Frequent Allelic Loss of the BCL10 Gene in Lymphomas with the T (11

Frequent allelic loss of the BCL10 gene in lymphomas with the t(11;14)(q13;q32)

TO THE EDITOR a

The translocation t(11;14)(q13;q32) is the cytogenetic hallmark of mantle cell lymphomas (MCL), in which it can be detected in over 80% of cases. Additionally, this translocation has been observed in subsets of other B-lymphocytic neoplasms.1 At the molecular level, the t(11;14) juxtaposes the BCL1-locus in chromosome band 11q13 next to the immunoglobulin heavy chain (IgH) locus in chromosome band 14q32, resulting in overexpression of cyclin D1 (CCND1). Cyclin D1 protein plays a crucial role in cell cycle progression by promoting the G1-S phase transition. Though overexpression of CCND1 due to the t(11;14) is regarded as the primary event in the pathogenesis of mantle cell lymphomas, experimental data from trans- genic mice suggest that cyclin D1 has minimal oncogenic potential, being insufficient to induce tumorigenicity by itself. Thus, the acqui- sition of secondary chromosomal aberrations appears to be crucial for the malignant transformation and clonal progression of CCND1- overexpressing lymphocytes. By karyotyping, such secondary chromosomal changes can be observed in more than 80% of B cell malignancies with t(11;14). Among the most frequently recurring secondary changes in these neoplasms are deletions in the short arm of chromosome 1 (1p). The common region of loss in cytogenetic as b well as CGH studies encompasses 1p22, suggesting the existence of a tumor suppressor gene involved in the pathogenesis of t(11;14)-positive B cell in this chromosomal region.2,3 Chromosome region 1p22 harbors the BCL10 gene, which we and others recently cloned from the translocation t(1;14)(p22;q32) recurrent in mucosa-associated lymphoid tissue (MALT) lymphomas.4,5 The BCL10 gene encodes a caspase recruitment domain (CARD)-containing apoptosis signaling protein that is capable of promoting apoptosis and suppressing in vitro transformation of rat embryonic fibroblasts by synergistic oncogenes. BCL10 cDNAs from t(1;14)-positive MALT tumors contain a striking variety of mutations that abrogate the pro-apoptotic function of the normal protein.4,5 These data suggest that wild-type BCL10 may act as a tumor suppressor. In a recent paper,6Bullinger et al screened 15 MCL, five of them with one copy of BCL10 deleted, for inactivating mutations. Except for well-established polymorphisms,4,5 no sequence alterations could be detected. We also recently presented a study7 aiming to determine whether the BCL10 gene might be the target of the 1p22 deletions found in MCL. From our series of 43 t(11;14) positive MCL 20 (47%) cases contained deletions of the short arm of chromosome 1 by stan- dard chromosome analyses. Thereby loss of 1p35-p36 was observed in seven patients (16%), whereas 16 of the 43 patients (37%) showed loss of 1p21(-p31), including three patients with both regions affected. Figure 1 Detection of BCL10 deletions in t(11;14)-positive lym- Interphase FISH with a BCL10-specific probe was performed on nine phomas. (a) Interphase FISH with a BCL10-specific probe of a primary of these lymphomas, five of them with typical mantle cell lymphoma, t(11;14)-positive mantle cell lymphoma revealing loss of one copy of four of them with high-grade (blastoid or pleomorphic) variants. In all the BCL10 gene in the nuclei of tumor cells (one red signal) in contrast cases, FISH with a BCL10-specific probe revealed a significant per- to an accompanying normal cell (two red signals). (b) FISH with a centage (24–95%) of nuclei with a signal constellation indicative of BCL10-specific probe (detected with Cy3) and a 1p36-specific probe BCL10 gene deletion (Figure 1a). Additionally, FISH of the t(11;14)- (detected with FITC) on a metaphase from the t(11;14)-positive cell positive mantle cell lymphoma cell line Granta 519 which contains line Granta 519. The intact chromosome 1 displays the expected sig- a derivative chromosome 1 with alterations that include the 1p22 nal constellation, with a red fluorescent signal from the BCL10 probe region, also revealed loss of one copy of the BCL10 gene locus (Figure at 1p22 and a green fluorescent signal from the D1Z2 probe at 1p36. 1b). Thus, one BCL10 allele was consistently lost in our series of Loss of one copy of the BCL10 gene in this cell line is due to a com- t(11;14)-positive lymphomas containing interstitial deletions in 1p22. plex alteration that generates a derivative chromosome 1 that also In order to determine whether the second allele of the BCL10 gene contains the 1p36-specific signal in an atypical position. According is also inactivated, seven primary cases with FISH-proven BCL10 to R-banding analysis, this derivative chromosome most likely rep- deletions and at least 45% aberrant cells, as well as the cell line resents a der(1)t(1;5)(p36;q14)del(1)(p12p31)del(1)(q12q31) (Harder Granta 519, were subjected to genomic mutation screening of the et al, unpublished data).

complete BCL10 open reading frame by direct SSCP and sequencing Correspondence: D Steinemann, Institute of Human Genetics, Univer- analyses (primers were derived from the genomic BCL10 sequence, sity Kiel, Schwanenweg 24, 24105 Kiel, Germany; Fax: 49 431 597 Acc. No. AF097732, sequences available upon request). Besides the 1880 mentioned polymorphisms no clonal mutations of the second allele Received 8 September 2000; accepted 23 October 2000 of BCL10 were detected in any of the eight lymphomas. Correspondence 475 phomas. We cannot presently rule out that post-transcriptional silencing or non-templated mutations at the RNA level affect BCL10 function in these tumors, however. Future studies will be required to address these issues by investigating possible aberrations of BCL10 protein expression, structure and function in t(11;14)-positive lymphomas, as well as other tumors. On the other hand the possibility exists that haploinsufﬁciency may be sufﬁcient to accelerate tumor progression due to dose dependent action of the BCL10 protein.

D Steinemann11Institute of Human Genetics, R Siebert1 University of Kiel, Kiel; S Harder12metaGen Gesellschaft fu¨r Figure 2 Methylation-specific PCR of the BCL10 CpG island. M, I Martin-Subero1 Genomforschung mbH, Berlin; 100 bp ladder; lanes 1–8, amplification of unmodified genomic DNA G Kettwig13Department of Hematopathology, with wild-type primer set (5Јcgcgtcgccgtcgacctcagaggcg3Ј and B Hinzmann2 University of Kiel, Kiel; 5Јgtccttcttcacttcagtgagg3Ј); lanes 9–16, amplification of bisulfite- S Gesk14Department of Pathology, treated DNA (protocol as described by Intergen, Oxford, UK) with U- M Tiemann3 University of Lu¨beck, Lu¨beck, Germany; and primer set (5Јtgtgttgttgttgatgattttagaggtg3Ј and 5Јtccttcttcacttcaat- H Merz45Departments of Pathology and aaaatcc3Ј) specific for unmethylated status; 17–24, amplification of A Rosenthal2 Hematology-Oncology, bisulfite-treated DNA with M-primer set (5Јcgcgtcgtcgtcgatttt- W Grote1 St Jude Children’s Research Hospital, agaggcg3Ј and 5Јtccttcttcacttcaataaaatcc3Ј) specific for methylated SW Morris5 Memphis, TN, USA DNA; a–g, DNA from seven primary t(11;14)-positive lymphomas B Schlegelberger1 with FISH-proven monoallelic BCL10 deletion; h, peripheral blood leukocyte control DNA. References Epigenetic mechanisms might also lead to inactivation of a candi- date tumor suppressor by transcriptional silencing. For example, hyp- 1 Raffeld M, Jaffe ES. bcl-1, t(11;14), and mantle cell-derived lym- ermethylation of CpG islands is a recurrent mode of transcriptional phomas. Blood 1991; 78: 259–263. silencing and has been shown to be a mechanism of inactivation of 2 Wlodarska I, Pittaluga S, Hagemeijer A, Wolf-Peeters C, Van Den some tumor suppressor genes like p16. Genomic analysis of the 5Ј Berghe H. Secondary chromosome changes in mantle cell lym- region of BCL10 revealed the existence of a CpG island that might phoma. Haematologica 1999; 84: 594–599. possess regulatory influence on BCL10. Methylation-specific PCR was 3 Bea S, Ribas M, Hernandez JM, Bosch F, Pinyol M, Hernandez L, performed on bisulfite-modified DNA from the seven t(11;14)-positive Garcia JL, Flores T, Gonzalez M, Lopez-Guillermo A, Piris MA, primary cases with FISH-proven BCL10 deletion, and from peripheral Cardesa A, Montserrat E, Miro R, Campo E. Increased number of blood leukocytes as a control (Figure 2). In all DNA samples investi- chromosomal imbalances and high-level DNA amplifications in gated, amplification with the wild-type primers and the primers spe- mantle cell lymphoma are associated with blastoid variants. Blood cific to the unmethylated state generated a specific product of 268 bp. 1999; 93: 4365–4374. In contrast, no product was obtained using the methylation-specific 4 Zhang Q, Siebert R, Yan M, Hinzmann B, Cui X, Xue L, Rakestraw primers. Thus, our data provide no evidence that transcriptional KM, Naeve CW, Beckmann G, Weisenburger DD, Sanger WG, silencing by methylation plays a major role for inactivation of the Nowotny H, Vesely M, Callet-Bauchu E, Salles G, Dixit VM, second BCL10 allele in t(11;14)-positive lymphomas. These findings Rosenthal A, Schlegelberger B, Morris SW. Inactivating mutations were also supported by the presence of BCL10 mRNA in the Granta and overexpression of BCL10, a caspase recruitment domain-con- 519 cell line, which contains only one BCL10 allele (data not shown). taining gene, in MALT lymphoma with t(1;14)(p22;q32). Nat If transcriptional silencing were to be the mechanism of inactivation Genet 1999; 22: 63–68. of the second allele in this cell line, no BCL10 mRNA should be 5 Willis TG, Jadayel DM, Du MQ, Peng H, Perry AR, Abdul-Rauf detectable. Remarkably, though we have not found any evidence for M, Price H, Karran L, Majekodunmi O, Wlodarska I, Pan L, Crook clonal genomic DNA mutations of BCL10 in Granta 519, the BCL10 T, Hamoudi R, Isaacson PG, Dyer MJ. Bcl10 is involved in mutation database contains 20 different transcript variants of BCL10 t(1;14)(p22;q32) of MALT B cell lymphoma and mutated in mul- from this cell line, which were identified by sequencing of cloned tiple tumor types. Cell 1999; 96: 35–45. cDNA (http://www.icr.ac.uk/haemcyto/bcldata/data.htm). Fifteen of 6 Bullinger L, Leupolt E, Schaffner C, Mertens D, Bentz M, Lichter these cDNA variants should result in truncated BCL10 protein. There- P, Do¨hner H, Stilgenbauer S. BCL10 is not the gene inactivated fore, non-templated mutations occurring during or after transcription by mutation in the 1p22 deletion region in mantle cell lymphoma. might also affect BCL10 proteins integrity and function. Leukemia 2000; 14: 1490–1492. In summary, we found frequent monoallelic deletion of BCL10 in 7 Steinemann D, Siebert R, Martin-Subero I, Harder S, Kettwig G, lymphomas containing t(11;14)(q13;q32). Nevertheless, the lack of Gesk S, Hinzmann B, Rosenthal A, Morris SW, Grote W, Schlegel- clonal inactivating mutations or transcriptional silencing by hyperme- berger B. Frequent allelic loss of the BCL 10 gene in lymphomas thylation of the second BCL10 allele questions whether the gene is with the translocation t(11;14)(q13;q32). Eur J Hum Genet 2000; indeed the target of the 1p22 deletions in t(11;14)-positive lym- 8: 505.

Leukemia