Stress-Responsive MDM2 Alternative Splicing: Regulation and Consequences

Stress-responsive MDM2 alternative splicing: regulation and consequences

in oncogenesis

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Aishwarya Griselda Jacob

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2014

Dissertation Committee:

Dawn S. Chandler, Advisor

Kathleen Boris-Lawrie

Denis C. Guttridge

Beth S. Lee

Aishwarya Griselda Jacob

2014

Abstract

p53, the quintessential tumor suppressor, plays the role of stress sensor within the cell and its expression is upregulated under conditions warranting DNA damage repair, cell-cycle arrest or cell death to activate transcriptional networks of effectors. Several stress-triggered mechanisms have been characterized that increase p53 protein stability and activity by interfering with the interaction between p53 and its chief negative regulators MDM2 and MDMX. These include post-translational modifications of the p53 and MDM proteins, sequestration of

MDM2 and MDMX and destabilization of the MDM proteins. Under these genotoxic-stress conditions, another phenomenon that occurs is the alternative splicing of MDM2 and MDMX that serves as an important, but often overlooked, means by which MDM2 and MDMX levels and functions can be altered.

Intriguingly, splice variants of MDM2 and MDMX have also been reported to occur in several cancer types and have been shown to promote tumorigenesis via unknown mechanisms. What remains to be understood is their mode of action in oncogenesis and also the splicing mechanisms by which they are generated. In this study we explore the roles of the tumor-associated splice variants, MDM2-ALT1 and MDMX-ALT2 in the modulation of the p53 tumor- suppressor pathway and in oncogenesis using in vitro and in vivo models of ii cancer. We show that MDM2-ALT1 and MDMX-ALT2 are capable of modulating the p53 transcriptional network by manipulating the activity of full-length MDM2 and MDMX. We also demonstrate the MDM2-ALT1 and MDMX-ALT2 over- expression promotes the tumorigenic and metatstatic properties of RMS

(rhabdomyosarcoma) cells. Additionally, we show that MDM2-ALT1 expression induces tumor formation in vivo albeit after a long period of latency. We have also examined the splicing regulatory mechanisms leading to the stress-induced generation of MDM2-ALT1 and have uncovered crucial factors FUBP1 (Far

Upstream Element Binding Protein 1) and PTBP1 (Polypyrimidine Tract Binding

Protein 1) that are necessary for efficient splicing of full-length MDM2.

Importantly, we show the presence of critical cis elements on MDM2 exon 11 that are necessary and sufficient for the regulation of its damage-inducible splicing.

Overall, our study has helped gain an understanding of several crucial aspects of the biology of MDM2 and MDMX splicing. Our findings are timely and relevant and present the potential to design and develop anti-cancer therapies targeting

MDM2 and MDMX alternative splicing.

iii

Dedication

This document is dedicated to the memory of my beloved grandmother

Mrs. Griselda Nallathamby.

Acknowledgments

Personal: I first thank and praise God for His wonderful mercy and grace that have guided me through the toughest times and helped me achieve great heights that I would never have deemed possible. Next, I express my heartfelt gratitude to my beloved parents, Dr. S. Jacob K Annamalai and Mrs. Praveena Jacob, without whose incredible love and support, I would not be where I am today. I also extend my gratitude to the rest of my family (direct and extended) and close friends, particularly Ms. Aswini Hariharan

(my bestest friend) and the “Columbus girls”, whose prayers and well-wishes have supported me all these years.

Professional: I sincerely thank my advisor Dr. Dawn S. Chandler whose impeccable guidance and mentorship have been instrumental to my success in graduate school.

She is a remarkable scientist and human being and she has truly been a source of inspiration for me. I am also grateful to the members of the Chandler laboratory particularly Dr. Thomas Bebee and Dr. Ravi Singh who helped shape my career as a graduate student and my close friends Ms. Catey Dominguez, Ms. Kristi Akehurst, Mr.

Daniel Comiskey Jr, Mr. Fuad Mohammad and Ms. Aixa Tapia-Santos who have been wonderful colleagues, collaborators and partners in crime. Importantly, I express my gratitude to my graduate committee members for all their immense support and kindness. Finally, I thank Pelotonia, the OSU-NCH muscle group and the NIH for funding my research.

Vita

May 2004 ...... Avila Convent, India

2008 ...... B.Tech. Biotechnology, Anna University

2008 to present ...... Graduate Research Associate, Department

of Molecular, Cellular and Developmental

Biology, The Ohio State University

Publications

1. O’ Brien D, Jacob AG, Qualman SJ, Chandler DS. “Advances in pediatric rhabdomyosarcoma characterization and disease model development.” Histol Histopathol. 2012 Jan;27 (1):13-22. PMID: 22127592.

2. Jacob AG, Singh RK, O'Brien D, Bebee TW, Gladman JT, Bolinger C, Jeyaraj S, Boris-Lawrie K, Chandler DS. Stress-induced isoforms of MDM2 and MDM4 correlate with high-grade disease and an altered splicing network in pediatric rhabdomyosarcoma. Neoplasia. 2013 Sep;15(9):1049-63. PMID: 24027430.

3. Jacob AG, Singh RK, Mohammad F, Bebee TW, Chandler DS. “The Splicing Factor FUBP1 Is Required for the Efficient Splicing of Oncogene MDM2 Pre- mRNA.” J Biol Chem. 2014 Jun 20;289 (25):17350-17364. PMID: 24798327.

4. Jacob AG, Singh RK, Comiskey DF Jr, Rouhier MF, Mohammad F, Bebee TW, Chandler DS “Stress-induced alternative splice forms of MDM2 and MDMX modulate the p53-pathway in distinct ways” Co-author with Dr. Ravi. K Singh. PLoS One. 2014 Aug 8;9(8):e104444. PMID: 25105592.

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments ...... v

Vita ...... vi

List of Tables ...... xiii

List of Figures ...... xiv

Chapter 1: Introduction ...... 1

1.1 Eukaryotic pre-mRNA splicing ...... 1

1.2 Alternative splicing ...... 6

1.3 Regulation of alternative splicing ...... 7

1.4 Mechanisms of alternative splicing regulation ...... 9

1.5 Implications of alternative splicing in disease and cancer ...... 13

1.6 Tumor suppressor p53 and its antagonists MDM2 and MDMX ...... 17

1.7 Regulation of p53 by MDM2 ...... 18

1.8 Regulation of p53 by MDMX ...... 21

1.9 MDM2 and MDMX in cancer ...... 22

vii

1.10 Alternative splicing of MDM2 and MDMX ...... 24

1.11 Why study MDM2 and MDMX alternative splicing? ...... 28

Chapter 2: Trans Regulators of MDM2 Splicing: Characterization of Far Upstream

Element Binding Protein 1 (FUBP1), Polypyrimidine Tract Binding Protein 1 (PTBP1) ..33

2.1 Introduction ...... 33

2.1.1 Far Upstream Element Binding Protein 1 (FUBP1) ...... 36

2.1.2 Poly Pyrimidine Tract Binding Protein 1 (PTBP1) ...... 37

2.2 Materials and Methods ...... 40

2.3 Results ...... 49

2.3.1 Intron 11 of stress-responsive MDM2 minigene shows differential binding of

factors under stress ...... 49

2.3.2 Mass-spectrometric identification of differentially bound proteins in nuclear

extracts from normal and damage-treated cells ...... 51

2.3.3 FUBP1 binds intron 11 of the MDM2 minigene ...... 53

2.3.4 FUBP1 enhances the splicing efficiency of the MDM2 3-11-12 minigene in

normal nuclear extract in vitro ...... 55

2.3.5 FUBP1 facilitates efficient splicing of both the upstream and downstream

introns in MDM2 2-exon minigenes in vitro ...... 56

2.3.6 FUBP1 shows differential binding to the upstream intron ...... 57

2.3.7 FUBP1 over-expression suppresses damage-inducible alternative splicing of

MDM2 minigene ...... 58

viii

2.3.8 Knockdown of FUBP1 induces MDM2 alternative splicing even in the absence

of stress...... 59

2.3.9 Alterations in the FUBP1 gene are a feature of several malignancies ...... 60

2.3.10 PTBP1 enhances the splicing efficiency of the MDM2 3-11-12 minigene in

normal nuclear extract in vitro ...... 61

2.3.11 PTBP1 facilitates efficient splicing of both the upstream and downstream

introns in MDM2 2-exon minigenes in vitro ...... 63

2.3.12 Knockdown of PTBP1 induces MDM2 alternative splicing in the absence of

stress ...... 64

2.4 Discussion ...... 65

2.4.1 Role of FUBP1 in MDM2 splicing ...... 65

2.4.2 Possible mechanisms for FUBP1 mediated splicing of MDM2 ...... 66

2.4.3 FUBP1 Δ74 and its role in MDM2 splicing ...... 68

2.4.4 Role of FUBP1 in cancer ...... 69

2.4.5 Role of PTBP1 in MDM2 splicing ...... 71

2.4.6 Summary ...... 74

Chapter 3: Cis elements in exon 11 of MDM2 are necessary and sufficient for its stress- responsive alternative splicing ...... 88

3.1 Introduction ...... 88

3.2 Materials and Methods ...... 92

3.3 Results ...... 95

3.3.1 Minimalized MDM2 minigene 3-11-12s is responsive to stress in vitro ...... 95

3.3.2 Exon 11 of the MDM2 3-11-12s minigene is necessary for its genotoxic stress-

response ...... 96

3.3.3 Exon 11 of the MDM2 3-11-12s minigene is necessary and sufficient to

sustain genotoxic stress-response in a heterologous context ...... 98

3.4 Discussion ...... 100

Chapter 4: MDM2-ALT1 as a suppressor and a driver of oncogenesis: in vitro studies and characterization in an in vivo model (mouse) of B cell specific expression ...... 106

4.1 Introduction ...... 106

4.2 Materials and Methods ...... 110

4.3 Results ...... 117

4.3.1 MDM2-ALT1 interacts with full-length MDMX and MDM2 ...... 117

4.3.2 MDMX-ALT2 dimerizes with MDM2 and MDMX ...... 118

4.3.3 MDM2-ALT1 and MDMX-ALT2 expression stabilizes p53 ...... 118

4.3.4 p53 upregulated upon MDM2-ALT1 over-expression is transcriptionally active

...... 119

4.3.5 MDM2-ALT1 and MDMX-ALT2 lead to activation of distinct p53 transcriptional

targets ...... 120

4.3.6 Mouse model of conditional MDM2-ALT1 expression ...... 123

4.3.7 MDM2-ALT1 expression in B cells leads to significantly higher lymphoma

incidence compared to controls ...... 124

4.3.8 MDM2-ALT1 positive mice show decreased B cell markers compared to

control mice ...... 126

4.4 Discussion ...... 128

4.4.1 Stress-responsive MDM2 and MDMX alternative splicing ...... 128

4.4.2 Effects of the expression of MDM splice variants on cell cycle ...... 129

4.4.3 Modulation of the p53-pathway by the MDM alternative splice variants ...... 131

4.4.4 MDM2-ALT1 and MDMX-ALT2 in cancer...... 134

4.4.5 Role of MDM2-ALT1 in vivo ...... 136

Chapter 5: Role of MDM2-ALT1 in Rhabdomyosarcoma ...... 152

5.1 Introduction ...... 152

5.1.1 Molecular pathways associated with RMS ...... 153

5.1.2 Animal models of RMS ...... 155

5.1.3 p53 pathway in RMS...... 158

5.1.4 Alternative splicing of MDM2 and MDMX in RMS ...... 159

5.2 Materials and Methods ...... 162

5.3 Results ...... 165

5.3.1 MDM2-ALT1 and MDMX-ALT2 enhance anchorage-independent growth of

untransformed myoblasts C2C12 and Rh30 RMS cells ...... 165

5.3.2 MDM2-ALT1 and MDMX-ALT2 expression leads to increased invasive

behavior of RMS cells...... 166

5.3.3 Role of MDM2-ALT1 in the PAX3-FOXO1 alveolar rhabdomyosarcoma model:

cohort generation using the conditional MDM2-ALT1 transgenic mouse...... 166

5.4 Discussion ...... 170

5.4.1 MDM2-ALT1 and MDMX-ALT2 as potential transforming factors ...... 171

5.4.2 MDM2-ALT1 expression in an RMS-sensitized in vivo model ...... 173

Chapter 6: Summary and Conclusions ...... 179

6.1 Stress-induced splice variants MDM2-ALT1 and MDMX-ALT2 are modifiers of the

p53 pathway ...... 180

6.2 MDM2-ALT1 and MDMX-ALT2 in cancer ...... 181

6.3 MDM2-ALT1 expression increases lymphoma incidence after a long latency..... 183

6.4 MDM2-ALT1 expression results in lowered B-cell numbers: Latent phase ...... 183

6.5 MDM2-ALT1 in p53-independent context ...... 184

6.6 To splice or not to splice ...... 185

6.7 Mechanisms regulating MDM2 splicing ...... 187

6.8 Implications in cancer ...... 190

6.9 Stress-induced MDM2 alternative splicing is regulated by cis regulatory elements

on exon 11 ...... 192

6.10 Splicing modulation ...... 194

6.11 Summary ...... 198

Notes ...... 200

References ...... 201

xii

List of Tables

Table 4.1 Comparison of lymphoid and non lymphoid malignancies observed in aging transgenic and control mice .………..…………...………………………………………..149

Table 4.2 Summary of flow cytometric analyses ……………………………………….150

xiii

List of Figures

Figure 1.1: MDM2 alternative splicing...... 30

Figure 1.2. MDMX alternative splicing ...... 31

Figure 1.3: Regulation of p53 by MDM2 and MDMX ...... 32

Figure 2.1: UVC Cross-linking assay reveals differential binding of proteins on intron 11 of MDM2 between normal and damaged conditions ...... 75

Figure 2.2: Deletions within RNA2 result in loss of the binding of the differential protein factors and reduced exon 11 splicing...... 76

Figure 2.3: FUBP1 and its damage-specific cleaved form bind RNA2...... 77

Figure 2.4: Immunointerference of FUBP1 compromises the splicing efficiency of the

MDM2 3-11-12 minigene...... 78

Figure 2.5: FUBP1 immunointerference decreases splicing of both introns of the MDM2 minigene but not the p53 minigene indicating transcript specificity ...... 79

Figure 2.6: FUBP1 binds the intron upstream of exon 11...... 80

Figure 2.7: Over-expression of FUBP1 and the Δ74 form suppresses the formation of

MDM2-ALT1 from an MDM2 minigene upon cisplatinum treatment ...... 81

xiv

Figure 2.8: Knockdown of FUBP1 results in the formation of MDM2-ALT1 even under normal conditions ...... 82

Figure 2.9: FUBP1 gene alterations are observed across several cancer types in The

Cancer Genome Atlas ...... 83

Figure 2.10: PTBP1 and its damage-specific cleaved forms bind RNA2 ...... 84

Figure 2.11: Immunointerference of PTBP1 compromises the splicing efficiency of the

MDM2 3-11-12 minigene ...... 85

Figure 2.12: PTBP1 immunointerference decreases splicing of both introns of the MDM2 minigene ...... 86

Figure 2.13: Knockdown of PTBP1 results in the formation of MDM2-ALT1 even under normal conditions ...... 87

Figure 3.1: The MDM2 3-11-12s minigene undergoes damage-induced exon 11 skipping in an in vitro splicing system while a control p53 7-8-9 minigene remains unresponsive

...... 103

Figure 3.3: MDM2 exon 11 is sufficient to regulate stress-responsive splicing in the heterologous p53 minigene context ...... 105

Figure 4.2: Full-length MDM2 co-immunoprecipitates with myc-MDM2-ALT1 and myc-

MDMX-ALT2...... 142

Figure 4.3: MDM2-ALT1 and MDMX-ALT2 expression causes upregulation of p53 and its downstream target p21 ...... 143

Figure 4.4: MDM2-ALT1 and MDMX-ALT2 lead to the activation of subtly different subsets of p53 transcriptional targets ...... 144

Figure 4.5: Expression of p53 target genes upon Nutlin-3 treatment shows similarities to

MDM-ALT over-expression ...... 145

Figure 4.6: Hypothesis for the role of MDM2-ALT1 in tumorigenesis. Based on the proposed model of Myc-induced tumorigenesis ...... 146

Figure 4.8: Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers in spleens compared to controls ...... 148

Figure 4.9: Identification of CD19+ CD5+ populations in splenic lymphomas from ctrl and expt animals ...... 149

Figure 5.1: MDM2-ALT1– and MDM4-ALT2–expressing cells show increase in migration and anchorage-independent growth ...... 176

Figure 5.2: Model of alveolar RMS with constitutive MDM2-ALT1 expression ...... 177

Figure 5.3: Model of alveolar RMS with constitutive MDM2-ALT1 expression ...... 178

xvi

Chapter 1: Introduction

Cancer is a multifaceted disease that is the 2nd leading cause of the death in the

United States of America and has been estimated will claim well over 500,000 lives in

2014 alone (American Cancer Society). Several decades of research have brought forth a vast amount of information regarding the etiology of the various cancer types and have contributed to the development of novel therapies. However, the sheer complexity of the molecular pathways involved combined with the inherent heterogeneity existing within each type of cancer, has impeded complete understanding of the disease and continues to pose challenges for both cancer diagnostics and treatment.

The progression from a normal cell to a malignant one is a multistage process and several theories have been postulated on how this transformation is initiated and how the proliferative and survival signals are sustained until tumor generation [1]. An important feature of a tumor cell is the deregulation of normal cell-cycle check points and the maintenance of constant mitogenic signaling, often brought about by tipping the balance between the expression of the tumor-suppressors and the oncogenes [1]. The disruption of the functions of the archetypal tumor-suppressor p53 constitutes one such scenario where mutations or aberrations at its genomic level or over-expression of its chief antagonists, the oncogenic MDM proteins, often serve to impact its expression and activity thereby favoring evasion of the cell-cycle arrest and apoptotic signals and leading to malignancies. Indeed, the primary focus of MDM and p53 research thus far

1 has been to accumulate knowledge of the interactions and the physiological functionality of these multifaceted proteins with the aim of targeting these pathways for cancer diagnostics and therapeutics. However, an important but relatively unexplored aspect is the role of the alternative splice variants of MDM2 and MDMX in p53 regulation and cellular transformation. In this study, we examine the physiological functions of the alternative splice variants MDM2-ALT1 and MDMX-ALT2 and present evidence supporting a dual role for these isoforms in the context of tumorigenesis. In addition, we explore the mechanisms governing the generation of MDM2-ALT1 in cells in response to genotoxic-stress and identify crucial splicing regulatory factors that can potentially be targeted for the modulation of MDM2 splicing.

1.1 Eukaryotic pre-mRNA splicing

The central dogma of gene expression dictates that the genomic information be transcribed into a pre-mRNA transcript that undergoes several processing events including 7-methylguanosine (m7G) capping at the 5’ end, polyadenylation at the 3’ end and splicing to generate the mature messenger RNA (mRNA) used for protein production via translation. Pre-mRNA splicing is the complex, multi-stage process by which the non-coding sections of the transcript called the introns are removed and the protein-coding exons are ligated together. This process is mediated by a large macromolecular machine termed the spliceosome which recognizes the boundary between exons and introns by means of the degenerate but strictly conserved signals.

The 5’ end of the intron is marked by a di-nucleotide GU called the donor or the 5’ splice site (ss) that is flanked by slightly less conserved signals (CAG/GURAGU) [2]. The 3’ end of the intron is demarcated by a conserved di-nucleotide AG called the acceptor or the 3’ splice site, an upstream branch point A (YNYCRAY: typically 18-40 bases from

3’ss) and an intervening polypyrimidine tract. The splicing process itself takes place in two transesterification steps the first of which involves the formation of a lariat structure as the result of nucleophilic attack on the phosphate at the 5’ss by the 2’OH group of the branchpoint A. In the second transesterification step, the reactive 3’OH group at the detached 5’exon makes a nucleophilic attack on the 3’ss leading to the ligation of the two exons and the release of the lariat which is subsequently debranched and degraded

[3].

The spliceosome that catalyzes the splicing reaction is an intricate and highly dynamic RNA-protein complex that constitutes one of the largest molecular machines in the cell. The components of the spliceosome include the 5 major UsnRNPs (Uridine rich small nuclear Ribonucleoproteins) and other non-snRNP splicing factors. The UsnRNPs themselves are RNA-protein complexes comprising a specific UsnRNA (U1, U2, U4, U5 and U6) bound by a hetero-heptameric Sm or Sm-like protein ring (Sm proteins B’/B, D3,

D2, D1, E, F and G or the Sm-like proteins LSm 2-8 for U6snRNA) and other UsnRNP specific proteins [4]. The assembly of the individual UsnRNPs is itself a complex, multi- step process that involves shuttling of both the RNA and protein components between the nucleus and the cytoplasm. All UsnRNAs except U6 are first transcribed by the RNA polymerase II, capped at the 5’ end with m7G and are transported to the cytoplasm where the Sm ring is assembled onto the RNA by the SMN (Survival Motor Neuron)-

Gemin complex. Additionally, the 3’ ends of the UsnRNAs are exonucleolytically cleaved to maintain a stem loop structure on the mature snRNA [4]. Their 5’ caps are subsequently hypermethylated into 2,2,7-trimethylated Guanosine (m3G) and the

UsnRNA-Sm complexes are imported to the nucleus where the other protein components unique to each UsnRNP are assembled. A total of about 45 proteins are

2 recruited as core factors of the snRNPs in their pre-assembled state including some non-SR RS-domain (Arg-Ser rich) containing proteins (U1-70K) [4-6]. Aside from these, a dynamic set of over a 100 non-UsnRNP proteins are known to associate with the spliceosome as part of its core components during the splicing process [5].

U6snRNA is transcribed by RNA polymerase III [7] and is assembled into the

U6snRNP complex within the nucleus itself. It is also different from the other UsnRNAs in that its 5’ cap is a γ-monomethyl structure and it is bound by the Sm-like or Lsm protein heptameric ring [4]. All UsnRNAs are post-transcriptionally modified at conserved internal residues via pseudouridylation and 2’O methylation which is important for complex stability and splicing [8]. In general, the length and secondary structure of the

UsnRNAs are well-conserved in eukaryotes although, not so much their sequence.

U6snRNA on the other hand is more conserved in its sequence, length and structure and is involved in highly intricate and dynamic RNA-RNA interactions with U4snRNA and

U2snRNA that are crucial for the progression of the splicing reaction [9].

The stepwise assembly of the spliceosomal machinery at the core splicing signals on the introns catalyzes the splicing reaction. The earliest splicing-committed complex E consists of the U1snRNP bound at the 5’ss, the U2 Auxiliary Factors (U2AF)

65 and 35 at the polypyrimidine tract and the 3’ss respectively and the protein SF1 bound at the branch point A. The interaction of the U1snRNP with the 5’ss relies on the base-pairing between the U1snRNA and the nucleotides at the 5’ss, an event that is often facilitated by accessory splicing factors such as the SR proteins (Serine-Arginine rich proteins). In a subsequent ATP-dependent step, U2snRNP binds the branch point and forms the prespliceosomal complex A. During this phase, SF1 is displaced and

3 cooperation between the U2AF proteins and SF3b components of U2snRNP serves to stabilize the interaction of U2snRNP with the substrate at the branch-point.

Next, the tri-snRNP U4/U6.U5 (pre-assembled from U5 and the U4-U6 snRNPs which are extensively base-paired to each other) joins the A complex to form the pre- catalytic spliceosomal complex B. Following this, an extensive rearrangement of the complexes occurs as the result of which the U4-U6 snRNA base pairing is lost. The

U6snRNP establishes new interactions with the 5’ss in the place of U1 and also with

U2snRNP in a ternary complex that involves base-pairing between U2 and U6snRNAs and the pre-mRNA (activated Bact and catalytically activated B* complexes). This reorganization leads to the expulsion of U1 and U4snRNPs and causes the juxtaposing of the branch-point and the 5’ss via U6-U2 in preparation for the first transesterification step. This represents the first catalytic complex C. Further rearrangements of the complex lead to the catalysis of the 2nd transesterification step of splicing and finally, the excision of the intron and the ligation of the two exons. Notably, the dynamic RNA-RNA interactions and the extensive structural rearrangements that occur during the splicing process are fueled by ATP hydrolysis mediated by several RNA-dependent ATPases

(DExD/H-box helicases) recruited as part of the spliceosome complex during various stages of splicing. At the end of reaction, the UsnRNPs are released from the substrate and reused for subsequent splicing reactions.

The splicing reaction is contingent on the coordination between the spliceosomal components assembled at the 5’ and the 3’ splice sites. The variable lengths of the exons and introns in the genome pose a challenge to the accurate pairing of sites to ensure correct splicing patterns [10]. For instance lower eukaryotic genomes possess long exons and relatively short introns while this architecture is reversed in higher

4 eukaryotes [11]. Currently, two models exist that describe the precise recognition of exon-intron boundaries by the spliceosome. The intron definition model that applies in the context of long exons flanked by relatively short introns (<250 bp) suggests that the spliceosome forms across the intron by pairing the splice sites across the intron [12, 13].

However, in the context of exons flanked by relatively long introns (>250 bp), the 3’ss

(upstream of the exon) and the 5’ss (downstream of the exon) are paired for spliceosome complex formation thereby defining the exon rather than the intron for splicing. This model is called the exon definition model [12-14]. Considering that the mammalian genome primarily consists of exons that are relatively short (average length of 100-300 nt) flanked by longer introns (average length >300 nt), it is likely that exon definition is the preferred mode of splicing prevalent in this system [15, 16].

The splicing of introns as mediated by the major spliceosome in eukaryotes bears striking mechanistic and also structural similarities with group II self-splicing introns (RNA based catalysis: ribozymes) particularly in the use of the branch-point adenosine [9, 17, 18]. However, the functioning of the RNA components of the spliceosome (from directing splice site recognition to the extensive structural remodeling that is integral to splicing) is deeply interwoven with its accessory proteins making the spliceosome a highly protein-laden machine. Indeed, the spliceosome is known to harbor a population of over 200 proteins during the various stages of the splicing reaction that includes both the core components (UsnRNP proteins) and other accessory factors [19]. Moreover, the protein composition of the spliceosome at each stage is dynamic and features frequent alterations due to the relative abundance and post- translational modifications of the protein splicing factors (1/3rd of the proteins associating with the spliceosome were observed to be phosphorylated) [5]. The RNA-protein

5 interdependence characteristic of spliceosome-mediated intron excision combined with dynamic nature of the configuration and interactions of the spliceosome and its substrates provides room for flexibility in splicing choices. Importantly this affords the opportunity for a high level of regulation of the pre-mRNA splicing process. Indeed, this flexibility is clearly evident in the phenomenon of alternative pre-mRNA splicing.

1.2 Alternative splicing

Alternative splicing is the differential inclusion of exons or sections of the pre-mRNA in the final transcript due to altered splice site choices by the spliceosomal machinery resulting in multiple mRNA isoforms from the same precursor. Alternative pre-mRNA splicing was first observed in Adenovirus 2 mRNA transcripts in the late 70’s [20, 21] and was subsequently described in calcitonin for the first time in eukaryotic genomes [22]. It is now known that alternative splicing occurs in >90% of genes and greatly impacts the physiology of the cell due to its influence on proteome diversity, mRNA stability (AS-

NMD) [23-27] and translational control [28]. The four major types of alternative splicing include alternative 5’ss (7.9%) or 3’ss (18.4%) selection, altered exon inclusion (inclusive of cassette and mutually exclusive exons) and intron-retention (2.8%) with cassette exon skipping events representing the most abundant type (38.4%) [29, 30]. From henceforth, we will examine alternative splicing in the context of cassette exons. In general, alternative exons have lower splice site strength (determined as the affinity of the

UsnRNPs for the splice sites based on sequence complementarity [31]), are shorter in length, show higher sequence conservation and frame preservation compared to constitutive exons (whose splicing is not subject to regulation and which are predominantly included in the final transcript) [32, 33]. Furthermore, intronic sequences flanking alternative exons show significantly higher levels of conservation (an average of

80% conservation) [30, 34, 35]. Taken together, these results indicate the evolutionary importance of alternative splicing and the necessity to maintain tight regulatory control of these events.

1.3 Regulation of alternative splicing

Considering that the core splicing signals that mark intron and exon boundaries are degenerate in nature, it is necessary for additional regulators to direct the spliceosome toward the appropriate target splice sites. Typically cis elements on the pre-mRNA and the interacting trans protein factors act in a coordinated manner to facilitate splicing decisions and constitute the splicing regulatory system. Cis-acting splicing regulatory elements (SREs) on the pre-mRNA target are instrumental in coordinating the splicing of both constitutive and alternative exons and function via RNA-protein and RNA-RNA interactions (secondary structures) both from locations proximal to and distal from relevant splice sites [36-41]. SREs are classified into splicing enhancers (SE: favor inclusion) or silencers (SS: favor exclusion) depending on their function and may be intronic (ISEs and ISS) or exonic (ESEs and ESS) based on location. Several approaches including splicing reporter and minigene-based assays and site-directed mutagenesis have traditionally been utilized to locate and characterize SREs involved in naturally occurring alternative splicing events [16]. Aside from these, large scale in vivo

(cell line-based) biochemical screening techniques in combination with computational genomic analyses have enabled the definition of general consensus sequences for enhancer or silencer SREs from random oligonucleotide libraries [42-46]. In general, exon-based SREs (ESEs and ESS) have been more extensively characterized than

ISREs [16, 43].

Another widely used approach to locate SREs is via the identification of binding sites for trans splicing regulatory factors. Canonically, ESE elements are bound by SR proteins (Serine-Arginine rich proteins) a class of RBPs, which are considered to be positive regulators of splicing and favor exon inclusion. On the other hand ESS and ISS elements are considered as primary binding sites for the hnRNP (heteronuclear

Ribonucleoprotein) family which typically promotes exon skipping. Besides these other

RNA-binding proteins such as the RBFOX (RNA binding protein, Fox1 homolog) family

[38, 47-63], ESRPs [56, 64, 65], Nova [66-69] and MBNL [52, 56, 70-73] are known regulators of alternative splicing. In vitro SELEX (Systematic Evolution of Ligands by

Exponential Enrichment) based experiments were used to iteratively select for oligonucleotides from randomized pools that showed high-affinity binding to purified trans factors. This approach was extensively used to determine consensus binding sites for several SR proteins and served as the basis for ESE prediction methods including

ESEfinder [74-77]. An important caveat of this technique is that it does not reflect in vivo binding capacities where other parameters including RNA secondary structure, other

SREs and competing splicing factors can potentially influence the interaction between a trans factor and its consensus sequence determined via SELEX. Additionally, the sequences identified using SELEX represent only the highest order of binding affinity for a specific trans factor under highly stringent conditions. As a result, other naturally occurring binding sites may not identifiable, based on SELEX-generated data. However, the advent of CLIP (Cross-Linking Immuno Precipitation) based techniques has overcome this and has greatly facilitated the precise identification of in vivo binding sites across the transcriptome for several trans splicing regulatory factors [36]. Moreover, this technique provides unique insight into the relationship between trans factor binding and

8 the alternative splicing patterns of target transcripts and will eventually help identify a

“splicing code” predictive of RBP binding and splicing regulation.

1.4 Mechanisms of alternative splicing regulation

Alternative splicing is regulated very precisely by an intricate network of interactions between the core spliceosomal complex and the splicing regulatory factors such as the

SR proteins and the hnRNPs on the target pre-MRNA. Several mechanisms have been proposed to explain the alteration in splice site choices under conditions of regulated splicing.

SR proteins: represent a class of splicing regulators that often bind ESE elements and promote exon inclusion and are among the best studied categories of splicing regulators.

SR proteins, so named because of their C-terminal RS (Arg-Ser rich domain) domain

[78] are phospho-proteins that interact with purine-rich sequences on the pre-mRNA via an N-terminal RNA recognition motifs (RRM). The RS domain fosters protein-protein interactions. As positive regulators of splicing, these proteins facilitate recruitment of the

U1snRNP to the 5’ss and the U2AF proteins to the 3’ss flanking the regulated exon thereby promoting its definition during early stages of spliceosome assembly. It has been postulated that these effects are mediated by direct interaction of the SR proteins with core components of the spliceosome (U1-70K of U1snRNP and U2AF35) via the

RS domains in these proteins under hyper-phosphorylated conditions [6, 79, 80]. In short, a general “rule” that may be considered as part of the splicing code is that SR proteins binding ESE elements on regulated exons mediate spliceosome recruitment at the weaker splice sites flanking the alternative exon and increase its inclusion in the final transcript. In an alternative model, the binding of SR proteins at ESEs on the target exon serves to antagonize the activity or binding of negative regulators such as the hnRNPs

9 thereby facilitating exon inclusion [6]. This has been exemplified in the case of the antagonistic relationship between hnRNPA1 and classical SR proteins SRSF1 and

SRSF2 in the context of the regulated splicing of HIV-1 tat exon 3 and SMN exon 7 [81,

82].

Another possible method of SR-protein mediated exon inclusion is through transcription-coupled splicing. Pre-mRNA splicing has been shown to occur co- transcriptionally in vivo and alterations in the rate of transcription elongation are known to affect splicing patterns [83-87]. For instance, a recent study showed that UV irradiation affects the phosphorylation of RNA polymerase C-terminal domain (RNA Pol

II CTD) thereby decreasing transcription elongation and inducing alternative splicing

[83]. Yet another study demonstrated that camptothecin-induced uncoupling of the spliceosomal and transcription complexes (interaction of EWS, an RNA pol II associated factor and YB-1 a spliceosome-associated factor, is inhibited by camptothecin) resulted in the alternative splicing of several genes including MDM2 [87]. Phosphorylation of the

Serine 2 residue of RNA Pol II CTD is associated with transcription elongation and is effected by the kinase P-TEFb (complex of CDK-9 and CyclinT1). P-TEFb has been shown to interact with the transcription elongation factor TAT-SF1 (component of the transcriptional complex) which in turn interacts with UsnRNPs thereby providing a means of connecting the transcriptional and spliceosomal complexes. Moreover, the interaction of TAT-SF1 and UsnRNPs has enhanced both transcription and splicing of an

HIV-1 reporter transcript [88]. Additionally, the CTD of RNA pol II serves as a hub for the recruitment of several pre-mRNA processing factors including SR proteins. Indeed,

SRSF2 (SC35) has been shown to affect transcription elongation and Ser 2 phosphorylation on select transcripts through its effects on P-TEFb recruitment [89]. This

10 raises the possibility that differential recruitment of SC35 to the RNA pol II complex during transcription elongation can also affect the splicing of regulated exons. Another example is the regulation of fibronectin EDI exon splicing by SRSF3 (SRp20). In this case SRSF3 caused the skipping of the EDI exon in a CTD-dependent but transcription elongation independent manner [90].

HnRNPs: are a family of RBPs that often function in repression of exon inclusion via their binding of ESS or ISS elements. HnRNPA1 and HnRNPI (Polypyrimidine Tract

Binding Protein 1 or PTBP1) represent the best characterized members of this protein family. HnRNPs are best known as antagonists of SR protein-mediated exon inclusion and several transcripts have been identified whose splicing patterns are sensitive to the relative levels of hnRNPs and SR proteins including HIV-1 exon 3, SMN, c-SRC N1 exon and Dscam (Down syndrome cell adhesion molecule; drosophila) [81, 91-96]. The mode of splicing repression by PTBP1 has been attributed to several mechanisms including the prevention of exon definition [97-100], masking of SREs [101], obstruction of

U1snRNP assembly [97] and restructuring of the pre-mRNA through inter and intra- molecular interactions to favor the splicing between distal splice sites [101-104]. Similar models have been proposed for hnRNPA1-mediated splicing repression. Its regulation of

Tat exon 3 splicing can be explained by the following models: a) hnRNPA1 masks binding sites for SRSF1 and SRSF2 on the exon and is reversed only at higher stoichiometric concentrations of the SR proteins or b) hnRNPA1 interferes with

U2snRNP assembly or c) hnRNPA1 mutlimerization leads to reorganization of the RNA structure in a manner similar to PTBP1 thereby mediating exon exclusion [3].

However, it should be noted that the role that a particular SRE and hence its binding protein, plays is strongly dependent upon its location and context [47, 105-115].

For instance, binding of splicing regulatory trans factors on introns versus exons can have opposite effects on exon inclusion. An example of such a scenario is hnRNP H whose binding to a G-rich site in the exon 7 of β-tropomyosin causes splicing repression but which mediates exon inclusion when bound to a similar site located in the intron downstream of the 5’ss [116, 117]. This is also true in the case of SR proteins [107-109,

112] where additionally, different binding positions even on the same exon or competition with other SR proteins can have opposite effects on splicing [47, 110, 111,

113-115]. Also, the binding of a trans splicing regulatory factor to either the upstream or the downstream intron relative to the alternative exon can determine its role as an activator or silencer of the splicing of the exon. This phenomenon was first documented in the splicing regulation mediated by Nova (splicing activation when bound to downstream intronic site but splicing repression from the upstream intron) [118].

However, since then such behavior has been reported in several splicing regulators including PTBP1, based on data obtained from RNAi mediated knock-down of these proteins (knock-down resulted in both exon-skipping and inclusion events) and CLIP- based mapping of their binding sites [36, 119].

Overall, alternative splicing is a very complex and intricate process that requires regulation at multiple levels by the interaction of cis elements and trans factors. Recent studies have shown that even epigenetic modifications and nucleosome positioning over exonic or intronic regions of the genome can affect the splicing patterns of the transcripts through complex mechanisms [120]. Hence it is important to understand that deregulation of the splicing system at any level can have long-standing effects on cellular function.

1.5 Implications of alternative splicing in disease and cancer

Alternative splicing is a major contributor to protein diversity and mRNA quality control within the cell. Emerging evidence suggest that alternative splicing networks are crucial in mediating physiological changes within the cell including response to stress or external stimuli and cell differentiation. Hence it is no surprise that alternative or aberrant splicing events induced by mutations or changes in the splicing regulatory landscape play an important role in disease etiology. For instance, several studies have demonstrated the importance of splicing regulation by tissue-specific regulatory RBPs such as nPTB [121], RBFOX [49, 50] and MBNL [71, 122] in the context of neuronal and muscle differentiation. Mutations in the RBFOX locus are associated with a broad spectrum of neurological disorders including epilepsy, autism and mental retardation indicating the wide spread impact of the impairment of RBFOX function on developmental programs [123, 124]. Neuro-muscular disorders including spinal muscular atrophy (SMA), Duchenne Muscular Dystrophy (DMD) and myotonic dystrophy,

Hutchison-Gilford progeria syndrome and retinitis pigmentosa represent prime examples of diseases with alternative splicing at the heart of their etiology [125, 126].

Disease associated alternative splicing events can be due to mutations in cis i.e. mutations that disrupt specific SREs or splice sites (10% of disease causing mutations

[127]) resulting in altered gene expression. A recent study showed that approximately

25% of nonsense or mis-sense mutations (Human Gene Mutation Database: HGMD) disrupted SREs with majority of these mutations causing with loss of ESEs or gain of

ESSs [128]. A typical example of this scenario is the c.5242C>A missense mutation that occurs in exon 18 of BRCA1 in several breast and ovarian cancers. This mutation results in the creation of an ESS with high binding affinity for hnRNPA1 and hnRNPH/F and

13 causes the skipping of exon 18 [129]. Yet another example includes missense mutations in the hereditary non-polyposis colorectal cancer (HNPCC) associated genes hMLH1

(c.842C>T in exon 10: SRSF1 and SRSF2 motifs) and hMSH2 (c.806C>T in exon 5:

SRSF6 motif) that result in the disruption of ESE motifs causing the exclusion of the pertinent exon from the final transcript [130]. The Survival Motor Neuron (SMN) genes 1 and 2 present an interesting example of two nearly identical loci with vastly different pre- mRNA splicing patterns. Here, a C>T transition in exon 7 of SMN2 disrupts an ESE

(SRSF1 site) while creating an ESS (hnRNPA1) thereby drastically reducing the inclusion of exon 7 in SMN2 and leading to lowered levels of functional SMN protein

[82]. This relates to the pathogenicity of the SMA (Spinal Muscular Atrophy) disease in which SMN1 is inactivated and SMN2 becomes the primary source of SMN.

Alternately, mutations in core spliceosomal machinery or “trans mutations” can affect the splicing of several transcripts and lead to disease. Retinitis pigmentosa is one such disease where hypomorphic mutations in PRPF31, PRP8, PRP3 or SNRNP200 result in lowered levels of these core spliceosomal components essential for U4/U6.U5 snRNP assembly [131]. Yet another scenario is the sequestration of crucial splicing factors by tandem repeat elements on toxic RNA which forms the basis for some diseases including myotonic dystrophy. Here, the splicing regulator MBNL accumulates on expanded CUG or CCUG repeats on DMPK transcripts resulting in loss of MBNL functionality and disease phenotype [132]. Aside from these, over-expression, depletion or altered localization and activity of crucial splicing factors such as the SR proteins and the hnRNPs can contribute to wide-spread alterations in cellular splicing networks leading to various disorders.

Alternative or aberrant splicing plays an important role in several neoplastic processes and contributes to numerous cancer types often by causing upregulation of tumorigenic isoforms of cancer-associated genes. For example, deregulated splicing pathways leading to the generation of oncogenic isoforms of the FGFR (Fibroblast

Growth Factor Receptor) family (IIIb and IIIc) cause the hyper-activity of FGF signaling pathways and contribute to epithelial mesenchymal transition (EMT) and metastasis in prostate and bladder cancers [133]. Aerobic glycolysis or the Warburg effect which is a hallmark of cancer cells features an increase in the levels of oncogenic isoform PKM2

(embryonic form of pyruvate kinase) obtained as the result of alternative splicing driven by hnRNPA1, A2 and PTBP1 [134]. Studies examining genomes and exomes for pathogenic variants across several cancer types have uncovered several somatic mutations that affect core spliceomal machinery in several malignancies [135]. For instance, mutations in the components of core splicesomal machinery like SF3b1

(component of the U2snRNP) and U2AF35 are frequently observed in several myelodysplastic syndromes including chronic myeloid leukemia (CML), uveal melanomas, lung adenocarcinomas, breast and pancreatic tumors [136].

Additionally, aberrant expression of splicing regulatory proteins can affect the splicing of a wide network of transcripts and contribute to oncogenesis. For instance,

SRSF1 is itself considered a proto-oncogene and is upregulated in several tumor types including breast cancer [137]. In its capacity as a splicing regulator, SRSF1 activates the splicing of oncogenic isoforms of a wide array of genes involved in control of proliferation, apoptosis and EMT. Notable examples include tyrosine kinase receptor

RON (skipping of exon 11 resulting in oncogenic ΔRON) [138], apoptosis regulator BIN1

(inclusion of exon 12A to generate isoform with no anti-tumor activity) [139] and S6

15 kinase 1 (novel isoform 2 of S6K1 induced by SRSF1 that has transformative properties)

[140]. Moreover, a recent study demonstrated that SRSF1 is under the transcriptional control of the oncogene c-Myc, further cementing its importance in oncogenesis. Other splicing factors implicated with oncogenic roles include SRSF3 (SRp20) and SAM68 which are also upregulated in numerous cancer types. One study that examined splicing alterations in a model of EMT uncovered the role of several splicing regulatory factors such as RBFOX, ESRPs (Epithelial splicing regulatory proteins), MBNL, CELF and hnRNPs in inducing alternative splicing of genes involved in EMT-associated processes including cell migration and cytoskeletal remodeling [56]. Importantly, somatic mutations in specific genes that disrupt SREs (intronic or exonic) or consensus splice sites can affect accurate pre-mRNA splicing and lead to the over-representation of aberrant splice isoforms in cancer. For instance, about 25 mutations previously considered as unclassified variants, have been identified in BRCA1 (intronic and exonic) in breast and ovarian cancers that potentially affect BRCA1 splicing [141].

Taken together, these studies clearly indicate the impact of alternative splicing pathways on tumorigenesis. Furthermore, they serve to illustrate the complex nature of the splicing alterations that are observed in cancer and the need to gain a comprehensive understanding of these pathways for the development of novel splicing modulation therapeutics. It is also important to note the intricate interplay between the alternative splicing and oncogenic signaling pathways such as c-Myc and PI3/AKT

(Phosphoinositide-3 kinase) [134, 142, 143]. Another crucial cancer pathway that is greatly impacted by alternative splicing is the p53 tumor-suppressor pathway.

1.6 Tumor suppressor p53 and its antagonists MDM2 and MDMX p53, the archetypal tumor-suppressor is known as the guardian of the genome as it is crucial for maintaining the integrity of the genome especially in response to genotoxic stress [144, 145]. p53 is a transcription factor whose targets include critical regulators of cell-cycle checkpoints (e.g. p21, 14-3-3), apoptosis (e.g. Bax, Fas) and DNA damage repair (e.g. GADD45) [146]. It comprises an N-terminal transactivation domain, a central

DNA binding domain (through which it interacts with p53 responsive promoters) and a C- terminal oligomerization domain which also contains nuclear localization and export signals in addition to a second, non-specific DNA binding domain [147, 148]. When activated, p53 induces cell-cycle arrest and/or apoptosis in cells and hence under homeostatic conditions p53 expression and activity are maintained at very low levels.

This is primarily due to the interaction of p53 with its negative regulators including the E3 ubiquitin ligases MDM2, COP1, PIRH2, TRIM24, CARP1 and CARP2 which target key

Lysine residues on p53 (most of which lie in the C-terminus) for poly-ubiquitination and lead to the degradation of p53 [149-153]. In addition, MDMX, a close family member and structural homolog of MDM2, also negatively regulates p53 by cooperating with MDM2 to target p53 for degradation or block p53’s transcriptional activity. To date, the nature of the interactions between MDM2, MDMX and p53 are the best characterized.

Inactivation of the p53 pathway is frequently observed in tumors often due to p53 mutations or the over-expression of its negative regulators MDM2 and MDMX. P53 mutations are observed in almost all tumor types albeit with different frequency of occurrence. For instance, ovarian cancers (~ 50%) show the highest frequency of p53 mutations while sarcomas and leukemias (about 5%) generally present with very low incidence of p53 mutations [154]. Almost 80% of the somatic mutations are mis-sense

17 mutations and in general, mutations in p53 occur within the DNA binding domain, known as the hot spot region. Codons 175, 245, 248 and 273 are most frequently mutated in cancers. Germ-line mutations of p53 lie at the heart of the etiology of a familial syndrome called the Li-Fraumeni syndrome (LFS) that manifests as a wide spectrum of early onset malignancies. Breast cancers represent the highest frequency of occurrence (50%) in

LFS but soft tissue sarcomas including bone sarcoma and rhabdomyosarcomas are also often observed [154]. In some tumor types, mutant p53 protein accumulates that displays dominant negative effects on wildtype p53 and gain of function (GOF) properties that influence tumorigenesis. R175H and R273H are two such mutations whose expression in vivo in mice increased metastasis and altered tumor burden compared to p53 knockout mice possibly due to their effects on wildtype p53 and cooperation with other oncogenic pathways because of altered transcriptional capacities

[154-156].

1.7 Regulation of p53 by MDM2

Murine Double Minute 2 (MDM2) was originally identified as part of a highly amplified locus (>50 fold) on double minute chromosomes in 3T3-DM cells (spontaneously transformed murine BALB/c cell line) and which was eventually recognized with transformative properties [157, 158]. The protein encoded by MDM2 (exons 3-12: 491 amino acids) is an E3 ubiquitin ligase with a characteristic RING domain at its C-terminal end (amino acids 433 to 488, exon 12) [159] (Fig 1.1). MDM2 also dimerizes via this domain. The N-terminus of MDM2 contains its p53 interaction domain (amino acids 19 to

108, exons 3-6) through which it binds the N-terminal transactivation domain of p53

[160, 161] (Fig 1.1). MDM2 also has a central acidic domain, a zinc finger domain and nuclear localization and export signals (ranging from amino acids 178 to 332, exons 9-

12) (Fig 1.1). Often considered the chief regulator of p53, MDM2 forms homodimers or heterodimers with MDMX that interact with and inhibit p53 activity or induce its ubiquitination [149] (Fig 1.3). Additionally, MDM2 has been shown to cooperate with p300/CBP (CREB binding protein) through its acidic domain to induce the polyubiquitination of p53. Mono-ubiquitination of p53 is also induced by MDM2’s E3 ligase activity. However, this does not activate p53 degradation but rather promotes p53 export from the nucleus and hence sequesters it away from its transcriptional targets [162,

163]. Apart from ubiquitination, MDM2 has also been shown to promote SUMOylation

(small ubiquitin-related modifier 1) and NEDDylation of p53 to inhibit its transcriptional activity [164, 165].

Interestingly, MDM2 maintains a negative feed-back loop with p53. MDM2 transcription is controlled by 2 promoters P1 and P2. The P1 promoter (upstream of exon 1) maintains basal transcription of MDM2 [166] while the P2 promoter located in intron 1 is responsive to several transcription factors including SP1, ETS and IRF8 [167].

Importantly, P2 based transcription is controlled by two p53 response elements located upstream of P2 on intron 1 making MDM2 a bona fide transcriptional target of p53 [168]

(Fig 1.1). This relationship creates an auto-regulatory feed-back loop that helps strike a balance in the relative levels of MDM2 and p53 within the cell. Transcripts from P1 and

P2 are identical except in their 5’UTRs (untranslated region). P1 promoter based transcripts do not possess exon 2 and include exon 1 in the 5’UTR while P2-based transcripts include exon 2 but not exon 1 in the 5’UTR [169] (Fig 1.1). Although, the protein products are identical, the translational efficiency of P1-based transcripts is 8 fold lower than P2-based mRNA [170-172]. Additionally, MDM2 regulates its own levels by auto-ubiquitination [159, 173].

The interaction of MDM2 with p53 through its N-terminal domain fosters the degradation of p53 or the inhibition of the latter’s transcriptional activity [149, 160, 161]

(Fig 1.3). This is critical because the deletion of Mdm2 in vivo in mice results in embryonic lethality (by day E6.5) as the result of massive p53-induced apoptosis [174].

However, in response to stress or under conditions requiring p53 activity, several mechanisms are triggered that interfere in the interaction between MDM2 and p53 and result in stabilization of p53. These include post-translational modifications of both proteins and also the interactions of MDM2 with its negative regulators (Fig 1.3).

Aside from ubiquitination, both MDM2 and p53 are substrates for a plethora of post-translational modifications like phosphorylation, acetylation, sumoylation neddylation and methylation with phosphorylation playing a major role in the regulation of MDM2-p53 interactions [164, 165] (Fig 1.3). For instance, in response to DNA damage, MDM2 is rapidly phosphorylated by several kinases including ATM (Ataxia

Telangiectasia Mutated), DNA-PK (DNA phospho kinase), Chk1, Chk2 and c-Abl. With the exception of DNA-PK (targets Ser 17 in the p53 binding domain), all other kinases target specific Serine or Threonine residues in the central acidic domain or the C- terminus of MDM2. These multi-site phosphorylation events serve to inhibit p53 and

MDM2 interaction and lead to the stabilization and activation of p53. One notable example is the phosphorylation of MDM2 Ser 15 and Ser 395 by ATM kinase that are crucial for p53 accumulation under DNA damage conditions [175]. Interestingly, phosphorylation of Ser 395 stabilizes p53 levels not only by interfering with MDM2-p53 interactions, but also by promoting the interaction of MDM2 (via the RING domain) with p53 mRNA thereby enhancing p53 translation [176, 177]. Conversely, the reactivation of the inhibitory effects of MDM2 after recovery from DNA damage, can be induced by

20 dephosphorylation at Ser 15 and Ser 395 by phosphatases like WIP1 (Wildtype p53 induced phosphatase 1) and PPM1D [178, 179]. Additionally, MDM2 phosphorylation by

Akt, Ck1 and 2 (Caesin kinases) CDK1 and 2, leads to the stabilization of MDM2 and stimulates MDM2-mediated p53 inhibition [178, 179].

The interaction of MDM2 with its negative regulators is another means of stabilizing p53. ARF (alternate reading frame), a tumor-suppressor, interacts with MDM2 through the acidic domain and sequesters MDM2 in the nucleolus resulting in p53 stabilization under stress [180, 181]. Interestingly, ARF is a transcriptional target of c-

Myc which, under certain conditions can trigger apoptotic pathways [182, 183]. Other negative regulators of MDM2 include the ribosomal proteins L5, L23 and L11 whose interactions with MDM2’s acidic domain serve to sequester MDM2 and activate p53 under conditions of ribosomal stress [184]. Additionally, deubiquitinating enzymes like

HAUSP have been shown to remove ubiquitin moieties from both p53 and MDM2 and stabilize these proteins [185-188]. Taken together, these findings serve to underscore the immense importance of maintaining a tight control of MDM2 and p53 interaction in cells both under normal and stressed conditions.

1.8 Regulation of p53 by MDMX

MDMX (MDM4), also a negative regulator of p53, is a close family member of MDM2 with similar gene protein architecture [189]. MDMX is also transcribed from 2 promoters

P1 and P2 that are arranged in a manner similar to MDM2 and result in transcripts with different 5’UTRs (Fig 1.2). Although P2 promoter of MDMX also has upstream p53 response elements, the activation of MDMX transcription on response to p53 is not to the same level as MDM2 [190]. MDMX also comprises an N-terminal p53 binding domain, central Acidic and Zinc finger domains and a C-terminal RING domain similar to

MDM2 (Fig 1.2). However, MDMX has not been demonstrated with E3 ubiquitin ligase activity. MDMX typically forms heterodimers with MDM2 to form complexes that are more stable than MDM2 homodimers [191, 192]. MDM2-MDMX heterodimers are more efficient in ubiquitinating p53 and this interaction has been shown to be essential to maintain low levels of p53 during embryogenesis [193-200] (Fig 1.3). Moreover, MDMX binds p53 at N-terminal transactivation domain of p53 and is capable of inhibiting p53- mediated transcription [201] (Fig 1.3). Additionally, MDMX stability is dictated by

MDM2’s E3 ubiquitin ligase activity [202]. Like MDM2, MDMX is also an essential gene whose deletion in the presence of wildtype p53 in vivo in mice results in embryonic lethality (E7.5-8.5) due to p53-dependent cell-proliferation arrest [203]. The different modes of embryonic lethality due to differences in cell fate upon MDM2 and MDMX deletion suggest non-overlapping roles for MDM2 and MDMX in p53 regulation [203,

204]. MDMX also presents with similar post-translational modifications as MDM2 that regulate its interaction with and control of p53 activity under conditions of cellular stress

[179, 205].

1.9 MDM2 and MDMX in cancer

The over-expression of MDM2 and MDMX via amplification at their locus or enhanced transcription (SNP 309 G/G in the SP1 response element of promoter P2 of MDM2) leads to cellular transformation. Under these conditions MDM2 and MDMX are considered oncogenes. Amplification or over-expression of MDM2 is hallmark of several tumor types (overall frequency of 7% across 19 tumor types from 3889 tumors of 28 varieties) with the highest frequency of occurrence (~30% although the number has varied slightly in different studies) in different types of soft-tissue sarcomas [206-208].

MDMX over-expression is associated with several tumor types including a subset of

22 gliomas and about 19% breast carcinomas. Interestingly, only small percentage of tumors (5%) with over-expression of MDMX was attributed with gene amplification in this study [209]. However, a more recent study that examined ductal breast carcinomas reported MDMX over-expression in over 65% of the tumors with high frequency of low copy number amplification of the MDMX locus (57%). Moreover, this study reported a correlation between MDMX amplification and highly invasive carcinomas [210]. One common element in tumors presenting with over-expression of MDM2 or MDMX is a striking lack of correlation with mutations in p53 [206-210] indicating that mutations in p53 and amplification of MDM might be redundant neoplastic lesions.

Both MDM2 and MDMX when over-expressed in mouse models predispose the mice to the development of spontaneous tumors indicating their oncogenic properties

[211, 212]. Additionally, instances of cooperativity with other neoplastic lesions have been reported for MDM2 and MDMX mediated oncogenesis [209, 212, 213].

Furthermore, when expressed in p53-null or p53-heterozygous background, both MDM2 and MDMX caused a change in tumor spectrum toward a significantly higher incidence of sarcomas in the case of MDM2 over-expression (45%) and carcinomas in the case of

MDMX (13%) over-expression (p53 null or p53 heterozygous mice present with only about 9% sarcomas and 5% carcinomas respectively) [211, 212]. These findings are suggestive of p53-independent roles for MDM2 and MDMX in tumorigenesis. Indeed, both MDM2 and MDMX have been attributed with p53-independent roles in proliferation, stress-response, apoptosis and also in cancer metastasis through their regulation of critical regulators of these processes. For instance, MDM2 targets tumor-suppressor pRb (retinoblastoma) [214], FOXO3a (transcription factor involved in cell cycle control)

[215] and E-Cadherin (EMT). Additionally, MDM2 has been shown to possess RNA-

23 binding properties through its RING domain that result in increased stability (MYCN) or translation of the substrates (XIAP, p53, MYCN) [177, 216, 217]. Both MDM2 and

MDMX promote genomic instability independent of p53 and of each other and associate with and inhibit Nbs (Nijmegen Breakage Syndrome T cells), a member of the double strand break repair complex [218, 219].

Considering that the incidence of MDM over-expression does not correlate with p53 mutations and that majority of the tumors over-expressing either MDM2 or MDMX show wild-type p53, it is possible to consider restoration of p53 activity as a viable therapeutic option. To this end several small molecules have been developed that interfere with either p53-MDM2 interactions (e.g. Nutlin 3a, RITA) or p53-MDMX interactions (e.g. RO-5963) or both (e.g. SAH-p53-8) [179]. These compounds primarily result in stabilization and activation of p53. Aside from these small molecules that target interaction of MDM2-p53 complex with the proteasome (JNJ-26854165) or the E3 ligase activity of MDM2 (e.g. MEL23 and MEL24) have also been developed for anti-cancer therapies [179].

1.10 Alternative splicing of MDM2 and MDMX

Alternative splicing of MDM2 was first reported in a panel of tumors comprising ovarian and bladder cancers and leukemic cell lines and was observed to correlate with high-grade disease. The 5 major splice variants (named MDM2-A to E) isolated in this study were found to lack intact p53 binding domains and all except MDM2-E possessed

RING domains. Moreover, upon transfection into NIH-3T3 cells, all the splice variants promoted transformation [220]. Since then splice variants of MDM2 have been identified in multiple cancer types including rhabdomyosarcomas, soft tissue sarcomas, lung cancer, Hodgkin’s lymphomas and glioblastomas [220-232]. Moreover tumors arising in

24 a murine model of lymphomagenesis (Eµ-Myc mice) presented with spontaneous generation of MDM2 alternative splice forms [183]. We have recently demonstrated the occurrence of MDM2 splice variants, particularly MDM2-ALT1 (MDM2-B), in a panel of

70 pediatric rhabdomyosarcoma (RMS) samples in a subtype-specific manner (MDM2-

ALT1 occurred in 85% alveolar and in 70% embryonal but only in 20% anaplastic RMS samples). Moreover, we observed that MDM2-ALT1 transcripts correlated with metastatic disease in both alveolar and embryonal RMS subtypes [230]. Interestingly,

MDM2 splice variants, particularly MDM2-ALT1 is induced in cells in response to a variety of genotoxic stress inducing agents such including UV irradiation, cisplatinum and camptothecin [87, 233, 234].

Concordant with their incidence in tumors and correlation with metastatic disease, splice variants of MDM2 have been shown to possess tumorigenic properties upon over-expression. MDM2-ALT1 (MDM2-B; exons 3.12), MDM2-ALT2 (MDM2-A; exons 3.10.11.12) and MDM2-ALT3 (MDM2-C; exons 3.4.10.11.12) are thus far the best characterized splice isoforms of MDM2 (Fig 1.1). For instance, the mouse homolog of

MDM2-ALT1 (Mdm2-b) was demonstrated with tumorigenic properties in vitro when over-expressed in MEFs (mouse embryonic fibroblasts) [235]. Moreover, expression of this splice form in vivo in mice under the control of GFAP (Glial Fibrillary Acidic Protein) promoter, led to a significantly higher incidence of tumors compared to negative control mice between 80 and 100 weeks of age [235]. Similarly, expression of an MDM2-ALT1 like molecule in the hematopoietic compartment of Eµ-Myc mice accelerated lymphomagenesis [236]. Furthermore, we have demonstrated the tumorigenic and metatstatic potential of MDM2-ALT1 in RMS cell lines and also in non-transformed

C2C12 myoblasts (chapter 5 results) [230]. Importantly, a recent study in colorectal

25 cancer system showed that co-expression of MDM2-ALT1 with a gain of function mutant p53 exacerbated tumorigenesis [232]. In the case of MDM2-ALT2 (MDM2-A), its over- expression was found to have tumorigenic effects in a mouse model only upon ARF or p53 deletion and presented with a distinct tumor spectrum compared to controls (MDM2-

A positive mice had significantly more T cell lymphomas compared to p53 null mice)

[237]. Overall, these studies implicate an important role for the tumor-associated MDM2 splice variants in oncogenesis.

Despite their strong association with tumorigenesis, the role of MDM2 splice variants in cancer still remains unclear. This is because the primary splice variants

MDM2-ALT1, ALT2 and ALT3 lack p53-binding domains and as a result cannot function in the regulation of p53 [220, 231, 234, 238-240] (Fig 1.1). This is in contrast with full- length MDM2 whose oncogenic properties are mostly directed toward the suppression of the p53 pathway (Fig 1.3). Moreover, MDM2-ALT1 and MDM2-ALT2 have been shown to stabilize p53 when over-expressed [232, 234, 238-240]. This result is attributed to their ability to bind and sequester full-length MDM2 and also full-length MDMX (in the case of MDM2-ALT1, see chapter 4 results) thereby acting as dominant negative proteins (Fig 1.3). Furthermore, MDM2-ALT1, ALT2 and ALT3 have been shown to modulate the p53 tumor-suppressor pathway in distinct ways (refer to chapter 4 for

MDM2-ALT1 results) [223, 231, 234, 238-240]. Notably, alternative splicing of MDM2 is associated with stabilized wildtype p53 in RMS and glioblastoma tumors [224, 230].

Alternative splicing of MDMX is also observed in several tumor types [241].

MDMX-S was first described in tumor cell lines in 1999 by Rallapalli et al as an alternatively spliced form of MDMX with an internal deletion (skipping of exon 6) that led to the generation of a stop codon after amino acid 127 (Fig 1.3). The truncated protein

26 generated from this transcript contained only the p53 binding domain of full-length

MDMX and a stretch of 13 novel amino acid residues. MDMX-S was found to possess greater affinity (> 10 fold) for p53 binding and was more potent in the inhibition of p53 compared to its full-length counterpart [242, 243]. Subsequently, over-expression of

MDMX-S was observed in a panel of 66 soft tissue sarcomas (STS, in 14% of tumors) and was found to correlate with poor patient survival [244]. In addition, MDMX-S is also observed in gliomas and papillary thyroid carcinomas and its oncogenic properties are postulated to be due to its high affinity for p53 and its ability to block p53 activity [245,

246]. Moreover, it is possible that the ratio of MDMX-S to MDMX is a determining factor in tumor outcome. Interestingly, a recent study showed that forced or obligatory expression of MDMX-S by exon 6 exclusion from the endogenous locus in a mouse model, caused embryonic lethality that could not be rescued by p53 deletion implying additional roles for MDMX-S in cell physiology [247].

Aside from MDMX-S, other splice variants of MDMX have been identified such as

MDMX-ALT1 (exons 6-9 are skipped), MDMX-A (exon 9 skipped), MDMX-G (exon 3-6 skipped: loss of p53 binding domain) and MDMX-211 (exon 2 spliced to terminal exon

11) [233, 248, 249] (Fig 1.3). Interestingly, MDMX-211 which was first identified in thyroid carcinomas is capable of binding MDM2 and inhibiting its p53-regulatory functions leading to p53 stabilization. However, the stabilized p53 was found to be transcriptionally inactive [248, 249]. Yet another splice variant of MDMX is MDMX-ALT2

(exons 4-9 are skipped) that occurs in RMS tumors. MDMX-ALT2 is architecturally similar to MDM2-ALT1 in that it lacks a p53-binding domain but retains the RING domain

(Fig 1.3). Similar to MDM2-ALT1, MDMX-ALT2 is also expressed in a subtype-specific manner in RMS tumors (43% alveolar RMS and 39% embryonal RMS expressed this

27 variant) and its expression correlates with metastatic disease [230]. Moreover, there exists a unique coordination in MDM2-ALT1 and MDMX-ALT2 splicing in 24% RMS tumors. Additionally, when expressed in untransformed C2C12 myoblasts or an RMS cell line (Rh30), MDMX-ALT2 also confers tumorigenic properties to the cells [230].

Intriguingly, MDMX is also alternatively spliced in response to genotoxic stress in a manner similar to MDM2. We and others have shown that under stress, full-length

MDMX transcripts decrease with a concomitant increase in the levels of alternative splice forms of MDMX [230, 250]. We have observed the generation of MDMX-ALT2 in response to UV irradiation and cisplatinum treatment [230, 233, 250]. Further highlighting its similarity to MDM2-ALT1, we found that MDMX-ALT2 is also paradoxically an activator of the p53 tumor-suppressor network. This is because MDMX-

ALT2 over-expression also led to p53 stabilization and activation through its binding to full-length MDM2 and MDMX (chapter 4 results) [239]. Taken together, these findings highlight the complex nature of the regulation of the MDM2-MDMX-p53 axis through alternative splicing.

1.11 Why study MDM2 and MDMX alternative splicing?

Deregulated splicing pathways can have far-reaching consequences on the fate of the cell due to the integral role played by pre-mRNA splicing in the maintenance of normal cell physiology. Cancer cells take advantage of the intricately regulated splicing system and foster the generation of oncogenic isoforms that are anti-apoptotic and favor cell-proliferation and metastasis. The p53 tumor-suppressor pathway is subject to deactivation in most cancer types often due to the disruption of balance between p53 and its chief negative regulators MDM2 and MDMX. Alternative splicing of MDM2 and

MDMX has been observed in several tumor types and certain splice variants including

MDM2-ALT1 and MDMX-ALT2 have been shown to contribute to tumorigenesis in vitro and in vivo through unknown mechanisms. Paradoxically, MDM2-ALT1 and MDMX-

ALT2 are also capable of modulating p53 levels and transcriptional activity. Current therapeutic strategies often aim to revive the p53 pathway in tumor cells. It is possible that the presence of MDM2 and MDMX splice variants can affect the functioning of the p53 pathway once revived. Hence, it becomes important to gain a deeper understanding of the roles of MDM2 and MDMX splice variants in tumorigenesis and the nature of their interaction with the p53 pathway. Additionally, it is crucial to understand the pre-mRNA splicing mechanisms that lead to the generation of these splice forms in cancer. In the following study, we have attempted to uncover the regulation of MDM2 alternative splicing and have utilized genotoxic stress as a model system to understand this phenomenon. Using novel biochemical systems coupled with stress-responsive minigenes that simulate the damage-inducible splicing of MDM2, we have identified the crucial factors that are necessary for the normal splicing of MDM2 and also those that regulate the damage-responsive alternative splicing. Additionally, we have explored the functions of the splice variants MDM2-ALT1 and MDMX-ALT2 in tumorigenesis and also in the regulation of the p53 tumor-suppressor network using in vitro and in vivo model systems.

Figure 1.1: MDM2 alternative splicing. MDM2 is organized into 12 exons and is under the transcriptional control of the P1 and p53-responsive P2 promoter resulting in transcripts with different 5’UTRs (exon 1 or 2) but identical coding sequences (exons 3 to 12). Alternative splicing of MDM2 results in at least 10 bona fide splice variants 3 of which are depicted here. MDM2- ALT1, MDM2-ALT2 and MDM2-ALT3 lack an intact p53-binding domain are unable to regulate p53 unlike full-length MDM2. However, they possess the RING domain which enables dimerization with full-length MDM2.

Figure 1.2. MDMX alternative splicing. MDMX is similar in architecture to MDM2 and is encoded from exons 2 to 11. Alternative splicing due to variable inclusion of exons in the coding region results in proteins with varying roles in p53 regulation. * denotes premature termination codons. Domains missing from truncated proteins are bordered by dashed lines.

Figure 1.3: Regulation of p53 by MDM2 and MDMX. Under homeostatic conditions MDM2 and MDMX interact with and regulate the tumor suppressor protein p53 by poly-ubiquitinating and targeting it for proteasome mediated degradation or by inhibiting its transcriptional activity. Upon induction of genotoxic stress, the interaction between p53 and the MDM proteins is impaired by several mechanisms leading to the stabilization of p53 and the activation of cell-cycle arrest, apoptosis or repair pathways.

Chapter 2: Trans Regulators of MDM2 Splicing: Characterization of Far

Upstream Element Binding Protein 1 (FUBP1), Polypyrimidine Tract

Binding Protein 1 (PTBP1)

2.1 Introduction

Alternative splicing is typically regulated by the interaction of trans acting RNA binding proteins (RBPs) with specific motifs or cis elements on the pre-mRNA thereby directing splice site choices. Classical splicing regulators include the SR proteins

(Serine-Arginine rich proteins that possess a characteristic RS domain) and the hnRNPs

(heterogeneous nuclear RiboNucleoProteins) that bind splicing silencer or enhancer sequences on their target pre-mRNA and influence the decision of the spliceosomal complex. Aside from these other RBPs can function in conjunction with the SR proteins and the hnRNPs as tissue-specific splicing regulators. Well known examples include

RBFOX (RNA binding protein, Fox1 homolog) proteins [38, 47-63], TIA-1/TIAR (T cell- restricted intracellular antigen 1) [251-261], Hu family proteins [252, 253, 256, 262, 263],

Nova [66-69], ESRPs [56, 64, 65], CELF (CUGBP and ETR3 like Factors)family proteins

[56, 71, 72, 264, 265], KSRP [266], nPTB [67, 267], SAM68 (Src-Associated substrate in

Mitosis of 68 kDa) [268-275] and MBNL [52, 56, 70-73].

In order to understand the splicing regulatory functions of the various classes of

RBPs, it is important to locate and characterize their binding sites in the transcriptome.

Consensus sequences for individual RBP binding sites are often determined using in

vitro approaches such as SELEX (Systematic Evolution of Ligands by

Exponential enrichment) that iteratively select for short, high-affinity RNA oligos binding the purified RBPs. Indeed, several splicing regulatory element (SRE) identification software rely on sequence information obtained from such screens to predict or locate

RBP binding to the query pre-mRNA targets [74-77]. However, the sequences predicted by these approaches are not always truly representative of RBP binding due to the highly contextual nature of RBP-RNA interactions. Indeed, genome wide RBP-RNA interaction mapping studies (largely based on RNA-protein cross-linking) have implicated that the binding of the RBPs to the target sites on the pre-mRNAs and their effects on splicing are highly subject to regulation depending on the context, binding affinities, co-factors, competition with other regulatory proteins, post-translational modifications, RNA secondary structure and several other parameters. Adding to the complexity is the fact that the short, degenerate cis elements (splicing regulatory elements or SREs) representing the target sites for the splicing regulatory proteins can be recognized by multiple RBPs or their isoforms depending on the cellular context and a variety of other factors [36, 276]. Hence, establishment of consensus recognition sequences for every known RBP often presents with difficulty and in silico predictions of

RBP binding require additional confirmation via in vivo cross-linking approaches.

Another important drawback is that, while exon based SREs and their trans protein binding partners have been extensively analyzed, relatively little is known about intronic SREs (ISREs) [43, 276]. Introns represent the bulk of the pre-mRNA sequence when compared to the exonic sequences (intron lengths lie anywhere from 50nt to over

100kb while exons average between 100-300nt in length) and they house several important splicing regulatory elements in addition to the core splicing signals [15, 16].

The importance of ISREs in regulation of alternative splicing is underscored by the fact that the ISREs associated with alternatively spliced exons show high levels of conservation compared to those associated with constitutive exons [30, 277-279]. Here also, high-throughput approaches such as large-scale splicing reporter screens, comparative genomics and CLIP (Cross-Link immunoprecipitation) based assays on specific RBPs have been useful in elucidating and demonstrating the importance of intron-based splicing enhancer and silencer sequences (ISREs), their trans protein binding partners and their position-dependent splicing regulatory functions [43, 55, 118,

119, 276, 277, 279-282].

To elucidate the cis SREs and the trans acting RBPs governing the stress- responsive and cancer-associated alternative splicing of the oncogene MDM2 [220, 222-

229, 233, 234], we had previously developed an in vitro minigene based system.

Specifically, we have developed an in vitro splicing assay using nuclear extracts from normal and cisplatinum-treated HeLa S3 cells and a damage-responsive MDM2 minigene. The MDM2 minigene (referred to as the 3-11-12 minigene) comprises exons 3 and 12 (that are spliced together in the MDM2-ALT1 isoform) and an intervening exon

11 flanked by evolutionarily conserved sequences from introns 3, 10 and 11 [283].

Importantly, the MDM2 3-11-12 minigene, when expressed in cell-lines, faithfully recapitulates the splicing patterns of endogenous MDM2 in that the internal exon 11 is spliced under normal conditions but is skipped specifically under DNA damaging conditions. The MDM2 3-11-12 minigene is also damage-responsive in vitro. When in vitro transcribed MDM2 3-11-12 pre-mRNA molecules are incubated in nuclear extracts from normal HelaS3 cells, the spliced product that is primarily detected is the full-length

3.11.12 transcript. However, in nuclear extracts from cisplatinum treated HelaS3 cells,

35 the predominant spliced product is the 3.12 transcript that excludes exon 11.

Furthermore, this damage-responsive behavior is transcript specific. A minigene comprising exons 7, 8 and 9 and the flanking introns of p53, which does not exhibit damage-responsive alternative splicing, shows similar splicing patterns in nuclear extracts from both normal and cisplatinum treated HelaS3 cells [283].

Using this in vitro splicing assay we have previously demonstrated the presence of evolutionarily conserved regions in intron 11 of MDM2 that are important for the normal and damage-induced alternative splicing of the MDM2 3-11-12 minigene

[283]. In this study, we have narrowed down specific cis ISREs within intron 11 that influence the regulation of damage-inducible exon 11 skipping of the MDM2 minigene

[284]. Further, we have identified potential regulators of the alternative splicing of MDM2 by isolating the trans protein factors that exhibited differential binding at these intron 11 cis elements under normal and cisplatinum-damage conditions [284]. As part of this screen we identified FUBP1 (Far Upstream Element Binding Protein 1) and

Polypyrimidine Tract Binding Protein 1 (PTBP1) as potential regulators of MDM2 splicing and have used a candidate approach to characterize their roles in this context [284].

2.1.1 Far Upstream Element Binding Protein 1 (FUBP1)

FUBP1 is considered a protooncogene and is a biomarker for a variety of cancer types in which it is highly expressed including hepatocellular carcinoma, NSCLC (non small cell lung carcinoma), gliomas and gastric cancer [285-291]. However, in oligodendrogliomas, where its expression is abolished due to mutations, FUBP1 is considered a tumor-suppressor [290, 292, 293]. Functionally, FUBP1 is a DNA Helicase

V [294] and is best known for its role in the transcriptional upregulation of c-MYC through its binding of ssDNA at the FUSE (Far Up Stream Element) [295] via the 4 tandem KH

(K-Homology) motifs in its central domain [296, 297]. However, it is capable of binding ssRNA and post-transcriptional functions have been described for FUBP1 in mRNA turnover and translation control [298-301]. While a close family member FUBP2

(KHSRP) is a known splicing regulator [266], FUBP1 itself had previously not been implicated in splicing despite the fact that its presence had been identified in the spliceosomal complex [19]. It was only recently that evidence describing a splicing regulatory role for FUBP1 emerged in which FUBP1 has been demonstrated to function as a suppressor of the second step of splicing through its binding of a 30nt AU-rich ESS element (Exonic Splicing Silencer) on the triadin exon 10 in a chimeric minigene context

[39]. In contrast, in the current study, we describe FUBP1 as a positive splicing regulator of the oncogene MDM2. We show here the binding of endogenous FUBP1 to intronic splicing enhancer elements in intron 11 of MDM2 and the role it plays in enhancing the efficient splicing of full-length MDM2 making this the second report to identify a splicing regulatory role for FUBP1 and the first report to describe an enhancer role for this splicing regulator.

2.1.2 Poly Pyrimidine Tract Binding Protein 1 (PTBP1)

PTBP1 or hnRNP I is an RNA binding protein that is well known in its role as a splicing repressor, often in the context of tissue-specific alternative splicing. This has been demonstrated in several cases including the c-Src N1 exon [302, 303], α-Actinin

SM exon [304-306], tropomyosin [307-309], troponin [310], FGF (Fibroblast Growth

Factor) receptors 1 and 2 [311, 312], IgM [313, 314] and Fas exon 6 [100]. However, recent studies have implicated that PTBP1 may also facilitate exon inclusion and that its role as splicing repressor or enhancer is contingent upon the location of its binding site on the target pre-mRNA relative to the splice sites of the regulated exon [119, 315, 316].

Structurally, PTBP1 is a 57KDa protein comprising a nuclear localization signal

(NLS) and 4 RNA Recognition Motifs (RRMs) separated by linker sequences the longest of which lies between RRMs 2 and 3 essentially separating the N-terminal and C- terminal RRMs of the protein [317]. Alternative splicing of PTB transcripts results in isoforms 2, 3 and 4 with variable linker lengths or RRM composition that display some differential activity in certain cases of alternative splicing and IRES-dependent translation control [318, 319]. In addition to these isoforms, tissue-specific homologs of

PTBP1 such as nPTB (expressed only in neuronal cells) and ROD1 (expressed only in hematopoietic cells) serve to regulate alternative splicing networks in a tissue specific manner [121, 267, 320]. The 4 RRMs of PTBP1 are slightly different in their consensus sequences and although they all recognize U/C rich poly pyrimidine tracts on the pre- mRNA, the N-terminal RRMs 1 and 2 preferentially bind short, structured elements while the C-terminal RRMs 3 and 4 typically bind longer, less structured stretches of RNA

[321]. While RRMs 1 and 2 can bind RNA and function as independent domains, RRMs

3 and 4 interact with each other to form a globular structure that shows high affinity for

RNA binding [104, 317, 322].

Several models have been proposed for PTBP1 mediated exon exclusion.

Earliest models suggested direct competition between PTBP1 and U2AF65 for binding at the polypyrimidine tracts as a means of preventing spliceosome assembly and exon recognition [323, 324]. However, it has since been demonstrated that PTBP1 binding does not interfere directly with recognition of the 5’ and 3’ splice sites by the spliceosomal components. Rather, it directly interacts via its RRMs1 and 2 with a pyrimidine rich sequence in the U1snRNA stem loop 4 at the early stages of spliceosome assembly (H and E complexes) [97]. This obstructs the assembly of further

38 splicing competent complexes and interactions with the 3’ splice site thus preventing proper exon definition or intron recognition [97-100]. A recent study demonstrated that

PTBP1 represses IgM splicing by binding inhibitor sequences in the M2 exon and forming an ATP dependent complex that directs U2snRNA away from the actual branch point sequence [314]. Additionally, PTBP1 is capable of causing extensive restructuring or looping of its RNA substrates by binding multiple sites in the introns flanking the exon via its 4 RRMs and intra or inter-molecular interactions between the RRMs 3 and 4 [101-

104]. This remodeling of RNA architecture can interfere with proper exon definition by the spliceosomal components at the 5’ and 3’ splice sites. Yet another model predicts that binding of PTBP1 at multiple sites across the introns can create a zone of repression where other splicing factors are prevented from assembling on the pre-mRNA and facilitating the splicing reaction [101]. Another mechanism involves the formation of ternary complexes by RRM2 with RNA and co-repressor proteins such as RAVER1 and

2 to suppress exon inclusion [325, 326].

The mechanisms of PTBP1 mediated exon inclusion, on the other hand are less clear. One study indicated that PTBP1 antagonizes U2AF65 binding at a pyrimidine rich enhancer element to facilitate inclusion of the alternative exon [316]. Yet another study demonstrated that PTBP1 suppressed the effects of a splicing repressor to enhance splicing of a regulated exon in the hnRNPA1 pre-mRNA [315]. A recent genome wide analysis that mapped PTBP1-RNA interactions indicated a position-dependent effect for the consequences of PTBP1 binding in that the binding of PTBP1 close to constitutive splice sites favored inclusion of the alternative exons [119].

PTB is an essential gene and its deletion in mice results in embryonic lethality

[327]. PTBP1 is ubiquitously expressed in most tissues where it serves to suppress

39 muscle and neuron-specific alternative splicing events [320]. PTBP1 regulates its own levels and those of its homologs nPTB (neuron-specific) and ROD1 (hematopoietic cells) by repressing the splicing of specific exons in these transcripts thereby leading to their degradation by nonsense mediated decay (NMD) [320]. However, in neurons, PTBP1 is down-regulated by miR-124 and a concomitant rise in nPTB levels is observed resulting in the activation of PTBP1-repressed exons and neuronal differentiation [328]. In myoblasts, miR-133 and miR-206 decrease levels of both PTBP1 and nPTB thereby activating muscle-specific exon inclusion events [329].

In its capacity as a splicing regulatory protein, PTBP1 directs the alternative splicing of several cancer-related genes including FGFR-1 [312], Fas [100] and Pyruvate

Kinase M2 (PKM2) [134, 143]. Elevated levels of PTBP1 have been observed in several types of tumors compared to the corresponding normal tissues [312, 330-332]. In addition, PTBP1 is a crucial player in the cancer cell-associated aerobic glycolysis or

Warburg effect due to its role in PKM2 splicing. Interestingly, PTBP1 mediates this effect as a downstream target of c-Myc transcriptional activity [134, 143, 333]. PTBP1 is linked to the p53 pathway via its role in Fas splicing and also as an enhancer of the IRES- mediated translation of the ΔN-p53 isoform (N-terminal truncated), a dominant negative form of p53 that inhibits wildtype p53 function [334]. In this study we further establish the role of PTBP1 in the p53 tumor suppressor pathway as a positive regulator of full- length MDM2 splicing.

2.2 Materials and Methods

Cell lines and culture conditions: HeLa (cervical cancer) and MCF7 (breast cancer) cells were cultured under standard conditions using DMEM with high glucose and supplemented with 10% FBS (Hyclone, Logan UT), L-glutamine (Cellgro, 25-005 CI) and

40 penicillin/streptomycin (Cellgro, 30-001 CI). HeLa S3 cells were maintained in RPMI

1640 medium supplemented with 10% FBS, L-glutamine and penicillin/streptoMYCin. For nuclear extract preparation, HeLa S3 cells were cultured in spinner flasks (Bellco, Vineland, NJ) with slow rotation of 90 rpm. For the phosphatase assays, 30 µg of normal or cisplatinum-damaged HeLa nuclear extracts were incubated for 1 hour at 37oC with 12 U of CIP (Ipswich, MA) and then loaded onto an SDS-PAGE gel. For the CASPASE inhibitor experiments HeLa S3, cells were incubated in pan-

CASPASE inhibitor BAF (Boc-Asp (OMe)-fluoromethyl ketone, catalog #B2682, Sigma

Aldrich, St. Louis, MO; a kind gift from Dr. Katsumi Kitagawa, Nationwide Children’s hospital, Columbus OH) at a concentration of 50 µM or an equal volume of DMSO for 1 hour. Cells were then treated with 75 µM cisplatinum for 12 hours or left untreated. Cells were then harvested for protein and analyzed using western blotting.

Nuclear-Cytoplasmic fractionation of HeLa S3 cells: The cells were cultured on plates in

RPMI 1640 media under standard conditions. They were then treated with cisplatinum

(75 µM) or left untreated for 12h after which they were trypsinized and spun down at

1000 rpm for 10 minutes in a clinical centrifuge. About 1/10th of the cells removed and resuspended in RIPA buffer to obtain the whole cell extract (WCE). The remaining cells were washed and resuspended in hypotonic buffer A (10 mM HEPES-KOH pH 8.0, 10 mM KCl, 1.5 mM MgCl2) and incubated on ice for 10 minutes. Following this, the cells were centrifuged, ruptured using a 26 G needle and then centrifuged again at 2000 rpm for 10 minutes to separate the nuclei and the cytoplasmic extract (CE). The nuclei were then washed again and resuspended in RIPA buffer to obtain the nuclear extract

(NE). 30 µg of protein from these fractions were subsequently used for immuno blotting.

HeLa S3 nuclear extracts preparation and in vitro splicing assays: Normal and cisplatinum-damaged HeLa S3 nuclear extracts were prepared as described previously

[283]. Briefly, HeLa S3 cells were cultured under either normal or cisplatinum-treated conditions and cells were harvested when in log phase of growth and nuclear extracts prepared using standard protocols [335, 336]. Cisplatinum (APP Pharmaceuticals LLC,

Schaumberg, IL) treatment was for 12 hours at a concentration of 75

µM. Immunointerference in vitro splicing assays were performed in normal nuclear extracts using either anti-FUBP1 antibody (sc-48821 clone H-42) or control rabbit IgG

(0111-01, Southern Biotech, Birmingham, AL). PTBP1 immunointerference in vitro splicing assays were performed using either anti-PTBP1 (clone SH54 Ab-1, Calbiochem cat # NA63) or mIgG (BD Pharmingen cat #555746) These in vitro splicing reactions were carried out at 30oC as previously described [283] with the difference that the nuclear extracts were incubated with 0.5 µg/reaction of either anti-FUBP1 or the isotype control antibody for 30 minutes prior to splicing. 20 fmol of cold in vitro transcribed pre- mRNA (T7 MEGAscript, Ambion; Austin,TX) was used as splicing substrate. Products of the splicing reactions were isolated after 2 hours of splicing and reverse-transcribed using gene specific primers. The cDNA was then used in a PCR reaction to amplify the linear products of splicing using 5’-end labeled (γ-32P) Flag-tag forward primer and the gene-specific reverse primers. The reverse primers and the PCR conditions (18 or 25 cycles) used for amplification of splicing products from the MDM2 and the p53 minigenes are as follows: for MDM2 exon 11- 5’ ACTTACAGCTAAGGAAATTTCAGGATCTTC 3’, for MDM2 exon 12 – 5’ ACTTACGGCCCAACATCTGTTGCAATGTGATGG 3’ or 5’

TAACTCGAGCCTCAACACATGACTCT 3’, for p53 exon 8: 5’

ACTTACCTCGCTTAGTGCTCCCTGGGGGCAGC 3’, and for p53 exon 9 – 5’

ACTTACGGCTGAAGGGTGAAATATTCTCCATCC 3’. The PCR products were then resolved on 6% sequencing gel (Urea-PAGE), dried, exposed to a phosphoimager screen and scanned using a Typhoon imager (GE Healthcare, NJ). The bands were quantified using ImageQuant (version 8.1). For the MDM2 3-exon immunointerference splicing experiments, splicing efficiency was calculated as the ratio of either full-length

(3.11.12) or skipped (3.12) spliced product to the unspliced pre-mRNA. For the 2-exon

MDM2 and p53 minigene systems, splicing efficiency was determined as the ratio of the spliced product to the unspliced pre-mRNA in every reaction. All experiments were conducted in at least 3 independent trials. Statistical analyses were performed using

Graphpad Prism 6.0c. Two-tailed, unpaired T-tests were used to evaluate the significance of the splicing changes under the various conditions and the error bars were represented as SEM.

UVC cross-linking assay: To obtain transcripts pertaining to regions RNA1, 2, 3, 4, A and

B, specific primer pairs with T7 promoter overhang at the 5’end of the forward primer were first used to amplify the corresponding regions of the MDM2 minigene. The primer pairs used were as follows: RNA 1 (142 bp) – Sense: 5’ GGAATT

CTAATACGACTCACTATAGGCAAGTTACTGTGTATCAGGC 3’ and antisense: 5’

GCTAGATATAGTCTCCTAATC 3’; RNA 2 (123 bp) – Sense: 5’ GGAATTCTAATACGA

CTCACTATAGGGATTAGGAGACTATATCTA GC 3’ and antisense: 5’

CAGCATGAGGACTAT AGTTAG 3’; RNA 3 (135 bp) – Sense: 5’

GGAATTCTAATACGACTCACTATAGGTTAGTAAATTTCCAGTATACC 3’ and antisense: 5’ GCAACTTTGCTATGTCTAAGG 3’; RNA 4 (143 bp) – Sense: 5’

GGAATTCTAATACGACTCACTATAGGTGAAACACTGAATATTGAGCC 3’ and antisense: 5’ GAAGTGCATTTCCAATAGTCC 3’; RNA A (128 bp) – Sense: 5’

GGAATTCTAATACGACTCACTATAGGGTAACCACCTCACAGATTCCAGC 3’ and antisense: 5’ AGGCTACAATTGAGGTATACG 3’; RNA B (118 bp) – Sense: 5’

GGAATTCTA ATACGACTCACTATAGGTAGGACTTATTACTAGGAAGCC 3’ and antisense: 5’ GTATCACTCTCCCCTGCC 3’. These PCR products were then used as templates for in vitro transcription reactions (T7 MAXIscript kit, Ambion, TX) and the radioactively labeled transcripts (internally labeled with α-32P-UTP) were purified. The radiolabeled RNA was then incubated for 30 minutes under splicing conditions (30oC, 20 mM HEPES buffer pH 7.4, 0.5 mM ATP, 20 mM creatine phosphate, 3.2 mM MgCl2,

2.6% PVA and 100 ng yeast tRNA to minimize non-specific protein binding) in normal

(N) or cisplatinum-damaged (D) nuclear extracts. The reactions were then transferred to a 96-well round bottom dish on ice and the cross-linking was performed using the

Stratalinker with UVC (254 nm) for 10 minutes. The plates were placed at 2 cm from the

UVC lamp. After cross-linking the reactions were transferred to eppendorf tubes where they were treated with 50U of RNAse A and 50U RNAse T1 at 37oC for 15 minutes. Following this, the reactions were stopped using the SDS-sample buffer and the cross-linked proteins were separated using SDS-PAGE (12% separating gel). The gel was then dried, exposed to a phosphoimager screen and scanned using the

Typhoon scanner. The image was analyzed using the ImageQuant software (Ver 5.0,

GE, NJ).

RNA Affinity Chromatography: The templates for the transcription of RNA2 (Δ1 and Δ3) and RNA A were amplified from the MDM2 minigene as described in the UV cross- linking assay. Biotin-labeled transcripts were then obtained from these templates using the T7 MEGAshortscript (Ambion, TX) and 10 µL of biotin labeling mix (Roche, IN). The biotin-labeled RNA was gel-purified, quantified (UVC spectrometry) and 2 µg of the

44 labeled transcripts were bound to 60 µl of 50% streptavidin-agarose bead slurry

(Novagen, WI) for 1 hour at 4oC. Prior to binding the biotinylated transcripts, the streptavidin-conjugated beads were equilibriated by washing twice in 1 ml of buffer D (20 mM HEPES-KOH, pH 8.0, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 0.5 mM PMSF and 1 mM DTT). After the binding reaction, the beads were washed twice in buffer D to remove any unbound RNA. Following this, 600µg of nuclear extract either normal (N) or damaged (D) was added to the RNA bound to the beads, under splicing conditions similar to the UV- cross-linking assay and incubated for 1 hour for 4oC. The beads bearing the biotinylated RNA and the proteins to them were then washed three times in buffer D. Finally, resuspending the agarose beads in 1.5x SDS-sample buffer and boiling the samples eluted the proteins that were bound to the beads. The eluted proteins were separated by SDS-PAGE and the gels were stained with silver stain

(SilverSNAP stain for mass spectrometry, Thermo Scientific, Waltham, MA) and the proteins visualized. Protein bands appearing differentially between the nuclear extracts from normal and damage-treated cells, were excised and sequenced via tandem mass spectrometry (at the Mass Spectrometry and Proteomics Facility, OSU). The binding of the proteins identified in the mass spectrometry screen were subsequently verified by

RNA affinity chromatography of the respective RNA regions followed by western blotting using antibodies specific to these proteins.

Immunoblotting: Typically, 30 µg of protein lysates (quantified using the Pierce BCA protein assay kit, Thermoscientific, Rockford, Il) were separated using SDS-PAGE (4% stacking and 10% separating gels) using standard techniques followed by immunoblotting with the specified antibodies. For the detection of endogenous FUBP1 in HeLa cell lysates and for the immunointereference in vitro splicing assays and for

45 confirmation of binding to RNA2 Δ1 in the RNA chromatography assays, the anti-FUBP1

H-42 clone (sc-48821; Santa Cruz Biotechnology) was used. For detection of endogenous PTBP1, anti-PTBP1 clone 1 (Zymed) was used. As loading controls, β-actin

(AC-15, A5441; Sigma Aldrich) or GAPDH (14C10, cat #2118; Cell Signaling) were used. To confirm over-expression of Flag-tagged FUBP1 isoforms, anti-Flag M2 (F3165;

Sigma Aldrich) was used and the anti-MYC tag antibody 9E10 clone (sc-40; Santa Cruz

Biotechnology, CA) was used to detect the MYC-tagged negative control over- expression constructs (MYC-LacZ or MYC-GFP). To detect SRSF1 in the phosphatase- treatment experiments, the anti-SRSF1 antibody (clone 103, cat # 32-4600; Life

Technologies, NY) was utilized.

Over-expression and knockdown assays: The splicing of the 3-11-12 MDM2 minigene and the intron 11 deletion constructs was assessed by transiently transfecting MCF7 cells with Fugene 6 (Roche Diagnostics Corporation, Indianapolis) according to manufacturer’s instructions. The cells were exposed to 50 J/m2 UVC 24 hours post transfection and were harvested for RNA 20 hours post treatment. For the over- expression assays testing the functions of FUBP1 and its isoforms, Hela cells were cotransfected with the corresponding expression constructs or a negative control (MYC-

LacZ or MYC-GFP) and the MDM2 3-4-10-11-12 minigene using Lipofectamine 2000

(Life Technologies, Grand Island, NY) according to manufacturer’s instructions. In this case, the cells were transfected at about 70% confluence on 10 cm plates. 18 hours post transfection, the cells were split into two groups for untreated and cisplatinum treated conditions. At 24 hours post-transfection, cisplatinum (APP Pharmaceuticals

LLC, Schaumberg, IL or Teva Pharmaceuticals, Irvine, CA) was added to the cells at a concentration of 75 µM. 24 hours after treatment; both floating and adherent cells were

46 collected and pooled and RNA and protein were harvested from these cells. RNA was extracted using the RNeasy Mini protocol (Qiagen, Valencia CA) and protein was extracted by resuspending the cells in RIPA buffer. For the FUBP1 and PTBP1 knockdown assays, Hela cells were transfected with non-specific (ns) siRNA or siFUBP1 or siPTB using Lipofectamine 2000. 48h post-transfection, cells were treated with cisplatin for 24 hours at and harvested (total of 72h siRNA treatment) in a procedure similar to the over-expression assays. The siRNA sequences used were: non-specific

(AAGGUCCGGCUCCCCCAAAUG) [337], siFUBP1 (GGAGGAGUUAACGACGCUUUU)

[39] and siPTB AACUUCCAUCAUUCCAGAGAA [338].

Protein expression and minigene plasmid constructs: The construction and cloning of the

3-11-12 and the 3-4-10-11-12 MDM2 and the p53 7-8-9 minigenes into the pCMV-Tag2B vector (Stratagene, La Jolla, CA), have been described previously [283]. Intron 11 deletions Δ1, Δ2 and Δ3 were first engineered into the 3-11-12 MDM2 minigene and these constructs were transfected into MCF7 cells to assess their splicing patterns and were also used to obtain templates for in vitro transcription of RNA2 Δ1, Δ2 and

Δ3. Briefly, intron 11 with the corresponding deletions and exon 12 was amplified using primers containing EcoRI and XhoI restriction sites. The PCR products thus amplified were then digested with EcoRI and XhoI and used to replace these regions in the original MDM2 3-11-12 minigene. For the over-expression assays, FUBP1 cDNA cloned into the pCDNA3.1 V5-Flag vector was used. This plasmid was a kind gift from

Dr. Sharon Dent (MD Anderson Cancer Center, Houston, TX). The Δ74 form of FUBP1, was constructed as described by Jang et al, 2009 [339] by amplifying the corresponding region of the FUBP1 cDNA downstream of the CASPASE cleavage site (sense: 5’

AGCACAGTGGCGGCCGCGCTAAGAAAGTTGCTCCTC 3’ and anti-sense: 5’

GCCCTCTAGACTCGAGCTACAGAGCTAGTTCTATAC 3’) and cloning it into the NotI-

XhoI sites of the pCDNA3.1-V5-Flag vector (kind gift from Dr. Sharon Dent). The cloning was performed using the Infusion kit (Clontech, Mountainview, CA) according to manufacturer’s instructions. All clones were verified by sequencing. The AQPA form was created by mutating the cleavage site of FUBP1 using the primers as described by

Jang et al, 2009 [339] (sense: 5’ GGAGCTCAACCAGCTGCTAAGAAAG 3’ and antisense: 5’ CTTTCTTAGCAGCTGGTTGAGCTCC 3’) using the Quikchange II mutagenesis kit (Agilent, Santa Clara, CA). As negative control,

MYC-tagged BNN-pCall2-LacZ (described in Jacob et al., 2013) or MYC-GFP (pCS2* mt-SGP; a kind gift from Dr. Heithem El-Hodiri, OSU) was utilized.

Reverse transcription and Polymerase Chain Reactions: Typically, 0.5 to 4µg of total

RNA was used for the reverse transcription reactions with random hexamers. Transcriptor RT enzyme (Catalog Number: 03531287001) from Roche

Diagnostics (Indianapolis, IN) was used for the cDNA synthesis reactions according to the manufacturer’s instructions. Polymerase chain reactions (PCRs) were performed under standard PCR conditions using Taq Polymerase from Sigma-Aldrich (Catalog

Number: D6677). For the amplification of the spliced products of the 3-4-10-11-12

MDM2 minigene used in the FUBP1 over-expression assays, a combination of Flag-tag as the forward primer and a gene-specific reverse primer was used (5’

CAATCAGGAACATCAAAGCC 3’). The splicing of the MDM2 3-11-12 wildtype minigene and intron 11-deletion mutants was also assayed similarly using the reverse primer GGCCCAACATCTGTTGCAATGTGATGG. The PCRs were performed at a Tm of 55oC for 35 cycles. The PCR products were resolved on a 1% agarose gel and the relative quantities of the full-length spliced product (3.4.10.11.12) and MDM2-ALT1

(3.12) were determined using ImageQuant (version 8.1) software. To detect endogenous MDM2 transcripts, a nested PCR approach was followed. An initial PCR

o reaction (Tm of 62 C, 35 cycles) was performed using external primers 5’

GAAGGAAACTGGGGAGTCT 3’ (sense) and 5’ GAGTTGGTGTAAAGGATG 3’(anti-

o sense). Following this, a second PCR reaction (Tm of 55 C, 35 cycles) was performed using a 1:10 dil of the products of the 1st PCR reaction as substrate for the 2nd reaction with nested primers 5’ CAGGCAAATGTGCAATACCAAC 3’ (sense) and 5’

CAATCAGGAACATCAAAGC 3’ (anti-sense). The PCR products were resolved on a

1.5% agarose gel and quantified as previously mentioned.

TCGA data mining: The Cancer Genome Atlas (TCGA) data was accessed via the cBioportal for Cancer Genomics (http://www.cbioportal.org/public-portal/) [340, 341] in

April, 2014. FUBP1 gene alterations were queried across all cancer studies in the portal.

Kaplan Meier curves generated for specific cancer types in response to the queried gene were also downloaded in April 2014.

2.3 Results

2.3.1 Intron 11 of stress-responsive MDM2 minigene shows differential binding of factors under stress

We have previously shown that MDM2 is alternatively spliced in response to genotoxic stress such as UV and cisplatinum treatment [233]. Furthermore, we have demonstrated the damage-responsive alternative splicing of an MDM2 minigene using an in vitro, cell-free splicing assay with nuclear extracts from untreated and cisplatinum- treated (damaged) HeLa S3 cells [283]. Moreover, using this minigene we showed that intron 11 of MDM2 contains conserved elements (in a region spanning 73 nt near the

5’ss and 243nt near the 3’ss) that are important for its stress-induced alternative splicing

[283]. We hypothesized that the differential splicing of the MDM2 minigene in nuclear extracts from normal and damage-treated cells, is the result of differential binding of trans regulatory splicing factors to cis regulatory elements within the conserved region of intron 11 and in this study we endeavored to define these elements and the proteins that bind them. To this end, we performed a UV cross-linking assay in which radioactively- labeled transcripts spanning regions across the MDM2 minigene’s intron 11 (RNA1-4,

Fig 2.1A) were incubated in nuclear extracts from normal or damage-treated cells under splicing conditions, cross-linked with UVC irradiation (254 nm for 10 minutes), subjected to RNAse digestion targeting unbound RNA and then run on an SDS-PAGE gel (Fig

2.1B). Only proteins cross-linked to the radio-labeled RNA are able to be visualized on the resulting autoradiogram. The differential migration of proteins between the nuclear extracts from normal and damage-treated cells, suggests differential binding of proteins to the radioactively labeled transcripts under the two conditions. We observed that

RNA2 on intron 11 of the MDM2 minigene showed clear differential banding patterns between nuclear extracts from normal or damage-treated cells with notably strong signals of cross-linking at approximately 55kDa and 65KDa (Fig 2.1B). For instance, the

55KDa cross-linking band was observed in the nuclear extract from normal cells but not in the nuclear extract from damage-treated cells. On the other hand, the protein factor running at approximately 65KDa bound RNA2 in damage-treatment but not under normal conditions raising the possibility that this factor plays a negative role in MDM2 splicing (Fig 2.1B). Additionally, we observed differential binding of a 65KDa factor on

RNA3 indicating the possibility that a single protein is associated with more than one binding site within the intron 11 RNA. Aside from these factors, RNAs 1, 3 and 4 also showed differential bands between the nuclear extracts from normal and damage-

50 treated cells that were migrating at other sizes. However, we chose to focus on RNA2

(123 nt), the region exhibiting the most differential binding of trans protein factors, for further analysis. We first confirmed the specificity of the factors that bound RNA2 differentially in nuclear extracts from normal or damage-treated cells. To do this, we generated sequential deletions Δ1, Δ2 and Δ3 in RNA2 region (Fig 2.2A) and performed

UV cross-linking on these transcripts in the two nuclear extracts. We observed that the differential bands observed on RNA2 at approximately 65KDa and 55KDa were retained in RNA2 Δ1 but were completely abolished in the largest deletion RNA2 Δ3 (Fig

2.2B). RNA2 Δ2 transcripts on the other hand, were still able to bind the 65KDa factor although they lost the ability to interact with the 55KDa protein (Fig 2.2B). This indicates specificity of the binding of these factors to elements lying in the RNA2 region. We then transfected the MDM2 3-11-12 minigenes containing the RNA2 deletions Δ1, Δ2 and Δ3 into MCF7 cells and assayed them for splicing either in the absence (-) or presence (+) of DNA damage. The deletion constructs showed increased skipping of exon 11 compared to the control wildtype minigene even in absence of damage treatment and this difference was statistically significant (comparing lane 3, 5 and 7 to the control wt 3-

11-12 minigene in lane 1) (Fig 2.2C). This indicates that sequential deletion of regions within RNA2 of intron 11 of the MDM2 minigene resulted in the loss of splicing enhancer elements within this region that are essential for regulating the splicing of exon 11.

2.3.2 Mass-spectrometric identification of differentially bound proteins in nuclear extracts from normal and damage-treated cells

In order to identify the specific factors that differentially cross-linked to RNA2 in intron 11 of the MDM2 minigene, we performed RNA affinity chromatography of biotin- labeled RNA2 Δ1 and Δ3 transcripts. RNA2 Δ1 is the minimal RNA that supports the

51 binding of both the 55 KDa and the 65 KDa proteins while the RNA2 Δ3 transcripts served as the negative control since the specific binding of the proteins was abolished in the UV cross-linking studies. The labeled transcripts were incubated in nuclear extracts from normal or damage-treated cells under conditions that support pre-mRNA splicing, similar to the UV cross-linking experiment. Streptavidin conjugated beads were then used to precipitate the Biotin-labeled RNA and the proteins binding them. Following this, the bound proteins were dissociated from the beads and separated on an SDS-PAGE gel and silver stained (Fig 2.3A). Bands specific to RNA2 Δ1 appearing differentially between the nuclear extracts from normal and damage-treated cells were excised from the gel and the proteins therein identified using tandem mass spectrometry (Fig 2.3A; the gel highlights findings consistent in three independent experiments). Importantly these bands did not appear in the RNA2 Δ3 pull-down lanes indicating specificity to the splicing regulatory regions within RNA2 Δ1. The binding of the following proteins identified in the mass spectrometric analyses to RNA2 Δ1 was confirmed by using RNA affinity chromatography of RNA2 Δ1 followed by western blotting; The binding of the following 8 proteins identified in the mass spectrometric analyses to RNA2 Δ1 was confirmed by using RNA affinity chromatography of RNA2 Δ1 followed by western blotting; KSRP (KH-type Splicing Regulatory Protein), FUBP1, PTBP1 (Polypyrimidine

Tract Binding Protein 1), hnRNP D (heterogeneous nuclear Ribonucleoprotein D), DHX9

(DEAH Box Helicase 9), U2AF65 (U2 Auxiliary Factor 65 KDa), Vimentin and β-actin (

Fig 2.3B, 2.10 and data not shown). Interestingly, we also observed the binding of damage-specific cleaved forms of some of these proteins including FUBP1 and PTBP1 to RNA2 Δ1 in cisplatinum-treated nuclear extracts (Fig 2.3B and 2.10) [342, 343].

2.3.3 FUBP1 binds intron 11 of the MDM2 minigene

The differentially binding factor that migrated at approximately 65KDa (Fig 3A) and bound RNA2 Δ1 specifically in the extracts from cisplatinum-treated cells was identified as FUBP1 in the mass spectrometric analysis. FUBP1 is a single-strand nucleic acid-binding helicase with a well-documented role as the transcriptional enhancer of c-MYC expression [294, 295]. Its direct and specific binding to RNA2 Δ1 was confirmed by immunoblotting analyses following RNA affinity chromatography of

RNA2 Δ1 and Δ3 in nuclear extracts normal and damage-treated cells (Fig 2.3B). While the FUBP1 form that bound RNA2 Δ1 in normal nuclear extract migrated at the expected size of approximately 70KDa, the damage-specific short form of FUBP1 that bound

RNA2 Δ1 only in nuclear extract from damage-treated cells, migrated at 65KDa (Fig

2.3B). To confirm that the presence of the short form of FUBP1 in the nuclear extract from damage-treated cells, was not due to the fractionation technique employed, we examined FUBP1 protein in the whole cell (WCE), nuclear (NE) and cytoplasmic (CE) extracts from untreated and cisplatinum-treated HeLa S3 cells (75 μM, 12 hours). We observed the presence of the short form of FUBP1 in all three fractions of the cisplatinum-treated cells, but not in the untreated cells (Fig 2.3C), indicating that the appearance of the short form of FUBP1 is not artifactual. In addition, we tested the possibility that the differentially migrating form of FUBP1 seen in nuclear extract from damage-treated cells, could be due to differential phosphorylation of FUBP1. We treated normal and damaged HeLa S3 nuclear extracts with calf intestinal phosphatase

(CIP) to remove phosphate moieties from the phospho-proteins in the extracts and then performed western blotting analysis for FUBP1. We observed no differences in the migration of the two forms of FUBP1 in nuclear extract from damage-treated cells

53 between CIP treated and untreated samples. Similarly, full-length FUBP1 in normal nuclear extract did not respond to CIP treatment (Fig 2.3D). As a positive control to gauge the efficiency of the phosphatase treatment of our extracts, we probed for SFRS1, a known phospho-protein. Indeed, SFRS1 showed differential migration in nuclear extracts from both normal and damage-treated cells that were treated with CIP when compared to untreated extracts (Fig 2.3D). These results indicate that the differential migration of the two forms of FUBP1 in nuclear extract from damage-treated cells is independent of phosphorylation.

A short form of FUBP1 has previously been described by Jang et al.,2009 [339] as a CASPASE 3 or CASPASE 7 cleavage product resulting from treatment with another

DNA damaging agent, etoposide. This form (Δ74), representing the C-terminal fragment obtained after cleavage of the full-length FUBP1 protein, migrated at approximately the same size (~65KDa) as the short form of FUBP1 that we observed under cisplatinum treatment. To test the possibility that the damage-specific form that we observed is the result of CASPASE cleavage of full-length FUBP1 in cisplatinum-treated cells, we treated HeLa S3 cells with a pan-CASPASE inhibitor BAF (50 µM) or DMSO followed by

12 hours of treatment with 75 µM cisplatinum. We observed that the short form of

FUBP1 was generated in cisplatinum-treated HeLa S3 cells preconditioned with

DMSO. However, the presence of the CASPASE inhibitor BAF prevented the generation of short form of FUBP1 indicating that this form is indeed a product of

CASPASE activity (Fig 2.3E).

2.3.4 FUBP1 enhances the splicing efficiency of the MDM2 3-11-12 minigene in normal nuclear extract in vitro

As we observed the differential binding of FUBP1 to intron 11 of the MDM2 minigene under normal and damaged conditions, we wanted to test the possibility that

FUBP1 regulates alternative splicing of the MDM2 minigene. To this end, we used an immunointerference in vitro splicing approach in which nuclear extracts were incubated with an antibody (H42 clone; epitope mapping near the N-terminus corresponding to amino acids 65-106) that recognized both the full-length and Δ74 forms of FUBP1 or corresponding isotype control. The nuclear extracts were then used to perform splicing reactions on the MDM2 3-11-12 minigene as previously described [283]. The splicing efficiency was quantified as the ratio of the band intensity of full-length spliced (3.11.12) or the exon 11 skipped (3.12) products to the intensity of unspliced transcripts in each reaction (Image quant version 8.1). The change in the splicing efficiency was normalized to the isotype control within each experiment (Fig 2.4B). Strikingly, we observed that immunointerference of FUBP1 in normal nuclear extracts resulted in a significant decrease in splicing efficiency of the MDM2 minigene compared to the isotype control (Fig 2.4A). There was no significant change in the ratio of skipped (3.12) to full- length (3.11.12) spliced products between the FUBP1-immunointerfered and isotype control reactions (Fig 2.4B). Additionally, we tested the efficacy of another N-terminal

FUBP1 antibody (N15 clone: recognizes only full-length form of FUBP1 in western blotting) in this assay but observed no changes in splicing (splicing efficiency or the ratio of skipped to full-length products) of the MDM2 minigene compared to the corresponding isotype controls (data not shown). This limitation argues the possibility of the inadequacy of the N-15 clone to block the FUBP1 active site or conversely non-specific

55 effects of the H-42 clone. To address this, we subsequently employed siRNA-based techniques to accurately characterize the role of FUBP1 in MDM2 splicing (see below). Additionally, to assess transcript-specificity of FUBP1 mediated splicing regulation, we examined the splicing of a non-damage responsive p53 7-8-9 minigene

[283] using immunointerference. However, this minigene displayed very poor splicing capability in nuclear extracts containing either IgG or FUBP1 antibodies and its splicing patterns could not be quantitated or evaluated. We were therefore unable to rule out

FUBP1’s role as a general splicing enhancer in these experiments.

2.3.5 FUBP1 facilitates efficient splicing of both the upstream and downstream introns in MDM2 2-exon minigenes in vitro

As we observed a decrease in splicing efficiency of the MDM2 3-11-12 minigene upon interference of FUBP1 in normal nuclear extracts (Fig 2.4), we wanted to examine whether splicing of the upstream and downstream introns (relative to exon 11 in the 3- exon minigene) was affected by FUBP1. To test this, we created 2-exon minigenes 3-11 and 11-12 from the MDM2 3-11-12 minigene. We additionally created a 2-exon p53 minigene (p53 8-9) to assess transcript specificity for FUBP1 mediated effects on splicing. We observed that splicing of the 11-12 minigene, that contains intron 11 with the FUBP1 binding sites, decreased in a statistically significant manner in FUBP1 immunointerference in normal nuclear extracts (Fig 2.5A). This change was quantified as the ratio of band volumes of the spliced 11.12 products to the corresponding unspliced transcripts in each reaction (Fig 2.5B). The change in the splicing efficiency was normalized to the rIgG isotype control within each experiment. Surprisingly, we observed that FUBP1 immunointerference led to statistically significant decrease in splicing of the 3-11 MDM2 minigene also, raising the possibility that FUBP1 can also

56 bind and regulate the splicing of regions in the intron upstream of the damage-regulated exon 11. Moreover, we were able to show that this effect is transcript specific since splicing of the p53 8-9 minigene did not show a significant change upon interference with

FUBP1 or rIgG treatment in the nuclear extracts (Fig 2.5A,B). To further confirm the transcript specific effect of FUBP1-mediated splicing, we generated a 2-exon minigene

7-8 comprising the upstream intron of the p53 7-8-9 minigene and examined its splicing under FUBP1 or rIgG immunointerference conditions. As a positive control for these experiments, we used the MDM2 3-11 minigene construct whose splicing is decreased when FUBP1 activity is inhibited (Fig 2.5A,B). As expected the 3-11 minigene showed statistically significant decrease in splicing efficiency under FUBP1 immunointerference conditions when compared to rIgG control (Fig 2.5C,D). However, the splicing of the p53 7-8 minigene remained unchanged between both conditions (Fig 2.5C,D). This indicates that splicing of neither intron of the p53 7-8-9 minigene is regulated by FUBP1.

2.3.6 FUBP1 shows differential binding to the upstream intron

As the inactivation of FUBP1 in normal nuclear extracts significantly decreased the in vitro splicing of the 3-11 MDM2 2-exon minigene, we examined regions in the chimeric intron upstream of exon 11 in the 3-11-12 MDM2 minigene (intron 3/10) for

FUBP1 binding sites. To this end, we used the UV cross-linking assay as described previously and examined the differential binding of factors between nuclear extracts from normal and damage-treated cells on radioactively-labeled transcripts, RNAs A and B which span the intron 3/10 (Fig 2.6A, B). RNA A showed the differential binding of the

65KDa factor similar to RNA2 (Fig 2.6B). We then used the RNA affinity chromatography technique to isolate the differential factors binding RNA A in nuclear extracts from normal and cisplatinum-damaged cells (Fig 2.6C). Mass spectrometric

57 analysis revealed the 65KDa factor to be FUBP1 and furthermore we confirmed the binding of FUBP1 to RNA A within the upstream intron by RNA affinity chromatography followed by western blotting (Fig 2.6D) (anti-FUBP1 H-42 clone). This indicates that

FUBP1 may regulate the splicing of the MDM2 minigene through binding sites on introns upstream and also downstream of the internal exon 11.

Our immunointerference results suggest that full-length FUBP1 is required in normal nuclear extracts for efficient splicing of the MDM2 (2-exon and 3-exon) minigenes. We therefore wanted to test whether or not the damage-specific Δ74 form of

FUBP1contributes to MDM2-ALT1 splicing in nuclear extracts from damage-treated cells

(which express the Δ74 FUBP1 isoform at high levels) using an immunointerference approach in which the H-42 antibody blocks activity of both full-length and Δ74

FUBP1. However, the immunointerference in vitro splicing assay proved to be limiting for this purpose. This is because, neither the 3-exon MDM2 nor the 2-exon MDM2 and p53 minigene systems, showed quantifiable splicing in these extracts in the presence of any IgG molecule due to the diminished splicing efficiency. We were therefore unable to accurately assess the role of the Δ74 FUBP1 form in the splicing of the MDM2 and the p53 minigenes in vitro. Hence, in subsequent experiments, we used over-expression assays in cultured cells to examine the function of the Δ74 FUBP1 form in the context of

MDM2 splicing.

2.3.7 FUBP1 over-expression suppresses damage-inducible alternative splicing of

MDM2 minigene

Since FUBP1 immunointerference decreased the splicing efficiency of the

MDM2 minigene in vitro, we wanted to test the effects of the over-expression of FUBP1 on the splicing of the MDM2 minigene in cells under normal and damaged

58 conditions. To do this, we over-expressed FUBP1 or a negative control (LacZ or GFP expressing plasmids; NC) along with a stress-responsive MDM2 minigene in HeLa cells. This stress-responsive MDM2 minigene comprises exons 3, 4, 10, 11 and 12 and importantly retains the complete intron 11 [283] and enabled us to assess the role of

FUBP1 in the context of the native intron 11. Additionally, we assayed in a similar manner, the function of the Δ74 short form of FUBP1 and CASPASE cleavage site mutant FUBP1 (AQPA) in which the CASPASE cleavage site (DQPD) has been mutated to prevent formation of the Δ74 form [339].

We hypothesized that FUBP1 over-expression would act as a positive regulator of minigene splicing even under damage. However, the damage-specific Δ74 form would act in a dominant negative manner and induce exon skipping in the minigene even in absence of damage. Indeed, the over-expression of FUBP1 and also the

CASPASE cleavage mutant FUBP1 (AQPA) decreased the induction of MDM2-ALT1

(3.12) upon cisplatinum treatment in a statistically significant manner when compared to over-expression of the negative control in these cells under both normal and damage conditions (Fig 2.7A). Surprisingly, we found that the stress-specific Δ74 form of

FUBP1, acted in a manner similar to full-length FUBP1 in that its over-expression also caused a statistically significant decrease in MDM2-ALT1 induction under normal and damage (Fig 2.7A). Immunoblotting was used to confirm the over-expression of the

FUBP1 proteins and the negative control (Fig 2.7B).

2.3.8 Knockdown of FUBP1 induces MDM2 alternative splicing even in the absence of stress

As the over-expression of FUBP1 attenuated the induction of MDM2-ALT1 from the minigene under cisplatinum stress, we reasoned that the knockdown of FUBP1

59 would have the opposite effect on MDM2 splicing. To this end, we examined the splicing of endogenous MDM2 in HeLa cells in the context of siRNA mediated FUBP1 knockdown. Notably, the use of siRNA targeting FUBP1 resulted in the knockdown of all forms of FUBP1 (both full-length and the damage-specific Δ74 forms). This is because these forms are derived from the same FUBP1 pre-mRNA transcripts and the Δ74 form is the result of the damage-induced, post-translational CASPASE-mediated cleavage of full-length FUBP1. Indeed, we observed that the knockdown of FUBP1 resulted in the induction of MDM2-ALT1 splicing even under normal conditions while the non-specific siRNA-treated cells showed only full-length MDM2 splicing under normal conditions (Fig

2.8; compare lane 3 to the control in lane 1). Moreover, cisplatinum stress in combination with the knockdown of FUBP1 resulted in a further increase in MDM2-ALT1 splicing compared to cisplatinum treatment of cells transfected with the non-specific siRNA (Fig 2.8; compare lane 2 to lane 4). The change in the cisplatinum treated cells was not statistically significant, possibly due to saturation of the system. These results indicate that loss of FUBP1 causes a decrease in the full-length MDM2 transcript and a corresponding increase in the alternatively spliced form, supporting FUBP1’s role as a positive regulator of MDM2 splicing.

2.3.9 Alterations in the FUBP1 gene are a feature of several malignancies

To examine whether or not FUBP1 expression was altered in other cancer types, we queried The Cancer Genome Atlas (TCGA) data portal maintained by the Memorial

Sloan Kettering Cancer Center (MSKCC) or the cBioPortal [340, 341]. When FUBP1 expression was queried for, the portal revealed alterations in FUBP1 gene due to mutations, amplification or deletions in 44 of the 69 published and unpublished cancer data sets maintained by the cBioportal. We have highlighted these alterations in FUBP1

60 for the top 15 hits in our search in the portal (Fig 2.9A). Consistent with the results observed by Bettegowda et al, 2011 [292], in oligodendrogliomas, the TCGA Brain lower grade glioma study (which includes oligodendrogliomas) appeared amongst the cancer types showing highest frequency of mutations in FUBP1 (9% of cases presented with mutations in FUBP1, Fig 2.9A #2). Moreover, these mutations were predicted to result in loss of FUBP1 expression or its inactivation in these tumors. We then examined the

Kaplan Meier survival estimates for the cancer studies for which these data were available including the low-grade glioma group. Interestingly, the glioma cohort did not show any changes in survival estimates between the patients with FUBP1 alterations and those with wildtype FUBP1 (2.9B). Of all the other cancer types examined, only the

Lung Adenocarcinoma (TCGA provisional study: #8 in Fig 2.9A) patients with alterations in FUBP1 (5 of 129 cases) showed significantly decreased survival compared to patients with wildtype FUBP1 (log rank test p=0.02, 2.9B).

2.3.10 PTBP1 enhances the splicing efficiency of the MDM2 3-11-12 minigene in normal nuclear extract in vitro

We observed the differential binding of PTBP1 to intron 11 of the MDM2 minigene under normal and damaged conditions. Additionally, we observed three damage-specific shorter products binding the MDM2 intron 11 (Fig 2.10A). Importantly, the damage-specific short forms of PTBP1 were present in whole cell extracts as well the nuclear and cytoplasmic fractions of cisplatinum-treated HelaS3 cells indicating that their appearance is not an artifact of the fractionation process (Fig 2.10B). CIP (Calf

Intestinal Phosphatase) treatment of the nuclear extracts from cisplatinum-treated

HelaS3 cells caused no change in the migration of these short PTBP1 forms indicating that they do not arise from differential phosphorylation patterns between normal and

61 damage-treated conditions (Fig 2.10C). However, treatment of HelaS3 cells with a pan-

CASPASE inhibitor BAF prior to cisplatinum-induced DNA damage, caused the disappearance of the shorter forms of PTBP1 compared to DMSO treated HelaS3 cells indicating that these forms are damage-specific CASPASE cleavage products (Fig

2.10D). Interestingly, CASPASE 3 mediated cleavage of PTBP1 has been described with the main forms generated being Δ139 and Δ172 [342] and a schematic of PTBP1 is presented with the cleavage sites indicated (Fig 2.10E).

We wanted to examine the role that PTBP1 plays in the alternative splicing of the

MDM2 minigene. To this end, we used the immunointerference in vitro splicing approach in which nuclear extracts were incubated with an antibody (SH54 clone) that recognized the full-length form of PTBP1 or corresponding isotype control. The nuclear extracts were then used to perform splicing reactions on the MDM2 3-11-12 minigene as previously described for FUBP1 [283]. The splicing efficiency was quantified as the ratio of the band intensity of full-length spliced (3.11.12) or the exon 11 skipped (3.12) products to the intensity of unspliced transcripts in each reaction (Image quant version

8.1). The change in the splicing efficiency was normalized to the isotype control within each experiment (Fig 2.11). Surprisingly, we observed that immunointerference of

PTBP1 in normal nuclear extracts also resulted in a significant decrease in splicing efficiency of the MDM2 minigene compared to the isotype control in a manner similar to

FUBP1 immunointerference (Fig 2.11). This experiment was performed twice and representative results are presented in Fig 2.11. However, there was also a significant decrease in the ratio of skipped (3.12) to full-length (3.11.12) spliced products between the PTBP1-immunointerfered and isotype control reactions indicating that the immunointerference of PTBP1 favored the formation of full-length spliced product (Fig

2.11). However, because the 3-11-12 minigene was not efficiently spliced when PTBP1 was blocked with antibodies Fig 2.11, it is possible that the quantification of the bands may not be accurate. Hence it is necessary to further confirm the role of PTBP1 in

MDM2 splicing in vivo in cells.

2.3.11 PTBP1 facilitates efficient splicing of both the upstream and downstream introns in MDM2 2-exon minigenes in vitro

As we observed a decrease in splicing efficiency of the MDM2 3-11-12 minigene upon interference of full-length PTBP1 in normal nuclear extracts (Fig 2.11), we wanted to examine whether splicing of the upstream and downstream introns (relative to exon

11 in the 3-exon minigene) was affected by PTBP1. To test this, we utilized the 2-exon minigenes 3-11 and 11-12 from the MDM2 3-11-12 minigene. As a control for transcript specificity, we used the 2-exon p53 minigene (p53 8-9). Here also, we observed that splicing of the 11-12 minigene, that contains intron 11 with the PTBP1 binding sites, decreased in a statistically significant manner upon PTBP1 immunointerference in normal nuclear extracts (Fig 2.12). This change was quantified as the ratio of band volumes of the spliced 11.12 products to the corresponding unspliced transcripts in each reaction (Fig 2.12). The change in the splicing efficiency was normalized to the mIgG isotype control within each experiment. Additionally, we observed that PTBP1 immunointerference led to statistically significant decrease in splicing of the 3-11 MDM2 minigene, raising the possibility that PTBP1 binds and regulates the splicing of regions in the intron upstream of the damage-regulated exon 11. The splicing of the p53 8-9 minigene showed a small albeit significant change upon interference with PTBP1 or mIgG treatment in the nuclear extracts (Fig 2.12). Because the fold change in splicing of the p53 minigene is very small compared to the MDM2 minigenes (~20% compared to

63 over 60% decrease in the MDM2 minigenes), we conclude that this effect is transcript specific. However, this does not exclude the possibility that PTBP1 affects the splicing of p53 transcripts to a certain extent or may act as a more general factor for splicing efficiency.

Overall, our immunointerference results suggest that full-length PTBP1 is required in normal nuclear extracts for efficient splicing of the MDM2 (2-exon and 3- exon) minigenes. What remains to be tested is whether or not the damage-specific cleaved forms of PTBP1 contribute to MDM2-ALT1 splicing. However, we were unable to accurately assess this using an immunointerference approach in nuclear extracts from damage-treated cells with a C-terminal PTBP1 antibody (Clone 1, Zymed) that recognizes both full-length PTBP1 and the cleaved forms. This is because, neither the

3-exon MDM2 nor the 2-exon MDM2 and p53 minigene systems, showed quantifiable splicing in these extracts in the presence of any IgG molecule due to the diminished splicing efficiency. We were therefore unable to accurately assess the role of the cleaved forms of PTBP1 in the splicing of the MDM2 and the p53 minigenes in vitro. Hence over-expression assays in cultured cells are required for examining the function of the PTBP1 cleaved forms in the context of MDM2 splicing.

2.3.12 Knockdown of PTBP1 induces MDM2 alternative splicing in the absence of stress

As the immunointerference of PTBP1 decreased the splicing efficiency of the

MDM2 minigene in vitro under normal conditions, it raises the possibility that PTBP1 is a positive regulator of MDM2 splicing and favors the splicing of normal full-length transcripts. Hence, we reasoned that the knockdown of PTBP1 would have the opposite effect on MDM2 splicing. To this end, we examined the splicing of endogenous MDM2

64 in HeLa cells in the context of siRNA mediated PTBP1 knockdown. Notably, the use of siRNA targeting PTBP1 resulted in the knockdown of all forms of PTBP1 (both full-length and the damage-specific cleaved forms). This is because these forms are derived from the same PTBP1 pre-mRNA transcripts and are the result of the damage-induced, post- translational CASPASE 3-mediated cleavage of full-length PTBP1 [342].

Indeed, we observed that the knockdown of PTBP1 resulted in the induction of

MDM2-ALT1 splicing even under normal conditions while the non-specific siRNA-treated cells showed only full-length MDM2 splicing under normal conditions (Fig 2.13; compare lane 3 to the control in lane 1). Moreover, cisplatinum stress in combination with the knockdown of PTBP1 resulted in a further increase in MDM2-ALT1 splicing compared to cisplatinum treatment of cells transfected with the non-specific siRNA (Fig 2.13; compare lane 2 to lane 4). The change in the cisplatinum treated cells was not statistically significant, possibly due to saturation of the system. These results indicate that loss of

PTBP1 causes a decrease in the full-length MDM2 transcript and a corresponding increase in the alternatively spliced form, supporting PTBP1’s role as a positive regulator of MDM2 splicing.

2.4 Discussion

2.4.1 Role of FUBP1 in MDM2 splicing

The key finding in this study is the role of the oncogenic factor FUBP1 in the regulation of MDM2 splicing. FUBP1 is single-strand DNA and RNA-binding protein best known for its role as a transcriptional regulator of the protooncogene c-MYC in many cancer types [294, 295, 344, 345] and also as regulator of post transcriptional events such as translation [301] and mRNA stability [285]. However, despite the fact that

FUBP1 has been isolated in association with spliceosomal complexes [19] and

65 comprises 4 KH domains (domains homologous to hnRNPK, a component of the spliceosomal H complexes [346], its role in splicing regulation has remained speculative until recently. Li et al, 2013, showed that FUBP1 suppresses triadin exon 10 splicing in the context of a chimeric reporter minigene through its binding of a 30 nt, AU-rich exonic splicing silencer (ESS) element in this exon at a consensus sequence AUAUAUGAU

[39]. Our study, in contrast, shows that FUBP1 functions as an enhancer of splicing in the context of the oncogene MDM2. Using an MDM2 3-11-12 minigene [283], we have identified the binding of FUBP1 to intronic splicing regulatory elements, approximately

120 nt in length, in intron 11 and intron 3/10 of this minigene (described in Singh et al.,

2009) [283] that are enriched in AU sequences. Although, we could not identify a single consensus binding-site described by Li et al, 2013 [39] for FUBP1 in these elements, it is possible that it can bind multiple, closely related AU-rich sequences to enhance splicing of the internal exon 11 of the MDM2 minigene.

2.4.2 Possible mechanisms for FUBP1 mediated splicing of MDM2

The inactivation of FUBP1 in vitro compromised the splicing of the introns of the

MDM2 minigene resulting in accumulation of unspliced RNA. In cultured cells, when

FUBP1 was knocked down, this was reflected in the skipping of exons of the endogenous MDM2 gene yielding MDM2-ALT1 transcripts even under normal conditions. This event is possibly a result of compromised splicing efficiency resulting from the knock down of FUBP1.Efficiency of pre-mRNA splicing is influenced by a variety of factors including transcription One possibility is through the disruption of the communication between the transcriptional and spliceosomal machinery during cotranscriptional splicing of pre-mRNA. Indeed, this scenario has been demonstrated in the context of MDM2 splicing by Dutertre et al, 2010, wherein alternative splicing of

MDM2 was induced in response to Camptothecin, a drug that obstructed the interaction between two important components of the spliceosome and the transcriptional complex

As FUBP1 is a known transcriptional regulator it is possible that the knockdown of

FUBP1 could affect the splicing of endogenous MDM2 via a similar mechanism.

However, in vitro, when transcription was uncoupled from splicing, we observed that

FUBP1 inactivation resulted in a decrease in splicing efficiency of the MDM2 minigene.

In this case, it is possible that FUBP1 aids in recruiting the spliceosomal machinery to the splice sites of the MDM2 minigene by binding to intronic splicing enhancer elements.

Adding a layer of support to this possibility is the fact that FUBP1 has been shown to interact with PUF60 (Poly U Binding Factor 60), a splicing factor that interacts with

U2AF65 and facilitates recruitment of U2snRNPs [347, 348]. However, the interaction of

PUF60 and FUBP1 has only been shown to occur in the context of c-MYC transcription regulation where a splice variant of PUF60, referred to as the FIR protein (FBP

Interacting Repressor, lacking the 1st 17 amino acids of PUF60), interacts with and antagonizes FUBP1 in the transcriptional complex [349]. The possibility that FUBP1 and

PUF60 interact and function together in the context of splicing regulation is yet to be explored.

Another important finding in our study is that the inactivation of FUBP1 in vitro decreased the splicing of both the upstream and the downstream introns relative to exon

11 in the 3-11-12 MDM2 minigene. Subsequently, we showed the binding of FUBP1and its damage-specific cleaved form to elements in both these introns. It is therefore possible that FUBP1 simultaneously binds both the introns across exon 11and mediates the efficient removal of the introns. Moreover, as the RNA2 and RNA A elements that bind FUBP1 contain AU- rich sequences, it is possible that FUBP1, which has a

67 proclivity for AU-rich regions such as the FUSE, has multiple binding sites on the introns of MDM2. It has been shown that FUBP1 molecules can contact 4 separate points on the FUSE through the 4 KH domains . It is possible that in the context of pre-mRNA splicing, FUBP1 binds multiple sites across the introns and facilitates better recruitment of the spliceosome or positive regulatory factors while masking or competing with negative regulatory factors.

2.4.3 FUBP1 Δ74 and its role in MDM2 splicing

We used a stress-responsive MDM2 minigene bearing an intact intron 11 to examine the roles of these forms of FUBP1 in MDM2 splicing. As the full-length FUBP1 or the Δ74 isoform bound the minigene under normal or damaged conditions respectively, we had hypothesized opposing roles for these forms in the splicing of

MDM2. Interestingly, both full-length and cleaved FUBP1 behaved in a similar fashion by suppressing the formation of MDM2-ALT1 under stress thereby acting as positive regulators of MDM2 splicing. However, this does not exclude the possibility that Δ74 could still function in an antagonistic manner to full-length FUBP1 under physiological conditions wherein the relative levels of these isoforms and their localization could be factors determining their functionality. Moreover, the negative splicing regulatory factors that actually facilitate the damage-induced skipping of MDM2 exons are yet to be uncovered and may more easily negatively affect the Δ74 isoform. Candidates showing differential binding to the RNA2 region and/or other, unidentified factors likely compete with FUBP1 under damage to bind the cis elements on MDM2 and mediate its stress- induced alternative splicing.

In short, the regulation of efficient splicing of the MDM2 pre-mRNA by FUBP1 (as indicated by the effects of its over-expression and knockdown in cells, Figs 7A, 8) sets

68 the stage for alterations in splicing patterns in response to specific stimuli, wherein mechanisms antagonistic to FUBP1 may function to alter the splicing efficiency of specific exons and create alternative splice forms of MDM2.

2.4.4 Role of FUBP1 in cancer

FUBP1 itself is considered a protooncogene due to its role in the etiology of several types of cancer where it is over-expressed [285-290]. On the other hand, a small subset of oligodendrogliomas with “loss of function” mutations in FUBP1 has been identified where FUBP1 is considered a tumor-suppressor [290, 292, 293]. Regardless of the role it plays, FUBP1 is an important modifier of crucial tumor-suppressive and oncogenic programs within the cell. In this respect, it has been shown to function through both c-MYC dependent and independent pathways as a regulator of transcriptional and post-transcriptional events such as pre-mRNA translation [285, 287,

299, 301, 344, 345, 350-352]. For instance, FUBP1 has inextricable ties with the p53 tumor-suppressor pathway through its transcriptional control of FUSE containing genes c-MYC and USP29 (deubiquitinating enzyme that stabilizes p53) and also via its regulation of translation and stability of Nucleophosmin and p21 (transcriptional target of p53) mRNA [285, 301, 350-352]. Additionally, the complex interactions of the various targets of FUBP1 amongst themselves or with other factors in the p53 pathway make

FUBP1 an important player in this suppressor pathway [353, 354].Over-expression of c-

MYC itself can have far-reaching consequences for the physiology of the cell due to its role as a master regulator of apoptosis and cellular proliferation. Indeed, MYC over- expression upsets the delicate balance of the ARF-MDM2-p53 axis thereby leading to lymphomagenesis. In that light, an important aspect of our study is that we have characterized the oncogene MDM2 as a substrate of FUBP1 mediated splicing. The role

69 of FUBP1 as a regulator of MDM2 splicing can have important ramifications for the

MDM2-p53 axis. Now with our evidence pointing towards its role as a modulator of

MDM2 splicing, a direct mode of involvement of FUBP1 in the complex p53 pathway has emerged. Specifically, we have identified FUBP1 as an enhancer of full-length MDM2 splicing efficiency.

MDM2 is a complex gene that expresses multiple isoforms distinct from its full- length form as a result of alternative splicing in cancer and under damage. However, the mechanisms underlying the regulation of MDM2 splicing, both constitutive and alternative, are poorly understood. It is important to understand these mechanisms as both FL-MDM2 and its splice variants have been shown to play important roles in the tumor types in which they are expressed. FL-MDM2 has a well-established function as an oncogene when its expression is uncontrolled and results in the inactivation of the p53-pathway. On the other hand, the oncogenic role of MDM2 splice variants, which typically lack the p53-binding domain and therefore lack the ability to negatively regulate p53, is less clear, although they have frequently been observed in several cancer types and have been shown to have tumorigenic properties both in vivo and in vitro Here, we have uncovered a part of the splicing-regulation landscape that affects the splicing of

MDM2. We have shown that FUBP1 enhances the splicing efficiency of FL-MDM2 and could therefore; serve to additionally enhance the expression and activity of FL-MDM2 in those cancer types where its over-expression mediates the tumorigenic phenotype. As

MDM2 is subject to multiple splicing events in response to a variety of stresses, the ability of FUBP1 to improve splicing efficiency also poises FUBP1 as a target for modifications that promote negative regulation of MDM2 splicing. Also, the factors, which play into the negative aspects of MDM2 splicing regulation, are yet to be characterized.

Indeed, UV cross-linking and RNA affinity chromatography revealed the differential binding of several other factors and their damage-specific isoforms to the MDM2 minigene in the nuclear extracts from damage-treated cells (Fig 1, 2, 3, 6, S1, Table S1).

It is conceivable that these factors, through complex interactions with the spliceosome or other regulatory factors, contribute to the damage-induced MDM2-ALT1 splicing and therefore demand further characterization. Nonetheless, it is possible that FUBP1 could influence MDM2 splicing and functionality as an oncogene although, extensive analyses of tumor panels for MDM2 splicing in conjunction with FUBP1 expression are required before this angle can be explored thoroughly. In summary, our study has uncovered a mechanism for the regulation of MDM2 gene expression via splicing control by FUBP1, a finding that opens up an additional avenue for exploring targets for cancer therapeutics that modulate the MDM2-p53 tumor-suppressor axis.

2.4.5 Role of PTBP1 in MDM2 splicing

Another factor that we found interacting with the evolutionarily conserved elements on RNA 2 on intron 11 of the MDM2 minigene is the Polypyrimidine Tract

Binding Protein 1 (PTBP1). PTBP1 is well known as a repressor of exon inclusion and several models have been proposed to describe the mechanism by which this effect is mediated [97-104, 314, 323-326]. In our case, we show that PTBP1 is a positive regulator of MDM2 splicing. A recent genome wide CLIP-based study suggested that the location of the PTBP1 binding site relative to the alternative exon is a determining factor in its function as a repressor or enhancer of splicing [119]. PTBP1 binding sites mapping close to the splice sites of the competing constitutive exon were associated with increased inclusion of the regulated exon. However, there were also instances where

PTBP1 bound close to the splice sites flanking the regulated exon but still aided in its

71 inclusion [119]. In the case of MDM2, we observed the binding of PTBP1 to RNA 2 that represents a 123 bp region close to the 5’ss of the MDM2 minigene’s intron 11. Intron 11 of the MDM2 minigene (316 bp) was constructed to retain the evolutionarily conserved

(between mouse and human MDM2) ISREs of the native or endogenous MDM2 intron

11 (2524 bp) at the 5’ (73bp) and 3’ (243bp) splice sites that would potentially play in the damage-regulated splicing of the upstream exon 11 [283]. 95bp of the RNA2 region containing the PTBP1 binding site mapped close to the 3’ss (approximately 250bp upstream of the native 3’ss) of the endogenous or native human MDM2 intron 11.

However, on the minigene this site is close to the 5’ss downstream of the regulated exon

11 in the 3-11-12 minigene. Despite the difference in location of the PTBP1 binding sites

(RNA 2 region), our results indicate that PTBP1 positively regulates the splicing of both endogenous MDM2 and the minigene. This is evidenced by the decrease in splicing efficiency of the MDM2 minigenes (2 exon and 3 exon) but not of a p53 minigene, upon blocking PTBP1 with antibodies in the immunointerference in vitro splicing assay in normal nuclear extracts (Fig 2.11 and 2.12). SiRNA-mediated knockdown of PTBP1 resulted in the skipping of the exons of endogenous MDM2 in the absence of stress (Fig

2.13).

These results do not exclude the possibility that PTBP1 binds MDM2 pre-mRNA at additional polypyrimidine tracts along the transcript. Indeed, it is highly likely that

PTBP1 enhances normal full-length splicing of MDM2 by binding its introns and causing restructuring of the pre-mRNA and resulting in configurations that favor the recognition of MDM2’s internal exons by the splicing machinery. However, detailed mapping of

PTBP1 binding sites to MDM2 pre-mRNA using CLIP or RNA immunoprecipitation (RIP)

72 is required before the exact mechanism of PTBP1’s role in MDM2 splicing i.e. positional effects of PTBP1 binding and any alterations in RNA structure can be correctly deduced.

We observed that RNA 2 also bound the damage-specific cleaved forms of

PTBP1. Three CASPASE-3 cleavage sites have previously been described for PTBP1

(indicated in Fig 2.10) two of which result in the separation of the N-terminal RRM 1

(RNA Recognition Motif) and the nuclear localization signal (NLS) from the RRMs 2, 3 and 4 in response to apoptotic stimuli [342]. The major cleaved forms of PTB generated in Hela cells in response to cisplatinum treatment migrated at the same sizes as described by Back et al (Δ139 and Δ172) indicating that the same cleavage sites are targeted in response to cisplatinum. Moreover, we also observed that PTBP1 is not cleaved in cisplatinum-treated MCF7 cells which are CASPASE-3 negative (data not shown). Together, these results suggest that cisplatinum induced PTBP1 cleavage in

Hela cells that we observe is comparable to the CASPASE-3 mediated cleavage of

PTBP1 observed in response to topoisomerase or kinase inhibitor drugs including

Staurosporine, etoposide and camptothecin [342]. Functionally, the N-terminal cleaved form of PTB has been demonstrated with functions opposite those of the full-length form in the context of IRES mediated translation [342]. Hence in the context of MDM2 splicing, it is possible that the damage-induced cleaved forms of PTBP1 will act as negative regulators or splicing repressors and facilitate exon skipping under damage binding the ISREs. Here also, over-expression cell-based analyses, in vitro PTBP1 immunodepletion and add back assays in conjunction with CLIP-based binding site mapping (under DNA damage conditions) will enable a better understanding of MDM2 splicing regulation by PTBP1 and its damage-specific cleaved forms. These assays will

73 also facilitate a more comprehensive understanding of the role of PTB’s cleaved forms in global splicing regulation under genotoxic stress conditions.

2.4.6 Summary

In general, the splicing of MDM2’s internal exons is subject to extensive regulation and is influenced by several factors including the link with other cellular processes such as pre-mRNA transcription. A recent study demonstrated that uncoupling of the spliceosome from the transcription complex resulted in the alternative splicing of MDM2. Moreover this study showed that some exons of MDM2 were more likely to be skipped than others under these conditions [87]. This indicates that the internal exons of MDM2 are more susceptible to being excluded upon perturbation of the splicing process and hence possibly demand high fidelity of splicing to maintain their inclusion in the final transcript under normal conditions. This necessitates the action of positive regulatory factors that efficiently remove the introns and boost splice site and thus exon recognition in order to facilitate the generation of fully functional MDM2 that is capable of p53 regulation. In this study, we have characterized the roles of two such splicing regulators FUBP1 and PTBP1 that bind conserved ISREs in intron 11 and possibly also in the other introns of MDM2 to ensure efficient full-length splicing of

MDM2. Our results are the first to provide valuable insight into a previously unexplored aspect of MDM2 regulation and pave the way for the development of novel splicing modulation strategies to control MDM2 levels within the cell.

Figure 2.1: UVC Cross-linking assay reveals differential binding of proteins on intron 11 of MDM2 between normal and damaged conditions. A. The intron 11 of the MDM2 minigene was divided into 4 overlapping sections for examination of differential protein binding under normal (N) and cisplatinum-damaged (D) conditions. The regions are indicated as RNA 1, 2, 3 and 4. B. UVC cross-linking of RNAs 1, 2, 3 and 4 shows the differential binding of proteins between normal and cisplatinum-damaged HeLa S3 nuclear extracts. RNA2 shows the most notable patterns of differential banding at approximately 55 KDa and 65 KDa (indicated by arrows).

Figure 2.2: Deletions within RNA2 result in loss of the binding of the differential protein factors and reduced exon 11 splicing. A. MDM2 minigene highlighting RNA2 and the sequential deletions Δ1, Δ2 and Δ3. B. UVC cross-linking of RNA2 Δ1, Δ2 and Δ3 shows the progressive loss of differential binding of factors between normal and damaged conditions with increasing size of deletion. The arrows indicate the crosslinking of bands at approximately 65 KDa and 55 KDa. C. The minigene constructs bearing the deletions in RNA2 region were transfected into MCF7 cells and subjected to UVC treatment (50 J/m2). RNA was harvested and RT-PCR was performed to assay the splicing of the wildtype and the mutant MDM2 minigenes. The deletions RNA2 Δ1, Δ2 and Δ3 show increased skipping of exon 11 compared to the wildtype minigene even in the absence of damage (compare lanes 3, 5 and 7 to the control lane 1). The percent MDM2-ALT1 (3.12) product from 3 independent experiments is graphically represented with SEM error bars. Two-tailed students T-test indicate that the increase in 3.12 spliced product in the RNA2 Δ1, Δ2 and Δ3 constructs is statistically significant in comparison with the wildtype minigene.

Figure 2.3: FUBP1 and its damage-specific cleaved form bind RNA2. A. The RNA2 Δ1 and Δ3 regions were subjected to RNA affinity chromatography by incubating in normal (N) and damaged (D) nuclear extracts and then pulling down Biotin-labeled RNA2 Δ1 and Δ3 transcripts. RNA2 Δ3 were used as negative controls to ensure the identification of specific protein factors. The proteins bound to these transcripts were isolated and subjected to SDS- PAGE followed by silver staining. The differential bands between normal and damaged conditions specific to RNA2 Δ1 were cut and subjected to tandem mass-spectrometry and the proteins were identified. The arrow indicates the differential band at approximately 65 KDa in nuclear extract from damage-treated cells. This band was identified as FUBP1 by the mass spectrometric analysis (Table S1). B. FUBP1 and a shorter isoform were identified as binding to RNA2 differentially between normal and damaged conditions. The binding was confirmed by RNA affinity chromatography of RNA2 Δ1 and Δ3 followed by western blotting (anti FBP1, H42). C. Fractionation of HeLa S3 cells (untreated and cisplatinum-treated; 75 µM cisplatinum for 12h) into whole-cell (WCE), nuclear (NE) and cytoplasmic (CE) extracts showed the appearance of the shorter isoform of FUBP1 in all three fractions of cisplatinum- treated cells. D. Normal and cisplatinum-damaged HeLa S3 nuclear extracts were treated with CIP (Calf Intestinal Phosphatase) and then assessed for the presence of FUBP1 and the damage-specific short isoform. FUBP1 and its short form did not show differential migration between untreated (-) and CIP-treated (+) normal or cisplatinum-damage nuclear extracts. As a positive control for CIP treatment, SRSF1, well-known as a phosphoprotein, was examined for difference in migration patterns. CIP treatment of nuclear extracts caused SRSF1 to migrate faster on SDS-PAGE. E. HeLa S3 cells were incubated with pan-CASPASE inhibitor BAF and then subjected to cisplatinum treatment for 12h. CASPASE inhibition prevented the appearance of the shorter isoform of FUBP1 under damage.

Figure 2.4: Immunointerference of FUBP1 compromises the splicing efficiency of the MDM2 3-11-12 minigene. A. The immunointerference of FUBP1 (H-42 clone) that recognizes both full-length and short form of FUBP1, in normal nuclear extracts results in a decrease in splicing efficiency of the MDM2 3-11-12 minigene as seen in the decreased intensity of the spliced products 3.11.12 and 3.12 in comparison with the isotype control. B. The splicing efficiency was quantified (Imagequant ver 8.1) as the ratio of pixel intensity of the 3.11.12 or 3.12 spliced products to unspliced pre-mRNA. These ratios were normalized to the rIgG isotype control and are graphically presented with SEM error bars. Two-tailed student’s T-test indicates significant changes in splicing efficiency under FUBP1 immunonointereference. However, no significant changes were observed in the ratio of skipped (3.12) to full-length (3.11.12) spliced product between rIgG and FUBP1 immunointerference.

Figure 2.5: FUBP1 immunointerference decreases splicing of both introns of the MDM2 minigene but not the p53 minigene indicating transcript specificity. A. Immunointerference with anti-FUBP1 (H-42 clone sc-48821 (lot #A1707) or rIgG isotype control was performed in normal nuclear extracts, which were then used in in vitro splicing of 2-exon minigenes derived from the MDM2 3-11-12 minigene that span either the intron upstream of exon 11 (3-11 minigene, n=3) or the intron downstream of exon 11 (11-12 minigene, n=4). The splicing of a 2- exon minigene (8-9) derived from a non-damage-responsive p53 minigene [283] was also assayed under similar conditions (n=5). The splicing of 3-11 and 11-12 MDM2 minigenes decreased significantly but not of the 8-9 p53 minigene. B. The splicing of the minigenes was quantified (Imagequant ver 8.1) as the ratio of pixel intensity of the 3.11 or 11.12 or 8.9 spliced products to unspliced pre-mRNA. These ratios were normalized to the rIgG isotype control and results from at least 3 independent experiments for each construct are graphically presented with SEM error bars. Two-tailed student’s T-test indicates statistically significant changes in splicing efficiency under FUBP1 immunonointereference for the MDM2 derived minigenes but not the p53 derived 8-9 minigene. C. The splicing of 7-8 2-exon construct derived from the p53 minigene (upstream intron in the p53 7-8-9 3 exon minigene) was also examined in comparison with the 3- 11 MDM2 minigene under conditions of FUBP1 immunointerference using the batch of H-42 FUBP1 antibody (lot # H3013). Shown here is a representative gel from 3 independent experiments. D. The splicing of these minigenes was quantified as described above and represented graphically with SEM error bars. Two-tailed student’s T-test indicates statistically significant changes in splicing efficiency under FUBP1 immunonointerference for the 3-11 MDM2 derived minigene but not the p53 derived 7-8 minigene.

Figure 2.6: FUBP1 binds the intron upstream of exon 11. A. RNA A and B were designed to span the intron upstream of exon 11 of the MDM2 3-11-12 minigene. B. RNAs A and B were subjected to the UVC-cross-linking assay similar to the experiments performed in Fig 1. RNA A showed differential cross-linking with the 65 KDa factor (arrow) between normal (N) and damage (D) conditions in a manner similar to RNA2. C. RNA affinity chromatography was performed on RNA A in nuclear extracts from normal and cisplatinum- treated cells and the differential band at 65KDa (arrow) in the damage nuclear extract was isolated (Silver-staining following SDS-PAGE) and sequenced using Tandem mass- spectrometry. The protein factor binding RNA A was identified as FUBP1. D. The binding of FUBP1 to RNA A was confirmed by western blotting (H-42 antibody) following RNA affinity chromatography.

Figure 2.7: Over-expression of FUBP1 and the Δ74 form suppresses the formation of MDM2-ALT1 from an MDM2 minigene upon cisplatinum treatment. A. Full-length FUBP1, the shorter isoform Δ74, a non-cleavable form of FUBP1 (AQPA) or a negative control (MYC- tagged LacZ or GFP) were overexpressed in HeLa cells along with an MDM2 3-4-10-11-12 minigene followed by no treatment (Nor) or 24h of cisplatinum treatment (Cis). RT-PCR was used to assess the splicing of the minigene. Shown here are the representative RT PCR results for an experiment in which MYC-tagged GFP was used as negative control. The contrast of the panel showing the 3.12 skipped product was increased for better visualization purposes only. The relative quantification of the full-length and 3.12 spliced products was performed prior to this adjustment. The full-length 3.4.10.11.12 and the skipped 3.12 product intensities were assessed using Imagequant Ver 8.1. The percentage of skipped product was determined as the internal band intensity ratio of skipped to full-length products. The percent skipped (3.12) product under normal or cisplatinum treament for all samples was then normalized to the corresponding negative control (NC). One-way ANOVA with Dunnett’s multiple comparisons test (GraphPad Prism 6.0c) was then used to determine the significance in the changes in 3.12 splicing between the negative control and the over-expression of the different isoforms of FUBP1 under untreated (Nor) or cisplatinum-treated (Cis) conditions. Full-length FUBP1 or its isoforms when overexpressed resulted in statistically significant decrease in the formation of the 3.12 skipped products both under normal and damage conditions compared to the negative control (NC). These changes in splicing of the minigene are represented graphically as the percent 3.12 product under the various conditions. Error bars represent SEM from three independent experiments. B. Western blotting was used to confirm over-expression of FUBP1 (Flag), its various isoforms and the negative control (MYC-tagged GFP is shown here).

Figure 2.8: Knockdown of FUBP1 results in the formation of MDM2-ALT1 even under normal conditions. HeLa cells were transfected with siRNA targeting FUBP1 (siFUBP1) or a non-specific control siRNA (siCtrl) and then grown normally (Nor) or treated with cisplatinum (Cis) for 24h and then harvested for total RNA and protein. Reverse transcription was performed followed by nested PCR to assess the splicing of endogenous MDM2. Knockdown of FUBP1 significantly increased MDM2-ALT1 splicing in the absence of damage (compare lane 3 to control lane 1). The knockdown of endogenous FUBP1 protein (both full-length and the cleaved Δ74 form) was confirmed using western blotting (H-42) and GAPDH was used as loading control. The intensity of the MDM2 FL and MDM2-ALT1 spliced products was quantified using Imagequant Ver 8.1 and the ratio of skipped to full-length products was calculated as percent MDM2- ALT1. The results of three independent trials are represented graphically with SEM error bars. Student’s T-test (two-tailed, GraphPad Prism 6.0c) was used to assess the significance of the change in percent MDM2-ALT1 between siCtrl and siFUBP1.

Figure 2.9: FUBP1 gene alterations are observed across several cancer types in The Cancer Genome Atlas. The Cancer Genome Atlas (TCGA) was queried for FUBP1 mutations and copy number alterations (CNA) across 69 cancer studies archived in the TCGA via the cBioPortal. A. The plot represents the percentage of cases with FUBP1 alterations (gene amplification, mutations, deletions or multiple alterations) in the top 15 hits (cancer studies). The table below the plot provides an explanation of the study presented and the number of cases in the study with FUBP1 alterations. B. The Kaplan Meier survival estimate curve for low-grade gliomas (#2 in 9A) shows no change in survival between patients with altered FUBP1 (red line) and those with wildtype FUBP1 (blue line). However, the Kaplan Meier survival estimate curve for lung adenocarcinoma (#8 in 9A) shows significant change in survival between patients with altered FUBP1 and those with wildtype FUBP1 (p=0.02).

Figure 2.10: PTBP1 and its damage-specific cleaved forms bind RNA2. A. The RNA2 Δ1 region was subjected to RNA affinity chromatography by incubating in normal (N) and damaged (D) nuclear extracts and then pulling down Biotin-labeled RNA2 Δ1 transcripts. PTBP1 and its shorter isoforms were identified as binding to RNA2 differentially between normal and damaged conditions as shown by western blotting (anti PTBP1, Zymed). B. Fractionation of HeLa S3 cells (untreated and cisplatinum-treated; 75 µM cisplat inum for 12h) into whole-cell (WCE), nuclear (NE) and cytoplasmic (CE) extracts showed the appearance of the shorter isoforms of PTBP1 in all three fractions of cisplatinum-treated cells. C. Normal and cisplatinum-damaged HeLa S3 nuclear extracts were treated with CIP (Calf Intestinal Phosphatase) and then assessed for the presence of PTBP1 and the damage-specific short isoforms. PTBP1 and its short forms did not show differential migration between untreated (-) and CIP-treated (+) normal or cisplatinum- damage nuclear extracts. As a positive control for CIP treatment, SRSF1, well-known as a phosphoprotein, was examined for difference in migration patterns (Fig 2.3D). CIP treatment of nuclear extracts caused SRSF1 to migrate faster on SDS-PAGE. D. HeLa S3 cells were incubated with pan-CASPASE inhibitor BAF and then subjected to cisplatinum treatment for 12h. CASPASE inhibition prevented the appearance of the shorter isoforms of PTBP1 under damage. E. Schematic of PTBP1 showing arrangement of the four RRMs and the location of the CASPASE cleavage sites as characterized by Back et al., 2002 [342].

Figure 2.11: Immunointerference of PTBP1 compromises the splicing efficiency of the MDM2 3-11-12 minigene. The immunointerference of PTBP1 (clone SH54) that recognizes the full-length form of PTBP1, in normal nuclear extracts results in a decrease in splicing efficiency of the MDM2 3-11-12 minigene as seen in the decreased intensity of the spliced products 3.11.12 and 3.12 in comparison with the isotype control. Representative gel from 2 experiments is presented. The splicing efficiency was quantified (Imagequant ver 8.1) as the ratio of pixel intensity of the 3.11.12 or 3.12 spliced products to unspliced pre-mRNA. These ratios were normalized to the mgG isotype control and are graphically presented with SEM error bars. Two- tailed student’s T-test indicates significant changes in splicing efficiency under PTBP1 immunonointereference. The ratio of skipped (3.12) to full-length (3.11.12) spliced product decreased between mIgG and PTBP1 immunointerference.

Figure 2.12: PTBP1 immunointerference decreases splicing of both introns of the MDM2 minigene. Immunointerference with anti-PTBP1 (clone SH54) or mIgG isotype control was performed in normal nuclear extracts, which were then used in in vitro splicing of 2-exon minigenes derived from the MDM2 3-11-12 minigene that span either the intron upstream of exon 11 (3-11 minigene, n=3) or the intron downstream of exon 11 (11-12 minigene, n=4). The splicing of a 2-exon minigene (8-9) derived from a non-damage-responsive p53 minigene [283] was also assayed under similar conditions (n=5). The splicing of 3-11 and 11-12 MDM2 minigenes decreased drastically but not of the 8-9 p53 minigene. The splicing of the minigenes was quantified (Imagequant ver 8.1) as the ratio of pixel intensity of the 3.11 or 11.12 or 8.9 spliced products to unspliced pre-mRNA. These ratios were normalized to the mIgG isotype control and results from at least 3 independent experiments for each construct are graphically presented with SEM error bars. Two-tailed student’s T-test indicates statistically significant changes in splicing efficiency under PTBP1 immunonointereference.

Figure 2.13: Knockdown of PTBP1 results in the formation of MDM2-ALT1 even under normal conditions. HeLa cells were transfected with siRNA targeting PTBP1 (siPTB) or a non-specific control siRNA (siCtrl) and then grown normally (Nor) or treated with cisplatinum (Cis) for 24h and then harvested for total RNA and protein. Reverse transcription was performed followed by nested PCR to assess the splicing of endogenous MDM2. Knockdown of PTBP1 significantly increased MDM2-ALT1 splicing in the absence of damage (compare lane 3 to control lane 1). The knockdown of endogenous PTBP1 protein (both full-length and the cleaved forms) was confirmed using western blotting and GAPDH was used as loading control. The intensity of the MDM2 FL and MDM2-ALT1 spliced products was quantified using Imagequant Ver 8.1 and the ratio of skipped to full-length products was calculated as percent MDM2-ALT1. The results of three independent trials are represented graphically with SEM error bars. Student’s T-test (two-tailed, GraphPad Prism 6.0c) was used to assess the significance of the change in percent MDM2-ALT1 between siCtrl and siPTBP1.

Chapter 3: Cis elements in exon 11 of MDM2 are necessary and sufficient

for its stress-responsive alternative splicing

3.1 Introduction

Alternative splicing is a tightly regulated process mediated by the complex interplay of cis elements on the pre-mRNA with the trans factors binding them. Indeed, splice site selection for both constitutive and regulated exons is highly dependent on the splicing regulatory signals that flank the splice sites. Based on their function, cis splicing regulatory elements (SREs) may be classified as enhancers or silencers of exon inclusion and depending on their location they may be exonic (ESE or ESS) or intronic

(ISE or ISS). The role of exonic SREs in splicing has been extensively analyzed and patterns have emerged that are helpful in locating putative SREs and in predicting their functions. For instance, the binding of splicing regulatory trans factors such as the family of Serine Arginine-rich proteins (SR proteins) to the SREs has traditionally been associated with exon inclusion or positive splicing regulation. Hence, the binding sites for these SR proteins have been considered as ESE elements and their consensus binding motifs (identified using oligo-protein affinity and selection based approaches such as

SELEX) form the basis for ESE detection in several prediction tools [74, 75, 355, 356].

On the other hand, ESS elements are typically associated with heterogeneous nuclear ribonucleoproteins (hnRNPs) that often act as negative regulators of splicing. However,

emerging evidence suggests that SRE function is highly contextual and this also dictates the role of the trans factors binding them.

Aside from these, other means have been utilized to detect functional SREs across the transcriptome independent of trans factor association. These approaches include minigene-based mutational analyses, large scale experimental assessment of splicing regulation by random oligomers in reporter constructs and computational genomics that examine sequence conservation and motif distribution biases [42, 44, 45,

110, 357-360]. Taken together, these studies have attempted to establish the “splicing code” by which the identification and functional categorization of specific splicing regulatory elements is made possible via universally applied techniques.

The importance of alternative splicing in disease has made it crucial to gain an understanding of the pathways and mechanisms regulating pre-mRNA splicing. For instance, the splicing of SMN2 exon 7 is a critical determining factor for the disease severity of spinal muscular atrophy (SMA). Extensive characterization of the cis elements on SMN2 pre-mRNA and the trans protein factors binding these elements, has paved the way for the development of numerous therapeutic strategies that directly target splicing of exon 7 [361-363]. Indeed, alternative or aberrant splicing events contribute to the etiology of several diseases including numerous cancer types where oncogenic splice isoforms predominate and promote cell proliferation and metastasis

[364].

Alterations in splicing can result from deregulated signaling pathways or abnormalities in the expression or function of splicing factors [364-366]. For example, aberrant expression or mutations in core splicing machinery such as SF3B1 and

U2AF65 or splicing regulators like SRSF1 and SRSF2 that can affect the splicing of a

89 wide range of pre-mRNA targets have been observed in several cancer types [364, 365,

367]. We recently demonstrated that pediatric RMS tumors exhibit genotoxic-stress associated splicing patterns of several genes including MDM2 raising the possibility that constitutive activation of DNA damage-response signaling and corresponding changes in splicing regulatory factors contribute to tumorigenesis [230]. Alternative splicing events that result in disease-associated splice forms can result from mutations in the individual genes themselves. These include mutations that affect core splicing signals at the 5’ and

3’ splice sites (although they represent only 10% of reported mutations) and the silent, missense or nonsense mutations in the coding regions which can disrupt ESR elements

[128, 368]. Interestingly, a recent study demonstrated that the latter category represents

~25% of reported mutations and that loss of exon identity due to dysfunctional ESR elements is an important mechanism underlying many splicing-dependent disease states

[128]. Overall, these studies serve to underscore the importance of pre-mRNA splicing in disease thereby necessitating a comprehensive understanding of the nature of the interactions between SREs and their protein binding partners.

Alternative splicing of MDM2 is induced in cells in response to genotoxic stress including UV irradiation and cisplatinum treatment [87, 230, 233, 234, 369]. The primary splice isoform generated under these conditions is MDM2-ALT1 whose constitutive expression is associated with several cancer types and is attributed with tumorigenic properties in in vitro and in vivo studies [220-232, 235, 236, 240, 369]. This isoform is generated as the result of a major cassette exon splicing event in which exons 4 to 11 of

MDM2 are skipped under DNA-damage and the terminal coding exons 3 and 12 are spliced together. However, the mechanisms regulating MDM2-ALT1 splicing under stress and in cancer are poorly understood.

What is currently known is that MDM2 splicing under stress is independent of p53 status and potentially does not occur downstream of the ATM and ATR kinase signaling pathways [233]. A recent study demonstrated that MDM2 splicing may be co- transcriptionally regulated because disruption of the interaction between the transcriptional machinery and spliceosome complex (disruption of EWS and YB1 interaction) upon treatment with camptothecin resulted in the skipping of MDM2’s internal exons and the formation of shorter splice variants including MDM2-ALT1 [87].

On the other hand, in a previous study from our lab, we observed that MDM2 alternative splicing can be regulated in a damage-responsive manner (UV and cisplatinum) in a cell- free in vitro splicing assay independent of pre-mRNA transcription [283]. This indicates that MDM2 splicing can at least be partly regulated via transcription-independent mechanisms. Moreover, using this in vitro splicing assay in conjunction with a damage- responsive MDM2 minigene, we have identified evolutionarily conserved cis elements in the intron 11 (ISREs) of MDM2 that are crucial for its efficient normal full-length splicing

[283, 284]. Additionally, we have isolated trans factors such as FUBP1 and PTBP1

(chapter 2 results) that bind these ISREs and positively regulate the splicing of full-length

MDM2 [284]. However, the cis SREs and the factors governing the damage-responsive alternative splicing still remained to be elucidated. In this study, we have made use of a minimal 3-11-12s minigene system to identify the cis splicing regulatory elements that directly mediate the damage-induced skipping of MDM2 exon 11. Using this approach, we show here that exon 11 contains important splicing regulatory elements (ESREs) that are necessary and sufficient to mediate its stress-responsive alternative splicing.

3.2 Materials and Methods

Minigene Constructs: The MDM2 3-11-12s minigene was constructed by truncating exon

3 (from 85 nt to include only the 38 nt at its 3’ end), exon 12 (from 229 nt to include only the 73 nt at the 5’ end), the upstream intron 3/10 (from 167 nt to 72 nt retaining 19 nt at its 5’ end and 53 nt of the 3’ end) and the downstream intron 11 (from 316 nt to 147nt including only 79 nt at the 5’end and 68 nt of the 3’end) of the previously described

MDM2 3-11-12 stress-responsive minigene (Singh et al.,2009). To assemble this minigene into the pCMV-tag2B vector, a strategy similar to the one described for the construction of the 3-11-12 minigene (Singh et al., 2009), was adopted. Using restriction sites engineered into the 5’ ends of PCR products, the 3’ end of intron 11 (68 nt region) and exon 12 (the complete exon 12 from the 3-11-12 minigene) were first cloned into the

EcoR1-Xho1 sites of the pCMV-Tag2B vector using the following primers: For: 5’

TCGAATTCGCTAGCATTCCTGTGACTGAGCAG 3’ and rev: 5’

TAACTCGAGCCTCAACACATGACTCT 3’. Following this, exon 12 was truncated at its

3’end first by restriction digest of the ApaI site in the multiple cloning site (MCS) of the pCMV-tag2B vector and the ApaI site native to exon 12 to release the 3’ fragment of exon 12. Following this, the construct was relegated to obtain the short exon 12 with only 73 nt at the 5’end. Subsequently, the 3’ end of intron 3/10 (53 nt), exon 11 (78 nt) and the 5’ end of intron 11 (79 nt) were amplified using primers (For: 5’

GCCTGCAGCTGATTGAAGGAAATAGGGCG and Rev: 5’

AGGGAATTCGAAGCTAGATATAGTCT 3’) that bear PstI and EcoRI sites at their 5’ ends and the PCR product thus obtained was cloned into the PstI-EcoRI sites of construct bearing the other end of intron 11 and truncated exon 12. Finally, using a similar approach, the exon 3 (38 nt) and the 5’ end of intron 3/10 (19 nt) were amplified

(For: 5’ GCGGATCCCCACCTCACAGATTCCAGCTTCGG 3’ Rev: 5’

CTGCAGCAAAAATACTAACCAGGGTCTC 3’) and cloned into the BamHI and PstI sites located on the MCS of the assembly vector containing the rest of the minigene. The construction of the p53 7-8-9 minigene has been described previously in Singh et al.,

2009.

Chimeric minigenes: The chimeric minigenes of MDM2 or p53 origin were all constructed by keeping the terminal exons (3 and 12 for the MDM2 and 7 and 9 for the p53 minigenes) intact with respect to their wild-type counterparts. Also, when the intronic regions were being swapped between the MDM2 and p53 minigenes, they did not include their native splice sites (the first 10 and the last 10 nt of each intron were considered as the splice sites and were not included in the intronic region being ligated into the heterologous system). On the other hand, the splice sites were maintained native to the exons (native to either the terminal exons or the internal exon being swapped) as 10 nt in the intron upstream or downstream or flanking the exon. For instance, the exon 11 retained the splice sites native to MDM2 with the flanking 10 nt from the intron 11 and intron 3/10 even when placed in the context of the p53 minigene.

A similar condition was maintained when p53 exon 8 was being placed in the MDM2 minigene context. The chimeric minigenes were assembled in the BamHI and HindIII sites of the pCMV-tag2B vector using the Clontech Infusion HD Kit (Catalog Number

638909). The individual elements to be assembled were first amplified using primers

(designed using the Infusion HD primer-design tools) with 15 bp overhangs complementary to the elements that will be placed adjacent to them. Following this, the inserts were ligated into the pCMV-Tag2B vector digested with BamHI and HindIII and

93 then transformed into stellar competent cells according the manufacturer’s protocols. All clones were verified by DNA sequencing.

In vitro splicing: In vitro transcribed pre-mRNA using T7 MEGAscript (Catalog Number

AM1334) by Ambion by Life Technologies (Carlsbad, CA) was obtained using PCR templates amplified from the various MDM2 or p53 minigenes and incorporating a T7 promoter region and a flag tag region at the 5’ end. The primers utilized were to amplify

PCR products for use as templates for the in vitro transcription were as follows: for the

MDM2 3-11-12s and the MDM2-based chimeric minigenes: For:

5’5’AGTAATACGACTCACTATAGGGATTACAAGGATGACGACGATAAGAGCCCGGG

CGGATCCCCACCTCACAGATTC 3’ and Rev: 5’

ACTTACGGCCCAACATCTGTTGCAATGTGATGG3’ with a 5’ splice site and the primers for the p53 7-8-9 minigene and the p53-based chimeric minigenes were as follows: For: 5’

AGTAATACGACTCACTATAGGGATTACAAGGATGACGACGATAAGGTTGGCTCTGA

CTGTACCACCATC 3’ and Rev: 5’ ACTTACGGCTGAAGGGTGAAATATTCTCCATCC

3’ with a 5’ss at the end. 20 fmol of the MDM2 and p53 minigene in vitro transcribed

RNA was subjected to in vitro splicing at 30°C in nuclear extracts from normal or 12-hour cisplatinum-damaged HeLa S3 cells as previously described [370]. RNA was extracted by standard phenol/choloroform and precipitated with 100% ethanol. RNA was reverse transcribed using gene-specific primers . Polymerase chain reactions (PCRs) were then performed using Platinum Taq Polymerase (Catalog Number 11304-011) from Life

Technologies (Carlsbad, CA) and subjected to a 25-cycle PCR using ATP γ-32P- radioactively-labeled Flag primer and gene-specific reverse primers (MDM2: 5’

ACTTACGGCCCAACATCTGTTGCAATGTGATGG 3’ and p53: 5’

ACTTACGGCTGAAGGGTGAAATATTCTCCATCC 3’) under standard PCR conditions

(95°C 4’, 95°C 0:40, 55°C 0:30, 72°C 1’, 72°C 7’). PCR products were loaded on a 6% denaturing urea-PAGE gel, dried at 80°C for 45 minutes and exposed to a phosphor screen overnight. The marker used was the radioactively-labeled, in vitro transcribed

RNA century marker (Catalog Number AM7140) from Life Technologies (Carlsbad, CA).

The sequences for the gene-specific primers (for the MDM2 and p53 minigenes and their corresponding chimeric minigenes) and the Flag-tag primer used have been described in Singh et al., 2009.

Quantification of Splicing Ratios: Percentages of full-length and skipped products were quantitated using ImageQuant TL (Version 8.1). Results were plotted in Figures 3.1-3,

SEM was used, and the significance of the results was assessed using the two‐tailed

Student's t‐test using GraphPad Prism (Version 6.0).

3.3 Results

3.3.1 Minimalized MDM2 minigene 3-11-12s is responsive to stress in vitro

We have previously shown that MDM2 minigenes recapitulate the damage-responsive splicing of the endogenous MDM2 pre-mRNA and thus can be utilized to understand the mechanisms regulating this splicing event [241]. To closely map the cis elements that are involved in the stress-responsive splicing of MDM2, we engineered a minimal stress- responsive MDM2 minigene called the 3-11-12s minigene comprising exons 3, 11 and

12 and conserved flanking intronic regions. This construct is derived from the previously published 3-11-12 MDM2 minigene [283] and contains minimal sequences in the introns and the terminal exons retaining the core splicing signals. Specifically, the 3-11-12s minigene was created by truncating exons 3 and 12 of the 3-11-12 minigene to retain only 38 nt and 73 nt at their 3’ and 5’ ends respectively. The upstream chimeric intron

(I3/10) of the 3-11-12 minigene was truncated to 72 nt (from 167 nt) and the downstream intron 11 to 147 nt (from 316 nt) in the 3-11-12s minigene. Importantly, the internal exon

11 remained intact, so splicing regulation could be thoroughly assessed. The 3-11-12s minigene, like its parent minigene, is responsive to genotoxic stress in vitro and in cellulo and excludes internal exon 11 specifically under stress (9.4% ± 4.6% SEM 3.12 product under normal conditions versus 76.2% ± 6.0% SEM under damage conditions), indicating that the minimal sequences included in the 3-11-12s minigene are sufficient to recapitulate the stress-induced alternative splicing of MDM2 (Figure 3.1A). Importantly, the difference in the levels of 3.12 product between normal and cisplatinum-treated conditions was statistically significant (n=3, Student’s T-test, p=0.0009).

3.3.2 Exon 11 of the MDM2 3-11-12s minigene is necessary for its genotoxic stress-response

To narrow down the cis elements that are important for mediating the stress-responsive alternative splicing of the MDM2 3-11-12s minigene, we employed an intron-exon swap approach between the stress-responsive MDM2 3-11-12s minigene (Figure 3.1A) and a non-responsive p53 7-8-9 minigene (Figure 3.1B) [283]. Briefly, we generated chimeric minigenes by interchanging the introns and/or the internal exon of the MDM2 minigene with corresponding regions from the p53 minigene. In all cases, the 5’ and 3’ splice sites that are native to the exonic elements were retained (10 nucleotides of the intronic elements flanking the exon and bearing the respective splice sites). These chimeric minigenes were then subjected to in vitro splicing in nuclear extracts prepared from untreated or cisplatinum-treated Hela S3 cells and the spliced products were visualized using an RT-PCR approach as described previously [283]. The ratio of the skipped product (3.12) to the corresponding full-length spliced product (3.11.12 for the MDM2

96 minigene or 3.8.12 for the chimeric minigenes containing the p53 exon) was determined using the ImageQuant software (Version 8.1) and the percent 3.12 product under each condition is represented graphically and assessed for statistically significant differences between normal and damaged splicing conditions.

When both the introns and exon 11 of the MDM2 minigene were replaced with introns 7 and 8 and exon 8 of the p53 minigene, the chimeric MDM2 minigene lost the ability to splice differentially and generated predominantly the exon 11 skipped product (3.12) in both extracts from normal and cisplatinum-treated cells. The splicing of this minigene resulted in the generation of 66.9% (± 6.4% SEM) 3.12 product even in nuclear extracts from normal cells (Figure 3.2A) as opposed to the basal level of 9.4% (± 4.6% SEM)

3.12 product in the wild-type MDM2 3-11-12s minigene (observed in three independent experiments; compare Figure 3.2A to Figure 3.1A). However, in nuclear extracts from cisplatinum-treated cells the splicing of the chimeric minigene was comparable to the stress-induced splicing of the wild-type MDM2 minigene and generated 78.9% (± 7.4%

SEM) of the 3.12 skipped product across three separate trials (compare Figure 3.2A to

Figure 3.1A). Moreover, the difference in the percent 3.12 splicing of the chimeric minigene between normal and cisplatinum-damaged conditions was not statistically significant (Student’s T-test p=0.2883, Figure 3.2A), unlike the wild-type MDM2 minigene. This indicates that the elements contained within the introns and/or the internal exon 11 of the MDM2 3-11-12s minigene are necessary for the damage-specific response and their loss resulted in the formation of a steady expression of this 3.12 product even under normal conditions (Figure 3.2A, F).

We next removed either the upstream (I3/10) (Figure 3.2B) or downstream (I11) (Figure

3.2C) or both introns (Figure 3.2D) from the MDM2 minigene and replaced them with the

97 corresponding introns from the non-responsive p53 minigene (5’ and 3’ splice sites in these constructs were those native to the exons of the respective minigene, and not from the introns being inserted). These chimeric MDM2 minigenes retained the damage response and showed statistically significant increase in percent 3.12 skipped product in nuclear extract from cisplatinum damaged cells (an average of 67.5% for all three chimeric minigenes in three separate experiments) compared to the nuclear extract from normal cells (an average of 32.1%; Figure 3.2B, C, D, F). This behavior was comparable to the damage-responsive splicing of the wild-type MDM2 3-11-12s minigene, although there was a slight increase in the baseline percent skipped 3.12 product in the normal nuclear extract (compare Figure 3.1A, 3.2B, C, D, F). However, when exon 11 of the MDM2 minigene was removed and replaced with exon 8 of the p53 minigene, the chimeric MDM2 minigene failed to show the damage responsive splicing ratio change (Figure 3.2E, F). Indeed, the percent 3.12 skipped product obtained when this minigene was spliced in nuclear extracts from normal cells (16.9 ± 11.2% SEM) and the percent 3.12 obtained from splicing in nuclear extracts from cisplatinum-damaged cells (17.9 ± 2.8% SEM) were not significantly different (Student’s T-test, p=0.9344).

Together, these data indicate that exon 11 of the MDM2 minigene contains important elements that regulate the damage responsive alternative splicing of the MDM2 minigene.

3.3.3 Exon 11 of the MDM2 3-11-12s minigene is necessary and sufficient to sustain genotoxic stress-response in a heterologous context

We then constructed reciprocal chimeras of the p53 minigene, which normally does not show splicing changes in response to stress (36.1 ± 4.8% SEM under normal or 40.1 ±

3.4% SEM under cisplatinum-damaged conditions of the 7.9 skipped product; Figure

3.1B). For these constructs, we replaced native elements of the p53 minigene with the corresponding intronic or exonic elements of the MDM2 minigene. When exon 8 of the p53 minigene and its flanking introns were replaced with both flanking introns and exon

11 of the MDM2 minigene, the chimeric p53 minigene exhibited damage-responsive alternative splicing similar to the wild-type MDM2 minigene (percent 7.9 spliced product was 12.6 ± 4.2% SEM under normal and 75.1 ± 5.5% SEM under cisplatinum-damaged conditions, p=0.0008 with the Student’s T-test) (Figure 3.3A, D). This indicates that the cis elements contained within the MDM2 minigene’s internal exon and introns are sufficient to facilitate damage-specific alternative splicing in the heterologous p53 minigene system. The chimeras in which intron 7 of the p53 minigene was removed either by itself or in conjunction with the downstream intron 8, failed to splice at all in nuclear extracts from both normal and damage-treated cells as only the unspliced minigene transcripts were detected after RT-PCR (Figure 3.3D). Interestingly, when intron 8 of the p53 minigene was replaced with intron 11 of the MDM2 minigene, there was a small though insignificant (Student’s T-test p= 0.1694) increase in the skipped 7.9 product in response to damage (40.7 ± 8.9% SEM under cisplatinum-damaged compared to 25.1 + 2.5% SEM under normal conditions) indicating that intron 11 of the

MDM2 minigene may contain elements that contribute to the damage responsive alternative splicing (Figure 3.3B, D). Strikingly, when exon 11 of the MDM2 minigene was inserted in the p53 minigene (MDM2 exon 11 was placed in the heterologous p53 minigene with its own exon 11 5’ and 3’ splice sites native to MDM2) in the place of the native p53 exon 8, the chimeric minigene responded to cisplatinum damage when spliced in nuclear extracts from stressed cells unlike the wild-type p53 minigene.

Indeed, the percentage of the 7.9 skipped product increased from 32.7% (± 5.4% SEM)

99 in nuclear extract from normal cells to 71.1% (± 5.9% SEM) in nuclear extracts from cisplatinum-treated cells (Fig 3.3C, D) and this difference was found to be statistically significant (Student’s T-test, p=0.0084). In short, the chimeric 7-11-9 p53 minigene behaved like the wild-type MDM2 minigene in response to damage indicating that MDM2 exon 11 is sufficient to confer damage response in a heterologous minigene context.

3.4 Discussion

DNA damage-induced alternative splicing of MDM2 is observed in both human and mouse transcripts [233]. Additionally, both human and mouse Mdm2 possess conserved SR protein binding sites in their exon 11 suggesting that the alternative splicing of MDM2 could be an important, evolutionarily conserved mechanism for the titration of MDM2 levels under stress. Furthermore, functional studies have revealed a role for the stress-inducible splice forms of MDM2 in cancer underscoring the importance of this splicing event and the necessity to gain an understanding of the mechanisms involved in the damage-responsive splicing of MDM2. Previously, we have shown, using a novel damage-inducible in vitro splicing system that intron 11 of MDM2 houses conserved positive elements that are primarily needed for the efficient full-length splicing of MDM2 [283, 284]. However, the factors governing the damage-responsive alternative splicing remain elusive.

In this study, using a minimal 3-11-12s minigene system we show that exon 11 of the MDM2 3-11-12s minigene contains the splicing regulatory elements that are necessary for its damage-specific alternative splicing. Importantly, we observed that the insertion of exon 11 is sufficient to alter the splicing patterns of a non-damage responsive p53 minigene and to confer the damage-induced exon skipping behavior characteristic of the wildtype MDM2 minigene. At the nucleotide level, exon 11 of human

100

MDM2 homolog shows approximately 82% (MegAlign Lasergene Suite ver?) of identity with that of the mouse gene. Hence, it is highly likely that exon 11 contains conserved splicing regulatory elements or ESREs that facilitate its damage-specific alternative splicing. Indeed, preliminary results from our lab indicate the presence of SRSF1

(SF2/ASF) and SRSF2 (SC35) sites on MDM2 exon 11. Mutational analyses of these sites revealed that SRSF1 is a negative regulator while SRSF2 acts as positive regulator of exon 11 splicing (Comiskey and Jacob et al, unpublished data) acting via ESS and

ESE elements respectively. These results highlight the unique nature of the splicing regulation of MDM2 in that a Yin and Yang interaction between the exon 11 ESE and

ESS elements is possibly at play to ensure full-length splicing under normal conditions and exon skipping under damaged conditions. However, extensive characterization of these sites and the roles of SRSF1 and SRSF2 are required to decipher the exact mechanisms by which the interactions of these cis elements and trans factors mediate regulated MDM2 splicing. Furthermore, additional SR proteins or hnRNPs might bind other sites on exon 11 or compete for these SRSF1 and SRSF2 sites in order to regulate the splicing of exon 11. It is also important to examine other regulated exons (4 to 10) of

MDM2 for evolutionarily conserved ESREs that potentially dictate their alternative splicing and characterize their functionality in MDM2 splicing.

Once functional cis SREs are identified on MDM2, it will possible to design anti sense oligonucleotides (AONs) that target these sites specifically and alter the ratios of full-length and the alternative splice variants of MDM2. Given the importance of MDM2 and its splice variants as modifiers of the p53 pathway, manipulation of MDM2 splicing as a means of controlling the expression of full-length MDM2 or MDM2-ALT1 is important especially in cancers presenting with aberrant expression of MDM2 or its

101 splice forms. In short our study has enabled the identification of the critical factors that regulate the stress-induced and possibly the cancer-associated generation of MDM2-

ALT1 thus paving the way for the development of novel splicing modulation therapeutics.

102

Figure 3.1: The MDM2 3-11-12s minigene undergoes damage-induced exon 11 skipping in an in vitro splicing system while a control p53 7-8-9 minigene remains unresponsive. A. A minimal MDM2 3-11-12s minigene, constructed to assess the elements essential for the generation of MDM2-ALT1 alternative splicing was derived from the previously described MDM2 3-11-12 minigene, which is responsive to stress-induced alternative splicing. The schematic represents the 3-11-12s minigene and the sizes depicted reflect the length of the exonic and intronic regions of the minigene construct and are inclusive of the flag-tag and the intervening region (cloning sites) of the pCMV-tag2B vector at the 5’end of the minigene construct. In vitro transcribed RNA obtained from the minigenes was subjected to a cell-free in vitro splicing assay using nuclear extracts from either untreated (N, NOR) or cisplatinum-treated Hela S3 cells (C, CIS). RNA was isolated, reversed transcribed, and subjected to a 25-cycle PCR using γ-32P- radioactively-labeled Flag primer and gene-specific reverse primers. The MDM2 minigene predominantly skips internal exon 11 when spliced in nuclear extracts from cisplatinum-treated cells, but not in nuclear extract from normal cells. The bar graphs represent the percentage of 3.12 skipped product obtained from three independent in vitro splicing experiments under each condition and the error bars represent standard error mean (SEM). The difference in the percentage of 3.12 product between normal and damaged splicing conditions is statistically significant (n=3, p=0.0009, ±4.573 NOR ±6.034 CIS). B. Damage-responsive alternative splicing is transcript-specific. A p53 7-8-9 minigene shows no changes in splicing patterns between the normal and damaged nuclear extract (n=3, p=0.5335, ±4.810 NOR ±3.437 CIS). The sizes of the minigene depicted in the schematic are reflective of the flag-tag and vector-specific regions at the 5’end of the minigene construct in a manner similar to the 3-11-12s minigene.

103

Figure 3.2: Loss of MDM2 exon 11 abolishes stress-responsive alternative splicing of the MDM2 minigene. Chimeric MDM2 minigenes were created by replacing the introns and/or internal exon of MDM2 with corresponding regions from the non-stress-responsive p53 minigene and were subjected to in vitro splicing in nuclear extracts from normal (N) or cisplatinum (C) treated cells. Percentage of the skipped splicing product 3.12 for the various chimeric minigenes is represented graphically for three independent experiments with error bars representing the SEM. A. The internal exon 11 and the introns of the MDM2 3-11-12s minigene were removed and replaced with exon 8 and the introns from the p53 minigene. The damage responsive alternative splicing of the MDM2 minigene is abolished and there is no significant difference between the percentage of 3.12 skipped product between normal and damaged conditions (p=0.2893 ±6.364 NOR ±7.437 CIS). However, statistically significant changes in the skipping of internal exon 11 (percent 3.12) between the normal and cisplatinum-damaged conditions was observed with the chimeric minigenes. B. The upstream intron of MDM2 3-11-12s minigene was replaced by the p53 intron 7 (n=3, p=0.0131 ±3,597 NOR ±4.446). C. The downstream intron of MDM2 3-11-12s minigene was replaced by p53 intron 8 (n=3, p=0.0184 ±13.32 NOR ±4.310 CIS). D. Both the introns of MDM2 3-11-12s minigene were replaced with p53’s introns 7 and 8 (n=3, p=0.0175 ±0.2681 NOR ±7.196 CIS), in a manner similar to the wild-type MDM2 3-11-12s minigene. E. The chimeric MDM2 minigene in which exon 11 was removed and replaced with p53 exon 8, displayed a loss of the damage-responsive alternative splicing and no statistically significant changes were observed in the percentage of 3.12 product obtained under normal and damaged splicing conditions (n=3, p=0.9344 ±11.22 NOR ±2.805 CIS). F. Table summarizing the MDM2 minigene constructs and the status of their damage-responsive splicing. 104

Figure 3.3: MDM2 exon 11 is sufficient to regulate stress-responsive splicing in the heterologous p53 minigene context. Chimeric p53 minigenes were created by replacing the introns and/or internal exon of p53 with corresponding regions from the stress-responsive MDM2 minigene. They were then spliced in vitro in nuclear extracts prepared from normal (N) and cisplatinum (C) treated cells. Percentage of the skipped splicing product 7.9 for the various chimeric minigenes is represented graphically for three independent experiments and the error bars reflect the SEM. A. Chimeric p53 minigene with its internal exon 8 and its flanking introns replaced by the corresponding regions of the MDM2 3-11-12s minigene exhibited damage- specific skipping of the internal exon similar to the wild-type MDM2 3-11-12s minigene. The difference in the percentage of the 7.9 product generated between normal and cisplatinum- damaged conditions was statistically significant (n=3, p=0.0008 ±4.224 NOR ±5.524 CIS). B. The chimeric p53 minigene with downstream intron 8 replaced by intron 11 of the MDM2 3-11-12s minigene did not show statistically significant changes in the percentage of 7.9 product obtained as a result of splicing under normal and cisplatinum-damaged conditions (n=3, p=0.1694 ±2.482 NOR ±8.958 CIS). C. The chimeric p53 minigene containing the exon 11 of MDM2 minigene showed statistically significant damage-specific induction of the 7.9 skipped product similar to the wild-type MDM2 3-11-12s minigene (n=3, p=0.0084 ±5.352 NOR ±5.867 CIS). D. Table summarizing the p53 minigene constructs and the status of their damage-responsive splicing. Splicing status of (-) indicates that constructs were not splicing competent in nuclear extracts as fully-spliced products were not detected by RT-PCR. 105

Chapter 4: MDM2-ALT1 as a suppressor and a driver of oncogenesis: in

vitro studies and characterization in an in vivo model (mouse) of B cell

specific expression

4.1 Introduction

The tumor-suppressor protein p53 is a transcription factor crucial for maintaining genomic integrity and for inducing cell-cycle arrest or cell-death pathways in the face of insurmountable cellular insult [144]. Under normal physiological conditions, p53 activity and levels are kept under tight control mainly by the Murine Double Minute (MDM) proteins. MDM2 is an E3 ubiquitin ligase that binds and polyubiquitinates p53 thereby targeting p53 for proteasome-mediated degradation [149-152, 173, 371]. Additionally, the binding of MDM2 to p53 blocks the latter’s transcriptional activity. MDMX (also known as MDM4), a close family member of MDM2, is also involved in the negative regulation of p53. Although it lacks E3 ligase activity, it is capable of forming either homodimers or heterodimers with MDM2, which inhibit p53’s transcriptional activity or aid in the ubiquitination of p53 [189, 191, 195, 197, 198, 200, 209]. Interestingly, MDM2 regulates its own levels and also that of MDMX via its E3 ubiquitin ligase activity [173,

202]. When over-expressed, MDM2 and MDMX are oncogenic in nature and lead to tumorigenesis by suppressing the activity of p53 and allowing uncontrolled proliferation

[157, 183, 209, 212, 372, 373]. .

106

Under conditions necessitating p53 activation, the interaction of MDM2 with p53 is disrupted through several tightly regulated post-translational events targeting these proteins [205, 374, 375]. Interestingly, in addition to protein modifications, alternative splice forms of MDM2 also play an important role in the activation of p53. At least 10 bona fide splice variants of MDM2 have been described in different cancer types and in response to stress, whose functions differ from the canonical role of full-length MDM2 in p53-regulation [241]. For instance, splice variants MDM2-ALT2 (MDM2-A, which contains exons 3, 10, 11, and 12) and MDM2-ALT3 (MDM2-C, which contains exons 3,

4, 10, 11, and 12) are incapable of binding and targeting p53 for degradation [231, 238].

In addition, MDM2-ALT1 (MDM2-B, which contains solely exons 3 and 12) and MDM2-

ALT2 also sequester full-length MDM2 in the cytoplasm, in effect, stabilizing p53 [223,

231, 238, 241]. In response to genotoxic stress such as UV irradiation or cisplatinum treatment, the predominant splice variant generated, MDM2-ALT1, also lacks the p53- binding domain but retains the RING domain required for dimerization [87, 233, 234,

241]. Functionally, MDM2-ALT1 has been shown to interact with and inactivate full- length MDM2 leading to the stabilization of p53 [232-234, 240]. Curiously, MDM2-ALT1 is constitutively expressed in several tumor types [220-230] and has also been shown to have tumorigenic properties in in vitro and in vivo systems [230, 235, 236], a function that directly contrasts its role in upregulation of tumor-suppressor p53. However, a recent study in colorectal tumors demonstrated that constitutive expression of MDM2-

ALT1 in tumors with gain-of-function mutant p53 results in the stabilization of the dominant-negative, oncogenic forms of p53 as a result of MDM2 inactivation thereby leading to tumorigenesis [232]. This raises the possibility that in cancer types with mutant p53, MDM2-ALT1 could indeed play the role of an oncogene by altering the

107 activity of its own full-length counterpart. However, it is curious that MDMX, also a potent p53 inhibitor, is unable to inactivate mutant p53 in MDM2-ALT1 expressing cells.

Hence, the role of MDMX in the context of cancers presenting with MDM2-ALT1 remains unclear.

Adding another layer of complexity is the fact that alternative splicing of MDMX also occurs in response to genotoxic stress. Particularly, the occurrence of cancer- associated splice variants, MDMX-S (that possesses high affinity for p53) and MDMX-

ALT2 (that lacks the p53-binding domain), has been reported upon cisplatinum treatment

[230, 233, 250, 376]. While the role of MDMX-S in tumorigenesis as a potent inhibitor of the p53 tumor-suppressor pathway is well understood [242-245], the role of MDMX-

ALT2 in cancer is not clear. MDMX-ALT2 is architecturally similar to MDM2-ALT1 in that it lacks the ability to bind p53. However, we have shown that MDMX-ALT2 is strongly associated with metastatic pediatric rhabdomyosarcoma (RMS) and have demonstrated its tumorigenic properties in vitro (chapter 5 results) [230]. Moreover, MDMX-ALT2 and

MDM2-ALT1 are coincident in ~ 24% RMS tumors, however, their role in RMS pathogenesis is not known [230].

The impact that MDM2-ALT1 and MDMX-ALT2 have on the p53 pathway and on their full-length counterparts has remained unclear. By overexpressing MDM2-ALT1, we demonstrate that it interacts with full-length MDMX and MDM2 and also leads to increased levels of the p53. Similarly, MDMX-ALT2 also dimerizes with both full-length

MDMX and MDM2 and leads to increased p53 indicating overlapping roles for MDM2 and MDMX splice variants. Furthermore, our study is the first to illustrate that MDMX-

ALT2 and MDM2-ALT1 can modulate the transcriptional activity of the stabilized p53

108 suggesting a function of these splice variants in fine-tuning stress response and pathways to tumorigenesis.

Our findings highlighting MDM2-ALT1’s role as an important modifier of the p53 pathway are in direct opposition to its role in tumorigenesis. To tease out its paradoxical roles in tumor-suppression and oncogenesis we extend our study to also examine the physiological functions of MDM2-ALT1 in vivo. A major concern that arises is that ubiquitous expression of MDM2-ALT1 can result in lethality [235] thus precluding a detailed characterization of its functions. To avoid this, we have generated a conditional mouse model of Cre-dependent MDM2-ALT1 expression that enables us to assess its role in any tissue of choice. Here, we examine the consequences of constitutive MDM2-

ALT1 expression in B cells and assess its role in lymphomagenesis.

Lymphomas comprise a large subset of solid lymphoid malignancies that includes B cell neoplasms (non-Hodgkin’s), T cell/NK (Natural Killer) cell neoplasms and

Hodgkin’s lymphoma. B cell lymphomas which represent majority of the non-Hodgkin’s category are further classified into over 15 subtypes based mainly on morphological features and cell of origin [377]. Molecular lesions contributing to the pathology of the disease include chromosomal rearrangements that result in fusion of proto-oncogenes such as Myc or BCL6 with an active Ig locus, inactivation of major tumor-suppressor networks such as the p53 pathway and the accrual of hyperactive mutations in protooncogenes [377, 378]. Aside from these, spontaneous alternative splicing of MDM2 has been reported in human (Hodgkin’s) and murine lymphomas [223, 236, 379].

Moreover, an MDM2-ALT1 like molecule has been shown to accelerate lymphomagenesis in the Eµ-Myc model that is sensitized to the formation of lymphomas

[236]. These findings, in addition to the fact that B cell loss in mice is not lethal, make a

109

B cell model of lymphomagenesis an ideal setting to characterize both the tumor- repressive and oncogenic functions of MDM2-ALT1. Using this system we demonstrate that in a wildtype p53 background, MDM2-ALT1 mediated tumorigenesis manifests only at later stages of life. We further provide evidence that this is potentially due to a tumor latent phase induced by its p53-dependent tumor-suppressive properties that are reflective of its properties observed in vitro.

4.2 Materials and Methods

Cell culture, transfections and over-expression constructs: MCF7 (breast carcinoma,

ATCC HTB-22) and H1299 (non- small cell lung carcinoma, ATCC CRL-5803) cells were cultured under standard conditions at 37oC in DMEM with high glucose supplemented with 10% Fetal Bovine Serum (FBS, Hyclone, Logan UT), L-Glutamine (Cellgro, 25-005

CI) and Penicillin-Streptomycin (Cellgro, 30-001 CI). HCT116 (colorectal) cells that are p53-wildtype or p53 null [380] were cultured in McCoy’s media supplemented with 10%

FBS, L-Glutamine and Penicillin-Streptomycin. Transfection of the over-expression constructs myc-tagged LacZ, MDM2-ALT1 or MDMX-ALT2 [230] was performed using

Fugene 6 (Promega, Madison, WI) according to manufacturer’s instructions. Cells were typically harvested 24 hours post-transfection for protein or RNA. The over-expression of the myc-tagged proteins was confirmed by immunoblotting in every experiment.

Co-immunoprecipitation and Immunoblotting: For the immunoprecipitation (IP) of myc- tagged proteins LacZ or MDM2-ALT1 or MDMX-ALT2 and also for the reciprocal IP of endogenous MDM2, MCF7 cells were transfected with the corresponding over- expression plasmids and 24 hours post-transfection, the cells were harvested in NP40 protein lysis buffer. Equal amounts of total protein (1000-2500 µg) were used for the immunoprecipitation of the myc-tagged proteins. Briefly, 500 µl of precleared protein

110 lysate (30 minutes on ice with 5 µg normal mouse IgG sc-2343AC, Santa Cruz

Biotechnology) was incubated overnight at 4oC with anti-myc tag antibody (conjugated to agarose beads, sc-40 9E10AC, Santa Cruz Biotechnology) or the anti-MDM2 SMP14 antibody (conjugated to agarose beads, sc-965AC, Santa Cruz Biotechnology) at concentration of 1 µg primary antibody per 100 µg protein. Following immunoprecipitation, the beads were collected, washed, boiled in 2X SDS loading buffer and equal volumes of the eluate containing the immunoprecipitated proteins were separated on 10% SDS-PAGE gels. For the IP input and all other immunoblotting analyses, 30 µg of the protein lysate was separated on 10% SDS-PAGE gels.

Antibodies used for immunoblotting were as follows: anti-MDM2 (2A10 mAb (epitope amino acids 294 to 339), kind gift of Dr. Lindsey Mayo, Indiana University and SMP14 sc-965 Santa Cruz Biotechnology: epitope amino acids 154-167), anti-MDMX (1 µg/ml,

A300-287A, Bethyl Laboratories, Montgomery, TX: epitope amino acids 125 to 175 of

MDMX), anti c-Myc (0.2 µg/ml, clone 9E10, sc-40 or clone A-14, sc-789, Santa Cruz

Biotechnology), anti-p53 (0.2 µg/ml, DO-1 clone, sc-126, Santa Cruz Biotechnology), anti-p21 (0.2 µg/ml, F-5, sc-6246, Santa Cruz Biotechnology), β-Actin (AC-15, A5441,

Sigma Aldrich, St. Louis, MO) and GAPDH (14C10, catalog #2118, Cell Signaling).

Reverse Transcription and quantitative Real-Time Polymerase Chain Reaction (qRT-

PCR): The MCF7 cells were transfected with myc-tagged LacZ or MDM2-ALT1 or

MDMX-ALT2 expression constructs for 24 hours and were then harvested for RNA and protein. For the Nutlin-3 experiments, MCF7 cells were transfected with LacZ expressing plasmids and 24 hours post-transfection, were treated with 10µM Nutlin-3

(N6287-1MG, Sigma Aldrich) or equal volume of DMSO for 12hours. They were then harvested for RNA and protein. RNA isolation was performed using the RNeasy Mini

111

Protocol (Qiagen, Valencia, CA). Typically, 1 µg of RNA with random hexamers was used to synthesize cDNA in reverse transcription reactions that were carried out using the Transcriptor RT enzyme (Catalog no. 03531287001, Roche Diagnostics,

Indianapolis, IN) according to manufacturer’s instructions. For detection of miRNA targets, the reverse transcription reaction was performed using 1 µg of RNA with gene- specific reverse primers for either the p53-target miRNAs or for the U6 snRNA endogenous control. These primers are listed below. Real-time PCR reactions were carried out using the SYBR Green PCR master mix (Applied Biosystems part no.

4309155). For the real-time quantification of p21 transcripts, the PCR reactions were performed on an ABI Prism 7500 Sequence Detection system (Applied Biosystems,

Foster City, CA) at 50oC for 2 minutes, 95oC for 10 minutes with 40 cycles of 95oC for 1 minute and 60oC for 1 minute each. All other real-time PCR assays were performed on an ABI 7900HT Fast Real Time PCR system under reaction conditions of 50oC for 2 minutes, 95oC for 10 minutes with 40 cycles of 95oC for 15 seconds and 60oC for 1 minute each for the mRNA targets and for 50 cycles for the miRNA targets. GAPDH (for mRNA targets) or U6 snRNA (for miRNA targets) levels in each sample were used as the endogenous control detector in all cases. The primers used to amplify the various p53-target transcripts (mRNA and miRNA targets) are listed below. For the miRNA targets, the gene-specific reverse primers were used only for reverse transcription reaction and the PCR amplification was carried out using the specific forward primer and a universal reverse primer (listed below). For U6 snRNA was amplified with the specific forward primer and the same reverse primer used for reverse transcription. All PCR reactions were carried out with 3 technical replicates and the amplification of single PCR products in each reaction was confirmed using dissociation curve analyses and also by

112 separating the products of the real-time PCR in 2.5% agarose gels. In the case of p21, the ratio of its transcript levels to GAPDH was plotted using GraphPad prism (ver 5.0b) with error bars representing the values from 4 independent experiments. The levels of all other transcriptional targets of p53 in MDM2-ALT1 or MDMX-ALT2 expressing cells relative to the corresponding transcript levels in LacZ transfected cells was determined as the relative quantification (RQ) or the 2-ΔΔCt values using the RQ manager (1.2.1) software. RQ values from a minimum of 3 independent experiments were plotted using

GraphPad Prism (ver 6.0) and error bars represent the standard error mean (SEM) unless specified. Statistical analyses to compare the level of p21 transcripts between

LacZ over-expressing samples and the MDM2-ALT1 or MDMX-ALT2 expressing samples were performed using one-way ANOVA with Bonferroni’s multiple comparison tests on the GraphPad Prism version 5.0b software. In all other cases, to determine statistical significance in the difference in transcript levels between the LacZ and MDM2-

ALT1 or MDMX-ALT2 transfected groups, unpaired two-tailed students’ T-tests were performed using GraphPad Prism ver 6.0. mRNA targets:

14-3-3σ: Forward: 5’ GGCCATGGACATCAGCAAGAA 3’, Reverse: 5’

CGAAAGTGGTCTTGGCCAGAG 3’

Bax: Forward: 5’ CCCCGAGAGGTCTTTTTCCG 3’, Reverse: 5’

GGCGTCCCAAAGTAGGAGA 3’

Cyclin D1: Forward: 5’ CCCGCACGATTTCATTGAAC 3’, Reverse: 5’

AGGGCGGATTGGAAATGAAC 3’

Fas1: Forward: 5’ GGGGTGGCTTTGTCTTCTTCTTTTG 3’, Reverse: 5’

ACCTTGGTTTTCCTTTCTGTGCTTTCT 3’

113

GADD45A: Forward: 5’ GCTGGTGACGAATCCACATTC 3’, Reverse: 5’

CAGATGCCATCACCGTTCAGG 3’

Noxa: Forward: 5’ GCTGGAAGTCGAGTGTGCTA 3’, Reverse: 5’

CCTGAGCAGAAGAGTTTGGA 3’

PCNA: Forward: 5’ AGGCACTCAAGGACCTCATCA 3’, Reverse: 5’

GAGTCCATGCTCTGCAGGTTT 3’

Puma: Forward: 5’ CCCTGGAGGGTCCTGTACAA 3’, Reverse: 5’

CTCTGTGGCCCCTGGGTAA 3’

WIP1: Forward: 5’ GTTCGTAGCAATGCCTTCTCA 3’, Reverse: 5’

CAATTTCTTGGGCTTTCATTTG 3’ p21: Forward: 5’ CCTGTCACTGTCTTGTACCCT 3’, Reverse: 5’

GCGTTTGGAGTGGTAGAAATCT 3’

GAPDH: Forward: 5’ GATGCTGGCGCTGAGTACG 3’, Reverse: 5’

GCTAAGCAGTTGGTGGTGC 3’

miRNA targets:

Universal reverse primer: 5’ TGGTGTCGTGGAGTCG 3’ miRNA 29b: Forward: 5’ ACACTCCAGCTGGGTAGCACCATTTGAAATC 3’, Reverse: 5’

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACTGA 3’ miRNA 34a: Forward: 5’ ACACTCCAGCTGGGTGGCAGTGTCTTAGCTG 3’, Reverse:

5’ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACCAG 3’ miRNA 107: Forward: 5’ ACACTCCAGCTGGGAGCAGCATTGTACAGG 3’, Reverse: 5’

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGATAGCC 3’ miRNA 145: Forward: 5’ ACACTCCAGCTGGGGTCCAGTTTTCCCAGG 3’, Reverse: 5’

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGGGATTC 3’

114 miRNA 192: Forward: 5’ ACACTCCAGCTGGGCTGACCTATGAATTCAC 3’, Reverse: 5’

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGGCTGTC 3’ miRNA 215: Forward: 5’ ACACTCCAGCTGGGATGACCTATGAATTGAC 3’, Reverse: 5’

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTCTGTC 3’

U6 snRNA: Forward: 5’ CTCGCTTCGGCAGCACA 3’, Reverse: 5’

AACGCTTCACGAATTTGCGT 3’

Generation and characterization of MDM2-ALT1 tumor cohorts: The mouse model of conditional MDM2-ALT1 expression was generated using the transgenic construct depicted in Fig 4.7A. ES cells were electroporated with this construct and stably selected for single insertion site clones. ES cell clones were then injected into blastocysts and the chimeric mice were generated following standard protocols. This was performed in collaboration with the transgenic animal core at the Nationwide Children’s Hospital

Research Institute. Once germline transmission of the transgene was confirmed, the chimeric mice were backcrossed into the C57Bl/6 strain to generate congenic mice. For all experiments in this study, animals belonging to the F3 generation (3rd generation of backcrossing) were utilized. To generate MDM2-ALT1-CD19 cre cohorts, the F3 MDM2-

ALT1 mice were bred to CD19 Cre (homozygous) mice (Jackson labs strain:

B6N.129P2-Cd19tm1(cre)Cgn/J). Animals were genotyped for the MDM2-ALT1 transgene using: MDM2 X3-X12 junS For- 5’ GAGACCCTGGACTATTGG 3’ and Poly AR Rev- 5’

CCCCATAATTTTTGGCAGAG 3’. For CD19 Cre the following primers were used: For-

5’ CCTGTTTTGCACGTTCACCG 3’ and Rev- 5’ ATGCTTCTGTCCGTTTGCCG 3’.

Genotyping was performed using standard PCR protocols typically at a melting temperature of 56oC. For RT-PCR analysis of MDM2-ALT1 expression, frozen tissues

(spleen and muscle) obtained from the mice of appropriate genotypes were pulverized

115 and RNA was extracted using the RNeasy mini kit (Qiagen, Valencia, CA). Typically 4 µg

RNA was utilized for the reverse transcription reaction with random hexameric primers using protocols described in the previous sections. MDM2-ALT1 expression was then validated using the same primers as the genotyping protocol. –RT controls were used to rule out contamination from genomic DNA. All pathological analyses of the mice including complete necropsy, H&E staining of the tissue sections and disease diagnoses were carried out at the Comparative Pathology and Mouse Phenotyping Shared

Resources (CPMPSR) by Dr. Krista La Perle at the Ohio State University. All statistical analyses were carried out using Graphpad Prism version 6.0.

Flow cytometric analyses: were performed in collaboration with the laboratory of Dr.

Prosper Boyaka at the College of Veterinary Medicine, OSU. Briefly, freshly excised spleens and lymph nodes of the mice were mashed using syringe plungers and filtered through a 70 µM mesh to obtain single cell suspensions in FACS buffer (1x PBS

(phosphate buffered saline) plus 2% FCS (fetal calf serum) and 0.01% Sodium Azide).

Splenocytes were subjected to an RBC (red blood cells) lysis step using ACK lysis buffer

(Life technologies) prior to use in flow cytometry. Cells were washed in FACS buffer, counted and resuspended to a final concentration of 1 x 106 cells/ml. Approximately

100,000 cells were stained for 30 minutes at 4oC with a combination of either anti-B220, anti-CD5, anti-IgM and anti-CD19 or anti-IgG, anti-CD3e, anti-IgM and anti-CD19 antibodies. Concentrations of antibodies used were: B220 FITC: 0.625 ug/mL, IgG FITC:

5 ug/mL, CD5 PE: 0.5 ug/mL, CD3e PE: 10 ug/mL, IgM PE-Cy7: 2.5 ug/mL, CD19 APC:

1 ug/mL. IgG FITC and IgM PE Cy7 antibodies were from Southern Biotech while all others were purchased from BD Pharmingen. Positive control tubes were included for the staining of individual antibodies. Importantly, we included a live-dead cell

116 discriminator (7AAD) for every sample examined and only the live cell population was considered for analyses in every set. Stained cells were then analyzed by flow cytometry using a BD Biosciences Accuri Cytometer. Data were collected for 10,000 events and analyzed using the BD Accuri C6 software. Further statistical analyses were performed using Graphpad Prism version 6.0.

4.3 Results

4.3.1 MDM2-ALT1 interacts with full-length MDMX and MDM2

MDM2-ALT1, a major stress- inducible splice variant of MDM2 lacks a p53-binding domain but contains an intact RING domain ([220] and fig 4.1A). The RING domain facilitates the homodimerization of MDM2 and also hetero-dimerization with MDMX [191,

192]. Previous reports have demonstrated the interaction of MDM2-ALT1 with full- length MDM2, which potentially affects the functions of MDM2 [232, 234]. We wanted to test the possibility that MDM2-ALT1 could also directly form heterodimers with MDMX.

To this end, we transfected MCF7 cells with plasmids expressing myc-MDM2-ALT1 or a negative control myc-GFP and performed an immunoprecipitation of the myc-tagged proteins. The immunoprecipitated samples were then probed with antibodies specific for

MDM2 or MDMX to identify interaction of MDM2-ALT1 and MDMX-ALT2 with the endogenous isoforms of MDM2 and MDMX (Fig 4.1). Consistent with previous reports, we observed the direct interaction of MDM2-ALT1 with full-length MDM2 (Fig 4.1C). We additionally performed reciprocal immunoprecipitation of MDM2 to validate interaction of endogenous MDM2 with MDM2-ALT1 in cells expressing control (myc-LacZ) or myc-

MDM2-ALT1. Results indicate that myc-MDM2-ALT1 interacted with endogenous

MDM2 (Figure 4.2). We also observed that MDM2-ALT1 interacts directly with full- length MDMX (Fig 4.1D). The specificity of these interactions is demonstrated by the

117 fact that myc-tagged LacZ or GFP did not co-immunoprecipitate with either endogenous

MDM2 or MDMX (Fig 4.1C and 4.1D).

4.3.2 MDMX-ALT2 dimerizes with MDM2 and MDMX

It has previously been shown that in response to genotoxic stress such as UV and cisplatinum treatment, MDMX is also alternatively spliced to create a damage-induced isoform, MDMX-ALT2 [230, 233, 250, 376]. Similar to MDM2-ALT1, MDMX-ALT2 lacks the p53-binding domain but retains the RING domain (Fig 4.1B). To test the possibility that MDMX-ALT2 can similarly dimerize with full-length MDMX and MDM2, we overexpressed myc-tagged MDMX-ALT2 in MCF7 cells. The immunoprecipitated myc-

MDMX-ALT2 was blotted with specific antibodies against MDM2 or MDMX to assess its interactions with endogenous MDM2 and MDMX isoforms (Fig 4.1). Indeed, we observed that myc-tagged MDMX-ALT2 co-immunoprecipitated with full-length MDM2

(Fig 4.1C) and MDMX (Fig 4.1D). Additionally, we verified interaction of MDM2 with

MDMX-ALT2 by reciprocal co-immunoprecipitation of endogenous MDM2 in cells expressing control (myc-LacZ) or myc-MDMX-ALT2. Results indicated that myc-MDMX-

ALT2 interacted with endogenous MDM2 (Figure 4.2). Importantly, myc-tagged LacZ used as a negative control in these experiments failed to co-immunoprecipitate either

MDM2 or MDMX (Fig 4.1C, D).

4.3.3 MDM2-ALT1 and MDMX-ALT2 expression stabilizes p53

Since MDM2-ALT1 and MDMX-ALT2 interact with full-length MDM2 and MDMX, it is possible that the formation of such complexes can impede the functions of these proteins. Moreover, MDM2-ALT1 expression has been shown previously to lead to the accumulation of p53 due to sequestration of MDM2 in the cytoplasm [232-234]. We hypothesized that MDMX-ALT2 expression could increase p53 levels in a similar

118 manner. To test this, we examined the expression of p53 in MCF7 cells that were transfected with a negative control (LacZ), MDMX-ALT2 or MDM2-ALT1. As expected,

MDM2-ALT1 expression caused a substantial increase in the levels of p53 protein compared to LacZ over-expression (Fig 4.3A p53 panel compare lanes 1 and 2).

MDMX-ALT2 expression also resulted in an increase in the p53 protein levels compared to LacZ over-expression (Fig 4.3A p53 panel compare lanes 1 and 3). However, this effect was more moderate compared to the MDM2-ALT1-mediated upregulation of p53 protein (Fig 4.3A p53 panel). As a positive control for the accumulation of p53 protein, we compared p53 levels in whole cell protein lysates from untreated and UVC-irradiated

(50 J/m2) MCF7 cells (Fig 4.3A, compare lanes 4 and 5).

4.3.4 p53 upregulated upon MDM2-ALT1 over-expression is transcriptionally active

Because over-expression of MDM2-ALT1 and MDMX-ALT2 leads to the accumulation of wild-type p53 protein in MCF7 cells, it raises the possibility that transcriptional targets of p53 may also be upregulated in response to the expression of these stress-inducible splice forms. We therefore examined the expression of p21 (Cyclin-dependent kinase inhibitor 1), a transcriptional target of p53 [381], in MCF7 cells expressing LacZ, MDM2-

ALT1 or MDMX-ALT2. Indeed, we observed a significant upregulation of p21 at the transcriptional level in cells expressing MDM2-ALT1 compared to LacZ expression (Fig

4.3B). In the case of MDMX-ALT2 over-expressing cells, the rise in p21 transcript levels was not statistically significant (Fig 4.3B). This pattern is consistent with the moderate rise in p53 levels observed upon MDMX-ALT2 over-expression (Fig 4.3A p53 panel).

However, the rise in p21 protein levels was evident both in cells transfected with MDM2-

ALT1 and in cells expressing MDMX-ALT2 compared to cells expressing LacZ (Fig 4.3C,

119 compare lanes 2 and 3 with lane 1). The UVC irradiated cells were used as a positive control of p21 induction compared to the untreated cells (Fig 4.3C, lanes 4 and 5).

4.3.5 MDM2-ALT1 and MDMX-ALT2 lead to activation of distinct p53 transcriptional targets

Since the over-expression of MDM2-ALT1 and MDMX-ALT2 lead to the upregulation of p53-target p21, we hypothesized that other transcriptional targets of p53 could also be upregulated under these circumstances. We assessed the transcript levels of candidate genes involved in the p53 tumor suppressor pathway and known to play roles in either cell-cycle control and/or DNA damage repair (p21, GADD45A, WIP1, PCNA, Cyclin D1 and 14-3-3σ) or apoptosis (Bax, Fas1, PUMA, Noxa) [382-394]. Of the 9 additional p53- target genes whose expression was assayed, only 3 (Bax, Cyclin D1, and Fas1) showed a significant increase in response to MDM2-ALT1 or MDMX-ALT2 over-expression. Bax transcript levels were significantly upregulated in response to the over-expression of

MDM2-ALT1 as well as MDMX-ALT2 (Fig 4.4A). However, Cyclin D1 levels showed significant increase only upon MDMX-ALT2 expression and Fas1 transcripts were significantly higher only in cells over-expressing MDM2-ALT1. In all cases the transcript levels of the p53-target genes upon MDM2-ALT1 or MDMX-ALT2 over-expression were normalized to corresponding transcript levels in LacZ expressing cells and GAPDH mRNA was used as the endogenous control (Fig 4.4A).

Similarly, we also examined the expression of 6 miRNA targets of p53 including miRNAs

34a, 107, 145, 192, 215, and miR29b [395-403]. While most miRNA targets show moderate increase in expression after MDM2-ALT1 or MDMX-ALT2, only miRNA 215 or miRNA 34a levels were significantly increased in cultures expressing MDM2-ALT1 or

MDMX-ALT2, respectively (Fig 4.4B). The transcript levels of the miRNA targets of p53

120 were normalized to U6 snRNA endogenous control and then normalized again to the

LacZ transfected controls in order to obtain the relative expression of the miRNA targets of p53. These results indicate that while MDM2-ALT1 and MDMX-ALT2 lead to increased p53 protein levels, the transcriptional activity of p53 is restricted to specific targets of p53 raising the possibility that these two splice forms act through distinct molecular pathways to regulate the p53 response.

To determine the p53 transcriptional effects that are mediated as a result of disrupted p53-MDM2 interaction in a manner similar to MDM2-ALT1 and MDMX-ALT2 over- expression, we used Nutlin-3, a drug that specifically inhibits the binding of p53 with

MDM2. We assessed the expression of our panel of p53 targets from DMSO or Nutlin-3 treated cultures. We observed significant upregulation of Bax, Fas1 and p21 upon

Nutlin-3 treatment when compared to DMSO treated cultures (Fig 4.5A). Importantly, these three targets are also upregulated after MDM2-ALT1 overexpression suggesting that overexpression of MDM2-ALT1 may induce transcription of these targets via an overlapping mechanism with Nutlin-3, specifically the disruption the p53-MDM2 interaction. In contrast, 14-3-3σ and WIP1 were significantly upregulated under Nutlin-3 treatment but not upon over-expression of either MDM2-ALT1 or MDMX-ALT2 (Fig

4.5A). Surprisingly, none of the miRNA targets showed a significant change in expression upon Nutlin-3 treatment (Fig 4.5B) despite showing an increase in p53 (Fig

4.5C). Our results indicate that, though there is some overlap in transcriptional target activation with Nutlin-3 treatment and overexpression of MDM2-ALT1, there are likely p53-independent mechanisms for MDM2-ALT1 transcriptional activation as well.

In summary these results indicate that MDM2-ALT1 and MDMX2-ALT2 are modifiers of the p53 pathway and possibly help sustain a fine-tuned response to stress.

121

In this capacity, MDM2-ALT1 and MDMX-ALT2 are facilitators of the p53-mediated tumor-suppression. However, this role is in contrast with the tumorigenic properties ascribed to these splice variants in several in vitro and in vivo studies [220, 232, 235,

236, 239]. In the case of MDM2-ALT1, a recent study demonstrated that its constitutive expression in colorectal cancers harboring gain-of-function mutations in p53 led to the stabilization of mutant p53 and exacerbated tumorigenesis [232]. However, we and others have previously observed that there is no correlation between p53 mutations and constitutive MDM2-ALT1 expression in tumors and that cancer types MDM2 alternative splicing in tumors often results in stabilization of wildtype p53 [224, 230, 404].

To better understand the role of MDM2 alternative splicing in the modulation of the p53 tumor-suppressor pathway and `in oncogenesis, we will examine the functionality of MDM2-ALT1 in vivo in a mouse model of conditional expression of the splice variant. To reconcile the opposing functions of MDM2-ALT1, we propose a model in which MDM2-ALT1 expression first initiates a p53-response by antagonizing p53’s negative regulators and results in proliferation arrest and/or apoptosis and a tumor- protective or tumor-latent phase. However, continuous expression of MDM2-ALT1 fosters the accumulation of mutations in the p53 pathway and subsequent uncoupling of the tumor-suppressor pathway leading to tumorigenesis (Fig 4.6). This model is similar to the mechanism of c-Myc induced tumorigenesis where the dose and duration of c-Myc expression dictates its behavior as a tumor-suppressor or an oncogene (Fig 4.6) [183].

Moreover, expression of MDM2-ALT2 (MDM2-A), another splice variant of MDM2 has been shown to promote senescence in the presence of an intact p53 tumor-suppressor pathway but demonstrates transformative properties in a p53 or ARF null context [237,

122

238] indicating the need for the disruption of crucial tumor-suppressor pathways for

MDM2-ALT mediated tumorigenesis.

4.3.6 Mouse model of conditional MDM2-ALT1 expression

A previous study showed that ubiquitous expression of MDM2-B (the mouse homolog of

MDM2-ALT1) resulted in embryonic lethality ostensibly due to uncontrolled p53 activity.

To better assess the phenotypes associated with MDM2-ALT1, we generated a mouse model of conditional MDM2-ALT1 expression. The construct (pCall2 MDM2-ALT1) comprises a chicken β-actin promoter and CMV enhancer that drive the expression of a

β-galactoside (β-geo) cassette flanked by LoxP sites for recombination and housing 3 downstream poly adenylation signals to prevent transcription read through. (Fig 4.7A)

Downstream of the β-geo cassette is cloned the cDNA of human MDM2-ALT1. MDM2-

ALT1 will be expressed only upon Cre-mediated excision of the upstream β-geo cassette

(Fig 4.7A). This construct was electroporated into embryonic stem (ES) cells, selected for neomycin resistance and DNA was extracted from each clone. Southern hybridization was performed and ES cell clones with single insertion sites were selected. 2 ES cell clones were selected (2C12 and 1C8) and mouse lines were generated using standard transgenesis techniques (blastocyst injection). Once germline transmission of the transgenic construct was confirmed, the chimeric mice were backcrossed into a C57Bl/6 background to generate congenic strains of MDM2-ALT1 transgenic mice. For the tumor cohort study, MDM2-ALT1 transgenic mice (heterozygote for the transgene 2ALT1+/-) of the 2C12 line in the F3 generation (3rd generation of backcrossing) were utilized. Mice expressing Cre recombinase under the control of the CD19 promoter (B cell specific) were crossed to the MDM2-ALT1 transgenic mice to generate tumor cohorts comprising the experimental mice that are positive for both the MDM2-ALT1 transgene and the

123

CD19 cre allele (Expt 2ALT1+/-;CD19+/-) and the control mice that express only the CD19

Cre (Ctrl 2ALT1-/-;CD19+/-). The breeding scheme for the generation of these cohorts is depicted in Fig 4.7B. Additionally, we confirmed B cell specific MDM2 ALT1 expression in the spleens (high population of B cells) of Expt animals (Fig 4.7C). Importantly, control litter mate mice positive for the MDM2 ALT1 transgene but lacking the CD19 Cre allele did not express MDM2 ALT1 in either spleen or muscle (Fig 4.7C compare lanes corresponding to C and E groups). However, it should be noted that, in subsequent generations of the 2C12 MDM2 ALT1 transgenic line, a low level of leaky MDM2 ALT1 was detected in the absence of Cre recombinase expression. However, the MDM2 ALT1 induced phenotypes were restricted to tissues with Cre recombinase where robust expression of the MDM2 ALT1 transgene is observed.

4.3.7 MDM2-ALT1 expression in B cells leads to significantly higher lymphoma incidence compared to controls

In our pilot experiments, Ctrl (2ALT1 transgene negative but CD19 cre positive

(heterozygous): 2ALT1-/-;CD19+/-) and Expt (2ALT1 transgene positive (heterozygous) and also CD19 cre positive (heterozygous): 2ALT1+/-;CD19+/-) mice were monitored until a maximum period of 2 years and 21 days for malignancies or any signs of illness. It should be noted that our cohorts were generated on C57Bl/6 background with wildtype p53. Mice that developed masses reaching a diameter of 1cm or were in distress were euthanized to meet IACUC endpoint criteria. However, we observed neither differences in life span between Ctrl (n=15, 2ALT1-/-;CD19+/-) and Expt (n=18 2ALT1+/-;CD19+/-) mice

(Fig 4.7D ATS Kaplan Meier insert) nor significant changes in the frequency or spectrum of malignancies in these animals (data not shown). In subsequent experiments, we generated cohorts of Ctrl and Expt (age-matched and litter mates) mice and aged them

124 to a specific time point (18 months). At this point, the mice were euthanized and complete necropsy and histopathological analyses were performed on a total of 75 animals (Ctrl: n=41 and Expt: n=34) in collaboration with the CPMPSR at the Ohio State

University. Both Expt and Ctrl groups presented with age-associated disorders such as degenerative joint disease, atrophy and lesions (incidental non-neoplastic lesions including fibro-osseus and vascular lesions common in aging mice) in various organs.

Additionally, both Expt and Ctrl animals developed non-lymphoid neoplasms that are commonly observed in aging mice of C57Bl/6 background (Table 4.1A and B). No significant differences emerged between the two groups with respect to these criteria.

When we evaluated the occurrence of lymphoid neoplasms in these animals, we observed that mice from both Ctrl and Expt groups developed lymphomas (in the spleens and/or lymph nodes). This is possibly due to the fact that lymphomas are a common type of malignancy associated with aging C57Bl/6 mice [405]. However, we found that MDM2-ALT1 positive Expt (55.9% - 19 of 34) mice showed significantly higher lymphoma - incidence compared to MDM2-ALT1 negative Ctrl (26.8% - 11 of 41) mice

(Fig 4.7E, Table 4.1A and B). These results clearly indicate that constitutive MDM2-

ALT1 expression in B cells led to increased lymphomagenesis in mice of advanced age.

Notably, these results were observed in mice bearing wildtype alleles at the p53 locus.

This suggests that in the context of wildtype p53 (and also other fully functional tumor- suppressor pathways) the oncogenic functions of MDM2-ALT1 become fully apparent only after an initial period of latency when a critical level of exposure to MDM2-ALT1 has been achieved.

125

4.3.8 MDM2-ALT1 positive mice show decreased B cell markers compared to control mice

To further examine the origin of the observed lymphoid neoplasms, we used flow cytometry for B cell markers CD19, B220, IgG and IgM and also T cell markers CD3e and CD5 (also expressed by a subset of B cells although to a lesser extent compared to

T cells) to immunophenotype the spleens and lymph nodes (axillary, inguinal and mesenteric) of a cohort of age-matched (18 months) ctrl (n=18) and expt (n=15) animals.

Concordant with the increased incidence of tumorigenesis, we expected that the spleens and lymph nodes of expt mice would in general exhibit higher levels of B cell markers compared to ctrl mice. Surprisingly, we found that the spleens and lymph nodes of the expt mice presented with significantly lowered population of cells expressing the B cell markers compared to the ctrl animals (Fig 4.8A and Table 4.2). The T cell markers showed no change in levels between the control and the experimental cohorts indicating a B cell specific phenomenon (Fig 4.8B and Table 4.2). Notably, this phenotype was more apparent in the spleens (Fig 4.8 and Table 4.2). This indicates that the expression of MDM2-ALT1 caused a decrease in B cell markers possibly due to cell-cycle arrest or the apoptosis of B cells. These results, in conjunction with the observed delay in induction of lymphomagenesis (observable at 18 months) by the expression of MDM2-

ALT1 in B cells, are suggestive of an earlier, possibly p53-dependent, phase of latency or tumor protection in a manner similar to Myc over-expression (Fig 4.6).

Additionally, as a supplement to the histopathological analyses, we examined the immunophenotyping results to identify subtypes of lymphoproliferative disorders occurring in the spleen and lymph nodes of these animals. Different subtypes of lymphomas are known to show distinctive expression patterns of cell-surface markers

126 and hence present very unique immunophenotypes that can be used to classify these malignancies. For instance, majority of mature B cell malignancies show increased intensity or populations of cells expressing markers such as CD19, CD45R (B220),

CD20 and CD79a while only few subtypes such as CLL (Chronic Lymphocytic

Leukemia) and Mantle cell lymphoma show variable to positive staining for markers like

CD5, CD10 and CD23 [406]. In our case, setting a diagnostic threshold of 20% for CD5- positive staining (on the CD19+ population) [407], we observed that only 1 spleen lymphoma (diagnosed via H&E staining) each from the ctrl (1 of 8) and expt (1 of 11) groups could be considered as showing aberrant CD5 expression on B cells (CD19+

CD5+) (Fig 4.9). CD5+ staining is associated with CLL and some other subclasses lymphomas including Diffuse Large B cell Lymphoma (DLBCL), Mantle Cell Lymphoma

(MCL) and Marginal zone B cell Lymphoma (MZL) [406] and it is possible that these lymphomas fall into one of these categories. Interestingly, the ctrl mouse presenting with the CD19+ CD5+ immunophenotype was also diagnosed with leukemia and hence it is possible that this phenotype is representative of CLL in this animal. All other tumors showed variable CD19+ CD5+ staining (ranging from <1% to almost 20%). Hence, these results are not conclusive in themselves to enable an accurate diagnosis of the tumor subtype and warrant evaluation of additional markers via immunohistochemical staining.

In summary, we observe that in vitro MDM2-ALT1 behaves as a modulator of the p53 pathway that activates p53 and its transcriptional targets. We find that in vivo this behavior is reflected in decreased B cell marker expression in spleens of MDM2-ALT1 positive mice (B cell specific expression) compared to MDM2-ALT1 negative controls providing evidence of an earlier phase of proliferation arrest or cell death. On the other hand, we also observe increased incidence of lymphomas in mice expressing MDM2-

127

ALT1 in their B cells at later stages in life (18 months). Taken together, these results lend support to our model that short term exposure to MDM2-ALT1 results in activation of the p53 tumor-suppressive network but continuous expression fosters the accumulation of mutations that uncouple the tumor-repressive functions of p53 and lead to tumorigenesis (Fig 4.6). However, additional experiments are required to fully understand interplay of these two phases of MDM2-ALT1’s biological functions.

4.4 Discussion

4.4.1 Stress-responsive MDM2 and MDMX alternative splicing

The maintenance of low physiological levels of the tumor-suppressor p53 is crucial for the routine functioning of the cell. MDM2 and MDMX are the factors that are chiefly responsible for the maintenance of low levels of p53 and also for curbing its activity as a transcription factor under normal conditions [149, 152, 189, 209, 371]. Importantly, both

MDM2 and MDMX are required to suppress p53 activity and this is evidenced by the fact that mice, null for either Mdm2 or Mdmx are not viable unless p53 is also deleted [174,

203, 408]. This is because MDM2 and MDMX possess distinct, non-overlapping roles in p53 regulation [203, 204, 409-412] but they are also inextricably intertwined in their functionality due to complex interactions with each other and wildtype p53 [192, 194,

196, 197, 199, 200, 413-416]. It is therefore conceivable that inactivation of both MDM2 and MDMX is imperative for the activation of p53 whenever required. For instance, the splicing of MDM2 and MDMX is coordinately altered in response to genotoxic-stress resulting in several splice variants including MDM2-ALT1 and MDMX-ALT2 that lack the p53-binding domain [230, 233] and are therefore, incapable of negatively regulating p53.

In this study, we have focused on examining the implications of the expression of splice variants MDM2-ALT1 and MDMX-ALT2 on the p53-pathway.

128

Both MDM2-ALT1 and MDMX-ALT2 retain the RING finger domain that is essential for the homo and hetero-dimerization of MDM2 and MDMX. MDM2-ALT1 has previously been shown to interact with full-length MDM2 and inactivate it by sequestering it and preventing functional homodimerization thereby resulting in the stabilization of p53 [223, 232-234, 240]. A recent study in colorectal cancers presenting with constitutive expression of MDM2-ALT1 suggested that in the context of mutant p53

MDM2-ALT1 actually contributes to oncogenesis by antagonizing full-length MDM2 and stabilizing the mutant p53 (with gain of function properties) in these tumors [232].

However, it is possible that the MDMX pathway in these tumors could still be active and inactivate mutant p53. We present evidence here that MDM2-ALT1 is capable of interacting with and inactivating MDMX in addition to MDM2. In short, because the presence of MDM2-ALT1 can affect the functioning of both the chief negative regulators of p53, it is possible that in these colorectal cancers, MDM2-ALT1 leads to upregulation of the mutant p53 and consequently tumorigenesis by suppressing both MDM2 and

MDMX. Moreover, we show that the architecturally similar MDMX-ALT2 is capable of dimerizing with its own full-length counterpart as well as with full-length MDM2. It is indeed possible that these interactions fostered by MDM2-ALT1 and MDMX-ALT2 serve to disrupt the formation of functional MDM2-MDMX heterodimers or MDM2 and MDMX homodimers. Consequently, it is possible that the resultant full-length MDM and MDM-

ALT complexes are incapable of negatively regulating p53 and lead to the observed increase in p53 protein levels.

4.4.2 Effects of the expression of MDM splice variants on cell cycle

Another important finding we present here is that the p53 protein that is upregulated in the presence of MDM2-ALT1 or MDMX-ALT2 is also transcriptionally active albeit in

129 subtly different ways. For instance, p21, an important downstream target of p53 is upregulated at both transcript and protein levels upon over-expression of MDM2-ALT1 consistent with previous findings [223, 240]. Concordant with the increased levels of p21, MDM2-ALT1 over-expression lead to G1-S phase cell cycle arrest in a p53 and p21-dependent manner (data not shown).

In the case of MDMX-ALT2 over-expression, there was only a moderate increase in p21 transcripts, which was not statistically significant. This is concordant with the fact that the increase in p53 levels observed upon MDMX-ALT2 over-expression was more modest compared to MDM2-ALT1 over-expression. It is possible that MDMX-ALT2 expression alone cannot sufficiently interfere with the MDM proteins homo- or heterodimers and thus upregulate and activate p53. Interestingly, there was a more noticeable rise in p21 at the protein level upon MDMX-ALT2 over-expression compared to the negative control. This raises the possibility that MDMX-ALT2 could play a role in modulating p21 protein stability. Both full-length MDM2 [417, 418] and MDMX [419] have been shown to promote the degradation of p21 in a p53 and ubiquitination independent manner. As MDMX-ALT2 interacts with full-length MDM2 and MDMX, it is possible that it impedes the MDM-mediated degradation of p21 thereby leading to increased stabilization of p21. However, we observed that the MDMX-ALT2-induced increase in p21 was insufficient to induce cell-cycle arrest in these cells (data not shown) indicating that additional events are possibly required to facilitate cell cycle arrest or that

MDMX-ALT2 possesses other p53-independent roles that over-ride the cell’s response to the increased p21 levels.

130

4.4.3 Modulation of the p53-pathway by the MDM alternative splice variants

Strikingly, when we also examined a panel of other transcriptional targets of p53, we observed subtle differences in the subset of p53 target genes that are activated in the presence of MDM2-ALT1 versus MDMX-ALT2 (Fig 4.4). The candidate genes examined were those involved in the p53 tumor suppressor pathway and known to play roles in either cell-cycle control and/or DNA damage repair (GADD45A, WIP1, PCNA, Cyclin D1 and 14-3-3σ) or apoptosis (Bax, Fas1, PUMA, Noxa, Bcl-XL). MDM2-ALT1 over- expression resulted in the significant upregulation of Bax and Fas1 transcripts although

GADD45A levels also showed a strong increase under these conditions. While MDMX-

ALT2 over-expression also resulted in an upregulation of Bax transcripts, it also caused the significant upregulation of Cyclin D1. MDM2-ALT1 over-expression however did not affect the Cyclin D1 pre-mRNA levels. Interestingly Cyclin D1 is a transcriptional target of p53-mediated repression [383] and cyclin D1 protein promotes cell-cycle progression

[420]. This raises the possibility that MDMX-ALT2 affects Cyclin D1 levels independent of p53 and also contributes to the absence of the cell-cycle arrest phenotype upon

MDMX-ALT2 over-expression despite the rise in p21 levels. We observed that MDM2 protein levels were also upregulated as a result of the over-expression of MDM2-ALT1 or MDMX-ALT2 possibly because MDM2 itself is a transcriptional target of p53.

Additionally, we examined the expression of miRNA targets of p53, which have well-known roles in cell-cycle inhibition, apoptosis and tumor-suppression. While miRNAs 34a [395-398], 107, 145, 192 and 215 are directly transcriptionally regulated by p53 via response elements at their promoters [399], miR29b expression is induced in a p53-dependent manner and is involved with p53 in positive feedback loop [400, 401].

Here also we found that not all miRNA targets are ubiquitously responsive to the

131 upregulation of p53 caused by the over-expression of MDM2-ALT1 or MDMX-ALT2.

While miR34a upregulation is evident upon over-expression of both MDM2-ALT1 and

MDMX-ALT2, the change was found to be modest but more consistent only in the presence of MDMX-ALT2. This is interesting because miR34a, a tumor suppressor miRNA that promotes p53-dependent cell-cycle arrest and senescence is part of a positive feedback loop with p53 in that; it negatively regulates MDMX expression [421,

422]. It is possible then that MDMX-ALT2 contributes at least in part, to the stabilization and transcriptional activity of p53 via miRNA mediated regulation. Another miRNA that showed significant changes upon MDM-ALT over-expression was miR215 whose expression promotes p21 upregulation and cell-cycle arrest. Interestingly, a close family member miR192 whose promoter is also p53-responsive showed no significant changes in expression in the presence of either MDM2-ALT1 or MDMX-ALT2.

Overall, these results indicate that the splice variants of MDM2 and MDMX influence the p53 pathway in distinct ways adding to previous findings that describe full- length MDM2 and MDMX as functionally distinct in terms of p53 regulation [203, 204,

409-412]. For instance, deletion of Mdm2 resulted in embryonic lethality due to apoptosis [174, 408, 409] while the deletion of Mdmx resulted in embryonic lethality due to the induction of cell cycle arrest [203, 409]. Interestingly, it is possible that subtle differences exist in the choice of p53 targets activated depending upon even the choice of MDM2 splice variant being expressed. For example, a previous study on splice- variant MDM2-A showed that in the presence of MDM2-A, p21 protein levels were increased in a p53-dependent manner but PUMA and BAX protein levels remained unchanged compared to cells lacking MDM2-A expression [238]. However, in the case of MDM2-ALT1 expression, we could observe significant increase in Bax mRNA levels

132 compared to control LacZ expressing cells (Fig 4.4A). This raises the possibility that the p53 response could be fine-tuned depending on the MDM2 splice variant being expressed.

To better understand the changes in gene expression induced by MDM-ALT over-expression in the context of p53 activation, we examined the expression of the p53 target mRNA and miRNA in the presence of the drug Nutlin-3. While the stabilization of p53 is also induced genotoxic stress treatment which also causes the alternative splicing of MDM pre-mRNA, it should be noted that stress stimuli activate multiple tumor- suppressor and DNA-damage signaling networks that feed into the p53 pathway and would occlude a clear understanding of the roles of the MDM-ALT variants in this scenario. Nutlin-3, one the other hand specifically inhibits the interaction of MDM2 and p53 thereby causing the stabilization of p53. As MDM2-ALT1 and MDMX-ALT2 both interact with the full-length MDM proteins and potentially inactivate or sequester them to stabilize p53, they can be viewed as acting in a manner similar to Nutlin-3. Indeed, we observed similarities in the pattern of p53 targets being activated in the presence of

Nutlin-3 and the over-expression of either of the MDM-ALT proteins although the fold changes in the expression of the individual target genes observed upon Nutlin-3 treatment were much higher. This is possibly due to the greater efficacy of the drug in targeting the cells and also the dependence on transfection efficiency in the case of the

MDM-ALT over-expression.

However, differences also existed between the Nutlin-3 system and the over- expression of MDM-ALT proteins. Nutlin-3-induced p53 caused significant upregulation of 14-3-3σ, Puma and WIP1 while neither MDM2-ALT1 nor MDMX-ALT2 contributed to changes in the expression of these genes. Furthermore, none of the miRNA targets of

133 p53 showed changes in expression levels upon Nutlin-3 treatment. This is in contrast with previous studies examining Nutlin-3 treatment of cells where the expression of at least miRNAs 34, 192 and 215 were shown to be altered in response to Nutlin-3 [399].

However, it is possible that cell line differences could account for these discrepancies.

Moreover, it is not surprising that the transcriptional activity of p53 can pose differences between Nutlin-3 treatment and MDM-ALT over-expression as p53 activity on its transcriptional targets is also contingent on the post-translational modification of p53 and the presence of co-activators. Additionally p53 shares target genes with its family members p63 and p73 whose levels and activity are also regulated in a complex manner by MDM2 and MDMX and it is possible that the MDM-ALT proteins influence these interactions as well. However, these possibilities are yet to be extensively explored.

In short, the expression of MDM2-ALT1 and MDMX-ALT2 could be viewed as a means of inactivating the full-length MDM proteins and thereby modulating the p53-dependent stress-response in unique ways. We present these findings in the following model: under normal conditions when the alternative splice forms such as MDM2-ALT1 and

MDMX-ALT2 are absent, their full-length counterparts are fully active and function to inhibit p53 function. However, under DNA damaging conditions, the splice variants like

MDM2-ALT1 and MDMX-ALT2 interact with and cause the inactivation of both MDM2 and MDMX leading to the stabilization of p53 and increase in its transcriptional activity.

4.4.4 MDM2-ALT1 and MDMX-ALT2 in cancer

The occurrence of MDM2-ALT1 transcripts is a common feature of several cancer types

[220-230] and has been associated with high grade, metastatic tumors in rhabdomyosarcomas (RMS), breast cancer, ovarian and bladder cancers [220, 226,

230]. Moreover, the spontaneous generation of alternative Mdm2 splice forms has been

134 reported in mouse lymphomas [183, 232]. In the case of MDMX-ALT2, we recently demonstrated the coordinate occurrence of MDMX-ALT2 transcripts with MDM2-ALT1 in about 24% pediatric RMS tumors and also its association with metastatic tumors [230].

The role that MDM2-ALT1 plays in cancer has been under scrutiny since it was first identified in tumors. Several studies have demonstrated an oncogenic role for MDM2-

ALT1, which is in direct contrast to its role in upregulating tumor-suppressor p53 [223,

230, 232, 235, 236]. MDMX-ALT2 also presents a similar conundrum in that it confers tumorigenic properties to cells [230], but is also capable of upregulating tumor- suppressor p53 levels (Fig 2). However as the study in colorectal cancer demonstrated, when MDM2-ALT1 is expressed in conjunction with mutant p53, it contributes to tumorigenesis [232]. It is possible that in tumors presenting with MDMX-ALT2 along with mutations in p53, a similar mechanism is at play wherein both MDM2 and MDMX can be inactivated by MDMX-ALT2 leading to the stabilization of mutant p53. While this is a viable mechanism for the functioning of the MDM splice variants in oncogenesis, it has been shown that mutations in p53 do not correlate with the alternative splicing of

MDM2 and MDMX in tumors [230, 404]. It is therefore tenable that alternate mechanisms exist by which MDM2 and MDMX splice variants affect the p53 tumor- suppressor pathway and lead to its uncoupling in novel ways and to tumorigenesis.

Alternately, the MDM splice variants could lead to tumor formation via p53-independent mechanisms. Indeed, full-length MDM2 and MDMX have been shown to have p53- independent roles in the regulation of cell division and cell death [178, 179, 211, 215-

218, 423-432] and it is therefore possible that MDM2-ALT1 and MDMX-ALT2 could also modify these pathways to contribute to tumorigenesis.

135

4.4.5 Role of MDM2-ALT1 in vivo

Our results show that MDM2-ALT1 plays opposing roles as a repressor and also a promoter of tumorigenesis (chapter 5 results and [230]) while maintaining a complex relationship with the p53 tumor-suppressor pathway (Fig 4.1, 4.2, 4.3, 4.4). To explain the dual nature of its function, we proposed a model in which the pro and antitumorigenic effects of MDM2-ALT1 become apparent only under specific conditions. We hypothesized that in the presence of wildtype p53; MDM2-ALT1 would initially function as a tumor suppressor and lead to a p53-dependent tumor-latent phase due to decreased cell proliferation and/or increased cell death. However, under conditions of persistent MDM2-ALT1 mediated anti-tumor signaling, somatic mutations would accumulate that either inactivate p53 directly or cause the uncoupling of the tumor- suppressor network eventually resulting in tumorigenesis (Fig 4.6). When we tested this possibility in vivo in our conditional mouse model of MDM2-ALT1 (B cell specific) expression, we observed that the MDM2-ALT1 positive cohort presented with significantly higher incidence of lymphomas (compared to age-matched negative controls) in aged mice (>18 months) (Fig 4.7, Table 4.1). This finding underscores the oncogenic effects of persistent MDM2-ALT1 expression which predominate over the basal levels of tumorigenesis associated with aging C57Bl/6 mice (compare 26.8% background levels of lymphomas in ctrl mice to 55.9% in MDM2-ALT1 positive expt mice, Fig 4.7E). Importantly, these results demonstrate that MDM2-ALT1 mediated tumorigenesis occurs only at later stages possibly after inactivation of the wildtype p53 pathway. However, this does not rule out the possibility that MDM2-ALT1 expression could induce pre-neoplastic lesions at earlier time points and hence complete necropsy

136 and examination of animals at various stages of life (< 18 months of age) are required to assess this possibility.

What remains to be understood is the mechanism by which MDM2-ALT1 expression actually drives tumorigenesis. One possibility is the inactivation of the p53 pathway via somatic mutations, a feature that is associated with several subtypes of lymphomas [433-440]. Sequencing the p53 locus in the lymphomas from both the expt and ctrl animals (especially in the hot spot region for mutations in the DNA binding domain) to assess the mutational status of p53 will reveal whether or not direct p53 inactivation plays a role in MDM2-ALT1 mediated tumorigenesis. Another important method to test this possibility is the expression of MDM2-ALT1 in the background of heterozygous p53 deletion. In this case, loss of heterozygosity of p53 in the lymphomas would be an indicator of direct inactivation of p53 via somatic mutations under conditions of constitutive MDM2-ALT1 expression. Mutations involved in uncoupling the p53 pathway downstream of p53 will have to be determined by a combination of sequencing, quantitative real-time PCRs and western blotting for p53’s transcriptional targets.

Additionally, examination of other commonly observed perturbations in lymphomas such as amplification of oncogenes c-Myc [183, 441-444], BCL6 [445, 446], aberrant expression of BCL2 [447-450], Cyclin D1 [451, 452] and other neoplastic lesions, would help uncover the molecular pathways that potentially cooperate with MDM2-ALT1 in driving lymphomagenesis.

The lack of discernible tumorigenesis at earlier stages of life (< 18 months) in

MDM2-ALT1 positive mice is in itself not a clear indicator of a p53-dependent tumor- protective phase. This is because age-matched MDM2-ALT1 negative control animals also do not present with overt tumors at < 18 months of age and in this sense the two

137 groups are not phenotypically distinct. However, in support of a tumor-latent phase induced by MDM2-ALT1, we do observe a statistically significant decrease in populations of cells expressing B cell markers CD19, B220, IgM and IgG in the expt mice compared to ctrls (Fig 4.8). Importantly, this distinction between the expt and ctrl mice is clearly indicative of an MDM2-ALT1 dependent, B cell specific phenotype that is noticeable even at 18 months of age when the tumorigenic phase of MDM2-ALT1 expression is dominant. This phenotype implies an MDM2-ALT1 mediated loss or decrease in proliferation of the B cells in these mice. Considering that MDM2-ALT1 expression is initiated upon CD19 expression as early as the pro-B cell phase of hematopoiesis, it is possible that this phenotype was initiated then and is evident throughout life from prenatal stages to adulthood.

To further validate this possibility, it is important to examine the B cell populations in the major lymphoid organs including bone marrow (major site of hematopoiesis) for the B cell markers at earlier time points in the lives of the expt and ctrl animals (<18 months). Additionally, the p53-dependence of this phenotype should be assessed by examining the levels of p53 and its downstream targets in MDM2-ALT1 positive and negative mice. Alternatively, loss of this B cell ablation phenotype in a p53 null background would serve as an indicator of the p53-dependence of the MDM2-ALT1- mediated phenomenon. One possible caveat to these studies is that the MDM2-ALT1 dependent B cell loss (as measured by flow cytometry for B cell markers) may only be apparent in older mice because of age-associated alterations or decline in hematopoiesis and less clear in younger mice with a more robust hematopoietic system

[453, 454]. Hence, additional experiments that directly compare the proliferation (in antigen-stimulated B cells; decreased proliferative response in MDM2-ALT1 positive

138 cells) and/or apoptosis (apoptotic markers; increased in MDM2-ALT1 positive cells) in B cells from MDM2-ALT1 positive and negative mice are necessary to clearly assess the extent of the MDM2-ALT1 dependent B cell loss phenotype.

Taken together, our results clearly demonstrate that MDM2-ALT1 mediated tumorigenesis in the presence of wildtype p53 is evident only at later stages of life (18 months) possibly due to the predominance of its role in p53 activation at early stages.

This corroborates a previous study in which the expression of Mdm2-b (mouse homolog of MDM2-ALT1) under the control of a GFAP promoter resulted in tumorigenesis at an average onset time of over 80 weeks in the context of unperturbed p53 and other tumor- suppressive networks [235]. However, in model systems sensitized for tumorigenesis or in which p53 is disabled, the tumor-promoting properties of MDM2-ALT1 become more apparent suggestive of p53-independent functions [220, 235, 236]. Indeed, MDM2-ALT2, another splice variant of MDM2, has been shown to behave differently in the contexts of intact and deactivated tumor-suppressor pathways [237, 238]. Our model of conditional

MDM2-ALT1 expression will prove to be a valuable tool to investigate the p53- independent aspects of MDM2-ALT1 function. Generation of MDM2-ALT1 positive or negative cohorts in the background of homozygous deletion of p53 will enable a detailed examination of the p53-independent functions of MDM2-ALT1. In this case we expect that MDM2-ALT1 positive mice will display acceleration of tumorigenesis, decreased life expectancy (< 4.5 months) and possibly differences in tumor burden or spectrum compared to MDM2-ALT1 negative controls (p53 null mice) [455].

In summary, we present evidence here that supports a role for alternative splice variants MDM2-ALT1 and MDMX-ALT2 as modifiers of the p53 pathway. Importantly, we demonstrate that they influence the transcriptional activity of p53 in unique ways by

139 activating the expression of a subtly distinct subset of p53 target genes implying that they help mediate another layer of regulation in the cells’ response to genotoxic stress.

Additionally, we assess in vivo the physiological implications of MDM2-ALT1 expression in a B cell lymphoma model and demonstrate a dual function for the splice variant as a suppressor and a promoter of oncogenesis.

140

Figure 4.1: MDM2-ALT1 and MDMX-ALT2 interact with full-length MDM2 and MDMX. A. Full-length MDM2 is encoded by exons 3 to 12 of the MDM2 gene and consists of the N- terminal p53-binding domain, the nuclear localization (NLS) and export signals (NES), the central ARF binding and Zinc finger domains and the C-terminal RING domain. MDM2-ALT1 comprises only exons 3 and 12 spliced together and the protein lacks the p53-binding domain. However, it retains the RING domain. B. Full-length MDMX, a close family member of MDM2, also comprises an N-terminal p53-binding domain, a central Zinc finger domain and a C-terminal RING domain and is encoded by exons 2 to 11 of the MDMX gene. MDMX- ALT2 consists of exons 2,3,10 and 11 and the protein is architecturally similar to MDM2-ALT1 in that it lacks the p53-binding domain but retains the RING domain. C. Myc-tagged constructs of LacZ, MDM2-ALT1 or MDMX-ALT2 were transfected into MCF7 cells. Immunoprecipitation of the myc-tagged proteins revealed the specific binding of full-length MDM2 to MDM2-ALT1 and MDMX-ALT2 and not to negative control protein myc-LacZ (compare lanes 2 and 3 to lane 1). Experiments were repeated a minimum of three times and consistent results were observed. Representative gel images are presented in the figure. D. Myc-tagged MDM2-ALT1 and MDMX-ALT2 co-immunoprecipitate with full-length MDMX while the negative control protein myc-LacZ does not interact with MDMX (compare lanes 2 and 3 to lane 1). These results were observed in two independent trials and representative images are shown.

141

Figure 4.2: Full-length MDM2 co-immunoprecipitates with myc-MDM2-ALT1 and myc- MDMX-ALT2. Reciprocal immunoprecipitation of full-length MDM2 using anti-MDM2 SMP14 antibody shows the specific interaction of MDM2 with myc-tagged MDM2-ALT1 and MDMX-ALT2 (immuno blot for anti-myc tag, upper panel). Representative blot from 3 independent experiments is depicted. The immunoprecipitation of MDM2 from cells transfected with myc-LacZ, MDM2- ALT1 and MDMX-ALT2 was confirmed by probing for full-length MDM2 using the anti MDM2 2A10 antibody (middle panel). Remnant signal from the c-Myc antibody caused the appearance of Myc-LacZ at higher exposures. GAPDH was used as loading control for the IP input samples (lowest panel).

142

Figure 4.3: MDM2-ALT1 and MDMX-ALT2 expression causes upregulation of p53 and its downstream target p21. A. The over-expression (O/E cell lysates) of the myc-tagged LacZ, MDM2-ALT1 or MDMX-ALT2 was confirmed using anti-myc tag antibody in the MCF7 cells that were transfected with the corresponding expression constructs (top panel). The level of p53 protein was examined in these samples using the anti-p53 antibody and an upregulation of p53 protein was observed upon MDM2-ALT1 or MDMX-ALT2 over-expression compared to LacZ expressing cells although the increase is more modest in MDMX-ALT2 over-expression (lanes 2 and 3 compared to lane 1). The positive control, UVC (50 J/m2) irradiated MCF7 cells show a strong upregulation of p53 protein levels in response to the stress when compared to untreated cells (lanes 4 and 5). β-actin was used as loading control. A minimum of three independent experiments was performed and representative gel images are shown. B. p21 expression at the mRNA level was examined using quantitative real-time PCR and GAPDH levels were used as the endogenous control. The ratio of p21 to GAPDH is represented graphically and the error bars represent standard deviations from at least 3 independent experiments. MCF7 cells over-expressing MDM2-ALT1 (2Alt1) show statistically significant increase in p21 transcript levels compared to LacZ expressing cells (p<0.01). The cells expressing MDMX-ALT2 (XAlt2) did not show statistically significant changes in p21 expression at the mRNA level. C. The levels of p21 protein in the MCF7 cells transfected with myc-tagged LacZ, MDM2-ALT1 or MDMX-ALT2 was examined using anti- p21 antibody. Both MDM2-ALT1 and MDMX-ALT2 over-expression lead to upregulation of p21 protein levels compared to LacZ over-expression (compare lanes 2 and 3 with lane 1). A minimum of three independent experiments was performed and consistent results observed. Representative images are shown here. Additionally, UVC-irradiated MCF7 cells were used as positive control and show an upregulation of p21 compared to untreated cells (lanes 4 and 5).

143

Figure 4.4: MDM2-ALT1 and MDMX-ALT2 lead to the activation of subtly different subsets of p53 transcriptional targets. A. MCF7 cells transfected with myc-tagged LacZ, or MDM2-ALT1 (Alt1) or MDMX-ALT2 (XAlt2) were examined for mRNA levels of a panel of 9 p53 transcriptional targets using quantitative real-time PCR and were normalized to LacZ- expressing cells. The bar graphs represent the relative quantification (2-ΔΔCt) values from at least 3 independent experiments and each consisting of 3 technical replicates. The error bars represent standard error means (SEM). B. qRT-PCR was used to compare the relative levels (2-ΔΔCt) of miRNA targets of p53 between cells over-expressing LacZ or MDM2-ALT1 or MDMX-ALT2. Here also a minimum of 3 independent trials was performed with 3 technical replicates each. The error bars represent standard error means (SEM). * represents p<0.05 and ** represents p<0.01 in all cases.

144

Figure 4.5: Expression of p53 target genes upon Nutlin-3 treatment shows similarities to MDM-ALT over-expression. MCF7 cells transfected with LacZ were treated with 10 μM Nutlin-3 or DMSO for 12 hours and then examined for the expression of A. p53 transcriptional target mRNAs and B. miRNA targets of p53 via quantitative real time PCR. The error bars represent SEM from at least 3 independent trials. * indicates statistically significant p <0.05 and ** indicates p < 0.01. C. Representative immuno blot showing confirmation of p53 and p21 upregulation upon Nutlin-3 treatment compared to DMSO treated MCF7 cells. GAPDH was used as loading control.

145

Figure 4.6: Hypothesis for the role of MDM2-ALT1 in tumorigenesis. Based on the proposed model of Myc-induced tumorigenesis. Eischen, C. M., J. D. Weber, M. F. Roussel, C. J. Sherr and J. L. Cleveland (1999). "Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis." Genes Dev 13(20): 2658-69.

146

Figure 4.7: Mice expressing MDM2-ALT1 in B-cells exhibit increased incidence of lymphomas compared to controls. A. Transgenic construct pCall2-MDM2 ALT1 that constitutively expresses a β-geo cassette but not MDM2-ALT1 in the absence of Cre. Cre recombinase expression results in excision of the β-geo cassette and subsequent generation of MDM2-ALT1 transcripts. ES cells were electroporated with this construct and 2 clones selected for single site insertions were used to generate transgenic mice (2 lines) by blastocyst injection using standard transgenesis protocols (data not shown). Location of the primers for genotyping (primers 2 and 3) and confirming recombination (primers 1 and 3) are indicated. B. Mice positive for the pCall2-MDM2 ALT1 transgene (F3 generation) were bred with mice homozygous for the CD19-Cre allele (Cre expression under the control of the CD19 promoter in B cells). Tumor cohorts were generated comprising litter mate or age-matched controls (Ctrl- transgene negative) and experimental mice (Expt-transgene positive). C. Expression of MDM2-ALT1 in the spleen (B- cells) of mice positive for both the transgene and CD19 Cre alleles (E) but not in control mice negative for the CD19-Cre allele (C). Importantly, skeletal muscle where CD19 promoter is not expressed of the transgene positive mice did not express MDM2-ALT1. D. Pilot study comprising a cohort of 15 ctrl and 18 expt animals. Kaplan Meier curves show no difference in life span between expt and ctrl groups (log rank test p = 0.5772). E. Mice expressing MDM2-ALT1 (Expt: 19 of 34 mice were lymphoma positive; 55.9%) in B cells show significantly higher incidence of lymphomas compared to MDM2-ALT1 negative mice (Ctrl: 11 of 41 mice were lymphoma positive; 26.8%) at 18 months of age (p=0.0174 Fisher’s exact test).

147

Figure 4.8: Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers in spleens compared to controls. Spleens of age- matched Ctrl (2ALT1 -/-; CD19 Cre +/-) and Expt (2ALT1 +/-; CD19 Cre +/-) mice were harvested at 18 months and the splenocytes were stained for A. B cell markers CD19, B220, IgG or IgM or B. T cell markers CD3e or CD5. Compared to 2ALT1 negative Ctrl mice (n=18), the 2ALT1 positive Expt (n=15) mice show statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. * indicates p<0.05 in all cases as determined by Two-tailed students T test (Graphpad Prism ver 6.0).

148

Figure 4.9: Identification of CD19+ CD5+ populations in splenic lymphomas from ctrl and expt animals. Representative flow cytometry analysis of splenocytes for staining of CD19 (B cells) and CD5 (predominantly T cells and a small subset of B cells) markers from ctrl (MDM2- ALT1 negative) and expt (MDM2-ALT1 positive) animals. The CD19+ population was considered as CD5+ above a threshold of 20%. This is evident in mice diagnosed with lymphomas in both the ctrl and expt groups. Also shown here is an example of a lymphoma negative mouse that lacks a distinct CD5+ subset in the CD19+ B cell population.

149

Table 4.1A. Contingency table of malignancies

tumors no tumors p value (Fisher's exact test)

Ctrl 11 30 0.0174↑ Lymphomas Expt 19 15

Ctrl 8 33 Non lymphoid 0.5824↔ Expt 9 25

Table 4.1B. List of non lymphoid malignancies

Non lymphoid neoplasms Ctrl Expt Pulmonary adenoma 2 3 Hemangiosarcoma 1

Fibroblastic osteosarcoma 1

Endophytic papilloma 1

Pituitary adenoma of pars distalis 2 3 Adenoma of harderian gland 1

Liver hemangioma 1 2 Hematoma of the ovaries 1

Squamous cell carcinoma of stomach 1

Histiocytic sarcoma 2 1

Table 4.1 Comparison of lymphoid and non lymphoid malignancies observed in aging transgenic and control mice. Ctrl (n=41) and expt (n=34) mice were aged to 18 months, euthanized and complete necropsy was performed in collaboration with the CPMPSR. A. Contingency table listing the number of mice diagnosed with lymphomas or non-lymphoid tumors. The p values of the Fisher’s exact test performed to compare the tumor incidence between the ctrl and expt groups reveal significantly higher lymphoma occurrence in expt mice. The incidence of non-lymphoid neoplasms shows no difference between ctrl and expt mice. B. Table listing the incidence of non-lymphoid neoplasms in the ctrl and expt mice.

150

Table 4.2 Summary of flow cytometric analyses

Markers Spleen Ax LN Ing LN Mes LN

CD19 P=0.0230 ↓ P=0.8696 ↔ P=0.0703 ↓? P= 0.1045 ↓?

B220 P=0.0339 ↓ P=0.3032 ↔ P=0.0232 ↓ P= 0.0762 ↓?

CD5 P=0.3774 ↔ P=0.1908 ↔ P=0.0381 ↑ P=0.8506 ↔

IgM P=0.0163 ↓ P=0.4616 ↔ P=0.0742 ↓? P=0.1461 ↓?

IgG P=0.0429 ↓ P=0.2785 ↔ P=0.0950 ↓? P=0.0719 ↓?

CD3e P=0.9255 ↔ P=0.7810 ↔ P=0.2770 ↔ P=0.9327 ↔

B220-CD5 P=0.6078 ↔ P=0.3192 ↔ P=0.7545 ↔ P=0.3415 ↔

B220-IgM P=0.0211 ↓ P=0.3837 ↔ P=0.0727 ↓? P=0.0818 ↓?

B220-CD19 P=0.0464 ↓ P=0.6522 ↔ P=0.0413 ↓ P=0.0981 ↓?

CD5-IgM P=0.8185 ↔ P=0.3373 ↔ P=0.7333 ↔ P=0.3882 ↔

CD19-CD5 P=0.6739 ↔ P=0.2522 ↔ P=0.6685 ↔ P=0.9930 ↔

CD19-IgM P=0.0133 ↓ P=0.8346 ↔ P=0.1036 ↓? P=0.1221 ↓?

IgM-IgG P=0.0202 ↓ P=0.2759 ↔ P=0.0849 ↓? P=0.0604 ↓?

CD19-IgG P=0.0240 ↓ P=0.6388 ↔ P=0.1074 ↓? P=0.0457 ↓

Table 4.2: Summary of flow cytometric analyses of B and T cell populations in the spleen, axillary, inguinal and mesenteric lymph nodes of Ctrl and Expt mice. The spleens and the lymph nodes of 18 month old Ctrl (2ALT1 negative; n=18) and Expt (2ALT1 positive; n=15) mice were harvested and cells stained for B cell (CD19, B220, IgM, IgG) and T cell (CD3e and CD5) markers. Shown in the table are the p values obtained by statistical comparison (Unpaired student’s T test: two-tailed) of the B cell or T cell populations in the spleens and lymph nodes of Expt and Ctrl mice. P values < 0.05 (95% CI) were deemed statistically significant (↑ or ↓) and comparisons showing p values <0.15 but >0.05 were considered as showing a trend (↓? or ↑?) in the indicated direction. Comparisons showing p values >0.15 were considered as non significant changes (↔). The arrows depict increase or decrease in B cell or T cell markers in the Expt animals compared to Ctrls. 151

Chapter 5: Role of MDM2-ALT1 in Rhabdomyosarcoma

5.1 Introduction

Pediatric Rhabdomyosarcoma (RMS) constitutes about 3% of childhood cancers predominantly affecting individuals between 0 and 14 years of age. However, it represents the most common type of soft tissue sarcoma in this age group with about

340 cases diagnosed each year. Based on histology, the disease is classified by the

International Classification of Rhabdomyosarcoma into three main subtypes; a) alveolar

RMS with tumor cells or rhabdomyoblasts resembling lung alveoli, b) embryonal RMS with layers or sheets of rhabdomyoblasts in various stages of myogenic differentiation reminiscent of embryonic myogenesis and c) the anaplastic or pleomorphic RMS characterized by large cells with hyperchromatic nuclei exhibiting multipolar mitosis [456,

457].

The alveolar (16%) and embryonal (75%) subtypes represent the most commonly occurring types of RMS. Although less frequent in occurrence, alveolar RMS is generally associated with the least favorable prognosis among the RMS subtypes.

The tumors typically present as solid painless mass at varied locations including the extremities, trunk and paratesticular or vaginal regions [458]. Clinical determinants of prognosis include primary tumor site, resectability, histological subtype, tumor size, metastasis and regional lymph node involvement. The Intergroup Rhabdomyosarcoma

Study Group (IRSG) has designed a system to categorize RMS tumors into various

152

stages or groups based on evaluation of these clinical criteria in an attempt to develop protocols for tailoring therapeutic regimens for disease of different recurrence- risk levels (low, intermediate and high risk RMS) [459-462]. The treatment protocols developed by the IRSG based on systematic examination of RMS cases since their establishment in the 1970s have been instrumental in substantially improving the prognosis and survival rates for patients presenting with various stages of the disease

[456, 459-462]. While tumor histology and other clinical attributes are useful in diagnostics and the design of chemotherapeutic regimens, the heterogeneous nature of

RMS disease causing high levels of variability between the different tumor subtypes continues to impede effective prognosis and treatment especially in the cases presenting with metastatic disease. Hence it becomes necessary to supplement these techniques with molecular tools and biomarkers thereby opening up additional avenues for therapeutic intervention.

5.1.1 Molecular pathways associated with RMS

While most RMS cases are sporadic, a small percentage of these tumors arise in association with familial genetic syndromes such as Li-Fraumeni (autosomal dominant disorder with underlying germline p53 mutations), Beckwith-Wiedemann (hereditary chromosomal aberrations at the 11p15 locus often with IGF2 over-expression and/or loss of CDKN1C) and Neurofibromatosis type 1 (NF1) (developmental syndrome with mutations of the neurofibromin gene) [458, 463-466] and bear the characteristic genetic aberrations. However, the most common genomic perturbations associated with sporadic RMS are the chromosomal translocations t(2;13) and t(1;13) in the case of alveolar RMS and allelic loss of the 11p15.5 locus in the case of embryonal RMS tumors

[456].

153

The translocations characterizing alveolar RMS result in the expression of fusion proteins comprising the DNA binding domains of the Pax3 (t(2;13)) or Pax7 (t(1;13)) transcription factors and the transactivation domains of another transcription factor

Forkhead (FOXO1) [467-469]. The PAX-FOXO1 fusion proteins have been demonstrated with higher transcriptional activity compared to their native counterparts and have been shown to possess tumorigenic properties due to their ability to interfere with wildtype PAX and activate transcription at the promoters of a wide range of targets that promote cellular proliferation and inhibit apoptosis and affect myogenic differentiation [470-483]. Together these translocations occur in about 80% of alveolar

RMS tumors and serve as major diagnostic and prognostic markers for alveolar RMS

[483].

The molecular pathways involved in embryonal RMS and fusion-negative alveolar RMS are less clear. Allelic loss of heterozygosity or loss due to imprinting at the

11p15.5 locus is frequently observed in embryonal RMS although it is not a defining feature of this subtype as the PAX-FOXO1 fusions are to alveolar RMS. This region houses several candidate tumor-suppressive genes including H19 and CDKN1C and complementation studies of this locus have demonstrated growth suppressive properties exerted by its expression [479]. Additionally, MYCN amplification, alterations in signaling pathways such as insulin receptor, nuclear factor kappa-light-chain enhancer of activated B cells (NFKB), RAS, Sonic Hedgehog and integrin-linked kinase have been implicated in the etiology of embryonal and fusion-negative RMS subtypes [479, 484-

490]. Despite these advances in the knowledge of the molecular pathways in RMS, there remains a relative dearth of reliable molecular biomarkers predictive of disease severity and/or prognosis across all the histological subtypes.

154

5.1.2 Animal models of RMS

RMS is still poorly understood and there is the need to develop a reliable animal model to understand the etiology of this disease and to enable therapeutic testing. Over the years, mouse, fly and fish models have been generated that mimic human alveolar

RMS and/or embryonal RMS and pleomorphic RMS. While some of these models tried to recapitulate the chromosomal aberrations that characterize RMS conditions, others tried to identify the crucial signaling pathways whose deregulation can lead to formation of any of the three types of RMS.

>80% of the alveolar RMS tumors are characterized by translocation events that lead to the generation of a potent transcriptional activator PAX/FOXO1 fusion protein.

Studies that mimicked the t(2;13) PAX3/FOXO1 fusion event, have reported a scenario in which the PAX3/FOXO1 fusion protein expression alone did not induce tumorigenesis though it acted as a toxic, dominant negative protein to PAX3 on ubiquitous expression during embryonic development leading to severe developmental defects [472, 491, 492].

Hence the need arose for a tissue specific, conditional expression of the PAX/FOXO1 fusion proteins, to understand their in vivo role in tumorigenesis. A conditional

PAX3/FOXO1 knock in model was developed that faithfully recapitulates the translocation t(2;13) in a Cre Recombinase dependent manner in post-natal terminally differentiating myofibers. Mice from this genetic cohort formed alveolar RMS tumors at a very low penetrance and long latency specifically from cells expressing the Myf6 Cre in skeletal muscle [493]. Furthermore, in a parallel study, Keller et al used the same mouse model to express the PAX3/FOXO1 fusion protein ubiquitously (RajCre) confirming the toxic, embryonic lethal effects of its expression [482]. This study also showed that expression of the PAX3/FOXO1 fusion protein in muscle satellite cell pools did not result

155 in tumor formation. These studies together lent support to the theory that post natal differentiated myoblasts or terminally differentiating myofibers are the cells of origin in alveolar RMS tumors and that these translocations are unlikely to be germline mutations

[482, 493]. Similarly a drosophila model expressing PAX7/FOXO1 t(1;13) in differentiated fly muscle led to “dedifferentiation” and formation of discrete mono-nuclear cells from synctial myofibers, providing more support for the possibility of a differentiated myoblast being the cell of origin for alveolar RMS; a question that had been puzzling researchers for decades [494].

These models also showed that perturbations in critical signalling pathways like p53, Ras are modifiers of the disease that work in cooperation with the fusion proteins generated by the translocations to form alveolar RMS. This cooperativity between these perturbed signaling pathways and the fusion proteins seemed to be essential as these models generated alveolar RMS tumors only in p53 null, ARF null or Ras mutated backgrounds suggesting that the translocation events are not sufficient to induce tumorigenesis. For instance, the expression of Pax3/FOXO1 in differentiating myofibers resulted in RMS tumor formation in only 1 of 228 mice at 383 days. However, concomitant deletion of p53 (Pax3/FOXO1+/+ ; p53F2-10/F2-10) or Arf (Pax3/FOXO1+/+ ;

Ink4a/ArfF2-3/F2-3) drastically increased the penetrance of the phenotype (2 of 5 mice for p53 knock-out and 4 of 14 for Arf knock-out) and decreased the time of tumor onset (75-

91 days for p53 deletion and 56-89 days for Arf deletion) [493]. To date, the model developed by Keller et al. (2004a,b) expressing the PAX3/FOXO1 fusion protein in terminally differentiating myoblasts, remains the only convincing translocation-positive alveolar RMS tumor model despite its low penetrance and slow tumor onset unless supplemented by p53 or ARF knockout. Indeed, it has been shown that these mouse

156 models do exhibit an expression profile analogous to human alveolar RMS to affirm the potential use of this mouse for therapeutic testing [495].

On the other hand, embryonal RMS and pleomorphic RMS tumors show perturbations in various tumor pathways but are translocation negative. Translocation- negative mouse models showing mutations in p53, Ras, ARF null alleles, Fos null alleles, constitutive activation of signaling pathways and oncogenes, all showed formation of spontaneous, relatively quick onset, embryonal or pleomorphic RMS with synergistic effects when two or more of these pathways were inactivated simultaneously

[496-504]. For instance, simultaneous deletion of p53 and c-Fos resulted in the development of embryonal RMS in 93% of the animals at 25 weeks indicating cross-talk between the p53 and Fos pathways in RMS [500]. Cooperativity between the p53 and

Ras pathways was observed in KRasG12V mice when homozygous deletion of p53 or expression of the R172H mutant p53 resulted in the formation of pleiomorphic RMS tumors almost 100% of the genetic cohorts bearing these lesions [497, 498]. These studies enabled an understanding of the cross talk occurring between different oncogenic and tumor-suppressive pathways, which lead to RMS formation. Interestingly, mouse models of muscular dystrophy such as dystrophin and sarcoglycan deficient mice presented with old age related, low penetrance alveolar RMS and embryonal RMS formation respectively [501, 502, 505]. Taken together, these mice can serve as good model systems to study embryonal, pleomorphic and translocation negative alveolar

RMS. However, the need for a genetically engineered animal model that perfectly satisfies all criteria for RMS development is far from over and better model systems remain to be established that will fully recapitulate the disease conditions and enable therapeutic testing.

157

In the absence of available genetically manipulated models, mouse xenograft models using human RMS tumors are frequently used to test therapeutic modalities. To this end, the National Cancer Institute has supported a consortium] referred to as the

Pediatric Preclinical Testing Program, which has established xenografts and cell lines from pediatric cancers, including seven rhabdomyosarcomas [506]. These models have been extensively characterized at the molecular level using Affymetrix gene profiling.

When comparing the rhabdomyosarcoma xenograft models to clinical samples, the models were shown to have similar copy number alterations and expression profiles indicating their promise for a representative response to therapeutics [507].

5.1.3 p53 pathway in RMS

What is clear from the studies modeling RMS in vivo in the background of p53 deletions or mutations is that the p53 pathway is strongly linked to the etiology of RMS disease. Indeed, germ-line p53 mutations are at the core of most cases of the Li-

Fraumeni syndrome, an autosomal dominant heritable disorder that predisposes patients to incidence of RMS amongst a wide spectrum of other tumor types [456, 508] further underscoring a role for p53 mutations in RMS etiology. However, incidence of p53 mutations in sporadic RMS which predominate over the familial RMS, is relatively rare and comprises only about 10% of the cases [230, 404, 509]. Hence it is possible that in these cases the p53 tumor-suppressor pathway is compromised or inactivated via other means. For instance, aside from p53 mutations, amplification or over-expression of

MDM2 is another important aberration that serves to down regulate the p53 pathway in several cancer types including sarcomas. Interestingly, although frequently reported in soft tissue sarcomas (approximately 30%), MDM2 gene amplification is also relatively rare in pediatric RMS (10-17%) suggesting that other mutations or modifications are at

158 play in RMS that potentially lead to uncoupling of the p53 pathway [221, 509, 510].

Similarly, over-expression of MDMX (or MDM4), although prevalent in about 17% of soft tissue sarcomas and associated with poor prognosis in these tumors [244], is not an overtly prominent feature of pediatric RMS.

5.1.4 Alternative splicing of MDM2 and MDMX in RMS

A phenomenon that has consistently been observed in RMS tumors is the alternative splicing of MDM2 and MDMX. For instance, Bartel et al. reported the occurrence of 10 different alternative MDM2 transcripts including common splice variants MDM2-ALT1 and MDM2- ALT2 in 75% (6 of 8) of RMS cell lines and 82% (9 of

11) of RMS patient tumor samples tested [222]. However, the exact significance of these splicing events in RMS prognosis is unknown. A previous study that endeavored to do so on a generalized STS tumor panel was hampered by the small representation of RMS tumors in the cohort (four RMS samples) and the fact that not all alternative MDM2 transcripts considered in this analysis may represent bonafide splice variants [221].

Nevertheless, the above study and others on ovarian and bladder cancers did reveal an association of advanced-stage tumors with the alternative MDM2 transcripts [220, 221,

226, 229]. In the case of MDMX, previous studies have shown that at least one splice variant MDMX-S is associated with poor prognosis in a panel of 66 STS tumors that included 14 RMS samples [244, 511], although the analysis did not focus on assessing this association in the individual STS tumor subtypes. Nevertheless, these studies indicate the prognostic potential of MDM2 and MDMX alternative splicing.

Previously, we have demonstrated in a panel of 70 pediatric RMS tumors, the strong association of the stress-induced alternative splice forms MDM2-ALT1 and

MDMX-ALT2 [233, 234] with alveolar and embryonal RMS but not the anaplastic

159 subtype [230]. Specifically, we observed that 23 of 27 (85%) alveolar RMS tumors and

16 of 23 (70%) embryonal RMS tumors expressed MDM2-ALT1 while only 2 of 20 anaplastic RMS samples (10%) expressed MDM2-ALT1. In the case of MDMX-ALT2, we observed its constitutive expression in 10 of 23 (43%; 4 samples exhibited no MDMX expression and were excluded) alveolar RMS samples and in 9 of 23 (39%) embryonal

RMS tumors but in none of the anaplastic RMS samples. In addition, there was no statistically significant correlation between the expression of MDM2-ALT1 (85% alveolar

RMS) or MDMX-ALT2 (70% alveolar RMS) expression and the characteristic translocations found in the alveolar subtype (17 of 27 tumors; 63% alveolar RMS), although the number of samples studied was relatively small. Importantly, tumor- matched normal human skeletal muscle tissue corresponding to 5 of these RMS patients, expressed neither MDM2-ALT1 nor MDMX-ALT2 indicative of the tumor specificity of these splicing events. Intriguingly, our analysis revealed coordination in expression of MDM2-ALT1 and MDMX-ALT2 with approximately 24% (16 of 66) of the patient RMS samples analyzed showing the presence of both MDM2-ALT1 and MDMX-

ALT2 transcripts [230].

Statistical analysis comparing the progression of disease in these patients

(analytic population with a non-missing measure for at least one MDM splice variant and available survival data) with the incidence of MDM2-ALT1 showed that these transcripts are strongly associated with high-risk RMS (p = .0288). Further, 91.6% (11 of 12) of the patients who presented with Intergroup Rhabdomyosarcoma Study Group (IRSG) stage

4 (positive for distant metastasis regardless of tumor size, site, invasiveness, and lymph node involvement) metastatic disease were positive for MDM2-ALT1 in their tumors

(statistically significant, p = .0043). Similarly, the presence of MDMX-ALT2 in the tumors

160 was associated significantly (p = .0274) with invasive T2 stage (tumor extension and/or fixation to surrounding tissue) RMS disease; 90.9% (10 of 11 tumors) of MDMX-ALT2– positive tumors were of T2 stage. Overall, we observed that 25 of 40 (62.5%) tumors that showed alternative splicing of either MDM2 or MDMX or both were of the invasive

RMS T2 type. Notably, we found that the association of MDM2-ALT1 with metastatic disease was not restricted to specific RMS subtypes. Of the 11 (11 of 12; i.e., 91.6%)

IRSG stage 4 metastatic tumors analyzed that expressed MDM2-ALT1, 6 were alveolar

(54.5%) and 5 were of the embryonal (45.5%) subtype, indicating that MDM2-ALT1 is an important biomarker of metastatic disease for both ARMS and ERMS subtypes. Taken together, these results highlight that the alternative splice variants MDM2-ALT1 and

MDMX-ALT2 can potentially predict RMS disease severity, thereby serving as useful prognostic markers for the most common RMS subtypes, alveolar RMS and embryonal

RMS [230].

Considering that MDM2-ALT1 and MDMX-ALT2 correlate significantly with high- risk metastatic RMS, it is possible that these splice forms play an important role in RMS etiology. Indeed, previous studies have demonstrated an oncogenic role for MDM2-ALT1 in both in vitro and in vivo experiments [220, 235, 236]. In this study, we demonstrate that over-expression of MDM2-ALT1 and MDMX-ALT2 confers anchorage independent growth properties to untransformed C2C12 cells in vitro suggesting an oncogenic role for these splice forms in RMS. Additionally, we show that MDM2-ALT1 and MDMX-ALT2 confer metastatic properties to Rh30 RMS cells in accordance with their correlation with metastatic RMS disease. We also describe here, a scheme to test the oncogenic properties of MDM2-ALT1 in vivo through its expression in the skeletal muscle of an alveolar RMS sensitized model [493] in the context of decreased or null p53 expression.

161

5.2 Materials and Methods

Cell Culture, Growth, and Transfection Conditions: Alveolar RMS cell line Rh30 was maintained in RPMI 1640 media and the mouse myoblast C2C12 cells in DMEM media supplemented with 10% FBS (Hyclone, Logan,UT), L-glutamine (Cellgro, 25-005 CI), and penicillin/streptomycin (Cellgro, 30-001 CI). For transient transfection of Rh30 and

C2C12 cells, Amaxa Cell Line Nucleofector V Kit was used according to the manufacturer’s instructions with Nucleofector Program B-032. Cells were allowed to recover for 24 hours before further experiments were performed. The cells were then detached from the plates using Accutase (Innovative Cell Technologies, San Diego, CA;

AT-104). Single cell suspensions were made, and cells were counted for use in the matrigel invasion assay and the focus-forming assay or for protein lysates for Western blot analysis of protein expression.

Plasmids and Protein Expression Constructs: LacZ, MDM2-ALT1, and MDMX-ALT2 cDNA were cloned into the BglII-XhoI sites of the Cre-inducible pCALL2 vector [512] whose β-galactosidase and neomycin resistance cassettes were previously excised by

Cre recombinase to facilitate constitutive expression of the corresponding downstream cDNA. These constructs were used for transient overexpression of these proteins in

Rh30 and C2C12 cells.

Matrigel Invasion Assay: Rh30 cells were electroporated with LacZ, MDM2-ALT1, or

MDMX-ALT2 expression plasmids. Fifty thousand cells resuspended in RPMI 1640 with

2% FBS were seeded into BD BioCoat Matrigel Invasion Chambers (354480) with 8-μm pores according to the manufacturer’s instructions and incubated in wells containing

RPMI 1640 with 15% FBS for 20 hours. The inserts were then removed from the invasion chambers, and cells from the inner surface of the membrane were scraped off.

162

Cells that were able to migrate through the membrane pores to the outer surface were then fixed, stained in toluidine blue, and mounted on slides. The slides were then imaged using the Olympus BX51 microscope (×10 magnification) equipped with a

CX9000 camera. The cells that were present on the outer surface of the membrane

(invading cells) were counted using the Stereo Investigator (9.10.5) and Neurolucida

(4.60.1) software (MBF Biosciences, Williston, VT). Data were analyzed as the number of invading cells for each group (LacZ, MDM2-ALT1, and MDMX-ALT2 expression) from three independent experiments. Statistical analysis (unpaired Student’s t test, 95%CI) was performed using the GraphPad Prism software version 6.0a.

96-Well Soft Agar Assays: The protocol for assessing the growth and foci-forming ability of transiently transfected cells in soft agar was adapted from Ke et al. [513]. Rh30 or

C2C12 cells were electroporated with LacZ, MDM2-ALT1, or MDMX-ALT2 expression plasmids; 4000 cells/well for Rh30 and 1000 cells/well for C2C12 cells were mixed with

0.35% LMP agarose (Invitrogen; Catalog No. 15517-022) in DMEM or RPMI 1640 with

10% FBS and plated onto 0.7% base agar (LMP agarose in DMEM or RPMI 1640 with

10% FBS) in individual wells of a 96-well plate (Corning Costar 3595). The agar was allowed to solidify, and a feeder layer of media was added on top of the solid cell layer.

Resazurin dye (final concentration of 44 mM) was added to the individual wells on day 0

(8-12 hours post seeding in soft agar), day 2, day 4, or day 7 of growth and incubated at

37°C for 4 hours after which fluorescence measurements (530-nm excitation and 590- nm emission) of resazurin reduction by cells was measured using a plate reader

(Molecular Devices spectramax M2A). All fluorescence readings were corrected for background using a “blank” well containing only the soft agar layers without the cells.

Two-way ANOVA with Holm-Sidak multiple comparisons test was performed between

163 the LacZ, MDM2-ALT1, and MDMX-ALT2 expression groups across the different time points using GraphPad Prism version 6.0a. All significance values were determined at

95% CI.

Generation of MDM2-ALT1-Pax3/FOXO1-p53F2-10-Myf6 Cre cohorts: Mice homozygous for the conditional Pax3 and FOXO1 alleles were obtained from the National Cancer

Institute mouse consortium (Strain: B6;129-Pax3tm1Mrc Strain Code: 01XBM MMHCC).

Mice homozygous for the Myf6 IRES Cre allele were also acquired from the National

Cancer Institute mouse consortium (Strain code: 01XBL - B6;129-Myf6tm2(Cre)Mrc

MMHCC). P53 F2-10/F2-10 mice were purchased from Jackson Laboratories (Strain Name:

B6.129P2-Trp53tm1Brn/J, Stock Number: 008462). The general breeding scheme to obtain the tumor cohorts is outlined in Fig 5.2A. Mice were genotyped and recombination confirmed using protocols established in Keller et al., 2004 for the Pax3-FOXO1 and

Myf6-Cre alleles [493]. MDM2-ALT1 transgenic mice utilized were of the 2C12 line

(Chapter 4 results) and in the 7th generation of backcrossing to the C57Bl6 background

(F7). Jackson lab protocols were followed for the genotyping of p53 F2-10 alleles. For detection of the MDM2-ALT1 transgene, the following primers were used: MDM2 X3-X12 junS For- 5’ GAGACCCTGGACTATTGG 3’ and Poly AR Rev- 5’

CCCCATAATTTTTGGCAGAG 3’. To confirm recombination of the transgene the following primers were used For- pCall2 del chk2 5’ GCAACGTGCTGGTTATTGTG 3’ and Poly AR Rev. Tumor bearing mice were sacrificed when the tumor volume reached

2 cm x 2 cm and their tissues harvested for formalin fixation and also frozen for protein,

RNA or DNA isolation. Kaplan Meier analysis was performed using the GraphPad Prism software version 6.0a.

164

5.3 Results

5.3.1 MDM2-ALT1 and MDMX-ALT2 enhance anchorage-independent growth of untransformed myoblasts C2C12 and Rh30 RMS cells

As MDM2-ALT1 and MDMX-ALT2 are strongly associated with alveolar and embryonal tumors and also correlate with high-risk disease in these categories, we wanted to test the possibility that these splice variants can contribute to oncogenic transformation.

Anchorage independent growth or the ability of cells to form foci when resuspended in solid media such as soft agar is an indicator of transformed growth. Therefore, we assessed the anchorage-independent growth of untransformed C2C12 myoblast cells that transiently expressed LacZ, MDM2-ALT1, or MDMX-ALT2 for 0, 2, 4, or 7 days by measuring the reduction of resazurin dye by the cells (a measure of the metabolic activity of live and proliferating cells). Indeed, we observed that the C2C12 myoblasts expressing MDM2-ALT1 and MDMX-ALT2 showed significantly more growth (P < .05) at day 7 in soft agar compared to the LacZ-expressing cells (Figure 5.1 A). Similarly, Rh30

RMS cells assayed for the effects of MDM2-ALT1 and MDMX-ALT2 on their anchorage- independent growth showed statistically significant (P < .05) increase in growth in solid soft agar media between days 0 and 7, whereas the Rh30 cells expressing LacZ showed no significant changes in growth under the same conditions (Figure 5.1B).

Overexpression of the proteins from the transfected constructs was verified in immunoblot analysis experiments (Figure 5.1C). Single bands were detected for overexpressed LacZ (myc-tag antibody) at 120 kDa and for MDMX-ALT2 (MDMX antibody) at approximately 40 kDa. Overexpressed MDM2-ALT1 was detected as a specific doublet by the MDM2 N20 antibody at about 40 kDa, possibly due to the usage of an alternate translation initiation codon downstream of the canonical start site in the

165

MDM2-ALT1 cDNA clone or posttranslational modifications of the overexpressedprotein.

The transfected cells were also used for the migration studies (below).

5.3.2 MDM2-ALT1 and MDMX-ALT2 expression leads to increased invasive behavior of RMS cells

Due to the strong association of MDM2-ALT1 and MDMX-ALT2 with metastatic RMS, we wanted to test the possibility that expression of these splice forms could affect the invasive behavior of RMS cell lines reflective of the metastatic potential of these cells. To this end, we transiently transfected Rh30 cells (which do not constitutively express

MDM2-ALT1 or MDMX-ALT2) with plasmid constructs expressing myc-tagged MDM2-

ALT1, MDMX-ALT2, or LacZ (negative control) and assessed their invasion through a matrigel-coated membrane in response to chemotactic gradient (2% FBS to 15% FBS media). Our results showed that MDM2-ALT1 and MDMX-ALT2 expression results in increased invasiveness of Rh30 cells through thematrigel membrane (Figure 5.1D).

Quantification of the number of invaded cells followed by statistical analysis revealed the increase in invasion by MDM2-ALT1–expressing Rh30 cells to be statistically significant

(p < .05) compared to the LacZ-expressing Rh30 cells (Figure 5.1E).

5.3.3 Role of MDM2-ALT1 in the PAX3-FOXO1 alveolar rhabdomyosarcoma model: cohort generation using the conditional MDM2-ALT1 transgenic mouse

We have shown that MDM2-ALT1 is constitutively expressed in 85% alveolar RMS tumors and is strongly associated with stage 4 metatstatic RMS. Over-expression of

MDM2-ALT1 in vitro confers tumorigenic properties to untransformed C2C12 myoblasts and increases the metastatic potential of Rh30 RMS cells. These results suggest that

MDM2-ALT1 contributes to RMS tumorigenesis and plays a role in metastasis and

166 hence it is important to examine in vivo the function of MDM2-ALT1 in RMS oncogenesis.

We have generated a mouse model of Cre-dependent MDM2-ALT1 expression and have demonstrated in a lymphoma model that conditional MDM2-ALT1 expression in B-cells leads to increased lymphomagenesis compared to age-matched controls (18 months; chapter 4 Fig 4.7). This demonstrates the utility of our mouse model to examine the role of MDM2-ALT1 in tumorigenesis in a tissue-specific manner. Importantly, our model enables the testing of the interplay of MDM2-ALT1 with the other tumor- suppressor and oncogenic pathways that have been implicated in RMS. For example, using our model of MDM2-ALT1 it is possible to express the splice isoform in the background of the extant genetic models of RMS (RMS sensitized models) which represent other disease-associated oncogenic events including p53 deficiency. This is important because MDM2-ALT1 expression has been shown to have differing tumorigenic attributes in wildtype and tumor-sensitized backgrounds [235, 236]. For instance, expression of MDM2-ALT1 in a background of wildtype p53 leads to increased tumor incidence in the transgenic mice compared to age-matched negative controls

(Chapter 4 results and Steinman et al, 2006) [235] but does not significantly alter lifespan or time of tumor onset. However, expression of an MDM2-ALT1-like isoform in the lymphoma-sensitized Eµ-Myc mice (constitutive over-expression of oncogene c-Myc in B cells) accelerated lymphomagenesis. Similarly, MDM2-ALT1 expression inhibits proliferation in wildtype MEFs but promotes anchorage independent growth in MEFs null for p53, p19/ARF or Rb (retinoblastoma) [235]. Hence it is possible that in the presence of additional genetic events, MDM2-ALT1 could behave differently to contribute to tumor formation.

167

Due to the strong association of MDM2-ALT1 with the aggressive alveolar RMS subtype, we sought to examine its functionality in the context of a mouse model that is sensitized for alveolar RMS. A conditional knock in mouse model has been developed

[493] which upon Cre expression creates a Pax3/FOXO1 fusion allele similar to the t(2;13) translocation event seen in >70% of alveolar rhabdomyosarcomas. This model closely mirrors alveolar rhabdomyosarcoma but requires disruption of p53/ARF pathways before tumorigenesis can occur i.e. these mice formed tumors only in p53 or

ARF null backgrounds. Hence it provides an ideal sensitized background useful to study the uncoupling of the MDM2-p53 regulatory pathways by MDM2-ALT1.

To test the ability of MDM2-ALT1 to lead to tumorigenesis, we utilized the Cre inducible Pax3/FOXO1 translocation alveolar rhabdomyosarcoma model in a conditional p53+/F2-10 (p53F2-10 allele generates a null mutant p53 upon Cre expression [514]) background. Currently, tumor cohorts have been generated to express MDM2-ALT1 and assess its function in 2 different contexts: 1) heterozygous p53 null conditions (P3F+/+;

Tg+/-; Cre+/-; p53+/-) to assess the uncoupling of the p53 pathway via loss of the wildtype p53 allele and 2) biallelic p53 knockout conditions (P3F+/+; Tg+/-; Cre+/-; p53-/-) to examine the p53-independent mechanisms of MDM2-ALT1 mediated tumorigenesis. Appropriate litter mate or age matched controls will be utilized that lack the MDM2-ALT1 transgene.

Fig 5.2A depicts the breeding scheme for the generation of tumor and control cohorts.

When Cre is expressed in the terminally differentiating skeletal muscle cells under the control of the Myf6 promoter, the Pax3/FOXO1 translocation occurs specifically in muscle and tumor but not liver tissue (Fig 5.2B upper panel). Similarly, the β-geo cassette in the transgene is excised and MDM2-ALT1 is expressed and one or both p53 alleles will be knocked out specifically in skeletal muscle. The recombination at the

168

MDM2-ALT1 transgene locus was confirmed by PCR (Fig 5.2B. * is non-specific band that appeared possibly due to mispriming. The primers used for this PCR covered the

LoxP recombination site and a Poly AR region. Hence mispriming could have taken place even in samples for MDM2-ALT1 negative mice.)

Mice homozygous for the Pax3/FOXO1 translocation with only one wildtype p53 allele developed alveolar RMS tumors at about 202 days. However, the penetrance of this phenotype in these mice was low (8.3%) [493]. In the case of Pax3/FOXO1 expression in the context of homozygous p53 deletion, earlier onset of RMS tumors was observed (75-91 days) with a phenotype penetrance of 40% [493]. These results raise the possibility that additional oncogenic events are necessary to drive tumorigenesis in this model in combination with Pax3/FOXO1 expression and p53 depletion. Hence, we hypothesized that the expression of MDM2-ALT1 in combination with the Pax3/FOXO1 fusion protein will contribute to selective pressure for the uncoupling of the p53 pathway through mutations and hence to rhabdomyosarcomagenesis in mice heterozygous for p53 deletion. Under these conditions, we expect increased tumorigenesis and possibly earlier tumor onset (<202 days) compared to litter mate controls that do not express

MDM2-ALT1. In the absence of functional p53 (homozygous p53 deletion), we expect that Pax3/FOXO1 mice expressing MDM2-ALT1 will exhibit accelerated tumor formation

(<75 days) and higher incidence compared to equivalent MDM2-ALT1 negative controls.

To date, we observe no differences in survival between the MDM2-ALT1 positive

(Expt) and MDM2-ALT`1 negative (Ctrl) cohorts under conditions of biallelic or heterozygous p53 deletion (Fig 5.3A and data not shown). In the background of homozygous p53 knockout we observed RMS tumors in 2 of 9 MDM2-ALT1 positive

(Expt; 101 and 211 days) mice and 1 of 9 MDM2-ALT1 negative mice (Ctrl; 114 days)

169

(Fig 5.3B). Additionally, one MDM2-ALT1 negative mouse heterozygous for p53 knockout (Ctrl) developed a tumor at 86 days. A typical RMS tumor from an MDM2-ALT1 positive p53 knockout mouse (Myf6 Cre positive skeletal muscle specific) is depicted in

Fig 5.3C.

We are currently continuing to monitor the tumor and control cohorts for further incidence of RMS tumors. We will also confirm the tumor type with histopathology at the mouse - pathology core at the Ohio State University School of veterinary medicine. In the tumors arising in the cohort with heterozygous p53 deletion, we will test the tumors for the loss of heterozygosity of the wildtype p53 allele by sequencing. Additionally, we will compare p53 protein levels and that of its downstream targets like p21, BAX, PUMA between normal skeletal muscle and the tumors to examine the uncoupling of the p53 tumor suppressor pathway.

5.4 Discussion

Previously, we have demonstrated strong subtype specificity for the occurrence of stress-inducible splice variants MDM2-ALT1 and MDMX-ALT2 with the alveolar and embryonal RMS subtypes but not with anaplastic RMS. Statistical analysis of patient survival and disease outcome in relation to these alternative splice forms showed the highly significant correlation between the presence of MDM2-ALT1 and MDMX-ALT2 transcripts and advanced stage metastatic RMS disease. Additionally, we showed that

91.6% patients with advanced, metastatic IRSG stage 4 disease expressed MDM2-ALT1 and these comprised almost equal numbers of alveolar (54.5%) and embryonal (45.5%) tumor subtypes. This is an important observation as it points toward MDM2-ALT1 as a novel predictor of metastatic disease transcending the two main RMS subtypes [230].

Additionally, it raises the possibility that MDM2-ALT1 and MDMX-ALT2 contribute to

170

RMS etiology. In the present study, we have examined the transformative potential of

MDM2-ALT1 and MDMX-ALT2 in the RMS context using in vitro cell-culture models.

Additionally, we describe the development of an in vivo mouse model to understand the role of MDM2-ALT1 in an RMS-sensitized background.

5.4.1 MDM2-ALT1 and MDMX-ALT2 as potential transforming factors

Here we have shown that MDM2-ALT1 and MDMX-ALT2 when expressed in Rh30 cells which are heterozygous for the R273C p53 missense mutation (inactive p53) [509, 515], can directly affect their migration through a matrigel membrane (reflective of metastatic behavior) and also their anchorage independent growth in soft agar. Importantly, MDM2-

ALT1 and MDMX-ALT2 cause an increase in the anchorage-independent growth of untransformed C2C12 cells suggesting that they possibly play a role in transformation of cells in the context of RMS. However, the mechanism by which they function in oncogenesis is not yet known.

The inhibition of p53 by full-length MDM2 relies on the p53-binding domain [159,

173], which is excluded in MDM2-ALT1. Therefore, it is unlikely that MDM2-ALT1 can directly affect p53 activity. However, MDM2-ALT1 has been shown to interact with and sequester full-length MDM2 in the cytoplasm [233, 234] thereby potentially stabilizing p53. This could be a possible mechanism by which p53 levels are elevated in tumors expressing MDM2-ALT1 [221, 224, 230]. Moreover, we and others have observed a very low frequency of p53 mutations (14%) in the RMS tumors [221, 230, 404]. Given that p53 is perhaps the most commonly mutated gene in human cancers, and that p53 mutations are absent in a larger percentage of rhabdomyosarcomas, it is an intriguing possibility that altered splicing of MDM2 and MDMX is an important step that leads to oncogenic transformation. However, it is also possible that in a majority of these tumors,

171 the p53 tumor suppressor pathway is disabled via an alternative mechanism or that other oncogenic programs are at play. This may be attributed to either misregulations in the over-active p53 pathway or to additional, potentially p53-independent functions of the alternatively spliced forms of MDM2, MDMX, or both.

Indeed, MDM2 has documented p53-independent roles, which become apparent in the absence of p53 [211, 214, 424, 425, 516]. The exogenous expression of MDM2-

ALT1 has been shown to have oncogenic functions in p53-null MEFs (Mouse Embryonic

Fibroblasts) and NIH3T3 cells. Further, the expression of Mdm2-b (mouse homolog of

MDM2-ALT1) under a GFAP promoter spontaneously induced the formation of myeloid sarcomas and B-cell lymphomas in transgenic mice [235]. It is therefore likely that

MDM2-ALT1 could retain or even affect the p53-independent properties of full-length

MDM2 thereby influencing tumor formation in a p53-independent context as well.

Furthermore, it has been shown that MDM2 gene dosage can affect rate of tumorigenesis and also tumor spectrum in mice with compromised Arf and/or p53 [211,

372, 425]. Therefore, the presence of MDM2 splice variants that are capable of interacting with and sequestering full-length MDM2 can be viewed as a means of altering the MDM2 gene dosage, which can eventually affect tumorigenesis and/or metastasis.

Additionally, the presence of MDMX alternative transcripts could influence tumorigenesis by affecting MDMX gene dosage in a scenario similar to MDM2. For instance, MDMX-S, a splice variant of MDMX that lacks exon 6 is associated with poor prognosis especially in some types of sarcomas. This is mainly due to the fact that high

MDMX-S levels result in low levels of full-length MDMX and consequently this selective pressure leads to MDM2 over-expression and/or p53 mutations [244, 511]. It is therefore possible that MDMX-ALT2, which is architecturally similar to MDM2-ALT1, could have

172 functions that manipulate the p53 pathway leading to cancer. Furthermore, distinct functions have been described for MDM2 and MDMX in the control of p53 activity [204], although the collaboration of MDM2 and MDMX is important for the regulation of p53

[200, 203], Therefore, we speculate that the coordinated splicing of MDMX-ALT2 with

MDM2-ALT1 observed in a subset of RMS tumors [230] could also affect tumorigenesis in ways unique to each.

5.4.2 MDM2-ALT1 expression in an RMS-sensitized in vivo model

Several genetic models exist that recapitulate the RMS tumor phenotypes due to perturbed tumor-suppressor or mitogenic signaling pathways [496-505]. The

PAX/FOXO1 translocation is a genomic aberration that is associated with 80% alveolar

RMS tumors [483]. However, its role as the driving mutation behind RMS tumorigenesis remains unclear. This is because in vitro analyses have demonstrated the tumorigenic properties of the PAX/FOXO1 fusion proteins that act in a dominant negative fashion to the native PAX proteins and possess over 100 fold greater transcriptional activity compared to their wildtype counterparts [470-475, 477]. However, these tumor phenotypes are not recapitulated in in vivo germ-line models of PAX/FOXO1 expression

[491, 492, 517]. A conditional knock-in model of the Pax3/FOXO1 translocation was generated by Keller et al (2004) in which expression of the Pax3/FOXO1 fusion protein in differentiating myofibers (Myf6 Cre) resulted in alveolar RMS tumors albeit at low frequency and long latency. Deletion of p53 or Arf in this model increased tumor incidence and induced earlier onset [493]. These results clearly indicate the requirement of additional genetic events for RMS initiation and progression. Due to the strong association of MDM2-ALT1 with alveolar RMS [230] and its established tumorigenic properties in both wildtype and p53 null backgrounds [220, 235, 236], we reasoned that

173

MDM2-ALT1 expression in this Pax3/FOXO1 RMS model would alter the pattern of tumor formation. Additionally, this model system enables us to assess both the p53- dependent and independent oncogenic functions of MDM2-ALT1 in the RMS context.

Surprisingly, were unable to detect any differences in the life expectancy or tumor incidence between the MDM2-ALT1 positive (Expt) and MDM2-ALT1 negative

(Ctrl) cohorts expressing Pax3/FOXO1 with deletion of both alleles of p53 (Fig 5.3).

Moreover, the penetrance of the phenotype i.e RMS tumor incidence in the Ctrl cohort was lower than has been reported by Keller et al, 2004 (11% in our cohort compared to the published 40%) [493]. It is possible that the expression of Cre under the control of the Myf6 promoter was inefficient in the terminally differentiating myofibers leading to insufficient recombination and expression of the transgenes in the skeletal muscle

(Pax3/FOXO1 or MDM2-ALT1 or p53 F2-10). The use of a more robust Cre expression system specific for skeletal muscle such as HSA Cre (human α-skeletal muscle Actin: striated muscle specific) [518] could enhance the efficiency of transgene expression and p53 deletion thereby enabling a more accurate assessment of the RMS phenotype in this model.

Another important reason for the poor penetrance of the RMS phenotype in this model could be that additional oncogenic events such as over-expression of MYCN

[484], constitutive Insulin Growth Factor (IGF) signaling [490], inactivation of Rb

(retinoblastoma) pathway or ARF deletion are required to initiate RMS tumorigenesis in vivo although the expression of Pax3/FOXO1 and/or MDM2-ALT1 were sufficient to confer tumorigenic properties to cell culture models in vitro (Fig 5.1) .

Importantly, the RMS tumors arising from the Pax3/FOXO1 mouse model have been shown to bear immunohistochemical similarity to human RMS tumors including

174 deregulated expression of the markers of myogenesis (MyoD, Pax7), proliferation

(Cyclin D1 and c-Myc) and upregulation of Pax3/FOXO1 targets (c-Met, Bcl-XL) [493].

Hence complete characterization of our MDM2-ALT1-Pax3/FOXO1 RMS model that encompasses the major hallmark features of this tumor type, will facilitate comprehensive understanding of alveolar RMS tumor biology and will additionally serve as an excellent tool to test potential therapeutics. Moreover, this model provides the flexibility for additional genetic manipulation to examine in depth the etiology of RMS tumorigenesis.

The last few years have seen remarkable progress in field of RMS study with the development of better diagnostic and prognostic tools. The potential of tailored therapeutics is becoming more apparent as the different molecular mechanisms directing the nature and progress of this disease are being uncovered. Model systems to test the efficacy of various therapies are emerging that can be used to specify treatment options for patients with perturbations in specific molecular pathways or genetic aberrations. Despite all this, the fight against RMS is far from over and extensive collaborative efforts are necessary between clinicians and researchers to bring about an end to rhabdomyosarcoma.

175

Figure 5.1: MDM2-ALT1– and MDM4-ALT2–expressing cells show increase in migration and anchorage-independent growth. Rh30 RMS cells and C2C12 myoblasts were transfected with LacZ, MDM2-ALT1, or MDM4-ALT2 expression constructs. The cells were used for soft agar and/or matrigel invasion assays. A. C2C12 cells expressing LacZ, MDM2-ALT1, or MDM4-ALT2 were seeded. Their growth was monitored at days 0, 2, 4, and 7 after seeding. Data from three independent experiments with triplicate wells for each transfection group are represented graphically with SEM error bars. C2C12 cells expressing MDM2-ALT1 (P = .0117) and MDM4- ALT2 (P = .0054) show significantly more anchorage-independent growth in soft agar at day 7 compared to LacZ-expressing cells. Additionally, comparison of growth in soft agar between days 0 and 7 showed significant increases in the MDM2-ALT1 (P = .0025) and MDM4-ALT2 (P = .0296) groups but not in LacZ. B. Rh30 cells expressing LacZ, MDM2-ALT1, or MDM4-ALT2 were similarly assayed for anchorage-independent growth for 7 days in soft agar.MDM2-ALT1 (P= .0109) and MDM4-ALT2 (P = .0389) expression caused significant increase in growth of Rh30 cells at day 7 compared to day 0. LacZ-expressing Rh30 cells however showed no significant changes in growth in soft agar between days 0 and 7. C. Western blots confirming expression of LacZ, MDM2-ALT1, and MDM4-ALT2 in Rh30 and C2C12 cells at 24 hours post nucleofection. D. Rh30 cells expressing MDM2-ALT1 and MDM4-ALT2 show increased migration through matrigel-coated membranes (8-μm pore size) compared to LacZ-expressing Rh30 cells. Representative ×10 magnification images of Rh30 cells post migration are shown here. E. The matrigel invasion experiments were performed in three independent trials, and the number of invasive cells was counted and represented graphically with SEM error bars for each group. Unpaired Student’s t test comparing the mean number of cells in each group with LacZ- expressing cells indicated a statistically significant increase (P = .0417, 95% CI) in invasive behavior of MDM2-ALT1–expressing Rh30 cells.

176

Figure 5.2: Model of alveolar RMS with constitutive MDM2-ALT1 expression. A. Breeding scheme to generate experimental MDM2-ALT1 positive and control MDM2-ALT1 negative alveolar RMS mice with conditional expression of the MDM2-ALT1 transgene and the Pax3/FOXO1 fusion protein in skeletal muscle (Myf6 Cre). p53 conditional knockout alleles (F2- 10) were also incorporated in this model for muscle-specific p53 deletion. B. Representative RT- PCRs showing MDM2-ALT1 recombination and Pax3/FOXO1 recombination in skeletal muscle and tumors of the RMS mice. L-Liver, M-Muscle, T-Tumor. b – water control. * non specific band.

177

Figure 5.3: Model of alveolar RMS with constitutive MDM2-ALT1 expression. A. Survival analysis of the experimental (Expt; n=9) and control (Ctrl; n=9) cohorts shows no difference in life expectancy between the 2 groups. B. Representative experimental mouse (MDM2-ALT1 positive) presenting with tumor mass arising from skeletal muscle. Mice were sacrificed to meet appropriate end-point criteria (tumor reaches 2 cm in diameter) and the tumor and normal tissues were collected. C. Table showing tumor incidence and average onset time in the experimental and control mice.

178

Chapter 6: Summary and Conclusions

Splice variants of MDM2 and MDMX including MDM2-ALT1, MDM2-ALT2 and

MDMX-ALT2 that are incapable of binding p53 are induced in cells in response to genotoxic stress [87, 230, 233, 234, 250, 369]. In accordance with a role in stress- response, these splice isoforms have been shown to stabilize p53 and activate the p53- transcriptional network by inhibiting full-length MDM2 and MDMX (including our results described in chapter 4) [232, 234, 238-240]. However, the fact that several tumor types constitutively present with alternative splice forms of MDM2 and MDMX (incapable of negatively regulating p53) that are often predictive of advanced stage disease, in conjunction with studies demonstrating tumorigenic properties for some of these splice variants (including our results described in chapters 4 and 5) [220-232, 235, 236], has called into question the exact nature of their interaction with the p53 tumor-suppressor network. Furthermore, very little is known about the mechanisms by which MDM splice variants are generated in cancer and under stress.

The work presented here provides unique insight into the functioning of the stress-responsive splice variants, MDM2-ALT1 and MDMX-ALT2 in the p53 pathway and their paradoxical contributions to neoplastic phenotypes. Additionally, this work explores the mechanisms regulating the stress-induced alternative splicing of MDM2 using novel in vitro cell-free splicing and in vivo cell-line based approaches.

179

6.1 Stress-induced splice variants MDM2-ALT1 and MDMX-ALT2 are modifiers of the p53 pathway

The sensitivity of MDM2 and MDMX splicing to DNA damage suggests that their alternative splicing may be a means of titrating or lowering the levels of full-length MDM transcripts and hence the proteins in order to activate p53 in response to cellular stress.

However, because splice isoforms such as MDM2-ALT1 and MDMX-ALT2 retain translatable ORFs and are substrates for polysome loading [230], it is possible that the proteins MDM2-ALT1 and MDMX-ALT2 which lack p53-binding domains, play additional roles in stress response. Indeed, we observed that over-expression of MDM2-ALT1 or

MDMX-ALT2 resulted in the upregulation of p53 protein [239]. Importantly, we showed that this effect is mediated by these proteins via the inhibition of both full-length MDM2 and MDMX through direct dimerization [239]. This indicates that the short splice isoforms

MDM2-ALT1 and MDMX-ALT2 act in a dominant negative fashion to their full-length counterparts to prevent the MDM proteins from interacting with p53 thereby stabilizing p53.

Moreover, we observed that the p53 accumulating under conditions of MDM2-

ALT1 or MDMX-ALT2 over-expression is transcriptionally active and induces G1/S phase cell-cycle arrest in the case of MDM2-ALT1 over-expression in a p53 and p21

(prototypical p53 transcriptional target involved in cell-cycle control) dependent manner

[239]. Curiously enough, upon examination of a panel of additional p53 transcriptional targets by qRT-PCR, we observed that over-expression of MDM2-ALT1 and MDMX-

ALT2 favored the upregulation of distinct subsets of p53 targets. This suggests that the influence of MDM2-ALT1 and MDMX-ALT2 on the p53 transcriptional network extends beyond just p53 upregulation (through inhibition of the p53-MDM interactions) into the

180 realm of selective p53 activation. To test this possibility we additionally examined the expression of the p53 target genes under conditions of p53 stabilization by direct inhibition of p53-MDM2 interaction (Nutlin-3a treatment). Indeed, the p53 targets upregulated upon MDM-ALT over-expression only showed partial overlap with Nutlin-3a

(small molecule inhibitor of MDM2-p53 interaction) treatment [239]. Hence it is likely that the presence of the different MDM splice variants can also modulate p53 activity in diverse ways thereby tailoring the cell’s response to stress stimuli. Taken together, our results implicate stress-responsive splice variants MDM2-ALT1 and MDMX-ALT2 with tumor-repressive functions as modifiers of the p53 pathway.

6.2 MDM2-ALT1 and MDMX-ALT2 in cancer

In direct contrast to their roles as activators of the p53 tumor-suppressor pathway, constitutive expression of MDM2-ALT1 and MDMX-ALT2 has been reported as a hallmark of several cancer types [220-232, 235, 236]. Moreover, MDM2-ALT1 has been attributed with oncogenic properties in several in vitro and in vivo studies [220, 232, 235,

236]. We showed the subtype-specific occurrence of these transcripts in pediatric

Rhabdomyosarcoma (RMS) tumors and their association with >90% of the high-grade, metastatic tumors in the panel indicative of their potential to serve as novel biomarkers for advanced stage pediatric RMS [230]. To test the possibility that MDM2-ALT1 and

MDMX-ALT2 could contribute to tumorigenic phenotypes in the RMS context, we examined the anchorage independence and metastatic potential of C2C12 myoblasts or

Rh30 RMS cells over-expressing MDM2-ALT1 or MDMX-ALT2. Indeed, we observed that C2C12 myoblasts and Rh30 cells expressing the MDM-ALT variants showed significantly higher growth in soft agar compared to a negative control. Furthermore, over-expression of MDM2-ALT1 and MDMX-ALT2 in Rh30 cells enhanced their

181 migration across a membrane in a trans-well assay that is reflective of increased metastatic potential of these cells [230]. These results strongly indicate that constitutive expression of MDM2-ALT1 or MDMX-ALT2 can confer tumorigenic and metastatic properties to cells.

How these stress-induced splice variants transition from tumor-suppressive p53 agonists to tumor-promoting molecules, remains unclear. One possible mechanism is through the MDM-ALT mediated stabilization of mutant, dominant negative, oncogenic forms of p53 in tumors. This has been demonstrated very clearly in the context of colorectal cancers constitutively expressing MDM2-ALT1 [232]. However, the frequency of the co-occurrence of p53 mutations and MDM alternative splicing in most tumor types is very low [404, 511] and we made similar observations in our panel of RMS tumors in that there was no significant correlation between p53 mutations and MDM-ALT expression [230]. In fact, we and others have observed that the tumors expressing

MDM2 or MDMX alternative splice forms present with increased levels wildtype p53

[224, 230]. This indicates that the p53 pathway has been unhinged or inactivated in such tumors although via unknown mechanisms, independent of p53 mutations.

Alternatively, it is possible that MDM2-ALT1 and MDMX-ALT2 retain some of the p53- independent functions of their full-length counterparts or acquire new oncogenic properties to promote tumorigenesis through such mechanisms [211, 215-219, 424, 425,

427, 519]. To test these possibilities and to gain a better understanding of the tumorigenic properties of the MDM splice variants, it is necessary to examine their behavior in vivo in a model of oncogenesis. In this study, we endeavored to explore in depth the role of MDM2-ALT1 in cancer.

182

6.3 MDM2-ALT1 expression increases lymphoma incidence after a long latency

To this end, we generated a transgenic model of conditional MDM2-ALT1 (human) expression and queried the role of MDM2-ALT1 in a B-cell lymphoma model (B-cell specific Cre driver CD19-Cre). We observed that MDM2-ALT1 expression in the mice resulted in significantly higher lymphoma incidence compared to controls (26.8% in controls vs 55.9% in MDM2-ALT1 positive mice) at 18 months of age. These results indicate that long-term exposure to MDM2-ALT1 can indeed promote tumorigenesis albeit after a long latency period. Moreover, our findings corroborate previous studies where the mouse homolog MDM2-B when expressed primarily in the brain under the control of a GFAP (Glial Fibrillary Acidic Protein) promoter, promoted late onset tumorigenesis in the mice at 80-100 weeks of age [235].

6.4 MDM2-ALT1 expression results in lowered B-cell numbers: Latent phase

A p53-dependent tumor-suppressive phase is evident in transgenic mice expressing

MDM2-ALT2 (MDM2-A). Phenotypically, this phase was reflected in vivo in the lethality of homozygous mice and decreased life spans of hemizygous MDM2-A expressing mice and in vitro in growth inhibition of MDM2-A positive mouse embryonic fibroblasts (MEFs)

[238]. In the case of B-cell specific MDM2-ALT1 expression, we could observe this phase in the form of a significant decrease in the percentage of cells expressing the B cell markers in the experimental mice compared to controls with this pattern being the most apparent in spleens. These results support a model in which the tumor-latent or tumor-repressive phase of MDM2-ALT1 expression during which the B cells expressing

183 the splice variant decrease in number potentially due to the activation of apoptotic or cell-cycle arrest pathways.

Combining these results we propose a model in which MDM2-ALT1 expression in the B cells of mice initially leads to decrease in B cell numbers as evidenced from the flow cytometry data. This is possibly due to the MDM2-ALT1 mediated activation of the p53 tumor-suppressor pathway resulting in increased B-cell death or decreased B-cell proliferation. However, prolonged MDM2-ALT1 expression in the B-cells leads to the formation of malignancies potentially originating from cells that lack or express lowered levels of mature B-cell markers like B220 or CD19. Taken together, our results demonstrate a scenario where the duration of its expression determines MDM2-ALT1 function. Similar mechanisms have been described for c-Myc induced tumorigenesis where the dosage and duration of the oncogene expression determined the balance between tumor suppression and tumor formation [183].

6.5 MDM2-ALT1 in p53-independent context

What remains to be tested is the role of MDM2-ALT1 in the absence of functional p53.

MDM2-ALT2 expression in vivo has been shown to be aggressively transformative when p53 is compromised or deleted [237]. Additionally, an MDM2-ALT1 like construct accelerated lymphomagenesis in Eµ-Myc mice (model of constitutive c-Myc expression under control of IgH enhancer) and led to loss of the wildtype allele in the tumors in a p53 heterozygous background [236]. The conditional mouse model of MDM2-ALT1 that we have generated will enable us to examine the effects of MDM2-ALT1 expression in individual tissues or cell types in the context of homozygous or heterozygous p53 deletion. Indeed, these experiments will enable the assessment of MDM2-ALT1 function when p53 dosage is titrated. For instance, under conditions of heterozygous p53

184 deletion, the resulting tumors from MDM2-ALT1 positive mice and negative controls can be assessed for frequency of loss of heterozygosity (LOH) or loss of the remaining wildtype p53 allele. This would indicate whether or not MDM2-ALT1 expression fosters selection for inactivation of p53 in tumors. Under conditions of homozygous p53 deletion, it stands to reason that MDM2-ALT1 expression would bypass the p53-dependent tumor-latent phase and promote tumor formation at earlier stages potentially at a higher rate compared to p53 null mice that do not express MDM2-ALT1.

To query this aspect of MDM2-ALT1 mediated oncogenesis, we are generating a cohort of alveolar rhabdomyosarcoma (RMS) sensitized Pax3/FOXO1 mice [493] that specifically express MDM2-ALT1 in skeletal muscle (Myf6 Cre) along with the fusion gene (Pax3/FOXO1) in the context of one or two conditional p53 knockout alleles. The association of MDM2-ALT1 with 85% alveolar RMS tumors combined with its ability to confer tumorigenic properties to non-transformed C2C12 myoblasts and increase the metastatic potential of Rh30 alveolar RMS cells [230], makes the Pax3/FOXO1 model of

RMS [493] a compelling in vivo system to assess the p53-dependent and p53- independent tumorigenic properties of MDM2-ALT1. We expect that MDM2-ALT1 expression will alter tumor burden, time of onset and/or the invasiveness of the resulting

RMS tumors in the Pax3/FOXO1 model. These results would indicate the importance of

MDM2-ALT1 splicing as a neoplastic lesion in RMS etiology and would enable us to test therapies targeting MDM2-ALT1 levels in RMS tumors.

6.6 To splice or not to splice

MDM2-ALT1 transcripts are constitutively expressed in cancer [220-232] and also induced in cells in response to treatment with DNA damaging agents such as UV, cisplatinum and camptothecin [87, 230, 233, 234, 240, 369]. MDM2-ALT1 functions as

185 an activator of the p53 pathway through its inhibition of full-length MDM2 and MDMX, p53’s negative regulators [224, 232, 234, 239, 240]. Paradoxically, in the context of mutant p53, MDM2-ALT1 expression is detrimental in that it stabilizes dominant, oncogenic forms of p53 [232]. On the other hand, prolonged exposure to MDM2-ALT1 even in the presence of wildtype p53 can potentially foster the accumulation of mutations that uncouple the tumor-suppressor network and lead to tumorigenesis, albeit delayed

[235]. Indeed, this scenario might also result from the use of chemotherapeutic drugs such as cisplatinum, which are DNA damaging agents and known to induce the alternative splicing of MDM2. Additionally, MDM2-ALT1 has putative p53-independent oncogenic properties which become apparent in the absence of p53 [235, 236].

The question that remains then is whether or not MDM2 alternative splicing should be targeted to modulate the p53 tumor suppressor network. The fact that MDM2 levels can be titrated and the p53 pathway specifically modified via splicing of MDM2 opens a new avenue in p53-based therapeutics. Moreover, alternative splice variants of

MDM2 can potentially serve as markers of high-grade disease for several cancer types including RMS. Hence, tumors requiring revival of the wildtype p53 especially cases presenting with MDM2 gene amplification [206, 221, 509, 520, 521], would benefit additionally from MDM2 splicing modulation therapies. On the other hand, in tumors presenting with mutant p53 and MDM2 alternative splice variants [232], splicing could be modulated to increase full-length MDM2 levels thereby facilitating the degradation of the oncogenic mutant p53 proteins. Tumors constitutively expressing MDM2 alternative splice variants in the presence of wildtype p53 present yet another scenario where splicing modulation therapies could be applied [224, 230]. In this case, the oncogenic

MDM2 splice variants potentially act in a p53-independent manner and hence gene

186 therapy strategies could be designed to downregulate specific MDM2 isoforms. In short, the most effective therapeutic approaches would involve manipulation of the relative levels of the different MDM2 splice isoforms with the status of the p53 pathway in the tumors being a crucial determinant of the rationale and design of the splicing alteration strategies.

6.7 Mechanisms regulating MDM2 splicing

To develop splicing modulation therapies, it is necessary to gain a comprehensive understanding of the mechanisms governing MDM2 alternative splicing in cancer and under stress. To gain insight into the regulation of MDM2 alternative splicing, we have made use of genotoxic stress as a model system. We have developed a novel damage- inducible in vitro cell-free splicing approach that allows us to examine the splicing patterns of a stress-responsive MDM2 minigene and tease out the cis elements and the trans factors mediating its damage-specific alternative splicing [283].

MDM2 splicing is regulated by trans factors FUBP1, PTBP1 through conserved intronic elements: Previously, our lab has used a stress-responsive MDM2 3-11-12 minigene to demonstrate that conserved intronic splicing regulatory elements (ISREs) in

MDM2 intron 11 are important for the damage-induced alternative splicing of the regulated exon 11 [283]. In this current study we have extended the analyses and show that the ISREs in intron 11 house positive cis elements or intronic splicing enhancer elements (ISEs) whose deletion causes skipping of exon 11 in the mutant minigenes even in the absence of damage. Moreover, we used in vitro UV cross-linking experiments and observed differential binding of trans factors to these ISEs between normal and DNA damage conditions. This indicates that competing interactions between

187 positive and negative splicing regulatory RNA binding proteins (RBPs) on the intron 11

ISEs facilitate the stress-specific alternative splicing of exon 11.

To identify the trans factors that differentially bind the ISEs on intron 11 between normal and damaged conditions, we utilized RNA affinity chromatography followed by mass spectrometry. Indeed, this screen revealed the interaction of novel as well as canonical splicing regulatory factors (refer chapter 2 table 1) to intron 11 of the MDM2 minigene. Utilizing, a candidate approach we endeavored to characterize the roles of the

Far Upstream element Binding Protein 1 (FUBP1) and the Polypyrimidine Tract Binding

Protein 1 (PTBP1) in MDM2 alternative splicing. In vitro immunointerference splicing assays along with cell-line based over-expression and siRNA knock-down experiments revealed a novel, positive, splicing regulatory role for FUBP1 in the context of MDM2.

Specifically, we observed that FUBP1 is needed for the efficient removal of the introns of the MDM2 minigene thereby enhancing splicing of full-length MDM2 transcripts.

Similarly, we found that PTBP1 is also a positive regulator of full-length MDM2 splicing and its inhibition in nuclear extracts affected the splicing of both introns of the MDM2 minigene.

Concordant with these findings, we observed that FUBP1 and PTBP1 also cross- linked with conserved elements in the intron 3/10 upstream of the regulated exon 11.

This raises the possibility that the other introns of MDM2 contain as yet uncharacterized

FUBP1 and PTBP1 binding sites which potentially act in a cooperative manner to promote the definition and splicing of MDM2’s exons. For instance, FUBP1 is well characterized in its role as an ATP-dependent helicase [294] and is known to bind long stretches of the substrate sequence via its 4 KH domains (hnRNPK homology domains that enable binding to single strand nucleic acids) and cause extensive structural

188 remodeling [297]. Hence it is possible that FUBP1 binding to MDM2’s introns can induce changes in RNA secondary structure and enhance splice site recognition across the length of regulated exons which encompasses ~30 Kb of genomic space. Additionally, it is possible that FUBP1 directly interacts with and recruits the spliceosome in its capacity as a positive regulator of pre-mRNA splicing. In the case of PTBP1, inter and intra molecular interactions via its RNA recognition motifs (RRMs) bound at different locations are known to cause restructuring and looping of the target RNA [103, 104]. While this mechanism has been described in the context of PTBP1-mediated splicing repression, it is also possible that it could create splicing-favorable configurations as it binds MDM2 introns thereby enhancing the splicing of MDM2 exons under normal conditions.

Additionally, we had observed that damage-specific cleaved forms of these proteins also bound the ISEs under stress conditions. Interestingly, genotoxic stress- induced CASPASE cleaved isoforms of FUBP1 and PTBP1 have previously been described and have been shown to function antagonistically to their full-length counterparts in splicing regulation or transcriptional control as in the case of FUBP1

[339, 342]. Hence we hypothesized that under normal conditions, the binding of full- length FUBP1 and PTBP1 to the ISEs would favor full-length splicing of MDM2. However under damaged conditions, cleaved forms of these proteins would compete with the full- length forms for binding the ISEs and facilitate exon skipping and the formation of

MDM2-ALT1 transcripts. Surprisingly, we found that at least in the case of FUBP1, the damage-induced cleaved form also positively regulated the splicing of an MDM2 minigene in a manner similar to full-length FUBP1. What remains to be tested is whether or not the stress-specific cleaved forms of PTBP1 function antagonistically to their full- length counterparts in the regulation of MDM2 splicing.

189

Taken together, we have identified a mechanism for the regulation of efficient, full-length splicing of the oncogene MDM2 by positive-acting trans factors FUBP1 and

PTBP1 via conserved cis elements in the introns of MDM2 (chapter 2 results).

Importantly, what still remains to be established is the identity of the negative regulatory trans factors that mediate the stress-induced skipping or alternative splicing of MDM2 exons. Our screen for differentially binding trans factors on the intron 11 of the MDM2 minigene between normal and damaged conditions has revealed multiple damage- specific interactions at these cis elements including U2 Auxiliary Factor 65 KDa

(U2AF65) and its CASPASE cleaved form, DHX9 (ATP dependent RNA Helicase A),

SF3B3 (Splicing Factor 3B subunit 3, a component of U2snRNP), hnRNP D and hnRNP

U. It is possible that these factors act individually or in a coordinated fashion to facilitate the skipping of exon 11 under damaged conditions. Interestingly, a recent study examining the effects of spliceosomal protein knockdown on p53 expression and activity, showed that knockdown of SF3B1 (subunit 1 of SF3b complex) but not other components of the splicing machinery such as U1-70 or USP39, induced the alternative splicing of MDM2 [522]. This raises the possibility that SF3B3 that binds intron 11 ISEs could play an important role in the splicing of MDM2 transcripts. Future studies examining the functioning of these factors using in vivo over-expression and knock-down assays and in vitro immunointerference or immunodepletion approaches will bring to light their involvement in the regulation of splicing of the complex oncogene MDM2.

6.8 Implications in cancer

The finding that FUBP1 and PTBP1 are potent regulators of MDM2 splicing has important implications in cancer.

190

FUBP1: Aside from its quintessential role as the transcriptional regulator of the oncogene c-Myc [295, 345], FUBP1 is at the center of an important post-transcriptional regulatory network where it functions as the regulator of mRNA stability and translation efficiency of crucial cell-cycle, apoptosis and cell motility factors including targets of the p53 tumor-suppressor pathway [301, 350, 351, 523]. Indeed, several cancer types exhibit deregulated FUBP1 expression [285-289, 291, 292, 344, 524] and it has been attributed with a potential role in oncogenesis in at least some of these cancer types although the mechanisms are not entirely clear. Our finding that FUBP1 is a regulator of

MDM2 expression via splicing control defines yet another link between FUBP1 and the p53 tumor-suppressor pathway. While FUBP1 over-expression could enhance full-length

MDM2 levels and contribute to tumorigenesis, its inactivation via mutations as observed in a subset of low-grade gliomas [290, 292, 293, 525, 526], could potentially activate alternative splicing of MDM2 including MDM2-ALT1 whose constitutive expression is associated with oncogenic phenotypes [220, 230, 235-237]. Indeed, alternative splicing of MDM2 has been reported in glioblastomas and astrocytomas [224, 229]. However, clear molecular profiling including transcriptome-wide RNA-seq analyses, of the tumor types exhibiting aberrant FUBP1 expression is required before the relationship between

FUBP1 and MDM2 splicing in cancer can be clearly established.

PTBP1: over-expression has thus far been associated with tumor phenotypes in glioblastoma multiforme, breast and ovarian cancers [312, 330-332]. As a splicing repressor, PTBP1 directs the formation of cancer-associated isoforms of several genes such as FGFR1 and 2 [311, 312], Fas [100] and Pyruvate Kinase M2 (PKM2) [134, 143,

333], thereby affecting crucial neoplastic processes including the metabolic switch to aerobic glycolysis or the Warburg effect in cancer cells via PKM2 [143]. PTBP1

191 influences the p53 pathway via its role in Fas exon 6 splicing [100] and as an enhancer of the stress-induced IRES mediated translation of p53 mRNA, a process that results in increased levels of the ΔN-p53 isoform (N-terminal truncated) and perturbs the transcriptional activity of full-length p53 [334]. With our finding that PTBP1 is a regulator of MDM2 splicing, we have established yet another link between PTBP1 and the p53 tumor-suppressor pathway. Interestingly, a recent study showed that c-Myc is a transcriptional activator of hnRNP proteins including PTBP1, an effect that plays a crucial role in mediating PKM2 splicing and cancer-cell glycolysis [134]. This is important because the c-Myc signaling network is intricately interwoven with the p53 tumor- suppressor pathway with one important link being that c-Myc activates p19-ARF, a negative regulator of MDM2 thereby facilitating p53 stabilization and subsequent apoptosis [527, 528]. Additionally, complex feedback loops featuring p53, MDM2 and c-

Myc exist to balance the relative levels of these proteins and maintain homeostasis under normal physiological conditions [529-531]. That c-Myc can also potentially regulate MDM2 levels via PTBP1-mediated splicing, introduces another layer of complexity to the Myc-MDM2-p53 axis but also factors in an additional avenue for potential therapeutic targeting of these cancer pathways via splicing alterations.

6.9 Stress-induced MDM2 alternative splicing is regulated by cis regulatory elements on exon 11

We showed that ISEs in intron 11 of MDM2 were primarily instrumental in facilitating full- length splicing of MDM2 via trans protein factors FUBP1 and PTBP1. However, the elements on the MDM2 minigene responsible for inducing the splicing ratio switch between full-length and exon 11 skipped transcripts under DNA damage conditions, remained elusive. To resolve this, we constructed chimeric minigenes by swapping the

192 internal exons and/or the introns between the stress-responsive MDM2 3-11-12s

(minimalized minigene) and the non stress-responsive p53 7-8-9 [283] minigenes and assayed their splicing patterns in vitro in nuclear extracts from normal and damage- treated HelaS3 cells. Interestingly, in this screen we identified that exon 11 of the MDM2 minigene was necessary for the stress-specific alternative splicing of MDM2 and also sufficient to induce this behavior in the heterologous p53 minigene. The stress-induced alternative splicing of MDM2 is conserved between mouse and human [233] and hence it is possible that the mechanisms and pathways involved are also conserved. Indeed, we find that the exon 11 sequence is 82% conserved between mouse and human.

ESE (Exonic Splicing Enhancer) analysis for prediction of binding sites of splicing regulatory factors revealed the presence of conserved SRSF1 (formerly known as

SF2/ASF) and SRSF2 (formerly known as SC35) sites (Comiskey and Jacob et al, unpublished data, not shown) on MDM2 exon 11. Characterization of these sites using mutational analyses in conjunction with over-expression of SRSF1 and SRSF2, indicated an interesting Yin and Yang functionality for these SR proteins in MDM2 splicing. While SRSF2 binding positively regulated exon 11 inclusion, SRSF1 acted as a negative factor that mediated exon 11 exclusion upon DNA damage under which conditions, SRSF1 levels increased and also showed increased binding to exon 11 of the MDM2 minigene (Comiskey and Jacob et al, unpublished data, not shown).

Although it remains to be tested, it is possible that the other exons of MDM2 also bear such conserved splicing regulatory sites that are geared toward mediating their stress-specific exclusion through a balance of positive and negative interactions with splicing regulatory trans factors. Additionally, it is possible that interactions between the trans factors bound at exonic and the intronic sites, alter exon definition and recognition

193 by the spliceosomal complex specifically under damage thereby leading to exon- skipping [532]. Irrespective of the mechanism of regulation, the importance of exonic

SREs is made evident from their high level of conservation across species, their evolutionary patterns in relation to the splice sites they regulate [16, 110, 533, 534] and the impact that mutations in such exonic SREs have on disease [128, 368, 535, 536].

Indeed, a recent study predicted that almost 25% of nonsense and missense mutations observed in human disease disrupt exonic splicing regulatory signals [128]. Hence it stands to reason that exonic SREs represent valuable targets for splicing modulation therapies in diseases with aberrant splicing at the heart of their etiology.

6.10 Splicing modulation

The identification of specific cis elements on the MDM2 pre-mRNA that regulate its normal and stress-induced alternative splicing sets the stage for altering MDM2 expression by splicing modulation at these sites.

Antisense Oligo Nucleotides (AONs): complementary to splicing regulatory cis elements can be used to modulate pre-mRNA splicing by sterically hindering or blocking the binding of the splicing regulatory trans factors at those sites. Depending on the site or mutation being targeted (either a splicing enhancer or splicing silencer), exon exclusion or inclusion can be facilitated. Indeed, splice modulation strategies employing AONs with chemistries optimized for nuclease resistance, high target affinity and cellular uptake have been successfully utilized to alter splicing patterns and relieve disease phenotypes in several scenarios [537-539] with the best known examples being neuromuscular disorders such as Spinal Muscular Atrophy (SMA; AONs targeting elements on SMN to mediate exon 7 inclusion) [540, 541] and Duchenne Muscular Dystrophy (DMD; AONs

194 used to induce skipping of duplicated exons or multiple exons to obtain transcripts with an intact reading frame) [542-544].

However, despite rapidly growing evidence supporting the importance of alternative splicing pathways in cancer, the use of AONs for splicing modification therapies in this context has been relatively rare. Manipulation of the alternative splicing of STAT3 exon 23 (targeting ESEs to promote alternative 3’splice site usage) [545], Bcl-

Xs (altered 5’ splice site selection) [546, 547] and FGFR1 alpha-exon (targeting ISS elements flanking the regulated alpha-exon) [548] in various cancer models are examples of note that have served to underscore the potential of AON targeting in cancer splicing. Interestingly, a recent study in Duchenne Muscular Dystrophy (DMD) demonstrated the efficacy of AONs in inhibiting the Transforming Growth Factor-β (TGF-

β) signaling cascades by targeting and promoting the exclusion of exons 2 or 6 of TGF-

βR1 (ALK5) transcripts. The resulting down-regulation or repression of the TGF-βR1 signaling promoted differentiation of C2C12 cells in vitro and the upregulation of Myog in dystrophic muscles of mdx mice [549]. Although proposed as a novel means of targeting

DMD, these results indicate the potential for AON-based splicing alteration therapies in the context of TGF-β signaling pathway in cancer.

Aside from the use of traditional AONs, several modifications of this technique have evolved that aim to improve targeting specificity and efficiency of the AONs. For instance, modified U1 snRNAs (essential component of the spliceosomal complex) that incorporate the specific AON sequence have been shown to be more effective in mediating splicing alterations compared to unmodified AONs [550]. This is possibly due to the fact that U1-snRNAs are naturally processed by the cellular machinery to target and bind pre-mRNA and hence result in better delivery of the AONs [537]. Bifunctional

195

RNAs represent another means of modifying this technology in which U7 snRNAs

(required for histone mRNA processing) are engineered to include the AON sequence but also bear a tail sequence containing an ESE or an ESS to attract a positive or negative trans regulatory factor that could enhance inclusion or skipping of the target exon [551].

Taken together, the characterization of specific splicing regulatory sequences on the MDM2 pre-mRNA paves the way for development of AON based splicing modulation strategies to alter the relative levels of the various MDM2 isoforms in the cell. Indeed, drug cocktail approaches may also be designed where pools of AONs targeting multiple

MDM2 SREs can be assessed for splicing modulation efficacy. Importantly, specific isoforms of MDM2 such as MDM2-ALT1 (3.12) or ALT2 (3.10.11.12) or ALT3

(3.4.10.11.12), can also be induced under these conditions by targeting the skipping of certain exons alone. In this case, AON mediated alternative splicing can prove to be an important tool to understand the biology of these MDM2 isoforms individually considering that expression of the different MDM2 isoforms influences the p53 pathway in subtly different ways [231, 234, 239].

Spliceosome Mediated RNA Trans splicing: is an RNA repair technique that enables splicing correction of the target pre-mRNA by hijacking the indigenous spliceosomal machinery and redirecting the splice site choice from the native exon on the same or cis transcript to that of a special construct supplied in trans (pre-mRNA trans splicing molecules or PTMs). A typical PTM comprises a) binding domain (70-150 nt) that ensures its hybridization to the target pre-mRNA usually masking the native splicing signals within the intron, b) splicing domain that bears the splicing signals for the PTM to ligate to the target pre-mRNA and c) a coding domain that contains the “corrected” or

196 customized mRNA sequence to be ligated to the pertinent exon. Based on optimal PTM design it is possible to trans splice exons at both the 5’ and the 3’ ends and also in between two cis exons [552]. The applicability of this technique has been demonstrated notably in the modulation of the splicing of SMN2 exon 7 (trans splicing RNA designed to hybridize and block the 3’ss and branch point of SMN2 exon 7 while providing SMN1 exon 7 in trans with appropriate splicing signals: intracerebral ventriclular injections of this vector extended survival of a severe SMA mouse model by 70%) [553] and in the treatment of Hemophilia A Factor VIII knock-out mice (generated by insertion of a neomycin cassette into the exon 16 of Factor VIII gene) with trans splicing cassette containing exons 16 through 26 [554]. One important advantage of this technique compared to other AON based methods is that prior knowledge of the SREs on the pre- mRNA is not required.

Small molecule splicing inhibitors: represent another, although more non-specific means of altering splicing patterns of genes. Typical splicing inhibitory compounds can interfere a) directly with the components of the spliceosome and prevent its assembly at the splice sites or b) indirectly inhibit other splicing regulatory factors such as the SR proteins and hnRNPs or their kinases and phosphatases [555, 556]. Cancer cells have been shown to be particularly sensitive to disruptions in the pre-mRNA splicing process possibly due to their high metabolic rates [557]. Large-scale screens have identified several compounds including bacterial fermentation products that are able to alter the activity of the core spliceosomal complex and in many cases display potent anti-tumor properties [555, 556]. Interestingly, some small molecule splicing-inhibitors like cardiotonic steroids (such as digitoxin used to treat heart failure) and TG003

(benzothiazole agent) can induce alternative splicing of specific transcripts due to their

197 effects on SR proteins or their kinases respectively [555]. For instance, TG003 competes for ATP with CLK kinases (CDC-2 like kinases) which are key SR protein kinases while digitoxin can alter splicing by depleting SR proteins SRSF3 and Tra-2β. While AONs and trans splicing techniques affect expression of only specific transcripts, small molecule splicing inhibitors can affect a broad range of transcripts. Additionally, there remains the possibility that such small molecules can affect the functioning of other molecular machinery and thus have more off target effects on cellular processes apart from pre- mRNA splicing.

A recent study demonstrated the sensitivity of p53 to disruptions in the splicing machinery. Systematic knockdown of spliceosome-associated proteins or treatment with

TG003 (inhibitor of SR protein kinases) resulted in the accumulation of p53 and concordant decrease in the stability of MDM2 [522, 555]. When MDM2 splicing was examined under these conditions, only the knockdown SF3B1 (essential component of the U2snRNP complex) resulted in the generation of alternative splice variants of MDM2

[522]. This is an important observation because several known splicesome inhibitor compounds including Spliceostatin A (SSA) function by interacting and interfering with the SF3b complex of U2snRNP [555, 558]. These results in addition to our observation of the damage-specific interaction of SF3B3 to the intron 11 ISEs on MDM2 (results of chapter 2), raise the possibility that small molecule splicing inhibitors such as SSA that target the SF3b complex can be utilized to modulate MDM2 expression at the splicing level.

6.11 Summary

The coordinately altered splicing of MDM2 and MDMX in response to genotoxic stress represents only one part of a network of stress-activated alternative splicing events [83,

198

87, 230]. We have observed similarities between the splicing landscapes of cisplatinum treated cells and RMS tumors [230]. Indeed, in this scenario RMS tumors may be considered as presenting with sustained stress-response signaling. This raises the possibility that RMS tumors and potentially other cancer types presenting with MDM2 and/or MDMX alternative splicing, bear similarities in their splicing networks. This implies an overlap in splicing regulatory mechanisms between the tumors exhibiting such coordinately altered splicing events. Whether they pertain to the signaling pathways that direct the splicing events or to the cis elements and interacting trans splicing regulatory factors, identification of these common regulatory mechanisms paves the way for targeting splicing and amelioration of common oncogenic splicing events.

199

Notes

Chapter 2: Figures 2.1, 2.6, 2.2A, 2.2B, 2.3A, 2.3B and 2.10 A were contributed to by

Ravi K. Singh, PhD. Figures 2.8, 2.13 and part of figure 2.2C were contributed to by

Fuad Mohammad. Both contributors have been credited with authorship in the publication Jacob et al., 2014 [284].

Chapter 4: Figures 4.1 and 4.3 were partly contributed to by Ravi K. Singh, PhD and fig

4.5B was contributed to by Fuad Mohammad. Both contributors have been credited with authorship in the publication Jacob et al, 2014 [239]. Figure 4.7C was generated in collaboration with Jordan T Gladman, PhD and fig 4.7D was generated by Aixa S Tapia-

Santos. These contributors along with collaborators Prosper N Boyaka, PhD and Haley

Steiner (contributed to figures 4.8 and 4.9) will be credited with authorship in any future manuscripts containing these data.

200

References

1. Hanahan D and Weinberg RA (2011). Hallmarks of cancer: the next generation. Cell. 144:646-674. 2. Zhang MQ (1998). Statistical features of human exons and their flanking regions. Hum Mol Genet. 7:919-932. 3. Black DL (2003). Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem. 72:291-336. 4. Will CL and Luhrmann R (2011). Spliceosome structure and function. Cold Spring Harb Perspect Biol. 3. 5. Agafonov DE, Deckert J, Wolf E, Odenwalder P, Bessonov S, Will CL, Urlaub H and Luhrmann R (2011). Semiquantitative proteomic analysis of the human spliceosome via a novel two-dimensional gel electrophoresis method. Mol Cell Biol. 31:2667-2682. 6. Long JC and Caceres JF (2009). The SR protein family of splicing factors: master regulators of gene expression. Biochem J. 417:15-27. 7. Kunkel GR, Maser RL, Calvet JP and Pederson T (1986). U6 small nuclear RNA is transcribed by RNA polymerase III. Proc Natl Acad Sci U S A. 83:8575-8579. 8. Yu AT, Ge J and Yu YT (2011). Pseudouridines in spliceosomal snRNAs. Protein Cell. 2:712-725. 9. Madhani HD and Guthrie C (1994). Dynamic RNA-RNA interactions in the spliceosome. Annu Rev Genet. 28:1-26. 10. Sterner DA, Carlo T and Berget SM (1996). Architectural limits on split genes. Proc Natl Acad Sci U S A. 93:15081-15085. 11. Hawkins JD (1988). A survey on intron and exon lengths. Nucleic Acids Res. 16:9893-9908. 12. De Conti L, Baralle M and Buratti E (2013). Exon and intron definition in pre- mRNA splicing. Wiley Interdiscip Rev RNA. 4:49-60. 13. Fox-Walsh KL, Dou Y, Lam BJ, Hung SP, Baldi PF and Hertel KJ (2005). The architecture of pre-mRNAs affects mechanisms of splice-site pairing. Proc Natl Acad Sci U S A. 102:16176-16181. 14. Robberson BL, Cote GJ and Berget SM (1990). Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol Cell Biol. 10:84-94. 15. Fu XD (2004). Towards a splicing code. Cell. 119:736-738. 16. Wang Z and Burge CB (2008). Splicing regulation: from a parts list of regulatory elements to an integrated splicing code. RNA. 14:802-813. 17. Jacquier A (1990). Self-splicing group II and nuclear pre-mRNA introns: how similar are they? Trends Biochem Sci. 15:351-354. 18. Tseng CK and Cheng SC (2008). Both catalytic steps of nuclear pre-mRNA splicing are reversible. Science. 320:1782-1784.

201

19. Rappsilber J, Ryder U, Lamond AI and Mann M (2002). Large-scale proteomic analysis of the human spliceosome. Genome Res. 12:1231-1245.20. Berget SM, Moore C and Sharp PA (1977). Spliced segments at the 5' terminus of adenovirus 2 late mRNA. Proc Natl Acad Sci U S A. 74:3171-3175. 21. Chow LT, Gelinas RE, Broker TR and Roberts RJ (1977). An amazing sequence arrangement at the 5' ends of adenovirus 2 messenger RNA. Cell. 12:1-8. 22. Rosenfeld MG, Amara SG, Roos BA, Ong ES and Evans RM (1981). Altered expression of the calcitonin gene associated with RNA polymorphism. Nature. 290:63-65. 23. Kalyna M, Simpson CG, Syed NH, Lewandowska D, Marquez Y, Kusenda B, Marshall J, Fuller J, Cardle L, McNicol J, Dinh HQ, Barta A and Brown JW (2012). Alternative splicing and nonsense-mediated decay modulate expression of important regulatory genes in Arabidopsis. Nucleic Acids Res. 40:2454-2469. 24. McGlincy NJ and Smith CW (2008). Alternative splicing resulting in nonsense- mediated mRNA decay: what is the meaning of nonsense? Trends Biochem Sci. 33:385-393. 25. Saltzman AL, Kim YK, Pan Q, Fagnani MM, Maquat LE and Blencowe BJ (2008). Regulation of multiple core spliceosomal proteins by alternative splicing-coupled nonsense-mediated mRNA decay. Mol Cell Biol. 28:4320-4330. 26. Lareau LF, Inada M, Green RE, Wengrod JC and Brenner SE (2007). Unproductive splicing of SR genes associated with highly conserved and ultraconserved DNA elements. Nature. 446:926-929. 27. Ni JZ, Grate L, Donohue JP, Preston C, Nobida N, O'Brien G, Shiue L, Clark TA, Blume JE and Ares M, Jr. (2007). Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense- mediated decay. Genes Dev. 21:708-718. 28. Sterne-Weiler T, Martinez-Nunez RT, Howard JM, Cvitovik I, Katzman S, Tariq MA, Pourmand N and Sanford JR (2013). Frac-seq reveals isoform-specific recruitment to polyribosomes. Genome Res. 23:1615-1623. 29. Nilsen TW and Graveley BR (2010). Expansion of the eukaryotic proteome by alternative splicing. Nature. 463:457-463. 30. Sugnet CW, Kent WJ, Ares M, Jr. and Haussler D (2004). Transcriptome and genome conservation of alternative splicing events in humans and mice. Pac Symp Biocomput.66-77. 31. Roca X, Sachidanandam R and Krainer AR (2005). Determinants of the inherent strength of human 5' splice sites. RNA. 11:683-698. 32. Xing Y and Lee C (2006). Alternative splicing and RNA selection pressure-- evolutionary consequences for eukaryotic genomes. Nat Rev Genet. 7:499-509. 33. Zheng CL, Fu XD and Gribskov M (2005). Characteristics and regulatory elements defining constitutive splicing and different modes of alternative splicing in human and mouse. RNA. 11:1777-1787. 34. Sorek R, Shemesh R, Cohen Y, Basechess O, Ast G and Shamir R (2004). A non-EST-based method for exon-skipping prediction. Genome Res. 14:1617- 1623. 35. Sorek R, Lev-Maor G, Reznik M, Dagan T, Belinky F, Graur D and Ast G (2004). Minimal conditions for exonization of intronic sequences: 5' splice site formation in alu exons. Mol Cell. 14:221-231.

202

36. Fu XD and Ares M, Jr. (2014). Context-dependent control of alternative splicing by RNA-binding proteins. Nat Rev Genet. 37. Graveley BR (2005). Mutually exclusive splicing of the insect Dscam pre-mRNA directed by competing intronic RNA secondary structures. Cell. 123:65-73. 38. Lovci MT, Ghanem D, Marr H, Arnold J, Gee S, Parra M, Liang TY, Stark TJ, Gehman LT, Hoon S, Massirer KB, Pratt GA, Black DL, Gray JW, Conboy JG and Yeo GW (2013). Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges. Nat Struct Mol Biol. 20:1434-1442. 39. Li H, Wang Z, Zhou X, Cheng Y, Xie Z, Manley JL and Feng Y (2013). Far upstream element-binding protein 1 and RNA secondary structure both mediate second-step splicing repression. Proc Natl Acad Sci U S A. 110:E2687-2695. 40. Hiller M, Zhang Z, Backofen R and Stamm S (2007). Pre-mRNA secondary structures influence exon recognition. PLoS Genet. 3:e204. 41. Jablonski JA, Buratti E, Stuani C and Caputi M (2008). The secondary structure of the human immunodeficiency virus type 1 transcript modulates viral splicing and infectivity. J Virol. 82:8038-8050. 42. Fairbrother WG, Yeh RF, Sharp PA and Burge CB (2002). Predictive identification of exonic splicing enhancers in human genes. Science. 297:1007- 1013. 43. Culler SJ, Hoff KG, Voelker RB, Berglund JA and Smolke CD (2010). Functional selection and systematic analysis of intronic splicing elements identify active sequence motifs and associated splicing factors. Nucleic Acids Res. 38:5152- 5165. 44. Zhang XH and Chasin LA (2004). Computational definition of sequence motifs governing constitutive exon splicing. Genes Dev. 18:1241-1250. 45. Wang Z, Rolish ME, Yeo G, Tung V, Mawson M and Burge CB (2004). Systematic identification and analysis of exonic splicing silencers. Cell. 119:831- 845. 46. Coulter LR, Landree MA and Cooper TA (1997). Identification of a new class of exonic splicing enhancers by in vivo selection. Mol Cell Biol. 17:2143-2150. 47. Han J, Ding JH, Byeon CW, Kim JH, Hertel KJ, Jeong S and Fu XD (2011). SR proteins induce alternative exon skipping through their activities on the flanking constitutive exons. Mol Cell Biol. 31:793-802. 48. Gehman LT, Stoilov P, Maguire J, Damianov A, Lin CH, Shiue L, Ares M, Jr., Mody I and Black DL (2011). The splicing regulator Rbfox1 (A2BP1) controls neuronal excitation in the mammalian brain. Nat Genet. 43:706-711. 49. Gehman LT, Meera P, Stoilov P, Shiue L, O'Brien JE, Meisler MH, Ares M, Jr., Otis TS and Black DL (2012). The splicing regulator Rbfox2 is required for both cerebellar development and mature motor function. Genes Dev. 26:445-460. 50. Gallagher TL, Arribere JA, Geurts PA, Exner CR, McDonald KL, Dill KK, Marr HL, Adkar SS, Garnett AT, Amacher SL and Conboy JG (2011). Rbfox-regulated alternative splicing is critical for zebrafish cardiac and skeletal muscle functions. Dev Biol. 359:251-261. 51. Venables JP, Brosseau JP, Gadea G, Klinck R, Prinos P, Beaulieu JF, Lapointe E, Durand M, Thibault P, Tremblay K, Rousset F, Tazi J, Abou Elela S and Chabot B (2013). RBFOX2 is an important regulator of mesenchymal tissue- specific splicing in both normal and cancer tissues. Mol Cell Biol. 33:396-405.

203

52. Venables JP, Lapasset L, Gadea G, Fort P, Klinck R, Irimia M, Vignal E, Thibault P, Prinos P, Chabot B, Abou Elela S, Roux P, Lemaitre JM and Tazi J (2013). MBNL1 and RBFOX2 cooperate to establish a splicing programme involved in pluripotent stem cell differentiation. Nat Commun. 4:2480. 53. Yeo GW, Xu X, Liang TY, Muotri AR, Carson CT, Coufal NG and Gage FH (2007). Alternative splicing events identified in human embryonic stem cells and neural progenitors. PLoS Comput Biol. 3:1951-1967. 54. Kim KK, Kim YC, Adelstein RS and Kawamoto S (2011). Fox-3 and PSF interact to activate neural cell-specific alternative splicing. Nucleic Acids Res. 39:3064- 3078. 55. Yeo GW, Coufal NG, Liang TY, Peng GE, Fu XD and Gage FH (2009). An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol. 16:130-137. 56. Shapiro IM, Cheng AW, Flytzanis NC, Balsamo M, Condeelis JS, Oktay MH, Burge CB and Gertler FB (2011). An EMT-driven alternative splicing program occurs in human breast cancer and modulates cellular phenotype. PLoS Genet. 7:e1002218. 57. O'Brien JE, Drews VL, Jones JM, Dugas JC, Barres BA and Meisler MH (2012). Rbfox proteins regulate alternative splicing of neuronal sodium channel SCN8A. Mol Cell Neurosci. 49:120-126. 58. Zubovic L, Baralle M and Baralle FE (2012). Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands. Nucleic Acids Res. 40:6255-6269. 59. Pistoni M, Shiue L, Cline MS, Bortolanza S, Neguembor MV, Xynos A, Ares M, Jr. and Gabellini D (2013). Rbfox1 downregulation and altered calpain 3 splicing by FRG1 in a mouse model of Facioscapulohumeral muscular dystrophy (FSHD). PLoS Genet. 9:e1003186. 60. Jangi M, Boutz PL, Paul P and Sharp PA (2014). Rbfox2 controls autoregulation in RNA-binding protein networks. Genes Dev. 28:637-651. 61. Kim KK, Adelstein RS and Kawamoto S (2014). Isoform-specific proteasomal degradation of Rbfox3 during chicken embryonic development. Biochem Biophys Res Commun. 450:1662-1667. 62. Alam S, Suzuki H and Tsukahara T (2014). Alternative splicing regulation of APP exon 7 by RBFox proteins. Neurochem Int. 78C:7-17. 63. Zhou HL, Baraniak AP and Lou H (2007). Role for Fox-1/Fox-2 in mediating the neuronal pathway of calcitonin/calcitonin gene-related peptide alternative RNA processing. Mol Cell Biol. 27:830-841. 64. Warzecha CC, Shen S, Xing Y and Carstens RP (2009). The epithelial splicing factors ESRP1 and ESRP2 positively and negatively regulate diverse types of alternative splicing events. RNA Biol. 6:546-562. 65. Warzecha CC, Jiang P, Amirikian K, Dittmar KA, Lu H, Shen S, Guo W, Xing Y and Carstens RP (2010). An ESRP-regulated splicing programme is abrogated during the epithelial-mesenchymal transition. EMBO J. 29:3286-3300. 66. Dredge BK and Darnell RB (2003). Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol Cell Biol. 23:4687-4700.

204

67. Polydorides AD, Okano HJ, Yang YY, Stefani G and Darnell RB (2000). A brain- enriched polypyrimidine tract-binding protein antagonizes the ability of Nova to regulate neuron-specific alternative splicing. Proc Natl Acad Sci U S A. 97:6350- 6355. 68. Jensen KB, Dredge BK, Stefani G, Zhong R, Buckanovich RJ, Okano HJ, Yang YY and Darnell RB (2000). Nova-1 regulates neuron-specific alternative splicing and is essential for neuronal viability. Neuron. 25:359-371. 69. Jelen N, Ule J, Zivin M and Darnell RB (2007). Evolution of Nova-dependent splicing regulation in the brain. PLoS Genet. 3:1838-1847. 70. Cheng AW, Shi J, Wong P, Luo KL, Trepman P, Wang ET, Choi H, Burge CB and Lodish HF (2014). Muscleblind-like 1 (Mbnl1) regulates pre-mRNA alternative splicing during terminal erythropoiesis. Blood. 124:598-610. 71. Kalsotra A, Xiao X, Ward AJ, Castle JC, Johnson JM, Burge CB and Cooper TA (2008). A postnatal switch of CELF and MBNL proteins reprograms alternative splicing in the developing heart. Proc Natl Acad Sci U S A. 105:20333-20338. 72. Kino Y, Washizu C, Oma Y, Onishi H, Nezu Y, Sasagawa N, Nukina N and Ishiura S (2009). MBNL and CELF proteins regulate alternative splicing of the skeletal muscle chloride channel CLCN1. Nucleic Acids Res. 37:6477-6490. 73. Lee KS, Cao Y, Witwicka HE, Tom S, Tapscott SJ and Wang EH (2010). RNA- binding protein Muscleblind-like 3 (MBNL3) disrupts myocyte enhancer factor 2 (Mef2) {beta}-exon splicing. J Biol Chem. 285:33779-33787. 74. Liu HX, Zhang M and Krainer AR (1998). Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev. 12:1998-2012. 75. Liu HX, Chew SL, Cartegni L, Zhang MQ and Krainer AR (2000). Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mol Cell Biol. 20:1063-1071. 76. Kim S, Shi H, Lee DK and Lis JT (2003). Specific SR protein-dependent splicing substrates identified through genomic SELEX. Nucleic Acids Res. 31:1955- 1961. 77. Reid DC, Chang BL, Gunderson SI, Alpert L, Thompson WA and Fairbrother WG (2009). Next-generation SELEX identifies sequence and structural determinants of splicing factor binding in human pre-mRNA sequence. RNA. 15:2385-2397. 78. Zahler AM, Lane WS, Stolk JA and Roth MB (1992). SR proteins: a conserved family of pre-mRNA splicing factors. Genes Dev. 6:837-847. 79. Zhou Z and Fu XD (2013). Regulation of splicing by SR proteins and SR protein- specific kinases. Chromosoma. 122:191-207. 80. Wu JY and Maniatis T (1993). Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell. 75:1061-1070. 81. Zhu J, Mayeda A and Krainer AR (2001). Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound SR proteins. Mol Cell. 8:1351-1361. 82. Cartegni L, Hastings ML, Calarco JA, de Stanchina E and Krainer AR (2006). Determinants of exon 7 splicing in the spinal muscular atrophy genes, SMN1 and SMN2. Am J Hum Genet. 78:63-77. 83. Munoz MJ, Perez Santangelo MS, Paronetto MP, de la Mata M, Pelisch F, Boireau S, Glover-Cutter K, Ben-Dov C, Blaustein M, Lozano JJ, Bird G, Bentley

205

D, Bertrand E and Kornblihtt AR (2009). DNA damage regulates alternative splicing through inhibition of RNA polymerase II elongation. Cell. 137:708-720. 84. de la Mata M, Alonso CR, Kadener S, Fededa JP, Blaustein M, Pelisch F, Cramer P, Bentley D and Kornblihtt AR (2003). A slow RNA polymerase II affects alternative splicing in vivo. Mol Cell. 12:525-532. 85. Nogues G, Kadener S, Cramer P, de la Mata M, Fededa JP, Blaustein M, Srebrow A and Kornblihtt AR (2003). Control of alternative pre-mRNA splicing by RNA Pol II elongation: faster is not always better. IUBMB Life. 55:235-241. 86. Nogues G, Munoz MJ and Kornblihtt AR (2003). Influence of polymerase II processivity on alternative splicing depends on splice site strength. J Biol Chem. 278:52166-52171. 87. Dutertre M, Sanchez G, De Cian MC, Barbier J, Dardenne E, Gratadou L, Dujardin G, Le Jossic-Corcos C, Corcos L and Auboeuf D (2010). Cotranscriptional exon skipping in the genotoxic stress response. Nat Struct Mol Biol. 17:1358-1366. 88. Fong YW and Zhou Q (2001). Stimulatory effect of splicing factors on transcriptional elongation. Nature. 414:929-933. 89. Lin S, Coutinho-Mansfield G, Wang D, Pandit S and Fu XD (2008). The splicing factor SC35 has an active role in transcriptional elongation. Nat Struct Mol Biol. 15:819-826. 90. de la Mata M and Kornblihtt AR (2006). RNA polymerase II C-terminal domain mediates regulation of alternative splicing by SRp20. Nat Struct Mol Biol. 13:973-980. 91. Olson S, Blanchette M, Park J, Savva Y, Yeo GW, Yeakley JM, Rio DC and Graveley BR (2007). A regulator of Dscam mutually exclusive splicing fidelity. Nat Struct Mol Biol. 14:1134-1140. 92. Eperon IC, Makarova OV, Mayeda A, Munroe SH, Caceres JF, Hayward DG and Krainer AR (2000). Selection of alternative 5' splice sites: role of U1 snRNP and models for the antagonistic effects of SF2/ASF and hnRNP A1. Mol Cell Biol. 20:8303-8318. 93. Yang X, Bani MR, Lu SJ, Rowan S, Ben-David Y and Chabot B (1994). The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo. Proc Natl Acad Sci U S A. 91:6924-6928. 94. Caceres JF, Stamm S, Helfman DM and Krainer AR (1994). Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science. 265:1706-1709. 95. Mayeda A and Krainer AR (1992). Regulation of alternative pre-mRNA splicing by hnRNP A1 and splicing factor SF2. Cell. 68:365-375. 96. Rooke N, Markovtsov V, Cagavi E and Black DL (2003). Roles for SR proteins and hnRNP A1 in the regulation of c-src exon N1. Mol Cell Biol. 23:1874-1884. 97. Sharma S, Maris C, Allain FH and Black DL (2011). U1 snRNA directly interacts with polypyrimidine tract-binding protein during splicing repression. Mol Cell. 41:579-588. 98. Sharma S, Falick AM and Black DL (2005). Polypyrimidine tract binding protein blocks the 5' splice site-dependent assembly of U2AF and the prespliceosomal E complex. Mol Cell. 19:485-496.

206

99. Sharma S, Kohlstaedt LA, Damianov A, Rio DC and Black DL (2008). Polypyrimidine tract binding protein controls the transition from exon definition to an intron defined spliceosome. Nat Struct Mol Biol. 15:183-191. 100. Izquierdo JM, Majos N, Bonnal S, Martinez C, Castelo R, Guigo R, Bilbao D and Valcarcel J (2005). Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol Cell. 19:475-484. 101. Wagner EJ and Garcia-Blanco MA (2001). Polypyrimidine tract binding protein antagonizes exon definition. Mol Cell Biol. 21:3281-3288. 102. Amir-Ahmady B, Boutz PL, Markovtsov V, Phillips ML and Black DL (2005). Exon repression by polypyrimidine tract binding protein. RNA. 11:699-716. 103. Lamichhane R, Daubner GM, Thomas-Crusells J, Auweter SD, Manatschal C, Austin KS, Valniuk O, Allain FH and Rueda D (2010). RNA looping by PTB: Evidence using FRET and NMR spectroscopy for a role in splicing repression. Proc Natl Acad Sci U S A. 107:4105-4110. 104. Oberstrass FC, Auweter SD, Erat M, Hargous Y, Henning A, Wenter P, Reymond L, Amir-Ahmady B, Pitsch S, Black DL and Allain FH (2005). Structure of PTB bound to RNA: specific binding and implications for splicing regulation. Science. 309:2054-2057. 105. Erkelenz S, Mueller WF, Evans MS, Busch A, Schoneweis K, Hertel KJ and Schaal H (2013). Position-dependent splicing activation and repression by SR and hnRNP proteins rely on common mechanisms. RNA. 19:96-102. 106. Motta-Mena LB, Heyd F and Lynch KW (2010). Context-dependent regulatory mechanism of the splicing factor hnRNP L. Mol Cell. 37:223-234. 107. Buratti E, Stuani C, De Prato G and Baralle FE (2007). SR protein-mediated inhibition of CFTR exon 9 inclusion: molecular characterization of the intronic splicing silencer. Nucleic Acids Res. 35:4359-4368. 108. Ibrahim EC, Schaal TD, Hertel KJ, Reed R and Maniatis T (2005). Serine/arginine-rich protein-dependent suppression of exon skipping by exonic splicing enhancers. Proc Natl Acad Sci U S A. 102:5002-5007. 109. Shen M and Mattox W (2012). Activation and repression functions of an SR splicing regulator depend on exonic versus intronic-binding position. Nucleic Acids Res. 40:428-437. 110. Goren A, Ram O, Amit M, Keren H, Lev-Maor G, Vig I, Pupko T and Ast G (2006). Comparative analysis identifies exonic splicing regulatory sequences-- The complex definition of enhancers and silencers. Mol Cell. 22:769-781. 111. Gallego ME, Gattoni R, Stevenin J, Marie J and Expert-Bezancon A (1997). The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A. EMBO J. 16:1772-1784. 112. Jiang ZH, Zhang WJ, Rao Y and Wu JY (1998). Regulation of Ich-1 pre-mRNA alternative splicing and apoptosis by mammalian splicing factors. Proc Natl Acad Sci U S A. 95:9155-9160. 113. Lemaire R, Winne A, Sarkissian M and Lafyatis R (1999). SF2 and SRp55 regulation of CD45 exon 4 skipping during T cell activation. Eur J Immunol. 29:823-837. 114. Solis AS, Peng R, Crawford JB, Phillips JA, 3rd and Patton JG (2008). Growth hormone deficiency and splicing fidelity: two serine/arginine-rich proteins, ASF/SF2 and SC35, act antagonistically. J Biol Chem. 283:23619-23626. 207

115. ten Dam GB, Zilch CF, Wallace D, Wieringa B, Beverley PC, Poels LG and Screaton GR (2000). Regulation of alternative splicing of CD45 by antagonistic effects of SR protein splicing factors. J Immunol. 164:5287-5295. 116. McCullough AJ and Berget SM (1997). G triplets located throughout a class of small vertebrate introns enforce intron borders and regulate splice site selection. Mol Cell Biol. 17:4562-4571. 117. Chen CD, Kobayashi R and Helfman DM (1999). Binding of hnRNP H to an exonic splicing silencer is involved in the regulation of alternative splicing of the rat beta-tropomyosin gene. Genes Dev. 13:593-606. 118. Licatalosi DD, Mele A, Fak JJ, Ule J, Kayikci M, Chi SW, Clark TA, Schweitzer AC, Blume JE, Wang X, Darnell JC and Darnell RB (2008). HITS-CLIP yields genome-wide insights into brain alternative RNA processing. Nature. 456:464- 469. 119. Xue Y, Zhou Y, Wu T, Zhu T, Ji X, Kwon YS, Zhang C, Yeo G, Black DL, Sun H, Fu XD and Zhang Y (2009). Genome-wide analysis of PTB-RNA interactions reveals a strategy used by the general splicing repressor to modulate exon inclusion or skipping. Mol Cell. 36:996-1006. 120. Zhou HL, Luo G, Wise JA and Lou H (2014). Regulation of alternative splicing by local histone modifications: potential roles for RNA-guided mechanisms. Nucleic Acids Res. 42:701-713. 121. Coutinho-Mansfield GC, Xue Y, Zhang Y and Fu XD (2007). PTB/nPTB switch: a post-transcriptional mechanism for programming neuronal differentiation. Genes Dev. 21:1573-1577. 122. Poulos MG, Batra R, Li M, Yuan Y, Zhang C, Darnell RB and Swanson MS (2013). Progressive impairment of muscle regeneration in muscleblind-like 3 isoform knockout mice. Hum Mol Genet. 22:3547-3558. 123. Martin CL, Duvall JA, Ilkin Y, Simon JS, Arreaza MG, Wilkes K, Alvarez-Retuerto A, Whichello A, Powell CM, Rao K, Cook E and Geschwind DH (2007). Cytogenetic and molecular characterization of A2BP1/FOX1 as a candidate gene for autism. Am J Med Genet B Neuropsychiatr Genet. 144B:869-876. 124. Bhalla K, Phillips HA, Crawford J, McKenzie OL, Mulley JC, Eyre H, Gardner AE, Kremmidiotis G and Callen DF (2004). The de novo chromosome 16 translocations of two patients with abnormal phenotypes (mental retardation and epilepsy) disrupt the A2BP1 gene. J Hum Genet. 49:308-311. 125. Faustino NA and Cooper TA (2003). Pre-mRNA splicing and human disease. Genes Dev. 17:419-437. 126. Tazi J, Bakkour N and Stamm S (2009). Alternative splicing and disease. Biochim Biophys Acta. 1792:14-26. 127. Krawczak M, Thomas NS, Hundrieser B, Mort M, Wittig M, Hampe J and Cooper DN (2007). Single base-pair substitutions in exon-intron junctions of human genes: nature, distribution, and consequences for mRNA splicing. Hum Mutat. 28:150-158. 128. Sterne-Weiler T, Howard J, Mort M, Cooper DN and Sanford JR (2011). Loss of exon identity is a common mechanism of human inherited disease. Genome Res. 21:1563-1571. 129. Millevoi S, Bernat S, Telly D, Fouque F, Gladieff L, Favre G, Vagner S and Toulas C (2010). The c.5242C>A BRCA1 missense variant induces exon

208

skipping by increasing splicing repressors binding. Breast Cancer Res Treat. 120:391-399. 130. Lastella P, Surdo NC, Resta N, Guanti G and Stella A (2006). In silico and in vivo splicing analysis of MLH1 and MSH2 missense mutations shows exon- and tissue-specific effects. BMC Genomics. 7:243. 131. Tanackovic G, Ransijn A, Thibault P, Abou Elela S, Klinck R, Berson EL, Chabot B and Rivolta C (2011). PRPF mutations are associated with generalized defects in spliceosome formation and pre-mRNA splicing in patients with retinitis pigmentosa. Hum Mol Genet. 20:2116-2130. 132. Fardaei M, Larkin K, Brook JD and Hamshere MG (2001). In vivo co-localisation of MBNL protein with DMPK expanded-repeat transcripts. Nucleic Acids Res. 29:2766-2771. 133. Tomlinson DC, L'Hote CG, Kennedy W, Pitt E and Knowles MA (2005). Alternative splicing of fibroblast growth factor receptor 3 produces a secreted isoform that inhibits fibroblast growth factor-induced proliferation and is repressed in urothelial carcinoma cell lines. Cancer Res. 65:10441-10449. 134. David CJ, Chen M, Assanah M, Canoll P and Manley JL (2010). HnRNP proteins controlled by c-Myc deregulate pyruvate kinase mRNA splicing in cancer. Nature. 463:364-368. 135. Watson IR, Takahashi K, Futreal PA and Chin L (2013). Emerging patterns of somatic mutations in cancer. Nat Rev Genet. 14:703-718. 136. Yoshida K, Sanada M, Shiraishi Y, Nowak D, Nagata Y, Yamamoto R, Sato Y, Sato-Otsubo A, Kon A, Nagasaki M, Chalkidis G, Suzuki Y, Shiosaka M, Kawahata R, Yamaguchi T, Otsu M, Obara N, Sakata-Yanagimoto M, Ishiyama K, Mori H, Nolte F, Hofmann WK, Miyawaki S, Sugano S, Haferlach C, Koeffler HP, Shih LY, Haferlach T, Chiba S, Nakauchi H, Miyano S and Ogawa S (2011). Frequent pathway mutations of splicing machinery in myelodysplasia. Nature. 478:64-69. 137. Karni R, de Stanchina E, Lowe SW, Sinha R, Mu D and Krainer AR (2007). The gene encoding the splicing factor SF2/ASF is a proto-oncogene. Nat Struct Mol Biol. 14:185-193. 138. Ghigna C, Giordano S, Shen H, Benvenuto F, Castiglioni F, Comoglio PM, Green MR, Riva S and Biamonti G (2005). Cell motility is controlled by SF2/ASF through alternative splicing of the Ron protooncogene. Mol Cell. 20:881-890. 139. Anczukow O, Rosenberg AZ, Akerman M, Das S, Zhan L, Karni R, Muthuswamy SK and Krainer AR (2012). The splicing factor SRSF1 regulates apoptosis and proliferation to promote mammary epithelial cell transformation. Nat Struct Mol Biol. 19:220-228. 140. Ben-Hur V, Denichenko P, Siegfried Z, Maimon A, Krainer A, Davidson B and Karni R (2013). S6K1 alternative splicing modulates its oncogenic activity and regulates mTORC1. Cell Rep. 3:103-115. 141. Wappenschmidt B, Becker AA, Hauke J, Weber U, Engert S, Kohler J, Kast K, Arnold N, Rhiem K, Hahnen E, Meindl A and Schmutzler RK (2012). Analysis of 30 putative BRCA1 splicing mutations in hereditary breast and ovarian cancer families identifies exonic splice site mutations that escape in silico prediction. PLoS One. 7:e50800. 142. David CJ and Manley JL (2010). Alternative pre-mRNA splicing regulation in cancer: pathways and programs unhinged. Genes Dev. 24:2343-2364. 209

143. Chen M, Zhang J and Manley JL (2010). Turning on a fuel switch of cancer: hnRNP proteins regulate alternative splicing of pyruvate kinase mRNA. Cancer Res. 70:8977-8980. 144. Lane DP (1992). Cancer. p53, guardian of the genome. Nature. 358:15-16. 145. Levine AJ (1997). p53, the cellular gatekeeper for growth and division. Cell. 88:323-331. 146. Vogelstein B, Lane D and Levine AJ (2000). Surfing the p53 network. Nature. 408:307-310. 147. Wang Y, Reed M, Wang P, Stenger JE, Mayr G, Anderson ME, Schwedes JF and Tegtmeyer P (1993). p53 domains: identification and characterization of two autonomous DNA-binding regions. Genes Dev. 7:2575-2586. 148. Wang P, Reed M, Wang Y, Mayr G, Stenger JE, Anderson ME, Schwedes JF and Tegtmeyer P (1994). P53 Domains - Structure, Oligomerization, and Transformation. Molecular and Cellular Biology. 14:5182-5191. 149. Momand J, Zambetti GP, Olson DC, George D and Levine AJ (1992). The mdm- 2 oncogene product forms a complex with the p53 protein and inhibits p53- mediated transactivation. Cell. 69:1237-1245. 150. Kubbutat MH, Jones SN and Vousden KH (1997). Regulation of p53 stability by Mdm2. Nature. 387:299-303. 151. Honda R, Tanaka H and Yasuda H (1997). Oncoprotein MDM2 is a ubiquitin ligase E3 for tumor suppressor p53. FEBS Lett. 420:25-27. 152. Haupt Y, Maya R, Kazaz A and Oren M (1997). Mdm2 promotes the rapid degradation of p53. Nature. 387:296-299. 153. Jain AK and Barton MC (2010). Making sense of ubiquitin ligases that regulate p53. Cancer Biol Ther. 10:665-672. 154. Olivier M, Hollstein M and Hainaut P (2010). TP53 mutations in human cancers: origins, consequences, and clinical use. Cold Spring Harb Perspect Biol. 2:a001008. 155. Olive KP, Tuveson DA, Ruhe ZC, Yin B, Willis NA, Bronson RT, Crowley D and Jacks T (2004). Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell. 119:847-860. 156. Lang GA, Iwakuma T, Suh YA, Liu G, Rao VA, Parant JM, Valentin-Vega YA, Terzian T, Caldwell LC, Strong LC, El-Naggar AK and Lozano G (2004). Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell. 119:861-872. 157. Fakharzadeh SS, Trusko SP and George DL (1991). Tumorigenic potential associated with enhanced expression of a gene that is amplified in a mouse tumor cell line. EMBO J. 10:1565-1569. 158. Cahilly-Snyder L, Yang-Feng T, Francke U and George DL (1987). Molecular analysis and chromosomal mapping of amplified genes isolated from a transformed mouse 3T3 cell line. Somat Cell Mol Genet. 13:235-244. 159. Honda R and Yasuda H (2000). Activity of MDM2, a ubiquitin ligase, toward p53 or itself is dependent on the RING finger domain of the ligase. Oncogene. 19:1473-1476. 160. Haines DS, Landers JE, Engle LJ and George DL (1994). Physical and functional interaction between wild-type p53 and mdm2 proteins. Mol Cell Biol. 14:1171- 1178.

210

161. Chen J, Marechal V and Levine AJ (1993). Mapping of the p53 and mdm-2 interaction domains. Mol Cell Biol. 13:4107-4114. 162. Lai Z, Ferry KV, Diamond MA, Wee KE, Kim YB, Ma J, Yang T, Benfield PA, Copeland RA and Auger KR (2001). Human mdm2 mediates multiple mono- ubiquitination of p53 by a mechanism requiring enzyme isomerization. J Biol Chem. 276:31357-31367. 163. Li M, Brooks CL, Wu-Baer F, Chen D, Baer R and Gu W (2003). Mono- versus polyubiquitination: differential control of p53 fate by Mdm2. Science. 302:1972- 1975. 164. Chen L and Chen J (2003). MDM2-ARF complex regulates p53 sumoylation. Oncogene. 22:5348-5357. 165. Xirodimas DP, Saville MK, Bourdon JC, Hay RT and Lane DP (2004). Mdm2- mediated NEDD8 conjugation of p53 inhibits its transcriptional activity. Cell. 118:83-97. 166. Mendrysa SM and Perry ME (2000). The p53 tumor suppressor protein does not regulate expression of its own inhibitor, MDM2, except under conditions of stress. Mol Cell Biol. 20:2023-2030. 167. Bond GL, Hu W, Bond EE, Robins H, Lutzker SG, Arva NC, Bargonetti J, Bartel F, Taubert H, Wuerl P, Onel K, Yip L, Hwang SJ, Strong LC, Lozano G and Levine AJ (2004). A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell. 119:591-602. 168. Zauberman A, Flusberg D, Haupt Y, Barak Y and Oren M (1995). A functional p53-responsive intronic promoter is contained within the human mdm2 gene. Nucleic Acids Res. 23:2584-2592. 169. Barak Y, Lupo A, Zauberman A, Juven T, Aloni-Grinstein R, Gottlieb E, Rotter V and Oren M (1994). Targets for transcriptional activation by wild-type p53: endogenous retroviral LTR, immunoglobulin-like promoter, and an internal promoter of the mdm2 gene. Cold Spring Harb Symp Quant Biol. 59:225-235. 170. Landers JE, Cassel SL and George DL (1997). Translational enhancement of mdm2 oncogene expression in human tumor cells containing a stabilized wildtype p53 protein. Cancer Res. 57:3562-3568. 171. Jin X, Turcott E, Englehardt S, Mize GJ and Morris DR (2003). The two upstream open reading frames of oncogene mdm2 have different translational regulatory properties. J Biol Chem. 278:25716-25721. 172. Barak Y, Gottlieb E, Juven-Gershon T and Oren M (1994). Regulation of mdm2 expression by p53: alternative promoters produce transcripts with nonidentical translation potential. Genes Dev. 8:1739-1749. 173. Fang S, Jensen JP, Ludwig RL, Vousden KH and Weissman AM (2000). Mdm2 is a RING finger-dependent ubiquitin protein ligase for itself and p53. J Biol Chem. 275:8945-8951. 174. Montes de Oca Luna R, Wagner DS and Lozano G (1995). Rescue of early embryonic lethality in mdm2-deficient mice by deletion of p53. Nature. 378:203- 206. 175. Maya R, Balass M, Kim ST, Shkedy D, Leal JF, Shifman O, Moas M, Buschmann T, Ronai Z, Shiloh Y, Kastan MB, Katzir E and Oren M (2001). ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage. Genes Dev. 15:1067-1077. 211

176. Gajjar M, Candeias MM, Malbert-Colas L, Mazars A, Fujita J, Olivares-Illana V and Fahraeus R (2012). The p53 mRNA-Mdm2 interaction controls Mdm2 nuclear trafficking and is required for p53 activation following DNA damage. Cancer Cell. 21:25-35. 177. Candeias MM, Malbert-Colas L, Powell DJ, Daskalogianni C, Maslon MM, Naski N, Bourougaa K, Calvo F and Fahraeus R (2008). P53 mRNA controls p53 activity by managing Mdm2 functions. Nat Cell Biol. 10:1098-1105. 178. Wade M, Wang YV and Wahl GM (2010). The p53 orchestra: Mdm2 and Mdmx set the tone. Trends Cell Biol. 20:299-309. 179. Wade M, Li YC and Wahl GM (2013). MDM2, MDMX and p53 in oncogenesis and cancer therapy. Nat Rev Cancer. 13:83-96. 180. Sherr CJ (2006). Divorcing ARF and p53: an unsettled case. Nat Rev Cancer. 6:663-673. 181. Weber JD, Taylor LJ, Roussel MF, Sherr CJ and Bar-Sagi D (1999). Nucleolar Arf sequesters Mdm2 and activates p53. Nat Cell Biol. 1:20-26. 182. Zindy F, Eischen CM, Randle DH, Kamijo T, Cleveland JL, Sherr CJ and Roussel MF (1998). Myc signaling via the ARF tumor suppressor regulates p53- dependent apoptosis and immortalization. Genes Dev. 12:2424-2433. 183. Eischen CM, Weber JD, Roussel MF, Sherr CJ and Cleveland JL (1999). Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev. 13:2658-2669. 184. Dai MS and Lu H (2004). Inhibition of MDM2-mediated p53 ubiquitination and degradation by ribosomal protein L5. J Biol Chem. 279:44475-44482. 185. Li M, Chen D, Shiloh A, Luo J, Nikolaev AY, Qin J and Gu W (2002). Deubiquitination of p53 by HAUSP is an important pathway for p53 stabilization. Nature. 416:648-653. 186. Li M, Brooks CL, Kon N and Gu W (2004). A dynamic role of HAUSP in the p53- Mdm2 pathway. Mol Cell. 13:879-886. 187. Cummins JM and Vogelstein B (2004). HAUSP is required for p53 destabilization. Cell Cycle. 3:689-692. 188. Cummins JM, Rago C, Kohli M, Kinzler KW, Lengauer C and Vogelstein B (2004). Tumour suppression: disruption of HAUSP gene stabilizes p53. Nature. 428:1 p following 486. 189. Shvarts A, Steegenga WT, Riteco N, van Laar T, Dekker P, Bazuine M, van Ham RC, van der Houven van Oordt W, Hateboer G, van der Eb AJ and Jochemsen AG (1996). MDMX: a novel p53-binding protein with some functional properties of MDM2. EMBO J. 15:5349-5357. 190. Phillips A, Teunisse A, Lam S, Lodder K, Darley M, Emaduddin M, Wolf A, Richter J, de Lange J, Verlaan-de Vries M, Lenos K, Bohnke A, Bartel F, Blaydes JP and Jochemsen AG (2010). HDMX-L is expressed from a functional p53- responsive promoter in the first intron of the HDMX gene and participates in an autoregulatory feedback loop to control p53 activity. J Biol Chem. 285:29111- 29127. 191. Tanimura S, Ohtsuka S, Mitsui K, Shirouzu K, Yoshimura A and Ohtsubo M (1999). MDM2 interacts with MDMX through their RING finger domains. FEBS letters. 447:5-9.

212

192. Sharp DA, Kratowicz SA, Sank MJ and George DL (1999). Stabilization of the MDM2 oncoprotein by interaction with the structurally related MDMX protein. J Biol Chem. 274:38189-38196. 193. Pant V, Xiong S, Iwakuma T, Quintas-Cardama A and Lozano G (2011). Heterodimerization of Mdm2 and Mdm4 is critical for regulating p53 activity during embryogenesis but dispensable for p53 and Mdm2 stability. Proc Natl Acad Sci U S A. 108:11995-12000. 194. Pei D, Zhang Y and Zheng J (2012). Regulation of p53: a collaboration between Mdm2 and Mdmx. Oncotarget. 3:228-235. 195. Okamoto K, Taya Y and Nakagama H (2009). Mdmx enhances p53 ubiquitination by altering the substrate preference of the Mdm2 ubiquitin ligase. FEBS letters. 583:2710-2714. 196. Migliorini D, Danovi D, Colombo E, Carbone R, Pelicci PG and Marine JC (2002). Hdmx recruitment into the nucleus by Hdm2 is essential for its ability to regulate p53 stability and transactivation. J Biol Chem. 277:7318-7323. 197. Linares LK, Hengstermann A, Ciechanover A, Muller S and Scheffner M (2003). HdmX stimulates Hdm2-mediated ubiquitination and degradation of p53. Proc Natl Acad Sci U S A. 100:12009-12014. 198. Huang L, Yan Z, Liao X, Li Y, Yang J, Wang ZG, Zuo Y, Kawai H, Shadfan M, Ganapathy S and Yuan ZM (2011). The p53 inhibitors MDM2/MDMX complex is required for control of p53 activity in vivo. Proc Natl Acad Sci U S A. 108:12001- 12006. 199. Gu J, Kawai H, Nie L, Kitao H, Wiederschain D, Jochemsen AG, Parant J, Lozano G and Yuan ZM (2002). Mutual dependence of MDM2 and MDMX in their functional inactivation of p53. J Biol Chem. 277:19251-19254. 200. Francoz S, Froment P, Bogaerts S, De Clercq S, Maetens M, Doumont G, Bellefroid E and Marine JC (2006). Mdm4 and Mdm2 cooperate to inhibit p53 activity in proliferating and quiescent cells in vivo. Proc Natl Acad Sci U S A. 103:3232-3237. 201. Marine JC and Jochemsen AG (2005). Mdmx as an essential regulator of p53 activity. Biochem Biophys Res Commun. 331:750-760. 202. Pan Y and Chen J (2003). MDM2 promotes ubiquitination and degradation of MDMX. Mol Cell Biol. 23:5113-5121. 203. Parant J, Chavez-Reyes A, Little NA, Yan W, Reinke V, Jochemsen AG and Lozano G (2001). Rescue of embryonic lethality in Mdm4-null mice by loss of Trp53 suggests a nonoverlapping pathway with MDM2 to regulate p53. Nat Genet. 29:92-95. 204. Barboza JA, Iwakuma T, Terzian T, El-Naggar AK and Lozano G (2008). Mdm2 and Mdm4 loss regulates distinct p53 activities. Mol Cancer Res. 6:947-954. 205. Chen J (2012). The Roles of MDM2 and MDMX Phosphorylation in Stress Signaling to p53. Genes Cancer. 3:274-282. 206. Momand J, Jung D, Wilczynski S and Niland J (1998). The MDM2 gene amplification database. Nucleic Acids Res. 26:3453-3459. 207. Nakayama T, Toguchida J, Wadayama B, Kanoe H, Kotoura Y and Sasaki MS (1995). MDM2 gene amplification in bone and soft-tissue tumors: association with tumor progression in differentiated adipose-tissue tumors. Int J Cancer. 64:342-346.

213

208. Forslund A, Zeng Z, Qin LX, Rosenberg S, Ndubuisi M, Pincas H, Gerald W, Notterman DA, Barany F and Paty PB (2008). MDM2 gene amplification is correlated to tumor progression but not to the presence of SNP309 or TP53 mutational status in primary colorectal cancers. Mol Cancer Res. 6:205-211. 209. Danovi D, Meulmeester E, Pasini D, Migliorini D, Capra M, Frenk R, de Graaf P, Francoz S, Gasparini P, Gobbi A, Helin K, Pelicci PG, Jochemsen AG and Marine JC (2004). Amplification of Mdmx (or Mdm4) directly contributes to tumor formation by inhibiting p53 tumor suppressor activity. Mol Cell Biol. 24:5835- 5843. 210. Yu Q, Li Y, Mu K, Li Z, Meng Q, Wu X, Wang Y and Li L (2014). Amplification of Mdmx and overexpression of MDM2 contribute to mammary carcinogenesis by substituting for p53 mutations. Diagn Pathol. 9:71. 211. Jones SN, Hancock AR, Vogel H, Donehower LA and Bradley A (1998). Overexpression of Mdm2 in mice reveals a p53-independent role for Mdm2 in tumorigenesis. Proc Natl Acad Sci U S A. 95:15608-15612. 212. Xiong S, Pant V, Suh YA, Van Pelt CS, Wang Y, Valentin-Vega YA, Post SM and Lozano G (2010). Spontaneous tumorigenesis in mice overexpressing the p53- negative regulator Mdm4. Cancer Res. 70:7148-7154. 213. Alt JR, Greiner TC, Cleveland JL and Eischen CM (2003). Mdm2 haplo- insufficiency profoundly inhibits Myc-induced lymphomagenesis. EMBO J. 22:1442-1450. 214. Miwa S, Uchida C, Kitagawa K, Hattori T, Oda T, Sugimura H, Yasuda H, Nakamura H, Chida K and Kitagawa M (2006). Mdm2-mediated pRB downregulation is involved in carcinogenesis in a p53-independent manner. Biochem Biophys Res Commun. 340:54-61. 215. Fu W, Ma Q, Chen L, Li P, Zhang M, Ramamoorthy S, Nawaz Z, Shimojima T, Wang H, Yang Y, Shen Z, Zhang Y, Zhang X, Nicosia SV, Zhang Y, Pledger JW, Chen J and Bai W (2009). MDM2 acts downstream of p53 as an E3 ligase to promote FOXO ubiquitination and degradation. J Biol Chem. 284:13987-14000. 216. Gu L, Zhang H, He J, Li J, Huang M and Zhou M (2012). MDM2 regulates MYCN mRNA stabilization and translation in human neuroblastoma cells. Oncogene. 31:1342-1353. 217. Gu L, Zhu N, Zhang H, Durden DL, Feng Y and Zhou M (2009). Regulation of XIAP translation and induction by MDM2 following irradiation. Cancer Cell. 15:363-375. 218. Bouska A, Lushnikova T, Plaza S and Eischen CM (2008). Mdm2 promotes genetic instability and transformation independent of p53. Mol Cell Biol. 28:4862- 4874. 219. Carrillo AM, Bouska A, Arrate MP and Eischen CM (2014). Mdmx promotes genomic instability independent of p53 and Mdm2. Oncogene. 0. 220. Sigalas I, Calvert AH, Anderson JJ, Neal DE and Lunec J (1996). Alternatively spliced mdm2 transcripts with loss of p53 binding domain sequences: transforming ability and frequent detection in human cancer. Nat Med. 2:912- 917. 221. Bartel F, Meye A, Wurl P, Kappler M, Bache M, Lautenschlager C, Grunbaum U, Schmidt H and Taubert H (2001). Amplification of the MDM2 gene, but not expression of splice variants of MDM2 MRNA, is associated with prognosis in soft tissue sarcoma. Int J Cancer. 95:168-175. 214

222. Bartel F, Taylor AC, Taubert H and Harris LC (2001). Novel mdm2 splice variants identified in pediatric rhabdomyosarcoma tumors and cell lines. Oncol Res. 12:451-457. 223. Sanchez-Aguilera A, Garcia JF, Sanchez-Beato M and Piris MA (2006). Hodgkin's lymphoma cells express alternatively spliced forms of HDM2 with multiple effects on cell cycle control. Oncogene. 25:2565-2574. 224. Kraus A, Neff F, Behn M, Schuermann M, Muenkel K and Schlegel J (1999). Expression of alternatively spliced mdm2 transcripts correlates with stabilized wild-type p53 protein in human glioblastoma cells. Int J Cancer. 80:930-934. 225. Hori M, Shimazaki J, Inagawa S, Itabashi M and Hori M (2000). Alternatively spliced MDM2 transcripts in human breast cancer in relation to tumor necrosis and lymph node involvement. Pathol Int. 50:786-792. 226. Lukas J, Gao DQ, Keshmeshian M, Wen WH, Tsao-Wei D, Rosenberg S and Press MF (2001). Alternative and aberrant messenger RNA splicing of the mdm2 oncogene in invasive breast cancer. Cancer Res. 61:3212-3219. 227. Evdokiou A, Atkins GJ, Bouralexis S, Hay S, Raggatt LJ, Cowled PA, Graves SE, Clayer M and Findlay DM (2001). Expression of alternatively-spliced MDM2 transcripts in giant cell tumours of bone. Int J Oncol. 19:625-632. 228. Tamborini E, Della Torre G, Lavarino C, Azzarelli A, Carpinelli P, Pierotti MA and Pilotti S (2001). Analysis of the molecular species generated by MDM2 gene amplification in liposarcomas. Int J Cancer. 92:790-796. 229. Matsumoto R, Tada M, Nozaki M, Zhang CL, Sawamura Y and Abe H (1998). Short alternative splice transcripts of the mdm2 oncogene correlate to malignancy in human astrocytic neoplasms. Cancer Res. 58:609-613. 230. Jacob AG, O'Brien D, Singh RK, Comiskey DF, Jr., Littleton RM, Mohammad F, Gladman JT, Widmann MC, Jeyaraj SC, Bolinger C, Anderson JR, Barkauskas DA, Boris-Lawrie K and Chandler DS (2013). Stress-Induced Isoforms of MDM2 and MDM4 Correlate with High-Grade Disease and an Altered Splicing Network in Pediatric Rhabdomyosarcoma. Neoplasia. 15:1049-1063. 231. Okoro DR, Arva N, Gao C, Polotskaia A, Puente C, Rosso M and Bargonetti J (2013). Endogenous human MDM2-C is highly expressed in human cancers and functions as a p53-independent growth activator. PLoS One. 8:e77643. 232. Zheng T, Wang J, Zhao Y, Zhang C, Lin M, Wang X, Yu H, Liu L, Feng Z and Hu W (2013). Spliced MDM2 isoforms promote mutant p53 accumulation and gain- of-function in tumorigenesis. Nat Commun. 4:2996. 233. Chandler DS, Singh RK, Caldwell LC, Bitler JL and Lozano G (2006). Genotoxic stress induces coordinately regulated alternative splicing of the p53 modulators MDM2 and MDM4. Cancer Res. 66:9502-9508. 234. Dias CS, Liu Y, Yau A, Westrick L and Evans SC (2006). Regulation of hdm2 by stress-induced hdm2alt1 in tumor and nontumorigenic cell lines correlating with p53 stability. Cancer Res. 66:9467-9473. 235. Steinman HA, Burstein E, Lengner C, Gosselin J, Pihan G, Duckett CS and Jones SN (2004). An alternative splice form of Mdm2 induces p53-independent cell growth and tumorigenesis. J Biol Chem. 279:4877-4886. 236. Fridman JS, Hernando E, Hemann MT, de Stanchina E, Cordon-Cardo C and Lowe SW (2003). Tumor promotion by Mdm2 splice variants unable to bind p53. Cancer Res. 63:5703-5706.

215

237. Volk EL, Fan L, Schuster K, Rehg JE and Harris LC (2009). The MDM2-a splice variant of MDM2 alters transformation in vitro and the tumor spectrum in both Arf- and p53-null models of tumorigenesis. Molecular cancer research : MCR. 7:863- 869. 238. Volk EL, Schuster K, Nemeth KM, Fan L and Harris LC (2009). MDM2-A, a common Mdm2 splice variant, causes perinatal lethality, reduced longevity and enhanced senescence. Dis Model Mech. 2:47-55. 239. Jacob AG, Singh RK, Comiskey DF, Jr., Rouhier MF, Mohammad F, Bebee TW and Chandler DS (2014). Stress-Induced Alternative Splice Forms of MDM2 and MDMX Modulate the p53-Pathway in Distinct Ways. PLoS One. 9:e104444. 240. Evans SC, Viswanathan M, Grier JD, Narayana M, El-Naggar AK and Lozano G (2001). An alternatively spliced HDM2 product increases p53 activity by inhibiting HDM2. Oncogene. 20:4041-4049. 241. Jeyaraj S, O'Brien DM and Chandler DS (2009). MDM2 and MDM4 splicing: an integral part of the cancer spliceome. Front Biosci. 14:2647-2656. 242. Rallapalli R, Strachan G, Tuan RS and Hall DJ (2003). Identification of a domain within MDMX-S that is responsible for its high affinity interaction with p53 and high-level expression in mammalian cells. J Cell Biochem. 89:563-575. 243. Rallapalli R, Strachan G, Cho B, Mercer WE and Hall DJ (1999). A novel MDMX transcript expressed in a variety of transformed cell lines encodes a truncated protein with potent p53 repressive activity. J Biol Chem. 274:8299-8308. 244. Bartel F, Schulz J, Bohnke A, Blumke K, Kappler M, Bache M, Schmidt H, Wurl P, Taubert H and Hauptmann S (2005). Significance of HDMX-S (or MDM4) mRNA splice variant overexpression and HDMX gene amplification on primary soft tissue sarcoma prognosis. Int J Cancer. 117:469-475. 245. Prodosmo A, Giglio S, Moretti S, Mancini F, Barbi F, Avenia N, Di Conza G, Schunemann HJ, Pistola L, Ludovini V, Sacchi A, Pontecorvi A, Puxeddu E and Moretti F (2008). Analysis of human MDM4 variants in papillary thyroid carcinomas reveals new potential markers of cancer properties. J Mol Med (Berl). 86:585-596. 246. Riemenschneider MJ, Buschges R, Wolter M, Reifenberger J, Bostrom J, Kraus JA, Schlegel U and Reifenberger G (1999). Amplification and overexpression of the MDM4 (MDMX) gene from 1q32 in a subset of malignant gliomas without TP53 mutation or MDM2 amplification. Cancer Res. 59:6091-6096. 247. Bardot B, Bouarich-Bourimi R, Leemput J, Lejour V, Hamon A, Plancke L, Jochemsen AG, Simeonova I, Fang M and Toledo F (2014). Mice engineered for an obligatory Mdm4 exon skipping express higher levels of the Mdm4-S isoform but exhibit increased p53 activity. Oncogene. 248. Giglio S, Mancini F, Gentiletti F, Sparaco G, Felicioni L, Barassi F, Martella C, Prodosmo A, Iacovelli S, Buttitta F, Farsetti A, Soddu S, Marchetti A, Sacchi A, Pontecorvi A and Moretti F (2005). Identification of an aberrantly spliced form of HDMX in human tumors: a new mechanism for HDM2 stabilization. Cancer Res. 65:9687-9694. 249. Mancini F, Di Conza G and Moretti F (2009). MDM4 (MDMX) and its Transcript Variants. Curr Genomics. 10:42-50. 250. Markey M and Berberich SJ (2008). Full-length hdmX transcripts decrease following genotoxic stress. Oncogene. 27:6657-6666.

216

251. Del Gatto-Konczak F, Bourgeois CF, Le Guiner C, Kister L, Gesnel MC, Stevenin J and Breathnach R (2000). The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5' splice site. Mol Cell Biol. 20:6287-6299. 252. Izquierdo JM (2010). Cell-specific regulation of Fas exon 6 splicing mediated by Hu antigen R. Biochem Biophys Res Commun. 402:324-328. 253. Izquierdo JM (2010). Heterogeneous ribonucleoprotein C displays a repressor activity mediated by T-cell intracellular antigen-1-related/like protein to modulate Fas exon 6 splicing through a mechanism involving Hu antigen R. Nucleic Acids Res. 38:8001-8014. 254. Choi EY and Pintel D (2009). Splicing of the large intron present in the nonstructural gene of minute virus of mice is governed by TIA-1/TIAR binding downstream of the nonconsensus donor. J Virol. 83:6306-6311. 255. Yeowell HN, Walker LC, Mauger DM, Seth P and Garcia-Blanco MA (2009). TIA nuclear proteins regulate the alternate splicing of lysyl hydroxylase 2. J Invest Dermatol. 129:1402-1411. 256. Zhu H, Hinman MN, Hasman RA, Mehta P and Lou H (2008). Regulation of neuron-specific alternative splicing of neurofibromatosis type 1 pre-mRNA. Mol Cell Biol. 28:1240-1251. 257. Izquierdo JM and Valcarcel J (2007). Two isoforms of the T-cell intracellular antigen 1 (TIA-1) splicing factor display distinct splicing regulation activities. Control of TIA-1 isoform ratio by TIA-1-related protein. J Biol Chem. 282:19410- 19417. 258. Izquierdo JM and Valcarcel J (2007). Fas-activated serine/threonine kinase (FAST K) synergizes with TIA-1/TIAR proteins to regulate Fas alternative splicing. J Biol Chem. 282:1539-1543. 259. McAlinden A, Liang L, Mukudai Y, Imamura T and Sandell LJ (2007). Nuclear protein TIA-1 regulates COL2A1 alternative splicing and interacts with precursor mRNA and genomic DNA. J Biol Chem. 282:24444-24454. 260. Shukla S, Del Gatto-Konczak F, Breathnach R and Fisher SA (2005). Competition of PTB with TIA proteins for binding to a U-rich cis-element determines tissue-specific splicing of the myosin phosphatase targeting subunit 1. RNA. 11:1725-1736. 261. Forch P, Puig O, Kedersha N, Martinez C, Granneman S, Seraphin B, Anderson P and Valcarcel J (2000). The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol Cell. 6:1089-1098. 262. Izquierdo JM (2008). Hu antigen R (HuR) functions as an alternative pre-mRNA splicing regulator of Fas apoptosis-promoting receptor on exon definition. J Biol Chem. 283:19077-19084. 263. Zhu H, Hasman RA, Barron VA, Luo G and Lou H (2006). A nuclear function of Hu proteins as neuron-specific alternative RNA processing regulators. Mol Biol Cell. 17:5105-5114. 264. Kuroyanagi H, Watanabe Y, Suzuki Y and Hagiwara M (2013). Position- dependent and neuron-specific splicing regulation by the CELF family RNA- binding protein UNC-75 in Caenorhabditis elegans. Nucleic Acids Res. 41:4015- 4025.

217

265. Barron VA, Zhu H, Hinman MN, Ladd AN and Lou H (2010). The neurofibromatosis type I pre-mRNA is a novel target of CELF protein-mediated splicing regulation. Nucleic Acids Res. 38:253-264. 266. Min H, Turck CW, Nikolic JM and Black DL (1997). A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev. 11:1023-1036. 267. Boutz PL, Stoilov P, Li Q, Lin CH, Chawla G, Ostrow K, Shiue L, Ares M, Jr. and Black DL (2007). A post-transcriptional regulatory switch in polypyrimidine tract- binding proteins reprograms alternative splicing in developing neurons. Genes & development. 21:1636-1652. 268. Matter N, Herrlich P and Konig H (2002). Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature. 420:691-695. 269. Paronetto MP, Achsel T, Massiello A, Chalfant CE and Sette C (2007). The RNA- binding protein Sam68 modulates the alternative splicing of Bcl-x. J Cell Biol. 176:929-939. 270. Rajan P, Gaughan L, Dalgliesh C, El-Sherif A, Robson CN, Leung HY and Elliott DJ (2008). The RNA-binding and adaptor protein Sam68 modulates signal- dependent splicing and transcriptional activity of the androgen receptor. J Pathol. 215:67-77. 271. Chawla G, Lin CH, Han A, Shiue L, Ares M, Jr. and Black DL (2009). Sam68 regulates a set of alternatively spliced exons during neurogenesis. Mol Cell Biol. 29:201-213. 272. Paronetto MP, Cappellari M, Busa R, Pedrotti S, Vitali R, Comstock C, Hyslop T, Knudsen KE and Sette C (2010). Alternative splicing of the cyclin D1 protooncogene is regulated by the RNA-binding protein Sam68. Cancer Res. 70:229- 239. 273. Valacca C, Bonomi S, Buratti E, Pedrotti S, Baralle FE, Sette C, Ghigna C and Biamonti G (2010). Sam68 regulates EMT through alternative splicing-activated nonsense-mediated mRNA decay of the SF2/ASF proto-oncogene. J Cell Biol. 191:87-99. 274. Pedrotti S, Bielli P, Paronetto MP, Ciccosanti F, Fimia GM, Stamm S, Manley JL and Sette C (2010). The splicing regulator Sam68 binds to a novel exonic splicing silencer and functions in SMN2 alternative splicing in spinal muscular atrophy. EMBO J. 29:1235-1247. 275. Iijima T, Wu K, Witte H, Hanno-Iijima Y, Glatter T, Richard S and Scheiffele P (2011). SAM68 regulates neuronal activity-dependent alternative splicing of neurexin-1. Cell. 147:1601-1614. 276. Wang Y, Xiao X, Zhang J, Choudhury R, Robertson A, Li K, Ma M, Burge CB and Wang Z (2013). A complex network of factors with overlapping affinities represses splicing through intronic elements. Nat Struct Mol Biol. 20:36-45. 277. Sorek R and Ast G (2003). Intronic sequences flanking alternatively spliced exons are conserved between human and mouse. Genome Res. 13:1631-1637. 278. Sugnet CW, Srinivasan K, Clark TA, O'Brien G, Cline MS, Wang H, Williams A, Kulp D, Blume JE, Haussler D and Ares M, Jr. (2006). Unusual intron conservation near tissue-regulated exons found by splicing microarrays. PLoS Comput Biol. 2:e4.

218

279. Yeo GW, Van Nostrand EL and Liang TY (2007). Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements. PLoS Genet. 3:e85. 280. Rossbach O, Hung LH, Khrameeva E, Schreiner S, Konig J, Curk T, Zupan B, Ule J, Gelfand MS and Bindereif A (2014). Crosslinking-immunoprecipitation (iCLIP) analysis reveals global regulatory roles of hnRNP L. RNA Biol. 11:146- 155. 281. Aznarez I, Barash Y, Shai O, He D, Zielenski J, Tsui LC, Parkinson J, Frey BJ, Rommens JM and Blencowe BJ (2008). A systematic analysis of intronic sequences downstream of 5' splice sites reveals a widespread role for U-rich motifs and TIA1/TIAL1 proteins in alternative splicing regulation. Genome Res. 18:1247-1258. 282. Lambert N, Robertson A, Jangi M, McGeary S, Sharp PA and Burge CB (2014). RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54:887-900. 283. Singh RK, Tapia-Santos A, Bebee TW and Chandler DS (2009). Conserved sequences in the final intron of MDM2 are essential for the regulation of alternative splicing of MDM2 in response to stress. Exp Cell Res. 315:3419- 3432. 284. Jacob AG, Singh RK, Mohammad F, Bebee TW and Chandler DS (2014). The Splicing Factor FUBP1 Is Required for the Efficient Splicing of Oncogene MDM2 Pre-mRNA. J Biol Chem. 289:17350-17364. 285. Rabenhorst U, Beinoraviciute-Kellner R, Brezniceanu ML, Joos S, Devens F, Lichter P, Rieker RJ, Trojan J, Chung HJ, Levens DL and Zornig M (2009). Overexpression of the far upstream element binding protein 1 in hepatocellular carcinoma is required for tumor growth. Hepatology. 50:1121-1129. 286. Malz M, Weber A, Singer S, Riehmer V, Bissinger M, Riener MO, Longerich T, Soll C, Vogel A, Angel P, Schirmacher P and Breuhahn K (2009). Overexpression of far upstream element binding proteins: a mechanism regulating proliferation and migration in liver cancer cells. Hepatology. 50:1130- 1139. 287. Singer S, Malz M, Herpel E, Warth A, Bissinger M, Keith M, Muley T, Meister M, Hoffmann H, Penzel R, Gdynia G, Ehemann V, Schnabel PA, Kuner R, Huber P, Schirmacher P and Breuhahn K (2009). Coordinated expression of stathmin family members by far upstream sequence element-binding protein-1 increases motility in non-small cell lung cancer. Cancer Res. 69:2234-2243. 288. Ma J, Chen M, Xia SK, Shu W, Guo Y, Wang YH, Xu Y, Bai XM, Zhang L, Zhang H, Zhang M, Wang YP and Leng J (2013). Prostaglandin E2 promotes liver cancer cell growth by the upregulation of FUSE-binding protein 1 expression. Int J Oncol. 42:1093-1104. 289. Zhang F, Tian Q and Wang Y (2013). Far upstream element-binding protein 1 (FUBP1) is overexpressed in human gastric cancer tissue compared to non- cancerous tissue. Onkologie. 36:650-655. 290. Baumgarten P, Harter PN, Tonjes M, Capper D, Blank AE, Sahm F, von Deimling A, Kolluru V, Schwamb B, Rabenhorst U, Starzetz T, Kogel D, Rieker RJ, Plate KH, Ohgaki H, Radlwimmer B, Zornig M and Mittelbronn M (2013). Loss of FUBP1 expression in gliomas predicts FUBP1 mutation and is associated with

219

oligodendroglial differentiation, IDH1 mutation and 1p/19q loss of heterozygosity. Neuropathol Appl Neurobiol. 291. Jia MY and Wang YJ (2014). Far upstream element-binding protein 1(FUBP1) expression differs between human colorectal cancer and non-cancerous tissue. Neoplasma. 292. Bettegowda C, Agrawal N, Jiao Y, Sausen M, Wood LD, Hruban RH, Rodriguez FJ, Cahill DP, McLendon R, Riggins G, Velculescu VE, Oba-Shinjo SM, Marie SK, Vogelstein B, Bigner D, Yan H, Papadopoulos N and Kinzler KW (2011). Mutations in CIC and FUBP1 contribute to human oligodendroglioma. Science. 333:1453-1455. 293. Sahm F, Koelsche C, Meyer J, Pusch S, Lindenberg K, Mueller W, Herold- Mende C, von Deimling A and Hartmann C (2012). CIC and FUBP1 mutations in oligodendrogliomas, oligoastrocytomas and astrocytomas. Acta Neuropathol. 123:853-860. 294. Vindigni A, Ochem A, Triolo G and Falaschi A (2001). Identification of human DNA helicase V with the far upstream element-binding protein. Nucleic Acids Res. 29:1061-1067. 295. Duncan R, Bazar L, Michelotti G, Tomonaga T, Krutzsch H, Avigan M and Levens D (1994). A sequence-specific, single-strand binding protein activates the far upstream element of c-myc and defines a new DNA-binding motif. Genes Dev. 8:465-480. 296. Braddock DT, Louis JM, Baber JL, Levens D and Clore GM (2002). Structure and dynamics of KH domains from FBP bound to single-stranded DNA. Nature. 415:1051-1056. 297. Benjamin LR, Chung HJ, Sanford S, Kouzine F, Liu J and Levens D (2008). Hierarchical mechanisms build the DNA-binding specificity of FUSE binding protein. Proc Natl Acad Sci U S A. 105:18296-18301. 298. Chien HL, Liao CL and Lin YL (2011). FUSE binding protein 1 interacts with untranslated regions of Japanese encephalitis virus RNA and negatively regulates viral replication. J Virol. 85:4698-4706. 299. Zheng Y and Miskimins WK (2011). Far upstream element binding protein 1 activates translation of p27Kip1 mRNA through its internal ribosomal entry site. Int J Biochem Cell Biol. 43:1641-1648. 300. Huang PN, Lin JY, Locker N, Kung YA, Hung CT, Lin JY, Huang HI, Li ML and Shih SR (2011). Far upstream element binding protein 1 binds the internal ribosomal entry site of enterovirus 71 and enhances viral translation and viral growth. Nucleic Acids Res. 39:9633-9648. 301. Olanich ME, Moss BL, Piwnica-Worms D, Townsend RR and Weber JD (2011). Identification of FUSE-binding protein 1 as a regulatory mRNA-binding protein that represses nucleophosmin translation. Oncogene. 30:77-86. 302. Chan RC and Black DL (1997). The polypyrimidine tract binding protein binds upstream of neural cell-specific c-src exon N1 to repress the splicing of the intron downstream. Mol Cell Biol. 17:4667-4676. 303. Chou MY, Underwood JG, Nikolic J, Luu MH and Black DL (2000). Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c-src neural-specific splicing. Mol Cell. 5:949-957.

220

304. Southby J, Gooding C and Smith CW (1999). Polypyrimidine tract binding protein functions as a repressor to regulate alternative splicing of alpha-actinin mutally exclusive exons. Mol Cell Biol. 19:2699-2711. 305. Gromak N, Matlin AJ, Cooper TA and Smith CW (2003). Antagonistic regulation of alpha-actinin alternative splicing by CELF proteins and polypyrimidine tract binding protein. RNA. 9:443-456. 306. Matlin AJ, Southby J, Gooding C and Smith CW (2007). Repression of alpha- actinin SM exon splicing by assisted binding of PTB to the polypyrimidine tract. RNA. 13:1214-1223. 307. Mulligan GJ, Guo W, Wormsley S and Helfman DM (1992). Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of beta- tropomyosin pre-mRNA. J Biol Chem. 267:25480-25487. 308. Gooding C, Roberts GC and Smith CW (1998). Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon. RNA. 4:85-100. 309. Sauliere J, Sureau A, Expert-Bezancon A and Marie J (2006). The polypyrimidine tract binding protein (PTB) represses splicing of exon 6B from the beta- tropomyosin pre-mRNA by directly interfering with the binding of the U2AF65 subunit. Mol Cell Biol. 26:8755-8769. 310. Charlet BN, Logan P, Singh G and Cooper TA (2002). Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing. Mol Cell. 9:649-658. 311. Carstens RP, Wagner EJ and Garcia-Blanco MA (2000). An intronic splicing silencer causes skipping of the IIIb exon of fibroblast growth factor receptor 2 through involvement of polypyrimidine tract binding protein. Mol Cell Biol. 20:7388-7400. 312. Jin W, Bruno IG, Xie TX, Sanger LJ and Cote GJ (2003). Polypyrimidine tract- binding protein down-regulates fibroblast growth factor receptor 1 alpha-exon inclusion. Cancer Res. 63:6154-6157. 313. Shen H, Kan JL, Ghigna C, Biamonti G and Green MR (2004). A single polypyrimidine tract binding protein (PTB) binding site mediates splicing inhibition at mouse IgM exons M1 and M2. RNA. 10:787-794. 314. Zheng X, Cho S, Moon H, Loh TJ, Oh HK, Green MR and Shen H (2014). Polypyrimidine tract binding protein inhibits IgM pre-mRNA splicing by diverting U2 snRNA base-pairing away from the branch point. RNA. 20:440-446. 315. Paradis C, Cloutier P, Shkreta L, Toutant J, Klarskov K and Chabot B (2007). hnRNP I/PTB can antagonize the splicing repressor activity of SRp30c. RNA. 13:1287-1300. 316. Lou H, Helfman DM, Gagel RF and Berget SM (1999). Polypyrimidine tract- binding protein positively regulates inclusion of an alternative 3'-terminal exon. Mol Cell Biol. 19:78-85. 317. Maynard CM and Hall KB (2010). Interactions between PTB RRMs induce slow motions and increase RNA binding affinity. J Mol Biol. 397:260-277. 318. Wollerton MC, Gooding C, Robinson F, Brown EC, Jackson RJ and Smith CW (2001). Differential alternative splicing activity of isoforms of polypyrimidine tract binding protein (PTB). RNA. 7:819-832.

221

319. Sawicka K, Bushell M, Spriggs KA and Willis AE (2008). Polypyrimidine-tract- binding protein: a multifunctional RNA-binding protein. Biochem Soc Trans. 36:641-647. 320. Spellman R, Llorian M and Smith CW (2007). Crossregulation and functional redundancy between the splicing regulator PTB and its paralogs nPTB and ROD1. Mol Cell. 27:420-434. 321. Clerte C and Hall KB (2009). The domains of polypyrimidine tract binding protein have distinct RNA structural preferences. Biochemistry. 48:2063-2074. 322. Simpson PJ, Monie TP, Szendroi A, Davydova N, Tyzack JK, Conte MR, Read CM, Cary PD, Svergun DI, Konarev PV, Curry S and Matthews S (2004). Structure and RNA interactions of the N-terminal RRM domains of PTB. Structure. 12:1631-1643. 323. Singh R, Valcarcel J and Green MR (1995). Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science. 268:1173-1176. 324. Lin CH and Patton JG (1995). Regulation of alternative 3' splice site selection by constitutive splicing factors. RNA. 1:234-245. 325. Rideau AP, Gooding C, Simpson PJ, Monie TP, Lorenz M, Huttelmaier S, Singer RH, Matthews S, Curry S and Smith CW (2006). A peptide motif in Raver1 mediates splicing repression by interaction with the PTB RRM2 domain. Nat Struct Mol Biol. 13:839-848. 326. Robinson F and Smith CW (2006). A splicing repressor domain in polypyrimidine tract-binding protein. J Biol Chem. 281:800-806. 327. Shibayama M, Ohno S, Osaka T, Sakamoto R, Tokunaga A, Nakatake Y, Sato M and Yoshida N (2009). Polypyrimidine tract-binding protein is essential for early mouse development and embryonic stem cell proliferation. FEBS J. 276:6658- 6668. 328. Makeyev EV, Zhang J, Carrasco MA and Maniatis T (2007). The MicroRNA miR- 124 promotes neuronal differentiation by triggering brain-specific alternative pre- mRNA splicing. Mol Cell. 27:435-448. 329. Boutz PL, Chawla G, Stoilov P and Black DL (2007). MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development. Genes & development. 21:71-84. 330. McCutcheon IE, Hentschel SJ, Fuller GN, Jin W and Cote GJ (2004). Expression of the splicing regulator polypyrimidine tract-binding protein in normal and neoplastic brain. Neuro Oncol. 6:9-14. 331. He X, Ee PL, Coon JS and Beck WT (2004). Alternative splicing of the multidrug resistance protein 1/ATP binding cassette transporter subfamily gene in ovarian cancer creates functional splice variants and is associated with increased expression of the splicing factors PTB and SRp20. Clin Cancer Res. 10:4652- 4660. 332. He X, Arslan AD, Ho TT, Yuan C, Stampfer MR and Beck WT (2014). Involvement of polypyrimidine tract-binding protein (PTBP1) in maintaining breast cancer cell growth and malignant properties. Oncogenesis. 3:e84. 333. Chen M, David CJ and Manley JL (2012). Concentration-dependent control of pyruvate kinase M mutually exclusive splicing by hnRNP proteins. Nat Struct Mol Biol. 19:346-354.

222

334. Grover R, Ray PS and Das S (2008). Polypyrimidine tract binding protein regulates IRES-mediated translation of p53 isoforms. Cell Cycle. 7:2189-2198. 335. Mayeda A and Krainer AR (1999). Preparation of HeLa cell nuclear and cytosolic S100 extracts for in vitro splicing. Methods Mol Biol. 118:309-314. 336. Zhu H, Hasman RA, Young KM, Kedersha NL and Lou H (2003). U1 snRNP- dependent function of TIAR in the regulation of alternative RNA processing of the human calcitonin/CGRP pre-mRNA. Mol Cell Biol. 23:5959-5971. 337. Wagner EJ and Garcia-Blanco MA (2002). RNAi-mediated PTB depletion leads to enhanced exon definition. Mol Cell. 10:943-949. 338. Wollerton MC, Gooding C, Wagner EJ, Garcia-Blanco MA and Smith CW (2004). Autoregulation of polypyrimidine tract binding protein by alternative splicing leading to nonsense-mediated decay. Mol Cell. 13:91-100. 339. Jang M, Park BC, Kang S, Chi SW, Cho S, Chung SJ, Lee SC, Bae KH and Park SG (2009). Far upstream element-binding protein-1, a novel caspase substrate, acts as a cross-talker between apoptosis and the c-myc oncogene. Oncogene. 28:1529-1536. 340. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, Antipin Y, Reva B, Goldberg AP, Sander C and Schultz N (2012). The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2:401-404. 341. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, Cerami E, Sander C and Schultz N (2013). Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 6:pl1. 342. Back SH, Shin S and Jang SK (2002). Polypyrimidine tract-binding proteins are cleaved by caspase-3 during apoptosis. J Biol Chem. 277:27200-27209. 343. Izquierdo JM (2008). Fas splicing regulation during early apoptosis is linked to caspase-mediated cleavage of U2AF65. Mol Biol Cell. 19:3299-3307. 344. Weber A, Kristiansen I, Johannsen M, Oelrich B, Scholmann K, Gunia S, May M, Meyer HA, Behnke S, Moch H and Kristiansen G (2008). The FUSE binding proteins FBP1 and FBP3 are potential c-myc regulators in renal, but not in prostate and bladder cancer. BMC Cancer. 8:369. 345. Ding Z, Liu X, Liu Y, Zhang J, Huang X, Yang X, Yao L, Cui G and Wang D (2013). Expression of far upstream element (FUSE) binding protein 1 in human glioma is correlated with c-Myc and cell proliferation. Mol Carcinog. 346. Zhou Z, Licklider LJ, Gygi SP and Reed R (2002). Comprehensive proteomic analysis of the human spliceosome. Nature. 419:182-185. 347. Hastings ML, Allemand E, Duelli DM, Myers MP and Krainer AR (2007). Control of pre-mRNA splicing by the general splicing factors PUF60 and U2AF(65). PLoS One. 2:e538. 348. Page-McCaw PS, Amonlirdviman K and Sharp PA (1999). PUF60: a novel U2AF65-related splicing activity. RNA. 5:1548-1560. 349. Liu J, He L, Collins I, Ge H, Libutti D, Li J, Egly JM and Levens D (2000). The FBP interacting repressor targets TFIIH to inhibit activated transcription. Mol Cell. 5:331-341. 350. Liu J, Chung HJ, Vogt M, Jin Y, Malide D, He L, Dundr M and Levens D (2011). JTV1 co-activates FBP to induce USP29 transcription and stabilize p53 in response to oxidative stress. EMBO J. 30:846-858. 223

351. Atanassov BS and Dent SY (2011). USP22 regulates cell proliferation by deubiquitinating the transcriptional regulator FBP1. EMBO Rep. 12:924-930. 352. He L, Liu J, Collins I, Sanford S, O'Connell B, Benham CJ and Levens D (2000). Loss of FBP function arrests cellular proliferation and extinguishes c-myc expression. EMBO J. 19:1034-1044. 353. Xiao J, Zhang Z, Chen GG, Zhang M, Ding Y, Fu J, Li M and Yun JP (2009). Nucleophosmin/B23 interacts with p21WAF1/CIP1 and contributes to its stability. Cell Cycle. 8:889-895. 354. Colombo E, Bonetti P, Lazzerini Denchi E, Martinelli P, Zamponi R, Marine JC, Helin K, Falini B and Pelicci PG (2005). Nucleophosmin is required for DNA integrity and p19Arf protein stability. Mol Cell Biol. 25:8874-8886. 355. Tian H and Kole R (2001). Strong RNA splicing enhancers identified by a modified method of cycled selection interact with SR protein. J Biol Chem. 276:33833-33839. 356. Cartegni L, Wang J, Zhu Z, Zhang MQ and Krainer AR (2003). ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 31:3568- 3571. 357. Ke S, Shang S, Kalachikov SM, Morozova I, Yu L, Russo JJ, Ju J and Chasin LA (2011). Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. 21:1360-1374. 358. Erkelenz S, Theiss S, Otte M, Widera M, Peter JO and Schaal H (2014). Genomic HEXploring allows landscaping of novel potential splicing regulatory elements. Nucleic Acids Res. 42:10681-10697. 359. Yu Y, Maroney PA, Denker JA, Zhang XH, Dybkov O, Luhrmann R, Jankowsky E, Chasin LA and Nilsen TW (2008). Dynamic regulation of alternative splicing by silencers that modulate 5' splice site competition. Cell. 135:1224-1236. 360. Chasin LA (2007). Searching for splicing motifs. Adv Exp Med Biol. 623:85-106. 361. Arnold WD and Burghes AH (2013). Spinal muscular atrophy: development and implementation of potential treatments. Ann Neurol. 74:348-362. 362. Mitrpant C, Porensky P, Zhou H, Price L, Muntoni F, Fletcher S, Wilton SD and Burghes AH (2013). Improved antisense oligonucleotide design to suppress aberrant SMN2 gene transcript processing: towards a treatment for spinal muscular atrophy. PLoS One. 8:e62114. 363. Porensky PN and Burghes AH (2013). Antisense oligonucleotides for the treatment of spinal muscular atrophy. Hum Gene Ther. 24:489-498. 364. Zhang J and Manley JL (2013). Misregulation of pre-mRNA alternative splicing in cancer. Cancer Discov. 3:1228-1237. 365. Padgett RA (2012). New connections between splicing and human disease. Trends Genet. 28:147-154. 366. Siegfried Z, Bonomi S, Ghigna C and Karni R (2013). Regulation of the Ras- MAPK and PI3K-mTOR Signalling Pathways by Alternative Splicing in Cancer. Int J Cell Biol. 2013:568931. 367. Das S and Krainer AR (2014). Emerging Functions of SRSF1, Splicing Factor and Oncoprotein, in RNA Metabolism and Cancer. Mol Cancer Res. 12:1195- 1204. 368. Cartegni L, Chew SL and Krainer AR (2002). Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 3:285-298. 224

369. Lents NH, Wheeler LW, Baldassare JJ and Dynlacht BD (2008). Identification and characterization of a novel Mdm2 splice variant acutely induced by the chemotherapeutic agents adriamycin and actinomycin D. Cell Cycle. 7:1580- 1586. 370. Ahouidi AD, Bei AK, Neafsey DE, Sarr O, Volkman S, Milner D, Cox-Singh J, Ferreira MU, Ndir O, Premji Z, Mboup S and Duraisingh MT (2010). Population genetic analysis of large sequence polymorphisms in Plasmodium falciparum blood-stage antigens. Infect Genet Evol. 10:200-206. 371. Oliner JD, Pietenpol JA, Thiagalingam S, Gyuris J, Kinzler KW and Vogelstein B (1993). Oncoprotein MDM2 conceals the activation domain of tumour suppressor p53. Nature. 362:857-860. 372. Eischen CM and Boyd K (2012). Decreased Mdm2 expression inhibits tumor development and extends survival independent of Arf and dependent on p53. PLoS One. 7:e46148. 373. Lenos K, de Lange J, Teunisse AF, Lodder K, Verlaan-de Vries M, Wiercinska E, van der Burg MJ, Szuhai K and Jochemsen AG (2011). Oncogenic functions of hMDMX in in vitro transformation of primary human fibroblasts and embryonic retinoblasts. Mol Cancer. 10:111. 374. Tang Y, Zhao W, Chen Y, Zhao Y and Gu W (2008). Acetylation is indispensable for p53 activation. Cell. 133:612-626. 375. Shieh SY, Ikeda M, Taya Y and Prives C (1997). DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell. 91:325-334. 376. Lenos K and Jochemsen AG (2011). Functions of MDMX in the modulation of the p53-response. J Biomed Biotechnol. 2011:876173. 377. Kuppers R (2005). Mechanisms of B-cell lymphoma pathogenesis. Nat Rev Cancer. 5:251-262. 378. Hartmann EM, Ott G and Rosenwald A (2008). Molecular biology and genetics of lymphomas. Hematol Oncol Clin North Am. 22:807-823, vii. 379. Garcia JF, Villuendas R, Sanchez-Beato M, Sanchez-Aguilera A, Sanchez L, Prieto I and Piris MA (2002). Nucleolar p14(ARF) overexpression in Reed- Sternberg cells in Hodgkin's lymphoma: absence of p14(ARF)/Hdm2 complexes is associated with expression of alternatively spliced Hdm2 transcripts. Am J Pathol. 160:569-578. 380. Bunz F, Dutriaux A, Lengauer C, Waldman T, Zhou S, Brown JP, Sedivy JM, Kinzler KW and Vogelstein B (1998). Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science. 282:1497-1501. 381. Macleod KF, Sherry N, Hannon G, Beach D, Tokino T, Kinzler K, Vogelstein B and Jacks T (1995). p53-dependent and independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dev. 9:935-944. 382. Tokino T and Nakamura Y (2000). The role of p53-target genes in human cancer. Crit Rev Oncol Hematol. 33:1-6. 383. D'Amico M, Wu K, Fu M, Rao M, Albanese C, Russell RG, Lian H, Bregman D, White MA and Pestell RG (2004). The inhibitor of cyclin-dependent kinase 4a/alternative reading frame (INK4a/ARF) locus encoded proteins p16INK4a and p19ARF repress cyclin D1 transcription through distinct cis elements. Cancer Res. 64:4122-4130.

225

384. Amundson SA, Myers TG and Fornace AJ, Jr. (1998). Roles for p53 in growth arrest and apoptosis: putting on the brakes after genotoxic stress. Oncogene. 17:3287-3299. 385. Kastan MB, Zhan Q, el-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B and Fornace AJ, Jr. (1992). A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell. 71:587-597. 386. Carrier F, Smith ML, Bae I, Kilpatrick KE, Lansing TJ, Chen CY, Engelstein M, Friend SH, Henner WD, Gilmer TM and et al. (1994). Characterization of human Gadd45, a p53-regulated protein. J Biol Chem. 269:32672-32677. 387. el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW and Vogelstein B (1993). WAF1, a potential mediator of p53 tumor suppression. Cell. 75:817-825. 388. Fiscella M, Zhang H, Fan S, Sakaguchi K, Shen S, Mercer WE, Vande Woude GF, O'Connor PM and Appella E (1997). Wip1, a novel human protein phosphatase that is induced in response to ionizing radiation in a p53-dependent manner. Proc Natl Acad Sci U S A. 94:6048-6053. 389. Xu J and Morris GF (1999). p53-mediated regulation of proliferating cell nuclear antigen expression in cells exposed to ionizing radiation. Mol Cell Biol. 19:12-20. 390. Hermeking H, Lengauer C, Polyak K, He TC, Zhang L, Thiagalingam S, Kinzler KW and Vogelstein B (1997). 14-3-3 sigma is a p53-regulated inhibitor of G2/M progression. Mol Cell. 1:3-11. 391. Miyashita T and Reed JC (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell. 80:293-299. 392. Owen-Schaub LB, Zhang W, Cusack JC, Angelo LS, Santee SM, Fujiwara T, Roth JA, Deisseroth AB, Zhang WW, Kruzel E and et al. (1995). Wild-type human p53 and a temperature-sensitive mutant induce Fas/APO-1 expression. Mol Cell Biol. 15:3032-3040. 393. Nakano K and Vousden KH (2001). PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell. 7:683-694. 394. Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T, Yamashita T, Tokino T, Taniguchi T and Tanaka N (2000). Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science. 288:1053-1058. 395. Raver-Shapira N, Marciano E, Meiri E, Spector Y, Rosenfeld N, Moskovits N, Bentwich Z and Oren M (2007). Transcriptional activation of miR-34a contributes to p53-mediated apoptosis. Mol Cell. 26:731-743. 396. Tarasov V, Jung P, Verdoodt B, Lodygin D, Epanchintsev A, Menssen A, Meister G and Hermeking H (2007). Differential regulation of microRNAs by p53 revealed by massively parallel sequencing: miR-34a is a p53 target that induces apoptosis and G1-arrest. Cell Cycle. 6:1586-1593. 397. Chang TC, Wentzel EA, Kent OA, Ramachandran K, Mullendore M, Lee KH, Feldmann G, Yamakuchi M, Ferlito M, Lowenstein CJ, Arking DE, Beer MA, Maitra A and Mendell JT (2007). Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol Cell. 26:745-752. 398. He L, He X, Lim LP, de Stanchina E, Xuan Z, Liang Y, Xue W, Zender L, Magnus J, Ridzon D, Jackson AL, Linsley PS, Chen C, Lowe SW, Cleary MA and Hannon GJ (2007). A microRNA component of the p53 tumour suppressor network. Nature. 447:1130-1134. 226

399. Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM, Schepeler T, Orntoft TF, Andersen CL and Dobbelstein M (2008). p53-Responsive micrornas 192 and 215 are capable of inducing cell cycle arrest. Cancer Res. 68:10094-10104. 400. Park SY, Lee JH, Ha M, Nam JW and Kim VN (2009). miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42. Nat Struct Mol Biol. 16:23-29. 401. Ugalde AP, Ramsay AJ, de la Rosa J, Varela I, Marino G, Cadinanos J, Lu J, Freije JM and Lopez-Otin C (2011). Aging and chronic DNA damage response activate a regulatory pathway involving miR-29 and p53. EMBO J. 30:2219- 2232. 402. Hermeking H (2012). MicroRNAs in the p53 network: micromanagement of tumour suppression. Nat Rev Cancer. 12:613-626. 403. Feng Z, Zhang C, Wu R and Hu W (2011). Tumor suppressor p53 meets microRNAs. J Mol Cell Biol. 3:44-50. 404. Ognjanovic S, Martel G, Manivel C, Olivier M, Langer E and Hainaut P (2012). Low Prevalence of TP53 Mutations and MDM2 Amplifications in Pediatric Rhabdomyosarcoma. Sarcoma. 2012:492086. 405. Haines DC, Chattopadhyay S and Ward JM (2001). Pathology of aging B6;129 mice. Toxicol Pathol. 29:653-661. 406. Craig FE and Foon KA (2008). Flow cytometric immunophenotyping for hematologic neoplasms. Blood. 111:3941-3967. 407. Baseggio L, Traverse-Glehen A, Petinataud F, Callet-Bauchu E, Berger F, Ffrench M, Couris CM, Thieblemont C, Morel D, Coiffier B, Salles G and Felman P (2010). CD5 expression identifies a subset of splenic marginal zone lymphomas with higher lymphocytosis: a clinico-pathological, cytogenetic and molecular study of 24 cases. Haematologica. 95:604-612. 408. Jones SN, Roe AE, Donehower LA and Bradley A (1995). Rescue of embryonic lethality in Mdm2-deficient mice by absence of p53. Nature. 378:206-208. 409. Chavez-Reyes A, Parant JM, Amelse LL, de Oca Luna RM, Korsmeyer SJ and Lozano G (2003). Switching mechanisms of cell death in mdm2- and mdm4-null mice by deletion of p53 downstream targets. Cancer Res. 63:8664-8669. 410. Boesten LS, Zadelaar SM, De Clercq S, Francoz S, van Nieuwkoop A, Biessen EA, Hofmann F, Feil S, Feil R, Jochemsen AG, Zurcher C, Havekes LM, van Vlijmen BJ and Marine JC (2006). Mdm2, but not Mdm4, protects terminally differentiated smooth muscle cells from p53-mediated caspase-3-independent cell death. Cell death and differentiation. 13:2089-2098. 411. Grier JD, Xiong S, Elizondo-Fraire AC, Parant JM and Lozano G (2006). Tissue- specific differences of p53 inhibition by Mdm2 and Mdm4. Mol Cell Biol. 26:192- 198. 412. Migliorini D, Lazzerini Denchi E, Danovi D, Jochemsen A, Capillo M, Gobbi A, Helin K, Pelicci PG and Marine JC (2002). Mdm4 (Mdmx) regulates p53-induced growth arrest and neuronal cell death during early embryonic mouse development. Mol Cell Biol. 22:5527-5538. 413. Uldrijan S, Pannekoek WJ and Vousden KH (2007). An essential function of the extreme C-terminus of MDM2 can be provided by MDMX. EMBO J. 26:102-112. 414. Marine JC, Francoz S, Maetens M, Wahl G, Toledo F and Lozano G (2006). Keeping p53 in check: essential and synergistic functions of Mdm2 and Mdm4. Cell death and differentiation. 13:927-934.

227

415. Xiong S, Van Pelt CS, Elizondo-Fraire AC, Liu G and Lozano G (2006). Synergistic roles of Mdm2 and Mdm4 for p53 inhibition in central nervous system development. Proc Natl Acad Sci U S A. 103:3226-3231. 416. Steinman HA, Hoover KM, Keeler ML, Sands AT and Jones SN (2005). Rescue of Mdm4-deficient mice by Mdm2 reveals functional overlap of Mdm2 and Mdm4 in development. Oncogene. 24:7935-7940. 417. Jin Y, Lee H, Zeng SX, Dai MS and Lu H (2003). MDM2 promotes p21waf1/cip1 proteasomal turnover independently of ubiquitylation. EMBO J. 22:6365-6377. 418. Zhang Z, Wang H, Li M, Agrawal S, Chen X and Zhang R (2004). MDM2 is a negative regulator of p21WAF1/CIP1, independent of p53. J Biol Chem. 279:16000-16006. 419. Jin Y, Zeng SX, Sun XX, Lee H, Blattner C, Xiao Z and Lu H (2008). MDMX promotes proteasomal turnover of p21 at G1 and early S phases independently of, but in cooperation with, MDM2. Mol Cell Biol. 28:1218-1229. 420. Lundberg AS and Weinberg RA (1998). Functional inactivation of the retinoblastoma protein requires sequential modification by at least two distinct cyclin-cdk complexes. Mol Cell Biol. 18:753-761. 421. Mandke P, Wyatt N, Fraser J, Bates B, Berberich SJ and Markey MP (2012). MicroRNA-34a modulates MDM4 expression via a target site in the open reading frame. PLoS One. 7:e42034. 422. Okada N, Lin CP, Ribeiro MC, Biton A, Lai G, He X, Bu P, Vogel H, Jablons DM, Keller AC, Wilkinson JE, He B, Speed TP and He L (2014). A positive feedback between p53 and miR-34 miRNAs mediates tumor suppression. Genes Dev. 28:438-450. 423. Xiao ZX, Chen J, Levine AJ, Modjtahedi N, Xing J, Sellers WR and Livingston DM (1995). Interaction between the retinoblastoma protein and the oncoprotein MDM2. Nature. 375:694-698. 424. Lundgren K, Montes de Oca Luna R, McNeill YB, Emerick EP, Spencer B, Barfield CR, Lozano G, Rosenberg MP and Finlay CA (1997). Targeted expression of MDM2 uncouples S phase from mitosis and inhibits mammary gland development independent of p53. Genes Dev. 11:714-725. 425. McDonnell TJ, Montes de Oca Luna R, Cho S, Amelse LL, Chavez-Reyes A and Lozano G (1999). Loss of one but not two mdm2 null alleles alters the tumour spectrum in p53 null mice. J Pathol. 188:322-328. 426. Yang JY, Zong CS, Xia W, Yamaguchi H, Ding Q, Xie X, Lang JY, Lai CC, Chang CJ, Huang WC, Huang H, Kuo HP, Lee DF, Li LY, Lien HC, Cheng X, Chang KJ, Hsiao CD, Tsai FJ, Tsai CH, Sahin AA, Muller WJ, Mills GB, Yu D, Hortobagyi GN and Hung MC (2008). ERK promotes tumorigenesis by inhibiting FOXO3a via MDM2-mediated degradation. Nat Cell Biol. 10:138-148. 427. Zhou S, Gu L, He J, Zhang H and Zhou M (2011). MDM2 regulates vascular endothelial growth factor mRNA stabilization in hypoxia. Mol Cell Biol. 31:4928- 4937. 428. Yang JY, Zong CS, Xia W, Wei Y, Ali-Seyed M, Li Z, Broglio K, Berry DA and Hung MC (2006). MDM2 promotes cell motility and invasiveness by regulating E- cadherin degradation. Mol Cell Biol. 26:7269-7282. 429. Lin HK, Wang L, Hu YC, Altuwaijri S and Chang C (2002). Phosphorylation- dependent ubiquitylation and degradation of androgen receptor by Akt require Mdm2 E3 ligase. EMBO J. 21:4037-4048. 228

430. Tang YA, Lin RK, Tsai YT, Hsu HS, Yang YC, Chen CY and Wang YC (2012). MDM2 overexpression deregulates the transcriptional control of RB/E2F leading to DNA methyltransferase 3A overexpression in lung cancer. Clin Cancer Res. 18:4325-4333. 431. Kadakia M, Brown TL, McGorry MM and Berberich SJ (2002). MdmX inhibits Smad transactivation. Oncogene. 21:8776-8785. 432. Wunderlich M, Ghosh M, Weghorst K and Berberich SJ (2004). MdmX represses E2F1 transactivation. Cell Cycle. 3:472-478. 433. Greiner TC, Moynihan MJ, Chan WC, Lytle DM, Pedersen A, Anderson JR and Weisenburger DD (1996). p53 mutations in mantle cell lymphoma are associated with variant cytology and predict a poor prognosis. Blood. 87:4302-4310. 434. Lossos IS and Levy R (2003). Higher grade transformation of follicular lymphoma: phenotypic tumor progression associated with diverse genetic lesions. Semin Cancer Biol. 13:191-202. 435. Lossos IS (2005). Molecular pathogenesis of diffuse large B-cell lymphoma. J Clin Oncol. 23:6351-6357. 436. Lindstrom MS and Wiman KG (2002). Role of genetic and epigenetic changes in Burkitt lymphoma. Semin Cancer Biol. 12:381-387. 437. Malkin D, Li FP, Strong LC, Fraumeni JF, Jr., Nelson CE, Kim DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA and et al. (1990). Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science. 250:1233-1238. 438. Srivastava S, Zou ZQ, Pirollo K, Blattner W and Chang EH (1990). Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature. 348:747-749. 439. Newcomb EW (1995). P53 gene mutations in lymphoid diseases and their possible relevance to drug resistance. Leuk Lymphoma. 17:211-221. 440. Xu-Monette ZY, Medeiros LJ, Li Y, Orlowski RZ, Andreeff M, Bueso-Ramos CE, Greiner TC, McDonnell TJ and Young KH (2012). Dysfunction of the TP53 tumor suppressor gene in lymphoid malignancies. Blood. 119:3668-3683. 441. Sewastianik T, Prochorec-Sobieszek M, Chapuy B and Juszczynski P (2014). MYC deregulation in lymphoid tumors: molecular mechanisms, clinical consequences and therapeutic implications. Biochim Biophys Acta. 1846:457- 467. 442. Ott G, Rosenwald A and Campo E (2013). Understanding MYC-driven aggressive B-cell lymphomas: pathogenesis and classification. Blood. 122:3884- 3891. 443. Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo RC and Croce CM (1982). Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci U S A. 79:7824-7827. 444. Ladanyi M, Offit K, Jhanwar SC, Filippa DA and Chaganti RS (1991). MYC rearrangement and translocations involving band 8q24 in diffuse large cell lymphomas. Blood. 77:1057-1063. 445. Phan RT and Dalla-Favera R (2004). The BCL6 proto-oncogene suppresses p53 expression in germinal-centre B cells. Nature. 432:635-639. 446. Shaffer AL, Yu X, He Y, Boldrick J, Chan EP and Staudt LM (2000). BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity. 13:199-212. 229

447. Lai R, Arber DA, Chang KL, Wilson CS and Weiss LM (1998). Frequency of bcl-2 expression in non-Hodgkin's lymphoma: a study of 778 cases with comparison of marginal zone lymphoma and monocytoid B-cell hyperplasia. Mod Pathol. 11:864-869. 448. Iqbal J, Neppalli VT, Wright G, Dave BJ, Horsman DE, Rosenwald A, Lynch J, Hans CP, Weisenburger DD, Greiner TC, Gascoyne RD, Campo E, Ott G, Muller-Hermelink HK, Delabie J, Jaffe ES, Grogan TM, Connors JM, Vose JM, Armitage JO, Staudt LM and Chan WC (2006). BCL2 expression is a prognostic marker for the activated B-cell-like type of diffuse large B-cell lymphoma. J Clin Oncol. 24:961-968. 449. Johnson NA, Savage KJ, Ludkovski O, Ben-Neriah S, Woods R, Steidl C, Dyer MJ, Siebert R, Kuruvilla J, Klasa R, Connors JM, Gascoyne RD and Horsman DE (2009). Lymphomas with concurrent BCL2 and MYC translocations: the critical factors associated with survival. Blood. 114:2273-2279. 450. Weiss LM, Warnke RA, Sklar J and Cleary ML (1987). Molecular analysis of the t(14;18) chromosomal translocation in malignant lymphomas. N Engl J Med. 317:1185-1189. 451. Gladkikh A, Potashnikova D, Korneva E, Khudoleeva O and Vorobjev I (2010). Cyclin D1 expression in B-cell lymphomas. Exp Hematol. 38:1047-1057. 452. Yatabe Y, Suzuki R, Tobinai K, Matsuno Y, Ichinohasama R, Okamoto M, Yamaguchi M, Tamaru J, Uike N, Hashimoto Y, Morishima Y, Suchi T, Seto M and Nakamura S (2000). Significance of cyclin D1 overexpression for the diagnosis of mantle cell lymphoma: a clinicopathologic comparison of cyclin D1- positive MCL and cyclin D1-negative MCL-like B-cell lymphoma. Blood. 95:2253- 2261. 453. Henry CJ, Marusyk A and DeGregori J (2011). Aging-associated changes in hematopoiesis and leukemogenesis: what's the connection? Aging (Albany NY). 3:643-656. 454. Kim M, Moon HB and Spangrude GJ (2003). Major age-related changes of mouse hematopoietic stem/progenitor cells. Ann N Y Acad Sci. 996:195-208. 455. Donehower LA (1996). The p53-deficient mouse: a model for basic and applied cancer studies. Semin Cancer Biol. 7:269-278. 456. O'Brien D, Jacob AG, Qualman SJ and Chandler DS (2012). Advances in pediatric rhabdomyosarcoma characterization and disease model development. Histol Histopathol. 27:13-22. 457. Parham DM (2001). Pathologic classification of rhabdomyosarcomas and correlations with molecular studies. Mod Pathol. 14:506-514. 458. Ruymann FB and Grovas AC (2000). Progress in the diagnosis and treatment of rhabdomyosarcoma and related soft tissue sarcomas. Cancer Invest. 18:223- 241. 459. Maurer HM (1975). Recent advances in management of childhood rhabdomyosarcoma. Va Med Mon (1918). 102:476-479. 460. Breitfeld PP and Meyer WH (2005). Rhabdomyosarcoma: new windows of opportunity. Oncologist. 10:518-527. 461. Raney RB, Maurer HM, Anderson JR, Andrassy RJ, Donaldson SS, Qualman SJ, Wharam MD, Wiener ES and Crist WM (2001). The Intergroup Rhabdomyosarcoma Study Group (IRSG): Major Lessons From the IRS-I

230

Through IRS-IV Studies as Background for the Current IRS-V Treatment Protocols. Sarcoma. 5:9-15. 462. Raney RB, Anderson JR, Barr FG, Donaldson SS, Pappo AS, Qualman SJ, Wiener ES, Maurer HM and Crist WM (2001). Rhabdomyosarcoma and undifferentiated sarcoma in the first two decades of life: a selective review of intergroup rhabdomyosarcoma study group experience and rationale for Intergroup Rhabdomyosarcoma Study V. J Pediatr Hematol Oncol. 23:215-220. 463. Steenman M, Westerveld A and Mannens M (2000). Genetics of Beckwith- Wiedemann syndrome-associated tumors: common genetic pathways. Genes Chromosomes Cancer. 28:1-13. 464. Matsumoto T, Kinoshita E, Maeda H, Niikawa N, Kurosaki N, Harada N, Yun K, Sawai T, Aoki S, Kondoh T and et al. (1994). Molecular analysis of a patient with Beckwith-Wiedemann syndrome, rhabdomyosarcoma and renal cell carcinoma. Jpn J Hum Genet. 39:225-234. 465. Smith AC, Squire JA, Thorner P, Zielenska M, Shuman C, Grant R, Chitayat D, Nishikawa JL and Weksberg R (2001). Association of alveolar rhabdomyosarcoma with the Beckwith-Wiedemann syndrome. Pediatr Dev Pathol. 4:550-558. 466. Sung L, Anderson JR, Arndt C, Raney RB, Meyer WH and Pappo AS (2004). Neurofibromatosis in children with Rhabdomyosarcoma: a report from the Intergroup Rhabdomyosarcoma study IV. J Pediatr. 144:666-668. 467. Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher FJ, 3rd, Emanuel BS, Rovera G and Barr FG (1993). Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet. 5:230-235. 468. Barr FG, Galili N, Holick J, Biegel JA, Rovera G and Emanuel BS (1993). Rearrangement of the PAX3 paired box gene in the paediatric solid tumour alveolar rhabdomyosarcoma. Nat Genet. 3:113-117. 469. Davis RJ, D'Cruz CM, Lovell MA, Biegel JA and Barr FG (1994). Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer Res. 54:2869-2872. 470. Lam PY, Sublett JE, Hollenbach AD and Roussel MF (1999). The oncogenic potential of the Pax3-FKHR fusion protein requires the Pax3 homeodomain recognition helix but not the Pax3 paired-box DNA binding domain. Mol Cell Biol. 19:594-601. 471. Scheidler S, Fredericks WJ, Rauscher FJ, 3rd, Barr FG and Vogt PK (1996). The hybrid PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma transforms fibroblasts in culture. Proc Natl Acad Sci U S A. 93:9805-9809. 472. Anderson J, Ramsay A, Gould S and Pritchard-Jones K (2001). PAX3-FKHR induces morphological change and enhances cellular proliferation and invasion in rhabdomyosarcoma. Am J Pathol. 159:1089-1096. 473. Bennicelli JL, Fredericks WJ, Wilson RB, Rauscher FJ, 3rd and Barr FG (1995). Wild type PAX3 protein and the PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma contain potent, structurally distinct transcriptional activation domains. Oncogene. 11:119-130. 474. Bennicelli JL, Advani S, Schafer BW and Barr FG (1999). PAX3 and PAX7 exhibit conserved cis-acting transcription repression domains and utilize a common gain of function mechanism in alveolar rhabdomyosarcoma. Oncogene. 18:4348-4356. 231

475. Fredericks WJ, Galili N, Mukhopadhyay S, Rovera G, Bennicelli J, Barr FG and Rauscher FJ, 3rd (1995). The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol Cell Biol. 15:1522-1535. 476. Davis RJ and Barr FG (1997). Fusion genes resulting from alternative chromosomal translocations are overexpressed by gene-specific mechanisms in alveolar rhabdomyosarcoma. Proc Natl Acad Sci U S A. 94:8047-8051. 477. Bennicelli JL, Edwards RH and Barr FG (1996). Mechanism for transcriptional gain of function resulting from chromosomal translocation in alveolar rhabdomyosarcoma. Proc Natl Acad Sci U S A. 93:5455-5459. 478. Barr FG, Nauta LE, Davis RJ, Schafer BW, Nycum LM and Biegel JA (1996). In vivo amplification of the PAX3-FKHR and PAX7-FKHR fusion genes in alveolar rhabdomyosarcoma. Hum Mol Genet. 5:15-21. 479. Xia SJ, Pressey JG and Barr FG (2002). Molecular pathogenesis of rhabdomyosarcoma. Cancer Biol Ther. 1:97-104. 480. Margue CM, Bernasconi M, Barr FG and Schafer BW (2000). Transcriptional modulation of the anti-apoptotic protein BCL-XL by the paired box transcription factors PAX3 and PAX3/FKHR. Oncogene. 19:2921-2929. 481. Kikuchi K, Tsuchiya K, Otabe O, Gotoh T, Tamura S, Katsumi Y, Yagyu S, Tsubai-Shimizu S, Miyachi M, Iehara T and Hosoi H (2008). Effects of PAX3- FKHR on malignant phenotypes in alveolar rhabdomyosarcoma. Biochem Biophys Res Commun. 365:568-574. 482. Keller C, Hansen MS, Coffin CM and Capecchi MR (2004). Pax3:Fkhr interferes with embryonic Pax3 and Pax7 function: implications for alveolar rhabdomyosarcoma cell of origin. Genes Dev. 18:2608-2613. 483. Keller C and Guttridge DC (2013). Mechanisms of impaired differentiation in rhabdomyosarcoma. FEBS J. 280:4323-4334. 484. Hachitanda Y, Toyoshima S, Akazawa K and Tsuneyoshi M (1998). N-myc gene amplification in rhabdomyosarcoma detected by fluorescence in situ hybridization: its correlation with histologic features. Mod Pathol. 11:1222-1227. 485. Minniti CP, Tsokos M, Newton WA, Jr. and Helman LJ (1994). Specific expression of insulin-like growth factor-II in rhabdomyosarcoma tumor cells. Am J Clin Pathol. 101:198-203. 486. Wang H, Garzon R, Sun H, Ladner KJ, Singh R, Dahlman J, Cheng A, Hall BM, Qualman SJ, Chandler DS, Croce CM and Guttridge DC (2008). NF-kappaB- YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. Cancer Cell. 14:369-381. 487. Durbin AD, Somers GR, Forrester M, Pienkowska M, Hannigan GE and Malkin D (2009). JNK1 determines the oncogenic or tumor-suppressive activity of the integrin-linked kinase in human rhabdomyosarcoma. J Clin Invest. 119:1558- 1570. 488. Tostar U, Malm CJ, Meis-Kindblom JM, Kindblom LG, Toftgard R and Unden AB (2006). Deregulation of the hedgehog signalling pathway: a possible role for the PTCH and SUFU genes in human rhabdomyoma and rhabdomyosarcoma development. J Pathol. 208:17-25. 489. Hatley ME, Tang W, Garcia MR, Finkelstein D, Millay DP, Liu N, Graff J, Galindo RL and Olson EN (2012). A mouse model of rhabdomyosarcoma originating from the adipocyte lineage. Cancer Cell. 22:536-546. 232

490. Makawita S, Ho M, Durbin AD, Thorner PS, Malkin D and Somers GR (2009). Expression of insulin-like growth factor pathway proteins in rhabdomyosarcoma: IGF-2 expression is associated with translocation-negative tumors. Pediatr Dev Pathol. 12:127-135. 491. Lagutina I, Conway SJ, Sublett J and Grosveld GC (2002). Pax3-FKHR knock-in mice show developmental aberrations but do not develop tumors. Mol Cell Biol. 22:7204-7216. 492. Relaix F, Polimeni M, Rocancourt D, Ponzetto C, Schafer BW and Buckingham M (2003). The transcriptional activator PAX3-FKHR rescues the defects of Pax3 mutant mice but induces a myogenic gain-of-function phenotype with ligand- independent activation of Met signaling in vivo. Genes Dev. 17:2950-2965. 493. Keller C, Arenkiel BR, Coffin CM, El-Bardeesy N, DePinho RA and Capecchi MR (2004). Alveolar rhabdomyosarcomas in conditional Pax3:Fkhr mice: cooperativity of Ink4a/ARF and Trp53 loss of function. Genes Dev. 18:2614- 2626. 494. Galindo RL, Allport JA and Olson EN (2006). A Drosophila model of the rhabdomyosarcoma initiator PAX7-FKHR. Proc Natl Acad Sci U S A. 103:13439- 13444. 495. Nishijo K, Chen QR, Zhang L, McCleish AT, Rodriguez A, Cho MJ, Prajapati SI, Gelfond JA, Chisholm GB, Michalek JE, Aronow BJ, Barr FG, Randall RL, Ladanyi M, Qualman SJ, Rubin BP, LeGallo RD, Wang C, Khan J and Keller C (2009). Credentialing a preclinical mouse model of alveolar rhabdomyosarcoma. Cancer Res. 69:2902-2911. 496. Nanni P, Nicoletti G, De Giovanni C, Croci S, Astolfi A, Landuzzi L, Di Carlo E, Iezzi M, Musiani P and Lollini PL (2003). Development of rhabdomyosarcoma in HER-2/neu transgenic p53 mutant mice. Cancer Res. 63:2728-2732. 497. Tsumura H, Yoshida T, Saito H, Imanaka-Yoshida K and Suzuki N (2006). Cooperation of oncogenic K-ras and p53 deficiency in pleomorphic rhabdomyosarcoma development in adult mice. Oncogene. 25:7673-7679. 498. Doyle B, Morton JP, Delaney DW, Ridgway RA, Wilkins JA and Sansom OJ (2010). p53 mutation and loss have different effects on tumourigenesis in a novel mouse model of pleomorphic rhabdomyosarcoma. J Pathol. 222:129-137. 499. Sharp R, Recio JA, Jhappan C, Otsuka T, Liu S, Yu Y, Liu W, Anver M, Navid F, Helman LJ, DePinho RA and Merlino G (2002). Synergism between INK4a/ARF inactivation and aberrant HGF/SF signaling in rhabdomyosarcomagenesis. Nat Med. 8:1276-1280. 500. Fleischmann A, Jochum W, Eferl R, Witowsky J and Wagner EF (2003). Rhabdomyosarcoma development in mice lacking Trp53 and Fos: tumor suppression by the Fos protooncogene. Cancer Cell. 4:477-482. 501. Chamberlain JS, Metzger J, Reyes M, Townsend D and Faulkner JA (2007). Dystrophin-deficient mdx mice display a reduced life span and are susceptible to spontaneous rhabdomyosarcoma. FASEB J. 21:2195-2204. 502. Fernandez K, Serinagaoglu Y, Hammond S, Martin LT and Martin PT (2010). Mice lacking dystrophin or alpha sarcoglycan spontaneously develop embryonal rhabdomyosarcoma with cancer-associated p53 mutations and alternatively spliced or mutant Mdm2 transcripts. Am J Pathol. 176:416-434. 503. Kobbert C, Mollmann C, Schafers M, Hermann S, Baba HA, Hoffmeier A, Breithardt G, Scheld HH, Weissen-Plenz G and Sindermann JR (2008). 233

Transgenic model of cardiac rhabdomyosarcoma formation. J Thorac Cardiovasc Surg. 136:1178-1186. 504. Mao J, Ligon KL, Rakhlin EY, Thayer SP, Bronson RT, Rowitch D and McMahon AP (2006). A novel somatic mouse model to survey tumorigenic potential applied to the Hedgehog pathway. Cancer Res. 66:10171-10178. 505. Langenau DM, Keefe MD, Storer NY, Guyon JR, Kutok JL, Le X, Goessling W, Neuberg DS, Kunkel LM and Zon LI (2007). Effects of RAS on the genesis of embryonal rhabdomyosarcoma. Genes Dev. 21:1382-1395. 506. Houghton PJ, Morton CL, Tucker C, Payne D, Favours E, Cole C, Gorlick R, Kolb EA, Zhang W, Lock R, Carol H, Tajbakhsh M, Reynolds CP, Maris JM, Courtright J, Keir ST, Friedman HS, Stopford C, Zeidner J, Wu J, Liu T, Billups CA, Khan J, Ansher S, Zhang J and Smith MA (2007). The pediatric preclinical testing program: description of models and early testing results. Pediatr Blood Cancer. 49:928-940. 507. Neale G, Su X, Morton CL, Phelps D, Gorlick R, Lock RB, Reynolds CP, Maris JM, Friedman HS, Dome J, Khoury J, Triche TJ, Seeger RC, Gilbertson R, Khan J, Smith MA and Houghton PJ (2008). Molecular characterization of the pediatric preclinical testing panel. Clin Cancer Res. 14:4572-4583. 508. Ognjanovic S, Olivier M, Bergemann TL and Hainaut P (2012). Sarcomas in TP53 germline mutation carriers: a review of the IARC TP53 database. Cancer. 118:1387-1396. 509. Taylor AC, Shu L, Danks MK, Poquette CA, Shetty S, Thayer MJ, Houghton PJ and Harris LC (2000). P53 mutation and MDM2 amplification frequency in pediatric rhabdomyosarcoma tumors and cell lines. Med Pediatr Oncol. 35:96- 103. 510. Takahashi Y, Oda Y, Kawaguchi K, Tamiya S, Yamamoto H, Suita S and Tsuneyoshi M (2004). Altered expression and molecular abnormalities of cell- cycle-regulatory proteins in rhabdomyosarcoma. Mod Pathol. 17:660-669. 511. Lenos K, Grawenda AM, Lodder K, Kuijjer ML, Teunisse AF, Repapi E, Grochola LF, Bartel F, Hogendoorn PC, Wuerl P, Taubert H, Cleton-Jansen AM, Bond GL and Jochemsen AG (2012). Alternate splicing of the p53 inhibitor HDMX offers a superior prognostic biomarker than p53 mutation in human cancer. Cancer Res. 72:4074-4084. 512. Lobe CG, Koop KE, Kreppner W, Lomeli H, Gertsenstein M and Nagy A (1999). Z/AP, a double reporter for cre-mediated recombination. Dev Biol. 208:281-292. 513. Ke N, Albers A, Claassen G, Yu DH, Chatterton JE, Hu X, Meyhack B, Wong- Staal F and Li QX (2004). One-week 96-well soft agar growth assay for cancer target validation. Biotechniques. 36:826-828, 830, 832-823. 514. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, van der Valk M and Berns A (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet. 29:418-425. 515. Dearth LR, Qian H, Wang T, Baroni TE, Zeng J, Chen SW, Yi SY and Brachmann RK (2007). Inactive full-length p53 mutants lacking dominant wildtype p53 inhibition highlight loss of heterozygosity as an important aspect of p53 status in human cancers. Carcinogenesis. 28:289-298. 516. Sdek P, Ying H, Zheng H, Margulis A, Tang X, Tian K and Xiao ZX (2004). The central acidic domain of MDM2 is critical in inhibition of retinoblastoma-mediated suppression of E2F and cell growth. J Biol Chem. 279:53317-53322. 234

517. Anderson MJ, Shelton GD, Cavenee WK and Arden KC (2001). Embryonic expression of the tumor-associated PAX3-FKHR fusion protein interferes with the developmental functions of Pax3. Proc Natl Acad Sci U S A. 98:1589-1594. 518. Miniou P, Tiziano D, Frugier T, Roblot N, Le Meur M and Melki J (1999). Gene targeting restricted to mouse striated muscle lineage. Nucleic Acids Res. 27:e27. 519. Gu L, Findley HW and Zhou M (2002). MDM2 induces NF-kappaB/p65 expression transcriptionally through Sp1-binding sites: a novel, p53-independent role of MDM2 in doxorubicin resistance in acute lymphoblastic leukemia. Blood. 99:3367-3375. 520. Leach FS, Tokino T, Meltzer P, Burrell M, Oliner JD, Smith S, Hill DE, Sidransky D, Kinzler KW and Vogelstein B (1993). p53 Mutation and MDM2 amplification in human soft tissue sarcomas. Cancer Res. 53:2231-2234. 521. Reifenberger G, Liu L, Ichimura K, Schmidt EE and Collins VP (1993). Amplification and overexpression of the MDM2 gene in a subset of human malignant gliomas without p53 mutations. Cancer Res. 53:2736-2739. 522. Allende-Vega N, Dayal S, Agarwala U, Sparks A, Bourdon JC and Saville MK (2012). p53 is activated in response to disruption of the pre-mRNA splicing machinery. Oncogene. 523. Zhang J and Chen QM (2013). Far upstream element binding protein 1: a commander of transcription, translation and beyond. Oncogene. 32:2907-2916. 524. Zubaidah RM, Tan GS, Tan SB, Lim SG, Lin Q and Chung MC (2008). 2-D DIGE profiling of hepatocellular carcinoma tissues identified isoforms of far upstream binding protein (FUBP) as novel candidates in liver carcinogenesis. Proteomics. 8:5086-5096. 525. Klink B, Miletic H, Stieber D, Huszthy PC, Campos Valenzuela JA, Balss J, Wang J, Schubert M, Sakariassen PO, Sundstrom T, Torsvik A, Aarhus M, Mahesparan R, von Deimling A, Kaderali L, Niclou SP, Schrock E, Bjerkvig R and Nigro JM (2013). A novel, diffusely infiltrative xenograft model of human anaplastic oligodendroglioma with mutations in FUBP1, CIC, and IDH1. PLoS One. 8:e59773. 526. Komotar RJ, Starke RM, Sisti MB and Connolly ES (2012). CIC and FUBP1 mutations in oligodendroglioma. Neurosurgery. 70:N22-23. 527. Nilsson JA and Cleveland JL (2003). Myc pathways provoking cell suicide and cancer. Oncogene. 22:9007-9021. 528. Hoffman B and Liebermann DA (2008). Apoptotic signaling by c-MYC. Oncogene. 27:6462-6472. 529. Sachdeva M, Zhu S, Wu F, Wu H, Walia V, Kumar S, Elble R, Watabe K and Mo YY (2009). p53 represses c-Myc through induction of the tumor suppressor miR- 145. Proc Natl Acad Sci U S A. 106:3207-3212. 530. Ho JS, Ma W, Mao DY and Benchimol S (2005). p53-Dependent transcriptional repression of c-myc is required for G1 cell cycle arrest. Mol Cell Biol. 25:7423- 7431. 531. Moll UM and Petrenko O (2003). The MDM2-p53 interaction. Mol Cancer Res. 1:1001-1008. 532. Mercado PA, Ayala YM, Romano M, Buratti E and Baralle FE (2005). Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene. Nucleic Acids Res. 33:6000-6010.

235

533. Xiao X, Wang Z, Jang M and Burge CB (2007). Coevolutionary networks of splicing cis-regulatory elements. Proc Natl Acad Sci U S A. 104:18583-18588. 534. Wu X, Tronholm A, Caceres EF, Tovar-Corona JM, Chen L, Urrutia AO and Hurst LD (2013). Evidence for deep phylogenetic conservation of exonic splice- related constraints: splice-related skews at exonic ends in the brown alga Ectocarpus are common and resemble those seen in humans. Genome Biol Evol. 5:1731-1745. 535. Blencowe BJ (2000). Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem Sci. 25:106-110. 536. Ward AJ and Cooper TA (2010). The pathobiology of splicing. J Pathol. 220:152- 163. 537. Hammond SM and Wood MJ (2011). Genetic therapies for RNA mis-splicing diseases. Trends Genet. 27:196-205. 538. Dias N and Stein CA (2002). Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther. 1:347-355. 539. Spitali P and Aartsma-Rus A (2012). Splice modulating therapies for human disease. Cell. 148:1085-1088. 540. Hua Y, Sahashi K, Hung G, Rigo F, Passini MA, Bennett CF and Krainer AR (2010). Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev. 24:1634-1644. 541. Hua Y, Vickers TA, Okunola HL, Bennett CF and Krainer AR (2008). Antisense masking of an hnRNP A1/A2 intronic splicing silencer corrects SMN2 splicing in transgenic mice. Am J Hum Genet. 82:834-848. 542. van Deutekom JC, Janson AA, Ginjaar IB, Frankhuizen WS, Aartsma-Rus A, Bremmer-Bout M, den Dunnen JT, Koop K, van der Kooi AJ, Goemans NM, de Kimpe SJ, Ekhart PF, Venneker EH, Platenburg GJ, Verschuuren JJ and van Ommen GJ (2007). Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med. 357:2677-2686. 543. Aartsma-Rus A, Janson AA, van Ommen GJ and van Deutekom JC (2007). Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy. BMC Med Genet. 8:43. 544. Kinali M, Arechavala-Gomeza V, Feng L, Cirak S, Hunt D, Adkin C, Guglieri M, Ashton E, Abbs S, Nihoyannopoulos P, Garralda ME, Rutherford M, McCulley C, Popplewell L, Graham IR, Dickson G, Wood MJ, Wells DJ, Wilton SD, Kole R, Straub V, Bushby K, Sewry C, Morgan JE and Muntoni F (2009). Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose- escalation, proof-of-concept study. Lancet Neurol. 8:918-928. 545. Zammarchi F, de Stanchina E, Bournazou E, Supakorndej T, Martires K, Riedel E, Corben AD, Bromberg JF and Cartegni L (2011). Antitumorigenic potential of STAT3 alternative splicing modulation. Proc Natl Acad Sci U S A. 108:17779- 17784. 546. Taylor JK, Zhang QQ, Wyatt JR and Dean NM (1999). Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat Biotechnol. 17:1097-1100. 547. Mercatante DR, Mohler JL and Kole R (2002). Cellular response to an antisense- mediated shift of Bcl-x pre-mRNA splicing and antineoplastic agents. J Biol Chem. 277:49374-49382. 236

548. Bruno IG, Jin W and Cote GJ (2004). Correction of aberrant FGFR1 alternative RNA splicing through targeting of intronic regulatory elements. Hum Mol Genet. 13:2409-2420. 549. Kemaladewi DU, Pasteuning S, van der Meulen JW, van Heiningen SH, van Ommen GJ, Ten Dijke P, Aartsma-Rus A, t Hoen PA and Hoogaars WM (2014). Targeting TGF-beta Signaling by Antisense Oligonucleotide-mediated Knockdown of TGF-beta Type I Receptor. Mol Ther Nucleic Acids. 3:e156. 550. Incitti T, De Angelis FG, Cazzella V, Sthandier O, Pinnaro C, Legnini I and Bozzoni I (2010). Exon skipping and duchenne muscular dystrophy therapy: selection of the most active U1 snRNA antisense able to induce dystrophin exon 51 skipping. Mol Ther. 18:1675-1682. 551. Skordis LA, Dunckley MG, Yue B, Eperon IC and Muntoni F (2003). Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci U S A. 100:4114-4119. 552. Mansfield SG, Chao H and Walsh CE (2004). RNA repair using spliceosome- mediated RNA trans-splicing. Trends Mol Med. 10:263-268. 553. Coady TH and Lorson CL (2010). Trans-splicing-mediated improvement in a severe mouse model of spinal muscular atrophy. J Neurosci. 30:126-130. 554. Bi L, Lawler AM, Antonarakis SE, High KA, Gearhart JD and Kazazian HH, Jr. (1995). Targeted disruption of the mouse factor VIII gene produces a model of haemophilia A. Nat Genet. 10:119-121. 555. Bonnal S, Vigevani L and Valcarcel J (2012). The spliceosome as a target of novel antitumour drugs. Nat Rev Drug Discov. 11:847-859. 556. Berg MG, Wan L, Younis I, Diem MD, Soo M, Wang C and Dreyfuss G (2012). A quantitative high-throughput in vitro splicing assay identifies inhibitors of spliceosome catalysis. Mol Cell Biol. 32:1271-1283. 557. Quidville V, Alsafadi S, Goubar A, Commo F, Scott V, Pioche-Durieu C, Girault I, Baconnais S, Le Cam E, Lazar V, Delaloge S, Saghatchian M, Pautier P, Morice P, Dessen P, Vagner S and Andre F (2013). Targeting the deregulated spliceosome core machinery in cancer cells triggers mTOR blockade and autophagy. Cancer Res. 73:2247-2258. 558. Kaida D, Motoyoshi H, Tashiro E, Nojima T, Hagiwara M, Ishigami K, Watanabe H, Kitahara T, Yoshida T, Nakajima H, Tani T, Horinouchi S and Yoshida M (2007). Spliceostatin A targets SF3b and inhibits both splicing and nuclear retention of pre-mRNA. Nat Chem Biol. 3:576-583.

237