RSC Advances
This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication.
Accepted Manuscripts are published online shortly after acceptance, before technical editing, formatting and proof reading. Using this free service, authors can make their results available to the community, in citable form, before we publish the edited article. This Accepted Manuscript will be replaced by the edited, formatted and paginated article as soon as this is available.
You can find more information about Accepted Manuscripts in the Information for Authors.
Please note that technical editing may introduce minor changes to the text and/or graphics, which may alter content. The journal’s standard Terms & Conditions and the Ethical guidelines still apply. In no event shall the Royal Society of Chemistry be held responsible for any errors or omissions in this Accepted Manuscript or any consequences arising from the use of any information it contains.
www.rsc.org/advances Page 1 of 31 RSC Advances
Fungal-bacterial interactions in mice with dextran sulfate sodium
(DSS)-induced acute and chronic colitis
Xinyun Qiu 1, 2# , Xia Li 1, Zhe Wu 1, Feng Zhang 1, Ning Wang 1, Na Wu 3,
Xi Yang 4, Yulan Liu 1* .
1Department of Gastroenterology, Peking University People's Hospital, Beijing, China. Manuscript 2 Department of Gastroenterology, First Affiliated Hospital of Nanjing Medical University,
Nanjing, China.
3Institute of Clinical Molecular Biology & Central Laboratory, Peking University People's
Hospital, Beijing, China. Accepted 4 CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Micro biology,
Chinese Academy of Sciences, Beijing, China.
# Dr. Xinyun Qiu is a doctoral candidate in Department of Gastroenterology, Peking University
People's Hospital from September 2012 to July 2015, and now he is a resident physician in
Department of Gastroenterology, First Affiliated Hospital of Nanjing Medical University. Advances
*Corresponding author. Mailing address for Yulan Liu: RSC Department of Gastroenterology, Peking University People's Hospital
No. 11 Xizhimen South Street, Xicheng District, Beijing 100044, China.
Phone: (8610)8832 5559; Fax: (8610)6831 8386; E mail: [email protected]
RSC Advances Page 2 of 31
Running Title: Fungal bacterial interactions in mice with DSS colitis.
ABSTRACT
The commensal intestinal microbiota plays critical roles in the initiation and development of Manuscript inflammatory bowel diseases (IBD). However, the importance of intestinal fungi and their interactions with bacteria in the pathogenesis of IBD is unclear. In this study, anti fungal drugs (fluconazole or
Amphotericin B [AmpB]) were administered to control mice and those treated, acutely (A DSS) and chronically (C DSS) with DSS. The severity of colonic inflammation was assessed, and Accepted pro inflammatory cytokine levels in the colonic mucosa and serum were detected by real time PCR and multiplex ELISA assay, respectively. The colonic bacterial 16S rDNA V3 region was analysed in normal and anti fungal drug treated mice by pyrosequencing. Specific bacterial genera related to IBD, butyryl CoA/acetate CoA transferase (a key transferase for butyrate production in bacteria) and tight junction proteins (occludin and ZO 1) in the colonic mucosa were detected by real time PCR Advances and/or western blot. The results showed that compared with controls ，intestinal Bacteroides , Alistipes , and Lactobacillus were increased in fluconazole treated mice; while only Alistipes was increased in
AmpB treated mice. Clostridium cluster XIVa and butyryl CoA/acetate CoA transferase levels were RSC reduced in both groups. Treatment with a high dose of anti fungal drugs dampened colonic occludin and
ZO 1, aggravated A DSS colitis, and exhibited no beneficial role in C DSS colitis. However, reducing fluconazole concentration to an appropriate dose attenuated C DSS colitis. In conclusion, fungi are important co operators with bacteria in maintaining intestinal micro ecological equilibrium. Extensive Page 3 of 31 RSC Advances
clearance of gut fungi could disrupt intestinal bacterial homeostasis and have an adverse impact on
IBD. Studies investigating the intestinal fungal bacterial interactions would aid the appropriate use of
anti fungal drugs in treating IBD.
Key words: Inflammatory bowel disease, Colitis, Intestinal microbiota, Fungi, Fungal bacterial
interactions.
BACKGROUND
Inflammatory bowel diseases (IBDs) such as ulcerative colitis (UC) and Crohn’s disease (CD),
are caused by multiple factors, including genetics, environment, immune dysfunction, and disturbance Manuscript of the intestinal microbiota. The latter comprises a large and diverse community of bacteria, fungi,
viruses, and archaea 1. The intestinal microbiota plays vital roles in developing and maintaining host
immunology, physiology, nutrition, and metabolism 2.
Patients with IBD are usually characterised by disturbances in their intestinal microflora. Accepted Several studies have reported an increased abundance of Gammaproteobacteria and
Enterobacteriaceae , and decreased abundance of Firmicutes in both UC and CD patients 3-5. Numbers
of bacteria producing butyrate, an important short chain fatty acid (SCFA) that plays a major role in
promoting visceral function and integrity, are significantly decreased in the gut of IBD patients 6, 7.
Additionally, pathogenic sulfur reducing, bile tolerant bacteria, which produce toxic and Advances proinflammatory hydrogen sulfide and exacerbate intestinal inflammation, are increased in the gut of
UC patients 8, 9. Besides bacteria, intestinal fungi also exhibit a significant change during inflammatory
condition. Denaturing gradient gel electrophoresis analysis of fungal 18S rDNA showed different RSC
fungal profiles between UC patients and healthy individuals, and an increased proportion of Candida
albicans was found in the colons of CD patients 10 , 11 , causing aggravated mucosal injury and
generation of anti Saccharomyces cerevisiae antibodies (ASCA) 12-14 .
Pathogenic gut microbiota could be an important inducer in IBD initiation and perpetuation, and RSC Advances Page 4 of 31
past studies have verified that elimination of gut bacteria by broad spectrum antibiotics is effective in inducing IBD remission 15 . However, to our knowledge, the role of anti fungal drugs in treating IBD has not been demonstrated conclusively. Fungi and bacteria coexist in the gastro intestinal (GI) canal, where they interact extensively with each other 16 , 17 . Fungi usually bloom during antibiotic perturbations, especially in immunocompromised patients such as those with acquired immune deficiency syndrome (AIDS), some cancers, and transplant recipients 18 . Dollive et al 18 demonstrated an outgrowth of fungi in both short term and long term antibiotic treatment in mouse models and found that Candida can persist in the gut at a high level for eight weeks after the cessation of antibiotics. However, whether anti fungal drugs have an effect on intestinal bacteria is unknown.
The objective of this study was to elucidate the interactions between intestinal bacteria and fungi, Manuscript and to investigate the role of intestinal fungi in IBD. To this end, we investigated the effects of anti fungal drugs (fluconazole and amphotericin B [AmpB]) in dextran sulphate sodium
(DSS) induced murine acute and chronic IBD models, and compared the bacterial composition in the colonic mucosa between normal and anti fungal drug treated mice. Our results unravel the interaction between bacteria and fungi in the gut and further our knowledge of microbial homeostasis in the GI Accepted canal.
MATERIALS AND METHODS
Animal protocols Advances
Six week old C57B/L6J mice were purchased from the Experimental Animal Center, Academy of
Military Medical Sciences (Beijing, China), housed four to five per cage and placed on standardized RSC rodent food and distilled water for four weeks prior to the study to stabilize their microflora. To induce acute DSS colitis, mice were given drinking water containing 2.5% (w/v) DSS (MP Biomedicals,
Aurora, OH) ad libitum for seven days and distilled water for two additional days before sacrifice. To induce chronic DSS colitis, mice were given four cycles of 7 day 2.5% (w/v) DSS followed by 7 day Page 5 of 31 RSC Advances
water (DSS+water) treatment 19 (Figure S1). All animal experiments were approved by the Committee
for Laboratory Animal Management of Peking University and treated humanely according to the
National Institutes of Health guidelines on the ethical use of animals.
Effect of anti-fungal drugs in mice with acute-DSS (A-DSS) colitis
To induce acute DSS colitis (A DSS), mice were given water containing 2.5% (w/v) DSS (molecular
weight 36–50 kDa; MP Biomedicals) ad libitum for seven days followed by water without DSS for
two additional days before sacrifice. Two anti fungal drugs (fluconazole and AmpB) were tested in the
A DSS model in separate experiments. In the first experiment, animals were divided into the Manuscript following four treatment groups (n = 8–10 per group): normal, A DSS, fluconazole, and A DSS +
fluconazole. In the second experiment, the same groups were used, but fluconazole was replaced with
AmpB. To deplete intestinal fungi using fluconazole, the fluconazole and A DSS + fluconazole groups
were exposed to fluconazole (0.5 mg/mL, Sigma Aldrich, St Louis, MO) via their drinking water 20 on
days 1–23. In the A DSS and A DSS + fluconazole groups, 2.5% (w/v) DSS was added to the drinking Accepted water only on days 15–21 (Table 1). To deplete intestinal fungi using AmpB, the AmpB and A DSS +
AmpB groups were administered AmpB (an insoluble drug, 1 mg/kg bodyweight) intragastrically on
days 1–23 using the method reported by Reikvam et al 21 . The normal and A DSS mice were
administrated distilled water intragastrically as a control. In the A DSS and A DSS + AmpB groups,
2.5% (w/v) DSS was added to drinking water only on days 15–21 (Table 1). Mice in all groups were Advances
weighed on days 14–23. The mice were sacrificed on day 23, and the colon tissues (3 cm above
the anal canal) were extracted and stained with haematoxylin and eosin as described previously.19 RSC Inflammation was graded by two independent blinded observers according to an established grading
system 22 .
Effect of different concentrations of fluconazole in mice with chronic-DSS (C-DSS) colitis RSC Advances Page 6 of 31
To induce C DSS colitis, mice were treated with four 14 day cycles consisting of seven days of water containing 2.5% DSS followed by seven days of distilled water (DSS + water) before being sacrificed, according to the protocol described by Batra et al 23 , with modifications. Mice were randomly divided into four groups: C DSS, C DSS + Flu1, C DSS + Flu2, and C DSS + Flu3. Three different concentrations of fluconazole (Flu1: 0.5 mg/mL [fungi depleted concentration], Flu2: 0.125 mg/mL, and Flu3: 0.0625 mg/mL) were added to the water on the fourth DSS + water cycle (Figure S1). Mice in all groups were weighed on the fourth DSS + water cycle (day 43–56), colon tissue was collected, and the inflammation was graded as stated earlier.
DNA isolation Manuscript
Mouse colons were opened longitudinally and briefly washed in cold sterile phosphate buffered saline
(PBS) three times immediately after sacrifice. The colonic mucosal samples (2 cm above the anal canal) were collected, frozen in liquid nitrogen, and stored at −80 °C until further processing.
DNA was extracted from the colonic tissue samples (referred to as mucosa in our study) by using a Accepted FastDNA ® SPIN Kit for Feces (MP Biomedicals) according to the manufacturer’s instructions and was quantified on a NanoDrop 1000 spectrophotometer (Thermo Scientific).
Library construction Advances
The 16S rRNA gene V3 region (representing bacteria) in the colonic mucosal samples of mice was amplified and pyrosequenced. We amplified 16S rDNA with the universal primers 341F RSC (5′ NNNNNNNNCCTACGGGAGGCAGCAG 3′) and 534R
(5′ NNNNNNNNATTACCGCGGCTGCTGG 3′)24 . The primer sets were modified with Illumina adapter regions for sequencing on the Illumina GAIIx platform, and the reverse primers were modified with an 8 bp Hamming error correcting barcode to distinguish the samples. The mucosal DNA template (200 ng) was combined with 0.25 L HotStarTaq ® Plus DNA Polymerase (Qiagen), 1 L Page 7 of 31 RSC Advances
dNTPs, 5 L polymerase chain reaction (PCR) buffer, and 2.5 pmol of each primer in a total volume
of 50 µL. The PCR cycle consisted of an initial step at 95 °C for 5 min; 25 cycles of 94 °C for 45 s,
55 °C for 45 s, and 72 °C for 60 s; and a final extension at 72 °C for 10 min. PCR products were
verified by 1.5% (w/v) agarose gel electrophoresis, stained with ethidium bromide, photographed
under UV illumination, and purified with the QIAquick ® gel extraction kit (Qiagen).
Real-time PCR
To detect the levels of inflammatory cytokines (IL 6, IL 17A, and IFN γ) and tight junction proteins
(occludin and ZO 1) in the colonic mucosa, total RNA was extracted from the proximal and distal Manuscript colon by the TRIzol ® method (Gibco) and converted into cDNA. Rpl32 was used as the internal
control as it is stable during intestinal inflammation 20 . The primers used are listed in Table 2. To detect
16S rDNA (representing bacteria), 18S rDNA (representing fungi), and several specific bacterial
genera in the colonic mucosa, β actin was used as the internal control. PCR reactions consisting of
100 ng template cDNA (or DNA), 0.8 L (10 nM) each primer, 10 L SYBR ® Green PCR master mix Accepted (TOYOBO), and 7.4 L of water in a total volume of 20 µL were performed on an ABI StepOne Plus
Sequence Detection System (Applied Biosystems); the thermocycling reactions involved the
following steps: 95 °C for 1 min; 40 cycles of 95 °C for 15 s, 56 °C for 15 s, and then 72 °C for 45 s.
The primers used are listed in Table 3. All samples were analysed in duplicate in a single 96 well
reaction plate, and the data were analysed according to the 2 ∆CT method. Advances
RSC Pro-inflammatory cytokines in the serum
Blood was collected, coagulated, centrifuged (10 min at 3000 × g), and stored at −80 °C until further
processing. Inflammatory cytokine (IL 6, IL 17A, and IFN γ) concentrations in the serum were
determined using Milliplex™ MAP mouse immunoassay kits (Millipore) according to the
manufacturer’s instructions. RSC Advances Page 8 of 31
Bioinformatics analysis
Sequences of the V3 region of 16S rDNA in mouse colonic mucosa were detected using an Illumina
HiSeq™ 2000 platform (reconstructed cDNA sequence: 2 × 150 bp). Ribosomal Database Project
(RDP) Classifier 2.8 was used for taxonomical assignment of all the sequences at 50% confidence after the raw sequences were identified by their unique barcodes. Bacterial genera with an average relative abundance of ≥0.01 in colonic samples were identified as major genera. Operational taxonomic units (OTUs) present in ≥50% of the mucosal specimens were deemed core OTUs. Partial least squares discriminant analysis (PLS DA) of core OTUs was performed using Simca P version 12
(Umetrics) to visualise and cluster the fungal community into different groups. Manuscript
Bacterial genera and butyryl-CoA/acetate-CoA transferase concentration in colonic mucosa
We utilised previously reported broad spectrum primers to amplify the targeted genomic DNA of Accepted Bacteroides 25 , Alistipes 26 , Lactobacillus 27 , Clostridium cluster XIVa 25 , Lachnospiracea incertae sedis
28 , Helicobacter 29 , and the butyryl-CoA/acetate-CoA transferase gene 25 in order to detect and quantify the different bacterial genera and the level of butyrate producing bacteria in the colonic mucosa of mice by real time PCR, with β actin as the internal control.
Advances
Western blot analysis. RSC Proximal and distal colonic tissues from normal, fluconazole , and AmpB treated mice were disrupted by homogenization on ice and centrifuged at 4 °C (12,000 × g, 15 min). The supernatants were collected, and protein concentrations were determined by the Bradford assay with bovine serum albumin. Equal amounts of protein (70 ng/lane) were separated on 8% SDS PAGE, transferred to a nitrocellulose membrane, blocked in 5% skim milk, and incubated with antibodies against Occludin Page 9 of 31 RSC Advances
( 1:200; Santa Cruz Biotechnology, Santa Cruz, CA), ZO 1 (1:100; Santa Cruz Biotechnology), and
β actin (1:2000; Cell Signaling) at 4 °C overnight. The membranes were washed and incubated with
horseradish peroxidase conjugated secondary antibody (1:400; Zhongshan Golden Bridge
Biotechnology, Beijing, China) for 1 h at room temperature. After one more wash, immunoreactive
bands were visualised with ECL detection regents (Thermo Scientific).
Statistical analysis
Results are expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed
using the Statistical Package for Social Sciences version 17.0 (SPSS Inc., Chicago, IL). Analysis of Manuscript variance (ANOVA) and Mann–Whitney U tests were used for analysis. Differences were considered
significant at a P value of less than 0.05.
RESULTS Accepted
Intestinal fungi-depletion by fluconazole aggravates A-DSS colitis in mice
The A DSS + fluconazole group exhibited the most severe colonic inflammation, greatest weight loss
(Figure 1A), shortest colon length (Figure 1B), and highest histological score (Figure 1C) among the
four groups (normal, fluconazole, A DSS, and A DSS + fluconazole), followed by the A DSS group.
The A DSS + fluconazole and A DSS mice showed higher mRNA levels of pro inflammatory Advances
cytokines (IL 6, IL 17A, and IFN γ) in the colonic mucosa and increased serum levels of
pro inflammatory cytokines compared with the normal and AF groups (Figure 2A F). Notably, the RSC
A DSS + fluconazole group exhibited the highest pro inflammatory cytokine level in both the colonic
mucosa and peripheral blood, followed by the A DSS group (Figure 2A F). No obvious inflammation
was detected in the normal and fluconazole treated mice (Figures 1 and 2).
RSC Advances Page 10 of 31
Intestinal fungidepletion by AmpB also aggravates A-DSS colitis in mice
The A DSS + AmpB group exhibited the most severe colonic inflammation among the normal, AmpB,
A DSS, and A DSS + AmpB groups. Both the A DSS and A DSS + AmpB mice showed significant weight loss compared with the normal and AmpB mice (Figure 3A). Moreover, the weight lost by the
A DSS + AmpB mice was markedly higher than that lost by the A DSS group on days 19 and 22.
(Figure 3A) The A DSS + AmpB group showed the shortest colon length (Figure 3B) and highest histological score (Figure 3C) among the four groups, followed by the A DSS group; the A DSS +
AmpB and A DSS mice revealed higher mRNA levels of pro inflammatory cytokines (IL 6, IL 17A, and IFN γ) in their colonic mucosa compared with the normal and AmpB groups (Figure S2). Notably, the A DSS + AmpB group showed the highest pro inflammatory cytokine concentration in the colon, Manuscript followed by the A DSS group (Figures 3 and S2). No obvious inflammation was detected in the normal and AmpB treated mice (Figure 3 and S2).
Comparison of 16S rDNA and 18s rDNA levels in the colonic mucosa of normal and anti-fungal Accepted drug-treated mice
18S rDNA and 16S rDNA primer amplified fragments were used to quantitatively analyse the fungal and bacterial content of the gut, respectively. Anti fungal drugs (fluconazole and AmpB) significantly decreased the 18S rDNA levels in the colonic mucosa. Interestingly, the 16S rDNA levels were not significantly different between the anti fungal drug treated and normal groups (Figure S3 and S4). Advances
RSC Bacterial compositions in the normal and anti-fungal drug-treated mice
To observe the effects of the anti fungal drugs (at a dosage that depleted intestinal fungi) on the intestinal microbiota and to compare the intestinal bacterial communities between normal and anti fungal drug treated mice, we investigated the bacterial composition of the colonic mucosa from Page 11 of 31 RSC Advances
normal and fluconazole treated mice by high throughput sequencing. Overall, 91,824,505 high quality
reads of the 16S rDNA V3 region (~5,739,031 reads/sample) were obtained for taxonomic analysis.
The rarefaction curve shows the observed number of OTUs on sequence counts at different
sequencing depths (Figure S5); the rarefaction curve was saturated, indicating that no new OTUs were
detected when the sequencing depth was increased. A total of 340 OTUs (>10 reads for each OTU)
were identified in the colonic mucosa of both groups (Figure 4A), 268 overlapping OTUs were
detected between the two groups, while 20 and 52 OTUs were uniquely present in the normal and
fluconazole mice, respectively, indicating a greater bacterial diversity in the gut of fluconazole treated
mice. PLS DA (Figure 4B) based on the core OTUs revealed that the colonic mucosal bacteria in the
normal and fluconazole mice could be classified into two different clusters. Three dominant phyla
(Firmicutes, Proteobacteria, and Bacteroidetes ) accounted for more than 97% in all of the samples Manuscript
(Figure 4C). Compared with the normal control group, the prevalence of Firmicutes and Bacteroidetes
was much higher, while that of Proteobacteria was much lower, in the fluconazole treated mice
(Figure 4C). In addition, eight major genera ( Helicobacter , Clostridium cluster XIVa, Anaerostipes,
Lachnospiracea incertae sedis, Lactobacillus, Mucispirillum, Marvinbryantia, and Alistipes ) were Accepted detected in the colonic mucosa of normal mice (Figure 4A), while thirteen major genera ( Helicobacter ,
Lactobacillus, Clostridium cluster XIVa, Lachnospiracea incertae sedis, Alistipes, Marvinbryantia,
Bacteroides, Hallella, Xylanibacter, Barnesiella , Anaerostipes, Flavonifractor , and Prevotella ) were
detected in the fluconazole group (Figure 4B).
We further detected the seven bacterial genera ( Bacteroides , Alistipes , Lactobacillus , Advances
Clostridium cluster XIVa, Lachnospiracea incertae sedis, and Helicobacter ) that are associated with
intestinal inflammation and carcinoma, as well as the butyryl-CoA/acetate-CoA transferase (a key RSC transferase in butyrate production in bacteria 30 ) gene level in the colonic mucosa of mice, and found
that Bacteroides , Alistipes , and Lactobacillus were significantly higher in the colonic mucosa of
fluconazole treated mice (Figure 5A C), while Clostridium cluster XIVa and butyryl-CoA/acetate-CoA
transferase levels were significantly lower, than in the normal control mice (Figure 5D and 5F). The
levels of Lachnospiracea incertae sedis and Helicobacter , two abundant bacteria in the mouse gut, RSC Advances Page 12 of 31
were not markedly different between the fluconazole treated and normal mice (Figure 5E and 5G). To study the effects of AmpB on the intestinal microbiota, we compared the differences in the levels of
Bacteroides , Alistipes , Lactobacillus , Clostridium cluster XIVa, Helicobacter , and butyryl-CoA/acetate-CoA transferase in the colonic mucosa of normal and AmpB treated mice by real time PCR. Interestingly, the level of Alistipes increased, while that of Clostridium cluster XIVa and butyryl-CoA/acetate-CoA transferase decreased in the colonic mucosa of the AmpB treated mice compared with the normal control (Figures S6B, D and F); the other four genera did not show remarkable differences between the two groups (Figure S6A, C and E).
Occludin and ZO-1 levels decreased in the colonic mucosa of anti-fungal drug-treated mice Manuscript
The levels of two tight junction proteins (occludin and ZO 1) were examined in the colon tissue of normal and anti fungal drug (fluconazole and AmpB) treated mice. The expression levels of occludin and ZO 1 were significantly lower in the colon tissue of anti fungal drug (fluconazole and
AmpB) treated mice than of the normal mice, as analysed by real time PCR (Figure 6A B) and western Accepted blot (Figure 6C D), respectively.
Effects of fluconazole treatment in mice with C-DSS colitis
To observe the effects of fluconazole treatment on C DSS murine colitis, we added fluconazole in the Advances drinking water at the fourth DSS + water cycle at three different concentrations. Among the four groups (C DSS, C DSS + Flu1, C DSS + Flu2, and C DSS + Flu3 groups) of mice, the C DSS and
C DSS + Flu1 (fungi depleted concentration of fluconazole) groups showed the greatest weight loss RSC
(Figure 7A), shortest colon length (Figure 7B), and highest pathological score (Figure 7C) and pro inflammatory cytokine level in the colonic tissue and serum (Figure 8), followed by the C DSS +
Flu3 and C DSS + Flu2 groups (Figures 7 and 8). However, no difference was detected in the degree of inflammation between the C DSS and C DSS + Flu1 mice (Figures 7 and 8) Page 13 of 31 RSC Advances
DISCUSSION
Intestinal fungi and bacteria are important micro ecological components that play crucial roles in
maintaining the health and functioning of the GI canal. Imbalance in the composition of both
microbiota has been implicated in the development of IBD 17 , 31 . Thus, modulation of gut microbiota in
IBD patients is a growing area of scientific research. Several studies have suggested that IBD patients
exhibit increased numbers of mucosal associated bacteria 32 , and gut inflammation could develop from
bacterial invasion in the intestinal mucosa and failed clearance of the intruders by the host immune
system 33 . Therefore, antibiotics were proposed as a beneficial therapeutic strategy for IBD 33 , 34 .
35
Intestinal fungi, although less abundant than bacteria , also bloom in the inflammatory colonic Manuscript
mucosa and invade the intestinal wall and extra enteric organs, especially when the host is severely
injured or immunocompromised 20 , 36 . However, whether anti fungal treatment is useful in treating IBD
has not been investigated.
In this study, we found that A DSS colitis in mice can be remarkably promoted by high dose of Accepted fluconazole, these results are in line with a recent research showing similar effects of fluconazole
treatment on the severity of A DSS colitis 37 . Then, we treated A DSS colitis mice with
another broad sepctrum anti fungal drug (AmpB) and interestingly got a similar observation.
Amphotericin B and fluconazole target fungi through quite different mechanisms 37 , so we put forward
the hypothesis that the aggravation of acute DSS colitis in DSS+fluconazole mice could not be an Advances
off target effect of fluconazole but was like a specific effect of disrupting the intestinal
micro ecological equilibrium. RSC
Gastrointestinal microbiota was considered to be divided into two distinct ecosystems: the mucosal
microbiota (adhered to the intestinal epithelium) and the fecal microbiota (mostly present in the stools) 12 .
Compared with fecal microbiota, the mucosal microbiota is believed to be more closely associated
with the epithelial innate immune response 38 , 39 ; therefore, we focused on the change of mucosal RSC Advances Page 14 of 31
microbial composition in the gut of normal and anti fungal drug treated mice in the current study.
Interestingly, both drugs dramatically decreased the mucosal fungal 18S rDNA level in the murine colon. Notably, the mucosal 16S rDNA (bacterial) level in the colon did not change after exposure to anti fungal drugs. We further detected the prevalence of various intestinal bacteria in the colonic mucosa of normal and fluconazole treated mice by high throughput sequencing. As evidenced by the results of PLS DA (Figure 4B), significant changes occurred in the bacterial composition of fluconazole treated mice compared with the normal control. We detected eight major genera
(Helicobacter , Clostridium cluster XIVa, Anaerostipes, Lachnospiracea incertae sedis, Lactobacillus,
Mucispirillum, Marvinbryantia, and Alistipes ) in the colonic mucosa of normal mice (Figure 4D), while thirteen major genera ( Helicobacter , Lactobacillus, Clostridium cluster XIVa, Lachnospiracea incertae sedis, Alistipes, Marvinbryantia, Bacteroides, Hallella, Xylanibacter , Barnesiella , Manuscript
Anaerostipes, Flavonifractor , and Prevotella ) were detected in the fluconazole treated mice (Figure
4E). Among the major bacterial genera, Helicobacter , Bacteroides, and Alistipes are positively associated with intestinal inflammation and/or tumour burden 40-43 , while Clostridium cluster XIVa,
Lachnospiracea incertae sedis (both of which are butyrate producing bacteria) 44 , and Lactobacillus 45 Accepted were demonstrated to be beneficial for IBD patients. Therefore, we quantified these bacteria in the colonic mucosa by real time PCR. The prevalence of two pathogenic bacterial genera ( Bacteroides and Alistipes) was found to be significant higher, while the levels of probiotic Clostridium cluster
XIVa and butyryl-CoA/acetate-CoA transferase were significantly lower, in fluconazole treated mice than in the normal control mice, indicating that fluconazole aggravated intestinal inflammation by Advances promoting the proliferation of pathogenic Bacteroides and Alistipes while reducing the proportion of beneficial butyrate producing bacteria (e.g., Clostridium cluster XIVa, etc.). However, the level of
Helicobacter , the most abundant genus in the mouse colon, did not significantly differ between the RSC two groups. Interestingly, the level of Lactobacillus , a probiotic bacterium, was increased in the colon after fluconazole treatment. Gut inflammation is affected by the total intestinal microbial community, and the strength of the anti inflammatory effect of Lactobacillus in the gut remains to be investigated.
We also compared the levels of the six bacterial genera and butyryl-CoA/acetate-CoA Page 15 of 31 RSC Advances
transferase in the colonic mucosa of AmpB treated mice and normal controls, and observed
significantly higher levels of Alistipes and significantly lower levels of Clostridium cluster XIVa and
butyryl-CoA/acetate-CoA transferase in the colonic mucosa of AmpB mice than in the normal control
(Figure S6), indicating that Alistipes and several butyrate producing bacteria (e.g., Clostridium cluster
XIVa, etc.) might play a role in the progression of intestinal inflammation. However, Helicobacter,
Lactobacillus, and Bacteroides did not show obvious differences between the two groups. The
pharmacological effect of AmpB is considerably different from that of fluconazole, and whether other
bacterial genera affect gut inflammation in AmpB treated mice remains to be studied.
IBD patients usually exhibit decreased abundance of occludin and ZO 1, two key tight junction
proteins that constituting intestinal mucosal barrier and regulate epithelial survival and pathogenesis Manuscript of gut inflammation and carcinoma, in their intestinal mucosa 46 , 47 . In this study, we found that a high
dose of anti fungal drugs (fungi depleted therapy) significantly downregulated colonic occludin and
ZO 1 expression. Previous studies have reported a positive association between butyrate producing
bacteria and tight junction proteins 46 , 48 . Therefore, we believe that the decreased levels of Clostridium
cluster XIVa and other butyryl CoA/acetate CoA transferase expressing butyrate producers could play Accepted
an important role in reducing mucosal tight junction protein expression, thereby exacerbating acute
DSS colitis in mice.
IBD is a chronic relapsing condition with life long effects on patients. Fungi are more abundant in
the colons of patients with a long history of UC than in those of patients with a short history and Advances intestinal fungi could be broken down by some pathogenic gram negative bacteria and provide energy
for the latter in the gut 49 . Moreover, fungi can translocate into colonic mucosa and extra enteric organs
19 in C DSS (but not in normal and A DSS) murine IBD models and could aggravate disease severity, RSC
indicating anti fungal therapy could be a promising approach to improve the chronic IBD condition.
However, only limited clinical studies have reported the anti fungal treatment in chronic IBD or IBD
patients with fungal infections 50 .
Intestinal fungi could play a more important role in affecting chronic intestinal inflammation than RSC Advances Page 16 of 31
was believed earlier. Properly use of anti fungal agents in treating IBD could be of great importance, while the appropriate dosage of these agents are need to be verified. In this study, we treated chronic
DSS colitis mice with three different doses of fluconazole, and found that only a moderate dose of fluconazole (0.125 mg/mL) could significantly accelerate chronic DSS colitis, while a lower dosage
(0.0625 mg/mL) and higher dosage (0.5 mg/mL) led to no obvious improvements. However, whether this dosage of fluconazole in animal experiment could be extrapolated to clinical applications remains further investigation.
In conclusion, we demonstrated that fungi are important co factors in maintaining gut microbiological homeostasis. Additionally, we provided some preliminary data for the usage of anti fungal drugs in treating IBD, and verified the existence of fungal bacterial interactions in gut Manuscript inflammation. Further, we demonstrated that too high a dose of anti fungal agents could agitate the intestinal micro ecological balance and dampen the intestinal mucosal barrier, only appropriate dose of anti fungal drugs could be used to relieve DSS colitis in mice. However, we only observed the effects of different doses of fluconazole on C DSS (but not A DSS) murine colitis. Besides, anti fungal agents used in treating IBD are still lack of quality clinical trial, further studies are also Accepted required to clarify the mechanism underlying the regulation of intestinal health by enteric microbiota and investigate whether a specific dose of fluconazole (or other anti fungal drugs) needs to be used in IBD and whether the anti fungal drugs should be applied, alone or in combination with other anti inflammatory drugs (or antibiotics) in the clinical IBD treatment. Advances
RSC
Acknowledgements
We thank Professor Baoli Zhu, Professor Weidong Yu, Dr. Na Lv, Dr. Chunguang Luan, Dr. Hongbin
Chen, Dr. Yujing Chi, Dr. Yujun Zhang, Dr. Jianhua Zhou, Miss. Huifang Miao for their assistance in these experiments. We also thank Dr. Kai Wang helped edit some paragraph in this article, and thank
Professor David.Topping and Professor Michael. Conlon for their assistance in English and grammar. Page 17 of 31 RSC Advances
Conflict of Interest
The authors declare that there is no conflict of interest.
Author Contributions
X.Q. designed the research; X.Q., X.L., Z.W., F.Z. and N.W. performed the research; X.Q., X.Y.,
analysed the data; X.Q. wrote the paper. Y.L. helped edit this manuscript.
References: Manuscript 1L. Biedermann and G. Rogler, Eur. J. Pediatr., 2015, 174 , 151 167.
2P. D. Scanlan and J. R. Marchesi, ISME J., 2008, 2, 1183 1193.
3P. Seksik, L. Rigottier Gois, G. Gramet, M. Sutren, P. Pochart, P. Marteau, R. Jian and J. Dore, Gut , 2003,
52 , 237 242. Accepted 4 U. Gophna, K. Sommerfeld, S. Gophna, W. F. Doolittle and S. J. Veldhuyzen van Zanten, J. Clin.
Microbiol., 2006, 44 , 4136 4141.
5 M. H. Giaffer, C. D. Holdsworth and B. I. Duerden, J. Med. Microbiol., 1991, 35 , 238 243.
6 L. Chen, W. Wang, R. Zhou, S. C. Ng, J. Li, M. Huang, F. Zhou, X. Wang, B. Shen, A. K. M, K. Wu and
B. Xia, Medicine (Baltimore) , 2014, 93 , e51. Advances
7 K. Machiels, M. Joossens, J. Sabino, V. De Preter, I. Arijs, V. Eeckhaut, V. Ballet, K. Claes, F. Van RSC Immerseel, K. Verbeke, M. Ferrante, J. Verhaegen, P. Rutgeerts and S. Vermeire, Gut , 2014, 63 ,
1275 1283.
8 W. E. Roediger, J. Moore and W. Babidge, Dig. Dis. Sci., 1997, 42 , 1571 1579.
9 T. Florin, D. Khalil, A. Lenarczyck, S. Moody and D. Cowley, Am. J. Gastroenterol., 1998, 93 , 2638.
10 S. J. Ott, T. Kuhbacher, M. Musfeldt, P. Rosenstiel, S. Hellmig, A. Rehman, O. Drews, W. Weichert, K. RSC Advances Page 18 of 31
N. Timmis and S. Schreiber, Scand. J. Gastroenterol., 2008, 43 , 831 841.
11 D. M. Underhill and I. D. Iliev, Nat. Rev. Immunol., 2014, 14 , 405 416.
12 M. Zwolinska Wcislo, T. Brzozowski, A. Budak, S. Kwiecien, Z. Sliwowski, D. Drozdowicz, D.
Trojanowska, L. Rudnicka Sosin, T. Mach, S. J. Konturek and W. W. Pawlik, J. Physiol. Pharmacol.,
2009, 60 , 107 118.
13 A. Standaert Vitse, B. Sendid, M. Joossens, N. Francois, P. Vandewalle El Khoury, J. Branche, H. Van
Kruiningen, T. Jouault, P. Rutgeerts, C. Gower Rousseau, C. Libersa, C. Neut, F. Broly, M.
Chamaillard, S. Vermeire, D. Poulain and J. F. Colombel, Am. J. Gastroenterol., 2009, 104 , 1745 1753.
14 A. Y. Koh, Current Fungal Infection Reports , 2013, 7, 144 151. Manuscript
15 D. H. Kerman and A. R. Deshpande, Postgraduate medicine , 2014, 126 , 7 19.
16 A. Y. Peleg, D. A. Hogan and E. Mylonakis, Nat. Rev. Microbiol., 2010, 8, 340 349.
17 Z. K. Wang, Y. S. Yang, A. T. Stefka, G. Sun and L. H. Peng, Aliment. Pharmacol. Ther., 2014, 39 ,
751 766. Accepted
18 S. Dollive, Y. Y. Chen, S. Grunberg, K. Bittinger, C. Hoffmann, L. Vandivier, C. Cuff, J. D. Lewis, G. D.
Wu and F. D. Bushman, PLoS One , 2013, 8, e71806.
19 X. Qiu, F. Zhang, X. Yang, N. Wu, W. Jiang, X. Li and Y. Liu, Sci. Rep., 2015, 5, 10416.
20 I. D. Iliev, V. A. Funari, K. D. Taylor, Q. Nguyen, C. N. Reyes, S. P. Strom, J. Brown, C. A. Becker, P. R. Advances Fleshner, M. Dubinsky, J. I. Rotter, H. L. Wang, D. P. McGovern, G. D. Brown and D. M. Underhill,
Science , 2012, 336 , 1314 1317. RSC
21 D. H. Reikvam, A. Erofeev, A. Sandvik, V. Grcic, F. L. Jahnsen, P. Gaustad, K. D. McCoy, A. J.
Macpherson, L. A. Meza Zepeda and F. E. Johansen, PLoS One , 2011, 6, e17996.
22 L. A. Dieleman, M. J. Palmen, H. Akol, E. Bloemena, A. S. Pena, S. G. Meuwissen and E. P. Van Rees,
Clin. Exp. Immunol., 1998, 114 , 385 391. Page 19 of 31 RSC Advances
23 A. Batra, M. M. Heimesaat, S. Bereswill, A. Fischer, R. Glauben, D. Kunkel, A. Scheffold, U. Erben, A.
Kuhl, C. Loddenkemper, H. A. Lehr, M. Schumann, J. D. Schulzke, M. Zeitz and B. Siegmund,
Mucosal immunology , 2012, 5, 580 591.
24 W. Jiang, N. Wu, X. Wang, Y. Chi, Y. Zhang, X. Qiu, Y. Hu, J. Li and Y. Liu, Sci. Rep., 2015, 5, 8096.
25 T. Wang, G. Cai, Y. Qiu, N. Fei, M. Zhang, X. Pang, W. Jia, S. Cai and L. Zhao, ISME J., 2012, 6,
320 329.
26 H. M. Roager, T. R. Licht, S. K. Poulsen, T. M. Larsen and M. I. Bahl, Appl. Environ. Microbiol., 2014,
80 , 1142 1149.
27 N. Wu, X. Yang, R. Zhang, J. Li, X. Xiao, Y. Hu, Y. Chen, F. Yang, N. Lu, Z. Wang, C. Luan, Y. Liu, B. Manuscript
Wang, C. Xiang, Y. Wang, F. Zhao, G. F. Gao, S. Wang, L. Li, H. Zhang and B. Zhu, Microb. Ecol.,
2013, 66 , 462 470.
28 T. Shinkai, T. Ueki, S. Koike and Y. Kobayashi, Anim. Sci. J., 2014, 85 , 254 261.
29 X. W. Huijsdens, R. K. Linskens, J. Koppes, Y. L. Tang, S. G. Meuwissen, C. M. Vandenbroucke Grauls Accepted
and P. H. Savelkoul, FEMS Immunol. Med. Microbiol., 2004, 41 , 79 84.
30 C. Charrier, G. J. Duncan, M. D. Reid, G. J. Rucklidge, D. Henderson, P. Young, V. J. Russell, R. I.
Aminov, H. J. Flint and P. Louis, Microbiology , 2006, 152 , 179 185.
31 S. R. Dalal and E. B. Chang, J. Clin. Invest., 2014, 124 , 4190 4196. Advances 32 A. Swidsinski, J. Weber, V. Loening Baucke, L. P. Hale and H. Lochs, J. Clin. Microbiol., 2005, 43 ,
3380 3389. RSC
33 G. P. Pineton de Chambrun, J. Torres, A. Darfeuille Michaud and J. F. Colombel, Dig. Dis., 2012, 30 ,
358 367.
34 T. Ohkusa, K. Kato, S. Terao, T. Chiba, K. Mabe, K. Murakami, Y. Mizokami, T. Sugiyama, A. Yanaka,
Y. Takeuchi, S. Yamato, T. Yokoyama, I. Okayasu, S. Watanabe, H. Tajiri and N. Sato, Am. J. RSC Advances Page 20 of 31
Gastroenterol., 2010, 105 , 1820 1829.
35 G. B. Huffnagle and M. C. Noverr, Trends Microbiol., 2013, 21 , 334 341.
36 H. Sokol, K. L. Conway, M. Zhang, M. Choi, B. Morin, Z. Cao, E. J. Villablanca, C. Li, C. Wijmenga,
S. H. Yun, H. N. Shi and R. J. Xavier, Gastroenterology , 2013, 145 , 591 601 e593.
37 M. L. Wheeler, J. J. Limon, A. S. Bar, C. A. Leal, M. Gargus, J. Tang, J. Brown, V. A. Funari, H. L.
Wang, T. R. Crother, M. Arditi, D. M. Underhill and I. D. Iliev, Cell Host Microbe., 2016, 19 , 865 873.
38 B. A. Duerkop, S. Vaishnava and L. V. Hooper, Immunity , 2009, 31 , 368 376.
39 P. Ricanek, S. M. Lothe, S. A. Frye, A. Rydning, M. H. Vatn and T. Tonjum, Clin. Exp. Gastroenterol.,
2012, 5, 173 186. Manuscript
40 S. A. Bassett, W. Young, M. P. Barnett, A. L. Cookson, W. C. McNabb and N. C. Roy, Nutrients , 2015,
7, 1798 1816.
41 N. T. Baxter, J. P. Zackular, G. Y. Chen and P. D. Schloss, Microbiome , 2014, 2, 20.
42 D. D. Nguyen, S. Muthupalani, J. A. Goettel, M. A. Eston, M. Mobley, N. S. Taylor, A. McCabe, R. Accepted
Marin, S. B. Snapper and J. G. Fox, Inflamm. Bowel. Dis., 2013, 19 , 2041 2050.
43 M. Scarpa, A. Grillo, D. Faggian, C. Ruffolo, E. Bonello, R. D'Inca, I. Castagliuolo and I. Angriman,
Surgery , 2011, 150 , 56 67.
44 D. Berry and W. Reinisch, Best Pract. Res. Clin. Gastroenterol., 2013, 27 , 47 58. Advances 45 M. A. von Schillde, G. Hormannsperger, M. Weiher, C. A. Alpert, H. Hahne, C. Bauerl, K. van
Huynegem, L. Steidler, T. Hrncir, G. Perez Martinez, B. Kuster and D. Haller, Cell Host Microbe., RSC
2012, 11 , 387 396.
46 S. Ploger, F. Stumpff, G. B. Penner, J. D. Schulzke, G. Gabel, H. Martens, Z. Shen, D. Gunzel and J. R.
Aschenbach, Ann. N. Y. Acad. Sci., 2012, 1258 , 52 59.
47 K. Wang, X. Jin, Y. Chen, Z. Song, X. Jiang, F. Hu, M. A. Conlon and D. L. Topping, Nutrients , 2016, Page 21 of 31 RSC Advances
8, doi: 10.3390/nu8050272.
48 H. Endo, M. Niioka, N. Kobayashi, M. Tanaka and T. Watanabe, PLoS One , 2013, 8, e63388.
49 F. Cuskin, E. C. Lowe, M. J. Temple, Y. Zhu, E. A. Cameron, N. A. Pudlo, N. T. Porter, K. Urs, A. J.
Thompson and A. Cartmell, Nature , 2015, 517 , 165 169.
50 S. Samuel, E. V. Loftus, Jr. and W. J. Sandborn, Aliment. Pharmacol. Ther., 2010, 32 , 1207 1209.
Manuscript Accepted Advances RSC RSC Advances Page 22 of 31 Manuscript
Figure 1. Effect of fluconazole in mice with acute-DSS (A-DSS) colitis. Four groups of mice Accepted
(Normal, A-DSS, Fluconazole, and A-DSS+Fluconazole group) were treated as shown in Table 1.
(n = 8–10/group). Weights (A) were measured on days 14–23, and the percent weight change was calculated. Colon lengths (B) and Histological scores (C) were measured on day 23 after sacrifice.
The values are expressed as mean ± SEM. Histological sections of colonic tissue stained with Advances hematoxylin and eosin showing the effects of fluconazole in mice. (D) (HE, ×100). *P < 0.05, ** P
< 0.01, *** P < 0.001. RSC
Page 23 of 31 RSC Advances
Manuscript
Figure 2 Inflammatory cytokine (IL 6, IL 17A, and IFN γ) levels in the colonic mucosa and
serum of normal, Fluconazole, A DSS and A DSS+Fluconazole mice . (A–C) mRNA
expression levels of IL 6, IL 17A, and IFN γ in the colon were measured by Realtime PCR and Accepted normalized to Rpl32 mRNA. (n = 8–10 /group). (D–F) IL 6, IL 17A, and IFN γ cytokine serum
concentrations were measured by MILLIPLEX TM Immunoassays. The values are expressed as
mean ± SEM. *P < 0.05, ** P < 0.01, *** P < 0.001.
Advances RSC RSC Advances Page 24 of 31 Manuscript
Figure 3 Effect of amphotericin B (AmpB) in mice with acute-DSS (A-DSS) colitis. Four groups of mice (Normal, AmpB group, A-DSS group, and A-DSS+AmpB group) were treated as Accepted shown in Table 1. (n = 8–10/group). Weights (A) were measured on days 14–23, and the percent weight change was calculated. The A-DSS+AmpB mice exhibited higher weight loss on days 19 and 22 than the DSS mice. Colon lengths (B) and Histology scores (C) were measured on day 23 after sacrifice. The values are expressed as mean ± SEM. Histological sections of colonic tissue Advances stained with hematoxylin and eosin showing the effects of AmpB in mice. (D) (HE, ×100). *P <
0.05, ** P < 0.01, *** P < 0.001. # P < 0.05. RSC
Page 25 of 31 RSC Advances Manuscript
Figure 4 Comparison of intestinal bacterial compositions between Normal and Fluconazole Accepted
treated mice. (A) The bacterial OTU attribution in colonic mucosa of normal and fluconazole
mice. The green circle indicates the OTUs present in normal samples, and the red circle indicates
the OTUs present in the fluconazole samples; overlap indicates the OTU shared by both samples.
(B) Partial least-squares discriminant analysis (PLS-DA) scores plot based on the relative Advances
abundance of bacterial OTUs (97% similarity level) in the colonic mucosa of normal (green
triangle) and fluconazole (red triangle) mice. (C) Specific bacterial phylum abundance in the RSC
colonic mucosa of normal and fluconazole mice. Major bacterial genera (relative abundance ≧
0.01 on average) in the colonic mucosa of normal (D) and fluconazole (E) treated mice. RSC Advances Page 26 of 31
Figure 5 Six different bacterial genera ( Bacteroides , Alistipes , Lactobacillus , Clostridium Manuscript cluster XIVa, Lachnospiracea incertae sedis , and Helicobacter ) and butyryl CoA/acetate CoA transferase level in the colonic mucosa of normal and fluconazole mice were determined by
Realtime PCR, β actin was used as the internal control. The values are expressed as mean ±
SEM. *P < 0.05. Accepted
Advances RSC Page 27 of 31 RSC Advances
Manuscript Figure 6. Tight junction proteins (Occludin and ZO-1) expression in colonic mucosa from
normal, Fluconazole, and AmpB treated mice . Proteins expression was first analyzed by
Realtime PCR (A and B), with Rpl32 mRNA to be the internal control; and then, was confirmed
by Western blot analysis, with β actin protein to be the internal control.
Accepted Advances RSC RSC Advances Page 28 of 31
Figure 7. Effect of different concentrations of fluconazole in mice with chronic-DSS (C-DSS) Manuscript colitis. Mice were randomly divided into C-DSS, C-DSS+Flu1, C-DSS+Flu2, and C-DSS+Flu3 groups. (n = 6–7 / group). All of the mice were treated as was illustrated in Figure S1. Weights (A) were measured on days 43–57, and the percent weight change was calculated. Colon lengths (B) and Histology scores (C) were measured on day 57 after sacrifice. The values are expressed as
mean ± SEM. Histological sections of colonic tissue stained with hematoxylin and eosin showing Accepted the effects of different dose of fluconazole in mice. (D) (HE, ×100). *P < 0.05.
Advances RSC Page 29 of 31 RSC Advances
Manuscript
Figure 8. Inflammatory cytokine levels in the colonic mucosa and serum of C-DSS,
C-DSS+Flu1, C-DSS+Flu2, and C-DSS+Flu3 mice. (A–C) IL 6, IL 17A, and IFN γ mRNA
expression levels in the colon were measured by Realtime PCR and normalized to Rpl32 mRNA.
(n = 6 7 /group). (D–F) IL 6, IL 17A, and IFN γ cytokine concentrations in serum were measured Accepted
by MILLIPLEX TM Immunoassays. The values are expressed as mean ± SEM. *P < 0.05.
Advances RSC RSC Advances Page 30 of 31
Table 1 Experimental treatment groups
group Day 1- Day 14 Day 15 - Day 21 Day 22 - Day 23 Normal N water N water N water DSS N water N water containing 2.5% DSS N water Fluconazole Flu water Flu water Flu water A-DSS Flu water Flu water containing 2.5% DSS Flu water +Fluconazol AmpB N water+ING-B N water+ ING-B N water+ ING-B A-DSS+ N water+ ING-B N water containing 2.5% DSS+ ING-B N water+ ING-B AmpB
Mice were treated with different drinking water regimens ad libitum (see Materials and Methods).
All mice were sacrificed on day 23. Colonic mucosal samples were collected and detected. N water: normal water. Flu water: N water containing 0.5 mg/mL fluconazole. ING-B: intragastric administration of amphotericin B (AmpB) (1 mg/kg bodyweight). Manuscript
Table 2 Primers used for the pro inflammatory cytokines (IL 6, IL 17A, and IFN γ) detecting. Rpl32 was used as the housekeeping gene.
Amplicon Forward primer Reverse primer IL-6 TGATGCACTTGCAGAAAACA ACCAGAGGAAATTTTCAATAGGC Accepted IL-17A CAGGACGCGCAAACATGA GCAACAGCATCAGAGACACAGAT IFN-γ GGATGCATTCATGAGTATTGC GCTTCCTGAGGCTGGATTC Occludin GCTTATCTTGGGAGCCTGGACA GTCATTGCTTGGTGCATAATGATTG ZO-1 AGGACACCAAAGCATGTGAG GGCATTCCTGCTGGTTACA Rpl32 AAGCGAAACTGGCGGAAAC TAACCGATGTTGGGCATCAG
Advances Table 3 Primers for detection of intestinal total fungi (18S rDNA), bacteria (16S rDNA) and several specific bacteria related to IBD at the genus level. β actin was used as an internal standard. Amplicon Forward primer (5´–3´) Reverse primer (5´–3´) RSC 16S (341F&534R) ATTACCGCGGCTGCTGG ATTACCGCGGCTGCTGG
18S ATTGGAGGGCAAGTCTGGTG CCGATCCCTAGTCGGCATAG
β actin ATGACCCAGATCATGTTTGA TACGACCAGAGGCATACAG
Bacteroides CTGAACCAGCCAAGTAGCG CCGCAAACTTTCACAACTGACTTA
Alistepes TTAGAGATGGGCATGCGTTGT TGAATCCTCCGTATT
Lactobacillus GCAGCAGTAGGGAATCTTCCACAAT GCTCGCTTTACGCCCAAT Page 31 of 31 RSC Advances
Clostridium cluster XIVa AAATGACGGTACCTGACTAA CTTTGAGTTTCATTCTTGCGAA
Lachnospiracea incertae GYGAAGAAGTATTTCGGTAT CCAACACCTAGTATTCATC
sedis
butyryl-CoA/acetate-CoA GCIGAICATTTCACITGGAAYWSITGG CCTGCCTTTGCAATRTCIACRAANG
transferase CAYATG C
Helicobacter ACCAAGGC(A/T)ATGACGGGTATC CGGAGTTAGCCGGTGCTTATT
Manuscript Accepted Advances RSC