded therefore that these low counts offer some hope for elimination of onchocerciasis.
However, there are still communities with high prevalence of onchocerciasis despite control efforts with ivermectin use over the years which needs to be given a closer attention (GHS,
2015).
In order to curb the socioeconomic consequences and public health problems associated with onchocerciasis, the Neglected Tropical Disease Control Programme of the Ghana Health
29
University of Ghana http://ugspace.ug.edu.gh
Service (GHS) initiated biannual ivermectin distribution in hyper endemic communities and annual distribution in meso and hypo endemic areas (Turner et al., 2013).
In its five-year strategic plan, 2013-2017, the NTDCP of the GHS, reaffirmed its commitment to a national goal of using community directed treatment with ivermectin (CDTI) and other effective interventions for elimination of onchocerciasis(GHS, 2012).
30
University of Ghana http://ugspace.ug.edu.gh
CHAPTER THREE
3.0 MATERIALS AND METHODS
3.1 Study area and population
The study was conducted in four (4) communities located in the Nkwanta North District of
Ghana. These communities were Kabonwole, Kofinyi, Lemina and Kanjo. The district which has a total population of 64, 553 is one of the twenty five (25) districts in the Volta Region. It lies between latitudes 7°30ʹN and 8°45ʹN and longitudes 0°45ʹE and 0°10ʹW. The Nkwanta
North district shares boundaries with the Nkwanta South district to the south, the Nanumba
South district to the north, the Kpandai district to the west and the Republic of Togo to the east.
The district Capital, Kpassa is located 270 km to the north of Ho (the regional Capital) (GSS,
2014).
The Nkwanta North district is located in the tropical climatic zone, and experiences double maxima of rainfall (i.e. between April and July; August and September) and experiences both the wet and dry seasons with the dry season occurring between November and March. The district lies in the transitional vegetation zone and is covered by savannah woodland and grassland. Pockets and remnants of semi-deciduous forest also exist. The district is endowed with a number of rivers and streams, the most important of which are River Oti and River
Kpassa. The streams and rivers exhibit a dendritic pattern, which forms the Oti basin and so provide favourable breeding grounds for the vectors of O. volvulus (GSS, 2014).
31
University of Ghana http://ugspace.ug.edu.gh
Figure 3.1 Map of the Nkwanta North District (Source: GSS, 2014)
32
University of Ghana http://ugspace.ug.edu.gh
3.2 Sample size calculation
The highest prevalence among the onchocerciasis sentinel communities in the Nkwanta North district was 6.9% (Unpublished data from NTDCP, 2012). The minimum sample size was determined to be 98 using the formula,
N=z2p(1-p)/e2 , where
N= minimum sample size required;
Z= confidence level at 95% (standard value of 1.96);
P= estimated prevalence of onchocerciasis; e= 5 % margin of error; (Sullivan, 2016).
Based on this sample size, a total of 218 samples were collected to increase the power of the study.
3.3 Sampling techniques
3.3.1 Community selection and inclusion criteria
Information about study population, IVM treatment history and prevalence was obtained from the District Disease Control Officer of the Nkwanta North District Health Directorate of the
Ghana Health Service (GHS). The four (4) communities for this study were selected based on disease prevalence and community accessibility
33
University of Ghana http://ugspace.ug.edu.gh
3.3.2 Participants selection
Selected communities were informed through their Chiefs. The study participants in each community were mobilized by the district health information officer and the purpose of the study explained to them. Those who consented were all recruited for the study. Each individual was given a unique identification number and clinical assessment by an experienced Physician
Assistant was conducted on all subjects as follows: the study subjects were examined physically for clinical signs of onchocerciasis such as skin rashes, depigmentation (leopard skin), visible and palpable nodules. The visual acuity of participants at far and near distances was determined using the Snellen chart and the ability to count figures at distance up to 6 m was also determined.
In addition, a structured questionnaire was administered to each participant to collect their personal data, clinical history and to determine their treatment status.
3.3.3 Sample collection and storage
All participants who consented from each community were skin snipped. Briefly, one skin snip from each iliac crest was collected using sterilized Walzer type corneo-scleral punch from each patient. Each snip was placed separately into a well of a microtitre plate containing 200 µl of physiological saline and incubated for 12-24 hours (overnight) at room temperature. The microtitre plates were sent to the laboratory and examined under an inverted microscope. The emergent MF were identified and enumerated. The MF from the positive wells were transferred into Eppendorf tubes containing 10% formalin and stored at room temperature. The residual skin snips were also put into Eppendorf tubes containing 80% ethanol and stored for further works.
34
University of Ghana http://ugspace.ug.edu.gh
3.3.4 DNA extraction of O. volvulus from skin snips
The DNA extraction was done using Quick-gDNA™ MiniPrep (Zymo Research Corporation,
USA) according to the manufacturer’s instructions with slight modifications. Briefly, skin snips were cut into smaller pieces on a clean glass slide using a sterile scalpel. With the aid of sterile forceps, the macerated skin snips were transferred into appropriately labeled 1.5 ml micro centrifuge tubes. Genomic Lysis Buffer, 200 µl and 10 µl of proteinase K were added to the sample and vortexed for 30 seconds to ensure mixing of the lysing reagent with the skin snips.
The mixture was incubated at 60°C for 1 hour with intermittent vortexing at 30 minute- intervals. The homogenate was pipetted into Zymo-Spin Column with 2 ml collection tube and spun at 10,000 xg for 60 seconds and the flow-through discarded. The Zymo-spin columnn was transferred into another 2 ml collection tube and 200µl of DNA Pre-Wash Buffer added, and centrifuged at 10,000 xg for 60 seconds. The Zymo-spin column was again transferred to another new 2 ml collection tube and 500 µl of g-DNA Wash Buffer added, and centrifuged at
10,000 xg for 60 seconds. The flow-through was discarded and the silica membrane was further dried by repeating the centrifugation at 10,000 xg for 60 seconds. The Zymo-Spin Column was placed in a sterile 1.5 ml microcentrifuge tube and 30µl DNA Elution Buffer was pipetted directly onto the Zymo-Spin Column membrane, incubated at room temperature for 10 to 15 mins, and then centrifuged at 8,000 rpm for 60 seconds to elute the DNA. For maximum yield of the DNA, the elution was repeated as described above into another tube as second elution.
3.3.5 Onchocerca volvulus DNA amplification using diagnostic primer
Polymerase chain reaction amplification for O. volvulus identification was carried out in Quanta
Green SYBR buffer in a volume containing 7.5 µl of B-R One-Step SYBR Green (Quanta
Biosciences, USA), 0.2 µl of each primer, 2.1 µl of nuclease free water and 5 µl of control and 35
University of Ghana http://ugspace.ug.edu.gh
test sample genomic DNA. The thermocyclying programme started with 3 minutes denaturation at 94°C followed by 45 cycles of denaturation at 94°C for 30 seconds, 48°C annealing for 30 seconds and 72°C extension of 40 seconds with final extension for 5 minutes (PTC-200,
BioRad, USA). The sequences of the primers used are OV_sd_diag-F1: 5'-
GTCTTATAGGAGTTTCTGT-3' and OV_sd_diag-R1: 5'-ACCCATCAACTTATCAAAAC-3'
(Atweneboana and colleagues (CSIR, 2016), unpublished).
3.3.6 Gel electrophoresis
The obtained PCR products were run on 2 % w/v agarose gel. Briefly, 2 g of agarose powder was added to 100 ml 1X TE buffer and dissolved by boiling in a microwave oven. It was allowed to cool to 60°C and 3 µl of ethidium bromide was added, swirled to mix and dispensed gently into the casting mold with combs and allowed to set.
Finally, 8 µl of the PCR products were checked by agarose gel electrophoresis with appropriate molecular weight markers (1 kb in multiples of 100 bp) inserted to determine the expected size relative to the marker. The marker, positive (forest and savannah) and negative controls as well as samples were loaded. Electrophoresis was run at 100V for 45 minutes. Gel was observed under a UV Trans-illuminator (BioDoc-it Imaging System, Cambridge, UK) and the molecular weights analyzed.
3.3.7 Nested PCR for Onchocerca volvulus strain identification.
Samples that were identified as O. volvulus with the diagnostic primers were selected for nested
PCR for identification of strain type according to the protocol and primers used by Fischer et al,
(1996) with slight modifications. Also, known forest and savannah strain samples were used as controls. Nest 1 was performed in a 15 µl volume containing 7.5 µl of B-R One-Step SYBR 36
University of Ghana http://ugspace.ug.edu.gh
Green (Quanta Biosciences, USA) mix, 0.2µl of each primer, 2.1 µl nuclease free water and 5
µl of genomic DNA. The thermocyclying programme (PTC-200, BioRad, USA) started with 3 minutes denaturation at 98°C followed by 40 cycles of denaturation at 98°C for 30 seconds,
58°C annealing for 30 seconds and 72°C extension of 30 seconds and final extension for 5 minutes. The primers used are S3 5'-ATCATTTTGCAAAATGCG-3' and S4 5'-
AATAACTGATGACCTATGACC-3'.
The product of the first PCR (nest 1) was diluted 1:20 and 5 µl was used for strain specific amplification in a 15 µl volume containing 7.5 µl of B-R One-Step SYBR mix (Quanta
Biosciences, USA), 0.2 µl of each primer and 2.1 µl of nuclease free water using the following cycling conditions: initial 3 minutes denaturation at 98°C followed by 45 cycles of denaturation at 98°C for 30 seconds 58°C annealing for 30 seconds and 72°C extension of 30 seconds with extended extension for 5 minutes (96 Universal Gradient PeQSTAR, UK) . The following are the primers used: FA: 5'- GCGGCATAAATCTGCAAATTC-3' and FB:
5'GATTTTTCCGACGAACAGCGC3'
3.4 Statistical Analysis
The data obtained were entered into Excel and validated. The analysis was performed using R statistical software. Test of statistical significance was determined using the Chi-square test.
37
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FOUR
4.0 RESULTS
4.1 Analysis of skin snip microscopy and O. volvulus DNA PCR results
Skin snips from a total of 218 participants were examined for the presence of O. volvulus MF by inverted microscopy and conventional PCR for O. volvulus DNA on residual skin snips. Of the
218 samples examined 3.7% (8/218) were positive for MF by skin snip microscopy and 9.2%
(20/218) were positive for O. volvulus DNA by PCR on residual skin snips. Of the 8 microscopy positive samples, DNA from 7 residual skin snip samples showed amplification with O. volvulus DNA and one (1) did not show any amplification. The difference in performance of skin snip microscopy and PCR was statistically significant (p<0.05).
4.1.1 Analysis of Onchocerca volvulus positive results for skin snip microscopy and DNA PCR by age and sex
Males constitute 54.1% (118/218) and females 45.9% (100/218) of the study participants surveyed. About 60% (12/20) of those positive for O. volvulus by DNA PCR are females and
40% (8/20) being males while by microscopy, males were the majority with 62.5% (5/8) with females trailing with 37.5% (3/8). The age group with the highest prevalence by PCR was 11-20 year group with 35% (7/20) and the least being 51-60 year with 0%. However, among the 11-20 year group, only 12.5% (1/8) was positive by microscopy with the age groups having highest prevalence rates being 21-30 and 31-40 groups, both with 37.5% (3/8). Again the 51-60 age group had the lowest prevalence by microscopy with 0.0%.
38
University of Ghana http://ugspace.ug.edu.gh
4.1.2 Analysis of skin microscopy and DNA PCR results by occupation
In the Nkwanta North district, farming is the predominant occupation with 70.2% (153/218) of the respondents engaged in it. Majority of those positive for O. volvulus, 60% (12/20) by PCR and 75% (6/8) by microscopy are farmers. The civil/public servants had the least with positive rate for both PCR and microscopy of 0.0%.
4.2 Analysis of results of Clinical manifestations of onchocerciasis
Clinical manifestations identified in this study are skin rashes/itches, visual impairment and nodules. The most predominant clinical manifestation among the 218 participants screened was skin rashes/itches with a prevalence of 15.1% (33/218) followed by visual impairment with a prevalence of 8.3% (18/218). Of the 18 participants who had visual impairment, 55.6% (10/18) had low vision (≤6/60 ≤ 6/18), 38.9% (7/18) had severe low vision (≤3/60-6/60) and 5.6%
(1/18) had profound low vision (3/60-NPL). Thus, overall, only, 0.5 % (1/218) (WHO criteria of acuity of <3/60) of the participants was suffering from blindness. Palpable nodules was found in only one person (1/218). Lizard skin and leopard skin lesions were not found among the participants examined.
4.2.1 Analysis of subjects manifesting onchocercal lesions by sex
Of the 33 participants who had rashes/itches 66.7% (22/33) were males and 33.3% (11/33) were females. Among those with visual impairment 72.2% (13/18) were males and 27.8% (5/18) were females. Also, of the 18 participants who were classified as having visual impairment, 10 had low vision of which 80% (8/10) were males and 20% (2/10) females. Severe low vision was found among 57.1% (4/7) males and 42.9% (3/7) female with the profound visual impairment.
The only participant with blindness is a male. 39
University of Ghana http://ugspace.ug.edu.gh
4.2.2 Analysis of subjects manifesting onchocercal lesions by age groups
This section describes the distribution of onchocercal lesions in the four communities of
Nkwanta North district by age. Of the 33 participants who had skin rashes/itches, the age group with most predominant lesion is 31-40 years, 27.3% (9/33) followed closely by 10-20 and 21-30 year groups both with 18.2% (6/33). As expected, visual impairment is commonest among the elderly group, 33.3% (6/18) and the least being among the 11-20 and 21-30 year groups with
5.6% (1/18) each.
4.2.3 Analysis of subjects manifesting onchocercal lesions by occupation
Of the 33 participants who had rashes/itches, 45.5% (15/33) were farmers. Students/pupils and traders both had 18.2% (6/33). Only one person in the public/civil servant category had rashes/itches. When the proportion of farmers with skin rashes/itches is compared with traders, fishermen and Civil/Public servants, the difference is significant (p<0.05).
A significant proportion, as high as 83.3% (15/18) of participants with visual impairment were farmers (p<0.05) including all the severe forms of low vision with only one participant each from student/pupil, public/civil servant and fisherman categories.
4.2.4 Analysis of demographic and treatment records of the study participants
The total number of participants recruited for this study was 218 made of 54.1% (118/218) males and females 45.9% (100/218) with the median ages of 35 and 30 respectively. The average length of stay of participants in the communities sampled were approximately 20 years for males and 18 years for females. The communities sampled were rural settings with majority,
40
University of Ghana http://ugspace.ug.edu.gh
69.3% (151/218) with no formal education and just 0.92% (2/218) with a tertiary education. The main occupation is farming 70.2% (153/218).
About 95% (207/218) of the participants have ever taken ivermectin treatment, as part of the community directed treatment with ivermectin programme, with the most recent being about one year prior to the sample collection.
4.3 DNA results analysis
4.3.1 Detection of O. volvulus using Diagnostic primers
The PCR assay used in this study amplified DNA from microfilariae in the skin snip using O. volvulus mitochondrial DNA primers OV_sd_diag-F1: 5'-GTCTTATAGGAGTTTCTGT-3' and OV_sd_diag-R1: 5'-ACCCATCAACTTATCAAAAC-3'. Amplification of DNA from skin snips from Nkwanta north district and the control samples with the diagnostic primers confirms the PCR products as belonging to O. volvulus.
Figure 4.1 shows successful amplification from skin snips from one of the communities in the
Nkwanta north district, Kabonwole (KA in lanes 3, 4, 7, 8 and 9) as depicted by visible bands on the agarose gel and figure 4.2 shows successful amplification from another community in the study area, Lemina (LM in lanes 3 and 4) and forest controls (FSP in lanes 5, 10, 11 and 12) and savannah controls (AB1, AB2, AB3, ASU 1, ASU 2 and ASU 3 in lanes 6, 7, 8, 9, 13 and 14 respectively.
41
University of Ghana http://ugspace.ug.edu.gh
Figure 4.1. Agarose gel electrophoresis pattern for amplification products of samples from
Kabonwule (KA) in lanes 3, 4, 7, 8 and 9 by OV Diagnostic primers
Figure 4.2. Agarose gel electrophoresis pattern for amplification products of samples from
Lemina (LM) in lanes 3, 4, and Controls from Agborlekame ABI, AB2 AB3 in lanes 6, 7, 8 and
42
University of Ghana http://ugspace.ug.edu.gh
Asubende ASU 1, ASU 2, ASU 3 in lanes 9, 13, and 14 and forest controls FSP 1,FSP 2, FSP 3 and FSP 4 in lanes 5,10, 11, 12 respectively by OV diagnostic primer.
.
4.3.2 Analysis of PCR test results for determination of O. volvulus strain using forest strain specific primers
Differentiation of the isolates was done using a 107 bp long fragment of forest strain-specific
DNA sequence on O. volvulus positive samples from the four (4) communities in the Nkwanta
North district and controls from Agborlekame (AB) and Asubende (ASU) (all savannah) and samples from Cameroun (FSP) (forest samples). The test samples and the savannah control samples did not amplify with the forest specific primers whereas controls from the forest regions show amplification (Fig. 4.3), suggestive of the samples from the Nkwanta North district belonging to savannah strains.
43
University of Ghana http://ugspace.ug.edu.gh
Figure 4.3. Agarose gel electrophoresis pattern of two isolates from Nkwanta North district (KA
47 and LM 52) in lanes 3 and 4 and savannah controls in lanes 5, 6, 7, 8 and 9 showing no amplification with nested PCR primers. Lanes 2, 10, 11, 12 and 13 amplified with the forest- strain specific primer producing amplicon size of 153 bp.
44
University of Ghana http://ugspace.ug.edu.gh
CHAPTER FIVE
5.0 DISCUSSION, CONCLUSION AND RECOMMENDATIONS
5.1 Discussion
The application of molecular techniques have aided in the description of O. volvulus isolates from different geographical regions. The close examination of the tandem repeat O-150 DNA sequences in particular has been useful in the differentiation of O. volvulus from other
Onchocerca species (Meredith et al., 1989; Zimmerman et al., 1993) as well as the separation of O. volvulus parasites into savannah and forest strains (Meredith et al., 1991).
This study produced results which suggest that all the O. volvulus isolates from the Nkwanta
North district were savannah strains. This is not surprising given the current climatic condition prevailing in the Nkwanta North district which lies in the savannah-forest mosaic where both forest and savannah strains are sympatric. As a result of human activities, these areas have been seriously deforested. The rampant deforestation in Ghana was confirmed by Wilson et al.
(2002), who observed that as a result of human activities there has been substantial increase in the proportion of savannah vectors of O. volvulus in southern part of Ghana and Togo. The increase in the savannah vectors according to them will lead to increased transmission of savannah strains of the parasites in deforested areas. Nkwanta North district is not spared the effect of deforestation, hence this outcome.
This finding is not consistent with the observations made by Dordor and colleagues
(unpublished data) where they found both savannah and forest strains among black flies caught in some communities in the Nkwanta North district. However, they found the predominant 45
University of Ghana http://ugspace.ug.edu.gh
strain to be that of savannah; 7 out of the 9 isolates characterized were suggestive of savannah strains and the remaining 2 being forest strains. Given the mobile nature of the flies, the identification of both forest and savannah strains of O. volvulus is not strange as those vectors habouring forest strains could be making occasional incursion into the district at the time of fly- catch. Again, this finding is not consistent with the findings of Oyibo et al. (2002) in a study they conducted in the Lade District (in Kwara state) which is in the forest-savannah transition zone of Nigeria on adult worms harvested from nodules. They found both savannah and forest strains of O. volvulus in the same individual. They explained this occurrence to be due to either the simultaneous transmission of both savannah and forest parasites or existence of a “hybrid” form of O. volvulus. Participants in the Nkwanta North district of Ghana being in the forest- savannah transition zone could also have been exposed to simultaneous transmission of both forest and savannah strains of the parasite, however, only the savannah strains were able to possibly establish infection in the individuals sampled. Given that nodules contain a number of adult worms, it is possible to have a mix of parasites of different strains due to individuals being exposed to bites of both savannah and forest vectors provided both parasites are able to establish infection in that individual.
By skin snip microscopy, this study revealed that more males than females were infected with
O. volvulus. This result is consistent with the findings of Wogu and Okaka (2008) who in their study observed that more males (27.5%) suffer from onchocerciasis than females (20%). Similar observations were made by Uttah (2010) who found 39.2% of the study participants to be males and 34.9% females and Nmorsi et al. (2002) who found more males (49.4%) than females
(33.3%). The explanation for this observation is that males are more exposed to the bites of the vectors of the disease either as they go about their occupational activities such as farming and 46
University of Ghana http://ugspace.ug.edu.gh
fishing or by living close to the breeding sites. Akinboye et al. (2010) attributed this observation to the fact that men are less clad as they go about their activities compared to females and so are more liable to bites of the blackflies. In the Nkwanta North district, farming is the predominant occupation in which males are expected to be engaged than females. This observation is a contradiction to what was found by Akinbo and Okaka (2010) who found more females (93.1%) infected than males (74.5 %) infected by Onchocerca volvulus in a study conducted in Ovia
Northeast LGA in Edo state of Nigeria. The observation by Akinbo and Okaka of more females being infected than males is corroborated by the PCR results in our study where more females
(60 %) than males (40 %) were classified positive using DNA PCR. Nkwanta North district is inhabited mostly by Konkombas (GSS, 2014) and among these tribes females are also engaged in farming just as the men if not more. Females in these communities do farming in addition to going to the river side to fetch water or wash by the river side with the attendant frequent exposure to insect bites. Therefore the result was expected.
This study revealed that prevalence of onchocerciasis was highest among farmers than any other occupational groups by both microscopy and DNA PCR. Similar observations were made by
Okoro et al. (2014) who found a significantly higher prevalence (combined prevalence of 22.2
% in the two Senatorial Districts in Ebonyi State, Nigeria) among farmers than traders, civil servants, and students. This difference in prevalence is due to risk of occupational exposure to the bites of the vectors. Civil/public servants did not record any infection with O. volvulus either by microscopy or DNA PCR in this study. The reason for this low prevalence is that this category of individuals are mostly working indoors during the day which is normally the biting period for the black flies and so are less exposed to the bites of these flies.
47
University of Ghana http://ugspace.ug.edu.gh
The commonest skin manifestation among the participants in the communities studied was rashes/itches) and is most prevalent among the 31-40 age bracket. The possible explanation for this observation is that this category of people are mostly the active working group and so are more exposed to frequent bites as they go about their farming, fishing or water fetching activities which are major risk factors of O. volvulus infection.
From the gross examination of the eye using Snellen chart, visual impairment was observed among 8.3% of the study subjects mostly among those above age 51 years. This is consistent with the observations made by Kamalu & Uwakwe (2014) where they found that ocular manifestations of onchocerciasis was more prevalent among the 50-62 year group. Blindness, visual acuity of <3/60 (WHO, 2005) was detected among 0.5% of the participants examined compared to 0.75% found in 3 sites sampled in Asante Akim district in Ashanti region of Ghana
(Taylor et al, 2009).
This study revealed skin snip microscopy prevalence which is lower than the data obtained from the 5 onchocerciasis sentinel sites in the Nkwanta North district in 2012 (unpublished data from
NTDCP) which has the highest prevalence at 6.9%. This low prevalence can be attributed to the impact of continued onchocerciasis control activities in the communities since about 95 % of the participants had ever had treatment with ivermectin as part of the CDTI with the most recent distribution done just about a year before sample collection. This finding is also consistent with epidemiological data obtained in 2014 from Asubende where the prevalence dropped from 5.9
% in 2007 to 3.2 % in 2014 (GHS, 2015).
48
University of Ghana http://ugspace.ug.edu.gh
The prevalence of clinical signs of onchocerciasis is generally low in the communities studied which corresponds to the low microscopy prevalence. This low prevalence is a good testament of the impact of ivermectin treatment in the district, nevertheless, the presence of skin MF is suggestive of the continued disease transmission.
Skin snip microscopy has been the method of choice for monitoring onchocerciasis control activities in Ghana. The sensitivity of microscopy depends largely on microfilaria load (Taylor et al, 1987; Basanez et al 2008). Therefore with the sustained IVM mass drug administration and the reduction in microfilarial load as evidenced in the 2014 epidemiological data (GHS,
2015) calls into question the utility of microscopy for disease mapping as elimination programmes are expanded to cover areas of low endemicity given that the PCR method in this study identified 12 more additional samples previously classified as negative by microscopy.
5.2 Conclusion
The results from this study suggest that Nkwanta north district is endemic for savannah strains of O. volvulus. The prevalence of the savannah strains in these communities may indicate a changing trend in vector population as a consequence of deforestation and climate change.
The predominant clinical manifestation found among the study subjects was skin rashes/itches.
The generally low prevalence of clinical manifestations and skin snip microscopy is an indication of success of several years of control activities in these communities in spite of evidence of disease transmission in the area.
49
University of Ghana http://ugspace.ug.edu.gh
5.3 Limitations
Owing to logistical challenges, refraction, slit lamp examination and ophthalmoscopy examinations were not done on the participants.
5.4 Recommendations
Further molecular characterization studies should be done in the other communities in the region to determine strain type(s) prevalent in these communities using both forest and savannah probes.
Also, more extensive study should be carried out in these communities with full ophthalmology examinations done on the participants to determine the true extent of visual impairment
Based on evidence of the PCR test detecting more skin snip positive samples than microscopy,
PCR-based techniques or more sensitive tools should be employed for monitoring onchocerciasis control activities.
50
University of Ghana http://ugspace.ug.edu.gh
REFERENCES
Abiose, A. (1998). Onchocercal eye disease and the impact of Mectizan treatment. Annals of
Tropical Medicine and Parasitology, 92 Suppl 1, S11-22. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/9861263.
Adewale, B., Mafe, M. A., & Oyerinde, J. P. O. (2005). Identification of the forest strain of
Onchocerca volvulus using the polymerase chain reaction technique. West African Journal
of Medicine, 24 (1): 21–5.
Akinbo, F.O. and Okaka C.E. (2005). Prevalence and Socio-Economic Effects of
Onchocerciasis in Ovia North East Local Government Area of Edo State, Nigeria. Rivista
Parasitologic., 22 (3): 215-221.
Akinboye, D.O., Okwong, E., Ajiteru, N., Fawole, O., Agbolade, O.M., Ayinde, O.O., Amosu,
A.M., Atuloma, N.O.S., Odula, O., Owodunni, B.M., Rebecca, S.N. and Falade, M. (2010).
Onchocerciasis among inhabitants of Ibarapa Local Government community of Oyo state,
Nigeria. Biomedical Research, 21 (2):174-178.
Alonso, L. M., Murdoch, M. E., & Jofre-Bonet, M. (2009). Psycho-social and economic
evaluation of onchocerciasis : a literature review . Social Medicine, 4 (1): 8–31.
Anderson, R. C. (2000). Nematode parasites of vertebrates: their development and
transmission. Wallingford: CABI. http://doi.org/10.1079/9780851994215.0000.
51
University of Ghana http://ugspace.ug.edu.gh
Andre, A. v. S., Blackwell, N. M., Hall, L. R., Hoerauf, A., Brattig, N. W., Volkmann, L., …
Pearlman, E. (2002). The Role of Endosymbiotic Wolbachia Bacteria in the Pathogenesis
of River Blindness. Science, 295 (5561): 1892–1895.
http://doi.org/10.1126/science.1068732.
Anosike, J. C., & Onwuliri, C. O. (1995). Studies on filariasis in Bauchi State, Nigeria. 1.
Endemicity of human onchocerciasis in Ningi Local Government Area. Annals of Tropical
Medicine and Parasitology, 89 (1): 31–8. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/7741592.
Armoo, S., Doyle, S. R., Osei-Atweneboana, M. Y., & Grant, W. N. (2017). Significant
heterogeneity in Wolbachia copy number within and between populations of Onchocerca
volvulus. Parasites & Vectors, 10 (1): 188. http://doi.org/10.1186/s13071-017-2126-4.
Aroian, R. V, Levy, A. D., Koga, M., Ohshima, Y., Kramer, J. M., & Sternberg, P. W. (1993).
Splicing in Caenorhabditis elegans Does Not Require an AG at the 3’ Splice Acceptor Site.
Molecular And Cellular Biology, 13 (1): 626–637. Retrieved from
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC358941/pdf/molcellb00013-0652.pdf.
Awadzi, K., Opoku, N. O., Attah, S. K., Lazdins-Helds, J. K., & Kuesel, A. C. (2015).
Diagnosis of O. volvulus infection via skin exposure to diethylcarbamazine: clinical
evaluation of a transdermal delivery technology-based patch. Parasites & Vectors, 8 (1):
515. http://doi.org/10.1186/s13071-015-1122-9.
52
University of Ghana http://ugspace.ug.edu.gh
Baker, R. H., Guillet, P., Sékétéli, A., Poudiougo, P., Boakye, D., Wilson, M. D., & Bissan, Y.
(1990). Progress in controlling the reinvasion of windborne vectors into the western area of
the Onchocerciasis Control Programme in West Africa. Philosophical Transactions of the
Royal Society of London. Series B, Biological Sciences, 328 (1251): 731–47, discussion
747-50.
Bari, A. & Rahman, S. B. (2007). Onchocerciasis : A review of a filarial disease of significant
importance for dermatologists and ophthalmologists. Journal of Pakistan Association of
Dermatologists, 1 (17): 32–45.
Basáñez, M.-G., Pion, S. D., Boakes, E., Filipe, J. A., Churcher, T. S., & Boussinesq, M.
(2008). Effect of single-dose ivermectin on Onchocerca volvulus: a systematic review and
meta-analysis. The Lancet Infectious Diseases, 8 (5): 310–322.
http://doi.org/10.1016/S1473-3099(08)70099-9.
Basáñez, M.-G., Pion, S. D. S., Churcher, T. S., Breitling, L. P., Little, M. P., & Boussinesq, M.
(2006). River Blindness: A Success Story under Threat? PLoS Medicine, 3 (9): e371.
http://doi.org/10.1371/journal.pmed.0030371.
Basáñez, M. G., Yarzábal, L., Frontado, H. L., & Villamizar, N. J. (2000). Onchocerca-
Simulium complexes in Venezuela: can human onchocerciasis spread outside its present
endemic areas? Parasitology, 120 (2): 143–60.
53
University of Ghana http://ugspace.ug.edu.gh
Basáñez, M. G., & Boussinesq, M. (1999). Population biology of human onchocerciasis.
Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences,
354 (1384): 809–26. http://doi.org/10.1098/rstb.1999.0433.
Boakye, D. A., Back, C., Fiasorgbor, G. K., Sib, A. P. P., & Coulibaly, Y. (1998). Sibling
species distributions of the Simulium damnosum complex in the West African
Onchocerciasis Control Programme area during the decade 1984-93, following intensive
larviciding since 1974. Medical and Veterinary Entomology, 12 (4), 345–358.
http://doi.org/10.1046/j.1365-2915.1998.00118.x.
Boakye, D. A. (1993). A pictorial guide to the chromosomal identification of members of the
Simulium damnosum Theobald complex in west Africa with particular reference to the
Onchocerciasis Control Programme Area. Tropical Medicine and Parasitology : Official
Organ of Deutsche Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur
Technische Zusammenarbeit (GTZ), 44 (3), 223–44.
Boatin, B. (2008). The Onchocerciasis Control Programme in West Africa (OCP). Annals of
Tropical Medicine & Parasitology, 102 (sup1): 13–17.
http://doi.org/10.1179/136485908X337427.
Boatin, B. A., Toé, L., Alley, E. S., Nagelkerke, N. J. D., Borsboom, G., & Habbema, J. D. F.
(2002). Detection of Onchocerca volvulus infection in low prevalence areas: a comparison
of three diagnostic methods. Parasitology, 125 (6): 545–52.
54
University of Ghana http://ugspace.ug.edu.gh
Boatin, B. A., Toé, L., Alley, E. S., Dembélé, N., Weiss, N., & Dadzie, K. Y. (1998).
Diagnostics in onchocerciasis: future challenges. Annals of Tropical Medicine and
Parasitology, 92 Suppl 1: S41-5.
Brattig, N. W. (2004). Pathogenesis and host responses in human onchocerciasis: impact of
Onchocerca filariae and Wolbachia endobacteria. Microbes and Infection, 6 (1): 113–28.
Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/14738900.
Brattig, N. W., Krawietz, I., Abakar, A. Z., Ertman, R D., Kruppa, T. K. and Massaougbodji, A.
(1994). A strong immunoglobulin G isotope antibody response in sowdah type
onchocerciasis. Journal of Infectious Disease, 170: 995-961.
Burnham, G. (1998). Onchocerciasis, 351: 1341–1346.
Cabrera, Z., Buttner, D. W., National, R. M. E. P., & Hill, M. (1988). Unique recognition of a low molecular weight Onchocerca volvulus antigen by IgG3 antibodies in chronic hyper- reactive oncho-dermatitis ( Sowda ), 223–229.
https://www.cartercenter.org/news/pr/guatemala-092916.html downloaded 3 July, 2017
55
University of Ghana http://ugspace.ug.edu.gh
Chandrashekar, R., Ogunrinade, A. F., & Weil, G. J. (1996). Use of recombinant Onchocerca
volvulus antigens for diagnosis and surveillance of human onchocerciasis. Tropical
Medicine & International Health : TM & IH, 1 (5): 575–80.
https://www.cdc.gov/dpdx/onchocerciasis/index.html
Cheke, R. A., & Garms, R. (2013). Indices of onchocerciasis transmission by different members
of the Simulium damnosum complex conflict with the paradigm of forest and savanna
parasite strains. Acta Tropica, 125 (1), 43–52.
http://doi.org/10.1016/j.actatropica.2012.09.002.
Cianchi, R., Karam, M., Henry, M. C., Villani, F., Kumlien, S., & Bullini, L. (1985).
Preliminary data on the genetic differentiation of Onchocerca volvulus in Africa
(Nematoda: Filarioidea): Acta Tropica 42 (4) 1985: 341-351.
Collins, R. C., Brandling-Bennett, A. D., Holliman, R. B., Campbell, C. C., & Darsie, R. F.
(1980). Parasitological diagnosis of onchocerciasis: comparisons of incubation media and
incubation times for skin snips. The American Journal of Tropical Medicine and Hygiene,
29 (1): 35–41.
Cotton, J. A., Bennuru, S., Grote, A., Harsha, B., Tracey, A., Beech, R., … Lustigman, S.
(2016). The genome of Onchocerca volvulus, agent of river blindness. Nature
Microbiology, 2 (November 2016), 16216. http://doi.org/10.1038/nmicrobiol.2016.216.
56
University of Ghana http://ugspace.ug.edu.gh
Crosskey, R. W. (1990). The Natural History of Blackflies. Wiley Chichester. Retrieved from
https://www.abebooks.co.uk/Natural-History-Blackflies-Crosskey-R.W-
Wiley/16841599303/bd.
Crump, A., Morel, C. M., & Omura, S. (2012). The onchocerciasis chronicle: From the
beginning to the end? Trends in Parasitology, 28 (7): 280–288.
http://doi.org/10.1016/j.pt.2012.04.005.
Cupp, E., Richards, F., Lammie, P., Eberhard, M., & Prichard, R. (2007). Efficacy of ivermectin
against Onchocerca volvulus in Ghana. Lancet (London, England), 370 (9593), 1123;
author reply 1124-5. http://doi.org/10.1016/S0140-6736(07)61501-3.
Dadzie, K. Y., Remme, J., Rolland, A., & Thylefors, B. (1989). Ocular onchocerciasis and
intensity of infection in the community. II. West African rainforest foci of the vector
Simulium yahense. Tropical Medicine and Parasitology : Official Organ of Deutsche
Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische
Zusammenarbeit (GTZ), 40 (3), 348–54. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/2559472.
De Leon, J. R. & Duke, B. O. L. (1966). Experimental studies on the transmission of
Guatemalan and West African strains of Onchocerca volvulus by Simulium ochraceum, S.
metallicum and S. callidum. Transactions of the Royal Society of Tropical Medicine and
Hygiene, 60 (6): 735–752. http://doi.org/10.1016/0035-9203(66)90223-9.
57
University of Ghana http://ugspace.ug.edu.gh
Donelson, J. E., Duke, B. O., Moser, D., Zeng, W. L., Erondu, N. E., Lucius, R., … Flores, G.
Z. (1988). Construction of Onchocerca volvulus cDNA libraries and partial
characterization of the cDNA for a major antigen. Molecular and Biochemical
Parasitology, 31 (3): 241–50. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/2464764.
Duke, B. O. (1993). The population dynamics of Onchocerca volvulus in the human host.
Tropical Medicine and Parasitology : Official Organ of Deutsche Tropenmedizinische
Gesellschaft and of Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 44 (2):
61–8. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8367667.
Duke, B. O. (1981). Geographical aspects of onchocerciasis. Annales de La Societe Belge de
Medecine Tropicale, 61 (2): 179–86. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/7283491.
Duke, B. O. L. (1976). Strains of Onchocerca volvulus and their pathogenicity. Tropical
Medicine and Parasitology, 27, 21-22.
Duke, B. O., & Anderson, J. (1972). A comparison of the lesions produced in the cornea of the
rabbit eye by microfilariae of the forest and Sudan-savanna strains of Onchocerca volvulus
from Cameroon. I. The clinical picture. Zeitschrift Fur Tropenmedizin Und Parasitologie,
23 (4): 354–68.
58
University of Ghana http://ugspace.ug.edu.gh
Duke, B. O. L. (1966). Onchocerca-Simulium complexes. Annals of Tropical Medicine &
Parasitology, 60 (4): 495–500. http://doi.org/10.1080/00034983.1966.11686442.
Duke, B. O., Lewis, D. J., & Moore, P. J. (1966). Onchocerca-Simulium complexes. I.
Transmission of forest and Sudan-savanna strains of Onchocerca volvulus, from
Cameroon, by Simulium damnosum from various West African bioclimatic zones. Annals
of Tropical Medicine and Parasitology, 60 (3): 318–26.
Eberhard, M. L., Ortega, Y., Dial, S., Schiller, C. A., Sears, A. W., & Greiner, E. (2000). Ocular
Onchocerca infections in two dogs in western United States. Veterinary Parasitology, 90
(4): 333–8. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10856819.
Egyed, Z., Sréter, T., Széll, Z., Nyiro, G., Márialigeti, K., & Varga, I. (2002). Molecular
phylogenetic analysis of Onchocerca lupi and its Wolbachia endosymbiont. Veterinary
Parasitology, 108 (2): 153–61. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/12208043.
Erttmann, K. D., Meredith, S. E., Greene, B. M., & Unnasch, T. R. (1990). Isolation and
characterization of form specific DNA sequences of O. volvulus. Acta Leidensia, 59 (1–2):
253–60. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2378208.
Erttmann, K. D., Unnasch, T. R., Greene, B. M., Albiez, E. J., Boateng, J., Denke, A. M., …
Williams, P. N. (1987). A DNA sequence specific for forest form Onchocerca volvulus.
Nature, 327 (6121): 415–417. http://doi.org/10.1038/327415a0. 59
University of Ghana http://ugspace.ug.edu.gh
Fischer, K., Beatty, W. L., Jiang, D., Weil, G. J., & Fischer, P. U. (2011). Tissue and stage-
specific distribution of Wolbachia in Brugia malayi. PLoS Neglected Tropical Diseases, 5
(5). http://doi.org/10.1371/journal.pntd.0001174.
Fischer, P., Bamuhiiga, J., Kilian, a H. D., & Buttner, C. W. (1996). Strain differentiation of
Onchocerca volvulus from Uganda using DNA probes. Parasitology, 112: 401–408.
Retrieved from isi:A1996UF33300006.
Forgione, M. A. Jr. (2002). Introduction to clinical differentials of Onchocerciasis.
Excerpt from Medicine.com, Inc (abstracts).
Garner, A., Duke, B. O., & Anderson, J. (1973). A comparison of the lesions produced in the
cornea of the rabbit eye by microfilariae of the forest and Sudan-savanna strains of
Onchocerca volvulus from Cameroon. II. The pathology. Zeitschrift Fur Tropenmedizin
Und Parasitologie, 24 (4): 385–96.
Ghana Health Service (2015). Ghana Health Service 2014 Annual Report, (July).
GHS (2012). Ghana Neglected Tropical Diseases Programme Master Plan; Five year strategic
plan, 2013-2017.
GSS (2014). The District Analytical Report, Nkwanta North District: 2010 Population and
Housing Census Report. 60
University of Ghana http://ugspace.ug.edu.gh
Gillette-Ferguson, I., Hise, A. G., Sun, Y., Diaconu, E., McGarry, H. F., Taylor, M. J., &
Pearlman, E. (2006). Wolbachia- and Onchocerca volvulus-Induced Keratitis (River
Blindness) Is Dependent on Myeloid Differentiation Factor 88. Infection and Immunity, 74
(4): 2442–2445. http://doi.org/10.1128/IAI.74.4.2442-2445.2006.
Greene, B. M., Fanning, M. M., & Ellner, J. J. (1983). Non-specific suppression of antigen-
induced lymphocyte blastogenesis in Onchocerca volvulus infection in man. Clinical and
Experimental Immunology, 52 (2): 259–65. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/6861374.
Hailu, A., Balcha, F., Birrie, H., Berhe, N., Aga, A., Mengistu, G., … Gemetchu, T. (2002).
Prevalence of onchocercal skin disease and infection among workers of coffee plantation
farms in Teppi, southwestern Ethiopia. Ethiopian Medical Journal, 40 (3): 259–69.
Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12602250.
Hall, L. R., & Pearlman, E. (1999). Pathogenesis of onchocercal keratitis (River blindness).
Clinical Microbiology Reviews, 12 (3): 445–53. Retrieved from
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=100248&tool=pmcentrez&rend
ertype=abstract.
61
University of Ghana http://ugspace.ug.edu.gh
Higazi, T. B., Filiano, A., Katholi, C. R., Dadzie, Y., Remme, J. H., & Unnasch, T. R. (2005).
Wolbachia endosymbiont levels in severe and mild strains of Onchocerca volvulus.
Molecular and Biochemical Parasitology, 141 (1): 109–112.
http://doi.org/10.1016/j.molbiopara.2005.02.006.
Higazi, T. B., Katholi, C. R., Mahmoud, B. M., Baraka, O. Z., Mukhtar, M. M., Qubati, Y. Al,
& Unnasch, T. R. (2001). Onchocerca volvulus: Genetic Diversity of Parasite Isolates from
Sudan. Experimental Parasitology, 97 (1): 24–34. http://doi.org/10.1006/expr.2000.4589.
Hoerauf, A., Satoguina, J., Saeftel, M., & Specht, S. (2005). Immunomodulation by filarial
nematodes. Parasite Immunology, 27 (10–11), 417–429. http://doi.org/10.1111/j.1365-
3024.2005.00792.x.
Hoerauf, A., Büttner, D. W., Adjei, O., & Pearlman, E. (2003). Onchocerciasis. BMJ (Clinical
Research Ed.), 326 (7382): 207–10. Retrieved from
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1125065&tool=pmcentrez&ren
dertype=abstract.
Hopkins, A. D. (2005). Ivermectin and onchocerciasis: is it all solved? Eye, 19 (10): 1057–
1066. http://doi.org/10.1038/sj.eye.6701962.
Kale, O. O. (1998). Onchocerciasis: the burden of disease. Annals of Tropical Medicine and
Parasitology, 92 Suppl 1: S101-15. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/9861275. 62
University of Ghana http://ugspace.ug.edu.gh
Kamalu, N. A., & Uwakwe, F. E. (2014). Evaluation of different Onchocerciass manifestation
by age and gender among residents in selected endemic villages in Okigwe Local
Government Area of Imo State , Nigeria, 20: 139–150.
http://doi.org/10.18052/www.scipress.com/ILNS.20.139.
Keddie, E. M., Higazi, T., & Unnasch, T. R. (1998). The mitochondrial genome of Onchocerca
volvulus: sequence, structure and phylogenetic analysis. Molecular and Biochemical
Parasitology, 95 (1): 111–127. http://doi.org/10.1016/S0166-6851(98)00102-9
Kron, M. A., & Ali, M. H. (1993). Characterization of a variant tandem repeat from Sudanese
Onchocerca volvulus. Tropical Medicine and Parasitology : Official Organ of Deutsche
Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische
Zusammenarbeit (GTZ), 44 (2): 113–5.
Lagatie, O., Merino, M., Batsa Debrah, L., Debrah, A. Y., & Stuyver, L. J. (2016). An
isothermal DNA amplification method for detection of Onchocerca volvulus infection in
skin biopsies. Parasites & Vectors, 9 (1): 624. http://doi.org/10.1186/s13071-016-1913-7.
Levine R: Millions Saved.In Controlling onchcocerciais in Sub-Saharan-Africa. Edited by
Danvers R Levine. Burlinton: Jones and Bartlett; 2007.
63
University of Ghana http://ugspace.ug.edu.gh
Little, M., Breitling, L., Basáñez, M.-G., Alley, E., & Boatin, B. (2004). Association between
microfilarial load and excess mortality in onchocerciasis: an epidemiological study. The
Lancet, 363 (9420): 1514–1521. http://doi.org/10.1016/S0140-6736(04)16151-5.
Lloyd, M. M., Gilbert, R., Taha, N. T., Weil, G. J., Meite, A., Kouakou, I. M. M., & Fischer, P.
U. (2015). Conventional parasitology and DNA-based diagnostic methods for
onchocerciasis elimination programmes. Acta Tropica, 146: 114–118.
http://doi.org/10.1016/j.actatropica.2015.03.019.
Lustigman, S., & McCarter, J. P. (2007). Ivermectin Resistance in Onchocerca volvulus:
Toward a Genetic Basis. PLoS Neglected Tropical Diseases, 1 (1), e76.
http://doi.org/10.1371/journal.pntd.0000076.
Mackenzie, C. D. (2007). Efficacy of ivermectin against Onchocerca volvulus in Ghana. The
Lancet, 370 (9593): 1123. http://doi.org/10.1016/S0140-6736(07)61502-5.
Marin, B., Boussinesq, M., Druet-Cabanac, M., Kamgno, J., Bouteille, B., & Preux, P.-M.
(2006). Onchocerciasis-related epilepsy? Prospects at a time of uncertainty. Trends in
Parasitology, 22 (1): 17–20. http://doi.org/10.1016/j.pt.2005.11.006.
McKechnie, N. M., Gürr, W., & Braun, G. (1997). Immunization with the cross-reactive
antigens Ov39 from Onchocerca volvulus and hr44 from human retinal tissue induces
ocular pathology and activates retinal microglia. The Journal of Infectious Diseases, 176
(5): 1334–43. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9359736. 64
University of Ghana http://ugspace.ug.edu.gh
Meredith, S. E. O., Lando, G., Gbakima, A. A., Zimmerman, P. A., & Unnasch, T. R. (1991).
Onchocerca volvulus: Application of the polymerase chain reaction to identification and
strain differentiation of the parasite. Experimental Parasitology, 73 (3), 335–344.
http://doi.org/10.1016/0014-4894(91)90105-6.
Meredith, S. E. O., Unnasch, T. R., Karam, M., Piessens, W. F., & Wirth, D. F. (1989). Cloning
and characterization of an Onchocerca volvulus specific DNA sequence. Molecular and
Biochemical Parasitology, 36 (1): 1–10. http://doi.org/10.1016/0166-6851(89)90194-1.
Michael, E., Bundy, D. A., & Grenfell, B. T. (1996). Re-assessing the global prevalence and
distribution of lymphatic filariasis. Parasitology, 112 (4): 409–28. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/8935952.
Molyneux, D. H. & Davies, J. B.et al. (1995). Onchocerciasis control in West Africa: Current
status and future of the onchocerciasis control programme. Parasitology Today, 11 (11),
399–402. http://doi.org/10.1016/0169-4758(95)80016-6.
Murdoch, M.E. (2012). Onchocerciasis up to date
http//www.uptodate.com/contents/onchocerciasis. Retrieved on 25/05/2017
65
University of Ghana http://ugspace.ug.edu.gh
Murdoch, M. E., Asuzu, M. C., Hagan, M., Makunde, W. H., Ngoumou, P., Ogbuagu, K. F., …
Remme, J. (2002). Onchocerciasis: the clinical and epidemiological burden of skin disease
in Africa. Annals of Tropical Medicine & Parasitology, 96 (3): 283–296.
http://doi.org/10.1179/000349802125000826.
Murdoch, M. E., Hay, R. J., Mackenzie, C. D., Williams, J. F., Ghalib, H. W., Cousens, S., …
Jones, B. R. (1993). A clinical classification and grading system of the cutaneous changes
in onchocerciasis. The British Journal of Dermatology, 129 (3): 260–9. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/8286222.
Nmorsi, O. P. G., Oladokun, I. A. A., Egwunyenga, O. A., & Oseha, E. (2002). Eye Lesions
And Onchocerciasis In A Rural Farm Settlement In Delta State , Nigeria. Southeast Asian
Journal Of Tropical Medicine And Public Health 33 (1).
Notomi, T., Mori, Y., Tomita, N., & Kanda, H. (2015). Loop-mediated isothermal amplification
(LAMP): principle, features, and future prospects. Journal of Microbiology, 53 (1): 1–5.
http://doi.org/10.1007/s12275-015-4656-9.
Nwoke, B.E.B. (1992). Ivermectin, the incredible Drug against Human Onchocerciasis.
Medicare Journal; 5: 1 -2.
Ogunrinade, A., Boakye, D., Merriweather, A., & Unnasch, T. R. (1999). Distribution of the
Blinding and Nonblinding strains of Onchocerca volvulus in Nigeria. The Journal of
Infectious Diseases, 179: 1577–1579. http://doi.org/JID981504 [pii]. 66
University of Ghana http://ugspace.ug.edu.gh
Okoro, N., Nwali, U. N., Nnamdi, O. A., & Innocent, O. C. (2014). The Prevalence and
Distribution of Human Onchocerciasis in Two Senatorial Districts in Ebonyi, 2 (2): 39–44.
http://doi.org/10.12691/ajidm-2-2-3.
Okulicz, J. F., Stibich, A. S., Elston, D. M., & Schwartz, R. A. (2004). Cutaneous
onchocercoma. International Journal of Dermatology, 43 (3): 170–172.
http://doi.org/10.1111/j.1365-4632.2004.02279.x.
Osei-Atweneboana, M. Y., Awadzi, K., Attah, S. K., Boakye, D. a., Gyapong, J. O., & Prichard,
R. K. (2011). Phenotypic Evidence of Emerging Ivermectin Resistance in Onchocerca
volvulus. PLoS Neglected Tropical Diseases, 5 (3), e998.
http://doi.org/10.1371/journal.pntd.0000998.
Oyibo, W. A., Fagbenro-Beyioku, F. A., Merriweather, A. and Unnasch, T. R. (2002).
Molecular characterization of Onchocerca volvulus in a middlebelt state of Nigeria.
African journal of Science and Technology, Science and Engineering Series, volume 3 (1),
22-24.
Pearlman, E., & Hall, L. R. (2000). Immune mechanisms in Onchocerca volvulus-mediated
corneal disease (river blindness). Parasite Immunology, 22 (12): 625–31.
http://doi.org/pim345 [pii].
67
University of Ghana http://ugspace.ug.edu.gh
Pion, S. D. S., Kaiser, C., Boutros-Toni, F., Cournil, A., Taylor, M. M., Meredith, S. E. O., …
Boussinesq, M. (2009). Epilepsy in Onchocerciasis Endemic Areas: Systematic Review
and Meta-analysis of Population-Based Surveys. PLoS Neglected Tropical Diseases, 3 (6):
e461. http://doi.org/10.1371/journal.pntd.0000461.
Post, R. (2005). The chromosomes of the Filariae. Filaria Journal, 4 (1): 10.
http://doi.org/10.1186/1475-2883-4-10.
Ranganathan, B. (2012). Onchocerciasis - An Overview, 8: 5–9.
Remme, J. H. F. (2004). Research for control: the onchocerciasis experience. Tropical Medicine
& International Health : TM & IH, 9 (2): 243–54. http://doi.org/10.1046/j.1365-
3156.2003.01192.x.
Remme, J., Dadzie, K. Y., Rolland, A., & Thylefors, B. (1989). Ocular onchocerciasis and
intensity of infection in the community. I. West African savanna. Tropical Medicine and
Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of
Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 40 (3): 340–7. Retrieved
from http://www.ncbi.nlm.nih.gov/pubmed/2617045.
Rolland, A. and Balay, G. (1986). L'Onchocercose dans Ie foyer Bissa. O.C.C.G.E. Centre
Muraz. Technical Report no.lll/ONCHO. Unpublished mimeographed document,
translation in English by OCP, Ouagadougou.
68
University of Ghana http://ugspace.ug.edu.gh
Schulz-Key, H. (1990). Observations on the reproductive biology of Onchocerca volvulus. Acta
Leidensia, 59 (1–2), 27–44. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/2378210.
Semba, R. D., Murphy, R. P., Newland, H. S., Awadzi, K., Greene, B. M., & Taylor, H. R.
(1990). Longitudinal study of lesions of the posterior segment in onchocerciasis.
Ophthalmology, 97 (10): 1334–41. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/2243684.
Sullivan, L. (2016). Power and sample size determination. Boston University School of Public
Health. Last modified in 2016 by Wayne W. LaMorte.
Takaoka, H., Tada, I., Hashiguchi, Y., Baba, M., Korenaga, M., Ochoa A., J., … Yarzabal, L.
(1986). A cross-compatibility study of Guatemalan and north Venezuelan Onchocerca
volvulus to Simulium metallicum from two countries. Japanese Journal of Parasitology,
351: 35–41.
Tamarozzi, F., Halliday, a., Gentil, K., Hoerauf, a., Pearlman, E., & Taylor, M. J. (2011).
Onchocerciasis: the Role of Wolbachia Bacterial Endosymbionts in Parasite Biology,
Disease Pathogenesis, and Treatment. Clinical Microbiology Reviews, 24 (3): 459–468.
http://doi.org/10.1128/CMR.00057-10.
69
University of Ghana http://ugspace.ug.edu.gh
Taylor, M. J., Awadzi, K., Basáñez, M.-G., Biritwum, N., Boakye, D., Boatin, B., … Adjei, O.
(2009). Onchocerciasis Control: Vision for the Future from a Ghanian perspective.
Parasites & Vectors, 2 (1): 7. http://doi.org/10.1186/1756-3305-2-7.
Taylor, H. R., Keyvan-Larijani, E., Newland, H. S., White, A. T., & Greene, B. M. (1987).
Sensitivity of skin snips in the diagnosis of onchocerciasis. Tropical Medicine and
Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of
Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ), 38 (2): 145–7.
Thylefors, B., Négrel, A. D., Pararajasegaram, R., & Dadzie, K. Y. (1995). Global data on
blindness. Bulletin of the World Health Organization, 73 (1): 115–21. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/7704921.
Toè, L., Adjami, A. G., Boatin, B. A., Back, C., Alley, E. S., Dembélé, N., … Unnasch, T. R.
(2000). Topical application of diethylcarbamazineto detect onchocerciasis recrudescence in
West Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene, 94 (5):
519–525. http://doi.org/10.1016/S0035-9203(00)90073-7.
Turner, H. C., Churcher, T. S., Walker, M., Osei-Atweneboana, M. Y., Prichard, R. K., &
Basanez, M. G. (2013). Uncertainty Surrounding Projections of the Long-Term Impact of
Ivermectin Treatment on Human Onchocerciasis. PLoS Neglected Tropical Diseases, 7 (4).
http://doi.org/10.1371/journal.pntd.0002169.
70
University of Ghana http://ugspace.ug.edu.gh
Udall, D. N. (2007). Recent Updates on Onchocerciasis: Diagnosis and Treatment. Clinical
Infectious Diseases, 44 (1): 53–60. http://doi.org/10.1086/509325.
Unnasch, T. R., & Williams, S. A. (2000). The genomes of Onchocerca volvulus. International
Journal for Parasitology, 30 (4): 543–552. http://doi.org/10.1016/S0020-7519(99)00184-8.
Uttah, E.C. (2010). Onchocerciasis in the Upper Imo River Basin, Nigeria: Prevalence and
comparative study of waist and shoulder snips from mesoendemic communities. Iranian
Journal of Parasitology, 5 (2), 33-41.
Wagbatsoma, V. A., & Okojie, O. H. (2004). Psychosocial effects of river blindness in a rural
community in Nigeria. The Journal of the Royal Society for the Promotion of Health, 124
(3): 134–6. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/15195454.
Webster, J. P., Molyneux, D. H., Hotez, P. J., & Fenwick, A. (2014). The contribution of mass
drug administration to global health: past, present and future. Philosophical Transactions
of the Royal Society B: Biological Sciences, 369 (1645): 20130434–20130434.
http://doi.org/10.1098/rstb.2013.0434.
Weil, G. J., Steel, C., Liftis, F., Li, B., Mearns, G., Lobos, E., & Nutman, T. B. (2000). A
Rapid‐Format Antibody Card Test for Diagnosis of Onchocerciasis. The Journal of
Infectious Diseases, 182 (6): 1796–1799. http://doi.org/10.1086/317629.
71
University of Ghana http://ugspace.ug.edu.gh
Wilson, M. D., Cheke, R. A., Flasse, S. P. J., Grist, S., Osei-Ateweneboana, M. Y., Tetteh-
Kumah, A., … Post, R. J. (2002). Deforestation and the spatio-temporal distribution of
savannah and forest members of the Simulium damnosum complex in southern Ghana and
south-western Togo. Transactions of the Royal Society of Tropical Medicine and Hygiene,
96(6), 632–639. http://doi.org/10.1016/S0035-9203(02)90335-4.
Winthrop, K. L., Furtado, J. M., Silva, J. C., Resnikoff, S., & Lansingh, V. C. (2011). River
blindness: an old disease on the brink of elimination and control. Journal of Global
Infectious Diseases, 3(2), 151–5. http://doi.org/10.4103/0974-777X.81692.
Wogu, M. D., & Okaka, C. E. (2008). Prevalence and socio-economic effects of onchocerciasis
in Okpuje , Owan West Local Government Area , Edo State , 4 (3).
World Health Organisation (2017). Onchocerciasis. Retrieved from
http:www.who.int/mediacentre/factsheets/fs374/en/.
World Health Organisation. (2016, 9th April). Onchoverciasis-the disease and its impact. Retrieved
from http://www.who.int/apoc/onchocerciasis/disease/en/.
World Health Organisation. (2011). APOC magazine, Geneva. available at
http://www.who.int/entity/apoc/magazine_final_du_01_juillet_2011.pdf.
WHO. (2010). WHO | Status of onchocerciasis in APOC countries. WHO. Retrieved from
http://www.who.int/apoc/onchocerciasis/status/en/. 72
University of Ghana http://ugspace.ug.edu.gh
World Health Organisation. (2008). Status of Onchocerciasis in African Programme for
Onchocerciasis Control (APOC) Countries, TDR/AFR/RP/951.6, Geneva.
World Health Organization. (2005). State of the world's sight: vision 2020: the Right to Sight:
1999-2005.
World Health Organisation. (2003). The prevention of blindness, World
Health Organisation Technical Report, No. 518.
World Health Organisation. (2001). Onchocerciasis (river blindness). Report from the Tenth
InterAmerican Conference on Onchocerciasis, Guayaquil, Ecuador. Weekly Epidemiology
Recommendations, 76, 205-212.
World Health Organisation. (1995) Expert Committee on Onchocerciasis. Third Report. Technical
Report Series 752. World Health Organisation. Geneva. Switzerland.
World Health Organisation (1995): Onchocerciasis and its Control. In: WHO technical report
series. No. 852.Geneva.
World Health Organisation. (1987). WHO Expert Committee on Onchocerciasis. Third Report.
Technical Report Series 752. Geneva. Switzerland.
73
University of Ghana http://ugspace.ug.edu.gh
Zeng, W. L., Alarcon, C. M., & Donelson, J. E. (1990). Many transcribed regions of the
Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis
elegans. Molecular and Cellular Biology, 10 (6), 2765–73.
http://doi.org/10.1128/MCB.10.6.2765.
Zimmerman, P. A., Toe, L., & Unnasch, T. R. (1993). Design of Onchocerca DNA probes
based upon analysis of a repeated sequence family. Molecular and Biochemical
Parasitology, 58 (2), 259–67. Retrieved from
http://www.ncbi.nlm.nih.gov/pubmed/8479450.
Zimmerman, P. A., Dadzie, K. Y., De Sole, G., Remme, J., Alley, E. S., & Unnasch, T. R.
(1992). Onchocerca volvulus DNA probe classification correlates with epidemiologic
patterns of blindness. The Journal of Infectious Diseases, 165 (5), 964–8.
74
University of Ghana http://ugspace.ug.edu.gh
APPENDICES
APPENDIX 1
PARTICIPANT INFORMATION FORM
Note: To be read or translated to the study subjects in a language they understand.
Dear Participant,
Your permission is kindly being sought to take part in a research study to determine the strain of
Onchocerca volvulus prevalent in your area. This study is being conducted by Rowland
Adukpo, an MPhil candidate from the School of Biomedical and Allied Health Sciences
(SBAHS). I am asking you to take part because you live in this area and so could have been infected by the parasite.
What the study is about: There is evidence that, at least, two strains of Onchocerca volvulus, the parasite which causes onchocerciasis exist in West Africa and are transmitted by different types of blackflies. They are also different in the severity of disease they cause. The savannah strain found in West Africa is associated with blindness in large proportions of individuals it infects but the forest strains on the other hand, have been found to be less likely to cause ocular disease, even in individuals with high parasite load. Reports from field officers working on onchocerciasis research project in the North Nkwanta district suggested that judging from the morphological features the microfilariae type present are most probably of the savannah type.
However, the preponderance of the ocular manifestations that are usually associated with
75
University of Ghana http://ugspace.ug.edu.gh
infection with savannah strains is absent. The purpose of this study is to characterize the strain type of O. volvulus prevalent in Kpassa and its environs.
What we will ask you to do: If you agree to be in this study, we will ask you a few questions and then take skin snips from your buttocks. The skin snips will be examined for the presence of microfilariae. Further investigations will be conducted on the microfilariae.
Risks and benefits: The risk associated with the skin snipping includes small cut, pain, discomfort and possible infection. The laboratory scientists and clinicians will take care of any such complications. Results of the tests will be communicated to health authorities in the district for appropriate action.
Voluntary participation and confidentiality: Taking part in this study is completely voluntary. You are free to withdraw at any time from the study. The information you give us will be used only for the study and not in any way that will harm you. The records of this study will be kept private. In any sort of report we make public we will not include any information that will make it possible to identify you. Research records will be kept in a locked file; only the researchers will have access to the records.
Contact: If you have any questions concerning the study you may contact Dr. Simon K. Attah at [email protected] or at 0277 520813 or Rowland Adukpo at [email protected] or at
0243 485320.
You will be given a copy of this form to keep for your records. 76
University of Ghana http://ugspace.ug.edu.gh
APPENDIX 2
INFORMED CONSENT FORM
I…………………………………………………………of………………………………………. hereby certify that the contents of the above information has been read by me/ interpreted to me in the………………………language by…………………………………………………………..
I have perfectly understood the same, and thereby appended my signature/mark (Right thumbprint) to this consent form as an evidence of my agreement to participate in this project. I will be given a copy of this consent form after it is completed and signed.
Signature or thumb print of Participant/Guardian ______
Date ______
Your Name ______
Signature of person obtaining consent ______Date ______
Printed name of person obtaining consent ______Date ______
77
University of Ghana http://ugspace.ug.edu.gh
APPENDIX 3
ETHICAL CLEARANCE
78
University of Ghana http://ugspace.ug.edu.gh
APPENDIX 4
QUESTIONNAIRE
Study Number______Date______
Section A: Personal Data
Date of Birth ______
Gender: [ ] M [ ] F
Level of education attained
No formal Education [ ]
Primary [ ]
Secondary [ ]
Tertiary [ ]
Other (specify) [ ]
Occupation
Farmer (Crop or animal) [ ]
Fisherman [ ]
79
University of Ghana http://ugspace.ug.edu.gh
Hunter [ ]
Trader [ ]
Public/Civil servant [ ]
Other (Student/pupils) [ ]
For how long have you been living in this community?
Have you ever received treatment for onchocerciasis? Yes/No
If yes, when was the last time?
Section B: Assessment of clinical signs and symptoms of onchocerciasis
Does the subject have? Please tick as appropriate
YES NO
Nodule(s) [ ] [ ]
Rashes/Itching [ ] [ ]
Leopard skin [ ] [ ]
Lizard skin [ ] [ ]
Ocular lesion/visual impairment [ ] [ ]
Blindness [ ] [ ]
Other (specify)
80