DOCSLIB.ORG

Genomic Relationships Among Sixteen Avena Species Based on (ACT)6 Trinucleotide Repeat FISH

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic Relationships Among Sixteen Avena Species Based on (ACT)6 Trinucleotide Repeat FISH Genome Genomic relationships among sixteen Avena species based on (ACT)6 trinucleotide repeat FISH Journal: Genome Manuscript ID gen-2017-0132.R2 Manuscript Type: Article Date Submitted by the Author: 06-Nov-2017 Complete List of Authors: Luo, Xiaomei; Sichuan Agricultural University Tinker, Nicholas; Ottawa Research and Development Centre Zhou, Yong-Hong; Sichuan Agricultural University Wight, Charlene;Draft Ottawa Research and Development Centre Liu, Juncheng; Sichuan Agricultural University Wan, Wenlin; Sichuan Agricultural University Chen, Liang; Sichuan Agricultural University Peng, Yuanying; Triticeae Research Institute of Sichuan Agricultural University, Is the invited manuscript for consideration in a Special N/A Issue? : Keyword: Genetic diversity, Oat, Oligonucleotide, Chromosome markers https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 32 Genome 1 Genomic relationships among sixteen Avena species based on (ACT)6 trinucleotide repeat FISH 2 Xiaomei Luo1*, Nick A. Tinker2, Yonghong Zhou3, Charlene P. Wight2, Juncheng Liu1，Wenlin Wan1, 3 Liang Chen1, Yuanying Peng3 4 5 1 College of Forestry, Sichuan Agricultural University, Huimin Road 211, Wenjiang District 611130, 6 Chengdu City, Sichuan Province, China; 7 2 Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, KW Neatby Bldg., 8 Central Experimental Farm, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada; 9 3 Triticeae Research Institute, Sichuan Agricultural University, Huimin Road 211, Wenjiang District 10 611130, Chengdu City, Sichuan Province,Draft China 11 * Corresponding author: Phone: 86-028-86291456 E-mail: [email protected] 12 1 / 25 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 2 of 32 13 Abstract Knowledge of the locations of repeat elements could be very important in the assembly of 14 genome sequences and assignment to physical chromosomes. Genomic and species relationships 15 among sixteen species were investigated using fluorescence in situ hybridization (FISH) with the Am1 16 and (ACT)6 probes. The Am1 oligonucleotide probe was particularly enriched in the C genomes, 17 whereas the (ACT)6 trinucleotide repeat probe showed a diverse distribution of hybridization patterns 18 in the A, AB, C, AC, and ACD genomes but might not be present in the B and D genomes. The 19 hybridization pattern of A. sativa was very similar to that of A. insularis, indicating that this species 20 most likely originated from A. insularis as a tetraploid ancestor. Although the two FISH probes failed 21 to identify relationships of more species, this proof-of-concept approach opens the way to the use of 22 FISH probes in assigning other signatureDraft elements from genomic sequence to physical chromosomes. 23 Keywords: Genetic diversity; Oat; Oligonucleotide; Chromosome markers 24 2 / 25 https://mc06.manuscriptcentral.com/genome-pubs Page 3 of 32 Genome 25 Introduction 26 The genus Avena comprises 29 species with three ploidy levels (Baum 1977; Baum and Fedak 1985a, 27 b). This genus includes two divergent diploid genomic groups (the A and C genomes). Based on 28 genomic research, Ac, Al, Ad, As, Ap, Cp, and Cv are used to provide detailed descriptions of subtle 29 chromosomal alterations (Rajhathy and Thomas 1974). The A, B and D genomes are closely related to 30 one another (Jellen et al. 1994; Katsiotis et al. 1997; Linares et al. 1998). Additionally, the B and D 31 genomes seem to be derivatives of the A genome (Rajharthy and Thomas 1974). Hybridization and 32 chromosome doubling has produced polyploid species with AB, AC and ACD genomes (Rajhathy 33 1991). Different hypotheses have been advanced regarding the potential diploid and tetraploid 34 progenitors of these polyploid species. Draft 35 The AB genome species have two possible origins. The first possibility is Ax genome duplication of 36 an A. hirtula, A. wiestii, or A. lusitanica diploid progenitor (Ladizinsky and Zohary 1968; Sadasivaiah 37 and Rajharthy 1968; Katsiotis and Forsberg 1995; Nikoloudakis et al. 2008). AB genomes with this 38 origin include A. barbata, A. vaviloviana, and A. abyssinica because these three species hybridize with 39 both one another and other Avena species (Leggett and Markland 1995). The second possibility is the 40 hybridization of an allopolyploid of AxAy genome species, in which case the A and B genomes 41 remained distinct (Rajharthy and Morrison 1959; Fominaya et al. 1988). This origin of the AB genome 42 includes only A. agadiriana. This species shares several morphological similarities with A. canariensis, 43 A. magna and A. murphyi as well as with some hexaploids; furthermore, the species crosses easily with 44 these hexaploids, which might indicate that A. agadiriana participated in hexaploid evolution (Thomas 45 1989; Badaeva et al. 2010a). 46 The ACD genome species also have two possible origins. The first possibility is the fusion of 3 / 25 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 4 of 32 47 ancestral C genome diploids with an ancestral Ax genome diploid to create ancestral AxC tetraploids. 48 Subsequently, the AxC tetraploids fused with ancestral Ay diploids to create hexaploids (Loskutov 2008; 49 Chew et al. 2016). The second possibility is that an ancient C genome and diverged A (D) diploid 50 ancestors formed CD genome tetraploids and then hybridized with the more recent A genome diploid 51 progenitors to form ACD genome hexaploids (Yan et al, 2016a; Liu et al. 2017). Probable AC genome 52 ancestors include A. murphyi, A. magna, and A. insularis (de lal Hoz and Fominaya 1989; Fu and 53 Williams 2008; Peng et al. 2010; Ladizinsky 2012; Liu et al. 2017). Probable A genome ancestors 54 include A. longiglumis, A. canariensis, A. wiestii, A. strigosa, A. damascena and A. lusitanica (Li et al. 55 2000; Nikoloudakis et al. 2008; Li et al. 2009; Peng et al. 2010; Luo et al. 2014; Yan et al. 2014; Chew 56 et al. 2016; Liu et al. 2017). Probable C genomeDraft ancestors include A. clauda, A. eriantha, and A. 57 ventricosa (Fominaya et al. 1995; Loskutov 2008; Nikoloudakis and Katsiotis 2008; Chew et al. 2016; 58 Liu et al. 2017). Probable diverged A (D) genome ancestors include A. longiglumis, A. canariensis, A. 59 wiestii, and A. atlantica (Luo et al. 2014; Chew et al. 2016; Liu et al. 2017). 60 The Avena species relationships and origins have been widely studied by the above molecular and 61 cytological approaches. Fluorescence in situ hybridization (FISH) has also been successfully used to 62 identify the C genome of Avena species (Fominaya et al. 1995; Nikoloudakis and Katsiotis 2008), to 63 detect A genomes (Linares et al. 1998), to discriminate AB genomes (Katsiotis et al. 1997; Irigoyen et 64 al. 2001; Badaeva et al. 2010a), to analyse AC genomes (Shelukhina et al. 2007), to compare species 65 with A genomes (Shelukhina et al. 2008), to explore D genome origins (Luo et al. 2014, 2015), to 66 distinguish ACD genomes (Irigoyen et al. 2002; Sanz et al. 2010), to characterize A. macrostachya 67 (Badaeva et al. 2010b), and to examine genomic and species relationships among Avena taxa (Katsiotis, 68 2000; Tomas et al. 2016). These FISH probes are usually several hundred base pairs in length, such as 4 / 25 https://mc06.manuscriptcentral.com/genome-pubs Page 5 of 32 Genome 69 pAs120a (114 bp) (Linares et al. 1998), 5S rRNA (120 bp) (Gerlach and Dyer 1980), A3-19 (171 bp) 70 (Tinker et al. 2009; Luo et al. 2014), A336 (391 bp) (Luo et al. 2015), pTa 794 (410 bp) (Gerlach and 71 Dyer 1980), pAm1 (464 bp) (Solano et al. 1992), and pSc119.2 (661 bp) (Katsiotis et al. 1997). 72 Oligonucleotides, except for (AC)10, have rarely been used as FISH probes in Avena species 73 (Fominaya et al. 2017), but they have been widely used for species of other genera, including Triticum 74 aestivum (Cuadrado et al. 2008; Tang et al. 2014), Secale cereal (Fu et al. 2015), Leymus mollis (Yang 75 et al. 2015), Aegilops triuncialis (Mirzaghaderi et al. 2014), and Thinopyrum intermedium (Li et al. 76 2016). Since none of the genomes in Avena have been published, knowledge of the locations of repeat 77 elements could be very important in the assembly of genome sequences and assignment to physical 78 chromosomes. To develop more chromosomeDraft markers to describe the relationships among Avena 79 species within the diploid, tetraploid and hexaploid groups, we have undertaken a FISH analysis testing 80 the oligonucleotide Am1 and trinucleotide repeat (ACT)6 probes. 81 Materials and methods 82 Plant materials and chromosome preparation 83 Details of the species, geographic distributions, and numbers of accessions and genomic constitutions 84 of the sixteen Avena species are given in Table 1. Seeds were germinated on sterile wet filter paper 85 under controlled temperature and light conditions (25 °C, 14 h, light and 20 °C, 10 h, dark). When the 86 seedling were 1.5-2.0 cm in length, the root tips were excised, fully immersed in nitrous oxide for 4 h 87 and then stored in 70% ethanol (Kato et al. 2004). Approximately 1 mm of the root-tip meristem was 88 cut and treated with cellulose and pectinase; then, the suspension was dropped onto slides (Komuro et 89 al. 2013). After air drying, the slides were examined using an Olympus CX21 (Olympus, Japan) and 90 then stored at -20 °C prior to use. 5 / 25 https://mc06.manuscriptcentral.com/genome-pubs Genome Page 6 of 32 91 DNA probe preparation 92 Two probes were used for the FISH analysis. The first probe was oligonucleotide Am1, which 93 contained a 51-bp fragment with the sequence 5’ 94 GATCCATGTGTGGTTTGTGGAAAGAACACACATGCAATGACTCTAGTGGTT 3’ and was 95 described by Fominaya et al. (1995). The second probe was the trinucleotide repeat (ACT)6, which 96 contained an 18-bp fragment with the sequence 5’ ACTACTACTACTACTACT 3’ and was described 97 by Cuadrado et al.
Load more

Recommended publications
  • Afdc 16(6759) P3
    AFDC 16(6759) P3 DRAFT TANZANIA STANDARD Oat grains — Specification TANZANIA BUREAU OF STANDARDS AFDC 16(6759) P3 Oat grains — Specification and grading 0. Foreword Oat grains are obtained from either Avena byzantina or Avena sativa a tall, erect annual cereal grass up to 1.5 m. It is widely grown as a food grain and fodder in temperate and sub-tropical regions. It also does well in the high-altitude tropics. Oats have numerous uses in food; most commonly, they are rolled or crushed into oatmeal, or ground into fine oat flour. Oatmeal is chiefly eaten as porridge, but may also be used in a variety of baked goods, such as oatcakes, oatmeal cookies, and oat bread. Oats are also an ingredient in many cold cereals, in particular muesli and granola. Oats may also be consumed raw, and cookies with raw oats are becoming popular. Oats are also occasionally used in several different drinks such as brewing beer. Oats may also be used in soup preparations. Development of this Tanzania standard was necessitated by the need to ensure the safety and quality of oat grains being produced and or marketed in Tanzania as well as for import and export markets. In preparation of this draft Tanzania standard assistance was drawn from CODEX STAN 201, Standard for Oats. In reporting the result of a test or analysis made in accordance with the Tanzania standard, if the final value observed or calculated is to be rounded off, it shall be done in accordance with TZS 4: (see clause 2). AFDC 16(6759) P3 1.
    [Show full text]
  • A Dual-Purpose Model for Spring-Sown Oats in Cold Regions of Northern China
    agronomy Article A Dual-Purpose Model for Spring-Sown Oats in Cold Regions of Northern China 1,2, 1,3, 1,3, 4 4 4 Jie Yang y, Longyu Hou y , Wenming Bai *, Jingyun Yan , Jianxi Hao , Jin Tao , Yingluo Luo 5, Jianmin Zhang 5 and Wen-Hao Zhang 1,3 1 State Key Laboratory of Vegetation and Environmental Change, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China; [email protected] (J.Y.); [email protected] (L.H.); [email protected] (W.-H.Z.) 2 College of Life Science, University of Chinese Academy of Sciences, Beijing 100049, China 3 Inner Mongolia Research Center for Prataculture, Chinese Academy of Sciences, Beijing 100093, China 4 Hulunbuir Institute of Ecological Industry Technology, Hulunbuir 021008, China; [email protected] (J.Y.); [email protected] (J.H.); [email protected] (J.T.) 5 Xieertala Farm, Hulunbuir 021024, China; [email protected] (Y.L.); [email protected] (J.Z.) * Correspondence: [email protected]; Tel.: +86-10-62836973 These authors contributed equally to this work. y Received: 7 September 2019; Accepted: 5 November 2019; Published: 7 November 2019 Abstract: Alpine regions in northern China are the traditional animal husbandry base. The lack of high-quality forage supply resulting from degradation of natural grasslands and low forage production due to short growing seasons greatly restricts development of animal husbandry in these areas. Spring oats have been widely planted in cold regions worldwide harvesting as either grains or forages because of their great adaptative ability to low temperatures and early maturation and high nutritional values.
    [Show full text]
  • Alaska Plant Materials Center Spring 2012 Seed Sale
    FOR IMMEDIATE RELEASE April 9, 2012 CONTACT: Division of Agriculture Peggy Hunt, Agronomist II, 907-745-8721, [email protected] State hosts April 16-27 sale of Alaska native grass, grain, and flower seeds The Alaska Plant Materials Center (PMC) will soon open its annual request period for “foundation” and “selected class release” germplasm of seeds of grass, grain, and flowers (forbs). The sale runs from April 16–27, 2012. At that time, the lists of the available seed lots – including quantities, varieties, and prices – will be posted on the Division of Agriculture and PMC web pages (http://dnr.alaska.gov/ag/ and http://plants.alaska.gov). The seed will be available for pickup after the seed sale ends at the PMC, located at 5310 South Bodenburg Spur in the Butte area of Palmer. The PMC produces “foundation and pre-certified” classes of seed, which in turn are sold to commercial growers. The growers then produce “certified seed” which eventually is sold to farmers, landscape companies, revegetation contractors, or construction companies. A ready market exists for those willing to take the time now to plant for the future. Demand can exceed the available supply of seeds. If this occurs, the Allocation Committee will determine the allocation. The committee consists of the Division of Agriculture Director and representatives from the University of Alaska, Agriculture and Forestry Experiment Station, the Alaska Seed Growers Association, and the PMC. This seed is for commercial growers only. For smaller amounts of seed, please contact businesses listed on the “Native Plant Source Directory”, http://plants.alaska.gov/native/index.php.
    [Show full text]
  • Diversified Therapeutic Potential of Avena Sativa: an Exhaustive Review
    Available online a t www.pelagiaresearchlibrary.com Pelagia Research Library Asian Journal of Plant Science and Research, 2011, 1 (3):103-114 ISSN : 2249 – 7412 Diversified therapeutic potential of Avena sativa : An exhaustive review 1Neelam Chatuevedi, 2Sachdev Yadav and 1Kalpana Shukla 1Department of Food Science and Nutrition, Banasthali University, Rajasthan 2Department of Pharmacy, Banasthali University, Rajasthan ______________________________________________________________________________ ABSTRACT Avena sativa belongs grasses family, the gramineae, commonly known as oat and are the third leading crop produced in United States after wheat and corn and the fourth most important crop worldwide. They are the most widely grown plant generally considered healthy food being commercially nutritious as well. Oat grain, oat bran, and oatmeal contain a soluble dietary fiber known as β-glucan, which can reduce serum concentration of total cholesterol and low–density lipoprotein cholesterol and also effective in lowering blood sugar levels. Various experimental studies have shown that oat is potential agent to prevent the induction and progression of various diseases such as cancer, bowel, malfunction, obesity, celiac disease etc. This review will discuss functional and medicinal properties of Avena sativa. However, owing to the numerous health benefits that they offer, their consumption has increased to quite an extent and they have now come to the forefront. Keywords : Avena sativa , β-glucan, functional and medicinal properties ______________________________________________________________________________ INTRODUCTION Avena sativa is the scientific name of grass commonly known as oats and ‘‘Jai’’ or ‘‘Javi’in Hindi. It belongs to natural order graminaceae. The common oat ( Avena sativa ) is a species of cereal grain grown for its seed, which is known by the same name (usually in the plural, unlike other grains).
    [Show full text]
  • Avena Nuda L.; Avena Sativa L
    E TG/20/11(proj.4) ORIGINAL: English DATE: 2018-04-06 INTERNATIONAL UNION FOR THE PROTECTION OF NEW VARIETIES OF PLANTS Geneva DRAFT * OATS UPOV Code(s): AVENA_NUD; AVENA_SAT Avena nuda L.; Avena sativa L. GUIDELINES FOR THE CONDUCT OF TESTS FOR DISTINCTNESS, UNIFORMITY AND STABILITY prepared by experts from Spain to be considered by the Technical Working Party for Agricultural Crops at its forty-seventh session, to be held in Naivasha, Kenya, from 2018-05-21 to 2018-05-25 Disclaimer: this document does not represent UPOV policies or guidance Alternative names:* Botanical name English French German Spanish Avena nuda L. Naked Oats Avoine nue Nackthafer Avena desnuda Avena sativa L., Oats Avoine Hafer Avena Avena byzantina K. Koch The purpose of these guidelines (“Test Guidelines”) is to elaborate the principles contained in the General Introduction (document TG/1/3), and its associated TGP documents, into detailed practical guidance for the harmonized examination of distinctness, uniformity and stability (DUS) and, in particular, to identify appropriate characteristics for the examination of DUS and production of harmonized variety descriptions. ASSOCIATED DOCUMENTS These Test Guidelines should be read in conjunction with the General Introduction and its associated TGP documents. * These names were correct at the time of the introduction of these Test Guidelines but may be revised or updated. [Readers are advised to consult the UPOV Code, which can be found on the UPOV Website (www.upov.int), for the latest information.] TG/20/11(proj.4) Oats, 2018-04-06 2 TABLE OF CONTENTS PAGE 1. SUBJECT OF THESE TEST GUIDELINES.........................................................................................................
    [Show full text]
  • Flora Mediterranea 26
    FLORA MEDITERRANEA 26 Published under the auspices of OPTIMA by the Herbarium Mediterraneum Panormitanum Palermo – 2016 FLORA MEDITERRANEA Edited on behalf of the International Foundation pro Herbario Mediterraneo by Francesco M. Raimondo, Werner Greuter & Gianniantonio Domina Editorial board G. Domina (Palermo), F. Garbari (Pisa), W. Greuter (Berlin), S. L. Jury (Reading), G. Kamari (Patras), P. Mazzola (Palermo), S. Pignatti (Roma), F. M. Raimondo (Palermo), C. Salmeri (Palermo), B. Valdés (Sevilla), G. Venturella (Palermo). Advisory Committee P. V. Arrigoni (Firenze) P. Küpfer (Neuchatel) H. M. Burdet (Genève) J. Mathez (Montpellier) A. Carapezza (Palermo) G. Moggi (Firenze) C. D. K. Cook (Zurich) E. Nardi (Firenze) R. Courtecuisse (Lille) P. L. Nimis (Trieste) V. Demoulin (Liège) D. Phitos (Patras) F. Ehrendorfer (Wien) L. Poldini (Trieste) M. Erben (Munchen) R. M. Ros Espín (Murcia) G. Giaccone (Catania) A. Strid (Copenhagen) V. H. Heywood (Reading) B. Zimmer (Berlin) Editorial Office Editorial assistance: A. M. Mannino Editorial secretariat: V. Spadaro & P. Campisi Layout & Tecnical editing: E. Di Gristina & F. La Sorte Design: V. Magro & L. C. Raimondo Redazione di "Flora Mediterranea" Herbarium Mediterraneum Panormitanum, Università di Palermo Via Lincoln, 2 I-90133 Palermo, Italy [email protected] Printed by Luxograph s.r.l., Piazza Bartolomeo da Messina, 2/E - Palermo Registration at Tribunale di Palermo, no. 27 of 12 July 1991 ISSN: 1120-4052 printed, 2240-4538 online DOI: 10.7320/FlMedit26.001 Copyright © by International Foundation pro Herbario Mediterraneo, Palermo Contents V. Hugonnot & L. Chavoutier: A modern record of one of the rarest European mosses, Ptychomitrium incurvum (Ptychomitriaceae), in Eastern Pyrenees, France . 5 P. Chène, M.
    [Show full text]
  • Avena Strigosa Schreb.) Germplasm
    EVALUATION OF BLACK OAT ( AVENA STRIGOSA SCHREB.) GERMPLASM Except where reference is made to the work of others, the work described in this thesis is my own or was done in collaboration with my advisory committee. This thesis does not include proprietary or classified information. ________________________________________ Thomas Antony Certificate of Approval: _________________________ _________________________ David B. Weaver Edzard van Santen, Chair Professor Professor Agronomy and Soils Agronomy and Soils _______________________ _________________________ Andrew J. Price Joe F. Pittman Assistant Professor Interim Dean Agronomy and Soils Graduate School EVALUATION OF BLACK OAT ( AVENA STRIGOSA SCHREB.) GERMPLASM Thomas Antony A Thesis Submitted to the Graduate Faculty of Auburn University in Partial Fulfillment of the Requirement for the Degree of Master of Science Auburn, Alabama December 17, 2007 EVALUATION OF BLACK OAT ( AVENA STRIGOSA SCHREB.) GERMPLASM Thomas Antony Permission is granted to Auburn University to make copies of this thesis at its discretion, upon the request of individuals or institutions and at their expense. The author reserves all publication rights. ___________________________________ Signature of Author ___________________________________ Date of Graduation iii THESIS ABSTRACT EVALUATION OF BLACK OAT ( AVENA STRIGOSA SCHREB.) GERMPLASM Thomas Antony Master of Science, December 17, 2007 (B.S. (Agriculture), Kerala Agricultural University, India, 2002) (B.S. (Botany), Mahatma Gandhi University, India, 1995) 156 Typed Pages Directed by Edzard van Santen Black oat has become an important winter cover crop in subtropical and temperate regions. Originating in the northern parts of Spain and Portugal, black oat cultivation has spread to different parts of the globe. Even though different in ploidy level, diploid black oat has been used in many hexaploid common oat ( A.
    [Show full text]
  • BLACK OATS (Avena Strigosa)
    Cover Crop Information Sheet BLACK OATS (Avena strigosa) True black oats (Avena strigosa) are a different species than oats (Avena sativa) usually planted in the Coastal Plain. They produce a dense, thick growth and will produce comparable biomass to cereal rye at half to 2/3 the height. They are less cold tolerant than common oats. There are two varieties of black oat available for sale in the U.S. – “SoilSaver” and “Pratex”. Seeds for SoilSaver are not currently commercially available due to seed crop failure. Recommended Varieties Variety Reasons Why Source SoilSaver Increased cold tolerance. USDA Black Oats Plant Guide Planting Information Information Comments Source Drilled Seed 1 - 1 ½ USDA Black Oats Plant Guide Depth (inches) Drilled Seeding 50 - 70 Managing Cover Crops Rate (lbs/acre) Profitably, USDA Black Oats Plant Guide Broadcast 100 USDA Black Oats Plant Guide Seeding Rate (lbs/acre) Aerial Seeding N/A Rate (lbs/acre) Termination Information Information Source Black oats are not as cold hardy as most oat varieties. They will usually winter kill USDA Black Oats Plant Guide at less than 19F depending on growth stage. SoilSaver was developed to be more cold tolerant. Black oats can be terminated by herbicides, rolling & crimping, mowing, and tillage. They can be killed by rolling & crimping alone at the early milk stage. Rolling & crimping should be combined with herbicides at earlier growth stages. Consult your local Extension and state Pest Management Handbook for herbicide recommendations. Always follow the herbicide label. Continue to next page… southerncovercrops.org 1 Cover Crop Information Sheet BLACK OATS (Avena strigosa) Cultural Traits Traits Comments Source Typical Dry 4,000 - 7,000 USDA Black Oats Plant Guide Matter Range (lbs/acre) Typical Total N 15 - 30 Unpublished Literature Review Range (lbs/acre) in Coastal Plain – Gaskin Life Cycle Cool season USDA Black Oats Plant Guide annual grain Growth Habit Upright USDA Black Oats Plant Guide Preferred Soil pH 4.5 - 7.3 USDA Black Oats Plant Guide Relative Seed N/A Currently not available.
    [Show full text]
  • First Record of Eriochloa Villosa (Thunb.) Kunth in Austria and Notes on Its Distribution and Agricultural Impact in Central Europe
    BioInvasions Records (2020) Volume 9, Issue 1: 8–16 CORRECTED PROOF Research Article First record of Eriochloa villosa (Thunb.) Kunth in Austria and notes on its distribution and agricultural impact in Central Europe Swen Follak1,*, Michael Schwarz2 and Franz Essl3 1Institute for Sustainable Plant Production, Austrian Agency for Health and Food Safety, Vienna, Austria 2Data, Statistics and Risk Assessment, Austrian Agency for Health and Food Safety, Vienna, Austria 3Division of Conservation Biology, Vegetation and Landscape Ecology, University of Vienna, Vienna, Austria Author e-mails: [email protected] (SF), [email protected] (MS), [email protected] (FE) *Corresponding author Citation: Follak S, Schwarz M, Essl F (2020) First record of Eriochloa villosa Abstract (Thunb.) Kunth in Austria and notes on its distribution and agricultural impact in Eriochloa villosa is native to temperate Eastern Asia and is an emerging weed in Central Europe. BioInvasions Records 9(1): Central Europe. Its current distribution in Central Europe was analyzed using 8–16, https://doi.org/10.3391/bir.2020.9.1.02 distribution data from the literature and data collected during field trips. In 2019, E. Received: 6 September 2019 villosa was recorded for the first time in Austria. It was found in a crop field in Accepted: 28 November 2019 Unterretzbach in Lower Austria (Eastern Austria). So far, the abundance of E. villosa in the weed communities in Austria and the neighboring Czech Republic is low and Published: 21 February 2020 thus, its present agricultural impact can be considered limited. However, in Romania Handling editor: Quentin Groom and Hungary, the number of records of E.
    [Show full text]
  • Course Details:Details
    http://www.unaab.edu.ng COURSE CODE: PBS 503 COURSE TITLE: Course evolution and taxonomy NUMBER OF UNITS: 2 Units COURSE DURATION: 2 hours per week COURSECOURSE DETAILS:DETAILS: Course Coordinator: Dr. Isaac Oludayo Daniel Email: [email protected] Office Location: Room 245, COLPLANT Other Lecturers: Dr. M. A. Adebisi and Prof. F. A. Showemimo COURSE CONTENT: Theory of evolution. Mechanics of crop evolution. Roles of hybridization recombination and natural selection in crop evolution. Isolation mechanism. Modes of speciation. Concepts of primary and secondary centers of origin. Origin of commonly cultivated crops. Genetic variation in populations. Genetic drift. An introduction to the principles of taxonomy, plant nomenclature, succession, mechanism of survival. Practicals: A survey of crop species and their wild relatives. Consideration of crop varieties and how they fit into a species. Collection of various species within a genus and seeing how they relate to each other. COURSE REQUIREMENTS: This is a compulsory course for all 500 level PBST students. All registered students must have minimum of 70% attendance to be able to write the final examination READING LIST: 1. Observed Instances of Speciation by Joseph Boxhorn. Retrieved 28 October 2006. 2. J.M. Baker (2005). "Adaptive speciation: The role of natural selection in mechanisms of geographic and non-geographic speciation". Studies in History and Philosophy of Biological and Biomedical Sciences 36: 303–326. doi:10.1016/j.shpsc.2005.03.005. available online 3. Katharine Byrne and Richard A Nichols (1999) "Culex pipiens in London Underground tunnels: differentiation between surface and subterranean populations" 4. Matthew L. Niemiller, Benjamin M.
    [Show full text]
  • Identification of Wild-Oats Dr Stephen Moss ROTHAMSTED RESEARCH in the UK, There Are Two Main Species Which Occur As Weeds of Arable Crops
    ® Identification of wild-oats Dr Stephen Moss ROTHAMSTED RESEARCH In the UK, there are two main species which occur as weeds of arable crops. Their relative fequencies, as reported in the Atlas of the British Flora (2002), are given as the (%) of the 2852 10 x 10 km grid squares surveyed in which the species was detected. Avena fatua – common Avena sterilis ssp. ludoviciana or spring wild-oat – winter wild-oat Occurs throughout England; Less common and mainly found more scattered distribution in within 50 – 100 miles of Oxford Scotland and Wales. (55%). where it was first recorded Germinates mainly in spring in the wild in 1910. (10%). (March/April) but with a Probably under-reported due variable, and sometimes to confusion with Avena fatua. considerable, amount of Germinates mainly in autumn autumn germination too (mainly Sept/Oct). and winter, from October to early March, and is more tolerant of freezing conditions than Avena fatua. Both species may occur within a single field, sometimes in mixture but sometimes in separate patches. Why does identification of species matter? Avena sterilis ssp. ludoviciana is generally considered the more challenging species to control, requiring more robust strategies Seedling emergence patterns and winter hardiness differ between the two species so correct identification can help in herbicide decision-making Although herbicide resistance has been found in both species, it is relatively more common in Avena sterilis ssp. ludoviciana. The first cases of resistance in the UK were all found in this species despite its more limited distribution. At the vegetative stage, wild-oats can be identified in cereal crops by: Hairy leaf margins and the absence of auricles Auricles No auricles on wild-oats Wheat - well developed, Barley - large, (or cultivated oats) but hairy auricles (hairs hairless auricles.
    [Show full text]
  • Verde Del Cultivo De Avena Sometido a Tres Abonos Orgánicos Y Un Fertilizante Químico
    UNIVERSIDAD TÉCNICA DE BABAHOYO FACULTAD DE CIENCIAS AGROPECUARIAS ESCUELA DE INGENIERÍA AGRONÓMICA Tesis de Grado Presentado al Consejo Directivo de la Facultad, como requisito previo a la obtención del título de: Ingeniero Agrónomo Tema: Efectos de la aplicación de la abonadura orgánica en el rendimiento y producción de biomasa verde del cultivo de avena (avena sativa l.) ” Autor: José Miguel Reascos Estrada Director: Ing. Agr. Segundo Rafael Vásquez El Ángel – Carchi - Ecuador -2015- i UNIVERSIDAD TÉCNICA DE BABAHOYO FACULTAD DE CIENCIAS AGROPECUARIAS ESCUELA DE INGENIERIA AGRONOMICA TESIS DE GRADO PRESENTADA AL H. CONSEJO DIRECTIVO COMO REQUISITO PREVIO A LA OBTENCIÓN DEL TÍTULO DE: INGENIERO AGRONOMO Tema: “EFECTOS DE LA APLICACIÓN DE LA ABONADURA ORGÁNICA EN EL RENDIMIENTO Y PRODUCCIÓN DE BIOMASA VERDE DEL CULTIVO DE AVENA (Avena sativa L.)” TRIBUNAL DE SUSTENTACIÓN Ing. Agr. Joffre León Paredes MBA. PRESIDENTE Ing. Agr. Tito Bohórquez Barros MBA. Ing. Agr. Félix Ronquillo Icaza MBA. VOCAL VOCAL ii Las investigaciones, resultados, conclusiones y recomendaciones del presente trabajo, son de exclusiva responsabilidad del autor: José Miguel Reascos Estrada iii DEDICATORIA Este trabajo de investigación se lo dedico primordialmente a Dios por darme vida, salud, a mi familia y amigos. A mis padres Nilo Reascos y Aida Estrada. A mi hijo Lenin Reascos y a mi esposa Yuri Pantoja. A toda mi familia. José Miguel Reascos Estrada iv AGRADECIMIENTOS A la Universidad Técnica de Babahoyo a través de las instalaciones de la SECE EL ANGEL por abrir las puertas para poder seguir adelante y poder ser una persona de bien. A la Facultad de Ciencias Agropecuarias de la Universidad Técnica de Babahoyo, por haberme instruido profesionalmente.
    [Show full text]