Quick viewing(Text Mode)

Heat Shock Protein 27 Mediates Repression of Androgen Receptor Function by Protein Kinase D1 in Prostate Cancer Cells

Heat Shock Protein 27 Mediates Repression of Androgen Receptor Function by Protein Kinase D1 in Prostate Cancer Cells

(2009) 28, 4386–4396 & 2009 Macmillan Publishers Limited All rights reserved 0950-9232/09 $32.00 www.nature.com/onc ORIGINAL ARTICLE Heat shock 27 mediates repression of function by protein kinase D1 in prostate cells

S Hassan1, MHU Biswas1, C Zhang, C Du and KC Balaji

Division of Urology, Department of Surgery, University of Massachusetts Medical School, Worcester, MA, USA

We have previously shown that protein kinase D1 (Jaggi et al., 2003, 2005; Mak et al., 2008; Syed et al., (PKD1), charter member of PKD protein family, is 2008). Two other independent studies have recently downregulated in advanced prostate cancer (PC) and shown that () is a novel influences androgen receptor (AR) function in PC cells. substrate of PKD1 (Doppler et al., 2005) and there is Other independent studies showed that serine 82 residue ligand-dependent interaction of Hsp27 and AR in PC in heat shock protein 27 (Hsp27) undergoes substrate cells (Zoubeidi et al., 2007). by PKD1 and is associated with nuclear Androgen receptor is a ligand-dependent transcrip- transport of AR resulting in increased AR transcriptional tion factor and member of superfamily, activity. In this study, we show that PKD1 interacts and which has a key role in prostate development and phosphorylates Hsp27 at Ser82 in PC cells, which is malignancy (Simental et al., 1991; Edwards and Bartlett, mediated by p38-dependent -activated protein 2005). In the absence of ligand, AR receptor is kinase pathway and is necessary for PKD1 repression of predominantly cytoplasmic, maintained in an inactive AR transcriptional activity and androgen-dependent but highly responsive state by a large dynamic hetero- proliferation of PC cells. The study provides first in vivo complex composed of Hsps, including . Ligand evidence that Hsp27 is a mediator of repression of AR binding leads to a conformational change in the AR, function by PKD1 in PC cells, thereby linking the data in dissociation from Hsp90 and is translocated to nucleus the published literature. by protein, Hsp27 (Edwards and Bartlett, Oncogene (2009) 28, 4386–4396; doi:10.1038/onc.2009.291; 2005). In addition to androgens, several other ligands, published online 21 September 2009 such as neuropeptides NT and Bom, can activate AR (Lee et al., 2001) and Hsp27 (Yuan and Rozengurt, Keywords: PKD1; Hsp27; AR; p38; prostate cancer 2008), thus circumventing the normal growth inhibition caused by androgen ablation, clinically resulting in castration-resistant PC. Introduction Heat shock protein27 is a ubiquitous and abundantly expressed member of the small Hsp family that has an Protein kinase D1 (PKD1) belongs to a family of novel important role in the regulation of many cellular serine/threonine protein kinases classified as a subfamily functions in response to diverse stress stimuli, , within Ca-calmodulin kinases superfamily (Valverde growth factors and G-protein-coupled receptor agonists et al., 1994; Manning et al., 2002). Earlier studies show (Belka et al., 1995; Haslbeck and Buchner, 2002; that PKD1 has a role in growth, expression, Parcellier et al., 2003; Evans et al., 2008; Yuan and survival, motility, protein trafficking and lymphocyte Rozengurt, 2008). Hsp27 is a chaperone responsible for biology (Wang, 2006; Jaggi et al., 2007; Du et al., refolding of denatured protein (Dudich et al., 1995) and 2009). In intact cells, PKD1 is activated by phorbol is thought to have major role in the regulation of esters, bryostatin-1 (a marine-derived macrolactone), , organization of the cytoskeleton and G-protein-coupled receptor agonists, such as neuroten- cell migration (Haslbeck and Buchner, 2002; Parcellier sin (NT) and bombesin (Bom), and other growth factors et al., 2003). Hsp27 appears in many cell types and it is (Rozengurt et al., 2005; Evans et al., 2008; Jaggi et al., located mainly in , and also in perinuclear region, 2008; Yuan and Rozengurt, 2008). We initially dis- and nucleus (Zoubeidi et al., covered that PKD1 is downregulated in advanced 2007). A high expression level of Hsp27 has inverse prostate cancer (PC), and later described its interaction relationship with cell proliferation; and with E-cadherin, b-catenin and androgen receptor (AR) altered expression levels of different phosphorylated forms of Hsp27 expression is also observed in various Correspondence: Professor KC Balaji, Division of Urology, Depart- (Cornford et al., 2000; Rocchi et al., 2004, 2005; ment of Surgery, University of Massachusetts Medical School, 55 Lake So et al., 2007). Avenue North, Room # S4-868, Worcester, MA-01655, USA. The p38 signaling cascade is one major signaling E-mail: [email protected] 1These authors contributed equally to this work. pathway that regulates Hsp27 (Widmann et al., 1999; Received 19 March 2009; revised 16 July 2009; accepted 17 August 2009; Zoubeidi et al., 2007; Yuan and Rozengurt, 2008). published online 21 September 2009 Hsp27 is directly phosphorylated at serine 15, 78 and 82 Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4387 residues by the p38 kinase substrate mitogen-activated Hsp27 was also detected in cell lysate and the sample protein kinase (MAPK)-activated protein kinase-2, immunoprecipitated by Hsp27 antibody. We also which influences subcellular distribution of Hsp27 observed that the interaction between PKD1 and (Stokoe et al., 1992; Rouse et al., 1994; Geum et al., phosphorylated Hsp27 was increased after stimulation 2002). In addition to well-established p38/MK2/Hsp27 of LNCaP cells with bryostatin-1. Bryostatin-treated or pathway, other studies showed that tumor producing untreated cell lysates were immunoprecipitated with phorbol ester and vascular endothelial growth factor PKD1 or IgG antibodies. After western blotting the stimulate the phosphorylation of Hsp27 through a samples with phosphorylated Hsp27 (Ser82), we found pathway independent of p38 MAPK (Maizels et al., that the presence of phosphorylated Hsp27 was in- 1998; Evans et al., 2008). Vascular endothelial growth creased in bryostatin-treated cells compared with factor has also been shown to activate PKD1, which untreated cells that were absent in IgG antibody-added induces Hsp27 substrate phosphorylation independent sample (Figure 1a, bottom). When the blot was stripped of p38 MAPK (Evans et al., 2008). Data in the literature and reprobed with PKD1 antibody, full-length PKD1 and our current study show that PKD1 can induce was present only in the sample immunoprecipitated by Hsp27 serine 82 residue phosphorylation either directly PKD1 and absent in the IgG antibody-added sample. or through p38-dependent pathway. The dependency We then examined the subcellular colocalization of on p38 pathway for PKD1 activity seems to be PKD1 and Hsp27 in PC cells by immunofluorescence model dependent (Stokoe et al., 1992; Rouse et al., microscopy. Immunofluorescence microscopy experi- 1994; Evans et al., 2008). ments show both PKD1 and Hsp27 in cytosol of Although there is data published in the literature LNCaP cells, as shown in Figure 1b. Cytoplasmic linking interactions among PKD1, Hsp27 and AR, it is colocalization of PKD1 (a), Hsp27 (b), DAPI (40,6- important to establish the evidence that PKD1-Hsp27- diamidino-2-phenylindole) (c) and merge of these AR axis is functional in vivo in PC images (d) in LNCaP cells is shown in the same focal cells, because all three are dysregulated in PC plane. These results corroborate the results from IP and have been shown to influence malignant phenotype experiments that PKD1 and Hsp27 are in close physical of cells. In this study, we confirmed PKD1-Hsp27 proximity in PC cells, suggesting a possible direct or interaction, Ser82 phosphorylation after PKD1 activa- indirect interaction. tion by either pharmacological agent bryostatin-1 or To find out the role of PKD1 in localization of AR in physiopathological stimulants NT and Bom and that nucleus, we have taken C4-2 and PKD1 stably Hsp27 is the mediator of repression of AR transcrip- transfected C4-2 (C4-2/PKD1) cells that were treated tional activity and androgen–AR-dependent cell prolif- with dihydrotestosterone (DHT) overnight. The PKD1 eration by PKD1 in PC cells. The establishment of expression was confirmed by western blot analysis that functional PKD1-Hsp27-AR signal transduction axis in was shown in Figure 1c (top). Immunoflurorescence PC cells, which is responsive to physiopathological assay of AR with C4-2 and C4-2/PKD1 cells showed the stimulants such as Bom and NT that are thought to predominant localization of AR in nucleus in C4-2 cells contribute castration-resistant PC, has potential impli- that was suppressed in PKD1-transfected C4-2 cells. In cations in areas of biomarker discovery, cancer ther- contrast, the cytoplasmic localization of AR is less or apeutics and biology. little in C4-2 cell, but was increased in C4-2/PKD1 cells compared with parental cells. From the results, we concluded that DHT-induced AR was transported by Results PKD1 from nucleus to cytoplasm in PC cells.

PKD1 and Hsp27 are present in the same protein complex in PC cells Physiopathological stimulants NT and Bom and We explored the interaction of PKD1 and Hsp27 in PC pharmacological PKD1 activator (bryostatin-1) cells by immunoprecipitation (IP) assays. Figure 1a phosphorylates Hsp27 at serine 82 in PC cells confirms that PKD1 and Hsp27 are present in the same Neurotensin and Bom are naturally occurring endogen- protein complex. Co-IP assays were performed using ous peptides distributed across species and several whole cell lysate prepared from LNCaP cells, and organs in , including brain, gut and prostate protein complexes immunoprecipitated with PKD1 (Carraway and Leeman, 1976; Martinez and Tache, antibody indicated the presence of Hsp27, which was 2000; Mosca et al., 2005). Although the exact role of also present in whole cell lysate in Figure 1a (top). The these peptides in normal prostate is unclear, they have specificity of PKD1 and Hsp27 interaction in PC cells been shown to involve in paracrine and autocrine was shown by the absence of PKD1 protein when PKD1 signaling, and may be associated with progression to antibody was replaced by IgG. When the blot was castration-resistant PC (Moody et al., 2003). As NT and stripped and reprobed with PKD1 antibody, full-length Bom are known PKD1 activators and PKD1 in turn is PKD1 was present only in lysate and the sample involved with of NT in several cell lines, we immunoprecipitated by PKD1. In reciprocal co-IP used the peptides as naturally occurring stimulants to experiment, the full-length PKD1 was detected when determine whether NT and Bom can induce Hsp27 the lysate was immunoprecipitated by Hsp27 but not phosphorylation at Ser82 (known PKD1 substrate). by IgG, as shown in Figure 1a (middle). Full-length Serum-depleted cultures of LNCaP cells were stimulated

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4388 IP: IgG PKD1 Lysate PKD1 (A) Hsp27 (B)

Blot: Hsp27

Blot: PKD1

IP: IgG Hsp27 Lysate

Blot: PKD1

Blot: Hsp27

Bryostatin: -+- IP : IgG PKD1 PKD1

Blot: p-Hsp27 DAPI (C) Merged (D)

Blot: PKD1

C4-2 C4-2/PKD1

PKD1

β-Actin

AR DAPI Merged

C4-2

C4-2/PKD1

DHT Figure 1 Protein kinase D1 (PKD1) and heat shock protein 27 (Hsp27) are present in the same protein complex. (a) PKD1–Hsp27 protein complex detected by co-immunoprecipitation and reciprocal co-immunoprecipitation assays. LNCaP prostate cancer cell lysates were incubated with anti-PKD1, anti-Hsp27 or rabbit IgG antibodies for 2 h at 4 1C and subsequently with 40 ml of protein A/G sepharose beads. After 2 h incubation, sepharose beads were washed thrice with RIPA buffer. The final pellets containing the sepharose beads and the protein complexes were mixed with 25 ml of Laemmli buffer and ran on sodium dodecyl sulfate polyacrylamide gel electrophoresis gel. The samples were analysed by western blotting using polyclonal antibody against PKD1 (rabbit polyclonal, Santa Cruz Biotechnology), p-Hsp27 (a rabbit polyclonal, Cell Signaling Technology) and monoclonal antibody against Hsp27 (mouse monoclonal, Cell Signaling Technology). Results show that PKD1 and Hsp27, as well as p-Hsp27 are present in the same immunocomplex. (b) Immunofluorescence staining showing colocalization of PKD1 and Hsp27 in the cytoplasm of LNCaP cells. LNCaP cells were washed with phosphate-buffered saline, fixed and incubated for 1 h with primary antibodies rabbit polyclonal anti- PKD1 and mouse monoclonal anti-Hsp27. Cells were then probed for 1 h with rhodamine RX and fluorescent isothiocyanate- conjugated secondary antibodies. After washing, the cells were mounted on slides with Slow Fade Antifade reagent (with DAPI (40,6-diamidino-2-phenylindole)). Cytoplasmic localization of PKD1, red (A), Hsp27, green (B), DAPI, blue (C) and merge of these images (D) in LNCaP cells was shown in the same focal plane that demonstrate cytoplasmic colocalization of PKD1 and Hsp27 (yellow). (c) Androgen receptor (AR) localization was modulated by PKD1. The cell lysate of C4-2 and C4-2/PKD1 were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis separation and western blotted with anti-PKD1 and anti b-actin. Results showed the expression of transfected PKD1 in C4-2/PKD1 cell, which was absent in C4-2 cells. Dihydrotestosterone (DHT) pretreated C4-2 and C4-2/PKD1 cells were washed with phosphate-buffered saline, fixed and incubated with AR antibody for 2 h followed by incubation of isothiocyanate-conjugated secondary antibody. After washing, the cells were mounted with DAPI and analysed for AR localization. Nuclear localization (blue) of AR (red) in C4-2/PKD1 cells was suppressed, but that was increased in cytoplasm compared with C4-2 cells.

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4389 with NT and Bom for 15 min, lysed and the extracts Next, to determine whether PKD1 activator bryosta- were analysed by western blotting using antibodies to tin-1 (Jaggi et al., 2008) induces Hsp27 phosphorylation detect phosphorylated state of Hsp27 at Ser82. As at Ser82 in PC cells, serum-depleted cultures of LNCaP, shown in Figure 2a (top), NT/Bom can induce Hsp27 C4-2 and C4-2/PKD1 cells were stimulated with phosphorylation at Ser82 in LNCaP cells. The lysates bryostatin-1 for 30 min, lysed and the extracts were were also western blotted to detect phosphorylated analysed by western blotting using antibodies to detect PKD1 at Ser916 and shown in Figure 2a (bottom). We phosphorylated state of Hsp27 at Ser82 and PKD1 at observed that NT/Bom could increase phosphorylation Ser916. As shown in Figure 2b, bryostatin-1 can induce of PKD1 at Ser916 in our PC model. Hsp27 phosphorylation at Ser82 or PKD1 phosphor- ylation at Ser916 in LNCaP or C4-2/PKD1 cells, which have high levels of PKD1 expression, but not in C4-2, which has very low PKD1 expression (Jaggi NT (nM) Bom (nM) et al., 2007, 2008; Du et al., 2009). In contrast, PKD1 activator (bryostatin-1) did not phosphorylate Hsp27 at 1130 100 30 Cont. serine 15, which is not a known PKD1 phosphorylation pHsp27 (Ser82) site, indicating the specificity of PKD1-dependent Hsp27 Ser82 phosphorylation in PC cells (data not Hsp27 shown).

LNCaP p-PKD1 (Ser 916) PKD1-induced Hsp27 Ser82 phosphorylation is p38 PKD1 MAPK dependent The serine 82 of Hsp27 can be phosphorylated by several kinases, including PKD1 (Evans et al., 2008). Hsp27 has previously been reported to be phosphory- lated by MAPK-activated protein kinase-2, and MAPK- activated protein kinase-2 is a known substrate of p38 Cont Bryo 1 nM Bryo 10 nM DHT 10 nMt MAPK (Stokoe et al., 1992; Rouse et al., 1994; pHsp27 (Ser 82) Widmann et al., 1999). To assess whether Hsp27 activation by PKD1 activator (NT, Bom, bryostatin-1) Hsp27 was dependent on p38 MAPK (PKD1-mediated effects can be dependent or independent of p38 MAPK (Stokoe LNCaP et al., 1992; Rouse et al., 1994; Evans et al., 2008)), we p-PKD1 (Ser 916) pretreated the LNCaP cells with p38 MAPK inhibitor, SB203580 (1 mM or 10 mM) or dimethyl sulfoxide control, PKD1 stimulated with PKD1 activators (NT 20 nM, Bom 10 nM, bryostatin-1 30 nM) and studied phosphorylation pHsp27 (Ser 82) of PKD1, p38 MAPK and Hsp27 Ser82. NT and Bom 1.00 1.90 2.47 2.62 C4-2/PKD1 stimulated a rapid activation of PKD1 and p38 MAPK, Hsp27 as shown by western blotting in Figure 3a with antibodies that detected the phosphorylated state of the activation loop series of PKD family members pHsp27 (Ser 82) (Ser744 and Ser748 in PKD), and threonine and tyrosine residues of p38 MAPK family members, which corre- 1.00 0.86 1.17 1.25 C4-2 lated with Hsp27 ser82 phosphorylation. Similarly, Hsp27 bryostatin-1 stimulated the activation of PKD1 and p38 MAPK, as shown by western blotting in Figure 3b. Figure 2 Protein kinase D1 (PKD1) activators neurotensin (NT), Thus PKD1 activators cause striking increase in Hsp27 bombesin (Bom) and bryostatin-1 phosphorylate serine 82 residue of heat shock protein 27 (Hsp27) in prostate cancer (PC) cells. (a) phosphorylation with concurrent phosphorylation of LNCaP cells were treated with varying concentrations of NT and both PKD1 and p38 MAPK in PC cells, suggesting that Bom for 15 min. Cell lysates were subjected to western blotting these proteins may share an epistatic relationship. using antibodies to serine 82 phospho-Hsp27, Hsp27, P-PKD1 at Treatment of LNCaP cells with SB203580, at a serine 916 and PKD1. (b) LNCaP, C4-2 and C4-2 overexpressing concentration that did not affect PKD1 phosphoryla- PKD1 (C4-2/PKD1) cells were treated with different concentra- tions of PKD1 activator, Bryostatin-1, for 30 min. Cell lysates were tion, attenuated Hsp27 Ser82 phosphorylation in subjected to western blotting using antibodies to phospho-Hsp27 response to NT and Bom in Figure 3a and bryostatin- and Hsp27. Bryostatin-1 induced Hsp27 phosphorylation at Ser82 1 in Figure 3b. These results suggest that Hsp27 and PKD1 phosphorylation at Ser916 in LNCaP and C4-2/PKD1 Ser82 phosphorylation induced by NT, Bom and cells but not in C4-2 cells, suggesting that PKD1 phosphorylates serine 82 in PC cells. The densitometry-analysed values were bryostatin-1 is p38 MAP kinase dependent in LNCaP generated for p-Hsp27 in C4-2 and c4-2/PKD1 cells and compared cells, which is possibly downstream of PKD1 and with control values for each. upstream of Hsp27.

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4390 Hsp27 Ser82 and p38 MAPK phosphorylation is mediated through PKD1 in LNCaP cells.

Control SB Bom Bom + SB NT NT + SB To determine whether pharmacological inhibition of

pHsp27 PKD1 activation can also attenuate PKD1 effect on Hsp27 Ser82 and p38 MAPK phosphorylation, we 1.00 0.78 4.49 2.64 2.81 0.53 examined the effect of Go6976, most selective commer- phospho p38 MAPK cially available PKD inhibitor (Jaggi et al., 2008) on

1.00 0.70 1.78 0.66 1.62 0.16 bryostatin-1-induced Hsp27 Ser82 and p38 MAPK pPKD1 phosphorylation in PC cells. LNCaP cells were pre- treated with Go6976 (1 mM) for 30 min followed by 1.00 0.90 1.51 1.68 1.38 1.29 treatment with bryostatin-1 (30 nM) for another 30 min.

β-actin As illustrated in Figure 4c, inhibition of PKD1 phosphorylation at serine 916 (phosphorylation at Ser916 correlates with PKD1 catalytic activity) (Rybin SB 203580 (μM) - 1 10 - 1 10 et al., 2009) by Go6976 also inhibited the effect of Bryostatin (30 nM) - - - + + + bryostatin-1-induced Hsp27 Ser82 and p38 MAPK

pHsp27 phosphorylation. These results suggest that phosphor- ylation of Hsp27 (Ser82) and p38 MAPK is not only phospho p38 MAPK dependent on PKD1 expression but also may depend on PKD1 activation. pPKD1 Hsp27 interacts with PKD1 to effect AR transcriptional β-actin activity in PC cells We have previously published that PKD1 influences Figure 3 Effect of p38 mitogen-activated protein kinase (MAPK) inhibitor, SB203580, on protein kinase D1 (PKD1) activators- AR-dependent function in PC cells (Mak et al., 2008). In induced heat shock protein 27 (Hsp27) phosphorylation. (a) Effect this experiment, we explored whether Hsp27 is necessary of p38 MAPK inhibitor, SB203580, on NT/Bom-induced Hsp27 for PKD1 repression of AR transcriptional activity. phosphorylation. LNCaP cells were preincubated with 1 & 10 mm When LNCaP cells were transiently transfected with of SB203580 for 30 min and then stimulated with neurotensin (NT, AR, the reporter gene androgen-responsive element 20 nM) and bombesin (Bom, 10 nM) for 15 min. Cell lysates were subjected to western blotting using phospho-specific antibodies luciferase followed by NT 30 nM, Bom 10 nM or DHT to Hsp27, PKD1 and p38 MAPK. The densitometry-analysed 10 nM stimulation, there was significant induction of the values were prepared and compared with control for every panel. reporter gene activity in a ligand-dependent manner (b) LNCaP cells were preincubated with 1 & 10 mm of SB203580 for (Figures 5a and b). This result suggests that NT and 30 min and then stimulated with bryostatin-1 for 30 min. Cell lysates were subjected to western blotting using phospho-specific Bom can substitute for androgen in stimulating the antibodies to Hsp27, PKD1 and p38 MAPK. Results show that androgen-dependent androgen-responsive element tran- serine 82 Hsp27 phosphorylation is decreased by p38 MAPK scription, which was significantly attenuated by trans- inhibitor in spite of PKD1 activation, which suggests that PKD1 fection with PKD1 or Hsp27 small interfering RNA phosphorylates Hsp27 indirectly through p38 MAPK pathway. (siRNA). Co-expression of both PKD1 and Hsp27 siRNA did not have significant additive or synergistic effect on AR transcriptional activity than when they were expressed individually, indicating that PKD1, AR Inhibition of PKD1 in PC cells reduces the effect and Hsp27 are in the same pathway. However, down- of PKD1 activators on Hsp27 and p38 MAPK regulation of PKD1 by shRNA could enhance the NT, phosphorylation Bom and DHT-induced AR , which was To confirm the specificity of PKD1 in mediating NT-, rescued by co-expression of Hsp27 siRNA, indicating Bom- and bryostatin-1-induced Hsp27 phosphorylation that Hsp27 is necessary for PKD1 repression of AR at Ser82 and p38 MAPK in PC, LNCaP cells (known to transcription and that PKD1 is upstream of Hsp27. express high levels of endogenous PKD1 (Jaggi et al., 2003)) were transfected with either targeted or non- targeted small hairpin RNA (shRNA) PKD1. PKD1 Hsp27 interacts with PKD1 to effect AR-mediated expression was inhibited by more than 70% using cell proliferation PKD1-targeted shRNA in LNCaP cells, and both Prostate cancer cells respond to androgenic stimulation nontargeted and PKD1-targeted shRNA-transfected by proliferation mediated by AR. To investigate the LNCaP cells were stimulated with 20 nM NT, 10 nM phenotypic effect of PKD1 repression of AR transcrip- Bom and with two doses (10 nM or 30 nM) of bryostatin- tional activity, we analysed cell proliferation in AR- 1. PKD1 knockdown attenuated NT and Bom-induced transfected cells stimulated with androgen, NT or Bom Hsp27 Ser82 and p38 MAPK phosphorylation, as in presence or absence of PKD1, Hsp27 siRNA or both. shown in Figure 4a. Similarly, as shown in Figure 4b, As shown in Figure 6, in the presence of DHT (10 nM), PKD1 knockdown blocked Bryostaion-1-induced there was a significant increase in cell proliferation and Hsp27 Ser82 and p38 MAPK phosphorylation. These this effect was attenuated by PKD1 or Hsp27 siRNA, results suggest that NT, Bom and bryostatin-1-induced and co-expression of PKD1 and Hsp27 siRNA did not

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4391 show significant additive or synergistic effect on AR- showing that PKD1-Hsp27-AR signal transduction dependent cell proliferation. Although we have pre- pathway is functional and can influence cell prolifera- viously shown that knockdown of PKD1 can enhance tion in PC. We have previously shown that PKD1 is cell proliferation in several PC cell lines (Mak et al., present in the same protein complex with AR, and this 2008; Syed et al., 2008), dependency of the effect on study provides further evidence that Hsp27 is also Hsp27 is novel. These results confirm that PKD1 present in protein complex with PKD1 and is necessary repression of AR activity stimulated by androgens or for PKD1 repression of AR activity in PC cells. Hsp27 promiscuous physiopathological ligands such as NT or has been shown to increase AR transcriptional activity Bom influences cell proliferation and, therefore, may by transporting AR from cytosol to nucleus after have a role in PC progression. binding of the ligand (Zoubeidi et al., 2007). As Hsp27 is phosphorylated at ser82 after activation of PKD1 in a p38-dependent fashion, it is possible that Hsp27 Discussion mediates repression of AR by PKD1 by either prevent- ing nuclear translocation of AR in spite of ligand This study provides first in vivo experimental evidence binding or preventing activity of AR within the nucleus. combining the data in the published literature by Our observation showed that PKD1 induced the translocation of AR from nucleus to cytoplasm. Cont. shRNA PKD1 shRNA Protein kinase D1 is capable of shuttling between Bom - - + - - + different subcellular compartments and is activated in NT - + - - + - intact cells by physiological stimulus such as NT and Bom or pharmacological activators such as bryostatin-1 pHsp27 (Yuan and Rozengurt, 2008). NT and Bom have been Hsp27 implicated in PC progression as they can induce LNCaP cell growth in the absence of androgen accompanied by AR activation (Lee et al., 2001). However, the role of phospho p38 MAPK physiological stimuli in PKD1–Hsp27-dependent AR

p38 MAPK transcription and PC cell proliferation is not known. This study shows that PKD1 can attenuate NT/Bom- induced AR transcription and cell proliferation in PKD1 LNCaP cells, and these effects are dependent on Hsp27. The exact mechanism of PKD1–Hsp27- β-actin mediated repression of AR activity remains to be investigated. One potential mechanism is our recent

Cont shRNA PKD1 shRNA

Bryostatin (nM) 010300 10 30

pHsp27 Figure 4 Knockdown of protein kinase D1 (PKD1) in prostate cancer (PC) cells abolished the effect of PKD1 activators on heat Hsp27 shock protein 27 (Hsp27) and p38 mitogen-activated protein kinase (MAPK) phosphorylation. (a) Effect of PKD1 knockdown on phospho p38 MAPK neurotensin (NT) and bombesin (Bom)-induced Hsp27 and p38 MAPK phosphorylation. LNCaP cells were transfected with p38 MAPK control small hairpin RNA (cont. shRNA) and PKD1 shRNA. After 48 h, cells were stimulated with neurotensin (NT, 20 nM) and bombesin (Bom, 10 nM) for 15 min. Cell lysates were subjected to PKD1 western blotting using antibodies to phospho-Hsp27, Hsp27, phospho-p38 MAPK, p38 MAPK, PKD1 and b-actin. Results show that Hsp27 Ser82 and p38 MAPK phosphorylation was β-actin consistently reduced with decreased expression of PKD1. (b) Effect of PKD1 knockdown on bryostatin-1-induced Hsp27 Ser 82 and Go6976 (1 μM) --+ + p38 MAPK phosphorylation. LNCaP cells were transfected with Bryostatin (30 nM) -- + + control shRNA and PKD1 shRNA. After 48 hours, cells were stimulated with bryostatin-1 (10 or 30 nM) for 30 min. Cell lysates pS82 Hsp27 were subjected to western blotting using antibodies to phospho- Hsp27, Hsp27, phospho-p38 MAPK, P38 MAPK, PKD1 and Hsp27 b-actin. Results show that Hsp27 Ser82 and p38 MAPK phosphorylation is concomitantly reduced with decreased expres- phospho p38 MAPK sion of PKD1. (c) Effect of PKD1 selective inhibitor, Go6976, on bryostatin-1-induced Hsp27 Ser82 and p38 MAPK phosphoryla- tion. LNCaP cells were preincubated with 1 mm of Go6976 for p38 MAPK 30 min and then stimulated with bryostatin-1 for 30 min. Cell lysates were subjected to western blotting using antibodies to pS916 PKD1 phospho-Hsp27, Hsp27, phospho-p38 MAPK, P38 MAPK, phospho-PKD1 and PKD1. Results show that phosphorylation PKD1 of Hsp27 Ser82 is halved but phosphorylation of p38 MAPK is almost completely blocked by PKD1 selective inhibitor.

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4392 300 *P<0.05 250 *P<0.05

*P<0.05 200

NT 30 nM 150 NS Bom 30 nM

100 RLU- % of control

50

0 Vector + + + + + + ------Control siRNA - - + + - - + + - - + + - - Hsp27 siRNA - - - - + + - - + + - - + + PKD1 ------+ + + + - - - - siPKD1 ------+ + + +

DHT 10 nM 1400 *P<0.05 *P<0.05 1200 *P<0.05

1000 NS

800

600

400 RLU - % of control 200

0 Vector +++ - - - - Control siRNA -+-+-- + Hsp27 siRNA --++- + - PKD1 ---+-- + siPKD1 ----- ++ Figure 5 Effect of protein kinase D1 (PKD1) or/and heat shock protein 27 (Hsp27) on (a) neurotensin (NT), bombesin (Bom) and (b) androgen-dependent androgen-responsive elements (ARE) transcription. LNCaP cells at a density of 0.5 Â 104 cells were plated in a 96-well plate. After 24 h, cells were transiently transfected with androgen receptor (AR), ARE-luciferase, pRL-tk luciferase, empty vector, PKD1 in pEGFP.C1 vector, shPKD1 in U6-KS vector, nontargeted small interfering RNA (siRNA) or Hsp27 siRNA at different combinations with Lipofectamine (Invitrogen). After 24 h, cells were incubated with phenol red-free RPMI 1640 in charcoal- stripped serum with or without neurotensin (NT, 30 nM), bombesin (Bom, 30 nM)(a) and 5a-dihydrotestosterone (DHT, 10 nM)(b) for another 24 h. The ratio of ARE to pRL-tk luciferase represent relative luciferase units (RLU) with s.e.m. (n ¼ 3). The percentage increase indicates the percentage ratio of normalized luciferase activities between cell cultured without treatment and with NT, Bom or androgen treatments. Asterisk (*) indicates statistical significance (Student’s t-test, Po0.05). Although the results show that decreased expression of PKD1 or Hsp27 decreases AR transcriptional activity, there is no cumulative effect after downregulation of PKD1 or Hsp27, suggesting that PKD1-Hsp27 are in the same signaling pathway.

discovery of PKD1-mediated substrate b-catenin, an respectively, which is mediated by b-catenin (Syed et al., established co-activator of AR, which may influence AR 2008). b-Catenin is a member of cadherin–catenin transcriptional activity after nuclear transport of AR by complex of proteins that has a role in cell adhesion Hsp27 (Syed et al., 2008; Du et al., 2009). and proliferation, and is a known co-activator of AR We have previously shown that down- or upregula- transcriptional activity (Wang et al., 2008). Interest- tion of PKD1 expression in several PC cell lines ingly, PKD1 interacts and phosphorylates b-catenin at increases or decreases cell proliferation and motility, threonine 112 and 120 residues, and site-directed

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4393 200 *P<0.05 *P<005

180 *P<0.05

160 NS 140 120 NT 30 nM 100 Bom 30 nM 80 DHT 10 nM 60 40

Cell proliferation (% Control) 20 0 Vector + -+--- Control siRNA +++ -- - Hsp27 siRNA -+++- - PKD1 -+-- + - siPKD1 ---- ++ Figure 6 Effect of protein kinase D1 (PKD1) or/and heat shock protein 27 (Hsp27) on neurotensin (NT), bombesin (Bom) and androgen (DHT, dihydrotestosterone)-induced cell proliferation. LNCaP cells were plated at 4 Â 103 per well in 100 ml RPMI 1640 medium in 96-well plate. Cells were transfected with different combinations of empty vector, PKD1, androgen receptor (AR), short hairpin PKD1 (shPKD1) expression plasmids, nontargeted small interfering RNA (siRNA) and Hsp27 siRNA. After 24 h, medium was removed and replaced with phenol red-free RPMI 1640 in charcoal-stripped serum containing NT (30 nM), Bom (30 nM) or DHT (10 nM). MTS (3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) assays were performed 72 h after transfection, as described previously (Syed et al., 2008). Cell proliferation is depicted as percentage of increase relative to untreated cells, mean with s.e.m. (n ¼ 4) of a single experiment. Asterisk (*) indicates statistical significant (Student’s t-test, Po0.05). The results of these proliferation experiments are consistent with AR transcriptional activity assay (Figure 5), showing that decreased expression of PKD1 or Hsp27 decreases AR-mediated proliferation, there is no cumulative effect after downregulation of PKD1 or Hsp27, suggesting that PKD1–Hsp27 are in the same signaling pathway. mutagenesis of T120 and/or T112 decreases b-catenin treatment of p38 MAPK inhibitor attenuates Hsp27 transcriptional activity (Du et al., 2009). Although the phosphorylation, it did completely abolish Hsp27 effect of T120 or T112 nonphosphorylation mutant on phosphorylation (Figure 3b) in spite of totally blocking AR activity is not known, PKD1 may influence AR p38 MAPK activity, suggesting that PKD1 may directly activity through multiple mechanisms, including Hsp27 phosphorylate Hsp27 as well. and b-catenin-mediated pathways. Interestingly, a re- Although our study confirms that NT activates PKD1 cent study in cells identified that Hsp27, in PC cells, others have shown that PKD dramatically but not Hsps 60, 70 or 90, interacted with b-catenin, influences NT secretion in basal and stimulated state in suggesting that Hsp 27 phosphorylation by PKD1 may BON pancreatic carcinoid cell line (Li et al., influence transport of b-catenin as well and may mediate 2008). Prostate cells express NT receptors, which on PKD1 repression of AR activity (Fanelli et al., 2008). ligand binding promote cell growth and proliferation Although it is widely recognized that Hsp27 is a (Carraway and Hassan, 2007). Neuroendocrine differ- substrate of p38 MAPK, other studies showed that entiation is associated with castration resistance in PC, phorbol esters also stimulate the phosphorylation of suggesting that NT expression may contribute to Hsp27 in a variety of cell types through a PKC- autocrine PC growth. The interdependent relationship dependent but p38 MAPK-independent pathway (Mai- between NT and PKD1 suggests that NT may be able to zels et al., 1998). We confirm in this paper that a specific influence PC cell function through an autocrine fashion, p38 MAPK inhibitor, SB203580, inhibited PKD1- known to have a role in secretion of NT. induced Hsp27 and p38 MAPK phosphorylation but The in vivo evidence provided in this study in cell lines not PKD1 phosphorylation, indicating that PKD1 is remains to be validated in preclinical models. Never- upstream of p38 MAPK and Hsp27. In addition, theless, the study exposes several potential translational knockdown of PKD1 by siRNA and chemical inhibition possibilities. Hsp inhibitors, especially Hsp90, are of PKD1 activity by Go6976 attenuates PKD1 activator currently in clinical trials and Hsp27 can now be (NT, Bom and bryostatin-1)-induced p38 MAPK considered a potential therapeutic target (Neckers, phosphorylation. Thus, in this study, we show that 2003). Progression to castration resistance is the main PKD1 phosphorylates Hsp27 at Ser82 in PC cells, which cause of PC mortality, and novel drugs that work is mediated by p38 MAPK pathway, and clarify this through epistatic mechanism could supplement efficacy convergent signaling pathway in PC cells. Hsp27 has of androgen ablative treatment in patients with PC. been shown to undergo direct substrate phosphorylation Moreover, PKD1 belongs to a family of kinases that by PKD1 (Doppler et al., 2005). In our study, although have proved to be the most successful targets in

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4394 rationale-based drug designing (Jaggi et al., 2007; Co-IP and immunoblotting Gomase and Tagore, 2008). Bryostatin 1, a PKD LNCaP cells were seeded in 10 cm dishes, and after 48 h, activator, has been used in several clinical trials for total cell lysate was prepared in triton lysis buffer cancers including prostate with limited success (Roberts (Sigma). Aliquots (20 ml) of cell lysate were taken as inputs et al., 2006; Ku et al., 2008). Further understanding of (5%) for PKD1 and Hsp27 in the co-IP experiment. The remaining cell lysate was incubated with 1 mg of rabbit IgG PKD1 mechanism of PKD1 activity will provide newer (control), 1 mg of PKD1 or 1 mg of Hsp27 antibodies, and approaches to improve efficacy of activators and subsequently with 40 ml protein A/G Sepharose beads. After inhibitors. 2 h of incubation at 4 1C, the protein complex bound to the In conclusion, the current study provides in vivo beads was washed thrice with lysate buffer, and the beads were evidence that Hsp27 undergoes phosphorylation resuspended in 25 ml sample buffer and subjected to sodium after activation of PKD1 through p38 MAPK pathway dodecyl sulfate polyacrylamide gel electrophoresis. Western and is necessary for repression of AR activity. AR blot analysis was performed as described previously (Syed repression by PKD1 results in decreased ligand- et al., 2008) using anti-Hsp27 or anti-PKD1 as primary dependent cell proliferation, both to physiological antibodies. stimulant androgens and to physiopathological stimulants NT and Bom. As PKD1, Hsp27 and AR Immunofluorescence are dysregulated in PC, PKD1–Hsp27–AR interaction LNCaP cells were cultured on glass coverslips (40 000 cells per provides us a novel signaling pathway worth well) until subconfluence and processed for immunofluores- cence study. The coverslips were incubated with primary exploring further to understand PC progression and antibodies in 10% goat serum in phosphate-buffered saline. can be an attractive target for biomarkers evaluation or After washing with phosphate-buffered saline, coverslips were therapeutic intervention. incubated with fluorescein isothiocynate, or rhodamine RX- conjugated secondary antibodies (Jackson Immunoresearch) for 1 h. The cells were washed in phosphate-buffered saline and mounted on slides with Slow Fade Antifade reagent (with Materials and methods DAPI) (Vector Labs, Burlingame, CA, USA). Photographs were taken at  20 magnification using Olympus 1X51 Cell culture, reagents and antibodies fluorescent microscope (Olympus, Melville, NY, USA) fol- Human PC cell lines LNCaP (ATCC, Manassas, VA, USA), lowed by analysis with imaging software. C4-2-GFP and C4-2-PKD1-GFP (Jaggi et al., 2005) were grown in RPMI 1640 media with 10% fetal bovine serum Transfection and luciferase assay (GIBCO BRL, Grand Island, NY, USA) at 37 1C and 5% LNCaP cells (0.5  105) were plated on 96-well plates and CO . All inhibitors were from Calbiochem (San Diego, CA, 2 transfected using lipofectin (0.5 ml per well; Invitrogen Life USA). NT, Bom and bryostatin-1 were from Sigma (St Louis, Technologies). The total amount of plasmid DNA and siRNA MO, USA). Antibodies to total Hsp27, phospho-Hsp27 (serine used were normalized by the addition of a control plasmid and 82 and 15), phospho-p38 MAPK (threonine 180/tyrosine 182) siRNA. After 24 h, the transfection media were replaced by were from Cell Signaling Technology (Beverly, MA, USA). charcoal-stripped serum containing phenol red-free RPMI Antibodies to PKD1, phospho-PKD1 (serine 744/serine 748, 1640 with or without 30 nM NT, 30 nM Bom or 10 nM DHT for serine 916) and b-actin were from Santa Cruz Biotechnology another 24 h. Luciferase or Renilla activities were determined (Santa Cruz, CA, USA). Horseradish peroxidase and fluores- using the Dual-Glo Luciferase Assay System (Promega, cence-conjugated IgGs were from Jackson Immunoresearch Madison, WI, USA) with the aid of a microplate luminometer Laboratories (West Grove, PA, USA). Luminoskan Ascent (Thermo Electric Corporation, Waltham, MA, USA). Plasmids and siRNA transfection The vector containing PKD1 was kindly provided by Dr FJ Cell proliferation assays Johannes (Fraunhofer Institute for Interfacial Engineering, To determine the effects of PKD1 and/or Hsp27 expression on Stuttgart, Germany). Construction of anti-PKD1 shRNA AR-dependent PC cell growth, MTS (3-(4, 5-dimethylthiazol- expression vector was carried out as described previously 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetra- (Du et al., 2006). For shRNA targeted to PKD1 oligos, 50-GA zolium) growth and viability assays were used, as described TCCGGAAGGAAATATCTCATGATTCAAGAGATCATG previously (Syed et al., 2008). LNCaP cells (4  103 per well) AGATATTTCCTTC-CTTTTTA-30 and 50-AGCTTAAAAA were plated in 100 ml RPMI 1640 medium containing 10% GGAGGAAGGAAAATATCTCATGATCTCTTGAATCA serum in 96-well plates and transfected with different TGAGATATTTCCTTCCG-30 were annealed and ligated to combinations of PKD1, PKD1 shRNA expression plasmids KSU6 vector that had been digested with BamH1 and HindIII or Hsp27 siRNA. The total amount of plasmid DNA and (Du et al., 2006). Double-stranded siRNA molecules with a siRNA used were normalized by the addition of a control two-base overhang at the 30-end of the antisense strand plasmid and siRNA. After 24 h, the medium was removed and corresponding to Hsp27 site (Rocchi et al., 2006) and a replaced with fresh medium containing phenol red-free RPMI nontargeted siRNA with scramble siRNA duplex as control 1640 and charcoal-stripped serum with or without 30 nM NT, were purchased from Dharmacon (Lafayette, CO, USA). The 30 nM Bom or 10 nM DHT. Following 72-h incubation after human Hsp27 mRNA target sequence for siRNA is transfection, MTS solution (Promega) was added to each well, 50-AGCUGCAAAAUCCGAUGAGA-30 (Rocchi et al., and plates were incubated in a humidified atmosphere. The 2006). For transfection, LNCaP cells were plated on 6-well absorbance of the product formazan, which is considered to be (1  105) and 96-well (0.5  104) plates, and transfections were directly proportional to the number of living cells, was performed using lipofectamine (Invitrogen, Rockville, MD, measured at 490 nm in a spectrophotometer. Relative cell USA) according to the manufacturer’s protocol. growth of transfected cells with target was

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4395 expressed as percent change compared with the cells expressed Acknowledgements with the respective control. We thank Dr FJ Johannes, Fraunhofer Institute for Interfacial Engineering, Stuttgart, Germany for providing the PKD1 Conflict of interest expression vector. This study was supported by an institutional grant from the Department of Surgery, University of The authors declare no conflict of interest. Massachusetts Medical School.

References

Belka C, Ahlers A, Sott C, Gaestel M, Herrmann F, Brach MA. Jaggi M, Rao PS, Smith DJ, Wheelock MJ, Johnson KR, Hemstreet (1995). Interleukin (IL)-6 signaling leads to phosphorylation of the GP et al. (2005). E-cadherin phosphorylation by protein kinase D1/ small heat shock protein (Hsp)27 through activation of the MAP protein kinase C{mu} is associated with altered cellular aggregation kinase and MAPKAP kinase 2 pathway in monocytes and and motility in prostate cancer. Cancer Res 65: 483–492. monocytic leukemia cells. Leukemia 9: 288–294. Ku GY, Ilson DH, Schwartz LH, Capanu M, O0Reilly E, Shah MA Carraway R, Leeman SE. (1976). Characterization of radioimmu- et al. (2008). Phase II trial of sequential paclitaxel and 1 h infusion noassayable neurotensin in the rat. Its differential distribution in the of bryostatin-1 in patients with advanced esophageal cancer. Cancer central nervous system, small intestine, and stomach. J Biol Chem Chemother Pharmacol 62: 875–880. 251: 7045–7052. Lee LF, Guan J, Qiu Y, Kung HJ. (2001). Neuropeptide-induced Carraway RE, Hassan S. (2007). Neurotensin receptor binding and androgen independence in prostate cancer cells: roles of nonreceptor neurotensin-induced growth signaling in prostate cancer PC3 cells tyrosine kinases Etk/Bmx, Src, and focal adhesion kinase. Mol Cell are sensitive to metabolic stress. Regul Pept 141: 140–153. Biol 21: 8385–8397. Cornford PA, Dodson AR, Parsons KF, Desmond AD, Woolfenden Li J, Chen LA, Townsend Jr CM, Evers BM. (2008). PKD1, PKD2, A, Fordham M et al. (2000). Heat shock protein expression and their substrate Kidins220 regulate neurotensin secretion in the independently predicts clinical outcome in prostate cancer. Cancer BON human endocrine cell line. J Biol Chem 283: 2614–2621. Res 60: 7099–7105. Maizels ET, Peters CA, Kline M, Cutler Jr RE, Shanmugam M, Doppler H, Storz P, Li J, Comb MJ, Toker A. (2005). Hunzicker-Dunn M. (1998). Heat-shock protein-25/27 phosphor- A phosphorylation state-specific antibody recognizes Hsp27, a ylation by the delta isoform of protein kinase C. Biochem J 332 novel substrate of protein kinase D. J Biol Chem 280: 15013–15019. (Pt 3): 703–712. Du C, Ge B, Liu Z, Fu K, Chan WC, McKeithan TW. (2006). PCR- Mak P, Jaggi M, Syed V, Chauhan SC, Hassan S, Biswas H et al. based generation of shRNA libraries from cDNAs. BMC Biotechnol (2008). Protein kinase D1 (PKD1) influences androgen receptor 6: 28. (AR) function in prostate cancer cells. Biochem Biophys Res Du C, Jaggi M, Zhang C, Balaji KC. (2009). Protein kinase D1- Commun 373: 618–623. mediated phosphorylation and subcellular localization of beta- Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. (2002). catenin. Cancer Res 69: 1117–1124. The protein kinase complement of the . Science 298: Dudich IV, Zav0yalov VP, Pfeil W, Gaestel M, Zav0yalova GA, 1912–1934. Denesyuk AI et al. (1995). Dimer structure as a minimum Martinez V, Tache Y. (2000). Bombesin and the brain-gut axis. cooperative subunit of small heat-shock proteins. Biochim Biophys Peptides 21: 1617–1625. Acta 1253: 163–168. Moody TW, Chan D, Fahrenkrug J, Jensen RT. (2003). Neuropep- Edwards J, Bartlett JM. (2005). The androgen receptor and signal- tides as autocrine growth factors in cancer cells. Curr Pharm Des 9: transduction pathways in hormone-refractory prostate cancer. Part 495–509. 2: androgen-receptor cofactors and bypass pathways. BJU Int 95: Mosca A, Berruti A, Russo L, Torta M, Dogliotti L. (2005). The 1327–1335. neuroendocrine phenotype in prostate cancer: basic and clinical Evans IM, Britton G, Zachary IC. (2008). Vascular endothelial growth aspects. J Endocrinol Invest 28: 141–145. factor induces heat shock protein (HSP) 27 serine 82 phosphoryla- Neckers L. (2003). Development of Hsp90 inhibitors: tion and endothelial tubulogenesis via protein kinase D and utilizing both forward and reverse chemical genomics for drug independent of p38 kinase. Cell Signal 20: 1375–1384. identification. Curr Med Chem 10: 733–739. Fanelli MA, Montt-Guevara M, Diblasi AM, Gago FE, Tello O, Parcellier A, Schmitt E, Gurbuxani S, Seigneurin-Berny D, Pance A, Cuello-Carrion FD et al. (2008). P-cadherin and beta-catenin are Chantome A et al. (2003). HSP27 is a -binding protein useful prognostic markers in breast cancer patients; beta-catenin involved in I-kappaBalpha proteasomal degradation. Mol Cell Biol interacts with heat shock protein Hsp27. Cell Stress Chaperones 13: 23: 5790–5802. 207–220. Roberts JD, Smith MR, Feldman EJ, Cragg L, Millenson MM, Roboz Geum D, Son GH, Kim K. (2002). Phosphorylation-dependent GJ et al. (2006). Phase I study of bryostatin 1 and fludarabine in cellular localization and thermoprotective role of heat shock protein patients with chronic lymphocytic leukemia and indolent (non- 25 in hippocampal progenitor cells. J Biol Chem 277: 19913–19921. Hodgkin0s) . Clin Cancer Res 12: 5809–5816. Gomase VS, Tagore S. (2008). Kinomics. Curr Drug Metab 9: 255–258. Rocchi P, Beraldi E, Ettinger S, Fazli L, Vessella RL, Nelson C et al. Haslbeck M, Buchner J. (2002). Chaperone function of sHsps. Prog (2005). Increased Hsp27 after androgen ablation facilitates andro- Mol Subcell Biol 28: 37–59. gen-independent progression in prostate cancer via signal transdu- Jaggi M, Chauhan SC, Du C, Balaji KC. (2008). Bryostatin 1 cers and activators of transcription 3-mediated suppression of modulates beta-catenin subcellular localization and transcription apoptosis. Cancer Res 65: 11083–11093. activity through protein kinase D1 activation. Mol Cancer Ther 7: Rocchi P, Jugpal P, So A, Sinneman S, Ettinger S, Fazli L et al. (2006). 2703–2712. Small interference RNA targeting heat-shock protein 27 inhibits the Jaggi M, Du C, Zhang W, Balaji KC. (2007). Protein kinase growth of prostatic cell lines and induces apoptosis via -3 D1: a protein of emerging translational interest. Front Biosci 12: activation in vitro. BJU Int 98: 1082–1089. 3757–3767. Rocchi P, So A, Kojima S, Signaevsky M, Beraldi E, Fazli L et al. Jaggi M, Rao PS, Smith DJ, Hemstreet GP, Balaji KC. (2003). Protein (2004). Heat shock protein 27 increases after androgen ablation and kinase C mu is down-regulated in androgen-independent prostate plays a cytoprotective role in hormone-refractory prostate cancer. cancer. Biochem Biophys Res Commun 307: 254–260. Cancer Res 64: 6595–6602.

Oncogene Hsp27 mediates repression of AR by PKD1 in PC cells S Hassan et al 4396 Rouse J, Cohen P, Trigon S, Morange M, Alonso-Llamazares A, cancer cells by differential expression of E-cadherin and protein Zamanillo D et al. (1994). A novel kinase cascade triggered kinase D1. J Cell Biochem 104: 82–95. by stress and heat shock that stimulates MAPKAP kinase-2 Valverde AM, Sinnett-Smith J, Van Lint J, Rozengurt E. (1994). and phosphorylation of the small heat shock proteins. Cell 78: Molecular cloning and characterization of protein kinase D: a target 1027–1037. for diacylglycerol and phorbol esters with a distinctive catalytic Rozengurt E, Rey O, Waldron RT. (2005). Protein kinase D signaling. domain. Proc Natl Acad Sci USA 91: 8572–8576. J Biol Chem 280: 13205–13208. Wang G, Wang J, Sadar MD. (2008). Crosstalk between the androgen Rybin VO, Guo J, Steinberg SF. (2009). Protein kinase D1 autopho- receptor and beta-catenin in castrate-resistant prostate cancer. sphorylation via distinct mechanisms at Ser744/Ser748 and Ser916. Cancer Res 68: 9918–9927. J Biol Chem 284: 2332–2343. Wang QJ. (2006). PKD at the crossroads of DAG and PKC signaling. Simental JA, Sar M, Lane MV, French FS, Wilson EM. (1991). Trends Pharmacol Sci 27: 317–323. Transcriptional activation and nuclear targeting signals of the Widmann C, Gibson S, Jarpe MB, Johnson GL. (1999). Mitogen- human androgen receptor. J Biol Chem 266: 510–518. activated protein kinase: conservation of a three-kinase module So A, Hadaschik B, Sowery R, Gleave M. (2007). The role of stress from yeast to human. Physiol Rev 79: 143–180. proteins in prostate cancer. Curr Genomics 8: 252–261. Yuan J, Rozengurt E. (2008). PKD, PKD2, and p38 MAPK mediate Stokoe D, Engel K, Campbell DG, Cohen P, Gaestel M. (1992). Hsp27 serine-82 phosphorylation induced by neurotensin in Identification of MAPKAP kinase 2 as a major enzyme responsible pancreatic cancer PANC-1 cells. J Cell Biochem 103: 648–662. for the phosphorylation of the small mammalian heat shock Zoubeidi A, Zardan A, Beraldi E, Fazli L, Sowery R, Rennie P et al. proteins. FEBS Lett 313: 307–313. (2007). Cooperative interactions between androgen receptor (AR) Syed V, Mak P, Du C, Balaji KC. (2008). Beta-catenin mediates and heat-shock protein 27 facilitate AR transcriptional activity. alteration in cell proliferation, motility and invasion of prostate Cancer Res 67: 10455–10465.

Oncogene

Top View