Molecular Evidence for the Systematic Position of <I>Urocynchramus

July2000] ShortCommunications 787

The Auk 117(3):787-791, 2000

Molecular Evidencefor the SystematicPosition of Urocynchramuspylzowi

JEFFG. Gr•oTIq• Departmentof Ornithology,American Museum of NaturalHistory New York,New York10024, USA

Urocynchramuspylzowi, known variously as Prze- Groth1998). Paynter (in Peters1968) doubted the in- walski's Rosefinch,Pink-tailed Rosefinch, and Pink- clusionof Urocynchramuswith carduelinesbecause tailed Bunting,is a finch-likebird of uncertainsys- of its ten-primariedcondition and becausethe red tematic affinities that is endemic to the mountains of colorationin its tail setit apartfrom rosefinches.The westernChina. In many linear classifications(e.g. ten-primariedstate prompted at least one author Sharpe1909, Vaurie 1959, Peters 1968, Morony et al. (Domaniewski1918) to arguefor classifyingthe bird 1975),it is listed next to the Long-tailedRosefinch in its own family,the Urocynchramidae. (Uragussibiricus) in the Carduelinae,to which it is PlacingUrocynchramus among other oscinefami- similar in size and severalplumage characters. Uro- lies hasbeen frustrated by the absenceof both skel- cynchramushas a muchthinner bill than Uragus,but etal and fluid-preservedspecimens of this bird. In- both specieshave disproportionately long tails com- formation on basic life-history attributes such as paredwith the restof thecardueline finches, and the mating behavior,nest structure,and vocalizations malesare bright pink on thethroat, breast, and belly. generallyis lacking,adding to thedifficulties of pro- Femalesof both speciesare streaked,sparrow-like, ducing convincingarguments for its taxonomicas- and lackthe brightpink coloration.Uragus and Uro- signment.Nevertheless, it is now possibleto extract cynchramusalso are exclusivelyAsiatic and live at DNA from dried museum skins that are decades old; high elevationsnear the centerof speciesdiversity of thesetechniques allow acquisition of numerouschar- rosefinchesin the genusCarpodacus, to which a close actersthat are useful in analyzingsystematic rela- relationshipwith Uragushas never been questioned. tionshipsof problematictaxa when freshbiological The few availableaccounts of its ecologyand behav- materialis not available.A prerequisitefor suchan ior (Przewalski 1876 [recounted in Vaurie 1956], analysisis comparableDNA sequenceinformation Sch•fer1938, B. Kingpers. comm.) state that the hab- from an appropriateset of othertaxa. itat associations,patterns of flight, and posturesof Phylogeneticanalyses of completemitochondrial Urocynchramusare similar to thoseof Uragus. cytochrome-b(cyt b) genesshow a well-supported Despiteits resemblanceto Uragus,Ur'ocynchramus separation between cardueline finches and emberi- frequentlyhas beenclassified as an emberizidbun- zid sparrows(Groth 1998). If Urocynchramusis either ting (Sharpe1888, Dresser 1902, Sibley and Monroe a carduelineor an emberizid,then its cyt-bsequence 1990).Przewalski (1876), who first collectedand de- shouldallow discriminationbetween these two pos- scribedthe bird, notedthe similarityof its bill struc- sibilities.My analysis(Groth 1998) also included a ture to that of buntingsand regarded its songas sim- wide rangeof otheroscine groups, thus providing a ilar to that of the buntingCynchramus (=Emberiza) broadphylogenetic context for placementof Urocyn- schoeniclus.Sushkin (1927) consideredthe external chramus if it is neither a car.dueline nor an emberizid. anatomyand structureof the hornypalette of Uro- Methods.--I extracted DNA from a 1-mm 2 flake of cynchramusto be most like that of buntings.Zusi toe skin from an adult male (American Museum of (1978) found that featuresof its interorbitalseptum Natural History 782951;collected by Ernst Shfiferat were unlike those of cardueline finches, but he could Kham, westernChina, 18 October1934) usingthe neitherconfirm nor rejectits possiblerelationship to methodsof Mundyet al. (1997).The entire cyt-b gene buntings. was amplifiedin five fragmentsusing a combination The most perplexingaspect of Urocynchramusis of 10primers (Table 1) designedfor oscinebirds. Five the condition of its outer primary (P10), which is of the primershad beenused in otherstudies, but I abouttwo-thirds the lengthof P9. Althougha well- obtainedfresh stocksfrom the manufacturer(Op- developedP10 suchas this is characteristicof many eronTechnologies, Inc.) asa precautionagainst con- oscinefamilies, all fringillids and emberizidsare tamination.Further precautionsincluded perform- "nine-primaried"in that P10 is vestigial.Although ing DNA extractionand assemblyof reactiontubes the nine-primariedcondition has been derived often in an isolatedroom away from the main laboratory in oscines,no taxonwithin a nine-primariedgroup using dedicated"ancient DNA" pipettorsand aero- is knownto haveundergone a characterreversal to sol-barrierpipet tips.I usedAmplitaq Gold kits (Ap- secondarilyderive the "ten-primaried"state (see plied Biosystems)according to manufacturers'in- structionsfor amplificationreactions, but theywere scaled down to total volumes of 10 •tL. All kit com- E-mail:[email protected] ponents (except enzyme), water, and disposable 788 ShortCommunications [Auk, Vol. 117

TABLE1. List of primersused for Urocynchramuscy- replicates,with eachreplicate containing five sepa- tochrome-bsequencing. rate heuristic searches with random-taxon addition. I depicteddistance relationships with a neighbor- Primer• Sequenceb joining tree (Saitou and Nei 1987) generatedusing L14851 c CCTACTTAGGATCATTCGCCCT modified genetic distances(third-position transi- L15068 CTAGCCATACACTACACAGCAGA tionseliminated). Trees were rootedusing data from L15410 c TGAGGAGGATTCTCAGTAGACAA four membersof the Corvida(sensu Sibley and Mon- L15656 c CCAAACCTACTACTAGGAGACCCAGA roe 1990). L15848 CCAAACTACGATCAATAACCTTCCG Resultsand discussion.--Severalobservations sug- H15103 TGCCGAGACGTACAATTCGGCTGA H15460 ATCGTAGGCCTCACACTAGTCCAC gestthat the resultingsequence was authenticUro- H15710 • GGCATAGGCGAATAGAAAGTATC cynchramuscyt b and not a contaminant.In experi- H15934 GGCTAGTTGGCCGATGATGATGAA mentsusing DNA from museumskins, all negative H16141 c AACATACCAGCTTTGGGAG control reactions were blank when visualized on EtBr-stainedagarose gels, whereas reactionswith aL andH referto extensionproducts on the light andheavy strands, respectively.Numbers indicate the positionof the 3' baseof theprim- UrocynchramusDNA were positive. Nevertheless, er accordingto the systemused for Gallus(Desjardins and Morais even thoughthe negativecontrol reactions showed 1990). no amplificationproducts, it is possiblethat the ex- b Primers are listed in the 5' to 3' direction. tract from Urocynchramuswas contaminatedwith cPreviously cited by Groth (1998). DNA from another species.If this were the case, "double" sequences,containing ambiguous base plasticswere irradiated with UV light before use. callsfrom a mixture of both Urocynchramusand the Thermocyclingwas donein a Perkin-ElmerAB19600 contaminant,might have resulted for some frag- machine with an initial hold at 94øC for 10 min fol- ments. However, double sequencesdid not occur. lowed by 40 cyclesconsisting of 95øCfor 20 s, 52øC Furthersupport for the authenticityof the sequence for 20 s, and 72øC for 30 s. To test for contamination, was that the five separatetarget DNA fragments, I also assemblednegative control reactionscontain- ranging in size from 277 to 391 bases (excluding ing all componentsexcept Urocynchramus DNA. Re- primer sites),showed no sitesin disagreementwith- actionproducts were then processedfurther and se- in areasof overlap,suggesting that only onesource quencedon an AB1377automated sequencer accord- was responsiblefor all amplification.It would have ing to methodsin Groth (1998). beenhighly unlikelyfor the sameputative contami- I assembledand edited the sequencesusing Se- nant to havebeen amplified cleanly for all five frag- quenchersoftware (Gene Codes).After scoringall mentsto the exclusionof any amplificationfrom the bases,which included the entirecyt-b gene, I added UrocynchramusDNA, which certainlypredominated it to the cyt-b data of 53 other oscines(1,143 base in the extract.Similarly, I doubt that the sequence pairs each;see Groth 1998). This data set included was that of a nuclearpseudogene because it is un- four putatively divergent lineages (genera) of car- likely that all five pairsof primerspreferentially am- dueline finches,one Hawaiian honeycreeper(Hima- plifieda nuclearproduct to theexclusion of themuch tione),five emberizidgenera of which one(Melophus) more abundantmitochondrial cyt b in the DNA ex- is Asiatic,and nine other membersof the "larger" tract.When comparedwith all othercyt-b sequences Emberizidae(as formerly recognized by AOU [1983], I had previouslygenerated, the final presumptive which I refer to as the superfamilyEmberizoidea). Urocynchramussequence was uniqueand highly di- One additionalentire cyt-bsequence, that from fro- vergentfrom all others. zen liver tissue of Uragussibiricus (Russia, Republic Parsimonyanalysis found five equally shorttrees of Buryatia, 55 km W and 30 km S of Ulan-Ude, 16 (length = 2,290; not shown),all of which showed June1993; University of WashingtonBurke Museum monophylyfor both the Fringillidaeand the "em- CDS 4888), was generated using the laboratory berizoids." Not one of the trees linked Urocynchra- methodsof Groth (1998) and added to the data set muswithin or asthe sistergroup of thesetwo clades. for a total of 55 taxa compared.I analyzedthe data Theseresults clearly show that no phylogeneticre- usingboth parsimony-and distance-basedmethods lationshipexists between Urocynchramus and Uragus. in PAUP*version 4.062 (Swofford1999). Following Instead, the branch to Urocynchramusoriginated argumentsI made earlier (Groth 1998),I eliminated from a more basalposition in all trees,whereas Ur- transition(AuG and CuT) changesat third posi- agus was embedded within the other cardueline tions of codons(using the searchand replacefunc- finches. A strict consensusof the five trees (not tion in MacClade version 3.0.6; Maddison and Mad- shown) placed Urocynchramuswithin a clade of dison 1992) to reduce "noise" due to saturation ef- "passeroid" (sensuSibley and Monroe 1990) taxa; fects. To find the shortestparsimony trees, I con- that is, in no treeswas it linked to "sylvioids"(Reg- ducted 500 heuristic searches with random taxon ulus, Abroscopus,Garrulax, and Zosterops),larks additionand TBRbranch swapping. Nodal support (Alaudidae), or membersof the Corvida. was estimatedwith 500bootstrap (Felsenstein 1985) Monophylyof all familiesof finchesand allieswas July 2000] ShortCommunications 789

A Vireo _• Vireo Lanius Lanius Cyanocitta Cyanocitta 791', Ptiloris Ptiloris I Corvida • Mirafra Mirafra Eremopterix Eremopteryx Galerida Galerida I Alaudidae Regulus Regulus Garrulax --• Garrulax Zosterops Zosterops Abroscopus 52 Nectarinia Nectarinia Dicaeum Dicaeum Urocynchramus Urocyn chram us Vidua Vidua 71 • Ortygospiza L 'AbroscopusEstrildidae Spermophaga Sperrnophaga Parmoptila optila Peucedramus eucedramus Prunella Ila Sporepipes Euplectes [_Lr----- Euplectes Malimbus [[_[-- Malimbus Pieceus • ' Pieceus Ploceidae Dinemellia [j Dinemellia . Piecepasser [__• Piecepasser 52 , Philetairus • Philetairus _ Fringilla ropipes1 Carpodacus A I Carpodacus • Leucosticte I I• •1 Himatione• Fringillidae Pinicola J L• • Cardue/is Uragus I II•Leucosticte • Carduelinae Himatione J 'L[•Pinicola Carduelis l' ' FringillaUragus • Montifringilla Montifringilla Passer Passeridae Petronia • PetroniaPasser • Motacilla Anthus ___L•__MMotacilla = Anthus Motacillidae Macronyx acronyx = Passerina Passerina Coryphospingus _j Coryphospingus Piranga -- •Piranga Icteria Icteria Seiurus Setophaga t [-- Seiurus 79 Dendroica •11 Wilsonia 68 75 Parula •j Parula Emberizoidea Wilsonia -El-- Setophaga -- Dendroica Icterus Icterus Melophus Spizella Melophus• Chondestes -• •__l-----Junco Junco L_l • Amphispiza El-- Spizella • Emberizidae ß Amphispiza ' Chondestes .•_ FIe.1. Phylogenetictrees showing relationships of Urocynchramus to other finches and allies ("Emberi- zoidea"= Emberizidaeof AOU1983). (A) Majority-rule tree showing only those nodes achieving a 50% or higherbootstrap value using parsimony. Numbers on branches are bootstrap percentages. (B)Neighbor- joiningtree, in whichbranch lengths are drawn proportional to geneticdistances. corroboratedby bootstrapanalysis (Fig. 1A), but no is a carduelinefinch or an emberizidsparrow. Tree- supportoccurred for linking Urocynchramusto any buildingusing geneticdistances (Fig. lB) placed of thesefamilies. Although it is clearthat entire cyt- Urocynchramuson a long,basal branch in the passe- b sequencesfor thisset of taxaare inadequate for re- reid assemblageand not nearany othertaxon in the solvingbasal relationshipsamong these families, analysis.The geneticdistinctiveness of Urocynchra- and for assigninga sistergroup to Urocynchramusmus can be furtherdescribed using transversion dis- with robustestimates of nodalsupport, it isstill pos- tances, which have been considered to evolve in a sibleto addressthe hypothesesthat Urocynchramusclock-like manner (Brown et al. 1982). Pairwise 790 ShortCommunications [Auk, Vol. 117 transversiondistances between Urocynchramusand on an earlier draft of the manuscript.Sievert Rohwer the fringillids ranged from 6.22 to 7.27%, and dis- (BurkeMuseum) sent the Uragussample. Lab work tances between Urocynchramusand "emberizoids" wassupported by theLewis B. andDorothy Cullman rangedfrom 6.04to 7.09%.In contrast,the maximum Programfor MolecularSystematics Studies of the pairwise transversiondistance was 5.34%(4.55% be- AMNH. tween carduelines)between any two fringillids, and 5.07%(3.32% between emberizids) between any two LITERATURE CITED "emberizoids." The lowest transversion distance be- tweenUrocynchramus and anyother species that I an- AMERICAN ORNITHOLOGISTS' UNION. 1983. Check- alyzed was with Parmoptila(5.60%), a taxonclearly list of North American birds, 6th ed. American supported to be within the Estrildidae (and with Ornithologists'Union, Washington,D.C. only 2.45%transversion distance from Spermophaga).BROWN, W. M., E. M. PRAGER, A. WANG, AND A. C. Given that cardueline and emberizid finches can WILSON.1982. Mitochondrialsequences of pri- be eliminated as candidates for the nearest relatives mates:Tempo and modeof evolution.Journal of of Urocynchramus,it is necessaryto considerthe re- Molecular Evolution 18:225-239. maininggroups of finchesand allies.The Passeridae DESJARDINS,P., ANDR. MORAIS.1990. Sequenceand and Motacillidaeconsist entirely of nine-primaried geneorganization of the chickenmitochondrial species;Urocynchramus is genetically divergent from genome:A novel gene order in. higher verte- all sampledmembers of both groups(6.13 to 7.01% brates. Journalof Molecular Biology212:599- transversiondistance), and it did not link to either 634. family in anyof thephylogenetic trees. Alternatively, DOMANIEWSKI,J. 1918. Die Stellung des Urocynchra- boththe Ploceidae and the Estrildidae consist mainly muspylzovi Przev. in der Systematik.Journal f/Jr of ten-primariedtaxa, yet the mitochondrialDNA Ornithologie66:421-424. evidencedoes not support a direct sister-groupre- DRESSER,H. E. 1902. A manual of Palearctic birds. H. lationship between Urocynchramusand either of E. Dresser, London. these families. FELSENSTEIN,J. 1985. Confidence limits on phyloge- The only ten-primariedfinch-like groupsnot al- nies: An approachusing the bootstrap.Evolu- readydiscussed are sunbirds(Nectariniidae) and ac- tion 39:783.791. centors(Prunellidae). Urocynchramus clearly is un- GROTH,J. G. 1998.Molecular phylogenetics of finches like sunbirdsin externalmorphology, and the mito- and sparrows:Consequences of characterstate chondrialevidence suggests no reasonto consider removalin cytochromeb sequences.Molecular the two taxa related. Some accentors, on the other Phylogeneticsand Evolution10:377-390. hand, superficiallyare rathersimilar to Urocynchra- MADDISON, W. P., AND D. R. MADDISON. 1992. musin bodysize, bill shape,and relative length of the MacClade,version 3: Analysisof phylogenyand tail. Additionally, the Prunellidae (consistingof a character evolution. Sinauer Associates, Sunder- single genus,Prunella) is exclusivelyPalearctic, and land, Massachusetts. the centerof speciesdiversity is near the range of MORONY, J. J., Jr., W. J. BOCK, AND J. FARRANO, Jr. Urocynchramus.Nevertheless, Urocynchramusand 1975. Reference list of birds of the world. Amer- Prunellashowed a high (6.04%) transversiondis- ican Museumof Natural History,New York. tance,and the two taxadid not link asmonophyletic MUNDY, N. I., P. UNLIT, AND D. S. WOODRUFF. 1997. in any of the shortestparsimony trees. Furthermore, Skin from feet of museum specimensas a non- no prunellidspossess the brightpink bodyplumage destructivesource of DNA for aviangenotyping. characteristicof male Urocynchramus. Auk 114:126-129. Phylogeneticanalysis of mitochondrialsequences PETERS,J. L. 1968. Check-list of birds of the world, suggeststhat Urocynchramusis no more closelyre- vol. 14. Museumof ComparativeBiology, Cam- lated to any singlefamily than it is to severalothers. bridge,Massachusetts. In other words, the sister group of UrocynchramusPRZEWALSKI, N.M. 1876. Mongoliia i strana Tangu- likely is a cladeconsisting of two or moreoscine fam- tov, vol. 2. RusskagoObva, St. Petersburg,Rus- ilies.The bestsummary of the presentgenetic data sia. is that Urocynchramusis a relictmember of a lineage SAITOU,N., ANDM. NE1.1987. The neighbor-joining that is as old as, or older than, other families of finch- method:A methodfor reconstructingphyloge- es. I agree with Domaniewski (1918) and Wolters netic trees.Molecular biology and Evolution4: (1979)that Urocynchramusbelongs in its own family, 406-425. the Urocynchramidae. SCHXFER,E. 1938.Ornithologische Ergebnisse zweier Acknowledgments.--Ithank GeorgeBarrowclough Forschungsreisennach Tibet. Journalf/Jr Orni- for permissionto removeskin from the specimenin thologie86:3-349. the AMNH; Ben King for sharinghis field observa- SHARPE,R. B. 1888.Catalog of the Passeriformes,or tions; and Paul Sweet, Joanna Freeland, Townsend perchingbirds, in the collectionof the British Peterson,and an anonymousreviewer for comments Museum,vol. 12. Taylorand Francis,London. July2000] ShortCommunications 791

SHARPE,R. B. 1909.A hand-listof the generaand spe- Rhodopechys,Carpodacus, Pinicola, Loxia, Uragus, ciesof birds, vol. 5. Taylorand Francis,London. Urocynchramus,and Propyrrhula.American Mu- SIBLEY,C. G., AND B. L. MONROE,Jr. 1990. Distribu- seum Novitates 1786:1-37. tion and taxonomyof birds of the world. Yale VAURIE, C. 1959. The birds of the Palearctic fauna. University Press,New Haven, Connecticut. Passeriformes.H. E & G. Witherby,London. SUSHKIN,P. P. 1927.On the anatomyand classifica- WOLTERS,H. E. 1979. Die Vogelarten der Erde, vol. 4. tion of the weaver-birds. Bulletin of the Ameri- Paul Parey,Hamburg and Berlin, Germany. can Museum of Natural History 57:1-32. Zu$I, R. L. 1978.The interorbitalsepturn in cardue- SWOFFORD,D. L. 1998.PAUP*. Phylogenetic analysis us- line finches. Bulletin of the British Ornitholo- ing parsimony(*and other methods), version 4.0. gists' Club 98:5-10. Sinauer Associates,Sunderland, Massachusetts. VAURIE, C. 1956. Systematic notes on Palearctic Received26 October1998, accepted 23 November1999. birds,no. 20. Fringillidae:The generaLeucosticte, AssociateEditor: A. ]. Baker

The Auk 117(3):791-794, 2000

Anatomical and Nutritional Adaptations of the Speckled Mousebird (Colius striatus)

COLLEENt. DOWNS,• J. OLAF WIRMINGHAUS,2 AND MICHAEL J. LAWES Schoolof Botanyand Zoology, University of Natal,Private Bag X01, Scottsville3209, SouthAfrica

Folivoryis a rare phenomenonin birds that has creasingbody mass, small folivores have proportion- evolvedindependently in severallineages. It hasbeen ally higher metabolicrequirements relative to their reportedin ratites(Withers 1983, Herd and Dawson gut capacitythan do large folivores(Demment and 1984), anatids(Buchsbaum et al. 1986, Dawson et al. VanSoest1985). Consequently,small avian folivores 1989),ptarmigan (Gasaway et al. 1975),the Kakapo have greaterproblems of energy acquisitionthan (Strigopshabroptilus; Oliver 1955, Powleslandet al. theirlarger avian counterparts and thus are expected 1992),and somespecies of Saltator(Bosque et al. 1999). to be rare. The Hoatzin (Opisthocomushoazin) is uniqueamong Mousebirds,order Coliiformes,comprise six spe- birdsin beingthe only documentedforegut fermenter ciesthat are endemicto sub-SaharanAfrica (Maclean andthe only obligate avian folivore (Grajal et al. 1989). 1993).Despite the paucityof species,mousebirds are Althoughfolivory is commonin mammals(Chivers remarkablysuccessful and haveradiated into many and Langer1994), the evolutionof folivoryin birdsis habitatsin Africa, occurringfrom harsh desert to constrainedby bodymass and the highmass-specific moist savanna. The folivorous habits of these birds energyrequirements of endothermyand flight, despite were first observedin the SpeckledMousebird (Col- the apparentunlimited supply of freshfoliage in na- ius striatus;Rowan 1967), althoughpeculiarities of ture.Klasing (1998) defines an avianfolivore as one that their thermoregulatoryability were noticedprior to concentrateson leaves;however, the categories from an this (McAtee 1947). Body temperaturesof mouse- obligatefolivore to a facultativefolivore are poorlyde- birds are correlatedwith ambienttemperature fluc- fined. tuations,which is a putativereason for their noctur- Folivoryis associatedwith reducedfood quality nal huddling behavior(Rowan 1967). Average body (Chiversand Langer 1994). Digestioncosts for fer- mass of each speciesis about 50 g, making mouse- mentingfolivores are high owing to gut specializa- birds amongthe smallestof folivorousbirds. Con- tions (i.e. a fermentation chamber) and associated sequently,we investigatedtheir gastrointestinal tract bacterial micro flora for the breakdown of cellulose and digestivephysiology and suggesthow adapta- and release of volatile fatty acids (VFA; VanSoest tionsin thesetraits permit the combinationof small 1983).Energy from a folivorousdiet is releasedslow- size and folivory in birds. To determinethe extentof ly, requiringa behavioraland physiologicallifestyle morphologicaland physiologicaladaptations, we that minimizesenergy expenditure. Because energy madeoutgroup comparisons with the Purple-crested requirementsper unit body massincrease with de- Turaco(Tauraco porphyreolophus ), which is a largefor- est frugivore,and with the Hoatzin. Methods.--Wecollected 13 Speckled Mousebirds E-mail: [email protected] from Creighton(30ø02'S, 29ø46'E) and Pietermaritz- Deceased. burg (29ø36'S,30ø24'E), South Africa, in May 1994