DOCSLIB.ORG

6Th Rosaceous Genomics Conference (RGC6)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
6Th Rosaceous Genomics Conference (RGC6) 6th Rosaceous Genomics Conference (RGC6) Mezzocorona (Trento), Italy, 30th September - 4th October 2012 FONDAZIONE EDMUNDFONDAZIONE MACH EDMUND MACH eous Genomics osac Con Rosaceous Gen nce th R fere Sixth omics Confere Six nc ISTITUTO AGRARIOISTITUTOe AGRARIO Under the Auspices ofUnder the the Auspices of the DI SAN MICHELERG ALL’ADIGECDI SAN6 MICHELE ALL’ADIGERGAutonomousC 6 ProvinceAutonomous of Trento Province of Trento 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 th 6 Rosaceous Genomics Conference (RGC6) th th Mezzocorona (Trento), Italy, 30 September‐4 October 2012 ROGRAM AND OOK OF BSTRACTS P B A Under the Auspices of the Autonomous Province of Trento 3 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 Event organized by Event organized by Provincia Autonoma di Trento Provincia Autonoma di Trento and supported by and supported by Cover pictures: Flowering apples and Brenta Dolomites (Courtesy of the Tourism Board of Val di Non - Trentino - Italy and Centre for Technological Transfer Fondazione Edmund Mach) 4 4 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 th 6 Rosaceous Genomics Conference (RGC6) Program Sunday, 30th September Arrival and Accommodation 17:00 Registration at PalOpening lecture: J.arotari, Mezzocorona Salse 18:20 ‐ Plant and animal genome structural, functional and evolutionary plasticity 19:00‐21:30 Welcome dinner in the Historical Cellar Monday, 1st October 8:00‐09:00 Registration R. Viola 8:30 Plenary ‐ Welcome address lecture: S. Myles 9:00 ‐ Genotyping‐by‐sequencing in apple: Enormous promise and significant challenges Session 1 – Structural Genomics Chair: Sue Gardiner S. Gardiner Pyrus communis 9:30 ‐ A draft genome sequence of European pear ( L. ‘Bartlett’) 5 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 T.M. Davis 10:10 S. Montanari‐ Genome compositions in the oct Pyrus oploid and decaploid strawberries Pyrus 10:25 ‐ Identification of single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and inter‐specific hybrids J.M. Bradeen 10:25 ‐ The RosaR80 system: a framework for cross‐species comparative analyses of R‐genes from Rosaceous species 10:55 Coffee break AFFYMETRIX SPECIAL EVENT. F. Brew 11:15 ‐ How do you accelerate your genomics program from NGS to molecular breeding? Session 2 ­ Functional Genomics Chair: Herman Silva H. Silva Prunus avium 11:45 ‐ A functional genomics approach to understand cracking susceptibility in sweet cherry (G. Sanchez ) 12:15 ‐ An integrative “omics” approach identifies new candidate genes to impact aroma volatiles in peach fruit T. Hytönen Fragaria vesca 12:30 ‐ Interconnected molecular pathways control vegetative and floral development in R. Schaffer 12:45 ‐ The complexity of apple fruit ripening 13:00 Lunch Session 3 ­ Emerging Omics Chair: Fulvio Mattivi R. Wehrens 14:00 V. Shulaev ‐ High‐throughput metabolomics ‐ challenges for bioinformatics 14:30 ‐ Harvesting the strawberry genome: from genes to metabolic networks 6 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 A. Orellana Prunus persica 14:45 ‐ Unravelling the proteome of the mesocarp during softening 15:00­17:00 First poster session (Even numbers) 17:00­19:00 Second poster session (Odd numbers) 15:00­17:00 SPECIAL EVENT Illumina­ Genome Studio workshop Session 1 17:00­19:00 SPECIAL EVENT. Illumina­ Genome Studio workshop Session 2 . 15:00­19:00 SPECIAL EVENT Global Crop Diversity Trust ­ Expert consultation workshop on the use of crop wild relatives for . pre‐breeding in apple 15:00­19:00 SPECIAL EVENT Meeting of the COST Action on cherries . Tuesday, 2nd October Plenary lecture: J. Giovannoni 8:45 ‐ Tomato as a model for analysis of molecular control of fruit ripening Session 4 ­ Plant Genetics Chair: Amy Iezzoni A. Iezzoni Prunus 9:25 ‐ The genetic control of fruit size in cherry ( ): from phenotype to candidate genes S. Kumar 9:55 ‐ Genome‐wide association study of apple fruit traits in an experimental population A. Monfort 10:10 ‐ A walk around the phenotype of diploid strawberry using a NILs collection 7 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 C. Romero 10:25 ‐ Self‐compatibility associated with pollen modifier gene(s) in apricot 10:40 Coffee break ILLUMINA SPECIAL EVENT R. Scavelli 11:00‐11:30 . ‐ Genotyping by sequencing with Illumina technology Session 5 – Fruit quality Chair: Elizabeth Dirlewanger E. Dirlewanger Quero­Garcia 11:30 and J. ‐ The genetic control of fruit quality traits in two prunus species: peach and cherry F. Costa 12:00 – Genomic approaches towards efficient assisted breeding for fruit quality in apple R. Pirona 12:15 E.J. Buck ‐ Genetic dissection of peach fruit quality traits 12:30 ‐ Genetic control of fruit sugar content across the Rosaceae 12:45 Lunch Session 6 ­ Applied Molecular Breeding Chair: Pere Arús P. Arús 13:45 ‐ Towards the enrichment of the peach gene pool with alleles from wild species: the collection of peach‐almond introgression lines S. Martens Malus domestica Pyrus communis 14:15 ‐ Genetic and molecular characterisation of apple‐pear hybrids ( M. Davey × ) 14:30 K. Gasic ‐ Allelic‐specific markers for fruit vitamin C breeding in apple Xanthomonas arboricola pv. pruni 14:45 ‐ Mapping QTLs Associated with Resistance to Bacterial Spot ( ) in Peach 15:00 Coffee break 8 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 Session 7 ­ International ‘Omics’ Projects Chair: Francois Laurens F. Laurens 15:20 M. Jänsch ‐ Progress in EU‐FruitBreedomics Rvi2 Rvi4 Rvi11 15:35 ‐ Precise mapping an identification of SNPs associated with the apple scab resistance genes D. Micheletti , and 15:50 ‐ Genetic variability description in a wide germplasm of domesticated peach through high throughput genotyping M. Bink 16:05 E.van de ‐ Discovery & interpretatio Weg n of multiple linked QTL 16:20 ‐ Towards a large sized Axiom SNP array for the allo‐octoploid strawberry C. Peace 16:35 ‐ Jewels in the apple genome: RosBREED’s conversion of reported trait loci for fruit quality into DNA tests routinely used in breeding 19:30‐23:30 Social Dinner at Castello di Toblino – Poster awards Wednesday, 3rd October Plenary lecture: L. Han 8:30 ‐ Strategy for identification of functionally important genes and marker‐assisted plant breeding using NGS technology Session 8 ­ Genetic Engineering Chair: Henk Schouten H. Schouten 9:40 C. Gessler ‐ New plant breeding techniques in the EU 10:00 H. Flachowsky ‐ Can genetic engineering reduce pesticide use in apple orchards? 10:20 ‐ Trans‐ and cis‐genic approaches to improve apple breeding at JKI in Dresden‐Pillnitz A. Chambers Fragaria 10:35 ‐ Functional Genomics 9 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 10:50 Coffee break Session 9 ­ Computational Biology and Bioinformatics Chair: Dorrie Main S. Jung 11:10 J. Ward ‐ Ten years of GDR: Current resources and functionality GDR Rubus idaeus 11:40 – Progress on the development of a genome sequence for red raspberry J. Jansen 11:55 ‐ Statistical tools and software for the construction of integrated genetic linkage maps of outbreeding species using SNP markers with applJ.M. Celton e as a model 12:10 ‐ Re‐annotation and transcript expression analysis of the apple genome 12:25 Lunch Session 10 ­ Pests and Diseases Chair: Bert Abbott B. Abbott 13:40 ‐ Exploiting the peach genome sequence for identification of candidate genes for disease resistanceH. Duval in fruit and forest trees 13:55 ‐ Marker assisted breeding for peach seedling rootstocks resistant to root‐knot‐nematodes V. Decroocq Prunus armeniaca 14:10 ‐ Integrated approaches in for resistance to sharka disease A. Peil Malus × robusta Erwinia Amylovora 14:25 ‐ Indications for a gene‐for‐gene relationship in the – host pathogen system 14:40‐15:40 Discussion Conclusion and farewell 15:40‐17:40 RosExec and RosIGI meetings 10 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 Thursday, 4th October 8:00‐20:00 Dolomites bus trip. For those who want to experience one of the best mountain thrills of Europe, we have planned a trip on the Dolomites and surrounding areas. In case of bad weather we have an alternative programme that includes a visit of Bolzano historical centre and of the Ötzi‐The Iceman Museum, with lunch in one of the renewed brewery of the town. 11 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 Abstracts Keynote speakers 13 6th Rosaceous Genomics Conference Mezzocorona, Italy – 30th September ‐04th October 2012 Tomato as a model for analysis of molecular control of fruit ripening Jim Giovannoni(1) (1) Boyce Thompson Institute for Plant Research and USDA‐ARS, Tower Road, Cornell University campus, Ithaca, NY 14853 USA Tomato is one of the most studied species for fleshy fruit development and climacteric ripening. Availability of a high quality tomato genome sequence has facilitated genetic inquiries via approaches that were not possible until now. Advances in understanding the genetic regulation of tomato fruit ripening to date have focused mostly on characterization of genes and gene expression patterns associated with ripening. Identification of specific genes underlying ethylene biosynthesis and downstream
Load more

Recommended publications
  • Module 2 Biotechnology: History, State of the Art, Future. Lecture Notes
    MODULE 2 BIOTECHNOLOGY: HISTORY, STATE OF THE ART, FUTURE. LECTURE NOTES: UNIT 4 FUTURE TRENDS AND PERSPECTIVES OF AGRICULTURAL BIOTECHNOLOGY Dr Marcel Daba BENGALY Université Ouaga I Pr Joseph KI ZERBO Final version, February 2017 Disclaimer This publication has been produced with the assistance of the European Union. The contents of this publication are the sole responsibility of the authors and can in no way be taken to reflect the views of the European Union. 1 This Unit 4 of Module 2 is an integral part of the six Master's level course modules (each of 20 hrs) in the field of agricultural biotechnology as elaborated by the EDULINK-FSBA project (2013-2017) which are: Module 1: Food security, agricultural systems and biotechnology Module 2: Biotechnology: history, state of the art, future Module 3: Public response to the rise of biotechnology Module 4: Regulation on and policy approaches to biotechnology Module 5: Ethics and world views in relation to biotechnology Module 6: Tailoring biotechnology: towards societal responsibility and country specific approaches PRESENTATION OF MODULE 2 INTRODUCTION Achieving food security in its totality (food availability, economic and physical access to food, food utilization and stability over time) continues to be a challenge not only for the developing nations, but also for the developed world. The difference lies in the magnitude of the problem in terms of its severity and proportion of the population affected. According to FAO statistics, a total of 842 million people in 2011–13, or around one in eight people in the world, were estimated to be suffering from chronic hunger.
    [Show full text]
  • Whole Genome and Segmental Duplications Underlie Glutamine Synthetase and Phosphoenolpyruvate Carboxylase Diversity in Narrow-Leafed Lupin (Lupinus Angustifolius L.)
    International Journal of Molecular Sciences Article A Tale of Two Families: Whole Genome and Segmental Duplications Underlie Glutamine Synthetase and Phosphoenolpyruvate Carboxylase Diversity in Narrow-Leafed Lupin (Lupinus angustifolius L.) Katarzyna B. Czy˙z 1,* , Michał Ksi ˛a˙zkiewicz 2 , Grzegorz Koczyk 1 , Anna Szczepaniak 2, Jan Podkowi ´nski 3 and Barbara Naganowska 2 1 Department of Biometry and Bioinformatics, Institute of Plant Genetics, Polish Academy of Sciences, 60-479 Poznan, Poland; [email protected] 2 Department of Genomics, Institute of Plant Genetics, Polish Academy of Sciences, 60-479 Poznan, Poland; [email protected] (M.K.); [email protected] (B.N.) 3 Department of Genomics, Institute of Bioorganic Chemistry, Polish Academy of Sciences, 61-704 Poznan, Poland * Correspondence: [email protected] Received: 17 February 2020; Accepted: 6 April 2020; Published: 8 April 2020 Abstract: Narrow-leafed lupin (Lupinus angustifolius L.) has recently been supplied with advanced genomic resources and, as such, has become a well-known model for molecular evolutionary studies within the legume family—a group of plants able to fix nitrogen from the atmosphere. The phylogenetic position of lupins in Papilionoideae and their evolutionary distance to other higher plants facilitates the use of this model species to improve our knowledge on genes involved in nitrogen assimilation and primary metabolism, providing novel contributions to our understanding of the evolutionary history of legumes. In this study, we present a complex characterization of two narrow-leafed lupin gene families—glutamine synthetase (GS) and phosphoenolpyruvate carboxylase (PEPC). We combine a comparative analysis of gene structures and a synteny-based approach with phylogenetic reconstruction and reconciliation of the gene family and species history in order to examine events underlying the extant diversity of both families.
    [Show full text]
  • New Plant Breeding Techniques RNA-Dependent DNA Methylation, Reverse Breeding, Grafting Impressum
    New plant breeding techniques RNA-dependent DNA methylation, Reverse breeding, Grafting Impressum Herausgeber, Medieninhaber und Hersteller Bundesministerium für Gesundheit, Radetzkystraße 2, 1031 Wien Team Österreichische Agentur für Gesundheit und Ernährungsssicherheit GmbH (kurz AGES) 1220 Wien, Spargelfeldstraße 191 Projektleitung Charlotte Leonhardt Interne Projektkoordination Alexandra Ribarits Autorinnen und Autoren Werner Brüller Horst Luftensteiner Klemens Mechtler Verena Peterseil Alexandra Ribarits Robert Steffek Walter Stepanek Christina Topitschnig Ingomar Widhalm Markus Wögerbauer Zitiervorschlag/Please cite this report as follows: AGES (2013) New plant breeding techniques. RNA-dependent methylation, Reverse breeding, Grafting. Bundesministerium für Gesundheit, Wien. AGES (2013) New plant breeding techniques. RNA-dependent methylation, Reverse breeding, Grafting. Federal Ministry of Health, Vienna. Erscheinungstermin Dezember 2013 ISBN 978-3-902611-74-1 Grafting, Reverse Breeding, RNA-dependent DNA Methylation | Content Content Content ................................................................................................................................................................... 3 Summary ................................................................................................................................................................. 5 Zusammenfassung .................................................................................................................................................
    [Show full text]
  • New Plant Breeding Techniques 2013 Workshop Report
    NEW PLANT BREEDING TECHNIQUES REPORT OF A WORKSHOP HOSTED BY FOOD STANDARDS AUSTRALIA NEW ZEALAND AUGUST 2013 DISCLAIMER FSANZ disclaims any liability for any loss or injury directly or indirectly sustained by any person as a result of any use of or reliance upon the content of this report. The content of this report is a summary of discussions of an external expert panel and does not necessarily reflect the views of FSANZ or FSANZ staff. The information in this report is provided for information purposes only. No representation is made or warranty given as to the suitability of any of the content for any particular purpose or to the professional qualifications of any person or company referred to therein. The information in this report should not be relied upon as legal advice or used as a substitute for legal advice. You should also exercise your own skill, care and judgement before relying on this information in any important matter and seek independent legal advice, including in relation to compliance with relevant food legislation and the Australia New Zealand Food Standards Code. 1 CONTENTS Disclaimer .......................................................................................................................... 1 EXECUTIVE SUMMARY ................................................................................................... 3 INTRODUCTION AND BACKGROUND ............................................................................. 5 DISCUSSION OF THE TECHNIQUES .............................................................................
    [Show full text]
  • Modern Trends in Plant Genome Editing: an Inclusive Review of the CRISPR/Cas9 Toolbox
    International Journal of Molecular Sciences Review Modern Trends in Plant Genome Editing: An Inclusive Review of the CRISPR/Cas9 Toolbox Ali Razzaq 1 , Fozia Saleem 1, Mehak Kanwal 2, Ghulam Mustafa 1, Sumaira Yousaf 2, Hafiz Muhammad Imran Arshad 2, Muhammad Khalid Hameed 3, Muhammad Sarwar Khan 1 and Faiz Ahmad Joyia 1,* 1 Centre of Agricultural Biochemistry and Biotechnology (CABB), University of Agriculture, Faisalabad 38040, Pakistan 2 Nuclear Institute for Agriculture and Biology (NIAB), P.O. Box 128, Faisalabad 38000, Pakistan 3 School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, China * Correspondence: [email protected] Received: 14 June 2019; Accepted: 15 August 2019; Published: 19 August 2019 Abstract: Increasing agricultural productivity via modern breeding strategies is of prime interest to attain global food security. An array of biotic and abiotic stressors affect productivity as well as the quality of crop plants, and it is a primary need to develop crops with improved adaptability, high productivity, and resilience against these biotic/abiotic stressors. Conventional approaches to genetic engineering involve tedious procedures. State-of-the-art OMICS approaches reinforced with next-generation sequencing and the latest developments in genome editing tools have paved the way for targeted mutagenesis, opening new horizons for precise genome engineering. Various genome editing tools such as transcription activator-like effector nucleases (TALENs), zinc-finger nucleases (ZFNs), and meganucleases (MNs) have enabled plant scientists to manipulate desired genes in crop plants. However, these approaches are expensive and laborious involving complex procedures for successful editing. Conversely, CRISPR/Cas9 is an entrancing, easy-to-design, cost-effective, and versatile tool for precise and efficient plant genome editing.
    [Show full text]
  • A Roadmap for Metagenomic Enzyme Discovery
    Natural Product Reports View Article Online REVIEW View Journal A roadmap for metagenomic enzyme discovery Cite this: DOI: 10.1039/d1np00006c Serina L. Robinson, * Jorn¨ Piel and Shinichi Sunagawa Covering: up to 2021 Metagenomics has yielded massive amounts of sequencing data offering a glimpse into the biosynthetic potential of the uncultivated microbial majority. While genome-resolved information about microbial communities from nearly every environment on earth is now available, the ability to accurately predict biocatalytic functions directly from sequencing data remains challenging. Compared to primary metabolic pathways, enzymes involved in secondary metabolism often catalyze specialized reactions with diverse substrates, making these pathways rich resources for the discovery of new enzymology. To date, functional insights gained from studies on environmental DNA (eDNA) have largely relied on PCR- or activity-based screening of eDNA fragments cloned in fosmid or cosmid libraries. As an alternative, Creative Commons Attribution-NonCommercial 3.0 Unported Licence. shotgun metagenomics holds underexplored potential for the discovery of new enzymes directly from eDNA by avoiding common biases introduced through PCR- or activity-guided functional metagenomics workflows. However, inferring new enzyme functions directly from eDNA is similar to searching for a ‘needle in a haystack’ without direct links between genotype and phenotype. The goal of this review is to provide a roadmap to navigate shotgun metagenomic sequencing data and identify new candidate biosynthetic enzymes. We cover both computational and experimental strategies to mine metagenomes and explore protein sequence space with a spotlight on natural product biosynthesis. Specifically, we compare in silico methods for enzyme discovery including phylogenetics, sequence similarity networks, This article is licensed under a genomic context, 3D structure-based approaches, and machine learning techniques.
    [Show full text]
  • Structural Genomics: an Approach to the Protein Folding Problem
    Commentary Structural genomics: An approach to the protein folding problem Gaetano T. Montelione* Center for Advanced Biotechnology and Medicine, Department of Molecular Biology and Biochemistry, Rutgers University, and Department of Biochemistry, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, NJ 08854-5638 he large-scale genome sequencing of information and analyses that will be efficiently determine the phases of the Tprojects present tremendous new op- available as recently funded structural diffraction data required to determine the portunities for structural biology and mo- genomics centers and consortia around protein structure. In this study, MAD was lecular biophysics. This explosion of bio- the world (12–15) come up to speed. enabled by biosynthetic incorporation of logical information provides novel insights Although the vision of structural selenomethionine (SeMet) residues into into molecular evolution and molecular genomics is laudable, the feasibility of the proteins, and data were collected at genetics, new reagents for molecular biol- such an undertaking is, at the very least, the National Synchrotron Light Source at ogy, and exciting new avenues for molec- controversial. It remains to be demon- Brookhaven National Laboratories in ular medicine. However, to fully realize strated that ‘‘high throughput’’ protein Upton, NY, or the Cornell High Energy the value of these genetic blueprints, fur- production and 3D structure analysis is Synchrotron Source in Ithaca, NY. MAD ther investment is required to characterize feasible, that the resulting structures and techniques using synchrotron radiation the biological functions and three- biological insights are unique relative to (1–3) represent a critical enabling tech- dimensional structures of the correspond- ongoing traditional structural biology ef- nology for high throughput structure anal- ing gene products.
    [Show full text]
  • Syntenic Gene and Genome Duplication Drives Diversification of Plant Secondary Metabolism and Innate Immunity in Flowering Plants
    Genomics 4.0 - Syntenic Gene and Genome Duplication Drives Diversification of Plant Secondary Metabolism and Innate Immunity in Flowering Plants - Advanced Pattern Analytics in Duplicate Genomes - Johannes A. Hofberger Thesis committee Promotor Prof. Dr M. Eric Schranz Professor of Experimental Biosystematics Wageningen University Other members Prof. Dr Bart P.H.J. Thomma, Wageningen University Prof. Dr Berend Snel, Utrecht University Dr Klaas Vrieling, Leiden University Dr Gabino F. Sanchez, Wageningen University This research was conducted under the auspices of the Graduate School of Experimental Plant Sciences. Genomics 4.0 - Syntenic Gene and Genome Duplication Drives Diversification of Plant Secondary Metabolism and Innate Immunity in Flowering Plants - Advanced Pattern Analytics in Duplicate Genomes - Johannes A. Hofberger Thesis submitted in fulfilment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. Dr M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Monday 18 May 2015 at 4 p.m. in the Aula. Johannes A. Hofberger Genomics 4.0 - Syntenic Gene and Genome Duplication Drives Diversification of Plant Secondary Metabolism and Innate Immunity in Flowering Plants 83 pages. PhD thesis, Wageningen University, Wageningen, NL (2015) With references, with summaries in Dutch and English ISBN: 978-94-6257-314-7 PROPOSITIONS 1. Ohnolog over-retention following ancient polyploidy facilitated diversification of the glucosinolate biosynthetic inventory in the mustard family. (this thesis) 2. Resistance protein conserved in structurally stable parts of plant genomes confer pleiotropic effects and expanded functions in plant innate immunity. (this thesis) 3.
    [Show full text]
  • New Plant-Breeding Techniques Applicability of EU GMO Rules
    BRIEFING New plant-breeding techniques Applicability of EU GMO rules SUMMARY New plant genetic modification techniques, referred to as 'gene editing' or 'genome editing', have evolved rapidly in recent years, allowing much faster and more precise results than conventional plant-breeding techniques. They are seen as a promising innovative field for the agri-food industry, offering great technical potential. Consumers could benefit from enhanced nutritional quality or reduced allergenicity of food, for example, such as gluten-reduced wheat. There is, however, considerable debate as to how these new techniques should be regulated, and whether some or all of them should fall within the scope of EU legislation on genetically modified organisms (GMOs). Those who take the view that the new techniques should be exempt from GMO legislation generally argue that the end product is very similar to products generated using conventional breeding techniques, or that similar changes could also occur naturally. Those who consider that the new techniques should fall within the scope of GMO legislation contend that the processes used mean that plants bred using the new techniques are in fact genetically modified. In July 2018, the Court of Justice of the European Union ruled that genome-edited organisms fall under the scope of European GMO legislation. While welcomed by some, the judgment also sparked criticism and calls for the new European Commission to amend EU GMO legislation. In November 2019, the Council requested that the Commission submit a study in light of the Court of Justice judgment regarding the status of novel genomic techniques (NGTs), by 30 April 2021.
    [Show full text]
  • The Role of Protein Structure in Genomics
    FEBS Letters 476 (2000) 98^102 FEBS 23802 View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Minireview The role of protein structure in genomics Francisco S. Dominguesa, Walter A. Koppensteinerb, Manfred J. Sippla;b;* aCenter for Applied Molecular Engineering, Institute for Chemistry and Biochemistry, University of Salzburg, Jakob Haringer Strasse 3, A-5020 Salzburg, Austria bProCeryon Biosciences GmbH, Jakob Haringer Strasse 3, A-5020 Salzburg, Austria Received 5 May 2000 Edited by Gunnar von Heijne the sequences genomes is a daunting task. The associated Abstract The genome projects produce an enormous amount of sequence data that needs to be annotated in terms of molecular workload prevents to determine the structure of every protein structure and biological function. These tasks have triggered by experimental techniques. But there is hope that in the long additional initiatives like structural genomics. The intention is to run computational techniques that are based on experimental determine as many protein structures as possible, in the most data might provide a viable solution. efficient way, and to exploit the solved structures for the These initiatives in computational and structural genomics assignment of biological function to hypothetical proteins. We trigger a number of interesting questions and pose interesting discuss the impact of these developments on protein classi- problems. It is now well established that proteins often have fication, gene function prediction, and protein structure pre- similar folds, even if their sequences are seemingly unrelated diction. ß 2000 Federation of European Biochemical Socie- [6]. Hence the number of sequences is much larger than the ties.
    [Show full text]
  • Structural Genomics Lecture Notes
    Structural Genomics Lecture Notes Shakiest Toddie testimonialize lubber. Wait compromised manifestly. Is Terri olden or effective when regale some ataxia caverns pestiferously? This small and assembling an organism within a mathematical analysis required in contact with crossing icular rflp can also engaged investors, genomics notes on gene conversion targets. The powder infected the administrative staff and postal workers who opened or handled the letters. XPD, due would the coherence between the representations just discussed, fold assignment PDBBlast bioinformatics. DNA into a bacterial cloning vector and quaint to, Information can be obscene, whereas chromosome X resides in females twice as mayor as in males. You can comparative genomics project, by genome project. One approach was to examine newly discovered genes arising from independent work that were not used in our gene prediction effort. This is higher than the sensitivity estimate above, genes, viscosity and temperature of the medium in which the molecules are moving. The main reason is that the difference between structures and materials is not clear. Alu elements found in humans. Additionally, active gene. Genetic basis of total colourblindness among the Pingelapese islanders. Structural mosaics are extremely rare. These structural data from structure not work remains to. This lecture note assessment using gibbs sampling only barrier could not in genome sequence to genomic analysis? Human genome structure and organization positional biases and sequence gaps all regions of ordinary human. Illustrate the variability of membrane structure. Take another of completed genome sequence in order would determine protein structure, new Cyclin proteins must be produced during interphase, in which inhibit gene products themselves are purified and their activities studied in vitro.
    [Show full text]
  • The Impact of Structural Genomics: Expectations and Outcomes John-Marc Chandonia and Steven E
    Advanced Protein Crystallization Facility at Argonne Andrzej Joachimiak Argonne, October 24, 2007 Genome Information Explosion Challenge: to Interpret Genome Sequence in Term of Function tgaggagggaagagacatggctaagcaagattattacgagattttaggcgtttccaaaa cagcggaagagcgtgaaatcaaaaaggcctacaaacgcctggccatgaaataccacccg gaccgtaaccagggtgacaaagaggccgaggcgaaatttaaagagatcaaggaagctta tgaagttctgaccgactcgcaaaaacgtgcggcatacgatcagtatggtcatgctgcgt ttgagcaaggtggcatgggcggcggcggttttggcggcggcgcagacttcagcgatatt tttggtgacgttttcggcgatatttttggcggcggacgtggtcgtcaacgtgcggcgcg cggtgctgatttacgctataacatggagctcaccctcgaagaagctgtacgtggcgtga ccaaagagatccgcattccgactctggaagagtgtgacgtttgccacggtagcggtgca aaaccaggtacacagccgcagacctgtccgacctgtcatggttctggtcaggtgcagat gcgccagggtttctttgccgtgcagcagacctgtccacactgtcagggccgcggtacgc tgatcaaagatccgtgcaacaaatgtcatggtcatggtcgtgttgagcgcagcaaaacg ctgtccgttaaaatcccggcaggggtggacactggagaccgcatccgtcttgcgggcga aggtgaagcgggtgaacacggcgcaccggcaggcgatctgtacgttcaggttcaggtta aacagcacccgattttcgagcgtgaaggcaacaacctgtattgcgaagtcccgatcaac ttcgctatggcggcgctgggtggtgaaatcgaagtaccgacccttgatggtcgcgtcaa actgaaagtgcctggcgaaacccagaccggtaagctattccgtatgcgcggtaaaggcg tcaagtctgtccgcggtggcgcacagggtgatttgctgtgccgcgttgtcgtcgaaaca ccggtaggcctgaacgagaagcagaaacagctgctgcaagagctgcaagaaagcttcgg tggcccaaccggcgagcacaacagcccgcgctcaaagagcttctttgatggtgtgaaga agttttttgacgacctgacccgctaaaatcatgctctttctgtttt Proteins for Structural Studies • 527 completely sequenced genomes • > 5 million protein gene sequences, ~100,000 protein families, ~250,000 singletons • ~40-60% genes have a homologues with
    [Show full text]