The Methyltransferase Yfgb/Rlmn Is Responsible for Modification of Adenosine 2503 in 23S Rrna

Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

SEOK-MING TOH,1 LIQUN XIONG,1 TAEOK BAE,2 and ALEXANDER S. MANKIN1 1Center for Pharmaceutical Biotechnology, University of Illinois, Chicago, Illinois 60607, USA 2Indiana University School of Medicine, Gary-Northwest, Gary, Indiana 46408, USA

ABSTRACT A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post- transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. Keywords: exit tunnel; peptidyl transferase; post-transcriptional modifications; radical SAM methyl transferase; ribosome

INTRODUCTION exceptions, the exact role of these modified nucleotides remains largely unknown. Analyzing functional properties Ribosomal RNA plays a critical role in protein synthesis. In of the ribosome lacking individual modifications is the the ribosome, rRNA adopts an intricate spatial structure most direct way to elucidate the contribution of post- that places chemical groups of rRNA nucleotides in the transcriptional modifications to translation. For that, one proper position for carrying out such elaborate functions as needs to know the enzymes that alter the chemical nature of monitoring codon–anticodon interactions, catalyzing pep- rRNA nucleotides. tide bond formation, binding ligands and cofactors, etc. In In bacteria, rRNA modifications involve mainly methyl- vitro transcribed rRNA can be assembled into small and ation of various rRNA residues and pseudouridylation. In large ribosomal subunits and can carry out protein syn- the case of Escherichia coli 23S rRNA, 25 modified nucleo- thesis reasonably well, suggesting that the main functional tides have been mapped (Andersen and Douthwaite 2006). properties of rRNA are dictated solely by its nucleotide Fourteen of these modifications are associated with domain sequence and spatial arrangement (Krzyzosiak et al. 1987; V, the main component of the peptidyl transferase center Green and Noller 1999; Khaitovich et al. 1999). Yet in the (PTC) (Fig. 1; Noller 1984). The pseudouridine synthases cell, rRNA carries a number of post-transcriptional mod- responsible for all five pseudouridine modifications in this ifications at specific nucleotide residues. The clustering of region (positions 2457, 2504, 2580, 2604, and 2605) have the modified nucleotides in functionally critical regions of been identified (Conrad et al. 1998; Huang et al. 1998; Del rRNA indicate their importance for ribosome activity Campo et al. 2001). Of the 9 remaining modified nucleo- (Ofengand and Fournier 1998). However, with a few tides, 7 carry methylations (m6A2030, m7G2069, Gm2251, m2G2445, Cm2498, m2A2503, and Um2552), one is a Reprint requests to: Alexander S. Mankin, Center for Pharmaceutical dihydrouridine (D2449), and one is a predicted 2-thio- Biotechnology, m/c 870, University of Illinois, 900 S. Ashland Avenue, cytidine (s2C2501) (Andersen et al. 2004). So far, only three Chicago, IL 60607, USA; e-mail: [email protected]; fax: (312) 413-9303. Article published online ahead of print. Article and publication date are at of the methyltransferases responsible for post-transcrip- http://www.rnajournal.org/cgi/doi/10.1261/rna.814408. tional methylation of nucleotides in domain V of 23S rRNA

98 RNA (2008), 14:98–106. Published by Cold Spring Harbor Laboratory Press. Copyright Ó 2008 RNA Society. Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

RlmN methylates A2503 in 23S rRNA

Here, we report the identification of the methyltransferase, RlmN, which is responsible for generation of m2A2503 in the ribosomes of Gram-positive and Gram-negative bacteria.

RESULTS

The E. coli gene yfgB encodes an enzyme responsible for methylation of A2503 in 23S rRNA S-adenosylmethionine- (SAM) dependent methyltransferase Cfr, whose gene was found in staphylococcal isolates from animal sources and more recently in a clinical strain of Staphylococcus aureus, confers resistance to a number of PTC-targeting inhibitors of protein synthesis (Kehrenberg et al. 2005; Long et al. 2006; Toh et al. 2007). Cfr-mediated antibiotic resistance results from hypermethylation of A2503 in 23S rRNA. Sequence analysis of the staphylococcal cfr gene showed its significant homology (32% sequence identity) with an E. coli gene yfgB that encodes a protein of unknown function (Schwarz et al. 2000; Kozbial and Mushegian 2005). Similar to Cfr, YfgB contains the cysteine-rich motif C124ALECKFC, which is a characteristic signature of the superfamily of proteins known as radical SAM enzymes (motif 1 in Fig. 2; Schwarz et al. 2000). Importantly, homology between Cfr and YfgB extends into FIGURE 1. Secondary structure of domain V of E. coli 23S rRNA the C-terminal portion of the protein, which in radical (Cannone et al. 2002). The sites of post-transcriptional modification SAM enzymes is often responsible for substrate binding, are indicated. Green: nucleotides that carry methylations; blue: suggesting that Cfr and YfgB may operate upon the same or 2 pseudouridines, dihydoruridine, or 2-thiocytidine. m A2503 is circled similar substrates. Therefore, we hypothesized that E. coli and in red. A DNA oligonucleotide used to prepare a fragment of 23S rRNA for the nucleotide analysis is shown by a solid line. yfgB could encode the elusive methyltransferase responsible for natural modification of A2503 in the 23S rRNA of E. coli to m2A. have been identified—RlmE (synonymous to FtsJ or RrmJ), To test this hypothesis we used the strain JW2501 from which generates 29-O-methylated uridine at position 1552 the ‘‘Keio’’ collection of E. coli clones containing single- (Bugl et al. 2000; Caldas et al. 2000), RlmL (synonymous gene knockouts of all nonessential genes in the E. coli K-12 to YcbY), which methylates the N2 position of G2445 strain BW25113 (Baba et al. 2006). In strain JW2501 of the (Lesnyak et al. 2006), and RlmB (synonymous with YifH), collection, the kanamycin resistance cassette replaced the which generates 29-O-methyl guanine at position 2251 yfgB gene. Inactivation of the yfgB gene in strain JW2501 (Lo¨vgren and Wikstro¨m 2001). was confirmed by PCR. One of the methylated nucleotides in the PTC is A2503. The modification status of A2503 in the JW2501 strain In E. coli, A2503 is post-transcriptionally modified to was initially analyzed by primer extension. In wild-type m2A (Kowalak et al. 1995). A2503 is located at the entrance of E. coli, the methylation of A2503 at C2 results in a weak the exit tunnel (Ban et al. 1998; Harms et al. 2001; Schuwirth reverse transcriptase stop (Fig. 3A). When 23S rRNA et al. 2005; Selmer et al. 2006); however, the precise functional extracted from the DyfgB strain JW2501 was used as a role of m2A2503 has not been explored. This nucleotide is template, the band corresponding to the reverse transcrip- fairly close to the binding sites of several PTC-targeting tase stop at m2A2503 was not observed, indicating the loss antibiotics, including clindamycin, carbomycin, streptogra- of m2A2503 modification in this strain. When the DyfgB min A, anisomycin, and linezolid (Schlunzen et al. 2001; strain was transformed with a plasmid overexpressing the Hansen et al. 2002; Tu et al. 2005). Mutations of A2503 confer YfgB protein (Kitagawa et al. 2005), the reverse transcrip- resistance to chloramphenicol and streptogramins (Vester and tase stop reappeared (Fig. 3B) establishing a causative Garrett 1988; Porse and Garrett 1999) and its hypermethyla- relationship between the presence of yfgB and post-tran- tion by Cfr methyltransferase in staphylococci or E. coli leads scriptional modification of A2503 in E. coli. to resistance against a number of PTC-targeting antibiotics We further investigated the presence of m2A2503 mod- (Kehrenberg et al. 2005; Long et al. 2006). ification in the DyfgB strain by two-dimensional thin-layer

www.rnajournal.org 99 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Toh et al.

FIGURE 2. Alignment of RlmN (YfgB) (E. coli) with similar proteins from Gram-negative bacteria (magenta), Gram-positive bacteria (cyan), and unicellular eukaryotes (orange). Residues with high consensus score (>90%, red; >50%, blue) are highlighted. The six conserved motifs of radical SAM enzymes are indicated (Schwarz et al. 2000; Kozbial and Mushegian 2005). Alignment was done using MultAlin server (http:// bioinfo.genopole-toulouse.prd.fr/multalin/multalin.html) (Corpet 1988). chromatography (2D-TLC). Many modified nucleotides C2501. The exact nature of the modification of C2501 has present in rRNA, including m2A, can be resolved by 2D- not been determined, but from the results of mass- TLC and are characterized by defined chromatographic spectrometric analysis it is compatible with 2-thiocytidine mobilities (Bochner and Ames 1982; Keith 1995). The (Andersen et al. 2004). oligonucleotide-protection technique was used to prepare a short segment of 23S rRNA that encompasses position The RlmN homolog in Staphylococcus aureus 2503 (Kowalak et al. 1995; Andersen et al. 2004). A 41- nucleotide (nt)-long oligonucleotide (Fig. 1) was hybrid- The 23S rRNA of Thermus thermophilus and Bacillus ized to 23S rRNA isolated from wild-type or DyfgB strains; megaterium is methylated at the position equivalent to the unhybridized RNA was digested by RNase A and the E. coli m2A2503 (Mengel-Jorgensen et al. 2006). However, protected rRNA segment was purified by gel electrophore- the extent of conservation of the A2503 modification sis. The RNA fragment was then hydrolyzed to 39-mono- within the evolutionary domain of Bacteria is unknown. nucleotides by RNase T2. The nucleotides were 59 labeled Given its location in the functionally important site in the by incubation with g-[32P]-ATP and polynucleotide kinase ribosome and proximity to the site of action of clinically and, after removal of the 39-phosphate by nuclease P1 important antibiotics, it was interesting to investigate hydrolysis, the nucleoside-59-monophosphates were sepa- whether this modification, and the enzyme corresponding rated by 2D-TLC (Fig. 4; Bochner and Ames 1982). A spot to the E. coli RlmN, is present in Gram-positive bacterial with the characteristic mobility of m2A was present in the pathogens. A BLAST search against the complete Uni- sample derived from wild-type rRNA but was absent in ProtKB database (http://www.ebi.ac.uk/uniprot/) using the rRNA prepared from the DyfgB strain. This result con- YfgB protein sequence as query and a threshold E value of firmed that A2503 remains unmodified in the absence of 0.001 identified >500 bacterial proteins with highly signif- YfgB and thus established YfgB as the methyltransferase icant similarity (>55%) to YfgB. Among these proteins was responsible for post-transcriptional modification of A2503 the polypeptide encoded by the gene NWMN_1128 of the to m2A. In agreement with the accepted convention clinical Staphylococcus aureus strain Newman, which (Ofengand and Del Campo 2004; Andersen and Douth- exhibited 36% sequence identity to E. coli protein RlmN. waite 2006), we propose to rename YfgB protein as RlmN It was a likely candidate for the enzyme responsible for (rRNA large subunit methyltransferase gene N). A2503 modification in wild-type S. aureus. Primer exten- An unidentified spot, marked X in Figure 4, was sion carried out on 23S rRNA prepared from the S. aureus observed in both samples. The origin of this spot is laboratory strain RN6390B and the clinical strain Newman unknown but it can correspond to the partially modified showed the presence of weak reverse transcriptase stops

100 RNA, Vol. 14, No. 1 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

RlmN methylates A2503 in 23S rRNA

However, in a co-growth competition experiment, the rlmN knockout mutant showed reduced fitness compared to wild type (Fig. 5). In a mixed culture initially containing equal proportions of wild-type and mutant cells, the representation of the rlmN mutant reduced to 6% after six dilutions (z50 doublings). Similarly, rlmN knockout cells also lost in co-growth competition with the control xylA knockout strain. Thus, the absence of m2A2503 modification produces a subtle but significant effect on cell fitness apparently through its effect on protein synthesis or ribosome assembly.

The lack of m2A2503 modification affects antibiotic sensitivity Acquired antibiotic resistance enzymes often target rRNA and prevent drug binding by modifying specific rRNA residues, usually via attaching one or several methyl groups (Weisblum 1995; Mann et al. 2001; Treede et al. 2003; Kehrenberg et al. 2005). A2503 is the target of modification by Cfr methyltransferase, which renders cells resistant to phenicols, lincosamides, oxazolidinones, pleuromutilins, and FIGURE 3. Primer extension analysis of 23S rRNA. (A) rRNA from a control wild-type E. coli strain BW25113 (wt) and yfgB (rlmN) streptogramin A antibiotics (Long et al. 2006). In some knockout mutant strain (DyfgB); sequencing lanes (A,G) are indi- cases, the lack of natural modification at specific rRNA cated. (B) rRNA from the E. coli yfgB knockout strain transformed positions may influence susceptibility of bacterial cells to with the yfgB expression plasmid (DyfgB/pyfgB) or with the empty antibiotics (Helser et al. 1972; Van Buul et al. 1983; Johansen vector (DyfgB/pCA24N); sequencing lane (A) is marked. (C) rRNA from S. aureus: ‘‘RN6390B,’’ control laboratory strain; ‘‘CM05’’ et al. 2006; Okamoto et al. 2007). Therefore, we tested clinical isolate CM05 that carries the cfr gene (Toh et al. 2007); susceptibility of the rlmN knockout E. coli mutant to an ‘‘1128-KO,’’ S. aureus Newman strain with the insertionally inacti- array of peptidyl transferase-targeting antibiotics. Though vated gene NWMN_1128, ‘‘control-KO,’’ S. aureus Newman strain E. coli is naturally resistant to many antibiotics owing to with the insertionally inactivated neutral gene NWMN-1912; ‘‘NWMN,’’ wild-type Newman strain. active efflux, high concentrations of the drugs do inhibit protein synthesis and cell growth (Xiong et al. 2000). The E. coli rlmN knockout strain showed a small but repro- corresponding to the possible occurrence of post-transcrip- ducible twofold increased susceptibility to tiamulin, hygro- tional modification at A2503 (Fig. 3C). However, when 23S mycin A, and sparsomycin compared to the wild-type strain rRNA prepared from the S. aureus Newman strain in which (Table 1). Inactivation of rlmN in S. aureus resulted in two- the NWMN_1128 gene was inactivated by transposon fold increased susceptibility to linezolid. insertion (Bae et al. 2004) was analyzed, the corresponding band was no longer present (Fig. 3C). This result indicated that the position equivalent to E. coli A2503 is post- transcriptionally modified in S. aureus and that the protein encoded by the NWMN_1128 gene is responsible for this modification. By analogy with E. coli, we expect that S. aureus carries m2A modification at position 2503 of 23S rRNA.

The lack of methylation of A2503 in E. coli 23S rRNA reduces cell fitness Inactivation of rlmN (yfgB) did not notably affect growth of E. coli in LB medium (data not shown). The rlmN À cells grew with a doubling time of 43 min, comparable to that of FIGURE 4. 2D-TLC analysis of nucleotides from the yfgB knockout wild-type BW25113 cells (41 min) or to a control strain and wild-type E. coli 23S rRNA fragment. The positions of 59 mono- phosphate UV markers are indicated by dashed-line circles. The where the kanamycin marker replaced the xylA gene, which radioactive spots used for alignment of the PhosphorImager scans is nonessential for growth in rich medium (44 min). with the TLC plates are circled with a solid line.

www.rnajournal.org 101 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Toh et al.

classic methylation reaction and calls for a principally different reaction mechanism (Wang and Frey 2007). It is not surprising, therefore, that the enzyme responsible for this reaction, RlmN, exhibits little similarity to other known methyltransferases that operate on rRNA. The amino acid sequence of RlmN shows characteristic signatures of a superfamily of proteins known as radical SAM enzymes (marked as ‘‘motifs’’ in Fig. 2) (Sofia et al. 2001; Kozbial and Mushegian 2005). All radical SAM enzymes contain the cysteine-rich motif CxxxCxxC (in RlmN: C124ALECKFC, motif 1 in Fig. 2), which is involved in chelation of the [4Fe–4S]1+ cluster. The cluster initiates a reductive cleavage of SAM, resulting in formation of 59 deoxyadenosyl radical. This radical then abstracts a hydro- FIGURE 5. Growth of DyfgB cells in competition with the initially gen atom from a chemically unreactive CH group thereby equal number of wild-type (closed boxes) and DxylA mutant cells (open leading to its chemical activation. The general role of SAM boxes). The percent of DyfgB cells in the population was determined at in radical SAM enzymes is thus of a substrate for generation each cycle by plating as described in Materials and Methods. of reactive radical. In regards to RlmN, this mechanism will imply that one molecule of SAM will be consumed to generate a 59deoxyadenosyl radical that will activate the C2 DISCUSSION aromatic carbon atom of the adenine base. The source of the We have identified the enzyme responsible for ‘‘natural’’ methyl group that is then transferred to the activated C2 post-transcriptional modification of A2503 to m2Ain carbon atom of adenine 2503 is unknown, but by analogy E. coli 23S rRNA. Cells lacking the gene yfgB (rlmN) carried with some other radical SAM methyltransferases, one can unmodified A at position 2503 of 23S rRNA. Reintroduc- expect that a second molecule of SAM may serve as the tion of rlmN into the knockout strain restored modification. methyl donor (Pierrel et al. 2004; Hernandez et al. 2007). These result unequivocally established RlmN as the methyl- We have shown that a protein with the structure, and transferase that modifies A2503 in 23S rRNA to m2A. likely function, similar to that of RlmN of Gram-negative There are 14 post-transcritionally modified purine E. coli is encoded in the genome of phylogenetically distant residues in rRNA of the E. coli ribosome (Andersen and Gram-positive S. aureus. Though we have not explicitly Douthwaite 2006). All the post-transcriptional modifica- analyzed the phylogenetic distribution of rlmN-like genes tions of purines in rRNA entail transfer of one or several among sequenced genomes, BLAST search shows that close methyl groups to the nitrogen base or to the ribose. In most RlmN homologs are encoded in chromosomal DNA of cases, the methyl-accepting groups (endo- or exocyclic many Gram-negative and Gram-positive bacteria (Fig. 2). nitrogen atoms of the purine base or 29oxygen of the The presence of methylated A2503 in 23S rRNA was ribose sugar) are nucleophilic and the methylation reaction experimentally detected in three bacterial species, E. coli, proceeds through a classic alkylation mechanism involving T. thermophilus, and B. megaterium (Kowalak et al. 1995; the methyl group of SAM. The only nucleotide in rRNA Mengel-Jorgensen et al. 2006). Proteins with considerable that is methylated at the carbon atom of the purine base is (30%–50%) similarity to RlmN are also encoded in A2503. Low nucleophilicity of the adenine’s C2 makes this genomes of several unicellular eukaryotes (Fig. 2) indicat- reaction much more challenging in chemical terms than the ing that the adenine residue corresponding to the bacterial

TABLE 1. Antibiotic susceptibility of the RlmN knockout strains in E. coli and S. aureus compared with the control strains

MIC (mg/mL)

Strain Tiamulin Chloramphenicol Clindamycin Linezolid Hygromycin A Sparsomycin Streptomycin

E. coli (wt)a 1024 8 512 1024 512 32 32 E. coli RlmNÀ 512 8 512 1024 256 16 32 S. aureus NWMN_1912b <18 >1024 4 128 32 128 S. aureus NWMN_1128c <18 >1024 2 128 32 128

aStrain BW25113. bStrain Newman with a transposon insertion in a ‘‘neutral’’ gene NWMN_1912. cStrain Newman with a transposon insertion in a gene NWMN_1128 homologous to the E. coli RlmN.

102 RNA, Vol. 14, No. 1 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

RlmN methylates A2503 in 23S rRNA

A2503 may be post-transcriptionally modified in these Deinococcus radiodurans 50S subunit, A2503 was modeled species. BLAST search in the archaeal genomes revealed in anti conformation (Ban et al. 1998; Harms et al. 2001; proteins with only limited similarity to RlmN. However, at Schuwirth et al. 2005; Selmer et al. 2006). Since the least one report mentioned the presence of m2A2503 in 23S modification status of A2503 in D. radiodurans is unknown rRNA of an archaeon Haloarcula marismortui (cited in (even though D. radiodurans genomes encodes a protein Mengel-Jorgensen et al. 2006). Thus, it appears that the homologous to RlmN), it is unclear whether this difference modification of A2503 to m2A is conserved among evolu- results from the lack of A2503 methylation or is a mere tionarily distant species. reflection of insufficient resolution. Nevertheless, a possible A rather ‘‘difficult’’ chemistry involved in formation of syn–anti transition of A2503 or, in general, the exact m2A2503 implies that there must have been a compelling orientation of the base should be affected by the presence reason for the cells to evolve an enzyme catalyzing this of the C2 methyl group (Saenger 1984). Directly, or reaction. Furthermore, broad distribution of RlmN homo- indirectly (via changing conformation of A2059 and/or logs among species indicates that there is strong evolution- A2058), the precise placement of A2503 base may influence ary pressure to maintain post-transcriptional modification the contacts between the tunnel wall and the nascent of A2503 in rRNA. What could the functional purpose of peptide and could be a part of the ribosome response having adenosine at position 2503 in 23S rRNA modified mechanism to specific nascent peptides in the tunnel. be? A2503 is located at the entrance to the nascent peptide RlmN was initially identified on the basis of its homol- exit tunnel and is exposed in the tunnel lumen (Ban et al. ogy with Cfr, an enzyme that hypermethylates A2503 and 2000). It tops the stack of three adenines (A2058/A2059/ renders cells resistant to several antibiotics, inhibitors of the A2503) (Fig. 6). These nucleotides, which are located at the peptidyl transferase activity (Schwarz et al. 2000, 2004). In constriction of the nascent peptide tunnel, might be a part cells that acquire cfr, A2503 has not one extra methyl of the mechanism that monitors the sequence of the group, as m2A2503 in wild-type rRNA, but two. However, nascent peptide (Mankin 2006). Indeed, mutations in the exact placement of the second methyl group in the Cfr- A2058 were shown to affect the ribosome stalling during modified A2503 is unknown (Kehrenberg et al. 2005). translation of the SecM nascent peptide, which depends on Given that, similar to RlmN, Cfr belongs to the radical the ribosome-nascent peptide interaction (Nakatogawa and SAM enzyme superfamily, one would expect that the Cfr- Ito 2002). In the crystallographic structures of the large catalyzed methylation reaction should also involve a CH ribosomal subunits of H. marismortui, T. thermophilus, and center. The only aromatic carbon atom available for E. coli, the base of A2503 is in syn conformation but in the methylation in m2A is C8. Even though C8-methylated adenine has not yet been found in natural RNAs, it is possible that Cfr utilizes the radical mechanism to methylate this chemically inert center. Another possibility is that Cfr converts m2A to 2-ethyladenosine. Though unusual, such a modification appears to be compatible with the published results of mass spectrometry of Cfr-modified 23S rRNA (Kehrenberg et al. 2005). Hypermethylation of A2503 by Cfr confers resistance to several drugs that bind in the vicinity of this nucleotide in the peptidyl transferase center (Long et al. 2006). The lack of A2503 natural modification in the E. coli rlmN knockout strain led to a modest increase in susceptibility to tiamulin, hygromycin A, and sparsomycin, confirming that the modification status of A2503 affects antibiotic sensitivity. This result is in line with a growing perception that the loss of natural post-transcriptional modifications in rRNA may affect susceptibility of bacterial cells to antibiotics, a notion that may have clinical implications (Helser et al. 1972; Van Buul et al. 1983; Johansen et al. 2006; Okamoto et al. 2007).

FIGURE 6. Position of the A2503 (red) in the E. coli ribosome MATERIALS AND METHODS (Schuwirth et al. 2005) relative to the tRNA substrates docked in the P site (light green) and A site (light blue) (Leach et al. 2007). A2503 is located within 9 A˚ of peptidyl tRNA and its base stacks on top of Strains and plasmids A2059 and A2058, located at the constriction of the nascent peptide tunnel. The C2 methyl group added to A2503 by RlmN is indicated by The collection of gene knockout mutants of the E. coli strain a red ball. BW25113 (Keio collection) was obtained from Nara Institute of

www.rnajournal.org 103 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Toh et al.

Science and Technology (Baba et al. 2006). The strain JW2501 in was transferred to Whatman 3MM paper, dried, and exposed on a the collection, which has the yfgB gene replaced with the phosphorimager screen. The screen was scanned on a Molecular kanamycin resistance cassette, was used in the experiments. The Dynamics PhosphorImager, and the band intensities were quan- gene replacement was verified by PCR analysis. The strain tified using Molecular Dynamics Image Quant software. JW3537, in which the kanamycin resistance cassette replaces xylA gene dispensable for growth in rich media, was used as control in Preparation of an rRNA segment some experiments. Plasmid expressing yfgB was from the ASKA encompassing A2503 library strain JW2501 (Kitagawa et al. 2005). S. aureus strains used in this work include RN6390B (Novick E. coli cells were grown in liquid LB medium to an optical density et al. 1993), Newman (wild type), and the following transpo- of A550 = 0.4 and harvested by centrifugation. Cells were washed son mutants: NWMN_1128 (the yfgB gene homolog) and and resuspended in Buffer A (20 mM Tris-HCl at pH 7.5, 100 mM NWMN_1912 (a prophage gene), the control mutant. The NH4Cl, 10 mM MgCl2, 0.5 mM EDTA, 6 mM BME). The cells mutants were generated by transducing the transposon insertions were lysed by passing them through a French press, and cell debris from the FNJ-0032 and FNJ-3200 strains of the Phoenix was removed by centrifugation (15 min at 16,000 rpm, then 10 library of bursa aurealis mutants (Bae et al. 2004) into Newman min at 24,000 rpm in the Beckman JA25 rotor, at 4°C). Ribosomes wild-type strain with the staphylococcal phage F85. were collected from the supernatants by centrifugation at 33,000 rpm for 22 h at 4°C in a Beckman Ti70 rotor. The pellet was Isolation of total cellular RNA and primer resuspended in resuspension buffer (50 mM Tris-HCl at pH 7.5, extension analysis 150 mM NH4Cl, 5 mM MgCl2, 6 mM BME) and stored at À80°C. We diluted 330 A260 of ribosomes in extraction buffer 0.3 M For isolation of total RNA, E. coli or S. aureus cells were grown in NaOAc (pH 5.5) to the final volume of 1000 mL, and rRNA was LB broth or tryptic soy broth, respectively, to an optical density of isolated by three repeated extractions with equal volumes of A550 =1.E. coli RNA was isolated using the TRIzol kit phenol/chloroform followed by ethanol precipitation. (Invitrogen) whereas S. aureus RNA was isolated using the To isolate a defined rRNA sequence, 1200 pmol of a 41-nt DNA UltraClean Microbial RNA Isolation Kit (Mo Bio Laboratories) oligonucleotide, GATGTGATGAGCCGACATCGAGGTGCCAAA according to the manufacturer’s protocols. CACCGCCGTCG, complementary to the 23S rRNA segment Primer extension analysis was carried out following the pub- 2480–2520 of E. coli 23S rRNA, were combined with 400 pmol lished protocol (Merryman and Noller 1998) with some mod- of total rRNA and 60 mL hybridization buffer (250 mM HEPES, ifications. Ten picomoles of the DNA primer TCGCGTAC 500 mM KCl at pH 7) in a total volume of 200 mL. The mixture CACTTTA, complementary to the positions 2563–2577 of 23S was incubated for 5 min at 90°C and then allowed to cool to room rRNA (E. coli numbering), were 32P-59-terminally labeled by temperature over 1.5 h. We added 0.00625 mg of RNase A (Sigma- incubation in the final volume of 10 mL with 10 mCi (1.7 pmol) Aldrich)/pmol rRNA, followed by a 50 min incubation at 37°C. g-[32P] ATP (6000 Ci/mmol) and 10 units of polynucleotide The reaction was extracted once with phenol/chloroform. Nucleic kinase in a 13 polynucleotide kinase buffer (Fermentas). Reaction acids were ethanol precipitated, dissolved in water, and incubated was incubated at 37°C for 30 min and then stopped by incubation with RQ1 DNase (Promega) at 37°C for 15 min. Following an- for 2 min at 90°C. other phenol/chloroform extraction and ethanol precipitation, the We combined 0.5 pmol of labeled primer with 2 mgof protected rRNA fragment was purified on a 13% polyacrylamide total cellular RNA in 4.5 mL of hybridization buffer (50 mM gel containing 7 M urea. Bands were visualized by ethidium bro- HEPES-KOH at pH 7, 100 mM KCl). Reactions were incubated mide staining, and the RNA band was excised and eluted over- at 90°C for 1 min and then cooled over z10 min to 45°C. night at 24°C in 0.3 M NaOAc (pH 5.5). RNA was extracted with Annealed reactions were then centrifuged for 15 sec to collect any phenol, phenol/chloroform, chloroform and ethanol precipitated. condensate. An extension reaction premix contained 0.65 mLof103 Analysis of nucleotide composition by 2D-TLC reaction buffer (1.3 M Tris-HCl at pH 8.5, 100 mM MgCl2, 100 mM DTT), 1.5 mL of dNTP mix (1 mM dGTP, 1 mM dATP, The isolated rRNA fragment (0.1–0.5 mg) was denatured by 1 mM dTTP, and 1 mM dCTP), 0.75 mL of RNase-free water, incubation at 65°C for 5 min and then placed on ice. The and 0.1 mL (3 units) of AMV reverse transcriptase (Seikagaku denatured RNA was digested to nucleoside 39 phosphates with America) per reaction. The amount of premix was adjusted 10 units of RNase T2 (Invitrogen) for 15 min at 37°C. The 39 according to the number of samples to be analyzed. We added 3 mononucleotides were then 59 32P phosphorylated by incubation mL of the pre-mix to each reaction tube with the annealed primer/ with 10 mCi (1.7 pmol) g-[32P] ATP (6000 Ci/mmol) and 10 units RNA complex. Samples were incubated at 42°C for 30 min. polynucleotide kinase in a 13 polynucleotide kinase buffer Following incubation, 120 mL of stop buffer (84 mM NaOAc at (Fermentas). The reaction was extracted with phenol-chloro- pH 5.5, 70% EtOH, 0.8 mM EDTA) were added to each tube form-isoamyl alcohol (25:24:1) and chloroform and then incu- followed by centrifugation at maximum speed for 10 min at room bated with 2 mg of nuclease P1 (USBiological) for 3 h to overnight temperature. After complete removal of supernatant and air- at 37°C. Prior to loading on TLC plates, the radiolabeled sample drying of the tubes for 2–3 min, the pellets were resuspended in was mixed with 1 mL of the marker comprising 1 A260 of each of 5 mL of formamide loading dye (Sambrook et al. 1989). We 59 AMP, GMP, CMP, and UMP. loaded 2 mL onto a 5-mm- wide slot of a 20 cm 3 40 cm 3 0.25 Two-dimensional separation of the 59-[32P] nucleoside mono- mM, 6% urea-polyacrylamide gel. The gel was run at 40 W until phosphates was performed on glass-backed polyethyleneimine the bromophenol blue dye reached the bottom of the gel. The gel cellulose F plates (Merck). Plates (20 cm 3 10 cm) were developed

104 RNA, Vol. 14, No. 1 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

RlmN methylates A2503 in 23S rRNA

at room temperature (first dimension: 20 cm, second dimen- Ban, N., Nissen, P., Hansen, J., Moore, P.B., and Steitz, T.A. 2000. The sion:10 cm). The solvent systems used were the following: first complete atomic structure of the large ribosomal subunit at 2.4 A˚ dimension: isobutyric acid: NH OH conc: H O=66:1:33, second resolution. Science 289: 905–920. 4 2 Bochner, B.R. and Ames, B.N. 1982. Complete analysis of cellular dimension: isopropanol: HCl: H O=70:15:15. Identification of 2 nucleotides by two-dimensional thin layer chromatography. J. each radiolabeled spot on the plate was performed by comparison Biol. Chem. 257: 9759–9769. with those in published reference maps (Keith 1995). Bugl, H., Fauman, E.B., Staker, B.L., Zheng, F., Kushner, S.R., Saper, M.A., Bardwell, J.C.A., and Jakob, U. 2000. RNA methyl- Cell growth experiments and microbiological testing ation under heat shock control. Mol. Cell 6: 349–360. Caldas, T., Binet, E., Bouloc, P., Costa, A., Desgres, J., and The growth rates of wild-type BW25113, YfgBÀ and XylAÀ strains Richarme, G. 2000. The FtsJ/RrmJ heat shock protein of Escher- were determined during exponential growth phase in triplicate ichia coli is a 23S ribosomal RNA methyltransferase. J. Biol. Chem. cultures at 37°C in rich LB liquid media. Overnight cultures were 275: 16414–16419. Cannone, J.J., Subramanian, S., Schnare, M.N., Collett, J.R., diluted to an optical density of A = 0.01 and growth was 550 D’Souza, L.M., Du, Y., Feng, B., Lin, N., Madabusi, L.V., monitored at A550 every 20 min. Muller, K.M., et al. 2002. The Comparative RNA Web (CRW) A co-growth competition experiment was performed in LB Site: An online database of comparative sequence and structure media at 37°C as described (Gutgsell et al. 2000). Initially, 10 mL information for ribosomal, intron, and other RNAs. BMC Bio- each from an overnight culture of kanamycin-sensitive BW25113 informatics 3: 2. parental strain and kanamycin-resistant YfgBÀ cells were mixed in Conrad, J., Sun, D., Englund, N., and Ofengand, J. 1998. The rluC 10 mL of LB media. At each 6-h interval, the culture was diluted gene of Escherichia coli codes for a pseudouridine synthase that is solely responsible for synthesis of pseudouridine at positions 1000-fold. At the same time, serial dilutions of the cultures were 955, 2504, and 2580 in 23S ribosomal RNA. J. Biol. Chem. 273: plated on LB agar and LB agar supplemented with kanamycin 18562–18566. (30 mg/mL). The plates were incubated at 37°C and the colonies Corpet, F. 1988. Multiple sequence alignment with hierarchical were counted. clustering. Nucleic Acids Res. 16: 10881–10890. doi: 10.1093/nar/ A co-growth competition assay with XylA knockout strain was 16.22.10881. performed in a similar way except that cells were plated on Del Campo, M., Kaya, Y., and Ofengand, J. 2001. Identification and MacConkey agar plates supplemented with 1% (w/v) D-xylose. site of action of the remaining four putative pseudouridine À À synthases in Escherichia coli. RNA 7: 1603–1615. On these plates, XylA cells formed white colonies whereas YfgB Green, R. and Noller, H.F. 1999. Reconstitution of functional 50S cells formed red colonies. ribosomes from in vitro transcripts of Bacillus stearothermophilus Antibiotic sensitivity testing was performed using CLSI- 23S rRNA. Biochemistry 38: 1772–1779. approved protocol (National Committee for Clinical Laboratory Gutgsell, N., Englund, N., Niu, L., Kaya, Y., Lane, B.G., and Standards 2003). Ofengand, J. 2000. Deletion of the Escherichia coli pseudouridine synthase gene truB blocks formation of pseudouridine 55 in tRNA in vivo, does not affect exponential growth, but confers a strong ACKNOWLEDGMENTS selective disadvantage in competition with wild-type cells. RNA 6: 1870–1881. We wish to thank Stephen Douthwaite and Birte Vester, Univer- Hansen, J.L., Ippolito, J.A., Ban, N., Nissen, P., Moore, P.B., and sity of Southern Denmark, for sharing information and advice on Steitz, T.A. 2002. The structures of four macrolide antibiotics experiments. This work was supported by NIH grant RO1 bound to the large ribosomal subunit. Mol. Cell 10: 117–128. Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., AI072445 to A.S.M. Bartels, H., Franceschi, F., and Yonath, A. 2001. High-resolution structure of the large ribosomal subunit from a mesophilic Received September 6, 2007; accepted October 9, 2007. eubacterium. Cell 107: 679–688. Helser, T.L., Davies, J.E., and Dahlberg, J.E. 1972. Mechanism of kasugamycin resistance in Escherichia coli. Nat. New Biol. 235: REFERENCES 6–9. Hernandez, H., Pierrel, F., Elleingand, E., Garcia-Serres, R., Andersen, N.M. and Douthwaite, S. 2006. YebU is a m5C methyl- Huynh, B.H., Johnson, M.K., Fontecave, M., and Atta, M. 2007. transferase specific for 16S rRNA nucleotide 1407. J. Mol. Biol. MiaB, a bifunctional radical-S-adenosylmethionine enzyme involved 359: 777–786. in the thiolation and methylation of tRNA, contains two essential Andersen, T.E., Porse, B.T., and Kirpekar, F. 2004. A novel partial [4Fe–4S] clusters. Biochemistry 46: 5140–5147. modification at C2501 in Escherichia coli 23S ribosomal RNA. Huang, L., Ku, J., Pookanjanatavip, M., Gu, X., Wang, D., RNA 10: 907–913. Greene, P.J., and Santi, D.V. 1998. Identification of two Escherichia Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., coli pseudouridine synthases that show multisite specificity for 23S Datsenko, K.A., Tomita, M., Wanner, B.L., and Mori, H. 2006. RNA. Biochemistry 37: 15951–15957. Construction of Escherichia coli K-12 in-frame, single-gene knock- Johansen, S.K., Maus, C.E., Plikaytis, B.B., and Douthwaite, S. 2006. out mutants: the Keio collection. Mol. Syst. Biol. 2: 2006.0008. doi: Capreomycin binds across the ribosomal subunit interface using 10.1038/msb4100050. tlyA-encoded 29-O-methylations in 16S and 23S rRNAs. Mol. Cell Bae, T., Banger, A.K., Wallace, A., Glass, E.M., Aslund, F., 23: 173–182. Schneewind, O., and Missiakas, D.M. 2004. Staphylococcus aureus Kehrenberg, C., Schwarz, S., Jacobsen, L., Hansen, L.H., and Vester, B. virulence genes identified by bursa aurealis mutagenesis and 2005. A new mechanism for chloramphenicol, florfenicol, and nematode killing. Proc. Natl. Acad. Sci. 101: 12312–12317. clindamycin resistance: Methylation of 23S ribosomal RNA at Ban, N., Freeborn, B., Nissen, P., Penczek, P., Grassucci, R.A., A2503. Mol. Microbiol. 57: 1064–1073. Sweet, R., Frank, J., Moore, P.B., and Steitz, T.A. 1998. A 9 A˚ Keith, G. 1995. Mobilities of modified ribonucleotides on two- resolution x-ray crystallographic map of the large ribosomal dimensional cellulose thin-layer chromatography. Biochimie 77: subunit. Cell 93: 1105–1115. 142–144.

www.rnajournal.org 105 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

Toh et al.

Khaitovich, P., Tenson, T., Kloss, P., and Mankin, A.S. 1999. 7-methylguanosine modification in 16S rRNA confers low-level Reconstitution of functionally active Thermus aquaticus large streptomycin resistance in bacteria. Mol. Microbiol. 63: 1096–1106. ribosomal subunits with in vitro-transcribed rRNA. Biochemistry Pierrel, F., Douki, T., Fontecave, M., and Atta, M. 2004. MiaB protein 38: 1780–1788. is a bifunctional radical-S-adenosylmethionine enzyme involved Kitagawa, M., Ara, T., Arifuzzaman, M., Ioka-Nakamichi, T., in thiolation and methylation of tRNA. J. Biol. Chem. 279: 47555– Inamoto, E., Toyonaga, H., and Mori, H. 2005. Complete set of 47563. ORF clones of Escherichia coli ASKA library (a complete set of E. Porse, B.T. and Garrett, R.A. 1999. Sites of interaction of strepto- coli K-12 ORF archive): Unique resources for biological research. gramin A and B antibiotics in the peptidyl transferase loop of 23S DNA Res. 12: 291–299. rRNA and the synergism of their inhibitory mechanisms. J. Mol. Kowalak, J.A., Bruenger, E., and McCloskey, J.A. 1995. Posttranscrip- Biol. 286: 375–387. tional modification of the central loop of domain V in Escherichia Saenger, W. 1984. Principles of nucleic acid structure. Springer-Verlag, coli 23S ribosomal RNA. J. Biol. Chem. 270: 17758–17764. New York. Kozbial, P. and Mushegian, A. 2005. Natural history of S-adenosyl- Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning; a methionine-binding proteins. BMC Struct. Biol. 5: 19. laboratory manual. Cold Spring Harbor Laboratory Press, Cold Krzyzosiak, W., Denman, R., Nurse, K., Hellmann, W., Boublik, M., Spring Harbor, NY. Gehrke, C.W., Agris, P.F., and Ofengand, J. 1987. In vitro synthesis Schlunzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., of 16S ribosomal RNA containing single base changes and assembly Albrecht, R., Yonath, A., and Franceschi, F. 2001. Structural basis into a functional 30S ribosome. Biochemistry 26: 2353–2364. for the interaction of antibiotics with the peptidyl transferase Leach, K.L., Swaney, S.M., Colca, J.R., McDonald, W.G., Blinn, J.R., centre in eubacteria. Nature 413: 814–821. Thomasco, L.M., Gadwood, R.C., Shinabarger, D., Xiong, L., and Schuwirth, B.S., Borovinskaya, M.A., Hau, C.W., Zhang, W., Vila- Mankin, A.S. 2007. The site of action of oxazolidinone antibiotics in Sanjurjo, A., Holton, J.M., and Cate, J.H.D. 2005. Structures of the ˚ living bacteria and in human mitochondria. Mol. Cell 26: 393–402. bacterial ribosome at 3.5 A resolution. Science 310: 827–834. Lesnyak, D.V., Sergiev, P.V., Bogdanov, A.A., and Dontsova, O.A. Schwarz, S., Werckenthin, C., and Kehrenberg, C. 2000. Identification 2006. Identification of Escherichia coli m2G methyltransferases: I. of a plasmid-borne chloramphenicol-florfenicol resistance gene in The ycbY gene encodes a methyltransferase specific for G2445 of Staphylococcus sciuri. Antimicrob. Agents Chemother. 44: 2530– the 23S rRNA. J. Mol. Biol. 364: 20–25. 2533. Long, K.S., Poehlsgaard, J., Kehrenberg, C., Schwarz, S., and Vester, B. Schwarz, S., Kehrenberg, C., Doublet, B., and Cloeckaert, A. 2004. 2006. The Cfr rRNA methyltransferase confers resistance to pheni- Molecular basis of bacterial resistance to chloramphenicol and cols, lincosamides, oxazolidinones, pleuromutilins, and streptogra- florfenicol. FEMS Microbiol. Rev. 28: 519–542. Selmer, M., Dunham, C.M., Murphy, F.V.I.V., Weixlbaumer, A., min A antibiotics. Antimicrob. Agents Chemother. 50: 2500–2505. Petry, S., Kelley, A.C., Weir, J.R., and Ramakrishnan, V. 2006. Lo¨vgren, J.M. and Wikstro¨m, P.M. 2001. The rlmB gene is essential Structure of the 70S ribosome complexed with mRNA and tRNA. for the formation of Gm2251 in 23S rRNA but not for ribosome Science 313: 1935–1942. maturation in Escherichia coli. J. Bacteriol. 183: 6957–6960. Sofia, H.J., Chen, G., Hetzler, B.G., Reyes-Spindola, J.F., and Mankin, A.S. 2006. Nascent peptide in the ‘‘birth canal’’ of the Miller, N.E. 2001. Radical SAM, a novel protein superfamily ribosome. Trends Biochem. Sci. 31: 11–13. linking unresolved steps in familiar biosynthetic pathways with Mann, P.A., Xiong, L., Mankin, A.S., Chau, A.S., Mendrick, C.A., radical mechanisms: Functional characterization using new anal- Najarian, D.J., Cramer, C.A., Loebenberg, D., Coates, E., ysis and information visualization methods. Nucleic Acids Res. 29: Murgolo, N.J., et al. 2001. EmtA, a rRNA methyltransferase confer- 1097–1106. doi: 10.1093/nar/29.5.1097. ring high-level evernimicin resistance. Mol. Microbiol. 41: 1349–1356. Toh, S.M., Xiong, L., Arias, C.A., Villegas, M.V., Lolans, K., Quinn, J., Mengel-Jorgensen, J., Jensen, S.S., Rasmussen, A., Poehlsgaard, J., and Mankin, A.S. 2007. Acquisition of a natural resistance gene Iversen, J.J.L., and Kirpekar, F. 2006. Modifications in Thermus renders a clinical strain of methicillin-resistant Staphylococcus thermophilus 23S ribosomal RNA are centered in regions of RNA– aureus resistant to the synthetic antibiotic linezolid. Mol. Micro- RNA contact. J. Biol. Chem. 281: 22108–22117. biol. 64: 1506–1514. Merryman, C. and Noller, H.F. 1998. Footprinting and modification- Treede, I., Jakobsen, L., Kirpekar, F., Vester, B., Weitnauer, G., interference analysis of binding sites on RNA. In RNA: Protein Bechthold, A., and Douthwaite, S. 2003. The avilamycin resistance interactions, a practical approach (ed. C.W.J. Smith), pp. 237–253. determinants AviRa and AviRb methylate 23S rRNA at the Oxford University Press, Oxford. guanosine 2535 base and the uridine 2479 ribose. Mol. Microbiol. Nakatogawa, H. and Ito, K. 2002. The ribosomal exit tunnel functions 49: 309–318. as a discriminating gate. Cell 108: 629–636. Tu, D., Blaha, G., Moore, P.B., and Steitz, T.A. 2005. Structures of National Committee for Clinical Laboratory Standards. 2003. Methods MLSBK antibiotics bound to mutated large ribosomal subunits for dilution antimicrobial susceptibility tests for bacteria that grow provide a structural explanation for resistance. Cell 121: 257–270. aerobically; approved standard M7-A6. Clinical Laboratory Stand- Van Buul, C.P., Damm, J.B., and Van Knippenberg, P.H. 1983. ards Institute, Wayne, PA. Kasugamycin resistant mutants of Bacillus stearothermophilus Noller, H.F. 1984. Structure of ribosomal RNA. Annu. Rev. Biochem. lacking the enzyme for the methylation of two adjacent adenosines 53: 119–162. in 16S ribosomal RNA. Mol. Gen. Genet. 189: 475–478. Novick, R.P., Ross, H.F., Projan, S.J., Kornblum, J., Kreiswirth, B., and Vester, B. and Garrett, R.A. 1988. The importance of highly conserved Moghazeh, S. 1993. Synthesis of staphylococcal virulence factors nucleotides in the binding region of chloramphenicol at the is controlled by a regulatory RNA molecule. EMBO J. 12: 3967–3975. peptidyl transfer center of Escherichia coli 23S ribosomal RNA. Ofengand, J. and Del Campo, M. 2004. Modified nucleosides in EMBO J. 7: 3577–3587. Escherichia coli ribosomal RNA. In EcoSal—Escherichia coli and Wang, S.C. and Frey, P.A. 2007. S-adenosylmethionine as an oxidant: Salmonella: Cellular and molecular biology (ed. R. Curtiss), Chap. The radical SAM superfamily. Trends Biochem. Sci. 32: 101–110. 4.6.1. ASM Press, Washington, DC. Weisblum, B. 1995. Erythromycin resistance by ribosome modifica- Ofengand, J. and Fournier, M.J. 1998. The pseudouridine residues of tion. Antimicrob. Agents Chemother. 39: 577–585. rRNA: Number, location, biosynthesis, and function. In Modifi- Xiong, L., Kloss, P., Douthwaite, S., Andersen, N.M., Swaney, S., cation and editing of RNA (eds. H. Grosjean and R. Benne), pp. Shinabarger, D.L., and Mankin, A.S. 2000. Oxazolidinone resis- 229–253. ASM Press, Washington, DC. tance mutations in 23S rRNA of Escherichia coli reveal the central Okamoto, S., Tamaru, A., Nakajima, C., Nishimura, K., Tanaka, Y., region of domain V as the primary site of drug action. J. Bacteriol. Tokuyama, S., Suzuki, Y., and Ochi, K. 2007. Loss of a conserved 182: 5325–5331.

106 RNA, Vol. 14, No. 1 Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press

The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

Seok-Ming Toh, Liqun Xiong, Taeok Bae, et al.

RNA 2008 14: 98-106

References This article cites 55 articles, 18 of which can be accessed free at: http://rnajournal.cshlp.org/content/14/1/98.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to RNA go to: http://rnajournal.cshlp.org/subscriptions