Chemokine Receptors in Podocytes Expression of Functional CCR And

The Journal of Immunology

Expression of Functional CCR and CXCR Chemokine Receptors in Podocytes1

Tobias Bruno Huber,2* Hans Christian Reinhardt,2* Markus Exner,† Jan Andreas Burger,* Dontscho Kerjaschki,‡ Moin A. Saleem,§ and Hermann Pavensta¨dt3*

Chemokines and their receptors play an important role in the pathogenesis of acute and chronic glomerular inﬂammation. However, their expression pattern and function in glomerular podocytes, the primary target cells in a variety of glomerulopathies, have not been investigated as of yet. Using RT-PCR, we now demonstrate the expression of CCR4, CCR8, CCR9, CCR10, CXCR1, CXCR3, CXCR4, and CXCR5 in cultured human podocytes. Stimulation of these receptors induced a concentration-dependent biphasic increase of the free cytosolic calcium concentration in podocytes in culture. In addition, we demonstrate that podocytes release IL-8 in the presence of FCS and that IL-8 down-regulates cell surface CXCR1. Chemokine stimulation of the detected CCRs and CXCRs increased activity of NADPH-oxidase, the primary source of superoxide anions in podocytes. Immunohisto- chemistry studies revealed only diffuse and weak CXCR expression in healthy human glomerula. In contrast, in membranous nephropathy, a characteristic podocyte disorder, the expression of CXCR1, CXCR3, and CXCR5 is up-regulated in podocytes. In conclusion, podocytes in culture and podocytes in human kidney sections express a set of chemokine receptors. The release of oxygen radicals that accompanies the activation of CCRs and CXCRs may contribute to podocyte injury and the development of proteinuria during membranous nephropathy. The Journal of Immunology, 2002, 168: 6244–6252.

he podocyte is a highly specialized cell which constitutes (3). During puromycin aminonucleoside nephrosis, an experimen- a crucial component of the glomerular filtration barrier. tal model for minimal change nephropathy, an increase of IFN- T Podocyte damage leads to the retraction of their foot pro- inducible protein (IP-10), monocyte chemoattractant protein cesses, resulting in proteinuria. Especially in diabetic nephropathy, (MCP) 1, MCP-3, and T cell activation gene 3 mRNA expression minimal change nephropathy, membranous nephropathy (MGN) ,4 has been reported (4Ð6). and focal segmental glomerulosclerosis, podocytes are the primary Chemokines are a group of small peptides that are subdivided target of injury (1). The precise mechanisms that lead to podocyte into four families, comprising Ͼ50 ligands with at least 17 differ- damage and proteinuria in glomerular diseases are only roughly ent receptors. These chemokine families are defined by the pres- understood. It has been suggested that presently unknown circu- ence of either a C, a CC, a CXC, or a CЈC residue at the amino lating mediators might affect podocyte functions and cause the terminus of the protein. The largest of these subfamilies is the retraction of foot processes and, thus, proteinuria in minimal CXC chemokines, in which two amino-terminal cysteines are sep- change nephropathy and focal segmental glomerulosclerosis (2). In arated by a nonconserved amino acid, and the CC chemokines, in those glomerular diseases that involve podocyte injury, it has been which two amino-terminal cysteines are juxtaposed (7). Within the suggested that cytokines mediate the inflammatory processes that glomerulum, chemokines and their receptors are expressed in in- ultimately result in proteinuria. For example, in Heymann nephri- filtrating cells as well as in resident glomerular cells. Glomerular- tis, an experimental rat model for MGN, depletion of CD8 cyto- produced chemokines seem not only to induce recruitment of in- toxic T cells prevents proteinuria, indicating that cytokines se- flammatory cells, but can also alter functions of resident creted by CD8 cytotoxic cells may be involved in podocyte injury glomerular cells, such as the formation of extracellular matrix (8). Therefore, chemokines may play an important role in the events leading to podocyte injury and proteinuria. In this study, we in- *Department of Medicine, Division of Nephrology, University of Freiburg, Freiburg, vestigated the expression and function of chemokine receptors in Germany; †Department of Laboratory Medicine and ‡Institute for Clinical Pathology, University of Vienna, Vienna, Austria; and ¤Academic Renal Unit, Medical School cultured podocytes and in human kidney sections. Building, Southmead Hospital, Bristol, United Kingdom Received for publication February 2, 2002. Accepted for publication April 19, 2002. Materials and Methods Cell culture The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance Human podocytes were isolated from normal human kidney sections ob- with 18 U.S.C. Section 1734 solely to indicate this fact. tained from renal carcinoma patients undergoing nephrectomy. Primary 1 This work was supported by the Else-Kro¬ner Fresenius Stiftung and Fonds zur cultures of podocytes were established as follows: Intact tissue was passed fo`rderung der Wissenschuftlichen Forschung, SFB 07, Project 07 (to D.K). through steel sieves with decreasing pore sizes of 450 and 180 ␮m. Glo- 2 T.B.H. and H.C.R. contributed equally to this manuscript. merula were collected using a third sieve with a pore size of 120 ␮m and counted under a light microscope (ϫ400). Encapsulated glomerula were 3 Address correspondence and reprint requests to Dr. Hermann Pavensta¬dt, Medi- zinische Universita¬tsklinik Freiburg, Abteilung IV, Labor C4, Hugstetter Strasse 55, absent upon visual inspection. Glomerula were suspended in DMEM con- D-79106 Freiburg, Germany. E-mail address: [email protected] taining 10% heat-inactivated FCS, 2.5 mM glutamine , 0.1 mM sodium 4 pyruvate, 5 mM HEPES buffer, 1 mg/ml streptomycin, 100 U/ml penicillin, Abbreviations used in this paper: MGN, membranous nephropathy; IP-10, IFN- 0.1ϫ nonessential amino acids (100ϫ; all Seromed, Berlin, Germany), inducible protein; MCP, monocyte chemoattractant protein; WT1, Wilm’s tumor Ag; 2ϩ ␥ ␣ insulin, transferrin, anda5mMsodium selenite supplement and then [Ca ]i, intracellular calcium; MIG, monokine induced by IFN- ; SDF-1 , stromal 2 cell-derived factor 1␣; BCA-1, B cell-attracting chemokine 1; MDC, macrophage- plated at a concentration of 100 glomerula/cm onto collagen-coated petri derived chemokine; TECK, thymus-expressed chemokine; CCL28, C chemokine li- dishes (Greiner, Nu¬rtingen, Germany). Glomerula were incubated at 37¡C gand 28; HCC, hemofiltrate CC chemokine. and 5% CO2 in air. After 4 days, cell colonies began to sprout around the

ϩ glomerula. Cell colonies were excised and incubated in a tube containing Measurements of the free cytosolic intracellular Ca2 5 ml 0.2% collagenase IV (Sigma-Aldrich, Deisenhofen, Germany) at 2ϩ concentration ([Ca ]i) 37¡C for 30 min and were then washed and plated in 25-cm2 culture flasks. ϩ Cells showed an epithelial morphology with a polyhedral shape when Measurements of cytosolic calcium with the Ca2 -sensitive dye fura 2 confluency was reached and were immunohistologically characterized as (Sigma-Aldrich) were performed in podocytes on an inverted fluorescence podocytes. They stained positive for Wilm’s tumor Ag (WT1) and ex- microscope setup (13). The system allows fluorescence measurements at pressed nephrin, markers which are only found in podocytes in the adult the single-cell level at three excitation wavelengths. The field of measure- kidney. Moreover, cells were negative for factor 8 related Ag, a marker for ment can be set between a diameter of 2 and 300 ␮m with an adjustable endothelial cells. Cells between passages 15 and 23 were seeded at 37¡C pinhole. A time resolution of up to 200 Hz was achieved by using a high- onto collagen A (Biochrom, Berlin, Germany)-coated plates and cultured speed filter wheel and a single photon counting tube (Hamamatsu H63460- in standard RPMI 1640 medium containing 10% FCS, 100 U/ml penicillin, 04; Hamamatsu, Herrsching, Germany). The autofluorescence signal of and 1 mg/ml streptomycin. In another set of experiments, early passages cells that had not been loaded with fura 2 was measured and subtracted (passage 1 and passage 4) of cultured podocytes were used to confirm the from the results obtained in fura-2-loaded cells. This had no effect on the functional expression of the chemokine receptors in short-term cultured bandwidth of the measurements. A calibration of the fura-2 fluorescence ϩ cells. In addition, a conditionally immortalized human podocyte cell line signal was attempted at the end of each experiment by using Ca2 iono- ␮ 2ϩ 2ϩ demonstrating nephrin and podocin expression was used (9) phore ionomycin (1 M) and low and high Ca buffers. [Ca ]i was Cultures of primary human podocytes were infected with retrovirus- calculated from the fluorescence ratio 340:380 nm according to the equa- containing supernatants from the packaging cell line (PA317). The retro- tion described by Grynkiewicz et al. (14). viral construct consisted of a SV40 large T-Ag gene containing both the tsA58 and the U19 mutations (10). Infection, selection, and continuous Measurement of IL-8 release culture were conducted at 33¡C. A single-cell clone was used for all of the The podocytes were cultured in six-well plates. They were kept at 37¡C for experiments described. 24 h at different FCS concentrations (0, 1, 10%) before supernatants were taken. IL-8 concentrations were measured with an ELISA (R&D Systems, Wiesbaden, Germany) following the manufacturer’s instructions. The pro- Induction of differentiation tein content of each well was measured with the Lowry method (15) and used to normalize the IL-8 release on the protein content per well. Subsequently, cells were grown on type I collagen-coated flasks layered with glass coverslips for the purpose of immunostaining. Cells were then Measurement of NADPH-oxidase activity plated onto the flasks and grown either at the “permissive” temperature of Podocytes were rinsed twice with ice-cold PBS, scraped from the wells, 33¡C (in 5% CO2) to promote cell propagation as a cobblestoned pheno- and resuspended in 2 ml of Krebs buffer. After centrifugation at 750 ϫ g type or at the “nonpermissive” temperature of 37¡C (in 5% CO2) to inac- tivate the SV40 T-Ag and allow the cells to differentiate. for 5 min at 4¡C, the pellet was resuspended in 1.5 ml of fresh Krebs buffer As a positive control for CXCR2 expression, we used human lung mi- (pH 7.35; containing 99 mM NaCl, 4.7 mM KCl, 1.8 mM CaCl2, 1.2 mM crovascular endothelial cells in one series of experiments (11). Cells were MgCl2, 25 mM NaHCO3, 1.03 mM K2HPO4, 20 mM sodium-HEPES, and cultured as previously described (11). 11.1 mM glucose). Cells were centrifuged as above and then resuspended in 0.6 ml of Krebs buffer. The luminescence buffer contained 5 ␮M lu- cigenin and 0.1 mM NADPH as the substrate. Expression of CCR and CXCR mRNA in cultured human To calculate the amount of superoxide produced, total counts were generated by integrating the area under the signal curve. These values were podocytes and human glomerula compared with a standard curve which was generated by using xanthine/ xanthine oxidase as described elsewhere (12). The RNA preparation, the reverse transcription and the PCR amplification 2Ϫ were performed according to the method described recently (12). In brief, Superoxide generation was expressed as nanomoles of O generated per the total RNA from cultured human podocytes or human glomerula was milligram of cellular protein per minute as described earlier (16). Protein con- isolated with guanidinium/acid phenol/chloroform extraction and the tent of the cell suspension was measured with the Lowry method (15). amount of RNA was measured with spectrophotometry. For first-strand Immunhistochemistry of cultured human podocytes synthesis, 2 ␮g of total RNA was mixed in 5ϫ reverse transcription buffer and incubated with5UofDNase I for 15 min. After termination, the The immunolabeling was done as previously described (17). Briefly, cov- reaction was completed with 0.5 mM dNTP, 0.5 ␮M sequence-specific erslips were fixed with 2% paraformaldehyde and 4% sucrose in PBS, for primers, 10 mM DTT, and 200 U of superscript II transcriptase (reverse 10 min, and were then permeabilized with 0.3% Triton X-100 (Sigma- transcriptase was omitted in some experiments to control for the amplifi- Aldrich) in PBS for 10 min. Nonspecific binding sites were blocked with cation of contaminating DNA). The reverse transcription was performed at 4% FCS plus 0.1% Tween 20 (Sigma-Aldrich) in PBS for 30 min. Primary 42¡C for 1 h followed by a denaturation at 95¡C for 5 min. cDNA was and secondary Abs were applied in the appropriate dilutions according to purified from amplification reaction and solved in 30 ␮l of 10 mM Tris- standard techniques, and the coverslips were mounted on glass slides with buffer (pH 8). PCR was performed in duplicates in a total volume of 20 ␮l, 15% Mowiol (Calbiochem, La Jolla, CA) and 50% glycerol in PBS. Fur- each containing 2 ␮l of reverse transcription reaction and 18 ␮lofPCR ther washes and mounting were conducted as above. Images were obtained master mixture containing 10 pmol each of sense and antisense primer and using a Leica photomicroscope attached to a Spot 2 slider digital camera 2.5UofTaq DNA polymerase. The cycle profile included denaturation for (Diagnostic Instruments, Solms, Germany) and processed with Adobe Pho- 30sat94¡C, annealing for 30 s at 60¡C, and extension for 30 s at 72¡C. toShop 5.0 software (Adobe Systems, Unterschleissheim, Germany). In the experiments for the analysis of the mRNA expression of CXCR1, 36 cycles of PCR were performed. In all other experiments, 30 cycles of PCR Immunohistochemistry of kidney cortex were performed. Normal kidney cortex and cortex from two patients with membranous ne- The amplification products of 10 ␮l from each PCR were separated on phropathy were obtained from nephrectomy specimens and snap frozen in a 1.5% agarose gel, stained with ethidium bromide, and visualized by UV liquid N . Cryostat sections (4 ␮m) were prepared and incubated with Abs irradiation. PCR amplification of reverse transcription reactions without 2 to CXCR 1Ð5 (10 ␮g/ml) (R&D Systems) for2hatroom temperature. reverse transcriptase revealed no PCR product, thereby excluding ampli- After being washed with PBS, bound Ab was detected using FITC-conju- fication of genomic DNA. The identity of amplification products was de- gated rabbit anti-mouse IgG (Accurate Chemical and Scientific, Westbury, termined by dideoxy sequencing. The primers used are shown in Table I. NY). As controls, primary Abs were omitted or replaced by irrelevant mouse Abs. Micrographs were taken on a microscope equipped for epilu- minescence (Axiophot; Carl Zeiss, Oberkochen, Germany). Semiquantitative analysis Chemicals The amplification products of 10 ␮l of PCR product were separated on a 1.5% agarose gel, stained with ethidium bromide, visualized with UV ir- The following agents were used: macrophage-derived chemokine (MDC), radiation, and photographed with Polaroid film 667. The photographs were I-309, thymus-expressed chemokine (TECK), hemofiltrate CC chemokine taken to evaluate the band densities by volume integration using a Hewlett (HCC-1), human CC chemokine 28 (CCL28), monokine induced by IFN-␥ Packard IIcx flatbad scanner and computer based imaging software (Image (MIG), stromal cell-derived factor 1␣ (SDF-1␣), B cell-attracting chemo- Quant; Molecular Dynamics, Krefeld, Germany). The data were normal- kine 1 (BCA-1), and IL-8 (all R&D Systems). The following Abs were ized on the GAPDH mRNA expression. used: anti-human CXCR1, anti-human CXCR2, anti-human CXCR3, anti- 6246 CHEMOKINE RECEPTORS AND PODOCYTES human CXCR4, anti-human CXCR5 (all R&D Systems), and FITC-con- In human glomerula, the PCR products of CCR1ÐCCR10 (Fig. jugated goat anti-mouse (Jackson ImmunoResearch Laboratories, West 1A, lower panel) and CXCR1ÐCXCR5 (Fig. 1B, lower panel) Grove, PA); the controls used were mouse IgG1 for monoclonal anti- could be detected. In addition, we studied the mRNA expression of CXCR Abs (Santa Cruz Biotechnology, Santa Cruz, CA) and monoclonal anti-human IL-8 Ab (R&D Systems). CCRs and CXCRs in conditionally immortalized, differentiated human podocytes, which may better mimic podocytes in vivo. Statistics These podocytes showed the same expression pattern of CCRs and The data are given as mean values Ϯ SEM, where n refers to the number CXCRs, namely, the CCR4, CCR8Ð10, and CXCR1, CXCR3, of experiments. The average of the effect of the agonist before and after the CXCR4, and CXCR5 (data not shown). experiment was taken as control. A paired t test was used to compare mean values within each experimental series. A p Յ 0.05 was accepted to indi- CCR ligands increase the free cytosolic calcium concentration ϩ cate statistical significance. [Ca2 ]i [infi] in human cultured podocytes Results Addition of the CCR4 agonist macrophage-derived chemokine (MDC, n ϭ 33), the CCR8 agonist I-309 (n ϭ 33), the CCR9 Human cultured podocytes and human glomerula express mRNA agonists TECK (n ϭ 6) and HCC-1 (n ϭ 2), and the specific for CCR and CXCR subtypes CCR10 agonist human CCL28 (n ϭ 4) (20, 21) to single podocytes 2ϩ By using RT-PCR, we studied the expression of CCR and CXCR loaded with fura-2 resulted in a reversible increase of [Ca ]i. The subtypes in human cultured podocytes and human glomerula with left panel of Fig. 2 shows the typical original fluorescence mea- sequence-specific primers for each different receptor subtype (Ta- surements obtained from single podocytes exposed to MDC (A,10 ble I). Fig. 1A shows ethidium-bromide-stained agarose gel elec- nM), I-309 (B, 100 nM), HCC-1 and TECK (C, 2.5 ␮g/ml and 100 trophoreses of PCR products for CCR4, CCR8, CCR9, and CCR10 nM, respectively), and CCL28 (D,2␮g/ml). The right panel of in cultured human podocytes. Fig. 1B shows ethidium bromide- Fig. 2 gives the concentration response curves (A, B, and D)orthe stained agarose gel electrophoreses of PCR products for CXCR1, summary of the experiments (C and D) for the different CCR CXCR3, CXCR4, and CXCR5 in cultured human podocytes. In agonists. contrast to all other CCRs and CXCRs, which were detectable with CXCR ligands increase the free cytosolic calcium concentration 30 cycles of PCR, CXCR1 could only be constantly detected with 2ϩ 36 cycles of PCR. [Ca ]i in human cultured podocytes Sequence analysis of the resulting amplification products re- The CXCR3 agonist MIG (n ϭ 32), the CXCR4 agonist SDF-1␣ vealed the sequence identity of the fragments. mRNA could not be (n ϭ 32), and the CXCR5 agonist BCA-1(n ϭ 46) induced a re- 2ϩ detected for CCR1Ð3 and CCR5Ð7 and CXCR2 in human podo- versible increase of [Ca ]i in podocytes. In contrast, different 2ϩ ␮ ϭ cytes using 30 or 36 cycles of PCR. concentrations of IL-8 had no effect on [Ca ]i (370 M, n 5; It is known that proinflammatory cytokines such as IL-1␤ can 37 ␮M, n ϭ 3; 3.7 ␮M, n ϭ 2) in podocytes grown in the presence stimulate the expression of chemokine receptors in other cell types of FCS. After the addition of IL-8, SDF-1␣ as a positive control ␤ 2ϩ (18). IL-1 has been shown to activate the transcription factor induced an increase of [Ca ]i in podocytes (Fig. 3A, left panel). ␬ ␤ 2ϩ ␣ NF- B in podocytes (19). In addition, IL-1 expression is up- The [Ca ]i response to MIG, SDF-1 , and BCA-1 was concen- regulated in podocytes in Heymann nephritis. To test whether tration dependent with an EC50 value of 85 nM for MIG, 0.6 nM IL-1␤ might induce mRNA expression for those CCRs and for SDF-1␣, and 10 nM for BCA-1, respectively. The left panel of CXCRs which could not be found by RT-PCR, podocytes were Fig. 3 shows typical original fluorescence measurements obtained treated with Il-1␤ (10 ng/ml) for 6 and 18 h, and mRNA expression from single podocytes exposed to IL-8 (A, 370 ␮M), MIG (B, 100 of CCRs and CXCRs was studied. IL-1␤ did not induce the ex- nM), SDF-1␣ (C, 10 nM), or BCA-1 (D, 100 nM). The right panel pression of either CCR1Ð3 or CCR5Ð7 nor did it induce the ex- of Fig. 3 gives the concentration response curves for the different pression of CXCR2 (n ϭ 3, data not shown). CXCR agonists.

Table I. PCR primers of CCR and CXCR chemokine receptors and the speciﬁc podocyte proteins WT1 and nephrin

Probe Product Length (bp) Sense Primer Sequence Antisense Primer Sequence Accession No.

CCR1 360 GCAGCCTTCACTTTCCTCAC AGGCGTAGATCACTGGGTTG NM001295 CCR2 583 CTCGCTGGTGTTCATCTTTG TCTCACTGCCCTATGCCTCT NM000647 CCR3 315 TGGCGGTGTTTTTCATTTTC CCGGCTCTGCTGTGGAT U28694 CCR4 473 TGCTCTTCGTGTTTTCCCTC CATCTTCACCGCCTTGTTCT NM005508 CCR5 311 CTTCTGGGCTCCCTACAACA CAGATATTTCCTGCTCCCCA U54994 CCR6 355 TAAAAGGCACAAAGCCATCC ATCTGCGGTCTCACTGGT NM004367 CCR7 338 ACATCGGAGACAACACCACA CATGCCACTGAAGAAGCTCA NM001838 CCR8 540 CATCCTGGTCCTTGTGGTCT GGCTTGGTCTTGTTGTGGTT NM005201 CCR9 572 TACTGGCTCGTGTTCATCGT TTGGCTTGTATCAGGGTGTG AJ132337 CCR10 493 GGGTTTCTCCTTCCACTCCT TATTCCCCACATCCTCCTTG U94888 IL-8 135 GTGCAGTTTTGCCAAGGAGT TAATTTCTGTGTTGGCGCAG M28130 MIG 265 TTCCTCTTGGGCATCATCTT TTTGGCTGACCTGTTTCTCC X72755 IP-10 266 CGATTCTGATTTGCTGCCTT CATTTCCTTGCTAACTGCTTTC X02530 SDF-1␣ 132 AGAGATGAAAGGGCAAAGAC CGTATGCTATAAATGCAGGG U19495 BCA-1 204 CAGCCTCTCTCCAGTCCAAG CATTCAGCTTGAGGGTCCC NM006419 CXCR1 423 GCCACCTGCAGATGAAGATT CAGCAGCCAAGACAAACAAA L19591 CXCR2 447 GTGAACCAGAATCCCTGGAA AGACGGTCCTTCGGAAAAGT M73969 CXCR3 379 CCACCCACTGCCAATACAAC CGGAACTTGACCCCTACAAA X95876 CXCR4 367 AATCTTCCTGCCCACCATCT GACGCCAACATAGACCACCT AF052572 CXCR5 340 GGTCTTCATCTTGCCCTTTG ATGCGTTTCTGCTTGGTTCT X68149 WT1 524 CGCCTTCACTGTCCACTTTT TCTGCCCTTCTGTCCATTTC X51630 Nephrin 408 AGGATTACGCCCTCTTCACA GCTGGTCTTCAGGTTCTCCA AF035835 The Journal of Immunology 6247

FIGURE 2. Fluorescence recordings showing the effect of CC chemo- 2ϩ FIGURE 1. Expression of mRNA for CCRs (A) and CXCRs (B)inhu- kines on [Ca ]i in podocytes. Left panel, The original recordings of the 2ϩ man cultured podocytes and human glomerula. Fragments of the different CC chemokines induced an increase of [Ca ]i in human podocytes: CCR4 chemokine receptors were amplified using specific primers (see Table I) agonist MDC (A), CCR8 agonist I-309 (B), CCR9 agonists HCC-1 and and subjected to agarose gel electrophoresis. Lanes on the left side indicate TECK (C), and CCR10 agonist CCL28 (D). Right panel, Concentration base pair length. Note that podocyte bands with the expected sizes are response curves or summary of the effects of the CCR ligands. Numbers of .Statistical significance ,ء .present in the CCR4, 8, 9, and 10 lane and in the CXCR1, CXCR3, observations are shown above the curve CXCR4, and CXCR5 lane, whereas in human glomerula (lower panels), bands of CCR1Ð10 and CXCR1Ð5 are positive. In both human cultured podocytes and human glomerula, the bands for WT1 and nephrin, which (D, F, and G, n ϭ 4), whereas no staining was seen for CXCR1 (B, are only expressed in podocytes, were present. Sequence analysis of the n ϭ 4) and CXCR2 (C, n ϭ 4). As a negative control, we used resulting amplification products revealed the sequence identity of the mouse IgG as the primary Ab in these experiments (Fig. 4A). fragments. Effect of FCS on IL-8 release and expression of CXCR1 in podocytes To test whether early passages of human podocytes express the To prove whether podocytes themselves may release chemokines, same set of functional chemokine receptors, the measurement of the expression of mRNA for IL-8, MIG, IP-10, SDF-1␣, and 2ϩ [Ca ]i was performed on these cells and revealed the same pat- BCA-1 was investigated using RT-PCR. Fig. 5A shows that podo- tern of calcium responses to CXCR ligands (passages 1 and 4: IL-8 cytes grown in the presence of 10% FCS express mRNA for IL-8 ␮ ϭ 2ϩ Ϯ ; ␮ (3.7 M, n 10; increase of [Ca ]i:0 nM) MIG (0, 5 M, but not for MIG, IP-10, SDF-1␣, or BCA-1. Fig. 5B shows that ϭ 2ϩ Ϯ ␣ ϭ n 5; increase of [Ca ]i: 136 30 nM), SDF-1 (10 nM, n IL-8 protein is released from podocytes after incubation with dif- 2ϩ Ϯ ϭ 6; increase of [Ca ]i: 155 41 nM), and BCA-1 (100 nM, n ferent concentrations of FCS (1 and 10%) and that only small 2ϩ Ϯ . 8; increase of [Ca ]i: 173 36 nM); data not shown) amounts are released in 0% FCS (n ϭ 6). FCS alone did not con- tain any detectable IL-8 (data not shown). To further investigate Immunolabeling of CXCR1Ð5 in human cultured podocytes whether CXCR1 or CXCR2 may have been down-regulated by the Immunolabeling was performed with human podocytes and con- release of IL-8 in podocytes that have been grown in the presence ditionally immortalized human podocytes cultured in 5% FCS. of FCS, the protein expression of CXCR1 and CXCR2 was inves- Both cultured human podocytes and immortalized, differentiated tigated in FCS-starved podocytes. Indeed, immunofluorescence podocytes revealed an identical pattern of CXCR staining: staining of starved podocytes showed an expression of CXCR1 but Fig. 4 shows the CXCR staining of the human immortalized not CXCR2 in immortalized, differentiated podocytes (Fig. 5C)or podocyte cell line. We detected a positive staining for CXCR3Ð5 in human podocytes (data not shown). For the positive control of 6248 CHEMOKINE RECEPTORS AND PODOCYTES

FIGURE 4. Immunofluorescence studies on the expression of CXCR1Ð5 in immortalized, differentiated human podocytes. Positive staining for CXCR3Ð5(D, F, and G). In podocytes cultured in FCS, no signal for the CXCR1 and CXCR2 (B and C) was detectable. Mouse IgG as FIGURE 3. Fluorescence recordings showing the effect of CXC che- 2ϩ negative control for these experiments (A). mokines on [Ca ]i in podocytes. A, IL-8, an agonist of CXCR1 and 2ϩ CXCR2, respectively, had no effect on [Ca ]i of human podocytes grown in FCS. After addition of IL-8, SDF-1␣ as a positive control induced an 2ϩ ␣ increase of [Ca ]i. BÐD, left panel, MIG, SDF-1 , and BCA-1, ligands for 2ϩ CXCR3, CXCR4, and CXCR5, respectively, induced an increase of FCS starvation might have also influenced the [Ca ]i response 2ϩ [Ca ]i in human podocytes. Right panel, Concentration response curves to the other CXCR agonists. To clarify this point, we assessed the 2ϩ ␮ ϭ ␣ ϭ of the effects of the CXCR ligands. Numbers of observations are shown [Ca ]i response to MIG (0.5 M, n 5), SDF-1 (10 nM, n -Statistical significance. 5), and BCA-1 (100 nM, n ϭ 5) in FCS-starved cells. When com ,ء .above the curve 2ϩ pared with the podocytes grown in FCS, the [Ca ]i response to CXCR2 staining, we used human lung microvascular endothelial the agonists was not significantly different from that of FCS- cells (Fig. 5C). In FCS-starved podocytes, IL-8 caused a concen- starved podocytes (data not shown). 2ϩ tration-dependent increase of [Ca ]i (Fig. 5D). Ϫ To clarify the role of IL-8 in suppressing CXCR1 expression in CCR and CXCR ligands increase O2 production in podocytes FCS-containing medium, we investigated the effect of IL-8-neu- Activation of the NADPH-oxidoreductase enzyme complex lead- 2ϩ tralizing Ab on the [Ca ]i response to IL-8. After adding IL-8- ing to generation of reactive oxygen species has been demon- neutralizing Ab (10 ␮g/ml; n ϭ 8) for 24 h to podocytes grown in strated in podocytes in vivo and in vitro. It has been suggested that 2ϩ FCS-containing medium, IL-8 did induce an increase of [Ca ]i. this generation of reactive oxygen species plays a major role in the Fig. 5E summarizes the data of the effect of neutralizing IL-8 Ab pathogenesis of proteinuria (22). The addition of NADPH (0.1 2ϩ on IL-8-induced increase of [Ca ]i. mM) to control podocytes led to a small increase of superoxide To investigate whether an up-regulation of CXCR1 takes place anion production (data not shown). After the pretreatment of podo- at the transcriptional level, we performed a series of semiquanti- cytes with IL-8 (50 nM, n ϭ 5), MIG (0.5 ␮M, n ϭ 8), SDF-1␣ tative RT-PCRs under different cell culture conditions: FCS star- (10 nM, n ϭ 6), and BCA-1 (100 nM, n ϭ 4), the addition of vation caused a slight increase of mRNA expression of CXCR1 NADPH caused a significant increase of superoxide production in but the addition of IL-8 in FCS-free medium or the addition of comparison to control conditions by 262 Ϯ 42%, 225 Ϯ 56%, IL-8-neutralizing Ab in FCS-containing medium did not result in 228 Ϯ 40%, and 216 Ϯ 61%, respectively (Fig. 6C). Before stim- a change of mRNA expression of CXCR1 (Fig. 5F). These results ulation with IL-8, cells were serum starved for 24 h to up-regulate indicate that functional CXCR1 down-regulation in the presence of CXCR1. FCS is not regulated on the transcriptional level but due to ligand- Like the CXCR ligands, the CCR ligands MDC (100 nM), I-309 induced receptor internalization. (10 nM), TECK (100 nM), and CCL28 (2 ␮g/ml) caused a signif- The Journal of Immunology 6249

FIGURE 5. Effect of FCS on IL-8 release and expression of CXCR1 in podocytes. A, Expression of mRNA for IL-8 but not MIG, IP-10, SDF-1␣, or BCA-1 was detected in human podocytes. B, Detection of the release of IL-8 protein from podocytes after incubation with different concentrations of FCS (1% and 10%). C, Immunofluorescence staining showed expression FIGURE 6. Effects of CCR and CXCR ligands on NADPH-mediated of CXCR1 but not CXCR2 in human podocytes. Mouse IgG was used as superoxide anion production in human podocytes. A, A representative a negative control for CXCR1 staining and human microvascular endothe- original recording of the time course and magnitude of NADPH-oxidase lial cells as positive control for CXCR2 staining. D, Concentration re- ϩ activation after stimulation with chemokine ligands, in this case sponse curve of the effect of IL-8 on [Ca2 ] in podocytes that were i SDF-1␣ (10 nM). B, Control cells and cells that had been treated with grown without FCS for 24 h. Numbers of observations are shown above the respective CXC chemokine for 4 h. C, Control cells and cells that Statistical significance. E, IL-8 induced an increase of ,ء .the curve 2ϩ had been treated with the respective CCR chemokine for 4 h. Super- [Ca ]i in the presence of serum-free medium (0% FCS) and in the presence of FCS-containing medium (1% FCS) with the IL-8-neutral- oxide generation by NADPH-oxidase activity was calculated by inte- izing Ab (n-IL-8 mab). F, Fragments of CXCR1 were amplified using grating the total counts during the first 15 min and superoxide gener- 2Ϫ specific primers (see Table I) and subjected to agarose gel electrophore- ation was expressed as nanomoles of O generated per milligram of sis under certain culture conditions. Band densities were evaluated by cellular protein per minute. volume integration. The data were normalized on the GAPDH mRNA expression.

Ϫ icant but smaller increase of superoxide production in comparison peroxide generation was expressed as nanomoles of O2 generated to control conditions by 136 Ϯ 9%, 162 Ϯ 7%, 129 Ϯ 8%, and per milligram of cellular protein per minute. Fig. 6A shows a rep- 129 Ϯ 9%, respectively (Fig. 6B). resentative original recording of the time course and magnitude of Superoxide generation by NADPH-oxidase activity was calcu- NADPH-oxidase activation after stimulation with CXCR ligands, lated by integrating the total counts during the ﬁrst 15 min. Su- in this case, SDF-1␣ (10 nM). 6250 CHEMOKINE RECEPTORS AND PODOCYTES

Immunofluorescence studies show the expression of CXCR1, Discussion CXCR3, and CXCR5 in kidneys with membranous nephropathy The CC and CXC chemokines are important chemotactic mole- but not in control kidneys cules that control leukocyte trafficking and function. Recent stud- We examined cryostat sections of normal kidney cortex and cortex ies have shown that these molecules also play an important role in from two patients with MGN and nephrectomy. The diagnosis of several additional biological functions, such as regulation of lym- membranous nephropathy was made on kidney biopsies with the phocyte development, expression of adhesion molecules, cell pro- typical findings of light, electron, and immunofluorescence mi- liferation, angiogenesis, virus-target cell interactions, and in vari- croscopy (data not shown). ous aspects of cancer (23). The CCRs and CXCRs are expressed in In control kidneys, there was no or only slight staining of a cell-type specific manner in subsets of leukocytes but also in CXCR1ÐCXCR5 (Fig. 7, A, C, E, G, and I), whereas in MGN a some nonhemopoietic cells, such as endothelial and epithelial positive fluorescence staining for CXCR1 (Fig. 7B), CXCR3 (Fig. cells; e.g., CCR8 have recently been detected in human endothelial 7F), and CXCR5 (Fig. 7J) could be detected in podocytes (arrows cells in culture and in endothelial cells in atherosclerotic plaques indicate podocytes, Fig. 7). Glomerular CXCR2 (Fig. 7, C and D) (24). In the present study, we investigated the expression of CCRs and CXCR4 (Fig. 7, G and H) were not detectable in these biopsies and CXCRs in human podocytes. Using RT-PCR, we demonstrate (Fig. 7). glomerular mRNA expression of CCR1Ð10 and CXCR1Ð5. The presence of all of the investigated CCRs and CXCRs in the glomerulum is best explained by the presence of several different glomerular cell types including podocytes, endothelial cells, mesangial cells, and macrophages that have invaded the mesangium (25). The RT-PCR technique did therefore not permit an assign- ment of chemokine receptor expression to specific cell types. In different cell lines of human cultured podocytes, RT-PCR studies showed mRNA expression of the CCR subtypes CCR4, CCR8, CCR9, and CCR10. The ligands for these receptors increase 2ϩ [Ca ]i in podocytes, indicating that the CCRs are functionally active. In podocytes grown in FCS, mRNA of the CXCR subtypes 1, 3, 4, and 5 were detected. Under these conditions, CXCR3Ð5 were functionally active as was demonstrated by the chemokine-induced 2ϩ increases in [Ca ]i. The half maximal concentrations fit well with those described in other cell types such as lymphocytes (26Ð28). It was only by using highly sensitive and stringent RT-PCR conditions that mRNA for CXCR1 could be detected in podocytes. Im- munhistochemically, CXCR1 could not be detected in podocytes grown in a medium with FCS. Also, IL-8, a ligand of CXCR1 and 2ϩ CXCR2, did not induce a [Ca ]i response in podocytes, suggesting that podocytes do not express functional CXCR1 under these conditions. However, we showed that FCS stimulated an IL-8 release in podocytes. In the absence of FCS, IL-8 release was inhibited and up-regulation of functional CXCR1 but not CXCR2 was induced; i.e., CXCR1 could be detected in immunnolabeling 2ϩ studies and IL-8 induced a [Ca ]i response. The data suggest that FCS-mediated release of IL-8 suppressed the expression of functional CXCR1 in podocytes. This hypothesis was supported in ex- 2ϩ periments, in which IL-8 increased [Ca ]i after a 24-h incubation of podocytes with FCS and IL-8 Abs to neutralize the released IL-8. The different culture conditions used did not significantly influence mRNA expression of CXCR1, indicating that CXCR1 is down-regulated by ligand-induced receptor internalization. IL-8 is known to be a neutrophil chemotactic factor which promotes leukocyte adhesion and leads to the recruitment of polymorphonu- clear leukocytes to sites of tissue inflammation (29). IL-8 protein expression along the capillary walls and in the mesangium has been reported in several forms of glomerulonephritis. It has been suggested that IL-8 may be partially responsible for the infiltration FIGURE 7. Immunofluorescence studies on the expression of of leukocytes during glomerulonephritis (30, 31). In addition, IL-8 CXCR1Ð5 in control kidney (A, C, E, G, and I) and in a kidney with might induce albuminuria by altering the metabolism of the sul- membranous nephropathy (B, D, F, H, and J). Note that there is no or slight staining of CXCR1 (A), CXCR3 (E), and CXCR5 (I) in the control kidney, fated compounds of the glomerular basement membrane (32). In a whereas in membranous nephropathy a positive fluorescence staining of model of immune complex nephritis, IL-8 was expressed in af- these CXCRs (B, F, and J) could be detected in podocytes (arrows indicate fected glomerula and injection of an anti-IL-8 Ab reduced glomer- podocytes). ular neutrophil infiltration, prevented fusion of foot processes of The Journal of Immunology 6251 podocytes, and inhibited proteinuria (33). IL-8 release of podo- In comparison to the strong staining of the CXCR1 and CXCR5 cytes during proteinuric diseases may therefore, in an autocrine in podocytes in MGN, CXCR3 staining was weaker. In a recently fashion, participate in the development of proteinuria in glomeru- performed semiquantitative evaluation of immunohistochemical lar diseases. mRNA could be detected in podocytes for IL-8 but staining for the CXCR3, Romagnani et al. (37) found only a slight not for IP-10, SDF-1␣, and BCA-1. However, these and other positive staining for CXCR3 in two of four kidneys from patients ligands can be released from leukocytes and lymphocytes, infil- with MGN, a finding that was not different from normal kidneys. trating glomerula in the case of inflammation. In addition, some The difference in our present study, where a small increase of chemokines are also produced by resident glomerular cells. Syn- CXCR3 staining could be observed in podocytes from patients thesis of MCP-1, IL-8, and IP-10 has been demonstrated in mes- with MGN, might be explained by methodical differences; i.e., in angial cells (34). the study by Romagnani et al. (37), paraformaldehyde was used to How might activation of CCRs and CXCRs influence podocyte fix kidney tissue and the avidin biotin-peroxidase method was used function? In Heymann nephritis, proteinuria is dependent on Ab- to detect Ab reaction. In addition, it might be difficult to quantify induced formation of the complement C5b-9 membrane attack positive staining in podocytes. Podocytes represent only 5% of all complex. It has been demonstrated that sublytic C5b-9 attack on glomerular cells and are sometimes difficult to localize. podocytes causes up-regulation of expression of the NADPH-ox- Is there any further evidence that CXC chemokines may partic- idoreductase enzyme complex by podocytes, which is then trans- ipate in the development of glomerular damage and proteinuria? It located to their cell surfaces. Subsequently, reactive oxygen spe- was recently demonstrated that IP-10 expression is up-regulated in cies are produced locally which reach the glomerular basement resident glomerular cells in vitro and in vivo in Adriamycin ne- membrane matrix. Reactive oxygen species initiate lipid peroxi- phropathy. Levels of glomerular IP-10 mRNA expression and glo- dation and subsequent degradation of glomerular basement mem- merular and tubulointerstitial IP-10 protein coincidenced with brane collagen IV, leading to proteinuria (35, 36). In the present maximal proteinuria (38). Therefore, IP-10 may participate in the study, we show that CCR and CXCR ligands induce the activation pathogenesis of podocyte injury and proteinuria during Adriamy- of NADPH-oxidase, a major source for the production of super- cin nephrosis. In addition to their possible role in glomerular in- oxide anions in podocytes. Activation of chemokine receptors in flammation, the chemokine receptors CCR5 and CXCR4 are also podocytes may therefore contribute to the pathogenesis of protein- known to serve as coreceptors for the cellular entry of HIV-1 (39). uria via activation of NADPH-oxidases, leading to a release of Moreover, CXCR5 has been demonstrated to act as a specific co- superoxide anions. receptor for HIV-2 (40). The podocyte plays a crucial role in the In contrast to the ample information about the release of che- pathogenesis of HIV nephropathy and it has recently been shown mokines during renal injury, little is known about the expression of that the loss of podocyte maturity markers and podocyte prolifer- chemokine receptors on glomerular cells in vivo. To our knowl- ation occur in HIV-associated nephropathy (41). Very recently, it edge, only CXCR3 have been detected in mesangial cells of pa- was demonstrated that CCR5 and CXCR4 were not expressed in tients with IgA nephropathy, membranoproliferative glomerulone- resident glomerular cells in HIV-associated renal disease (42). The phritis, and rapidly progressive glomerulonephritis, indicating that possible role of CXCR5 in HIV-2-induced nephropathy has to be CXCR3 might contribute to mesangial cell proliferation in these investigated in future studies. Expression of CXCR5 was primarily diseases (37). It is well known that cultured cells frequently reflect demonstrated on B lymphocytes (43). Interestingly, we show here pathological conditions rather than a physiological situation. With that CXCR5 is also expressed on a nonhemopoietic cell type; the this in mind, chemokine receptor expression may be the result of podocyte. Several earlier studies have shown that podocytes are cell culture conditions. For example, CXCR3 were shown to be able to express other leukocyte-associated markers, such as CD2- functionally active in cultured human mesangial cells. However, associated protein or CD68 under normal and pathological condi- slight or no signal of immunological staining for CXCR3 could be tions, respectively, indicating that there are some similarities be- detected in normal glomerula, whereas a positive signal was seen tween protein expression of leukocytes and podocytes (44, 45). in injured glomerula, suggesting that CXCR3 expression is up- Recently, it has also been shown that injured podocytes undergo a regulated during glomerular inflammation (37). In agreement with process of transdifferentiation with the acquisition of epitopes that these findings, only a slight immunohistological staining for CX- are characteristic of activated macrophages (46). The presence of CRs could be detected in normal human glomerula. This slight and distinct chemokine receptors on podocytes further supports the diffuse signal was seen for CXCR3 and CXCR5 in healthy human idea that podocytes can turn into inflammatory cells which are glomerula. However in patients with MGN, a positive staining for actively involved in the inflammatory processes that occur in glo- CXCR1, CXCR3, and CXCR5 was detected in podocytes, but not merular diseases. for CXCR2 or CXCR4. With regard to the release of superoxide In conclusion, cultured podocytes express functional CCR and anions after activation of these receptors in podocytes in culture, CXCR receptors. Activation of these receptors may contribute to these receptors may be involved in the pathogenesis of podocyte podocyte damage and proteinuria during glomerular diseases. injury and proteinuria in MGN. The difference in expression of Therefore, it will be interesting to find out whether chemokine CXCR4 in cultured podocytes and in podocytes during MGN receptor antagonists can reduce proteinuria in patients with inflam- (podocytes in culture possess CXCR4, whereas during MGN matory glomerulopathy. podocytes do not express CXCR4) might be due to the following: 1) CXCR4 might not be present in MGN but instead in other Acknowledgments glomerular diseases associated with injury of the podocyte. 2) We thank Temel Kilic, Charlotte Hupfer, Monika von Hofer, Barbara Mu¬l- CXCR4 might only be found under cell culture conditions. ler, and Petra Daemisch for their excellent technical assistance. ␤ The proinflammatory cytokine IL-1 , which has been shown to References induce chemokine receptor expression in astroglioma cells (18), 1. Pavenstadt, H. 2000. Roles of the podocyte in glomerular function. did not stimulate mRNA expression for those CCRs and CXCRs Am. J. Physiol. 278:F173. which have not been detected in unstimulated podocytes. This sug- 2. Savin, V. J., R. Sharma, M. Sharma, E. T. McCarthy, S. K. Swan, E. Ellis, H. Lovell, B. Warady, S. Gunwar, A. M. Chonko, et al. 1996. Circulating factor gests that no additional chemokine receptor expression can be in- associated with increased glomerular permeability to albumin in recurrent focal duced by Il-1␤ in podocytes. segmental glomerulosclerosis. N. Engl. J. Med. 334:878. 6252 CHEMOKINE RECEPTORS AND PODOCYTES

3. Penny, M. J., R. A. Boyd, and B. M. Hall. 1998. Permanent CD8ϩ T cell de- 25. Schreiner, G. F., and E. R. Unanue. 1984. Origin of the rat mesangial phagocyte pletion prevents proteinuria in active Heymann nephritis. J. Exp. Med. 188:1775. and its expression of the leukocyte common antigen. Lab. Invest. 51:515. 4. Tang, W. W., M. Qi, J. S. Warren, and G. Y. Van. 1997. Chemokine expression 26. Loetscher, M., B. Gerber, P. Loetscher, S. A. Jones, L. Piali, I. Clark-Lewis, in experimental tubulointerstitial nephritis. J. Immunol. 159:870. M. Baggiolini, and B. Moser. 1996. Chemokine receptor specific for IP10 and 5. Park, Y. S., C. Guijarro, Y. Kim, Z. A. Massy, B. L. Kasiske, W. F. Keane, and mig: structure, function, and expression in activated T-lymphocytes. J. Exp. Med. M. P. O’Donnell. 1998. Lovastatin reduces glomerular macrophage influx and 184:963. expression of monocyte chemoattractant protein-1 mRNA in nephrotic rats. 27. McColl, S. R., M. Hachicha, S. Levasseur, K. Neote, and T. J. Schall. 1993. Am. J. Kidney Dis. 31:190. Uncoupling of early signal transduction events from effector function in human 6. Ou, Z. L., Y. Natori, and Y. Natori. 1999. Gene expression of CC chemokines in peripheral blood neutrophils in response to recombinant macrophage inflamma- experimental acute tubulointerstitial nephritis. J. Lab. Clin. Med. 133:41. tory proteins-1␣ and -1␤. J. Immunol. 150:4550. 7. Luster, A. D. 1998. ChemokinesÐchemotactic cytokines that mediate inflamma- 28. Jinquan, T., S. Quan, H. H. Jacobi, H. O. Madsen, C. Glue, P. S. Skov, tion. N. Engl. J. Med. 338:436. H. J. Malling, and L. K. Poulsen. 2000. CXC chemokine receptor 4 expression 8. Lloyd, C. M., A. W. Minto, M. E. Dorf, A. Proudfoot, T. N. Wells, D. J. Salant, and stromal cell-derived factor-1␣-induced chemotaxis in CD4ϩ T lymphocytes and J. C. Gutierrez-Ramos. 1997. RANTES and monocyte chemoattractant pro- are regulated by interleukin-4 and interleukin-10. Immunology 99:402. tein-1 (MCP-1) play an important role in the inflammatory phase of crescentic 29. Baggiolini, M., B. Dewald, and B. Moser. 1994. Interleukin-8 and related che- nephritis, but only MCP-1 is involved in crescent formation and interstitial fi- motactic cytokines: CXC and CC chemokines. Adv. Immunol. 55:97. brosis. J. Exp. Med. 185:1371. 30. Cockwell, P., C. J. Brooks, D. Adu, and C. O. Savage. 1999. Interleukin-8: a 9. Saleem, M. A., M. J. O’Hare, J. Reiser, R. J. Coward, C. D. Inward, T. Farren, pathogenetic role in antineutrophil cytoplasmic autoantibody-associated glomer- C. Y. Xing, L. Ni, P. W. Mathieson, and P. Mundel. 2002. A conditionally ulonephritis. Kidney Int. 55:852. immortalized human podocyte cell line demonstrating nephrin and podocin ex- 31. Mezzano, S., M. E. Burgos, F. Olavarria, and I. Caorsi. 1997. Immunohistochem- ␤ pression. J. Am. Soc. Nephrol. 13:630. ical localization of IL-8 and TGF- in streptococcal glomerulonephritis. J. Am. 10. Stamps, A. C., S. C. Davies, J. Burman, and M. J. O’Hare. 1994. Analysis of Soc. Nephrol. 8:234. proviral integration in human mammary epithelial cell lines immortalized by 32. Garin, E. H., L. West, and W. Zheng. 1997. Effect of interleukin-8 on glomerular retroviral infection with a temperature-sensitive SV40 T-antigen construct. Int. J. sulfated compounds and albuminuria. Pediatr. Nephrol. 11:274. Cancer 57:865. 33. Wada, T., N. Tomosugi, T. Naito, H. Yokoyama, K. Kobayashi, A. Harada, 11. Schraufstatter, I. U., J. Chung, and M. Burger. 2001. IL-8 activates endothelial N. Mukaida, and K. Matsushima. 1994. Prevention of proteinuria by the admin- cell CXCR1 and CXCR2 through Rho and Rac signaling pathways. istration of anti-interleukin 8 antibody in experimental acute immune complex- induced glomerulonephritis. J. Exp. Med. 180:1135. Am. J. Physiol. 280:L1094. ␣ 12. Greiber, S., T. Munzel, S. Kastner, B. Muller, P. Schollmeyer, and H. Pavenstadt. 34. Duque, N., C. Gomez-Guerrero, and J. Egido. 1997. Interaction of IgA with Fc receptors of human mesangial cells activates transcription factor nuclear fac- 1998. NAD(P)H oxidase activity in cultured human podocytes: effects of aden- ␬ osine triphosphate. Kidney Int. 53:654. tor- B and induces expression and synthesis of monocyte chemoattractant protein-1, IL-8, and IFN-inducible protein 10. J. Immunol. 159:3474. 13. Nitschke, R., U. Frobe, and R. Greger. 1991. Antidiuretic hormone acts via V1 35. Neale, T. J., R. Ulrich, P. Ojha, H. Poczewski, A. J. Verhoeven, and D. Kerjas- receptors on intracellular calcium in the isolated perfused rabbit cortical thick chki 1993. Reactive oxygen species and neurophil respiratory burst cytochrome ascending limb. Pflu¬gers Arch. 417:622. ϩ b558 are produced by kidney glomerular cells in passive Heymann nephritis. 14. Grynkiewicz, G., M. Poenie, and R. Y. Tsien. 1985. A new generation of Ca2 Proc. Natl. Acad. Sci. USA 90:3645. indicators with greatly improved fluorescence properties. J. Biol. Chem. 260: 36. Kerjaschki, D., and T. J. Neale. 1996. Molecular mechanisms of glomerular in- 3340. jury in rat experimental membranous nephropathy (Heymann nephritis). J. Am. 15. Lowry O. H., N. J. Rosebrough, A. L. Parr, and R. J. Randall. 1951. Protein Soc. Nephrol. 7:2518. measurement with the Folin phenol reagent. 193,265Ð275. 37. Romagnani, P., C. Beltrame, F. Annunziato, L. Lasagni, M. Luconi, G. Galli, 16. Hink, U., H. Li, H. Mollnau, M. Oelze, E. Matheis, M. Hartmann, M. Skatchkov, L. Cosmi, E. Maggi, M. Salvadori, C. Pupilli, and M. Serio. 1999. Role for F. Thaiss, R. A. Stahl, A. Warnholtz, et al. 2001. Mechanisms underlying endo- interactions between IP-10/Mig and CXCR3 in proliferative glomerulonephritis. thelial dysfunction in diabetes mellitus. Circ. Res. 88:E14. J. Am. Soc. Nephrol. 10:2518. 17. Mundel, P., J. Reiser, B. A. Zuniga Mejia, H. Pavenstadt, G. R. Davidson, 38. Gomez-Chiarri, M., A. Ortiz, S. Gonzalez-Cuadrado, D. Seron, S. N. Emancipator, W. Kriz, and R. Zeller. 1997. Rearrangements of the cytoskeleton and cell con- T. A. Hamilton, A. Barat, J. J. Plaza, E. Gonzalez, and J. Egido. 1996. Interferon- tacts induce process formation during differentiation of conditionally immortal- inducible protein-10 is highly expressed in rats with experimental nephrosis. ized mouse podocyte cell lines. Exp. Cell Res. 236:248. Am. J. Pathol. 148:301. 18. Oh, J. W., K. Drabik, O. Kutsch, C. Choi, A. Tousson, and E. N. Benveniste. 39. Wenzel, U. O., and R. A. Stahl. 1999. Chemokines, renal disease, and HIV 2001. CXC chemokine receptor 4 expression and function in human astroglioma infection. Nephron 81:5. cells. J. Immunol. 166:2695. 40. Kanbe, K., N. Shimizu, Y. Soda, K. Takagishi, and H. Hoshino. 1999. A CXC 19. Greiber, S., B. Muller, P. Daemisch, and H. Pavenstadt. 2002. Reactive oxygen chemokine receptor, CXCR5/BLR1, is a novel and specific coreceptor for human species alter gene expression in podocytes: induction of granulocyte macrophage- immunodeficiency virus type 2. Virology 265:264. colony-stimulating factor. J. Am. Soc. Nephrol. 13:86. 41. Barisoni, L., W. Kriz, P. Mundel, and V. D’Agati. 1999. The dysregulated podo- 20. Homey, B., W. Wang, H. Soto, M. E. Buchanan, A. Wiesenborn, D. Catron, cyte phenotype: a novel concept in the pathogenesis of collapsing idiopathic focal A. Muller, T. K. McClanahan, M. C. Dieu-Nosjean, R. Orozco, et al. 2000. segmental glomerulosclerosis and HIV-associated nephropathy. J. Am. Soc. Cutting edge: the orphan chemokine receptor G protein-coupled receptor- 2 Nephrol. 10:51. (GPR-2, CCR10) binds the skin-associated chemokine CCL27 (CTACK/ALP/ 42. Eitner, F., Y. Cui, K. L. Hudkins, M. B. Stokes, S. Segerer, M. Mack, P. L. Lewis, ILC). J. Immunol. 164:3465. A. A. Abraham, D. Schlondorff, G. Gallo, et al. 2000. Chemokine receptor CCR5 21. Wang, W., H. Soto, E. R. Oldham, M. E. Buchanan, B. Homey, D. Catron, and CXCR4 expression in HIV-associated kidney disease. J. Am. Soc. Nephrol. N. Jenkins, N. G. Copeland, D. J. Gilbert, N. Nguyen, et al. 2000. Identification 11:856. of a novel chemokine (CCL28), which binds CCR10 (GPR2). J. Biol. Chem. 43. Legler, D. F., M. Loetscher, R. S. Roos, I. Clark-Lewis, M. Baggiolini, and 275:22313. B. Moser. 1998. B cell-attracting chemokine 1, a human CXC chemokine ex- 22. Neale, T. J., P. P. Ojha, M. Exner, H. Poczewski, B. Ruger, J. L. Witztum, pressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/ P. Davis, and D. Kerjaschki. 1994. Proteinuria in passive Heymann nephritis is CXCR5. J. Exp. Med. 187:655. associated with lipid peroxidation and formation of adducts on type IV collagen. 44. Shih, N. Y., J. Li, V. Karpitskii, A. Nguyen, M. L. Dustin, O. Kanagawa, J. Clin. Invest. 94:1577. J. H. Miner, and A. S. Shaw. 1999. Congenital nephrotic syndrome in mice 23. Segerer, S., P. J. Nelson, and D. Schlondorff. 2000. Chemokines, chemokine lacking CD2-associated protein. Science 286:312. receptors, and renal disease: from basic science to pathophysiologic and thera- 45. Bariety, J., D. Nochy, C. Mandet, C. Jacquot, D. Glotz, and A. Meyrier. 1998. peutic studies. J. Am. Soc. Nephrol. 11:152. Podocytes undergo phenotypic changes and express macrophagic-associated 24. Haque, N. S., J. T. Fallon, M. B. Taubman, and P. C. Harpel. 2001. The che- markers in idiopathic collapsing glomerulopathy. Kidney Int. 53:918. mokine receptor CCR8 mediates human endothelial cell chemotaxis induced by 46. Bariety, J., P. Bruneval, G. Hill, T. Irinopoulou, C. Mandet, and A. Meyrier. I-309 and Kaposi sarcoma herpesvirus-encoded vMIP-I and by lipoprotein(␣)- 2001. Posttransplantation relapse of FSGS is characterized by glomerular epithe- stimulated endothelial cell conditioned medium. Blood 97:39. lial cell transdifferentiation. J. Am. Soc. Nephrol. 12:261.