sign in sign up
<<
Home , Salmonella

Acta Scientiae Veterinariae, 2015. 43: 1333.

RESEARCH ARTICLE ISSN 1679-9216 Pub. 1333

Identification of and Salmonella spp. in Swine Through PCR

Lívia Boarini1, Mariana Casteleti Beraldo-Massoli1, Mariana Froner Casagrande1, Marita Vedovelli Cardozo1, Lilian Cristina Makino2, Andressa de Souza3, Marco Monteiro de Lima4, Walter Maldonado Jr.5 & Ruben Pablo Schocken-Iturrino1

ABSTRACT Background: The presence Clostridium spp. and Salmonella spp. is the main concern in swine sector, since they interfere in the microbiological quality of meat and can be responsible for several diseases, presenting occurrences such as intestinal and enterotoxaemia. It is necessary to improve production and quality of meat and by-products swine ensur- ing good quality origin of products marketed. Considering these aspects, the objective of the present study was to assess the presence of Clostridium perfringens and Salmonella spp. in pigs destined for consumption, with bacterial counts and identification using PCR technique. Materials, Methods & Results: The collections were made at slaughterhouse and confinement, with bacterial count by the pour-plate technique with Reinforced Clostridial Agar, and the identification by PCR with cpa, cpb, IA, cpe, etx and cpb-2 genes for C. perfringens; and invA and fliC for Salmonella spp. The scores presented average values of 6.04 x 104 CFU/mL for confinement, and 1.8 x 104 CFU/mL in the slaughterhouse. The means counts between the confinement and slaughterhouse groups showed significant difference (P < 0.01). The samples taken at the slaughterhouse were from several farms at random, and allowed the appraisal of hygienic conditions, since animals of confinement remained sanitized and the accumulation of feces on floor was avoided. The PCR technique presented positive results forC. perfringens alpha (cpa) in 25% of the confinement samples, and 46.4% in the slaughterhouse.Salmonella spp. was identified in 9.5% of confinement and 21.4% of the slaughterhouse. Discussion: The presence of C. perfringens and Salmonella spp. is directly related to losses in the entire system of cre- ation of pigs, since infected animals are susceptible to severe diseases, or without clinical signs can exhibit apathy and loss of appetite making weight gain difficult and causing deficiency of the . The difference between the averages counts of the confinement and the slaughterhouse may be due to several factors, but environmental conditions and hygienic are the most influence these differences. When the slaughterhouse samples were collected, the contact with swine of the other farm and the stress of transport may allow the excretion of C. perfringens in greater quantity than usual, while the animals of confinement remained in stalls separate and stress-free the whole period. Many researches have been demonstrating that the identification of pathogenic by PCR has been more sensitive and faster than conventional microbiology. For this work, this technique gave swift and reliable results, since it consisted of amplification of specific genes to the species of C. perfringens and Salmonella spp. and S. Typhimurium. This fact is of great relevance to contribute preventively with the diagnosis and treatment of animals before they can cause damage to the sector. This comparison can be confirmed when observed the correlation coefficient (- 0,25) between detection of bacterial and weight of animals confined. These results demonstrate that animals with high count of bacteria were those who had greater difficulties in gaining weight, and consequently were slaughtered below the ideal weight. It could be concluded that C. perfringens and Salmonella spp. are often related directly to negative influence on pig production, mainly in initial confinement hindering the weight gain of the animals, and in the industry sector contaminating the meat and its derivatives. Moreover, the molecu- lar biology methods showed to be quite efficient when compared to the conventional ones, thus, PCR can be considered a useful tool to improve pig production.

Keywords: anaerobic bacteria, swine production, slaughterhouse.

Received: 4 June 2015 Accepted: 8 December 2015 Published: 19 December 2015 1Departamento de Patologia Veterinária, 3Departamento de Medicina Veterinária Preventiva, 4Departamento de Zootecnia e 5Departamento de Ciências Exatas, Faculdade de Ciências Agrárias e Veterinárias/Universidade Estadual Paulista (FCAV/UNESP), Jaboticabal, SP, Brazil. 2Departamento de Engenharia de Pesca, Universidade Estadual Paulista (UNESP), Registro, SP, Brazil. CORRESPONDENCE: L. Boarini [[email protected] - Tel.: +55 (16) 3209-7369]. Departamento de Patologia Veterinária, Prédio de Microbiologia, FCAV/UNESP. Via de Acesso Prof. Paulo Donato Castellane s/n. CEP 14.884-900 Jaboticabal, SP, Brazil.

1 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333.

INTRODUCTION Methodology The Clostridium spp. and Salmo- The seek for Clostridium spp. began with se- nella spp. are directly related to diseases in piglets, rial dilutions subjected to thermal shock [4] to active such as intestinal infections and enterotoxaemia. This germination of spores and elimination of vegetative are patogens found in the intestinal tract of animals cells and possible contaminants. and are identified as responsible for a wide range of After thermal shock, an aliquot of 1 mL of diseases in human and animal. each dilution was transferred to a Petri dish, and The pathogenicity of C. perfringens in the in- Reinforced Clostridial Agar was added by the pour testinal tract of pigs is associated whit the occurrence of plate method and incubated in anaerobic conditions 1 toxin, mainly α (type A) and β (type C) [15,17]. with GasPack system at 37°C for 48 h. Typical Which can cause , hemorrhagic, necrotic colonies (3 to 5)were inoculated in BHI broth tubes and malignant edema and is considered the (Brain Heart Infusion)1 and incubated at 35°C for 24 leading cause of diarrhea in newborns. h. DNA extractions were performed by the technique Infections by Salmonella spp. have worldwide of Marmur [12]. dissemination and spreads quickly among animals The PCR reactions were directed for the de- why contact with the stool, causing great economic tection of genes encoding toxins alpha, beta, Epsilon, losses and public health [13]. As as, failures in iota (Table 1). The reactions followed 1X buffer [100 management at the industrial process carries those mi- mM Tris-HCl pH 8.8; 500 mM KCl; 0.8% (v/v) Non- croorganisms from infected animals during slaughter, idet P40]; MgCl2 2 mM; dNTP’s 0.2 mM, 1.5 U of extending the scale of contamination to the consumer. Taq DNA polymerase, 5 pmol of each primer, 60 ng It is considered of utmost importance the microbio- of genomic DNA and sterile pure water 20 µL. The logical control of these agents to minimize economic amplifications were in thermal cycler Veriti Thermal losses and ensure and trade security in products Cycler2 programmed with annealing temperature of derived from . 55°C for 1 min. The electrophoretic used agarose gel The growing market expansion, care with pro- 1% (p/v) with SYBR Green3 1X and molecular size duction and marketing of meat are essential for better standard 100 pb DNA Ladder4 , and photo documenta- product quality and , sice C. perfringens tion GEL DOCTM EQ5. food poisoning ranks among the most common food- For Salmonella spp., samples were incubated at borne diseases worldwide [11]. 42°C for 24 h, transfer 1 mL in 10 mL Selenite broth- As infected pigs are still a major source of Novobiocin® and Rappaport Vassiladis for enrichment introduction of bacteria into the human food chain at 37°C and 42°C, for 24 h. After enrichment, samples [8], the present study has as objective to evaluate the were isolated on MacConkey Agar and XLD with presence of C. perfringens and Salmonella spp. in incubation at 37°C for 24 h. Suggestive colonies of pigs. Using bacterial counts and Salmonella spp. were place onto Radhanjs Agar6, Agar techniques allow rapid and accurate identification Rambach7 and TSI (Triple Agar) and incubated results. under the same conditions. The extraction of DNA of Salmonella also followed the technique of Marmur MATERIALS AND METHODS [12], and the identification with PCR reactions using oligonucleotides of invA gene (Table 2). Amplifications Sampling were executed in thermal cycler Veriti Thermal Cycler2 Samples were collected in the pig confine- with annealing temperature of 60°C for 1 min. The ment of the College of Agricultural and samples were subjected to electrophoresis in agarose Sciences - UNESP/FCAV, Jaboticabal Campus and in gel 1% (p/v), with SYBR® Green3 1X and molecular slaughterhouse in the countryside of the State of São size standard 100 pb DNA Ladder4, and photo docu- Paulo in Brazil, being 84 animals fom a slaughterhouse mented on GEL DOCTM EQ5. and 84 from the confinement, without signs of infec- Positive samples to invA, were submitted also tion. Anorectal swabs were collected of each animal, to gene fliC (Table 2) in order to identify a possible and placed onto tubes with water peptone 0.1% sterile. Salmonella Typhimurium. The PCR executed in

2 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333. thermal cycler Veriti Thermal Cycler2 with anneal- Statistical analysis ing temperature 52°C for 1 min. The samples were Data are presented as mean values ± sd of du- subjected to electrophoresis in agarose gel 1% (p/v) plicate measurements. Statistical analysis was done by with SYBR® Green3 1X and molecular size standard Tukey´s test, P < 0.01 was considered significant, and 100 pb DNA Ladder4, photo documented with DOCTM the coefficient of variation stabilized by transformation GEL EQ5. of values for log (x + 5).

Table 1. Nucleotides sequences used to amplify and confirm the Clostridium perfringens species in the collected samples. Gene Primer Sequence (5’→ 3’) Size (pb) Forward AGTCTACGCTTGGGATGGAA cpa 900 Reverse TTTCCTGGGTTGTCCATTTC Forward TCCTTTCTTGAGGGAGGATAAA cpb 611 Reverse TGAACCTCCTATTTTGTATCCCA Forward AAACGCATTAAAGCTCACACC IA 293 Reverse CTGCATAACCTGGAATGGCT Forward GGGGAACCCTCAGTAGTTTCA cpe 506 Reverse ACCAGCTGGATTTGAGTTTAATG Forward TGGGAACTTCGATACAAGCA etx 396 Reverse TTAACTCATCTCCCATAACTGCAC Forward CAAGCAATTGGGGGAGTTTA cpb-2 200 Reverse GCAGAATCAGGATTTTGACCA

Table 2. Nucleotide sequences used for amplification and confirmation of the species of Salmonella spp. and Salmonella Typhimurium in the collected samples. Gene Sequence (5’→ 3’) Size (pb) GTGAAATTATCGCCACGTTCGGGCAA invA Salmonella spp. 284 pb TCATCGCACCGTCAAAGGAACC CGGTGTTGCCCAGGTTGGTAAT Salmonella fliC 620 pb ACTGGTAAAGATGGCT Thyphimurium

RESULTS differences between the two assessments (DMS 5% Seventeen of the 84 samples from confinement = 0.7024). The slaughterhouse samples compared to presented anaerobic bacteria with counts of 1.2 x 105 those of the confinement showed an increased fre- CFU/mL in the first assessment, and 7.88 x 102 CFU/ quency of anaerobic count in the samples collected in mL in 24 animals in the second one. Samples of the the slaughterhouse (Table 3). slaughterhouse showed counts of 1.8 x 104 CFU/mL. The weight gain of animals of the confine- These samples characterized greater frequency of ment varied according the bacterial count, with anaerobic when compared with confinement showing negative coefficient of correlation between the count of higher variation DMS (5%). There were no significant Clostridium spp. and weight gain of animals, with 3 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333. value of - 0.25, showing that the mean samples group Salmonella spp. were detected on eight samples with larger bacterial counts showed lower weight gain. (9.5%) at the confinement and 18 (21.4%) at slaughter- Molecular research of Alpha toxins (cpa), house, using PCR with gene invA (Figure 2). For Sal- beta (cpb), Epsilon (cpe) and iota (τ), allowed the monella Typhimurium, the number of positive samples identification ofC. perfringens type A in 21 (25 %) in a slaughterhouse was greater than in confinement, and confinement of animals (46.4%) of 39 individuals reaching 8.33% of positivity in the samples (Figure 3), in the slaughterhouse (Figure 1). while in confinement the percentage was 3.57%.

Table 3. Average values of counts obtained from samples collected in confinement and in slaughterhouse. Average Values Significance First Evaluation 1.2 x 105 b Second Evaluation 7.88 x 102 b Slaughterhouse 1.85 x 104 a CV 49.7 F 28.89* P < 0.01 DMS (5%) 0.7024 *Transformed data for log (x+5), the equal lyrics represent data what no significant differences and lyrics different which obtained significance with each other. Statistical results are showed according to Tukey´s test α( = 5%).

Figure 1. Amplification of samples of Clostridium perfringens type A with primer encoding the cpa gene by PCR. Channels: 1. Standard molecular 100 bp DNA Ladder4; 2. Positive Control; 3. Negative Control; 4 to 6. Samples collected from confinement; 7 to 9. Samples collected in the slaughterhouse.

Figure 2. Amplification of Salmonella spp with primer encoding the invA gene by PCR. Channels: 1. Standard molecular bands of 100 bp DNA Ladder4; 2. Positive Control; 3. Negative Control; 4 to 6. Samples collected from confinement; 7 to 10. Samples collected in the slaughterhouse. 4 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333.

Figure 3. Amplification of Salmonella Typhimurium with primer encoding fliC gene by PCR. Channels: 1. Standard molecular bands of 100 bp DNA Ladder4; 2. Positive Control; 3. Negative Control; 4 to 7. Samples collected from the slaughterhouse; 8 to 10. Samples collected in the confinement.

DISCUSSION This comparison can be confirmed when ob- The bacterial counts between the confinement served the correlation coefficient between bacteria and and slaughterhouse groups showed significant differ- weight of confined animals. These results demonstrate ence (P < 0.01). The samples taken at the slaughter- that animals with high count of bacteria were those house were from several farms at random, and allowed who had greater difficulties in gaining weight, and the appraisal of hygienic conditions, since animals of consequently were slaughtered below the ideal weight. confinement remained sanitized and the accumula- This fact corroborates with the ones described by Baker tion of feces on floor was avoided. The difference in [1], where this occurrence was also verified. bacterial counts can be linked to this factor, where the In all cases of piglets diagnosed with C. per- group with controlled conditions showed lower scores fringens, they were found to have enteritis and diarrhea, of colonies. which leads to weight loss and often deaths of less When comparing the two samples collected resistant individuals. Among the toxins of this agent, on confinement, it is observed that there were more the most commonly associated with the disease is type positives in the second ones. This fact can occur when alpha toxin, which is characterized by its aggressive- animals kept in confinement suffer stress, this may af- ness in its action on the intestinal villi [6]. However, fect the immune system and makes them susceptible more recent researches have demonstrated that the to infections by environment pathogens. During the expression of alpha toxin alone did not show wor- confinement period, there were no characteristic signs rying cases of injury, only when it is associated with of by C. perfringens, however, the typification other toxins that expressed its cytotoxic power [17]. by PCR showed positivity for this in the Recently, studies shows that beta2 toxin produced by pigs. C. perfringens is commonly found in the intestines C. perfringens type A has been linked to frames of ill- of warm-blooded animals without clinical signs, which nesses in pigs, but the specific role of this toxin in the occur only when there is production of toxins [7]. manifestation of enteric diseases is not fully elucidated Molecular biology techniques are gain headway [15]. In a recent and extensive study, 85% isolates from by allowing the identification of potentially pathogenic pigs with diarrhea or enteritis were cpb-2-harbouring, microorganisms, prior to the onset of clinical signals. and is correlation was even higher (91%) in neonatal This fact is of great relevance to contribute preventively pigs with enteritis or diarrhea [16]. with the diagnosis and treatment of animals before This relationship between the cytotoxic power they can cause damage to the sector. C. perfringens are of toxins allows the understanding of the results of responsible for reducing the feed conversion ratio and this work, where even in the absence of clinical signs the gain weight of animals, and that demands greater it was positive for the presence of gene cpa (alpha investments with food and supplements in order to toxin encoder) of C. perfringens found by molecular minimize severe cases of economic loss. techniques.

5 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333.

This data permit to conclude that the illness the Salmonella spp. [5], concluded what on PCR in confined pigs is directly related to the presence or resulted in 21% more positive samples detected than by absence of the gene expression for the toxin beta2. The standard microbiology technique. These results have absence of illness in the pigs was confirmed because the established that PCR is proven to be a fast and secure expression of this gene was not identified molecularly method for identification, in addition to preventing the in the samples. occurrence of dubious results before the interpretation As for the presence of Salmonella spp. and of biochemical tests. S. Typhimurium the literature recognizes the pres- It was concluded that technique is frequently ence of this bacteria intermittently and systematically used in research labs, scientific papers and has gained frequent in animals from grange. This fact worries headway in other sectors, such as food industries, the industrial sector requiring greater care during the production and diagnostic laboratories, in order to slaughter and evisceration in order to prevent the spread improve the control and speed identification. Studies of this agent in the industrial process. that seek to identify the presence of C. perfringens The results for Salmonella spp. showed higher and Salmonella spp. in finishing pigs leads to better at the slaughterhouse (21.4%) when com- understanding of the action of disease and of preven- pared to confinement (9.5%). This difference can be tion methods, thus avoiding serious economic losses attributed to hygienic quality of the finishing farms in the sector and improving sanitary control of farms and the fact that animals over stress suffered dur- and slaughterhouse. ing transport to slaughter, since this can trigger the intermittent elimination of the agent to environment, CONCLUSION infecting healthy animals. The detection of Salmo- The presence of C. perfringens and Salmo- nella spp. in slaughterhouse is considered a risk factor nella spp. is related directly to negative influence for the steps of slaughter, evisceration and cutting on pig production, mainly in initial confinement of carcasses, since the industrial process is dynamic hindering the weight gain of the animals, and in and an effective control of this agent during the pro- the industry sector contaminating the meat and its duction line is difficult. Bessa [3] found significant derivatives. correlations between the presence of Salmonella In these cases the molecular biology methods spp. in carcasses on slaughter line and the bacteria showed to be quite efficient when compared to the in intestinal contents of animals. conventional ones, using the gens of toxins in the detec- Up to 10% of cases of in humans tion of such pathogens. Thus, PCR can be considered is motivated by consumption of pork meat, and that an useful tool to improve pig production. 17% of the pigs with age of slaughter are infected with Salmonella spp., but estimate that 4% of the animals MANUFACTURERS eliminate the microorganism in their feces for a long 1BD BBLTM. Franlin Lakes, NJ, USA. period [10]. 2Applied Biosystems Inc. CA, USA. Many researches have been demonstrating 3Invitrogen. Carlsbad, CA, USA. that the use of PCR to identify Salmonella spp. have 4FERMENTAS AB. Vilnius, Lithuania. more sensitivity than the conventional microbiology. 5BIO-RAD. Benicia, CA, USA. For this work, this technique gave swift and reliable 6HiMedia Laboratories, L.B.S. Marg. Mumbai, India. results, since it consisted of amplification of specific 7Merck, Sharp & Dohme S.A. Madrid, Spain. genes to the species of C. perfringens and Salmonella Acknowledgements. The authors would like to thank Professor spp. and S. Typhimurium. PCR technique was much Dr. Maria Cristina Thomaz for allowing the use of the animal more swifter and effective than conventional methods of the farming of FCAVJ for the collections of samples, and [9], since in just three days the author obtained relevant to Professor Dr. Angelo Berchieri Junior for contributing with and reliable results while traditional methods extended the default strain of Salmonella Typhimurium. for more than seven days. Declaration of interest. The authors report no conflicts of Also comparing standard microbiological interest. The authors alone are responsible for the content and techniques with PCR technique for the detection of writing of paper

6 L. Boarini, M.C. Beraldo-Massoli, M.F. Casagrande, et al. 2015. Identification of Clostridium perfringens and Salmonella spp. in Swine Through PCR. Acta Scientiae Veterinariae. 43: 1333.

REFERENCES

1 Baker A.A., Davis E., Rehberger T. & Rosener D. 2010. Prevalence and diversity of toxigenic Clostridium perfringens and Clostridium difficile among swineherds in the Midwest. Applied Environoment Microbiology. 76: 2961-2967. 2 Baums C.G., Schotte U., Amtsberg G. & Goethe R. 2004. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Veterinary Microbiology. 100: 11-16. 3 Bessa C. M. 2006. Caracterização fenotípica e genotípica de amostras de sorovar Typhimurium isoladas de suínos no Rio Grande do Sul. 145f. Porto Alegre, RS. Tese (Doutorado em Ciências Veterinárias). Programa de Pós-graduação em Ciências Veterinárias, Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul. 4 Cardozo M.V., Schocken-Iturrino R.P., Beraldo-Massoli M.C., Cavani R., Casagrande M.F., Boarini L., Borges C.A. & Beraldo L.G. 2012. Pathogens in animal meal and use of Salmex® in the elimination of Clostridium perfrin- gens. African Journal of Microbiology Research. 6(16): 3727-3731. 5 Castagna S.M.F., Schwarz C.W. & Cardoso M. 2005. Detection of Salmonella sp. from porcine origin: a comparison between a PCR method and standard microbiological techniques. Brazilian Journal of Microbiology. 36: 373-377. 6 Ferreira T.S.P., Moreno A.M., Almeida R.R., Gomes C.R., Gobbi D.D.S., Filsner P.H.N.L. & Moreno M. 2012. Molecular typing of Clostridium perfringens isolated from swine in slaughterhouse from São Paulo State, Brazil. Ciência Rural. 42(8): 1450-1456. 7 Gomes A. M., Lobato F.C.F., Martins N.R.S. & Assis R.A. 2008. Genotyping of Clostridium perfringens isolates from by multiplex PCR. Ciência Rural. 38(7): 1943-1947. 8 Gotter V., Klein G., Koesters S., Kreienbrock L., Blaha T. & Campe A. 2012. Main risk factors for Salmonella- infections in pigs in northwestern Germany. Preventive Veterinary Medicine. 106: 301-307. 9 Gouvêa R. 2009. Comparação entre isolamento bacteriológico convencional e PCR na detecção de Salmonella spp. em amostras de carne de frango artificialmente contaminadas e de campo. 54f. Niterói, RJ. Dissertação (Mestrado Higiene Veterinária). Programa de Pós-graduação em Medicina Veterinária, Universidade Federal Fluminense. 10 Hill A.A., Snarly E.L., Arnold M.E., Alban L. & Cook A.J. 2008. Dynamics of Salmonella on British pig grower-finisher farm: A stochastic model. and Infection. 136(3): 320-333. 11 Lindstrom M., Heikinheimo A., Lahti P. & Korkeala H. 2011. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. . 28(2): 192-198. 12 Marmur J. 1961. A procedure for the isolation of deoxyribonucleic acid from microorganisms. Journal of Molecular Biology. 3: 208-218. 13 Muller M. 2005. Comparação da presença de suínos portadores de Salmonella sp. no inicio da fase de terminação e ao abate, em três granjas do Rio Grande do Sul. 87 fl. Porto Alegre, RS. Dissertação (Mestrado Microbiologia Agrícola e do Ambiente). Programa de Pós-graduação em Microbiologia Agrícola e do Ambiente. Faculdade de Agronomia, Universidade Federal do Rio Grande do Sul. 14 Oliveira S.D., Santos L.R., Schuch D.M.T., Silva A.B., Salle C.T.P. & Canal C.W. 2002. Detection and identification of Salmonella from -related samples by PCR. Veterinary Microbiology. 87: 25-35. 15 Songer J.G. & Uzal F.A. 2005. Clostridial enteric infection in pig. Journal Veterinary Diagnostic Investigation. 17: 528-536. 16 Van Asten A.J.A.M., Nikolaou G.N. & Grone A. 2010. The occurrence of cpb2-toxigenic Clostridium perfringens and the possible role of β2-toxin in enteric disease of domestic animal and humans. The Veterinary Journal. 183: 135-140. 17 Vieira A.A.S., Guedes R.M.C., Salvarani F.M, Silva R.O.S., Assis R.A & Lobato F.C.F. 2008. Genotyping of Clostridium perfringens isolated from piglets. Arquives of Institute Biologic. 75(4): 513-516

1333 www.ufrgs.br/actavet

7