Genome
Genomic relationships among sixteen Avena species based on (ACT)6 trinucleotide repeat FISH
Journal: Genome
Manuscript ID gen-2017-0132.R2
Manuscript Type: Article
Date Submitted by the Author: 06-Nov-2017
Complete List of Authors: Luo, Xiaomei; Sichuan Agricultural University Tinker, Nicholas; Ottawa Research and Development Centre Zhou, Yong-Hong; Sichuan Agricultural University Wight, Charlene;Draft Ottawa Research and Development Centre Liu, Juncheng; Sichuan Agricultural University Wan, Wenlin; Sichuan Agricultural University Chen, Liang; Sichuan Agricultural University Peng, Yuanying; Triticeae Research Institute of Sichuan Agricultural University,
Is the invited manuscript for consideration in a Special N/A Issue? :
Keyword: Genetic diversity, Oat, Oligonucleotide, Chromosome markers
https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 32 Genome
1 Genomic relationships among sixteen Avena species based on (ACT)6 trinucleotide repeat FISH
2 Xiaomei Luo1*, Nick A. Tinker2, Yonghong Zhou3, Charlene P. Wight2, Juncheng Liu1，Wenlin Wan1,
3 Liang Chen1, Yuanying Peng3
4
5 1 College of Forestry, Sichuan Agricultural University, Huimin Road 211, Wenjiang District 611130,
6 Chengdu City, Sichuan Province, China;
7 2 Ottawa Research and Development Centre, Agriculture and Agri-Food Canada, KW Neatby Bldg.,
8 Central Experimental Farm, 960 Carling Avenue, Ottawa, ON K1A 0C6, Canada;
9 3 Triticeae Research Institute, Sichuan Agricultural University, Huimin Road 211, Wenjiang District 10 611130, Chengdu City, Sichuan Province,Draft China 11 * Corresponding author: Phone: 86-028-86291456 E-mail: [email protected]
12
1 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 2 of 32
13 Abstract Knowledge of the locations of repeat elements could be very important in the assembly of
14 genome sequences and assignment to physical chromosomes. Genomic and species relationships
15 among sixteen species were investigated using fluorescence in situ hybridization (FISH) with the Am1
16 and (ACT)6 probes. The Am1 oligonucleotide probe was particularly enriched in the C genomes,
17 whereas the (ACT)6 trinucleotide repeat probe showed a diverse distribution of hybridization patterns
18 in the A, AB, C, AC, and ACD genomes but might not be present in the B and D genomes. The
19 hybridization pattern of A. sativa was very similar to that of A. insularis, indicating that this species
20 most likely originated from A. insularis as a tetraploid ancestor. Although the two FISH probes failed
21 to identify relationships of more species, this proof-of-concept approach opens the way to the use of 22 FISH probes in assigning other signatureDraft elements from genomic sequence to physical chromosomes. 23 Keywords: Genetic diversity; Oat; Oligonucleotide; Chromosome markers
24
2 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 3 of 32 Genome
25 Introduction
26 The genus Avena comprises 29 species with three ploidy levels (Baum 1977; Baum and Fedak 1985a,
27 b). This genus includes two divergent diploid genomic groups (the A and C genomes). Based on
28 genomic research, Ac, Al, Ad, As, Ap, Cp, and Cv are used to provide detailed descriptions of subtle
29 chromosomal alterations (Rajhathy and Thomas 1974). The A, B and D genomes are closely related to
30 one another (Jellen et al. 1994; Katsiotis et al. 1997; Linares et al. 1998). Additionally, the B and D
31 genomes seem to be derivatives of the A genome (Rajharthy and Thomas 1974). Hybridization and
32 chromosome doubling has produced polyploid species with AB, AC and ACD genomes (Rajhathy
33 1991). Different hypotheses have been advanced regarding the potential diploid and tetraploid 34 progenitors of these polyploid species. Draft
35 The AB genome species have two possible origins. The first possibility is Ax genome duplication of
36 an A. hirtula, A. wiestii, or A. lusitanica diploid progenitor (Ladizinsky and Zohary 1968; Sadasivaiah
37 and Rajharthy 1968; Katsiotis and Forsberg 1995; Nikoloudakis et al. 2008). AB genomes with this
38 origin include A. barbata, A. vaviloviana, and A. abyssinica because these three species hybridize with
39 both one another and other Avena species (Leggett and Markland 1995). The second possibility is the
40 hybridization of an allopolyploid of AxAy genome species, in which case the A and B genomes
41 remained distinct (Rajharthy and Morrison 1959; Fominaya et al. 1988). This origin of the AB genome
42 includes only A. agadiriana. This species shares several morphological similarities with A. canariensis,
43 A. magna and A. murphyi as well as with some hexaploids; furthermore, the species crosses easily with
44 these hexaploids, which might indicate that A. agadiriana participated in hexaploid evolution (Thomas
45 1989; Badaeva et al. 2010a).
46 The ACD genome species also have two possible origins. The first possibility is the fusion of
3 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 4 of 32
47 ancestral C genome diploids with an ancestral Ax genome diploid to create ancestral AxC tetraploids.
48 Subsequently, the AxC tetraploids fused with ancestral Ay diploids to create hexaploids (Loskutov 2008;
49 Chew et al. 2016). The second possibility is that an ancient C genome and diverged A (D) diploid
50 ancestors formed CD genome tetraploids and then hybridized with the more recent A genome diploid
51 progenitors to form ACD genome hexaploids (Yan et al, 2016a; Liu et al. 2017). Probable AC genome
52 ancestors include A. murphyi, A. magna, and A. insularis (de lal Hoz and Fominaya 1989; Fu and
53 Williams 2008; Peng et al. 2010; Ladizinsky 2012; Liu et al. 2017). Probable A genome ancestors
54 include A. longiglumis, A. canariensis, A. wiestii, A. strigosa, A. damascena and A. lusitanica (Li et al.
55 2000; Nikoloudakis et al. 2008; Li et al. 2009; Peng et al. 2010; Luo et al. 2014; Yan et al. 2014; Chew 56 et al. 2016; Liu et al. 2017). Probable C genomeDraft ancestors include A. clauda, A. eriantha, and A. 57 ventricosa (Fominaya et al. 1995; Loskutov 2008; Nikoloudakis and Katsiotis 2008; Chew et al. 2016;
58 Liu et al. 2017). Probable diverged A (D) genome ancestors include A. longiglumis, A. canariensis, A.
59 wiestii, and A. atlantica (Luo et al. 2014; Chew et al. 2016; Liu et al. 2017).
60 The Avena species relationships and origins have been widely studied by the above molecular and
61 cytological approaches. Fluorescence in situ hybridization (FISH) has also been successfully used to
62 identify the C genome of Avena species (Fominaya et al. 1995; Nikoloudakis and Katsiotis 2008), to
63 detect A genomes (Linares et al. 1998), to discriminate AB genomes (Katsiotis et al. 1997; Irigoyen et
64 al. 2001; Badaeva et al. 2010a), to analyse AC genomes (Shelukhina et al. 2007), to compare species
65 with A genomes (Shelukhina et al. 2008), to explore D genome origins (Luo et al. 2014, 2015), to
66 distinguish ACD genomes (Irigoyen et al. 2002; Sanz et al. 2010), to characterize A. macrostachya
67 (Badaeva et al. 2010b), and to examine genomic and species relationships among Avena taxa (Katsiotis,
68 2000; Tomas et al. 2016). These FISH probes are usually several hundred base pairs in length, such as
4 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 5 of 32 Genome
69 pAs120a (114 bp) (Linares et al. 1998), 5S rRNA (120 bp) (Gerlach and Dyer 1980), A3-19 (171 bp)
70 (Tinker et al. 2009; Luo et al. 2014), A336 (391 bp) (Luo et al. 2015), pTa 794 (410 bp) (Gerlach and
71 Dyer 1980), pAm1 (464 bp) (Solano et al. 1992), and pSc119.2 (661 bp) (Katsiotis et al. 1997).
72 Oligonucleotides, except for (AC)10, have rarely been used as FISH probes in Avena species
73 (Fominaya et al. 2017), but they have been widely used for species of other genera, including Triticum
74 aestivum (Cuadrado et al. 2008; Tang et al. 2014), Secale cereal (Fu et al. 2015), Leymus mollis (Yang
75 et al. 2015), Aegilops triuncialis (Mirzaghaderi et al. 2014), and Thinopyrum intermedium (Li et al.
76 2016). Since none of the genomes in Avena have been published, knowledge of the locations of repeat
77 elements could be very important in the assembly of genome sequences and assignment to physical 78 chromosomes. To develop more chromosomeDraft markers to describe the relationships among Avena 79 species within the diploid, tetraploid and hexaploid groups, we have undertaken a FISH analysis testing
80 the oligonucleotide Am1 and trinucleotide repeat (ACT)6 probes.
81 Materials and methods
82 Plant materials and chromosome preparation
83 Details of the species, geographic distributions, and numbers of accessions and genomic constitutions
84 of the sixteen Avena species are given in Table 1. Seeds were germinated on sterile wet filter paper
85 under controlled temperature and light conditions (25 °C, 14 h, light and 20 °C, 10 h, dark). When the
86 seedling were 1.5-2.0 cm in length, the root tips were excised, fully immersed in nitrous oxide for 4 h
87 and then stored in 70% ethanol (Kato et al. 2004). Approximately 1 mm of the root-tip meristem was
88 cut and treated with cellulose and pectinase; then, the suspension was dropped onto slides (Komuro et
89 al. 2013). After air drying, the slides were examined using an Olympus CX21 (Olympus, Japan) and
90 then stored at -20 °C prior to use.
5 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 6 of 32
91 DNA probe preparation
92 Two probes were used for the FISH analysis. The first probe was oligonucleotide Am1, which
93 contained a 51-bp fragment with the sequence 5’
94 GATCCATGTGTGGTTTGTGGAAAGAACACACATGCAATGACTCTAGTGGTT 3’ and was
95 described by Fominaya et al. (1995). The second probe was the trinucleotide repeat (ACT)6, which
96 contained an 18-bp fragment with the sequence 5’ ACTACTACTACTACTACT 3’ and was described
97 by Cuadrado et al. (2008). The oligonucleotide probes were synthesized by Sangon Biotech Co., Ltd.
98 (Shanghai, China). The synthetic oligonucleotide Am1 was 5’-end-labelled with
99 6-carboxytetramethylrhodamine (TAMRA), whereas the other synthetic trinucleotide repeat (ACT)6 100 was 5’-end-labelled with 6-carboxyfluoresceinDraft (FAM). These synthesized probes were diluted using 1× 101 TE solution; the concentration was maintained at 10 µM, and the solution was stored at -20 °C.
102 FISH analysis
103 FISH with two probes was perfected as described by Hao et al. (2013). The chromosome preparations
104 were fixed with 4% (w/v) paraformaldehyde, washed with 2× saline sodium citrate (SSC), and
105 dehydrated using an ethanol series before air drying. Deionized formamide (FA; 60 µL) was added to
106 the chromosome preparations, which were then denatured for 2 min at 80 °C and placed in an ethanol
107 series at -20 °C before air drying. A hybridization mixture (10 µL) containing 0.35 µL trinucleotide
108 repeat (GAA)6, 4.825 µL of 2× SSC and 4.825 µL of 1× TE was applied to each chromosome
109 preparation. The preparations were covered with glass coverslips, and the chromosomes and probes
110 were hybridized at 37 °C in a humidity chamber for 1-2 h. The preparations were then rinsed twice for
111 5 min with 2× SSC at room temperature and finally with ddH2O. The preparations were counterstained
112 with 4, 6-diamidino-2-phenylindole (DAPI, Vector Laboratories, Inc., Burlingame, VT, USA). The
6 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 7 of 32 Genome
113 slides were examined using an Olympus BX-51 microscope coupled to a Photometric SenSys Olympus
114 DP70 CCD camera (Olympus, Japan). The raw images were processed using Photoshop ver. 7.1
115 (Adobe Systems Incorporated, San Jose, CA, USA) using only functions that affected the entire image
116 equally. Three to five spreads were observed from each species with corresponding signal results.
117 Results
118 FISH analysis of mitotic metaphase plates from sixteen Avena species
119 FISH analysis of the mitotic metaphase plates of six (AA) Avena diploids illustrated in Fig. 1. The
120 trinucleotide repeat probe (ACT)6 is visible in Figs. 1a-1f (green). The (ACT)6 probe produced single
121 intercalary bands (arrows). These bands were relatively weak in intensity but were reproducible near, in 122 the middle or at the termini of the chromosomes.Draft Two signals were observed near the termini of the
123 chromosomes, with one each in the As genome (Fig. 1a, A. wiestii) and Al genome (Fig. 1b, A.
124 longiglumis). Four signals were observed near or in the middle of the As genome chromosomes (Fig. 1c,
125 A. nuda), whereas two signals were observed near or in the middle of the As genome chromosomes (Fig.
126 1d, A. nuda; Fig. 1e, A. strigosa) and in the Ac genome chromosomes (Fig. 2f, A. canariensis). A
127 summary of these results is as follows: (i) two signals were detected near the chromosome termini in
128 the Al genome; (ii) two signals were detected near or in the middle of the Ac genome chromosomes;
129 and (iii) two and four signals were detected near or in the middle of the chromosomes and two signals
130 were detected near the chromosome termini in the As genome. These results suggest that the
131 distribution of (ACT)6 differs among the Al, Ac and As genomes. Additionally, the results suggest that
132 the As genome is diverse.
133 FISH analysis of the mitotic metaphase plates of three (AABB) Avena tetraploids is illustrated in Fig.
134 2. The probe (ACT)6 is visible in Figs. 2a-2c (green). The (ACT)6 probe produced single intercalary
7 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 8 of 32
135 bands (arrows). These bands were relatively weak in intensity but were reproducible near the middle or
136 at the termini of the chromosomes. Two signals were observed at the chromosome termini, and two
137 signals were observed in the middle of the chromosomes in the AB genome (Fig. 2a, A. barbata). Four
138 signals were observed near the middle of chromosomes in the AB genome (Fig. 2b, A. abyssinica; Fig.
139 2c, A. vaviloviana). These results suggest that the distribution of (ACT)6 differs between the A. barbata
140 genome and the A. abyssinica and A. vaviloviana genomes. Furthermore, the results suggest that the
141 AB genome is variable.
142 FISH analysis of the mitotic metaphase plates of two (CC) Avena diploids is illustrated in Fig. 3. The
143 probe (ACT)6 is visible in Figs. 3a-3c (green). The (ACT)6 probe produced single intercalary bands 144 (white arrows). These bands were particularlyDraft intense but were reproducible near the middle or at the 145 termini of the chromosomes. Two signals were observed near the chromosome termini, and four signals
146 were observed near the middle of the chromosomes in the C genome (Figs. 3a, A. ventricosa; Figs.
147 3b-3c, A. eriantha). These results suggest that the distribution of (ACT)6 is similar between A.
148 ventricosa and A. eriantha. Interestingly, two abnormal chromosomes were observed in Fig. 3c (A.
149 eriantha, red arrows). The long chromosome was approximately five times longer than the short
150 chromosome. One obvious constriction was observed near the terminus of the long chromosome arm,
151 and the other obvious constriction was observed near the terminus of the short chromosome arm. The
152 abnormal chromosomes were observed in only one metaphase cell, but this observation still suggests
153 that the A. eriantha chromosome structure is unstable.
154 FISH analysis of the mitotic metaphase plates of three (AACC) Avena tetraploids is illustrated in Fig.
155 4. The probe (ACT)6 is visible in Figs. 4a-4f (green), whereas the oligonucleotide probe Am1 is visible
156 in Figs. 4b, 4d, and 4f (red). The (ACT)6 probe produced single intercalary bands (arrows), whereas the
8 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 9 of 32 Genome
157 Am1 probe produced signals that were particularly enriched in the C genome chromosomes. Fourteen
158 signals were observed near or in the middle of the AC genome chromosomes (Figs. 4a, A. insularis).
159 Eight signals were observed near or in the middle of the A genome chromosomes, whereas six strong
160 signals were observed near or in the middle of the C genome chromosomes (Fig. 4b). Two signals were
161 observed at the chromosome termini, and ten signals were detected near or in the middle of the AC
162 genome chromosomes (Fig. 4c, A. magna). Four signals were observed near or in the middle of the A
163 genome chromosomes, two signals were observed at the A chromosome termini, and six signals were
164 observed near or in the middle of the C genome chromosomes (Fig. 4d, A. magna). Two signals were
165 observed at the chromosome termini, and ten signals were detected near or in the middle of the AC 166 genome chromosomes (Fig. 4e, A. murphyiDraft). Four signals were detected near or in the middle of the A 167 genome chromosomes, whereas six signals were observed near or in the middle of the C genome
168 chromosomes, and two weak signals were observed at the C genome chromosome termini (Fig. 4f, A.
169 murphyi). Interestingly, two signal loci were observed close to the middle or at the terminus of one
170 chromosome (Figs. 4c-4d, A. magna; 4e-4f, A. murphyi). These results suggest that the distribution of
171 (ACT)6 differs among the A. insularis, A. magna and A. murphyi genomes. Furthermore, the results
172 suggest that the AC genome is variable.
173 FISH analysis of the mitotic metaphase plates of two (AACCDD) Avena hexaploids is illustrated in
174 Fig. 5. The probe (ACT)6 is visible in Figs. 5a-5b (green), whereas the probe Am1 is visible in Figs. 5b
175 and 5d (red). The (ACT)6 probe produced single intercalary bands (arrows). These bands were
176 particularly intense but were reproducible in the middle of the chromosomes. Fourteen signals were
177 observed in the middle of the ACD genome chromosomes (Figs. 5a, A. sativa). Eight signals were
178 observed in the middle of the AD genome chromosomes, while six were observed in the middle of the
9 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 10 of 32
179 C genome chromosomes (Figs. 5b, A. sativa). Twelve signals were observed in the middle of the ACD
180 genome chromosomes (Figs. 5c, A. fatua). Six signals were observed in the middle of the AD genome
181 chromosomes, whereas six were observed in the middle of the C genome chromosomes (5d, A. fatua).
182 These results suggest that the distribution of (ACT)6 is similar between A. sativa and A. fatua.
183 Furthermore, the results suggest that the ACD genome is conserved.
184 Summary of the FISH signal patterns of sixteen Avena species
185 A summary of the FISH signal patterns of sixteen Avena species based on the results shown in Fig. 1 to
186 Fig. 5 is illustrated in Fig. 6. The sixteen species were sorted into five groups (A, AB, C, AC, and ACD)
187 based on the genome constitution of the species in the group. To visually display the relationships 188 among the species, the probed chromosomesDraft are presented with the species. The signal loci were 189 distributed near or in the middle of the chromosomes (M) or at the chromosome termini (T). Group A
190 includes three subgroups: (i) 2AT, including A. wiestii (As) and A. longiglumis (Al); (ii) 2AM, including
191 A. nuda (As), A. strigosa (As), and A. canariensis (Ac); and (iii) 4AM, including A. brevis (As). Group
192 AB includes two subgroups: (i) 2M2T, including A. barbata, and (ii) 4M, including A. abyssinica and A.
193 vaviloviana. Group C includes A. ventricosa and A. eriantha (4CM2CT). Group AC includes three
194 subgroups: (i) 8AM6CM, including A. insularis; (ii) 4AM2AT6CM, including A. magna; and (iii)
195 4AM6CM2CT, including A. murphyi. Group ACD includes A. sativa and A. fatua (8ADM6CM and
196 6ADM6CM). Interestingly, two signal loci were observed close to the middle or at the terminus of one
197 chromosome each in A. magna and A. murphyi (2 signals on 1 chromosome). These results suggest that
198 the distribution of the (ACT)6 signal loci among the sixteen Avena species is diverse.
199 The results from groups A and AB suggest that (i) 2M2T in A. barbata may have originated from
200 2AT in A. wiestii (As) and A. longiglumis (Al) as well as 2AM in A. nuda (As), A. strigosa (As), and A.
10 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 11 of 32 Genome
201 canariensis (Ac), (ii) 4M in A. abyssinica and A. vaviloviana may have originated from 4AM in A.
202 brevis (As), and (iii) probe (ACT)6 might not be present in the B genomes. The results from groups C
203 and AC suggest that (i) 4CM in A. insularis, A. magna and A. murphyi may have originated from 4CM
204 in A. ventricosa and A. eriantha and (ii) 2CT in A. murphyi may have originated from 2CT in A.
205 ventricosa and A. eriantha. The results from groups A and AC suggest that (i) 2AM in A. insularis, A.
206 magna and A. murphyi may have originated from 2AM in A. nuda (As), A. strigosa (As), and A.
207 canariensis (Ac) and (ii) 4AM in A. insularis, A. magna and A. murphyi may have originated from
208 4AM in A. brevis (As). The AC and ACD results suggest that 8ADM6CM in A. sativa may have
209 originated from 8AM6CM in A. insularis, and (iii) probe (ACT)6 might not be present in the D 210 genomes. Draft
211 In total, the hybridization patterns for the Am1 and (ACT)6 probes showed that (i) probe Am1 was
212 particularly enriched in the C genome, and (ii) probe (ACT)6 showed large loci in the C genome and
213 was distributed in the A, AB, C, AC, and ACD genomes but might not be present in the B and D
214 genomes.
215 Discussion
216 Oligonucleotide probes Am1 and (ACT)6 revealed diverse patterns among the A, AB, C, AC, and ACD
217 genomes. This result provides key information that can be used in the physical assignment of genome
218 sequences to chromosomes. Moreover, this proof-of-concept approach opens the way to the use of
219 FISH probes in assigning other signature elements from genomic sequence to physical chromosomes.
220 Further discussion will focus on the following points: (i) the diverse patterns of the A, AB, C, AC, and
221 ACD genomes and (ii) the genetic relationships between Avena species and the hexaploid oat origins.
222 Diverse patterns of the A, AB, C, AC, and ACD genomes
11 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 12 of 32
223 Recently, FISH has been widely shown to be an important and effective tool for the characterization
224 and assessment of intraspecific and interspecific genetic relationships in Avena (Irigoyen et al. 2001;
225 Badaeva 2010a, b; Luo et al. 2014, 2015). The oligonucleotide probe Am1 was particularly enriched in
226 the C genome. This probe contained only 51 base pairs but could still identify the C genome in the
227 present study, thus functioning nearly the same as the 464 bp pAm1 (Solano et al. 1992; Sanz et al.
228 2010). The trinucleotide repeat probe (ACT)6 also showed large loci in C genome. Fominaya et al.
229 (2017) reported a preferential distribution of (AC)10 in the pericentromeric and interstitial regions of A
230 and D genome chromosomes and in the pericentromeric heterochromatic regions of C genome
231 chromosome. The location of the trinucleotide repeat probe (ACT)6 loci at either the middle or termini 232 (or even at both the middle and terminusDraft of an individual chromosome) show the diverse distribution of 233 hybridization patterns in Avena species.
234 The (ACT)6 signal pattern was relatively constant in the C and ACD genomes. The C and ACD
235 genomes contained only two species each in this study, which may make the (ACT)6 signal pattern an
236 easy trend to recognize. However, the observation of abnormal chromosomes in A. eriantha indicates
237 that structurally unstable chromosomes still retain the 6CM signal loci. Chew et al. (2016) also found
238 that all hexaploids and C genome diploids might remain unchanged and form two major clusters, which
239 was consistent with our results. The (ACT)6 signal pattern was more diverse in the A, AB and AC
240 genomes. Three (ACT)6 signal patterns were observed in the A genomes and even in the As genome.
241 Differences among the A genomes of diploid species have also been characterized using cytological
242 studies (Rajhathy and Thomas 1974; de la Hoz and Fominaya 1989; Thomas 1992) and molecular
243 studies (Fu and Williams 2008; Chew et al. 2016; Liu et al. 2017). Two (ACT)6 signal patterns were
244 observed in the AB genomes. Irigoyen et al. (2001) found that A. vaviloviana gave a strong smear,
12 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 13 of 32 Genome
245 whereas A. barbata gave a weak smear in which pronounced bands were found. Badaeva et al. (2010a)
246 found that A. abyssinica and A. vaviloviana had a clear C band in the middle of the short arm, which
247 was either weaker or absent in A. barbata. The difference between A. abyssinica, A. vaviloviana and A.
248 barbata is consistent with our results. Three (ACT)6 signal patterns were observed in the AC genomes.
249 Differences were found among A. insularis, A. magna and A. murphyi in the present study. Previously,
250 A. insularis was distinguished from A. magna and A. murphyi (Yan et al. 2016a), and A. magna was
251 shown to be distinct from A. murphyi (Drossou et al. 2004), which is mostly consistent with our results.
252 The (ACT)6 probe loci were distributed in the A, AB, C, AC, and ACD genomes but might not be
253 present in B and D genomes based on the intensity and number of (ACT)6 signals. The (ACT)6 signals 254 were weak and few in the A and AB genomesDraft but strong and many in C, AC, ACD genomes.
255 Comparing A and AB, the few differences in the signals indicate that (ACT)6 loci might not be present
256 in the B genome. Comparing AC and ACD, the few differences in the signal indicate (ACT)6 loci might
257 not be present in the D genome. Even if the (ACT)6 signal present in the B and D genomes, it should be
258 very weak and few in number. (ACT)6 probe loci are found in the A genome but not the B or D genome,
259 indicating that the A genome is different from the B and D genomes. Minor genetic differences have
260 been discerned between the A, B and D genomes (Oinuma, 1953; Katsiotis et al. 1997). The As 120a
261 satellite DNA sequence may discriminate the A genome from the B and D genomes in AB genomes
262 (Irigoyen et al. 2001) and ACD genomes (Linares et al. 1998; Sanz et al. 2010), which is consistent
263 with our results. Based on the distribution of (ACT)6 loci on the C genome chromosomes of diploid
264 and polyploid Avena species, we propose a model for the chromosomal alterations that have occurred
265 during the evolution of Avena species. This perspective is also supported by Badaeva (2010b) based on
266 rDNA locus distributions.
13 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 14 of 32
267 Genetic relationships of Avena species and the hexaploid oat origin
268 Based on the (ACT)6 signal patterns of the A and AB genomes, A. barbata may have originated from A.
269 nuda, A. strigosa, and A. canariensis as well as A. wiestii and A. longiglumis, while A. abyssinica, A.
270 vaviloviana may have originated from A. brevis. Genetic homogeneity existed between A. barbata, A.
271 wiestii and A. longiglumis (Liu et al. 2017, Alicchio et al. 1995). Liu et al. (2017) inferred that A. brevis
272 was related to A. abyssinica and A. vaviloviana. This result mostly agrees with our results. Nevertheless,
273 Li et al. (2000) indicated that A. strigosa and A. longiglumis participated in the formation of A.
274 abyssinica. This result contradicts our result. Based on the (ACT)6 signal patterns of the A, C, and AC
275 genomes, A. insularis, A. magna and A. murphyi may have originated from A. brevis, A. wiestii, A. 276 longiglumis, A. ventricosa and A. erianthaDraft. Liu et al. (2017) inferred that A. murphyi was related to A. 277 ventricosa and A. eriantha. Nikoloudakis and Katsiotis (2008) revealed the close proximity of A.
278 ventricosa to an active role in the evolution of tetraploid and hexaploid oats. This result supports our
279 result. However, Leggett (1998) indicated that A. eriantha was unlikely to have participated in the
280 formation of A. magna. Liu et al. (2017) inferred that A. nuda was related to A. murphyi. This result is
281 different from our result. Based on the (ACT)6 signal patterns of the AC and ACD genomes, A. sativa
282 may have originated from A. insularis. This result is confirmed by cytological and fertility data
283 (Ladizinsky 1998), cytogenetic analysis (Badaeva et al. 2010b), and phylogenetic analysis (Liu et al.
284 2017). However, doubts were cast on these findings by Shelukhina et al. (2007), Nikoloudakis et al.
285 (2008), Peng et al. (2010), Yan et al. (2014).
286 The (ACT)6 signal loci are observed at the chromosome termini in the A genome (A. wiestii and A.
287 longiglumis), C genome (A. ventricosa and A. eriantha), AC genome (A. magna and A. murphyi), and
288 AB genome (A. barbata) but not in the ACD genome (A. sativa and A. fatua), which indicates that
14 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 15 of 32 Genome
289 chromosome construction has exhibited gradual variation during evolution. Kellogg et al. (2004) put
290 forward that this variation was the outcome of a set of highly active processes, including gene
291 duplication and deletion, chromosomal duplication followed by gene loss, amplification of
292 retrotransposons separating genes, and genome rearrangement; the latter process often follows
293 hybridization or polyploidy. Rodrigues et al. (2017) suggested that the loss of the C genome sequence
294 might be correlated with differences in the parental genome size in Avena polyploid species. Indeed,
295 the C genome is larger than the A genome (Bennett 2012). Yan et al. (2016b) demonstrated that most of
296 the polyploid species in Avena had experienced genome downsizing in relation to their diploid
297 progenitors. Therefore, the (ACT)6 signal loci at the chromosome termini are possibly lost during the 298 evolution of Arena species hybridizationDraft or polyploidy. 299 Conclusion
300 The hybridization patterns of A. sativa are very similar to the pattern of A. insularis. Hence, the present
301 results suggest that A. insularis might be the AC genome progenitor of A. sativa. Our study using only
302 two FISH probes failed to indicate the relationships of more species. However, other oligonucleotide
303 and trinucleotide repeat probes have been used to label Avena species with the aim of revealing the
304 species and genomes of the Avena taxa. Our results provide key information that can be used in the
305 physical assignment of genome sequences to chromosomes. Moreover, this proof-of-concept approach
306 opens the way to the use of FISH probes in assigning other signature elements from genomic sequences
307 to physical chromosomes.
308 Acknowledgements
309 This study was supported by the Natural Science Foundation of China (003Z1001). The authors greatly
310 appreciate the American National Plant Germplasm System (Pullman, WA, USA) and Plant Gene
15 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 16 of 32
311 Resources of Canada (Saskatoon, SK, Canada) for providing the material for the investigation.
312 Compliance with Ethical Standards
313 Conflict of Interest: The authors declare that they have no conflict of interest.
314 References:
315 Alicchio, R., Aranci, L., and Conte, L. 1995. Restriction fragment length polymorphism based
316 phylogenetic analysis of Avena L. Genome 38(6): 1279-1284. doi:10.1139/g95-168.
317 Badaeva, E.D., Shelukhina, O.Y., Diederichsen, A., Loskutov, I.G., and Pukhalskiy, V.A. 2010a.
318 Comparative cytogenetic analysis of Avena macrostachya and diploid C-genome Avena species.
319 Genome 53(2): 125-137. doi:10.1139/g09-089. 320 Badaeva, E.D., Shelukhina, O.Y., Goryunova,Draft S.V., Loskutov, I.G., and Pukhalskiy, V.A. 2010b. 321 Phylogenetic relationships of tetraploid AB-Genome Avena species evaluated by means of
322 cytogenetic (C-Banding and FISH) and RAPD analyses. Journal of Botany 2010: 1-13.
323 doi:10.1155/2010/742307.
324 Baum, B.R. 1977. Oats: Wild and Cultivated. A monograph of the genus Avena L. (Poaceae).
325 Agriculture Canada.
326 Baum, B.R., and Fedak, G. 1985a. Avena atlantica, a new diploid species of the oat genus from
327 Morocco. Botany 63(6): 1057-1060. doi:10.1139/b85-144.
328 Baum, B.R., and Fedak, G. 1985b. A new tetraploid species of Avena discovered in Morocco. Botany
329 63(8): 1379-1385. doi:10.1139/b85-191.
330 Bennett, M.D., and Leitch, I.J. 2012. Plant DNA C-values database (release 6.0, Dec. 2012). Accessible
331 from http://www.kew.org/cvalues/.
16 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 17 of 32 Genome
332 Chew, P., Meade, K., Hayes, A., Harjes, C., Bao, Y., Beattie, A.D., Puddephat, I., Gusmini, G., and
333 Tanksley, S.D. 2016. A study on the genetic relationships of Avena taxa and the origins of hexaploid
334 oat. Theoretical and Applied Genetics 129(7): 1405-1415. doi:10.1007/s00122-016-2712-4.
335 Cuadrado, A., Cardoso, M., and Jouve, N. 2008. Increasing the physical markers of wheat
336 chromosomes using SSRs as FISH probes. Genome 51(10): 809-815. doi:10.1139/G08-065.
337 de la Hoz, P.S., and Fominaya, A. 1989. Studies of isozymes in oat species. Theoretical and Applied
338 Genetics 77(5): 735-741. doi:10.1007/BF00261252.
339 Drossou, A., Katsiotis, A., Leggett, J.M., Loukas, M., and Tsakas, S. 2004. Genome and species
340 relationships in genus Avena based on RAPD and AFLP molecular markers. Theoretical and 341 Applied Genetics 109(1): 48-54. doi:10.1007/s00122-004-1615-y.Draft 342 Fominaya, A., Hueros, G., Loarce, Y., and Ferrer, E. 1995. Chromosomal distribution of a repeated
343 DNA sequence from C-genome heterochromatin and the identification of a new ribosomal DNA
344 locus in the Avena genus. Genome 38(3): 548-557. doi:10.1139/g95-071.
345 Fominaya, A., Vega, C., and Ferrer, E. 1988. C-banding and nucleolar activity of tetraploid Avena
346 species. Genome 30(5): 633-638. doi:10.1139/g88-107.
347 Fominaya, A., Loarce, Y., Montes, A., Ferrer, E. 2017. Chromosomal distribution patterns of the (AC)10
348 microsatellite and other repetitive sequences, and their use in chromosome rearrangement analysis
349 of species of the genus Avena. Genome 60 (3): 216-227. doi.org/10.1139/gen-2016-0146.
350 Fu, S., Chen, L., Wang, Y., Li, M., Yang, Z., Qiu, L., Yan, B., Ren, Z., and Tang, Z. 2015.
351 Oligonucleotide probes for ND-FISH analysis to identify rye and wheat chromosomes. Scientific
352 reports 5: 10552. doi:10.1038/srep10552.
17 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 18 of 32
353 Fu, Y.B., and Williams, D.J. 2008. AFLP variation in 25 Avena species. TAG. Theoretical and applied
354 genetics. Theoretische und angewandte Genetik 117(3): 333-342. doi:10.1007/s00122-008-0778-3.
355 Gerlach, W.L., and Dyer, T.A. 1980. Sequence organization of the repeating units in the nucleus of
356 wheat which contain 5S rRNA genes. Nucleic Acids Research 8(21): 4851-4865.
357 doi:10.1093/nar/8.21.4851.
358 Hao, M., Luo, J., Zhang, L., Yuan, Z., Yang, Y., Wu, M., Chen, W., Zheng, Y., Zhang, H., and Liu, D.
359 2013. Production of hexaploid triticale by a synthetic hexaploid wheat-rye hybrid method.
360 Euphytica 193(3): 347-357. doi:10.1007/s10681-013-0930-2.
361 Irigoyen, M.L., Linares, C., Ferrer, E., and Fominaya, A. 2002. Fluorescence in situ hybridization 362 mapping of Avena sativa L. cv. SunIIDraft and its monosomic lines using cloned repetitive DNA 363 sequences. Genome 45(6): 1230-1237. doi:10.1139/g02-076.
364 Irigoyen, M.L., Loarce, Y., Linares, C., Ferrer, E., Leggett, M., and Fominaya, A. 2001. Discrimination
365 of the closely related A and B genomes in AABB tetraploid species of Avena. Theoretical and
366 Applied Genetics 103(8): 1160-1166. doi:10.1007/s001220100723.
367 Jellen, E.N., Gill, B.S., and Cox, T.S. 1994. Genomic in situ hybridization differentiates between A/D-
368 and C-genome chromatin and detects intergenomic translocations in polyploid oat species (genus
369 Avena). Genome 37(4): 613-618. doi:10.1139/g94-087.
370 Kato, A., Lamb, J.C., and Birchler, J.A. 2004. Chromosome painting using repetitive DNA sequences
371 as probes for somatic chromosome identification in maize. Proceedings of the National Academy of
372 Sciences of the United States of America 101(37): 13554-13559. doi:10.1073/pnas.0403659101.
18 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 19 of 32 Genome
373 Katsiotis, A. 1997. The close relationship between the A and B genomes in Avena L. (Poaceae)
374 determined by molecular cytogenetic analysis of total genomic, tandemly and dispersed repetitive
375 DNA sequences. Annals of Botany 79(2): 103-109. doi:10.1006/anbo.1996.0312.
376 Katsiotis, A. 2000. Repetitive DNA, Genome and Species Relationships in Avena and Arrhenatherum
377 (Poaceae). Annals of Botany 86(6): 1135-1142. doi:10.1006/anbo.2000.1284.
378 Kellogg, E.A., and Bennetzen, J.L. 2004. The evolution of nuclear genome structure in seed plants.
379 American Journal of Botany 91(10): 1709-1725. doi:10.3732/ajb.91.10.1709.
380 Komuro, S., Endo, R., Shikata, K., and Kato, A. 2013. Genomic and chromosomal distribution patterns
381 of various repeated DNA sequences in wheat revealed by a fluorescence in situ hybridization 382 procedure. Genome 56(3): 131-137. doi:10.1139/gen-2013-0003.Draft 383 Ladizinsky, G. 1998. A new species of Avena from Sicily, possibly the tetraploid progenitor of
384 hexaploid oats. Genetic Resource Crop Evolution 45(3): 263-269. doi:10.1023/a:1008657530466.
385 Ladizinsky, G. 2012. Studies in oat evolution: A Man's Life with Avena. Springer Berlin Heidelberg.
386 Ladizinsky, G., and Zohary, D. 1968. Genetic relationships between diploids and tetraploids in series
387 eubarbatae of Avena. Canadian Journal of Genetics and Cytology 10(1): 68-81.
388 doi:10.1139/g68-010.
389 Leggett, J.M. 1998. Chromosome and genomic relationships between the diploid species Avena
390 strigosa, A. eriantha and the tetraploid A. maroccana. Heredity 80(3): 361-363.
391 doi:10.1046/j.1365-2540.1998.00305.x.
392 Leggett, M., and Markland, G.S. 1995. The genomic structure of Avena revealed by GISH. In
393 Proceedings of the Kew Chromosome Conference IV. pp. 133-139.
19 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 20 of 32
394 Li, C.D., Rossnagel, B.G., and Scoles, G.J. 2000. The development of oat microsatellite markers and
395 their use in identifying relationships among Avena species and oat cultivars. Theoretical and
396 Applied Genetics 101(8): 1259-1268. doi:10.1007/s001220051605.
397 Li, W.T., Peng, Y.Y., Wei, Y.M., Baum, B.R., and Zheng, Y.L. 2009. Relationships among Avena
398 species as revealed by consensus chloroplast simple sequence repeat (ccSSR) markers. Genet
399 Resour Crop Ev 56(4): 465-480. doi:10.1007/s10722-008-9379-x.
400 Li, G., Wang, H., Lang, T., Li, J., La, S., Yang, E., and Yang, Z. 2016. New molecular markers and
401 cytogenetic probes enable chromosome identification of wheat-Thinopyrum intermedium
402 introgression lines for improving protein and gluten contents. Planta 244(4): 865-876. 403 doi:10.1007/s00425-016-2554-y. Draft 404 Linares, C., Ferrer, E., and Fominaya, A. 1998. Discrimination of the closely related A and D genomes
405 of the hexaploid oat Avena sativa L. Proceedings of the National Academy of Sciences of the
406 United States of America 95(21): 12450-12455. doi:10.1073/pnas.95.21.12450.
407 Liu, Q., Lin, L., Zhou, X., Peterson, P.M., and Wen, J. 2017. Unraveling the evolutionary dynamics of
408 ancient and recent polypoidization events in Avena (Poaceae). Scientific Reports 7: 41944.
409 doi:10.1038/srep41944.
410 Luo, X., Tinker, N.A., Zhang, H., Wight, C.P., Kang, H., Fan, X., Wang, Y., Sha, L., and Zhou, Y. 2014.
411 Centromeric position and genomic allocation of a repetitive sequence isolated from chromosome
412 18D of hexaploid oat, Avena sativa L. Genetic Resource Crop Evolution 62(1): 1-4.
413 doi:10.1007/s10722-014-0170-x.
20 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 21 of 32 Genome
414 Luo, X., Zhang, H., Kang, H., Fan, X., Wang, Y., Sha, L., and Zhou, Y. 2014. Exploring the origin of
415 the D genome of oat by fluorescence in situ hybridization. Genome 57(9): 469-472.
416 doi:10.1139/gen-2014-0048.
417 Mirzaghaderi, G., Houben, A., and Badaeva, E.D. 2014. Molecular-cytogenetic analysis of Aegilops
418 triuncialis and identification of its chromosomes in the background of wheat. Molecular
419 Cytogenetics 7(1): 91. doi:10.1186/s13039-014-0091-6.
420 Nikoloudakis, N., and Katsiotis, A. 2008. The origin of the C-genome and cytoplasm of Avena
421 polyploids. Theoretical and Applied Genetics 117(2): 273-281. doi:10.1007/s00122-008-0772-9.
422 Nikoloudakis, N., Skaracis, G., and Katsiotis, A. 2008. Evolutionary insights inferred by molecular 423 analysis of the ITS1-5.8S-ITS2 and IGSDraft Avena sp. sequences. Molecular Phylogenetics and 424 Evolution 46(1): 102-115. doi:10.1016/j.ympev.2007.10.007.
425 Oinuma, T. 1953. Karyomorphology of cereals. The Japanese Journal of Genetics 28(5-6): 219-226.
426 doi:10.1266/jjg.28.219.
427 Peng, Y.Y., Baum, B.R., Ren, C.Z., Jiang, Q.T., Chen, G.Y., Zheng, Y.L., and Wei, Y.M. 2010. The
428 evolution pattern of rDNA ITS in Avena and phylogenetic relationship of the Avena species
429 (Poaceae: Aveneae). Hereditas 147(5): 183-204. doi:10.1111/j.1601-5223.2010.02172.x.
430 Rajhathy, T. 1991. The chromosomes of Avena. Elsevier Science, Amsterdam, Netherlands
431 Rajhathy T, T.H. 1974. Cytogenetics of oats (Avena L.). Genetics Society of Canada, Ottawa.
432 Rajhathy, T., and Morrison, J.W. 1959. Chromosome morphology in the genus Avena. Canadian Journal
433 of Botany 37(3): 331-337. doi:10.1139/b59-024. Fu
21 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 22 of 32
434 Rodrigues, J., Viegas, W., and Silva, M. 2017. 45S rDNA external transcribed spacer organization
435 reveals new phylogenetic relationships in Avena genus. PloS one 12(4): e0176170.
436 doi:10.1371/journal.pone.0176170.
437 Sanz, M.J., Jellen, E.N., Loarce, Y., Irigoyen, M.L., Ferrer, E., and Fominaya, A. 2010. A new
438 chromosome nomenclature system for oat (Avena sativa L. and A. byzantina C. Koch) based on
439 FISH analysis of monosomic lines. Theoretical and Applied Genetics 121(8): 1541-1552.
440 doi:10.1007/s00122-010-1409-3.
441 Shelukhina, O., Badaeva, E.D., Loskutov, I.G., and Pukhal'skii, V.A. 2007. [A comparative cytogenetic
442 study of the tetraploid oat species with the A and C genomes: Avena insularis, A. magna, and A. 443 murphyi]. Genetika 43(6): 747-761. doi:10.1134/S102279540706004X.Draft 444 Shelukhina, O.Y., Badaeva, E.D., Brezhneva, T.A., Loskutov, I.G., and Pukhalsky, V.A. 2008.
445 Comparative analysis of diploid species of Avena L. using cytogenetic and biochemical markers:
446 Avena canariensis Baum et Fedak and A. longiglumis Dur. Russian Journal of Genetics 44(6):
447 694-701. doi:10.1134/s1022795408060094.
448 Solano, R., Hueros, G., Fominaya, A., and Ferrer, E. 1992. Organization of repeated sequences in
449 species of the genus Avena. Theoretical and Applied Genetics 83(5): 602-607.
450 doi:10.1007/BF00226904.
451 Tang, Z., Yang, Z., and Fu, S. 2014. Oligonucleotides replacing the roles of repetitive sequences pAs1,
452 pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. Journal of Applied Genetics
453 55(3): 313-318. doi:10.1007/s13353-014-0215-z.
454 Thomas, H. 1989. New species of Avena. In Proceedings of the 3rd International Oat Conference, Lund,
455 Sweden. pp. 18-23.
22 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 23 of 32 Genome
456 Tomas, D., Rodrigues, J., Varela, A., Veloso, M.M., Viegas, W., and Silva, M. 2016. Use of repetitive
457 sequences for molecular and cytogenetic characterization of Avena species from Portugal.
458 International Journal of Molecular Sciences 17(2). doi:10.3390/ijms17020203.
459 Yan, H., Bekele, W.A., Wight, C.P., Peng, Y., Langdon, T., Latta, R.G., Fu, Y.B., Diederichsen, A.,
460 Howarth, C.J., Jellen, E.N., Boyle, B., Wei, Y., and Tinker, N.A. 2016a. High-density marker
461 profiling confirms ancestral genomes of Avena species and identifies D-genome chromosomes of
462 hexaploid oat. Theoretical and Applied Genetics. 129(11): 2133-2149.
463 doi:10.1007/s00122-016-2762-7.
464 Yan, H., Martin, S.L., Bekele, W.A., Latta, R.G., Diederichsen, A., Peng, Y., and Tinker, N.A. 2016b. 465 Genome size variation in the genus AvenaDraft. Genome 59(3): 209-220. doi:10.1139/gen-2015-0132. 466 Yan, H.H., Baum, B.R., Zhou, P.P., Zhao, J., Wei, Y.M., Ren, C.Z., Xiong, F.Q., Liu, G., Zhong, L.,
467 Zhao, G., and Peng, Y.Y. 2014. Phylogenetic analysis of the genus Avena based on chloroplast
468 intergenic spacer psbA-trnH and single-copy nuclear gene Acc1. Genome 57(5): 267-277.
469 doi:10.1139/gen-2014-0075.
470 Yang, X., Wang, C., Li, X., Chen, C., Tian, Z., Wang, Y., and Ji, W. 2015. Development and Molecular
471 Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D) Disomic Substitution
472 Line with Stripe Rust Resistance. PloS one 10(10): e0140227. doi:10.1371/journal.pone.0140227.
23 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 24 of 32
473 Legends
474 Fig. 1. FISH analysis of the mitotic metaphase plates from six AA Avena diploids: (a) Avena wiestii, (b)
475 Avena longiglumis, (c) Avena brevis, (d) Avena nuda, (e) Avena strigosa, and (f) Avena canariensis. The
476 chromosomes were probed with a 5’-FAM-labelled (ACT)6 trinucleotide repeat (green) in all images.
477 The (ACT)6 signals are indicated with white arrows. All chromosomes were counterstained with DAPI.
478 Scale bar = 5 µm.
479 Fig. 2. FISH analysis of the mitotic metaphase plates from three AABB Avena tetraploids: (a) Avena
480 barbata, (b) Avena abyssinica, and (c) Avena vaviloviana. The chromosomes were probed with a
481 5’-FAM-labelled (ACT)6 trinucleotide repeat (green) in all images. The (ACT)6 signals are indicated 482 with white arrows. All chromosomes wereDraft counterstained with DAPI. Scale bar = 5 µm. 483 Fig. 3. FISH analysis of the mitotic metaphase plates from two CC Avena diploids: (a) Avena
484 ventricosa and (b-c) Avena eriantha. The chromosomes were probed with a 5’-FAM-labelled (ACT)6
485 trinucleotide repeat (green) in all images. The (ACT)6 signals are indicated with white arrows, whereas
486 abnormal chromosomes are indicated with red arrows. All chromosomes were counterstained with
487 DAPI. Scale bar = 5 µm.
488 Fig. 4. FISH analysis of the mitotic metaphase plates from three AACC Avena tetraploids: (a-b) Avena
489 insularis, (c-d) Avena magna, and (e-f) Avena murphyi. The chromosomes were probed with a
490 5’-FAM-labelled (ACT)6 trinucleotide repeat (green) in all images and with a 5’-TAMRA-labelled
491 Am1 oligonucleotide (red) in b, d and f. The trinucleotide repeat (ACT)6 signals are indicated with
492 white arrows. All chromosomes were counterstained with DAPI. Scale bar = 5 µm.
493 Fig. 5. FISH analysis of the mitotic metaphase plates from two AACCDD Avena hexaploids: (a-b)
494 Avena sativa and (c-d) Avena fatua. The chromosomes were probed with a 5’-FAM-labelled (ACT)6
24 / 25
https://mc06.manuscriptcentral.com/genome-pubs Page 25 of 32 Genome
495 trinucleotide repeat (green) in all images and with a 5’-TAMRA-labelled Am1 oligonucleotide (red) in
496 b and d. The (ACT)6 signals are indicated with white arrows. All chromosomes were counterstained
497 with DAPI. Scale bar = 5 µm.
498 Fig. 6. Genetic relationships between the Avena species based on FISH signal patterns. Sixteen species
499 were sorted into five groups (A, AB, C, AC, and ACD) based on the genome constitution of the species
500 in the group. To visually display the relationships among the species, the probed chromosomes are
501 presented with the species. The signal loci are summarized into two types. One type has a signal
502 location near or in the middle of a chromosome (M), whereas the other type has a signal location near
503 or at the terminus of a chromosome (T). Additionally, the capital letters A and C indicate the genomes 504 of Avena (e.g., 2AM indicates signal lociDraft near the middle of 2 chromosomes in the A genome). 505 Captions
506 Table 1 Summary of the sixteen Avena species included in the current study.
507
25 / 25
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 26 of 32
Draft
https://mc06.manuscriptcentral.com/genome-pubs Page 27 of 32 Genome
Draft
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 28 of 32
Draft
https://mc06.manuscriptcentral.com/genome-pubs Page 29 of 32 Genome
Draft
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 30 of 32
Draft
https://mc06.manuscriptcentral.com/genome-pubs Page 31 of 32 Genome
Draft
https://mc06.manuscriptcentral.com/genome-pubs Genome Page 32 of 32
Table 1 Summary of sixteen Avena species included in current study.
Species Geographic distribution No. of accessions Genome
Avena brevis Canada, Ontario CIav 9013 AsAs
Avena nuda Netherlands PI 401795 AsAs
Avena strigosa Spain PI 73584 AsAs
Avena wiestii Egypt, Giza PI 53626 AsAs
Avena canariensis Spain CN 6195 AcAc
Avena longiglumis Canada, Ontario CIav 9071 AlAl
Avena eriantha Spain, Madrid PI 367381 CpCp
Avena ventricosa Morocco Draft PI 657337 CvCv Avena abyssinica Ethiopia CIav 2519 AABB
Avena barbata Israel PI 287199 AABB
Avena vaviloviana Ethiopia, Tigre PI 412729 AABB
Avena insularis Tunisia CN 108634 AACC
Avena magna* Morocco PI 657552 AACC
Avena murphyi Morocco PI 657364 AACC
Avena sativa Australia PI 584783 AACCDD
Avena fatua Russian Federation, Leningrad CIav 1779 AACCDD
*Avena magna is synonym of Avena maroccana.
https://mc06.manuscriptcentral.com/genome-pubs