Jonchère et al. BMC Physiology 2012, 12:10 http://www.biomedcentral.com/1472-6793/12/10

RESEARCH ARTICLE Open Access Identification of uterine ion transporters for mineralisation precursors of the avian eggshell Vincent Jonchère, Aurélien Brionne, Joël Gautron and Yves Nys*

Abstract Background: In Gallus gallus, eggshell formation takes place daily in the hen uterus and requires large amounts of 2+ - the ionic precursors for calcium carbonate (CaCO3). Both elements (Ca , HCO3) are supplied by the blood via trans-epithelial transport. Our aims were to identify coding for ion transporters that are upregulated in the uterine portion of the oviduct during eggshell calcification, compared to other tissues and other physiological states, and incorporate these proteins into a general model for mineral transfer across the tubular gland cells during eggshell formation. Results: A total of 37 candidate ion transport genes were selected from our database of overexpressed uterine genes associated with eggshell calcification, and by analogy with mammalian transporters. Their uterine expression was compared by qRTPCR in the presence and absence of eggshell formation, and with relative expression levels in 2+ - 2+ - magnum (low Ca /HCO3 movement) and duodenum (high rates of Ca /HCO3 trans-epithelial transfer). We identified overexpression of eleven genes related to calcium movement: the TRPV6 Ca2+ channel (basolateral uptake of Ca2+), 28 kDa calbindin (intracellular Ca2+ buffering), the endoplasmic reticulum type 2 and 3 Ca2+ pumps (ER uptake), and the inositol trisphosphate receptors type 1, 2 and 3 (ER release). Ca2+ movement across the apical membrane likely involves membrane Ca2+ pumps and Ca2+/Na+ exchangers. Our data suggests that Na+ transport involved the SCNN1 channel and the Na+/Ca2+ exchangers SLC8A1, 3 for cell uptake, the Na+/K+ ATPase for cell output. K+ uptake resulted from the Na+/K+ ATPase, and its output from the K+ channels (KCNJ2, 15, 16 and KCNMA1). - - We propose that the HCO3 is mainly produced from CO2 by the carbonic anhydrase 2 (CA2) and that HCO3 is - - - 2+ + secreted through the HCO3/Cl exchanger SLC26A9. HCO3 synthesis and precipitation with Ca produce two H . Protons are absorbed via the membrane’sCa2+ pumps ATP2B1, 2 in the apical membrane and the vacuolar - - - (H+)- at the basolateral level. Our model incorporate Cl ions which are absorbed by the HCO3/Cl exchanger SLC26A9 and by Cl- channels (CLCN2, CFTR) and might be extruded by Cl-/H+ exchanger (CLCN5), but also by Na+ K+ 2Cl- and K+ Cl- cotransporters. Conclusions: Our Gallus gallus uterine model proposes a large list of ion transfer proteins supplying Ca2+ and - HCO3 and maintaining cellular ionic homeostasis. This avian model should contribute towards understanding the mechanisms and regulation for ionic precursors of CaCO3, and provide insight in other species where epithelia transport large amount of calcium or bicarbonate. Keywords: Ion, Mineral, Calcium, Transporter, Uterus, Eggshell, Chicken

* Correspondence: [email protected] INRA, UR83 Recherches Avicoles, F-37380, Nouzilly, France

© 2012 Jonchère et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Jonchère et al. BMC Physiology 2012, 12:10 Page 2 of 17 http://www.biomedcentral.com/1472-6793/12/10

Background uterine calbindin levels and Ca2+ flux [11,13,14]. This Biomineralisation is a process by which living organisms protein could also take part in maintaining low intracel- develop mineral structures to perform a variety of roles lular Ca2+ to avoid cell death as observed in other spe- related to support, defence and feeding. Amongst these, cies and tissues [15]. Ca2+ secretion from epithelial cells a large number of animals (birds, molluscs, foraminifera, to the uterine fluid is active involving a Ca2+ ATPase, corals, sea urchins) mineralises by co-precipitation of the activity of which varies with the stage of eggshell cal- 2+ 2- calcium (Ca ) and carbonates (CO3 ) to form a protect- cification [4,7]. A recent study [16] identified and loca- ive shell or a skeleton. The prerequisite for shell min- lized the plasma membrane Ca2+ ATPase isoform 4 eralisation is the supply of large amounts of Ca2+ and (PMCA4) in the apical membrane of epithelial cells of 2- + CO3 in a limited extracellular milieu by trans-cellular king quail. The disruption of sodium (Na ) re- transport, requiring the presence of ion channels, ion absorption by specific inhibitors in perfused uterus or pumps and ion exchangers. In Gallus gallus, eggshell in vitro reduced Ca2+ secretion by 50% [9,17], revealing formation takes place daily in the hen uterus and is one a strong relationship between Na+ and Ca2+ transfers of the most rapid mineralisation processes [1]. It and therefore the putative presence of Na+/Ca2+ exchan- + + requires large amount of calcium carbonate (CaCO3)as gers in uterine cells. The Na /K ATPase responsible for the hen exports the equivalent of her body weight as Na+ re-absorption in the plasma membrane is charac- eggshell in one year of egg production (>1.5 kg). Both terised and is upregulated during the period of shell 2+ - elements (Ca and HCO3) are not stored in the uterus calcification [18]. but are continuously supplied during eggshell formation The second essential component of eggshell mineral- by the blood plasma via trans-epithelial transport taking isation is carbonate. Blood carbon dioxide (CO2) is pro- place across the uterine glandular cells [2-4]. Early stud- vided in cells by passive diffusion through the plasma ies determined the ion concentrations of the uterine membrane [2,19]. In the uterine tubular gland cells, a fluid, which bathes the eggshell and changes during the family of key , the carbonic anhydrases (CA) [6] - sequential stages of calcification (Table 1) [5], identified catalyses the hydration of CO2 to HCO3 as confirmed by - several proteins involved in ion transport [3,6,7], and inhibition of HCO3production and secretion by acetazo- recorded changes in ion fluxes across the uterine epithe- lamide, a CA inhibitor [9]. Chloride (Cl-) is absorbed by lium in response to inhibitors [8-10]. the uterus and any perturbation of Na+ flux by ouabain These classic approaches led to a hypothesis concerning [9] reverses both the Na+ and Cl- fluxes, but reduces also - the mechanisms of ion transfer through the uterine glan- HCO3 secretion suggesting that its transfer is dependent 2+ - - - dular cells (Figure 1; [1]). In hens, the Ca blood on Cl via a Cl /HCO3 exchanger which has not been -4 - (1.2 mM) and epithelial cell concentrations (10 mM), identified. Finally, the production of HCO3 in tubular 2+ 2+ 2- suggest that Ca entry in cell is passive via a Ca chan- gland cells and of CO3 in the uterine fluid generates nel, which remains unidentified. The intracellular Ca2+ high levels of protons (H+) ions. The concomitant de- transport through the cell involves 28 kDa calbindin crease in uterine and plasma pH during calcification [3,11,12]. The 28 kDa calbindin expression is greatly reflects the reabsorption of H+ [5]. upregulated during eggshell formation and falls after Only a few genes and related proteins involved in uter- suppression of calcification (by premature egg expul- ine ion transfer have been identified to date. Our object- sion), suggesting a very close relationship between ive therefore was to use the recent information issuing from the chicken genome sequencing [20] and subse- Table 1 PH and ion concentrations in blood plasma, quent enrichment in the chicken /protein databases uterine fluid and epithelial cells during eggshell to identify uterine ion transport proteins. Use of a recent mineralisation[5] transcriptomic study revealing uterine genes related to Blood plasma Epithelial cells Uterine fluid eggshell calcification [21] and of the analogies with 8 h PO 18 h PO transporters previously described in mammalian tissues Ions [mM] [mM] [mM] [mM] transferring large quantities of ions (intestine, kidney, Ca2+ 1.2 <0.0002 6 10 pancreas) allows the identification of putative genes en- Na+ 140 12 144 80 coding proteins involved in uterine trans-epithelial ion K+ 4 139 12 60 transports. Confirmation of their presence in birds and - evaluation of their involvement have been analysed by HCO3 23 12 60 110 comparing in the uterus compared to pH 7.4 7.0-7.4 7.6 7.1 the magnum (the oviduct segment responsible for the Cl- 130 4 71 45 synthesis and secretion of egg white proteins) and the The eggshell precursors are secreted in the uterine fluid where the eggshell 2+ mineralization daily takes place from 10 hours to 22 hours post ovulation (yolk duodenum (Ca uptake and neutralization of stomach 2+ - entry in the oviduct). PO: post ovulation. acid), where both Ca and HCO3 trans-epithelial Jonchère et al. BMC Physiology 2012, 12:10 Page 3 of 17 http://www.biomedcentral.com/1472-6793/12/10

Figure 1 Classic hypothesis concerning ion transfers in the hen uterus during eggshell calcification [1,5,8-10]. Ca2+ entry in cell is passive via a Ca2+ channel, 28 kDa calbindin contributes to intracellular transfer and maintenance of a low Ca2+ level. Ca2+ secretion involving a Ca2+ 2+ + ATPase and a Ca /Na exchanger. Carbonic anhydrase has a key role in providing carbonate from plasma CO2. transfers are respectively low and high. The magnum to the magnum (egg white protein secretion) [21] and and the uterus secrete a large amount of water, Na+ and analogies with transporters previously described in Cl- during the phase of hydration of egg albumen which mammalian tissues at the intestinal and kidney level takes place before the active phase of eggshell formation [24,26]. A list of 37 genes was therefore selected as can- in the uterus [5,22]. By contrast, the duodenum is the didates possibly involved in uterine trans-epithelial ion proximal region of the intestine with a high capacity for transfers (Table 2). To facilitate identification of candi- Ca2+ absorption [23] and secretes a large amount of dates in the manuscript, we have only used the gene - HCO3 for neutralization of gastric acidity [24,25]. An symbol for describing both genes and proteins. additional experimental approach was the comparison of gene expression in the uterus isolated from hens at the Uterine expression of the 37 genes encoding ion stage of eggshell formation, to those for which eggshell transporters formation was suppressed by premature egg expulsion. The mRNA expression of 37 transporters was analysed We identified a large number of genes coding for ion by RT-PCR in the uterus, and three other ion secreting transport and propose a general model describing the or absorbing epithelia (magnum, duodenum and kidney) putative contribution and localisation of the ion trans- and in muscle where no trans-epithelial ion transfer porters in the tubular gland cell of the hen’s uterus. occurs (Additional file 1: Table 1). Amongst these 37 genes, mRNA expression was observed in the uterus for Results 34 genes. Three genes (the endoplasmic Ca2+ pump type Identification of uterine ion transporters 1(ATP2A1), two exchangers Na+ dependent (SLC4A8) - - The first step of this work was to establish a list of ion or independent (SLC4A9) Cl /HCO3 were not expressed transporters potentially involved in supplying eggshell in the uterus and were not further studied. minerals. The ion transfer model established in the A large majority of these 34 genes were also revealed Gallus gallus uterus (Figure 1) using physiological data in the duodenum. Conversely, SLC4A8 was expressed [5,8,9] was used to produce a first list of genes encoding only in duodenum. Four genes were revealed only in the ionic transporter proteins. This approach was completed uterus and were not present in the magnum (TRPV6, by using a recent transcriptomic study revealing genes CALB1, SCNN1B and SLC26A9) or in muscle (CALB1, overexpressed in the uterus (shell formation) compared SCNN1B, SLC4A10 and CLCN2). The 34 genes revealed Jonchère et al. BMC Physiology 2012, 12:10 Page 4 of 17 http://www.biomedcentral.com/1472-6793/12/10

Table 2 Function of genes potentially involved in the ion transfer for supplying eggshell mineral precursors in hen uterus Name Gene symbol Functional data Transfer type Transient receptor potential cation channel TRPV6 Ca2+ channel (plasma membrane) subfamily V member 6 Calbindin 28 K CALB1 [11,14,28]Ca2+ intracellular transporter (intracellular) Endoplasmic reticulum calcium ATPase 1 ATP2A1 Ca2+ATPases (endoplasmic & plasma membrane) Endoplasmic reticulum calcium ATPase 2 ATP2A2 Endoplasmic reticulum calcium ATPase 3) ATP2A3 IP3 receptor1 ITPR1 Ca2+ channels (endoplasmic membrane) IP3 receptor2 ITPR2 IP3 receptor3 ITPR3 Ryanodine receptor 1 RYR1 Ca2+ channel (endoplasmic membrane) Plasma membrane calcium-transporting ATP2B1 Ca2+/H+ exchanger (plasma membrane) ATPase 1 (PMCA1) Plasma membrane calcium-transporting ATP2B2 ATPase 2 (PMCA2) Plasma membrane calcium-transporting ATP2B4 [16] ATPase 4 (PMCA4) Sodium/calcium exchanger 1 SLC8A1 Na+/Ca2+ exchanger (plasma membrane) Sodium/calcium exchanger 3 SLC8A3 Amiloride-sensitive sodium channel subunit SCNN1A [31]Na+ channels (plasma membrane) alpha Amiloride-sensitive sodium channel subunit SCNN1B [31] beta Amiloride-sensitive sodium channel subunit SCNN1G [31] gamma Sodium/potassium-transporting ATPase subunit ATP1A1 [18]Na+/K+ exchanger (plasma membrane) alpha-1 Sodium/potassium-transporting ATPase subunit ATP1B1 [18] beta-1 + - Solute carrier family 4 member 4 SLC4A4 Na /HCO3 co-transporters (plasma membrane) Solute carrier family 4 member 5 SLC4A5 Solute carrier family 4 member 7 SLC4A7 Solute carrier family 4 member 10 SLC4A10 Inward rectifier potassium channel 2 KCNJ2 Inward rectifiers K+ channels (plasma membrane) Inward rectifier potassium channel 5 KCNJ15 Inward rectifier potassium channel 16 KCNJ16 Calcium-activated potassium channel subunit KCNMA1 K+ channel (plasma membrane) alpha-1 - Carbonic anhydrase 2 CA2 [6] Catalyse HCO3 formation (plasma membrane) Carbonic anhydrase 4 CA4 Carbonic anhydrase 7 CA7 - - Solute carrier family 4 member 8 SLC4A8 HCO3/Cl exchangers (plasma membrane) Solute carrier family 4 member 9 SLC4A9 Solute carrier family 26 member 9 SLC26A9 Vacuolar H ATPase B subunit osteoclast ATP6V1B2 H+ pump (organelles and plasma membrane isozyme Cystic fibrosis transmembrane conductance CFTR Cl- channel (plasma membrane) regulator Chloride channel protein 2 CLCN2 Cl- channel (plasma membrane) H(+)/Cl(−) exchange transporter 5 CLCN5 Cl-/H+ exchanger (plasma membrane) Jonchère et al. BMC Physiology 2012, 12:10 Page 5 of 17 http://www.biomedcentral.com/1472-6793/12/10

in the uterus are candidates for supplying ions in pump type 2 and 3 (ATP2A2, 3), inositol the uterus. trisphosphate receptor type 1, 2, 3 (ITPR1, 2, 3), Ca2± pumps PMCA type 1, 2 and 4 Comparative expression of ion transfer genes between (ATP2B1, 2, 4) and Ca2±/Na± exchanger type 1, 3 uterus and other secreting tissues (SLC8A1, 3). The expression of the 34 genes encoding proteins poten- (2) Na+ transfer: amiloride-sensitive Na+ channel tially involved in uterine ion transfer were quantitatively subunit α, β, and γ (SCNN1A, B, G), Na±/K± evaluated by comparing their gene expression in the transporting ATPase subunit α and β (ATP1A1, B1), uterus to those of two other tissues (magnum, duode- Ca2±/Na± exchanger type 1 and 3 (SLC8A1, 3), 2+ - ± - num) where Ca and HCO3 trans-epithelial transport several Na /HCO3 co-transporters are at low and high levels, respectively. After normalisa- (SLC4A4, 5, 7, 10). tion, the fold changes in gene expression between uterus (3) K+ transfer: Na±/K± transporting ATPase subunit vs magnum and uterus vs duodenum was statistically α and β (ATP1A1, B1) and several K± channels analysed (Figure 2). (KCNJ2, 15, 16, KCNMA1). - Amongst the 34 comparisons of gene expression be- (4) HCO3 production and transfer: CAs type 2, 4, 7, - - tween the uterus and the magnum, only one gene (the rya- (CA2, 4, 7), an HCO3/Cl exchanger (SLC26A9), ± - nodine receptor 1) was not differentially expressed. The 33 and several Na /HCO3 co-transporters other genes showed higher levels of gene expression in the (SLC4A4, 5, 7, 10). uterus than in the magnum (fold change of Ut/Ma up to (5) H+ transfer: VH± ATPase pump subunit B 12 ln). Amongst these 33 genes, 16 genes (underlined in (ATP6V1B2), and Cl-/H+ exchanger (CLCN5). the following list) are not differentially expressed between (6) Cl- transfer: CFTR channel (CFTR), Cl- channel - - uterus and duodenum suggesting they are equally import- protein 2 (CLCN2), an HCO3/Cl ant in both tissues able to absorb or secrete large amounts exchanger (SLC26A9) and a Cl-/H+ exchanger 2+ - of Ca and HCO3. These 33 gene candidates suspected to (CLCN5). be involved in uterine ionic transfer corresponded to: Fourteen genes amongst the 33 were overexpressed in (1) Ca2+ transfer: TRPV Ca2± channel (TRPV6), the uterus compared with the duodenum. This overex- calbindin 28 kDa (CALB1), endoplasmic Ca2± pression of transporters in the uterus relative to the

Figure 2 Relative expression of genes coding ion transporters in chicken uterus compared to magnum or duodenum. Gene expression of ion transporters for eggshell mineralisation were quantitatively evaluated by qRT-PCR in the uterus (eggshell formation) and compared to 2+ - those of magnum and duodenum where Ca and HCO3 trans-epithelial transport are at low and high levels, respectively. Jonchère et al. BMC Physiology 2012, 12:10 Page 6 of 17 http://www.biomedcentral.com/1472-6793/12/10

duodenum is indicative of genes whose function is more precursors. We compared expression of these genes in uterine specific. They corresponded to: the uterus when calcification takes place or after its sup- pression due to premature expulsion of the eggs for 3–4 (1) Ca2+ transfer: endoplasmic Ca2+ pump type 3 consecutive days. The early egg expulsion eliminates the 2+ - (ATP2A3), inositol trisphosphate receptors Ca and HCO3 requirement for shell formation, and (ITPR1, 2), Ca2+ pumps PMCA2 (ATP2B2) and eliminates the mechanical stimulation of the uterine wall Ca2+/Na+ exchanger type 3 (SLC8A3). due to the presence of the egg, which is known to upre- (2) Na+ transfer: amiloride-sensitive Na+ channel gulate expression of certain genes. Fold changes in gene subunit α, β, and γ (SCNN1A, B, G), Ca2+/Na+ expression between the calcifying or inactive uterus are + - exchanger type 3 (SLC8A3), Na /HCO3 presented in Figure 3. co-transporters (SLC4A5). Twelve genes amongst 33 were overexpressed in the pres- (3) K+ transfer: several K+ channels (KCNJ2, 16 ence of eggshell calcification compared to hens in which and KCNMA1). shell formation had been suppressed (67 fold change): - + - (4) HCO3 production and transfer: Na /HCO3 co-transporters (SLC4A5). (1) Ca+2+ transfer: 28 kDa calbindin (CALB1), (5) Cl- transfer: Cl- channel protein 2 (CLCN2) endoplasmic Ca2+ pump type 3 (ATP2A3), and and CFTR channel (CFTR). Ca2+ pumps PMCA2 (ATP2B1, 2). (2) Na+ transfer: amiloride-sensitive Na+ channel Three genes are underexpressed in the uterus com- subunit γ (SCNN1G) and Na+/K+ transporting pared with the duodenum suggesting that their function ATPase subunit α (ATP1A1). is more specific to the duodenum: (3) K+ transfer: Na+/K+ transporting ATPase subunit α (ATP1A1) and the K+ channels (KCNJ2, (1) Ca2+ transfer: Ca2+ pumps PMCA1 (ATP2B1). KCNJ15 and KCNMA1). - - (2) HCO3 production and transfer: CA type 7 (CA7). (4) HCO3 production and transfer: carbonic anhydrase + - + - - - (3) H transfer and (4) Cl transfer: H /Cl CA type 2 (CA2), an HCO3/Cl exchanger exchanger (CLCN5). (SLC26A9). (5) Cl- transfer: the Cl- channel (CFTR) and an - - Comparative expression of genes in the presence or HCO3/Cl exchanger (SLC26A9). absence of eggshell formation This model was explored to reveal regulation of gene ex- In contrast, 2 genes corresponding to a Ca2+/H+ + - pression associated with the process of shell formation exchanger (ATP2B4) and to a Na /HCO3 co-transporter and to discern some of the ionic transport proteins more (SLC4A7) showed an underexpression when eggshell likely to be involved in supplying shell mineral calcification takes place.

Figure 3 Comparison of ion transporter gene expression in the presence (Calcif) and absence of eggshell calcification (No Calcif). Jonchère et al. BMC Physiology 2012, 12:10 Page 7 of 17 http://www.biomedcentral.com/1472-6793/12/10

Nineteen of the 33 uterine genes did not show any fold mineral precursors in the hen’s uterus. Analysis of their change between these two physiological conditions: expression by RT-PCR, showed that 34 of these genes were expressed at the uterine level. In order to study 2+ 2+ 2+ - (1) Ca transfer: TRPV Ca channel (TRPV6), their involvement in providing both Ca and HCO3 for endoplasmic Ca2+ pump type 2 (ATP2A2), eggshell formation, the expression of these 34 genes in inositol trisphosphate receptors (ITPR1, 2, 3), and the uterus was quantified by qRT-PCR and compared Ca2+/Na+ exchanger type 1 and 3 (SLC8A1, 3). with two other epithelia (magnum and duodenum) + + 2+ - (2) Na transfer: amiloride-sensitive Na channel where Ca and HCO3 transfers are respectively low and subunit α and γ (SCNN1A, B), Na+/K+ transporting high. In addition, the expression of these genes was ATPase subunit β (ATP1B1), Ca2+/Na+ compared in the uterus during two situations: during + - 2+ - exchanger type 1 and 3 (SLC8A1, 3), Na /HCO3 eggshell calcification and when Ca and HCO3 secre- co-transporters (SLC4A4, 5, 10). tions were suppressed due to premature egg expulsion. (3) K+ transfer: Na+/K+ transporting ATPase subunit β These approaches allowed the identification of numer- (ATP1B1) and a K+ channel (KCNJ16). ous transporting proteins providing minerals for shell - (4) HCO3 production and transfer: CA type 4, 7 formation in the hen’s uterus. + - (CA4, 7), several Na /HCO3 co-transporters (SLC4A4, 5, 10). Ca2+ transfer (5) Cl- transfer: Cl- channel protein 2 (CLCN2) and Ca2+ is not stored in the uterus before eggshell calcifica- H+/Cl- exchanger (CLCN5). tion but comes from blood plasma by trans-epithelial (6) H+ transfer: VH+ ATPase pump subunit B transport. This Ca2+ export is extremely rapid during (ATP6V1B2) and H+/Cl- exchanger (CLCN5). calcification and corresponds to a consumption of the total plasmatic Ca2+ pool every 12 min. Studies of Ca2+ Discussion transfer in vivo using perfusion of uterus [8,9] and Eggshell calcification in the avian uterus is one of the in vitro exploring the effects of inhibitors of ion ATPases fastest mineralisation processes in the living world. The or carbonic anhydrase [10,31], and ionic analysis of uter- Ca2+ metabolism is intense in Gallus gallus hens which ine fluid during eggshell formation [5], made it possible export a large amount of Ca2+ (2 g daily) and conse- to build a first model of Ca2+ transfer in the uterus 2+ - + quently there are numerous physiological adaptations to (Figure 1): Ca , HCO3 secretion and Na reabsorption support this function [1,27-30]. In fact, an egg- was considered to occur against their electrochemical producing hen shows a specific appetite for Ca2+ a few gradient, to involve active intracellular transfer as shown hours before shell calcification is initiated and its cap- by specific inhibitors [8-10] and to occur in the uterine acity to absorb Ca2+ in the intestine increases by 6-fold glandular cells as revealed by immunohistochemistry of due to large stimulation of the active metabolite of vita- transport proteins [32]. Trans-epithelial transfer of Ca2+ min D at the kidney level. The uterus acquires the cap- occurs in three steps as observed in all transporting epi- 2+ - 2+ acity to transfer a great quantity of Ca and HCO3 for thelia: Ca influx through a downhill gradient, an intra- supplying mineral precursors of the eggshell during less cellular Ca2+ transport involving calbindin 28 kDa than 14 hours. This model is therefore particularly rele- protein [33] and active output into the lumen through a vant to explore the mechanisms of mineral transport Ca2+ pump [4]. The high plasma Ca2+ concentration needed for the extracellular biomineralisation of the egg- (1.2 mM free Ca2+) relative to the uterine cell interior shell. In this study, we focused on intracellular ionic (10-4 mM free Ca2+) (Table 1) suggests that the Ca2+ transporters and did not explore the proteins involved in entry into cells passively occurs via Ca2+ selective chan- their regulation. This process has been the object of nels present in the basolateral plasma membrane. In many physiological and pharmacological works as other tissues, such as intestine, kidney and plasma, reviewed by Nys [1] and Bar [30]. However, the molecu- TRPVs 5, 6 (Transient Receptor Potential Vanilloid) are lar identification of ionic transporters remains incom- epithelial channels that represent the principal pathway plete in the uterus. Genome sequencing in human and for Ca2+ uptake into the cell [26,34]. Our study showed other mammalian species has contributed to the mo- that in Gallus gallus, only one gene [NCBI Gene ID: lecular identification of genes and related proteins 418307; Swiss-Prot: TRPV6] is present. This channel is involved in ionic trans-epithelial transfer in the intestine significantly overexpressed in the uterus compared with and kidneys [24,26]. By using this literature and data the magnum, where Ca2+ transfer is low. Its uterine ex- provided by a recent high throughput analysis of chicken pression is similar to that of the duodenum where Ca2+ uterine genes related to eggshell calcification [21], we absorption is also large. Cellular Ca2+ influx might use a identified 37 putative genes encoding ion trans-epithelial similar Ca2+ channel, TRPV6, at the intestinal and uter- transporters and tested their involvement in providing ine level but their localisation is hypothesized to differ Jonchère et al. BMC Physiology 2012, 12:10 Page 8 of 17 http://www.biomedcentral.com/1472-6793/12/10

according to the site of Ca2+ influx, being located in the The inositol 1, 4, 5-trisphosphate receptors (ITPR) are basal membrane in the uterus but in the apical mem- intracellular Ca2+ channels, localised mainly in the endo- brane in the intestine. The uterine expression of TRPV6 plasmic reticulum [41,42] and allowing the release of is not however modified according to whether calcifica- Ca2+ from this organelle. The three isoforms (ITPR1, 2 3) tion takes place. The presence of other Ca2+ channels were overexpressed in the uterus compared to the mag- cannot be ruled out as additional putative candidates. A num but were not modified when comparing the presence recent transcriptomic study in our laboratory comparing or absence of calcification. The higher expression of uterine gene expression in hens with or without shell ITPR1 and ITPR 2 in the uterus compared to the calcification revealed the presence of high expression of duodenum supports our hypothesis concerning their con- TRPC1, TRPP, TRPM7, TRPML1 and ORAI 1 (unpub- tribution to the regulation of intra-cellular Ca2+. The rya- lished data, Brionne A, Nys Y and Gautron J). nodine receptors which are involved in muscle excitation- An intracellular Ca2+ buffer is crucial to keep the free contraction coupling in mammalian tissues [38] are alter- cytosolic Ca2+ concentration below toxic levels. Follow- native channels for Ca2+ release from the endoplasmic ing Ca2+ entry into the uterine glandular cell, several reticulum. RYR1 expression was revealed in the uterus, systems could contribute to intracellular transport of but there was no difference between the uterus, magnum Ca2+, while maintaining the low but essential free Ca2+ or duodenum, suggesting a weak involvement in endo- concentration for survival of the cell. In certain tissues, plasmic reticulum Ca2+ release. In conclusion, these calbindin proteins, 9 kDa and 28 kDa in mammals [15] observations of high expression of genes encoding ATP2A or 28 kDa in birds [3,35], are present at high cytosolic pumps and ITPR Ca2+ channels involved in Ca2+ uptake concentration and possess high Ca2+ binding capacity. and release in endoplasmic reticulum suggest the involve- Direct correlation has been demonstrated between their ment of this organelle in intracellular Ca2+ buffering in mucosal concentration and the efficiency of Ca2+ trans- uterine glandular cells. fer in intestine and uterus under numerous experimental The last step of uterine Ca2+ trans-epithelial transport conditions [26,28,30]. It is generally accepted that calbin- is output from the glandular cells, which occurs against dins facilitate the diffusion of intracellular Ca2+ and serve a concentration gradient. Ca2+ secretion towards the as a Ca2+ buffer needed for cell protection against Ca2+ uterine fluid occurs via an active process, involving the stress and accompanying apoptotic cellular degradation Ca2+ ATPase [7,32,43]. This has recently been associated that is induced by a high intracellular Ca2+ concentration with the PMCA4 (plasma membrane ATPase Ca2+) [16]. [15,36,37]. In our study, we observed an elevated expres- Four isoenzymes (ATP2B1, B2, B3 and B4) of PMCAs sion of calbindin 28 kDa in the uterus during calcification pumps are identified in mammals [44]. Only three of an eggshell compared to the magnum (Figure 2) and (ATP2B1, B2, B4) are conserved in birds. Each of these compared to the uterus with no shell in formation (fold were overexpressed in the uterus compared to the mag- difference in expression: 67) in agreement with previous num (Figure 2). ATP2B2 was also overexpressed in the studies [11,14,28]. This uterine calbindin 28 kDa is there- uterus compared to the duodenum, and in presence of fore associated with intracellular Ca2+ transport from the the eggshell mineralisation (Figure 3) suggesting a more basal membrane of the glandular cells to the apical mem- active role in Ca2+ secretion at the uterine level. In con- brane where Ca2+ is extruded into the uterine fluid. trast, ATP2B1 and ATP2B4 were underexpressed in the An alternative system in mammals to maintain a low uterus compared to duodenum and for ATP2B4 in pres- intracellular Ca2+ concentration relies on the endoplas- ence of shell formation. In mammals, it is ATP2B1 mic reticulum which contributes to Ca2+ homeostasis which plays a more important role in intestinal Ca2+ ab- through its capacity for Ca2+ uptake and storage [38,39]. sorption [26,45]. In other bird species, Parker et al. [16] The endoplasmic reticulum Ca2+ ATPases(ATP2A1,2,3) localized the plasma membrane Ca2+-transporting play an active role in Ca2+ uptake by this organelle (reach- ATPase 4 (ATP2B4) in the apical membrane of uterine ing 10 to 100 mM free Ca2+), while maintaining the cyto- epithelial cells but did not explore the presence of plasmic concentration at low concentrations of 10-4 mM ATP2B2 and its differential expression during calcifica- free Ca2+. Amongst the three isoenzymes (Table 2), only tion. In human osteoblasts, the isoforms 1 and 2 take ATP2A2 and ATP2A3 were overexpressed in the uterus part in the Ca2+ supply necessary for bone mineralisa- compared to the magnum. The absence of ATP2A1 ex- tion whereas the isoform 4 is not detected [46]. pression fits with its predominant localisation in mamma- It was observed thirty years ago that the inhibition of lian muscle in contrast to ATP2A2 and ATP2A3 which Na+ transfer by Na+/K+ ATPase inhibitors considerably are expressed in numerous tissues [40]. The overexpres- reduced Ca2+ secretion into the uterine lumen [9,17], sion of ATP2A3 in the uterus compared to duodenum showing a coupling between uterine Ca2+ secretion and suggests a more crucial role of this transporter, the regula- Na+ re-absorption. The uterine absorption of Na+ is tion of which remained to be explored. revealed by the decreased Na+ concentrations in the Jonchère et al. BMC Physiology 2012, 12:10 Page 9 of 17 http://www.biomedcentral.com/1472-6793/12/10

uterine fluid observed between the early stage of shell by the uterine glandular cells at the apical membrane. calcification and the end of calcification (Table 1). These The γ subunit (SCNN1G) was overexpressed during observations support the hypothesis that Na+/Ca2+ shell calcification in contrast to the α and β subunits exchangers participate in the uterine Ca2+ secretion. The (SCNN1A, 1B) suggesting its predominant involvement role of these transporters is clearly established at the in the uterus. mammalian intestinal and renal level [47]. Our study In the basolateral membrane, the Na+ glandular cell supported this mechanism for Ca2+ secretion in the output towards plasma is active and occurs against a chicken uterus, as both Na+/Ca2+ exchangers (SLC8A1 large electrochemical gradient (Table 1). This is provided and 3) were overexpressed in the uterus compared to the by the Na+/K+ ATPase, which is crucial in all animals magnum, whereas their expression did not change in the for actively transporting Na+ out and K+ into the cell, presence or absence of eggshell mineralisation (Figures 2 and for maintaining the membrane potential and active and 3). The mammalian exchangers allow the cell output transport of other solutes in intestine, kidney or placenta of one Ca2+ ion against three Na+ ions at the basolateral [34,53]. Its presence in the avian uterus and crucial role membrane level. This transport is facilitated by the Na+ in ionic transfer during shell formation has been demon- gradient, which provides the energy necessary for the Ca2+ strated [8-10,17]. In situ hybridization in the chicken output against its gradient [34,47]. Similarly, the respective uterus [18] showed that only the α1 subunit of Na+/K+ Na+ gradient between the cell (12 mM) and the uterine ATPase (ATP1A1), is present in the uterus whereas the fluid (80 to 144 mM, Table 1) may provide the bird uterus α2 and α3 subunits (ATP1A2, A3) are absent. In this with the energy needed for the Ca2+ output towards the study, the α1 subunit (ATP1A1), but also the β1 subunit uterine fluid at the apical membrane of the glandular cells. of Na+/K+ ATPase (ATP1B1), were overexpressed in the Conversely, the unfavourable gradient of Na+ concentra- uterus compared to the magnum. We also confirmed tions between blood (140 mM) and glandular cells at the the overexpression of α1 subunit of Na+/K+ ATPase basal membrane level will prevent Ca2+ uptake in the cells during the phase of calcification in contrast to the by exchange with Na+.BothNa+/Ca2+ exchangers β1subunit of Na+/K+ ATPase, in agreement with (SLC8A1 and 3) are therefore predicted to be present Lavelin et al. [18]. only in the apical membrane of the uterine glandular cells. The possibility of an uptake of Na+ from plasma The co-expression of the SLC8A1 and 3 genes and of into the uterine glandular cells at the basal membrane 2+ + - ATP2BX is observed in numerous Ca transporting epi- via Na /HCO3 co-transporters (SLC4A4, 5, 7, 10) is dis- 2+ - thelia [48-51] but their respective involvements in Ca flux cussed in the section addressing HCO3 transfer. has been questioned. Na+/Ca2+ exchangers have a weak af- finity for Ca2+,butstrongCa2+ conductance. On the other K+ secretion hand, the Ca2+ ATP2BX pumps have a strong affinity for In the gastrointestinal or kidney epithelia, K+ channels Ca2+, but a weaker conductance [26]. These data suggest that provide the driving force for electrogenic transport pro- Ca2+ transport is mainly assured by the Na+/Ca2+ exchan- cesses across membranes and are involved in cell volume gers. In the hen uterus, the inhibition of the Na+/K+ ATPase regulation or in secretory and reabsorptive processes. K+ led to a 60% decrease in Ca2+ transport in vitro or during channels are crucial for maintenance of body homeosta- uterine perfusion [9,17]. This observation underlines the im- sis and form the largest group of ion channels in mam- portance of the Na+/Ca2+ exchangers in the avian uterus. mals as more than one hundred thirty genes have been The information on uterine Ca2+ transport is summar- identified in human [54,55]. The chicken database ized in the model described in Figure 4. revealed more than 80 such genes in birds. We explored only a limited number of K+ channel candidates in Na+ transfer chicken uterus by selecting 4 K+ channels overexpressed During eggshell calcification, Na+ is absorbed from the in uterus compared to their expression in magnum, as uterine fluid into the blood plasma. This absorption revealed in our hen transcriptomic study [21]. The resulting from the predominance of apical to basolateral increased K+ concentrations in uterine fluid between flux relative to basolateral to apical flux, is partly due to early (8 hours) and late stages of calcification (Table 1), the presence of the Na+/Ca2+ exchangers (SLC8A1 and 3), demonstrates that uterine K+ net flow corresponds to a but a complementary system has been demonstrated by secretion into uterine fluid. A portion of K+ secretion using epithelial Na+ channel blockers [31]. Amiloride- might be associated with the passive component of sensitive Na+ channels are essential in various epithelia water secretion which occurs during the egg plumping [52]. Three subunits (SCNN1A, 1B, 1 G) of the Na+ at the early stage of shell calcification (up to 10 hours) channel are overexpressed in the uterus compared to but no experimental data has explored this contribution the magnum and to the duodenum (Figure 2), suggest- through a putative paracellular pathway. K+ uptake at ing the involvement of these transporters in Na+ uptake the basolateral membrane, from the blood plasma Jonchère et al. BMC Physiology 2012, 12:10 Page 10 of 17 http://www.biomedcentral.com/1472-6793/12/10

Figure 4 New and general model describing uterine ion transporters during eggshell calcification. The hypotheses concerning the transfer of ions through the uterine glandular cells are described in conclusion. towards the uterine glandular cells, should result from subunit α) was stimulated during calcification (Figure 3). activities of the Na+/K+ ATPases (ATP1A1, B1). By ana- These results showed that KCNJ2, 15, 16, and KCNM K+ logy with other intestinal, kidney, pancreatic, placenta, channels are involved in the maintenance of potential mammary glands or blood cells, we expect that K+ chan- membrane and K+ recycling during eggshell calcification nels present in the glandular cell will recycle K+ to allow and have therefore been introduced in the model functioning of the active Na+/K+ ATPases. We tested 4 (Figure 4). We propose to localize them in the apical genes: three coding K+ channels (KCNJ2, 15, 16) and membrane but we have no evidence that they are absent one K+ large conductance Ca2+ activated channel from the basolateral membranes. (KCNMA1), which could be involved in K+ cell output - (Tables 1 and 3). The KCNJ2, 15, 16 channels belong to HCO3 production and transfer the KCNJ family (potassium inwardly-rectifying channel, Eggshell mineralisation results from the co-precipitation + 2+ - subfamily J) which are stimulated by external K concen- of Ca and HCO3. The bicarbonate precursor of the tration. Their expressions are observed in numerous epi- eggshell calcite is mainly derived from the blood carbon + thelia where K secretion occurs [54-56]. The KCNMs dioxide (CO2) which penetrates the uterine glandular (K+ large conductance Ca2+ activated channels, subfam- cells by simple diffusion through the plasma membrane ily M) participate in K+ output in a large range of tissues [2,19]. Carbonic anhydrases (CAs) [6] catalyse the hydra- 2+ - and epithelia and are regulated by Ca cellular levels tion of intracellular CO2 to HCO3, which is secreted into [54-56]. Our results showed that the expression of the uterine fluid. In the mammalian gastrointestinal KCNJ2, 15, 16 and KCNMA1 K+ channels were higher tract, including pancreas, the cellular and membrane in the uterus compared with the magnum. Moreover, bound CAs are key enzymes allowing secretion or re- the expression of KCNJ2, 15 and KCNMA1 (KCNM absorption of large amount of acid across the mucosa or Jonchère et al. BMC Physiology 2012, 12:10 Page 11 of 17 http://www.biomedcentral.com/1472-6793/12/10

protect epithelial cells from acid injury by secreting bi- (Figure 2). SLC4A7 is underexpressed in the uterus dur- carbonate [24,25,57]. In all mammalian species, the duo- ing calcification compared to its absence (Figure 3) sug- denum buffers gastric acid secretion by producing gesting that involvement of this transporter is limited - intracellular HCO3 from CO2 at a higher rate than the during the eggshell calcification process. In mammals, + - stomach or distal small intestine. The CO2 originates Na /HCO3 co-transporters mediate the electroneutral + - from intestinal lumen at the duodenal level but is pro- movement of Na and HCO3 across the plasma mem- vided from blood plasma via the respiratory system to brane [58]. The ionic concentrations in the plasma and the uterine tissue [1]. This study showed a larger expres- uterine glandular cells (Table 1) show a favourable con- sion of the cytosolic CA2 and 7 and of the membrane centration gradient for uptake of these ions, supporting bound CA4 in the chicken uterus than in magnum the localisation of these transporters in the basolateral - (Figure 2). No difference in expression was observed be- membrane of uterine glandular cells to allow HCO3 tween the uterus and the duodenum for CA2 and 4. entry. However, previous studies [2,19] showed that - Cytoplasmic CA2 is the predominant CA in the duode- the majority of HCO3 used for the eggshell came from num, playing a major function in the hydration of CO2 blood CO2 and only for a minor part from plasma - - + - to produce HCO3 [25]. Similarly, we propose that CA2 HCO3.Na/HCO3 co-transporters (SLC4A4, 5, 10) are - plays a major role in the uterus to provide the carbonate likely to have a minor role in HCO3 supply to the uter- precursor for the eggshell. CA7 is significantly underex- ine glandular cells. The cystic fibrosis transmembrane pressed in the uterus compared to the duodenum, sug- conductance regulator (CFTR) contributes to fluid secre- - gesting a secondary rule in HCO3 uterine production. A tion from epithelial cells of the lung, pancreas and intes- major role for CA2 is supported by the overexpression tine, as shown in pathological situations associated with - - of this CA gene in the presence of eggshell mineralisa- impaired fluid production, Cl and HCO3 secretion due tion, in contrast to CA4 and 7 (Figure 3). to defective CFTR [63,64] or in pharmacological studies - The HCO3 produced by CA2 in uterine glandular cells of reproductive epithelium [65]. Its contribution to - must be then secreted into the uterine fluid to build the HCO3 secretion is unlikely because of the unfavourable eggshell. In mammalian pancreas [57] and in duodenum gradient or it is possibly indirect through regulation of - - - [25] which secrete large amounts of HCO3 towards the HCO3 transporters [65]. Its role as a Cl channel is dis- - - - lumen, anion HCO3/Cl exchangers (SLC4AX) have cussed in the following section on Cl . Studies using spe- + - - - been located in apical membrane and Na /HCO3 co- cific inhibitors and measuring Cl and HCO3 flows are - - transporters (SLC26AX) at the basolateral membrane needed to quantify the contribution of HCO3/Cl - [58,59]. In the bird uterus, there is a strong association exchangers in HCO3 uterine secretion. - - between HCO3 secretion and Cl transport [9,31] which - - supports the involvement of HCO3/Cl exchangers. The - + HCO3 flow through the uterine apical membrane is an H transfer - electrogenic process which is facilitated by output of HCO3 production in the glandular epithelial cells, its se- intracellular Cl-, via an exchanger of the SLC26 electro- cretion into uterine fluid and the co-precipitation of 2- 2+ genic family [31,57]. Our study confirmed the expression CO3 with Ca leads to a progressive acidification of the - - + of a HCO3/Cl exchanger (SLC26A9) in the uterus as uterine fluid and of glandular cells [1,5]. In fact, two H shown in other epithelial cells [59]. SLC26A9 is sus- are produced for each CaCO3 formed. This metabolic - pected to have a role in intestinal HCO3 secretion, in acidosis is partially compensated by hyperventilation by particular to neutralise gastric acidity [60,61]. Our the hen and by an increased renal H+ excretion [22]. results showed an overexpression of SLC26A9 exchanger The plasma membrane Ca2+ -transporting ATPases in the uterus compared to the magnum or when the cal- (ATP2B1, 2) of the apical membrane actively extrude cification takes place, whereas no variation of expression Ca2+, as previously mentioned. However several lines of was observed between the duodenum and the uterus evidence have established that these pumps contribute (Figure 2). These observations suggest a common mech- to H+ re-absorption coupled to Ca2+ secretion [66,67]. anism between both tissues and support the hypothesis The present study highlights their crucial role in Ca2+ of the involvement of this transporter in the supply of secretion by uterine glandular cells during eggshell - + - + HCO3 for eggshell calcification. Na /HCO3 co- formation and therefore in H re-absorption from the transporter genes (SLC4A4, 5, 7, 10; [58,62]) are also uterine fluid through the apical membrane. Alternatively, - + + expressed in the uterus and likely contribute to HCO3 the Na /H exchangers have been shown to contribute transport. SLC4A4, 5, 7 and 10 showed higher expres- to H+ output in the pancreatic duct which also secretes - sion in the uterus than in the magnum. An overexpres- large amount of HCO3. In a recent transcriptomic study sion relative to the duodenum is observed only for of the uterus (unpublished data, Brionne A, Nys Y and SLC4A5, the three others being similarly expressed Gautron J), we detected expression of various Na+/H+ Jonchère et al. BMC Physiology 2012, 12:10 Page 12 of 17 http://www.biomedcentral.com/1472-6793/12/10

exchangers (SLC9A 1, 2, 6, 7, 8, 9), supporting this The CLCN2 channel, a family member of the CLCN possibility. (Cl- channel), is relatively ubiquitous in epithelial cells In this study, RT-PCR shows that the V H+ ATPase and other cellular types [74,75]. It is considered to par- pump (VAT) is expressed in the bird uterus during calci- ticipate in various functions such as cellular volume fication. In mammals, this VAT complex is made up of regulation [76,77], cardiac activity regulation [78,79] and at least 14 subunits and allows transfer of H+ by hy- Cl- trans-epithelial transfer [80,81]. Our study revealed drolysis of ATP [68,69]. This VAT is present in many that the CLCN2 channel is overexpressed in the uterus membranes of organelles and also frequently in the compared to the magnum or the duodenum (Figure 2). plasma membranes of renal cells or osteoclasts [70]. The uterine fluid (>45 mM) and intracellular (4 mM) Cl- VAT is therefore a good candidate for transferring pro- concentrations are favourable to a Cl- passive entry in tons to plasma in the hen uterine glandular cell, espe- uterine glandular cells. In parallel, another Cl- channel, cially as this VAT was revealed in other species the cystic fibrosis transmembrane conductance regulator + - producing CaCO3 biominerals and shown to export H (CFTR) could also contribute to Cl entry in the cell as during mineralisation [71,72]. This proton ATPase observed in numerous tissues [74]. In the chicken extrudes H+ across the basolateral membrane of pancre- uterus, the CFTR channel is expressed at a higher level atic duct epithelium [57] which is secreting high than in the magnum and the duodenum (Figure 2). It is - amounts of HCO3 using mechanisms quite similar to also overexpressed in the uterus during eggshell calcifi- uterine glandular cells. Our study reveals overexpression cation (Figure 3). The CLCN2 and CFTR channel are of the VAT subunit B in the uterus, which transfers large therefore probably expressed in the apical membrane amounts of H+ compared with the magnum, where lim- and might contribute to Cl- entry in the cell. ited amounts of H+ are transferred. The VAT is likely to On the other hand, Cl- output could be carried out by participate in H+ export from cytoplasm of the uterine CLCN5, another member of CLCN family. Renal prox- cells to the blood plasma across the plasma membrane. imal tubule cells highly express the V H+ ATPase for The role of CLCN5 in H+ transfer is discussed in the en- acidification of endosomes and electroneutrality is suing Cl- section. ensured by transfer of Cl- by CLCN5 [74]. The CLCN5 H+/Cl- exchanger [75] has been localised mainly in or- ganelle membranes but also in the plasma membrane. Cl- transfer Our study revealed an overexpression of CLCN5 H+/Cl- The Cl- concentrations decrease from 71 to 45 mM in in the uterus compared to the magnum, so this channel the uterine fluid (Table 1) when comparing the initial might contribute to Cl- output through the basal mem- and late stage of eggshell calcification in parallel with brane. An alternative would be that Cl- output relies on changes of larger magnitude in Na+ concentrations. The cation-coupled cotransport as observed in fish or mam- high concentration of these ions observed at the early mals. The SLC12 family consists of Na+-K+-2Cl- cotran- stage of calcification might result from the large secre- sporters and of K+-Cl- electroneutral cotransporters, and tions of water, Na+ and Cl- which occurs during the are expressed either in kidney where they contribute to plumping period (hydration of the egg white proteins), 6 salt reabsorption, or more ubiquitously being involved in to 10 h after ovulation possibly through a paracellular cell volume regulation [82-84]. In the chicken uterus, pathway [1]. These water and saline secretions are com- one Na+-K+-2Cl- cotransporter (SLC12A2) and 4 K+-Cl- pleted at the initiation of the rapid phase of shell forma- cotransporters (SLC12A4, 7, 8, 9) are putative candidate, tion, when Na+ and Cl- net fluxes are inversed. The net as expression of these genes is revealed in the chicken flux of Cl- is inhibited by acetazolamide, demonstrating uterus transcriptome (unpublished data, Brionne A, Nys - - the relationship between Cl transport and HCO3 secre- Y and Gautron J). In addition, furosemide, a blocker of tion derived from CAs activity [8,9,31], and the involve- Na+-K+-2Cl- cotransporters, has been shown to decrease - - ment of HCO3/Cl exchangers of the SLC4 or SLC26 egg shell thickness [85]. - - family [57,62,73]. Amongst the SLC4Ax HCO3/Cl exchangers, we observed no expression of SLC4A8 and Conclusions there is no evidence of any expression of SLC4A1, 2 or 3 Initial studies on ion transfer in the uterus using physio- in avian uterine transcriptomic study [21]. The role of logical and pharmacological approaches provided a pre- SLC26A9 exchanger was previously discussed in the liminary model of ion transfer contributing to the - 2+ - HCO3 section. This exchanger is predicted to be located uterine Ca and HCO3 necessary for shell mineralisa- in the apical membrane of the uterine glandular cells tion (Figure 1) [1,5,8-10,17]. The current approaches and to contribute to Cl- cell uptake during eggshell cal- using knowledge gleaned from the chicken genome se- cification as suggested in hens subjected to acetazola- quence and uterine transcriptomic expression data [21] mide inhibitors [31] or in other species [57,59]. identified numerous genes encoding putative transporters Jonchère et al. BMC Physiology 2012, 12:10 Page 13 of 17 http://www.biomedcentral.com/1472-6793/12/10

Table 3 Primers used for RT-PCR and qRT-PCR of ion transporter genes Gene symbol RefSeq accession Forward primer Reverse primer TPRV6 XM_416530 AACACCTGTGAAGGAGCTGGTGAG TCTGCTGCTTGTTTTGTTGCC CALB1 NM_205513 CAGGGTGTCAAAATGTGTGC GCCAGTTCTGCTCGGTAAAG ATP2A1 NM_205519 AAGGGGGGGTCTTTAAGGATGG CAAACTGCTCCACCACCAACTC ATP2A2 XM_415130 GCAGCTTGCATATCTTTTGTGCTG CATTTCTTTCCTGCCACACTCC ATP2A3 NM_204891 CAACCCCAAGGAGCCTCTTATC GGTCCCTCAGCGTCATACAAGAAC ITPR1 XM_414438 AATGGCAAAAGGCGAGGAAAGC GGAGCAGCAGCAAGCGGG ITPR2 XM_001235612 TGAGCATTGTGAGTGGCTTC GTTGACCTGGCTGTCCAAAT ITPR3 XM_418035 AGTACAACGTGGCCCTCATC GTCGTGTCTGCTCTCCATGA RYR1 X95266 GTTCCTCTGCATCATCGGCTAC AATTGCTGGGGAAGGACTGTG ATP2B1 XM_416133 CTGCACTGAAGAAAGCAGATGTTG GCTGTCATATACGTTTCGTCCCC ATP2B2 XM_001231767 TTACTGTACTTGTGGTTGCTGTCCC GGTTGTTAGCGTCCCTGTTTTG ATP2B4 XM_418055 GCTGGTGAAGTTGTCATCCGTC TGCTCTGAAGAAAGCTGATGTTGG SLC8A1 NM_001079473 GGATTGTGGAGGTTTGGGAAGG CTGTTTGCCAGCTCGGTATTTC SLC8A3 XM_001231413 GGAGAGACCACAACAACAACCATTC AGCTACGAATCCATGCCCACAC SCNN1A NM_205145 GCTTGCCAGAAAACAGTCCCTC AGTCAGACTCATCCAGGTCTTTGG SCNN1B XM_425247 ATGGAAGTAGACCGCAGT GTTGTATGGCAGCACAGT SCNN1G XM_414880 CAAAAGGCACTTCACCCGTTTC GGACAATGATCTTGGCTCCTGTC ATP1A1 NM_205521 GCACAAAGAAGAAAAAGGCGAAGG GGGTGGAGGTGTAAGGGTATTTG ATP1B1 NM_205520 TCTGGAACTCGGAGAAGAAGGAG GACGGTGAGCAACATCACTTGG SLC4A4 XM_420603 GGAAAGCACCATTCTTCGCC CCTCCAAAAGTGATAGCATTGGTC SLC4A5 XM_423797 TGAACGTCTCCGCTACATCCTG ACTTTATCCACCTGGCTGACTCC SLC4A7 XM_418757 AAATTGCCAAGTTCGTGGTGG GCGAAGCAAATGAGAAGTTACGG SLC4A9 XM_001232427 TCCTGACTGGAGTCTCTGTCTTCC AGGTGATCTGGCTGGTGTTTTG SLC4A10 XR_026836 CGCTGATGACAGATGAGGTGTTC GGTGGTTCTATTCGGATTGTTGG KCNJ2 NM_205370 CCATTGCTGTTTTCATGGTG TCCTGGACTTGAGGAGCTGT KCNJ15 XM_425554 TGAGGGAAGGGAGACTCTGA GCTTCCATCCTCACTGCTTC KCNJ16 XM_425383 CATTCCTGTTCTCCCTGGAA CATTTTAGCCAAGGCTGCTC KCNMA1 NM_204224 GGGATGATGCGATCTGTCTT GACAAACCCACAAAGGCACT CA2 NM_205317 ATCGTCAACAACGGGCACTCCTTC TGCACCAACCTGTAGACTCCATCC CA4 XM_415893 GCTAACACATTTTTCCCCCTTCC CTTTATAGCACATCGCATCAGCC CA7 XM_414152 GCACAAGTCTTATCCCATTGCC GCCGTTGTTGGAGATGTTGAGAG SLC4A8 XM_001235579 AGAAGAAGAAGTTGGACGATGCC GGTCAGTTCTGTCCTTGCTGTTCTG SLC26A9 XM_425821 GCCTCTTCGATGAGGAGTTTGAG CTGACCCCACCAAGAACATCAG ATP6V1B2 XM_424534 ATTCTCTGCTGCTGGTTTGCCC CATGGACCCATTTTCCTCAAAGTC CFTR NM_001105666 AAGAGGGCAGGGAAGATCAACGAG CGGGTTAGCTTCAGTTCAGTTTCAC CLCN2 XM_423073 CCTGGACACCAATGTGATGCTG CACGAAGGTCTTCAGGGTGAGATAC CLCN5 XM_420265 CGATTGGAGGAGTGCTCTTTAGTC CAAAAGGATTGATGGAACGCAG supplying the mineral precursors of eggshell mineralisa- intestinal epithelial cells for Ca2+ movement, even if the tion. We have used this information to build a model de- Ca2+ flux is reversed between both uterus and duodenum. scribing the ion supply mechanisms in the uterus, The main steps of ion transfer in the hen’s uterus can following a logical sequence for ion transfers for secretion be summarised (as presented in Figure 4): 2+ - of large amounts of Ca and HCO3 to form the eggshell (Figure 4). This work identified 31 genes and related pro- (1) Ca2+ secretion through epithelial glandular cells teins involved in this process. It is consistent with prelim- involves TRPV6 Ca2+ channel in the basolateral inary hypotheses. Our analysis also revealed that analogies membrane (cell uptake entry), 28 kDa calbindin - 2+ exist in the mechanisms of HCO3 secretion by pancreatic (CALB1, intracellular transfer), endoplasmic Ca duct cells and by duodenum, and to a lower extent with pumps type 2, 3 (ATP2A2, 3, uptake by endoplasmic Jonchère et al. BMC Physiology 2012, 12:10 Page 14 of 17 http://www.biomedcentral.com/1472-6793/12/10

reticulum), and inositol trisphosphate receptors type CaCO3 biomineral such as coral, molluscs, foramin- 1, 2, 3 (ITPR1, 2, 3, output from the reticulum). ifera or sea urchins. Ca2+ is then extruded from the glandular cells by the membrane’sCa2+ pumps (ATP2B1, 2) and Methods Ca2+/Na+ exchangers (SLC8A1, 3). The Animals handling and housing endoplasmic Ca2+ pumps, inositol trisphosphate The experiment was conducted at the Unité Expéri- receptors, and 28 kDa calbindin contribute to mentale Pôle d'Expérimentation Avicole de Tours maintain a low intracellular free Ca2+ concentration (UEPEAT - INRA, Tours, France) according to the legis- essential for cell survival. lation on research involving animal subjects set by the (2) Na+ transport involves three Na+ channels (subunits European Community Council Directive of November SCNN1A, 1B, 1 G; uptake in the cell), Na+/Ca2+ 24, 1986 (86/609/EEC) and under the supervision of an exchangers SLC8A1 and 3 (uptake in the cell) and authorized scientist (Authorization # 7323, J Gautron). the Na+/K+ ATPase (ATP1A1, ATP1B1, output Forty week old laying hens (ISA brown strain) were from the cell). caged individually and subjected to a light/dark cycle of (3) K+ uptake entry into the cell results from the 14 hour light and 10 hour darkness (14 L:10D). The hens Na+/K+ ATPase; the K+ channels (KCNJ2, 15, were fed a layer of mash as recommended by the Institut 16 and KCNMA1) contribute to its output release National de la Recherche Agronomique (INRA). Each at the apical membrane. cage was equipped with a device for automatic recording - (4) HCO3 is mainly produced from CO2 by CA2 and to of oviposition time. a lesser extent by CA4, and is also provided at a + + low level from plasma by the Na /HCO3 Collection of laying hens oviduct tissues - co-transporters (SLC4A4, 5, 10). HCO3 is exported Tissue samples (magnum, uterus, duodenum, kidney - - from the cell through the HCO3/Cl exchanger and gastrocnemius) were harvested in 8 hens while the SLC26A9. egg was in the uterus during the active phase of calcifi- - (5) HCO3 synthesis in the cell and co-precipitation cation (16–18 hour post-ovulation). Additionally, uterine - 2+ of HCO3 with Ca in the uterine fluid produces tissues were collected from 8 birds injected with 50 μg two H+ which are transferred to plasma via the of F2-α prostaglandin during 4 consecutive days to expel membrane Ca2+ pumps ATP2B1, 2 in the apical the egg before mineralisation had begun (6 to 8 hours membrane and the VAT pump at the post ovulation). All tissue samples were quickly frozen basolateral level. in liquid nitrogen and stored at −80°C until RNA (6) Cl- ions in the uterine fluid enter the cell by the extraction. - - - HCO3/Cl exchanger SLC26A9 and by Cl channels (CLCN2, CFTR uptake in the cells), and might be Determination of Gallus gallus cDNA sequences involved extruded by Cl-/H+ exchanger (CLCN5), but in mineral supply and design of primers also by Na+-K+-2Cl- and K+-Cl- cotransporters The list of ion transporters was established using recent (SLC12Ax). transcriptomic data and Gallus gallus databases when available. The transporters not yet identified in chicken This model proposes a large but not exhaustive list were identified using human orthologs in Swiss-Prot/ of ionic transfer proteins involved in the supply of TrEMBL and RefSeq databases. The corresponding 2+ - Ca and HCO3 or in maintaining cellular homeosta- human sequences were aligned to Gallus gallus Refseq sis (volume, electroneutrality). The model qualitatively database using BlastN algorithm an e-value cut-off describes putative mechanisms and cellular localisa- of 10-20. Primers (Table 3), were designed from the tion of the candidates. These hypotheses relying on Gallus gallus using Mac vector software (MacVector, expression of the genes and on analogies with other Cambridge, U.K.). The quality of the primers was tested tissues that transfer large amount of ions, need to be by virtual PCR for dimerization and specificity using confirmed using immunochemistry for their cell local- Amplify 3X software [86]. isation or by specific inhibition, to establish their relative contribution and understand their interaction RNA isolation, reverse transcription and classical and regulation. This avian model where huge Total RNA was extracted from frozen tissue samples 2+ - amounts of Ca and HCO3 are exported daily fol- using a commercial kit (RNeasy Mini kit, Qiagen; lowing a precise spatial and temporal sequence Courtaboeuf, France) and simultaneously treated with should contribute to understanding the mechanism DNase (RNase-free DNase set, Qiagen; Courtaboeuf, and regulation of ionic precursors of CaCO3 France) according to the manufacturer’s procedure. and provide insight for other species secreting a RNA concentrations were measured at 260 nm using Jonchère et al. BMC Physiology 2012, 12:10 Page 15 of 17 http://www.biomedcentral.com/1472-6793/12/10

a NanodropND 1000 (Thermo Fischer, Wilmington, second comparison (uterus with and without calcifica- Delaware, USA). The integrity of RNA was evaluated tion). The log of the ratio was used for statistical analysis on a 2% agarose gel and with an Agilent 2100 Bioa- using the 5th version of StatView, software (SAS Institute nalyser (Agilent Technologies, Massy, France). Only Inc. Cary, NC). A one-way analysis of variance was per- RNA samples with a 28S/18S ratio > 1.3 were consid- formed to detect differences (P < 0.05; 8 replicates/treat- ered for RT-PCR and qRT-PCR experiments. Total ment) in gene expression amongst different conditions. RNA samples (5 μg) were subjected to reverse- Additional file transcription using RNase H-MMLV reverse tran- scriptase (Superscript II, Invitrogen, Cergy Pontoise, Additional file 1: Table 1. RT-PCR of the candidate genes potentially France) and random hexamers (Amersham, Orsay, involved in ion transfer in four secreting tissues and in muscle. France). PCR was performed using primers (Table 3) for 30 cycles at 60°C. The specificity of the PCR reac- Competing interests tion was assessed by sequencing of PCR products The authors declare that they have no competing interests. (Cogenics, Meylan, France), and alignment of the sequences using BLASTN algorithm against the Authors' contributions VJ, JG contributed to the strategy, the experimental design, and planning of Gallus gallus RefSeq nucleic data bank. the study. VJ carried out the experiments and analyses, interpreted data and wrote the first draft of the paper. JG is the supervisor of VJ (Ph.D. student). Quantitative RT-PCR (qRT-PCR) AB contributed to the interpretation of data and to the writing of the paper. YN conceived the research program focused on identification of egg Alternatively, cDNA sequences were amplified in real proteins. He was involved in the strategy, the experimental design, data W time using the qPCR Master mix plus for SYBR Green interpretation and was fully involved in the writing of the paper. All authors I assay (Eurogentec, Seraing, Belgium) with the ABI have read and approved the final manuscript.

PRISM 7000 Sequence Detection System (Applied Bio- Acknowledgements systems, France). To account for variations in mRNA The authors gratefully acknowledge the European Community for its extraction and reverse transcription reaction between financial support through the RESCAPE project (RESCAPE Food CT 2006– 036018), and SABRE program (European Integrating project Cutting-Edge samples, mRNA levels were normalized either to riboso- Genomics for Sustainable Animal Breeding Project 016250). VJ thanks the mal 18S rRNA levels for each sample in the first series Region Centre and INRA for financial support. We also thank Magali Berges of comparison (magnum, uterus, and duodenum) or to for her technical assistance and Jean Didier Terlot-Brysinne for care of experimental birds. We wish to thank Prof. Maxwell Hincke, Department of TBP (TATA box binding protein) for each samples in Cellular & Molecular Medicine, University of Ottawa, 451 Smyth Road, Ottawa the second series of comparison (comparison of expres- K1H 8 M5, Canada, for his critical reading of the manuscript and constructive sion in the uterus with and without mineralisation). The remarks. expression levels of 18S rRNA were measured using Received: 24 April 2012 Accepted: 16 August 2012 TaqMan Universal PCR Master Mix and developed Taq- Published: 4 September 2012 Man assay for human 18S rRNA (Applied Biosystems, Courtaboeuf, France) as previously validated [87]. The References 1. Nys Y, Hincke MT, Arias JL, Garcia-Ruiz JM, Solomon SE: Avian eggshell PCR conditions consisted of an uracil-N-glycosylase pre- mineralization. Poult Avian Biol Rev 1999, 10(3):143–166. incubation step at 50°C for 2 min, followed by a denatur- 2. Hodges R, Lörcher K: Possible sources of the carbonate fraction of egg ation step at 95°C for 10 min, and 40 cycles of shell calcium carbonate. Nature 1967, 216:606–610. 3. Lippiello L, Wasserman RH: Fluorescent-antibody localization of vitamin-D- amplification (denaturation for 15 sec at 95°C, annealing dependent calcium-binding protein in oviduct of laying hen. J Histochem and elongation for 1 min at 60°C). A melting curve was Cytochem 1975, 23(2):111–116. carried out from 60 to 95°C for each sample amplified 4. Coty WA, McConkey CL: A high-affinity calcium-stimulated activity W in the hen oviduct shell gland. Arch Biochem Biophys 1982, 219(2):444–453. with SYBR Green. Each run included triplicates of no 5. Sauveur B, Mongin P: Comparative study of uterine fluid and egg template controls, standards and samples. Standards cor- albumen in shell gland of hen. Ann Biol Anim Biochim Biophys 1971, respond respectively to a pool of the magnum, uterus, 11(2):213–224. 6. Common RH: The carbonic anhydrase activity of the hen oviduct. J Agri and duodenum RT products for the first series of experi- Soc Univ Coll Wales 1941, 31:412–414. ments and of the uterus with and without mineralisation 7. Pike JW, Alvarado RH: Ca2 + −Mg2 + −activated atpase in shell gland of for the second series of comparison. The threshold cycle japanese-quail (Coturnix-coturnix-japonica). Comp Biochem Physiol B 1975, 51(1):119–125. (Ct), defined as the cycle at which fluorescence rises 8. Eastin WC, Spaziani E: Control of calcium secretion in avian shell gland above a defined base line, was determined for each sam- (Uterus). Biol Reprod 1978, 19(3):493–504. ple and cDNA control. A calibration curve was calcu- 9. Eastin WC, Spaziani E: On the mechanism of calcium secretion in the avian shell gland (Uterus). Biol Reprod 1978, 19(3):505–518. lated using the Ct values of the cDNA control samples 10. Pearson TW, Goldner AM: Calcium-transport across avian uterus - Effects and relative amount of unknown samples were deduced of electrolyte substitution. Am J Physiol 1973, 225(6):1508–1512. from this curve. The ratio value was calculated for each 11. Nys Y, Mayel-Afshar S, Bouillon R, Vanbaelen H, Lawson DEM: Increases in calbindin D-28 k messenger-Rna in the uterus of the domestic-fowl sample as sample/18 S rRNA in the first comparison induced by sexual maturity and shell formation. Gen Comp Endocrinol (magnum, uterus, and duodenum) or sample/TBP in the 1989, 76(2):322–329. Jonchère et al. BMC Physiology 2012, 12:10 Page 16 of 17 http://www.biomedcentral.com/1472-6793/12/10

12. Striem S, Bar A: Modulation of quail intestinal and egg-shell gland 37. Christakos S, Dhawan P, Benn B, Porta A, Hediger M, Oh GT, Jeung EB, calbindin (Mr 28000) gene-expression by vitamin-D3, Zhong Y, Ajibade D, Dhawan K, et al: Vitamin D molecular mechanism of 1,25-dihydroxyvitamin-D3 and egg-laying. Mol Cell Endocrinol 1991, action. Ann N Y Acad Sci 2007, 1116:340–348. 75(2):169–177. 38. Gorlach A, Klappa P, Kietzmann T: The endoplasmic reticulum: Folding, 13. Nys Y, Zawadzki J, Gautron J, Mills AD: Whitening of brown-shelled eggs: calcium homeostasis, signaling, and redox control. Antioxid Redox Signal mineral composition of uterine fluid and rate of protoporphyrin 2006, 8(9–10):1391–1418. deposition. Poult Sci 1991, 70(5):1236–1245. 39. Rossi D, Barone V, Giacomello E, Cusimano V, Sorrentino V: The 14. Bar A, Striem S, Mayel-afshar S, Lawson DEM: Differential regulation of sarcoplasmic reticulum: An organized patchwork of specialized domains. calbindin-D28K mRNA in the intestine and eggshell gland of the laying Traffic 2008, 9(7):1044–1049. hen. J Mol Endocrinol 1990, 4(2):93–99. 40. Periasamy M, Kalyanasundaram A: SERCA pump isoforms: Their role in 15. Christakos S, Barletta F, Huening M, Dhawan P, Liu Y, Porta A, Peng X: calcium transport and disease. Muscle Nerve 2007, 35(4):430–442. Vitamin D target proteins: Function and regulation. J Cell Biochem 2003, 41. Vermassen E, Parys JB, Mauger JP: Subcellular distribution of the inositol 88(2):238–244. 1,4,5-trisphosphate receptors: functional relevance and molecular 16. Parker SL, Lindsay LA, Herbert JF, Murphy CR, Thompson MB: Expression determinants. Biol Cell 2004, 96(1):3–17. and localization of Ca2 + −ATPase in the uterus during the reproductive 42. Patterson RL, van Rossum DB, Kaplin AI, Barrow RK, Snyder SH: Inositol cycle of king quail (Coturnix chinensis) and zebra finch (Poephila 1,4,5-trisphosphate receptor/GAPDH complex augments Ca2+ release via guttata). Comp Biochem Physiol A 2008, 149(1):30–35. locally derived NADH. Proc Natl Acad Sci USA 2005, 102(5):1357–1359. 17. Pearson TW, Goldner AM: Calcium-transport across avian uterus.II. Effects 43. Lundholm CE: DDE-induced eggshell thinning in birds: Effects of p, p'- of inhibitors and nitrogen. Am J Physiol 1974, 227(2):465–468. DDE on the calcium and prostaglandin metabolism of the eggshell 18. Lavelin I, Meiri N, Genina O, Alexiev R, Pines M: Na + −K+−ATPase gene gland. Comp Biochem Physiol C 1997, 118(2):113–128. expression in the avian eggshell gland: distinct regulation in different 44. Strehler EE, Zacharias DA: Role of in generating cell types. Am J Physiol Regul Integr Comp Physiol 2001, 281(4):R1169–R1176. isoform diversity among plasma membrane calcium pumps. Physiol 19. Lörcher K, Zscheile C, Bronsch K: Rate of CO2 and C14 exhalation in laying Rev 2001, 81(1):21–50.46. hens resting and during egg-shell mineralisation after a single injection 45. Howard A, Legon S, Walters JRF: Human and rat intestinal plasma- of NaHC1403. Ann Biol Anim Biochim Biophys 1970, 10:133–139.20. membrane calcium-pump isoforms. Am J Physiol 1993, 20. Consortium ICGS: Sequence and comparative analysis of the chicken 265(5):G917–G925.47. genome provide unique perspectives on vertebrate evolution. Nature 46. Kumar R, Haugen JD, Penniston JT: Molecular-cloning of a plasma- 2004, 432(7018):695–716. membrane calcium-pump from human osteoblasts. J Bone Miner Res 21. Jonchère V, Rehault-Godbert S, Hennequet-Antier C, Cabau C, Sibut V, 1993, 8(4):505–513. Cogburn LA, Nys Y, Gautron J: Gene expression profiling to identify 47. Philipson KD, Nicoll DA: Sodium-calcium exchange: A molecular eggshell proteins involved in physical defense of the chicken egg. BMC perspective. Annu Rev Physiol 2000, 62:111–133. Genomics 2010, 11:57. 48. Belkacemi L, Bedard I, Simoneau L, Lafond J: Calcium channels, 22. Sauveur B: Electrolyte composition of different zones of egg albumen in transporters and exchangers in placenta: a review. Cell Calcium 2005, 2 breeds of hen. Ann Biol Anim Biochim Biophys 1969, 9(4):563–573. 37(1):1–8. 23. Bronner F, Pansu D: Nutritional aspects of calcium absorption. J Nutr 1999, 49. Herchuelz A, Kamagate A, Ximenes H, Van Eylen F: Role of Na/Ca exchange 129(1):9–12. and the plasma membrane Ca2 + −ATPase in beta cell function and 24. Kaunitz JD, Akiba Y: Duodenal carbonic anhydrase: Mucosal protection, death. Ann N Y Acad Sci 2007, 1099:456–467. luminal chemosensing, and gastric acid disposal. Keio J Med 2006, 50. Ruknudin AM, Lakattaa EG: The regulation of the Na/Ca exchanger and 55(3):96–106. plasmalemmal Ca2+ ATPase by other proteins. Ann N Y Acad Sci 2007, 25. Flemström G, Allen A: Gastroduodenal mucus bicarbonate barrier: 1099:86–102. protection against acid and pepsin. Am J Physiol Cell Physiol 2005, 51. Blaustein MP, Juhaszova M, Golovina VA, Church PJ, Stanley EF: Na/Ca 288(1):1–19. exchanger and PMCA localization in neurons and astrocytes - Functional 26. Bouillon R, Van Cromphaut S, Carmeliet G: Intestinal calcium absorption: implications. Ann N Y Acad Sci 2002, 976:356–366. Molecular vitamin D mediated mechanisms. J Cell Biochem 2003, 52. Garty H: Molecular-properties of epithelial, amiloride-blockable 88(2):332–339. Na + channels. FASEB J 1994, 8(8):522–528. 27. Hurwitz S: Calcium homeostasis in birds. Vitam Horm 1989, 45:173–221. 53. Jorgensen PL, Hakansson KO, Karlish SJD: Structure and mechanism of Na, 28. Nys Y: Regulation of plasma 1,25 (OH)2D3, of osteocalcin and of K-ATPase: Functional sites and their interactions. Annu Rev Physiol 2003, intestinal and uterine calbindin in hens.InAvian Endocrinology. Edited by 65:817–849. Sharp PJ. Bristol: Society for Endocrinology; 1993:345–357. 408p. 54. Heitzmann D, Warth R: Physiology and pathophysiology of potassium 29. Nys Y: Régulation endocrinienne du metabolisme calcique chez la poule et channels in gastrointestinal epithelia. Physiol Rev 2008, 88(3):1119–1182. calcification de la coquille. 6th edition. Paris: Thèse de Docteur de l’université 55. Hebert SC, Desir G, Giebisch G, Wang WH: Molecular diversity and en Physiologie animale; 1990:162p. regulation of renal potassium channels. Physiol Rev 2005, 85(1):319–371. 30. Bar A: Calcium transport in strongly calcifying laying birds: Mechanisms 56. Warth R: Potassium channels in epithelial transport. Pflugers Arch 2003, and regulation. Comp Biochem Physiol A 2009, 152(4):447–469. 446(5):505–513. 31. Vetter AE, O'Grady SA: Sodium and anion transport across the avian 57. Steward MC, Ishiguro H, Case RM: Mechanisms of bicarbonate secretion in uterine (shell gland) epithelium. J Exp Biol 2005, 208(3):479–486. the pancreatic duct. Annu Rev Physiol 2005, 67:377–409. 32. Wasserman RH, Smith CA, Smith CM, Brindak ME, Fullmer CS, Krook L, 58. Romero MF, Fulton CM, Boron WF: The SLC4 family of HCO3- transporters. Penniston JT, Kumar R: Immunohistochemical localization of a calcium- Pflugers Arch 2004, 447(5):495–509. pump and calbindin-D28k in the oviduct of the laying hen. 59. Dorwart MR, Shcheynikov N, Yang D, Muallem S: The solute carrier 26 Histochemistry 1991, 96(5):413–418. family of proteins in epithelial ion transport. Physiol 2008, 23(2):104–114. 33. Wasserman RH, Taylor AN: Vitamin D3-induced calcium-binding protein in 60. Xu J, Henriksnas J, Barone S, Witte D, Shull GE, Forte JG, Holm L, Soleimani chick intestinal mucosa. Science 1966, 152(3723):791–793. M: SLC26A9 is expressed in gastric surface epithelial cells, mediates Cl-/ 34. Hoenderop JGJ, Nilius B, Bindels RJM: Calcium absorption across epithelia. HCO3- exchange, and is inhibited by NH4+. Am J Physiol Cell Physiol 2005, Physiol Rev 2005, 85(1):373–422. 289(2):C493–C505. 35. Jande S, Tolnai S, Lawson D: Immunohistochemical localization of vitamin 61. Xu J, Song PH, Miller ML, Borgese F, Barone S, Riederer B, Wang ZH, Alper D-dependent calcium-binding protein in duodenum, kidney, uterus and SL, Forte JG, Shull GE, et al: Deletion of the chloride transporter cerebellum of chickens. Histochemistry 1981, 71(1):99–116. Slc26a9 causes loss of tubulovesicles in parietal cells and impairs acid 36. Lambers TT, Mahieu F, Oancea E, Hoofd L, de Lange F, Mensenkamp AR, secretion in the stomach. Proc Natl Acad Sci USA 2008, Voets T, Nilius B, Clapham DE, Hoenderop JG, et al: Calbindin-D-28 K 105(46):17955–17960. dynamically controls TRPV5-mediated Ca2+ transport. EMBO J 2006, 62. Alper SL: Molecular physiology of SLC4 anion exchangers. Exp Physiol 25(13):2978–2988. 2006, 91(1):153–161. Jonchère et al. BMC Physiology 2012, 12:10 Page 17 of 17 http://www.biomedcentral.com/1472-6793/12/10

63. Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S: Aberrant 86. Engels WR: Contributing software to the internet - the amplify program. CFTR-dependent HCO3- transport in mutations associated with cystic Trends Biochem Sci 1993, 18(11):448–450. fibrosis. Nature 2001, 410(6824):94–97. 87. Gautron J, Murayama E, Vignal A, Morisson M, McKee MD, Rehault S, Labas 64. Hug MJ, Tamada T, Bridges RJ: CFTR and bicarbonate secretion to V, Belghazi M, Vidal ML, Nys Y: Cloning of ovocalyxin-36, a novel chicken epithelial cells. News Physiol Sci 2003, 18:38–42. eggshell protein related to lipopolysaccharide-binding proteins, 65. Chan HC, Shi QX, Zhou CX, Wang XF, Xu WM, Chen WY, Chen AJ, Ni Y, bactericidal permeability-increasing proteins, and plunc family proteins. Yuan YY: Critical role of CFTR in uterine bicarbonate secretion and the J Biol Chem 2007, 282(8):5273–5286. fertilizing capacity of sperm. Mol Cell Endocrinol 2006, 250(1–2):106–113. 66. Niggli V, Sigel E, Carafoli E: The Purified Ca-2+ Pump of Human- doi:10.1186/1472-6793-12-10 Erythrocyte Membranes Catalyzes an Electroneutral Ca-2+−H + Exchange Cite this article as: Jonchère et al.: Identification of uterine ion in Reconstituted Liposomal Systems. J Biol Chem 1982, 257(5):2350–2356. transporters for mineralisation precursors of the avian eggshell. BMC 67. Smallwood JI, Waisman DM, Lafreniere D, Rasmussen H: Evidence That the Physiology 2012 12:10. Erythrocyte Calcium-Pump Catalyzes a Ca-2 + −Nh + Exchange. J Biol Chem 1983, 258(18):1092–1097. 68. Beyenbach KW, Wieczorek H: The V-type H + ATPase: molecular structure and function, physiological roles and regulation. J Exp Biol 2006, 209(4):577–589. 69. Marshansky V, Futai M: The V-type H + −ATPase in vesicular trafficking: targeting, regulation and function. Curr Opin Cell Biol 2008, 20(4):415–426. 70. Nishi T, Forgac M: The vacuolar (H+)-atpases - Nature's most versatile proton pumps. Nat Rev Mol Cell Biol 2002, 3(2):94–103. 71. Furla P, Galgani I, Durand I, Allemand D: Sources and mechanisms of inorganic carbon transport for coral calcification and photosynthesis. J Exp Biol 2000, 203(22):3445–3457. 72. Bertucci A, Tambutte E, Tambutte S, Allemand D, Zoccola D: Symbiosis- dependent gene expression in coral-dinoflagellate association: cloning and characterization of a P-type H(+)-ATPase gene. Proc Biol Sci 2010, 277(1678):87–95. 73. Chang MH, Plata C, Zandi-Nejad K, Sindic A, Sussman CR, Mercado A, Broumand V, Raghuram V, Mount DB, Romero MF: Slc26a9-Anion exchanger, channel and Na + transporter. J Membr Biol 2009, 228(3):125–140. 74. Jentsch TJ, Stein V, Weinreich F, Zdebik AA: Molecular structure and physiological function of chloride channels. Physiol Rev 2002, 82(2):503–568. 75. Duran C, Thompson CH, Xiao Q, Hartzell HC: Chloride Channels: Often Enigmatic, Rarely Predictable. Annu Rev Physiol 2010, 72:95–121. 76. Furukawa T, Ogura T, Katayama Y, Hiraoka M: Characteristics of rabbit ClC-2 current expressed in Xenopus oocytes and its contribution to volume regulation. Am J Physiol 1998, 274(2):C500–C512. 77. Britton FC, Hatton WJ, Rossow CF, Duan D, Hume JR, Horowitz B: Molecular distribution of volume-regulated chloride channels (ClC-2 and ClC-3) in cardiac tissues. Am J Physiol Heart Circ Physiol 2000, 279(5):H2225–H2233. 78. Britton FC, Wang GL, Huang ZM, Ye LD, Horowitz B, Hume JR, Duan DY: Functional characterization of novel alternatively spliced ClC-2 chloride channel variants in the heart. J Biol Chem 2005, 280(27):25871–25880. 79. Huang ZM, Prasad C, Britton FC, Ye LL, Hatton WJ, Duan D: Functional role of CLC-2 chloride inward rectifier channels in cardiac sinoatrial nodal pacemaker cells. J Mol Cell Cardiol 2009, 47(1):121–132. 80. Bosl MR, Stein V, Hubner C, Zdebik AA, Jordt SE, Mukhopadhyay AK, Davidoff MS, Holstein AF, Jentsch TJ: Male germ cells and photoreceptors, both dependent on close cell-cell interactions, degenerate upon ClC-2Cl (−) channel disruption. EMBO J 2001, 20(6):1289–1299. 81. Nehrke K, Arreola J, Nguyen HV, Pilato J, Richardson L, Okunade G, Baggs R, Shull GE, Melvin JE: Loss of hyperpolarization-activated Cl- current in salivary acinar cells from Clcn2 knockout mice. J Biol Chem 2002, 277(26):23604–23611. 82. Hebert SC, Mount DB, Gamba G: Molecular physiology of cation-coupled Submit your next manuscript to BioMed Central – Cl- cotransport: the SLC12 family. Pflugers Arch 2004, 447(5):580 593. and take full advantage of: 83. Adragna NC, Di Fulvio M, Lauf PK: Regulation of K-Cl cotransport: from function to genes. J Membr Biol 2004, 201(3):109–137. 84. Gamba G: Molecular physiology and pathophysiology of electroneutral • Convenient online submission cation-chloride cotransporters. Physiol Rev 2005, 85(2):423–493. • Thorough peer review 85. Lundholm CE, Bartonek M: Furosemide decreases eggshell thicjness and • No space constraints or color figure charges inhibits 45Ca2+ uptale by asubcellular fraction of eggshell gland mucosa of the domestic-Fowl. Comp Biochem Physiol C 1992, 101(2):317–320. • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit