DOCSLIB.ORG

Molecular Evidence for the Systematic Position of <I>Urocynchramus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Evidence for the Systematic Position of <I>Urocynchramus July2000] ShortCommunications 787 The Auk 117(3):787-791, 2000 Molecular Evidencefor the SystematicPosition of Urocynchramuspylzowi JEFFG. Gr•oTIq• Departmentof Ornithology,American Museum of NaturalHistory New York,New York10024, USA Urocynchramuspylzowi, known variously as Prze- Groth1998). Paynter (in Peters1968) doubted the in- walski's Rosefinch,Pink-tailed Rosefinch, and Pink- clusionof Urocynchramuswith carduelinesbecause tailed Bunting,is a finch-likebird of uncertainsys- of its ten-primariedcondition and becausethe red tematic affinities that is endemic to the mountains of colorationin its tail setit apartfrom rosefinches.The westernChina. In many linear classifications(e.g. ten-primariedstate prompted at least one author Sharpe1909, Vaurie 1959, Peters 1968, Morony et al. (Domaniewski1918) to arguefor classifyingthe bird 1975),it is listed next to the Long-tailedRosefinch in its own family,the Urocynchramidae. (Uragussibiricus) in the Carduelinae,to which it is PlacingUrocynchramus among other oscinefami- similar in size and severalplumage characters. Uro- lies hasbeen frustrated by the absenceof both skel- cynchramushas a muchthinner bill than Uragus,but etal and fluid-preservedspecimens of this bird. In- both specieshave disproportionately long tails com- formation on basic life-history attributes such as paredwith the restof thecardueline finches, and the mating behavior,nest structure,and vocalizations malesare bright pink on thethroat, breast, and belly. generallyis lacking,adding to thedifficulties of pro- Femalesof both speciesare streaked,sparrow-like, ducing convincingarguments for its taxonomicas- and lackthe brightpink coloration.Uragus and Uro- signment.Nevertheless, it is now possibleto extract cynchramusalso are exclusivelyAsiatic and live at DNA from dried museum skins that are decades old; high elevationsnear the centerof speciesdiversity of thesetechniques allow acquisition of numerouschar- rosefinchesin the genusCarpodacus, to which a close actersthat are useful in analyzingsystematic rela- relationshipwith Uragushas never been questioned. tionshipsof problematictaxa when freshbiological The few availableaccounts of its ecologyand behav- materialis not available.A prerequisitefor suchan ior (Przewalski 1876 [recounted in Vaurie 1956], analysisis comparableDNA sequenceinformation Sch•fer1938, B. Kingpers. comm.) state that the hab- from an appropriateset of othertaxa. itat associations,patterns of flight, and posturesof Phylogeneticanalyses of completemitochondrial Urocynchramusare similar to thoseof Uragus. cytochrome-b(cyt b) genesshow a well-supported Despiteits resemblanceto Uragus,Ur'ocynchramus separation between cardueline finches and emberi- frequentlyhas beenclassified as an emberizidbun- zid sparrows(Groth 1998). If Urocynchramusis either ting (Sharpe1888, Dresser 1902, Sibley and Monroe a carduelineor an emberizid,then its cyt-bsequence 1990).Przewalski (1876), who first collectedand de- shouldallow discriminationbetween these two pos- scribedthe bird, notedthe similarityof its bill struc- sibilities.My analysis(Groth 1998) also included a ture to that of buntingsand regarded its songas sim- wide rangeof otheroscine groups, thus providing a ilar to that of the buntingCynchramus (=Emberiza) broadphylogenetic context for placementof Urocyn- schoeniclus.Sushkin (1927) consideredthe external chramus if it is neither a car.dueline nor an emberizid. anatomyand structureof the hornypalette of Uro- Methods.--I extracted DNA from a 1-mm 2 flake of cynchramusto be most like that of buntings.Zusi toe skin from an adult male (American Museum of (1978) found that featuresof its interorbitalseptum Natural History 782951;collected by Ernst Shfiferat were unlike those of cardueline finches, but he could Kham, westernChina, 18 October1934) usingthe neitherconfirm nor rejectits possiblerelationship to methodsof Mundyet al. (1997).The entire cyt-b gene buntings. was amplifiedin five fragmentsusing a combination The most perplexingaspect of Urocynchramusis of 10primers (Table 1) designedfor oscinebirds. Five the condition of its outer primary (P10), which is of the primershad beenused in otherstudies, but I abouttwo-thirds the lengthof P9. Althougha well- obtainedfresh stocksfrom the manufacturer(Op- developedP10 suchas this is characteristicof many eronTechnologies, Inc.) asa precautionagainst con- oscinefamilies, all fringillids and emberizidsare tamination.Further precautionsincluded perform- "nine-primaried"in that P10 is vestigial.Although ing DNA extractionand assemblyof reactiontubes the nine-primariedcondition has been derived often in an isolatedroom away from the main laboratory in oscines,no taxonwithin a nine-primariedgroup using dedicated"ancient DNA" pipettorsand aero- is knownto haveundergone a characterreversal to sol-barrierpipet tips.I usedAmplitaq Gold kits (Ap- secondarilyderive the "ten-primaried"state (see plied Biosystems)according to manufacturers'in- structionsfor amplificationreactions, but theywere scaled down to total volumes of 10 •tL. All kit com- E-mail:[email protected] ponents (except enzyme), water, and disposable 788 ShortCommunications [Auk, Vol. 117 TABLE1. List of primersused for Urocynchramuscy- replicates,with eachreplicate containing five sepa- tochrome-bsequencing. rate heuristic searches with random-taxon addition. I depicteddistance relationships with a neighbor- Primer• Sequenceb joining tree (Saitou and Nei 1987) generatedusing L14851 c CCTACTTAGGATCATTCGCCCT modified genetic distances(third-position transi- L15068 CTAGCCATACACTACACAGCAGA tionseliminated). Trees were rootedusing data from L15410 c TGAGGAGGATTCTCAGTAGACAA four membersof the Corvida(sensu Sibley and Mon- L15656 c CCAAACCTACTACTAGGAGACCCAGA roe 1990). L15848 CCAAACTACGATCAATAACCTTCCG Resultsand discussion.--Severalobservations sug- H15103 TGCCGAGACGTACAATTCGGCTGA H15460 ATCGTAGGCCTCACACTAGTCCAC gestthat the resultingsequence was authenticUro- H15710 • GGCATAGGCGAATAGAAAGTATC cynchramuscyt b and not a contaminant.In experi- H15934 GGCTAGTTGGCCGATGATGATGAA mentsusing DNA from museumskins, all negative H16141 c AACATACCAGCTTTGGGAG control reactions were blank when visualized on EtBr-stainedagarose gels, whereas reactionswith aL andH referto extensionproducts on the light andheavy strands, respectively.Numbers indicate the positionof the 3' baseof theprim- UrocynchramusDNA were positive. Nevertheless, er accordingto the systemused for Gallus(Desjardins and Morais even thoughthe negativecontrol reactions showed 1990). no amplificationproducts, it is possiblethat the ex- b Primers are listed in the 5' to 3' direction. tract from Urocynchramuswas contaminatedwith cPreviously cited by Groth (1998). DNA from another species.If this were the case, "double" sequences,containing ambiguous base plasticswere irradiated with UV light before use. callsfrom a mixture of both Urocynchramusand the Thermocyclingwas donein a Perkin-ElmerAB19600 contaminant,might have resulted for some frag- machine with an initial hold at 94øC for 10 min fol- ments. However, double sequencesdid not occur. lowed by 40 cyclesconsisting of 95øCfor 20 s, 52øC Furthersupport for the authenticityof the sequence for 20 s, and 72øC for 30 s. To test for contamination, was that the five separatetarget DNA fragments, I also assemblednegative control reactionscontain- ranging in size from 277 to 391 bases (excluding ing all componentsexcept Urocynchramus DNA. Re- primer sites),showed no sitesin disagreementwith- actionproducts were then processedfurther and se- in areasof overlap,suggesting that only onesource quencedon an AB1377automated sequencer accord- was responsiblefor all amplification.It would have ing to methodsin Groth (1998). beenhighly unlikelyfor the sameputative contami- I assembledand edited the sequencesusing Se- nant to havebeen amplified cleanly for all five frag- quenchersoftware (Gene Codes).After scoringall mentsto the exclusionof any amplificationfrom the bases,which included the entirecyt-b gene, I added UrocynchramusDNA, which certainlypredominated it to the cyt-b data of 53 other oscines(1,143 base in the extract.Similarly, I doubt that the sequence pairs each;see Groth 1998). This data set included was that of a nuclearpseudogene because it is un- four putatively divergent lineages (genera) of car- likely that all five pairsof primerspreferentially am- dueline finches,one Hawaiian honeycreeper(Hima- plifieda nuclearproduct to theexclusion of themuch tione),five emberizidgenera of which one(Melophus) more abundantmitochondrial cyt b in the DNA ex- is Asiatic,and nine other membersof the "larger" tract.When comparedwith all othercyt-b sequences Emberizidae(as formerly recognized by AOU [1983], I had previouslygenerated, the final presumptive which I refer to as the superfamilyEmberizoidea). Urocynchramussequence was uniqueand highly di- One additionalentire cyt-bsequence, that from fro- vergentfrom all others. zen liver tissue of Uragussibiricus (Russia, Republic Parsimonyanalysis found five equally shorttrees of Buryatia, 55 km W and 30 km S of Ulan-Ude, 16 (length = 2,290; not shown),all of which showed June1993; University of WashingtonBurke Museum monophylyfor both the Fringillidaeand the "em- CDS 4888), was generated using the laboratory berizoids." Not one of the trees linked Urocynchra- methodsof Groth (1998) and added to the data set muswithin or asthe sistergroup of thesetwo clades. for a total of 55 taxa compared.I analyzedthe data Theseresults clearly show that no phylogeneticre- usingboth parsimony-and distance-basedmethods
Load more

Recommended publications
  • Phylogeography of Finches and Sparrows
    In: Animal Genetics ISBN: 978-1-60741-844-3 Editor: Leopold J. Rechi © 2009 Nova Science Publishers, Inc. Chapter 1 PHYLOGEOGRAPHY OF FINCHES AND SPARROWS Antonio Arnaiz-Villena*, Pablo Gomez-Prieto and Valentin Ruiz-del-Valle Department of Immunology, University Complutense, The Madrid Regional Blood Center, Madrid, Spain. ABSTRACT Fringillidae finches form a subfamily of songbirds (Passeriformes), which are presently distributed around the world. This subfamily includes canaries, goldfinches, greenfinches, rosefinches, and grosbeaks, among others. Molecular phylogenies obtained with mitochondrial DNA sequences show that these groups of finches are put together, but with some polytomies that have apparently evolved or radiated in parallel. The time of appearance on Earth of all studied groups is suggested to start after Middle Miocene Epoch, around 10 million years ago. Greenfinches (genus Carduelis) may have originated at Eurasian desert margins coming from Rhodopechys obsoleta (dessert finch) or an extinct pale plumage ancestor; it later acquired green plumage suitable for the greenfinch ecological niche, i.e.: woods. Multicolored Eurasian goldfinch (Carduelis carduelis) has a genetic extant ancestor, the green-feathered Carduelis citrinella (citril finch); this was thought to be a canary on phonotypical bases, but it is now included within goldfinches by our molecular genetics phylograms. Speciation events between citril finch and Eurasian goldfinch are related with the Mediterranean Messinian salinity crisis (5 million years ago). Linurgus olivaceus (oriole finch) is presently thriving in Equatorial Africa and was included in a separate genus (Linurgus) by itself on phenotypical bases. Our phylograms demonstrate that it is and old canary. Proposed genus Acanthis does not exist. Twite and linnet form a separate radiation from redpolls.
    [Show full text]
  • Of Larks, Owls and Unusual Diets and Feeding Habits V
    Of larks, owls and unusual diets and feeding habits V. Santharam Santharam, V. 2008. Of larks, owls and unusual diets and feeding habits. Indian Birds 4 (2): 68–69. V. Santharam, Institute of Bird Studies & Natural History, Rishi Valley Education Centre, Rishi Valley 517352, Chittoor District, Andhra Pradesh, India. Email: [email protected] Mss received on 17th December 2007. A day with the larks the presence of the distinctly long crest, which when flattened, 18th January 2007: Suresh Jones and I were off on waterfowl reached the upper nape. There were at least four birds present counts at some wetlands near Rishi Valley, (Andhra Pradesh, that morning. India). It was a cool and crisp morning with clear skies. After a The last species of the day was the common Ashy-crowned year of rains the wetlands had begun drying up. We knew there Sparrow-Lark Eremopterix grisea, which was noticed in the more would be fewer birds for us to count this year. We were least drier, open country. The prized sighting that morning was an bothered since we were sure to find other interesting birds. albino specimen fluttering about in the stiff breeze like a sheet of I was just telling Suresh that I have, in the past, seen Indian paper (which we mistook it for, initially!). Its plumage, including Eagle-Owls Bubo benghalensis perched on roadside electric posts, the beak, was pinkish white. Its eye appeared darker and there when a dead Indian Eagle-Owl, on the road, drew our attention. was a faint pinkish wash on its breast and tail.
    [Show full text]
  • Natural Epigenetic Variation Within and Among Six Subspecies of the House Sparrow, Passer Domesticus Sepand Riyahi1,*,‡, Roser Vilatersana2,*, Aaron W
    © 2017. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2017) 220, 4016-4023 doi:10.1242/jeb.169268 RESEARCH ARTICLE Natural epigenetic variation within and among six subspecies of the house sparrow, Passer domesticus Sepand Riyahi1,*,‡, Roser Vilatersana2,*, Aaron W. Schrey3, Hassan Ghorbani Node4,5, Mansour Aliabadian4,5 and Juan Carlos Senar1 ABSTRACT methylation is one of several epigenetic processes (such as histone Epigenetic modifications can respond rapidly to environmental modification and chromatin structure) that can influence an ’ changes and can shape phenotypic variation in accordance with individual s phenotype. Many recent studies show the relevance environmental stimuli. One of the most studied epigenetic marks is of DNA methylation in shaping phenotypic variation within an ’ DNA methylation. In the present study, we used the methylation- individual s lifetime (e.g. Herrera et al., 2012), such as the effect of sensitive amplified polymorphism (MSAP) technique to investigate larval diet on the methylation patterns and phenotype of social the natural variation in DNA methylation within and among insects (Kucharski et al., 2008). subspecies of the house sparrow, Passer domesticus. We focused DNA methylation is a crucial process in natural selection on five subspecies from the Middle East because they show great and evolution because it allows organisms to adapt rapidly to variation in many ecological traits and because this region is the environmental fluctuations by modifying phenotypic traits, either probable origin for the house sparrow’s commensal relationship with via phenotypic plasticity or through developmental flexibility humans. We analysed house sparrows from Spain as an outgroup. (Schlichting and Wund, 2014).
    [Show full text]
  • Montifringilla Nivalis
    Report under the Article 12 of the Birds Directive European Environment Agency Period 2008-2012 European Topic Centre on Biological Diversity Montifringilla nivalis Annex I No International action plan No White-winged Snowfinch, Montifringilla nivalis, is a species of passerine bird in the sparrow family found in unvegetated or sparsely vegetated land ecosystems. Montifringilla nivalis has a breeding population size of 16900-29900 pairs and a breeding range size of 122000 square kilometres in the EU27. The breeding population trend in the EU27 is Unknown in the short term and Unknown in the long term. The EU population status for Montifringilla nivalis is Unknown, as the data reported were not sufficient to assess the population status of the species. Page 1 Montifringilla nivalis Report under the Article 12 of the Birds Directive Assessment of status at the European level Breeding Breeding range Winter population Winter Breeding population trend Range trend trend Population population population size area status Short Long Short Long size Short Long term term term term term term 16900 - 29900 p x x 122000 Unknown See the endnotes for more informationi Page 2 Montifringilla nivalis Report under the Article 12 of the Birds Directive Page 3 Montifringilla nivalis Report under the Article 12 of the Birds Directive Trends at the Member State level Breeding Breeding range Winter population Winter % in Breeding population trend Range trend trend MS/Ter. population EU27 population size area Short Long Short Long size Short Long term term term term term term AT 24.2 6000 - 11000 p 0 x 36377 0 0 DE 2.6 140 - 270 p 0 0 1132 0 0 ES 11.8 4500 - 6000 p x 0 11136 x 0 FR 15.3 2000 - 4000 p x x 22400 x 0 GR IT 45.1 4000 - 8000 p x x 50400 + - SI 0.9 100 - 300 p x x 666 0 0 See the endnotes for more informationii Page 4 Montifringilla nivalis Report under the Article 12 of the Birds Directive Page 5 Montifringilla nivalis Report under the Article 12 of the Birds Directive Short-term winter population trend was not reported for this species.
    [Show full text]
  • European Red List of Birds
    European Red List of Birds Compiled by BirdLife International Published by the European Commission. opinion whatsoever on the part of the European Commission or BirdLife International concerning the legal status of any country, Citation: Publications of the European Communities. Design and layout by: Imre Sebestyén jr. / UNITgraphics.com Printed by: Pannónia Nyomda Picture credits on cover page: Fratercula arctica to continue into the future. © Ondrej Pelánek All photographs used in this publication remain the property of the original copyright holder (see individual captions for details). Photographs should not be reproduced or used in other contexts without written permission from the copyright holder. Available from: to your questions about the European Union Freephone number (*): 00 800 6 7 8 9 10 11 (*) Certain mobile telephone operators do not allow access to 00 800 numbers or these calls may be billed Published by the European Commission. A great deal of additional information on the European Union is available on the Internet. It can be accessed through the Europa server (http://europa.eu). Cataloguing data can be found at the end of this publication. ISBN: 978-92-79-47450-7 DOI: 10.2779/975810 © European Union, 2015 Reproduction of this publication for educational or other non-commercial purposes is authorized without prior written permission from the copyright holder provided the source is fully acknowledged. Reproduction of this publication for resale or other commercial purposes is prohibited without prior written permission of the copyright holder. Printed in Hungary. European Red List of Birds Consortium iii Table of contents Acknowledgements ...................................................................................................................................................1 Executive summary ...................................................................................................................................................5 1.
    [Show full text]
  • The Evolution of Ancestral and Species-Specific Adaptations in Snowfinches at the Qinghai–Tibet Plateau
    The evolution of ancestral and species-specific adaptations in snowfinches at the Qinghai–Tibet Plateau Yanhua Qua,1,2, Chunhai Chenb,1, Xiumin Chena,1, Yan Haoa,c,1, Huishang Shea,c, Mengxia Wanga,c, Per G. P. Ericsond, Haiyan Lina, Tianlong Caia, Gang Songa, Chenxi Jiaa, Chunyan Chena, Hailin Zhangb, Jiang Lib, Liping Liangb, Tianyu Wub, Jinyang Zhaob, Qiang Gaob, Guojie Zhange,f,g,h, Weiwei Zhaia,g, Chi Zhangb,2, Yong E. Zhanga,c,g,i,2, and Fumin Leia,c,g,2 aKey Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, 100101 Beijing, China; bBGI Genomics, BGI-Shenzhen, 518084 Shenzhen, China; cCollege of Life Science, University of Chinese Academy of Sciences, 100049 Beijing, China; dDepartment of Bioinformatics and Genetics, Swedish Museum of Natural History, SE-104 05 Stockholm, Sweden; eBGI-Shenzhen, 518083 Shenzhen, China; fState Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, 650223 Kunming, China; gCenter for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences, 650223 Kunming, China; hSection for Ecology and Evolution, Department of Biology, University of Copenhagen, DK-2100 Copenhagen, Denmark; and iChinese Institute for Brain Research, 102206 Beijing, China Edited by Nils Chr. Stenseth, University of Oslo, Oslo, Norway, and approved February 24, 2021 (received for review June 16, 2020) Species in a shared environment tend to evolve similar adapta- one of the few avian clades that have experienced an “in situ” tions under the influence of their phylogenetic context. Using radiation in extreme high-elevation environments, i.e., higher snowfinches, a monophyletic group of passerine birds (Passer- than 3,500 m above sea level (m a.s.l.) (17, 18).
    [Show full text]
  • AERC Wplist July 2015
    AERC Western Palearctic list, July 2015 About the list: 1) The limits of the Western Palearctic region follow for convenience the limits defined in the “Birds of the Western Palearctic” (BWP) series (Oxford University Press). 2) The AERC WP list follows the systematics of Voous (1973; 1977a; 1977b) modified by the changes listed in the AERC TAC systematic recommendations published online on the AERC web site. For species not in Voous (a few introduced or accidental species) the default systematics is the IOC world bird list. 3) Only species either admitted into an "official" national list (for countries with a national avifaunistic commission or national rarities committee) or whose occurrence in the WP has been published in detail (description or photo and circumstances allowing review of the evidence, usually in a journal) have been admitted on the list. Category D species have not been admitted. 4) The information in the "remarks" column is by no mean exhaustive. It is aimed at providing some supporting information for the species whose status on the WP list is less well known than average. This is obviously a subjective criterion. Citation: Crochet P.-A., Joynt G. (2015). AERC list of Western Palearctic birds. July 2015 version. Available at http://www.aerc.eu/tac.html Families Voous sequence 2015 INTERNATIONAL ENGLISH NAME SCIENTIFIC NAME remarks changes since last edition ORDER STRUTHIONIFORMES OSTRICHES Family Struthionidae Ostrich Struthio camelus ORDER ANSERIFORMES DUCKS, GEESE, SWANS Family Anatidae Fulvous Whistling Duck Dendrocygna bicolor cat. A/D in Morocco (flock of 11-12 suggesting natural vagrancy, hence accepted here) Lesser Whistling Duck Dendrocygna javanica cat.
    [Show full text]
  • Primary Moult of the Brambling Fringilla Montifringilla in Northern Sweden
    ORNIS SVECICA 1:113-118, 1991 https://doi.org/10.34080/os.v1.23089 Primary moult of the Brambling Fringilla montifringilla in northern Sweden ULF OTTOSSON & FREDRIK HAAS Abstract The postnuptial wing moult of the Brambling was studied in from the regression analysis. The moult speed shown here for a subalpine birch forest near Ammamas (65° 58' N, 16° 07' E) the Brambling is much faster than for the Chaffmch and might in Swedish Lapland. 580 moult cards were collected during an be due to some constraint for moulting during early autumn. annual ringing scheme in the years 1984-1989. Regression analysis of moult data, with date as the independent value, showed an average moult duration for males and females of Ulf Ottosson and Fredrik Haas, Department of Ecology, 47 days. Raggedness values support the moult speed estimated Animal Ecology, Ecology Building, S-223 62 Lund, Sweden. Introduction The complete moult once a year of flight and body husen (55° 23' N, 12° 55' E) in the southwestemrnost feathers is one of the major events together with bree­ part of Sweden, the median ringing date is 6 and 15 ding in the annual life cycle of a small passerine such as October for females and males, respectively (Anon. the Brambling Fringi/la montifringilla. There are two 1990). Regularly juvenile Bramblings arrive to south­ main moult patterns described for non-tropical passeri­ ern parts of Sweden already in late July-early August nes: post-nuptial moult - a complete moult in the (S. Bensch, pers. comm.). According to Jenni (1982) breeding area after breeding, and winter moult - a the timing of autumn migration shows a rather low complete moult in the winter quarters (Streseman & variation between years, but final wintering areas var­ Streseman 1966, Ginn & Melville 1983).
    [Show full text]
  • Systematic Notes on Asian Birds. 12.1 Types of the Alaudidae
    ZV-335 085-126 | 12 03-01-2007 09:10 Pagina 85 Systematic notes on Asian birds. 12.1 Types of the Alaudidae E.C. Dickinson, R.W.R.J. Dekker, S. Eck & S. Somadikarta With contributions by M. Kalyakin, V. Loskot, H. Morioka, C. Violani, C. Voisin & J-F. Voisin Dickinson, E.C., R.W.R.J. Dekker, S. Eck & S. Somadikarta. Systematic notes on Asian birds. 12. Types of the Alaudidae. Zool. Verh. Leiden 335, 10.xii.2001: 85-126.— ISSN 0024-1652. Edward C. Dickinson, c/o The Trust for Oriental Ornithology, Flat 3, Bolsover Court, 19 Bolsover Road, Eastbourne, East Sussex, BN20 7JG, U.K. (e-mail: [email protected]). René W.R.J. Dekker, National Museum of Natural History, P.O. Box 9517, 2300 RA Leiden, The Netherlands. (e-mail: [email protected]). Siegfried Eck, Staatliche Naturhistorische Sammlungen Dresden, Museum für Tierkunde, A.B. Meyer Bau, Königsbrücker Landstrasse 159, D-01109 Dresden, Germany. (e-mail: [email protected]). Soekarja Somadikarta, Dept. of Biology, Faculty of Science and Mathematics, University of Indonesia, Depok Campus, Depok 16424, Indonesia. (e-mail: [email protected]). Mikhail V. Kalyakin, Zoological Museum, Moscow State University, Bol’shaya Nikitskaya Str. 6, Moscow 103009, Russia. (e-mail: [email protected]). Vladimir M. Loskot, Department of Ornithology, Zoological Institute, Russian Academy of Science, St. Petersburg, 199034, Russia. (e-mail: [email protected]). Hiroyuki Morioka, Curator Emeritus, National Science Museum, Hyakunin-cho 3-23-1, Shinjuku-ku, Tokyo 100, Japan. Carlo Violani, Department of Biology, University of Pavia, Piazza Botta 9, 27100 Pavia, Italy.
    [Show full text]
  • Supporting Information 1. Intensity of Feather Mites (Min=Minimum, Max=Maximum, Med=Median) and Sample Size (N) for Each Bird Species and Country
    Supporting information 1. Intensity of feather mites (Min=Minimum, Max=Maximum, Med=Median) and sample size (N) for each bird species and country. Denmark Spain Mauritania Morocco Romania Ukraine TOTALS Bird Species Min Max Med N Min Max Med N Min Max Med N Min Max Med N Min Max Med N Min Max Med N Med N Acrocephalus arundinaceus 1 800 30.0 109 4 868 69.0 27 43 136 Acrocephalus melanopogon 1 2128 486.0 62 486 62 Acrocephalus paludicola 42 150 110.0 3 110 3 Acrocephalus palustris 2 128 9.0 11 9 11 Acrocephalus schoenobaenus 1 215 15.0 85 2 64 23.0 38 17 123 Acrocephalus scirpaceus 1 182 5.0 1071 1 92 14.0 12 5 1083 Aegithalos caudatus 1 1199 95.0 165 2 170 40.0 12 78 177 Alaemon alaudipes 5 5 5.0 1 5 1 Alauda arvensis 4 528 25.0 20 25 20 Anthus berthelotii 1 284 26.0 77 26 77 Anthus campestris 6 7 6.5 2 155 155 155.0 1 7 3 Anthus pratensis 1 200 43.0 7 43 7 Anthus spinoletta 1 610 20.0 430 20 430 Anthus trivialis 5 800 105.0 20 39 465 250.0 9 115 29 Bombycilla garrulus 31 395 212.5 10 212.5 10 Bucanetes githagineus 1 539 71.0 50 71 50 Calandrella brachydactyla 1 322 8.5 30 8.5 30 Calandrella rufescens 1 2928 61.5 372 1 185 43.5 8 61.5 380 Carduelis cannabina 1 750 46.0 979 46 979 Carduelis carduelis 1 500 15.0 210 2 239 45.5 12 15 222 Carduelis chloris 1 1500 71.5 1739 5 339 68.5 30 71.5 1769 Carduelis citrinella 2 231 44.0 257 44 257 Carduelis spinus 1 1400 79.5 284 79.5 284 Cecropis daurica 1 110 29.0 6 29 6 Certhia brachydactyla 1 217 6.0 16 6 16 Cettia cetti 1 500 25.0 324 25 324 Chersophilus duponti 1 1603 107.0 339 5 881 123.0 21
    [Show full text]
  • The Cinnamon Ibon Hypocryptadius Cinnamomeus Is a Forest Canopy Sparrow
    Ibis (2010), 152, 747–760 The Cinnamon Ibon Hypocryptadius cinnamomeus is a forest canopy sparrow JON FJELDSA˚ ,1 MARTIN IRESTEDT,2 PER G. P. ERICSON3 &DARIOZUCCON2* 1Zoological Museum, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen, Denmark 2Molecular Systematics Laboratory, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden 3Department of Vertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden The Cinnamon Ibon inhabits the canopy of cloud-forest of Mindanao Island in the Philippines, and has until now been classified as an aberrant member of the Zosteropidae (white-eyes). We assessed the systematic position of this enigmatic species using DNA sequence data (two mitochondrial markers, two nuclear introns and two nuclear exons) and broad taxon sampling. The species was robustly placed among the granivorous passe- roid clades, as a basal branch in the family of true sparrows, Passeridae. Morphological data lend further support, as the Cinnamon Ibon shows similar specialization of the skull as other granivorous passeroids. The species’ restricted distribution in the montane cloud-forest of the island of Mindanao, which is of oceanic origin, is difficult to explain without assuming an over-water dispersal event. Keywords: Passeridae, Passeriformes, passerines, Passeroidea, phylogeny, systematics, zoogeography, Zosteropidae. The Cinnamon Ibon Hypocryptadius cinnamomeus lized tongue (Hachisuka 1930, Mees 1969). Thus, is an enigmatic bird of the cloud-forest of the Hachisuka (1930) erected a separate subfamily for southern Philippine island of Mindanao (Delacour it, and Mees (1969) did not think it belonged in & Mayr 1946, Kennedy et al. 2000, van Balen the Zosteropidae at all, but could offer no alterna- 2008).
    [Show full text]
  • Juvenile Plumage Whiteness Is Associated with the Evolution Of
    1 Juvenile plumage whiteness is associated with the 2 evolution of clutch size in passerines 3 4 Running header: juvenile signals and family size 5 6 7 Judith Morales1*, José Javier Cuervo1, Juan Moreno1 and Juan José Soler2 8 9 Running header: juvenile signals and family size 10 11 1National Museum of Natural Sciences (MNCN-CSIC), c/ José Gutiérrez Abascal 2, 12 28006 Madrid, Spain 13 2Estación Experimental de Zonas Áridas (EEZA-CSIC), Ctra. de Sacramento s/n, La 14 Cañada de San Urbano, 04120 Almería, Spain 15 *Correspondence: [email protected]; Tel.: +34 914 111 328 (ext. 1341) 16 1 17 Fig. A1. Example of selection of juvenile ventral feathers using the magnetic lasso tool in 18 Photoshop (plate from the Complete Birds of the Western Palearctic on CD‐ROM version 1.0 19 (Cramp and Perrins 1998, Oxford University Press, Oxford, UK)). 20 21 2 22 Table S1. Values of juvenile ventral and tail/wing whiteness, mean clutch size, type of nest (open vs. cavity/domed), (log10) female mass (g) and number of 23 broods raised per year (1 = one vs. 2 = more than one) are shown for all the species included in the analyses (n = 210). Data were obtained from The 24 Complete Birds of the Western Palearctic on CD‐ROM version 1.0 (BWP, Cramp and Perrins 1998, Oxford University Press, Oxford, UK), except when marked 25 with a superscript letter. Predation rate (percentage of nests lost due to predation) was available for a reduced set of species (n = 79). If not specified with 26 superscript letters, predation rate was obtained from BWP.
    [Show full text]