Number 5 May 2012

VolumeVolume 16 1 -- NumberNumber 51 May -May Sept 2012ember 1997

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles ("cards") on genes, leukaemias, solid tumours, cancer-prone diseases, more traditional review articles on these and also on surrounding topics ("deep insights"), case reports in hematology, and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Louis Dallaire (Montreal, Canada) Education Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL AT INIST-CNRS

Volume 16, Number 5, May 2012

Table of contents

Gene Section

AMBN (ameloblastin (enamel matrix protein)) 325 Marina Gonçalves Diniz, Ricardo Santiago Gomez, Carolina Cavalieri Gomes, André Luiz Sena Guimarães BCAR1 (breast cancer anti-estrogen resistance 1) 328 Allison Berrier CEP57 (centrosomal protein 57kDa) 335 Sandra Hanks, Katie Snape, Nazneen Rahman CLDN10 (claudin 10) 338 Madhu Lal-Nag GATA3 (GATA binding protein 3) 341 Mathieu Tremblay, Maxime Bouchard HTRA2 (HtrA serine peptidase 2) 347 Miroslaw Jarzab, Dorota Zurawa-Janicka, Barbara Lipinska MIR196B (microRNA 196b) 357 Deepak Kaul, Deepti Malik PRLR (prolactin receptor) 361 Chon-Hwa Tsai-Morris, Maria L Dufau

Leukaemia Section t(3;11)(p25;p15) 366 Jean-Loup Huret

Solid Tumour Section

Bone: Aneurysmal bone cysts 368 Jean-Loup Huret Bone: t(16;17)(q22;p13) in aneurysmal bone cyst 372 Jean-Loup Huret Bone: t(17;17)(p13;q21) in aneurysmal bone cyst 374 Jean-Loup Huret

Cancer Prone Disease Section

Mosaic variegated aneuploidy syndrome 376 Sandra Hanks, Katie Snape, Nazneen Rahman Atlast(11;14)(q 13;q32)of Genetics in multiple myeloma and Cytogenetics Huret JL, Laï JL in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Deep Insight Section

Chromothripsis: a new molecular mechanism in cancer development 380 Jian-Min Chen, Claude Férec, David N Cooper

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Short Communication

AMBN (ameloblastin (enamel matrix protein)) Marina Gonçalves Diniz, Ricardo Santiago Gomez, Carolina Cavalieri Gomes, André Luiz Sena Guimarães Department of Oral Surgery and Pathology, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Belo Horizonte-MG CEP 31270, Brazil (MGD, RSG), Department of Pathology, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Belo Horizonte-MG CEP 31270, Brazil (CCG), Department of Dentistry, Universidade Estadual de Montes Claros, Montes Claros, Brazil (ALSG)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/AMBNID51161ch4q13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI AMBNID51161ch4q13.txt

Identity Transcription HGNC (Hugo): AMBN Alternatively spliced. Exon 6 can be excluded by the use of an alternative splice site (Macdougall et Location: 4q13.3 al., 2000). There are 2 validated alternative Local order: AMBN is between the sequence polyadenylation sites. tagged site markers D4S409 and D4S1558 (Karrman et al., 1997). Protein DNA/RNA Description The predicted protein has 447 aa (48,3 kDa). There Note are 3 protein isoforms. The human precursor The putative start codon location and exon-intron protein contains a phosphorylation site for tyrosine sizes differs among reports in literature. kinase, a SH3 binding region, an O-linked Description glycosylation, and a heparin binding domain 13 exons and 12 introns (Toyosawa et al., 2000; (Kobayashi et al., 2007; Krebsbach et al., 1996; Macdougall et al., 2000) encompassing Yamakoshi et al., 2001; Sonoda et al., 2009). approximately 15005 bp. Ameloblastin is cleaved after secretion into several Until 2011, 44 SNP were described (NCBI dbSNP). lower-molecular-mass proteins that are developmentally expressed (Ravindranath et al., 2007).

The genomic organization of the human ameloblastin gene according to Mardh et al., 2001. The map is drawn to scale. Filled boxes represent exons and the thin lines indicate introns. Sequencing of AMBN intron 11 revealed an interrupted dinucleotide repeat (CA)n.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 325

AMBN (ameloblastin (enamel matrix protein)) Diniz MG, et al.

Expression Amelogenesis imperfecta Tomes processes of secretory ameloblasts Disease (Krebsbach et al., 1996; Cerny et al., 1996; Fong et Amelogenesis imperfect is a common group of al., 1996), odontoblasts and pre-odontoblasts (Fong inherited defects such as hypoplastic or et al., 1996; Nagano et al., 2003). Outer enamel, hypomineralized enamel. Autosomal dominant, and sheath space between rod and interrod enamel autosomal recessive, and X-linked forms of (Uchida et al., 1995; Macdougall et al., 2000). amelogenesis imperfect are recognized. Early bone and cartilage extracellular matrices Oncogenesis during embryogenesis (Spahr et al., 2006). Amelogenin and ameloblastin have an impaired Localisation secretion in ameloblasts of phenocopies human X- Extracellular matrix. linked amelogenesis imperfect mice, which results in severe enamel bio-mineralization defects, loss of Function ameloblast phenotype, increased ameloblast Tooth enamel biomineralization (Uchida et al., apoptosis, and formation of multi-cellular masses 1997). Interactions between the ameloblasts and the (Barron et al., 2010). AMBN mutations in the enamel extracellular matrix (Fukumoto et al., coding region or splice sites were discarted to be 2004). Dental epithelium cell adhesion (Sonoda et responsible for autosomal dominant amelogenesis al., 2009). Early bone formation and repair (Iizuza imperfecta (Mardh et al., 2001). et al., 2011; Tamburstuen et al., 2011). Homology References Pig (sheathlin), cattle, rat, and mouse AMBN Uchida T, Fukae M, Tanabe T, Yamakoshi Y, Satoda T, Murakami C, et al.. Immunochemical and sequences showed a high amino acid sequence immunocytochemical study of a 15 kDa non-amelogenin similarity. and related proteins in the porcine immature enamel: proposal of a new group of enamel proteins sheath Mutations proteins. Biomed Res. 1995; 16:131-140. Cerny R, Slaby I, Hammarstrom L, Wurtz T.. A novel gene Somatic expressed in rat ameloblasts codes for proteins with cell binding domains. J Bone Miner Res. 1996 Jul;11(7):883- AMBN gene mutations have been observed in 91. several epithelial odontogenic tumor entities: unicystic ameloblastoma, solid ameloblastoma, Fong CD, Slaby I, Hammarstrom L.. Amelin: an enamel- related protein, transcribed in the cells of epithelial root adenomatoid odontogenic tumor, squamous sheath. J Bone Miner Res. 1996 Jul;11(7):892-8. odontogenic tumor, and calcifying epithelial odontogenic tumor (Toyosawa et al., 2000; Krebsbach PH, Lee SK, Matsuki Y, Kozak CA, Yamada KM, Yamada Y.. Full-length sequence, localization, and Perdigão et al., 2004; Perdigão et al., 2009). chromosomal mapping of ameloblastin. A novel tooth- specific gene. J Biol Chem. 1996 Feb 23;271(8):4431-5. Implicated in Uchida T, Murakami C, Dohi N, Wakida K, Satoda T, Takahashi O.. Synthesis, secretion, degradation, and fate Odontogenic tumors of ameloblastin during the matrix formation stage of the rat Disease incisor as shown by immunocytochemistry and immunochemistry using region-specific antibodies. J Odontogenic tumours arise from the residues of Histochem Cytochem. 1997 Oct;45(10):1329-40. odontogenic epithelium and/or ectomesenchyme, as MacDougall M, Simmons D, Gu TT, Forsman-Semb K, a result of disturbances in the development of teeth Mardh CK, Mesbah M, Forest N, Krebsbach PH, Yamada and associated structures. Y, Berdal A.. Cloning, characterization and immunolocalization of human ameloblastin. Eur J Oral Sci. Oncogenesis 2000 Aug;108(4):303-10. AMBN gene is mutated in ameloblastomas and others odontogenic tumors (Toyosawa et al., 2000; Takata T, Zhao M, Uchida T, Kudo Y, Sato S, Nikai H.. Immunohistochemical demonstration of an enamel sheath Perdigão et al., 2004; Perdigão et al., 2009). Ambn- protein, sheathlin, in odontogenic tumors. Virchows Arch. null mice develop odontogenic tumors of dental 2000 Apr;436(4):324-9. epithelium origin (Fukumoto et al., 2004). AMBN Toyosawa S, Fujiwara T, Ooshima T, Shintani S, Sato A, expression prevents odontogenic tumor Ogawa Y, Sobue S, Ijuhin N.. Cloning and characterization development by suppressing cell proliferation and of the human ameloblastin gene. Gene. 2000 Oct 3;256(1- maintaining differentiation phenotype through 2):1-11. Msx2, p21, and p27 (Sonoda et al., 2009). The Mardh CK, Backman B, Simmons D, Golovleva I, Gu TT, absence of ameloblastin in epithelial odontogenic Holmgren G, MacDougall M, Forsman-Semb K.. Human tumors has been considered a useful marker for the ameloblastin gene: genomic organization and mutation analysis in amelogenesis imperfecta patients. Eur J Oral functional differentiation of secretory ameloblast Sci. 2001 Feb;109(1):8-13. (Takata et al., 2000).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 326

AMBN (ameloblastin (enamel matrix protein)) Diniz MG, et al.

Yamakoshi Y, Tanabe T, Oida S, Hu CC, Simmer JP, odontogenic tumor. Anticancer Res. 2009 Aug;29(8):3065- Fukae M.. Calcium binding of enamel proteins and their 7. derivatives with emphasis on the calcium-binding domain of porcine sheathlin. Arch Oral Biol. 2001 Sonoda A, Iwamoto T, Nakamura T, Fukumoto E, Nov;46(11):1005-14. Yoshizaki K, Yamada A, Arakaki M, Harada H, Nonaka K, Nakamura S, Yamada Y, Fukumoto S.. Critical role of Nagano T, Oida S, Ando H, Gomi K, Arai T, Fukae M.. heparin binding domains of ameloblastin for dental Relative levels of mRNA encoding enamel proteins in epithelium cell adhesion and ameloblastoma proliferation. enamel organ epithelia and odontoblasts. J Dent Res. J Biol Chem. 2009 Oct 2;284(40):27176-84. Epub 2009 Jul 2003 Dec;82(12):982-6. 31. Fukumoto S, Kiba T, Hall B, Iehara N, Nakamura T, Barron MJ, Brookes SJ, Kirkham J, Shore RC, Hunt C, Longenecker G, Krebsbach PH, Nanci A, Kulkarni AB, Mironov A, Kingswell NJ, Maycock J, Shuttleworth CA, Yamada Y.. Ameloblastin is a cell adhesion molecule Dixon MJ.. A mutation in the mouse Amelx tri-tyrosyl required for maintaining the differentiation state of domain results in impaired secretion of amelogenin and ameloblasts. J Cell Biol. 2004 Dec 6;167(5):973-83. phenocopies human X-linked amelogenesis imperfecta. Hum Mol Genet. 2010 Apr 1;19(7):1230-47. Epub 2010 Perdigao PF, Gomez RS, Pimenta FJ, De Marco L.. Jan 12. Ameloblastin gene (AMBN) mutations associated with epithelial odontogenic tumors. Oral Oncol. 2004 Iizuka S, Kudo Y, Yoshida M, Tsunematsu T, Yoshiko Y, Sep;40(8):841-6. Uchida T, Ogawa I, Miyauchi M, Takata T.. Ameloblastin regulates osteogenic differentiation by inhibiting Src kinase Spahr A, Lyngstadaas SP, Slaby I, Pezeshki G.. via cross talk between integrin beta1 and CD63. Mol Cell Ameloblastin expression during craniofacial bone Biol. 2011 Feb;31(4):783-92. Epub 2010 Dec 13. formation in rats. Eur J Oral Sci. 2006 Dec;114(6):504-11. Tamburstuen MV, Reseland JE, Spahr A, Brookes SJ, Kobayashi K, Yamakoshi Y, Hu JC, Gomi K, Arai T, Fukae Kvalheim G, Slaby I, Snead ML, Lyngstadaas SP.. M, Krebsbach PH, Simmer JP.. Splicing determines the Ameloblastin expression and putative autoregulation in glycosylation state of ameloblastin. J Dent Res. 2007 mesenchymal cells suggest a role in early bone formation Oct;86(10):962-7. and repair. Bone. 2011 Feb;48(2):406-13. Epub 2010 Sep Ravindranath RM, Devarajan A, Uchida T.. Spatiotemporal 18. expression of ameloblastin isoforms during murine tooth development. J Biol Chem. 2007 Dec 14;282(50):36370-6. This article should be referenced as such: Epub 2007 Oct 5. Diniz MG, Gomez RS, Gomes CC, Guimarães ALS. AMBN Perdigao PF, Carvalho VM, DE Marco L, Gomez RS.. (ameloblastin (enamel matrix protein)). Atlas Genet Mutation of ameloblastin gene in calcifying epithelial Cytogenet Oncol Haematol. 2012; 16(5):325-327.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 327

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

BCAR1 (breast cancer anti-estrogen resistance 1) Allison Berrier Department of Oral and Craniofacial Biology, LSUHSC-NO School of Dentistry, 1100 Florida Avenue, Clinical Bldg, Room 8301, New Orleans, LA 70119, USA (AB)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/BCAR1ID761ch16q23.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI BCAR1ID761ch16q23.txt

Identity DNA/RNA Other names: CAS, CAS1, CASS1, CRKAS, See figure 1 below. FLJ12176, FLJ45059, P130Cas HGNC (Hugo): BCAR1 Location: 16q23.1

Figure 1.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 328

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

proline-rich PxxP ligands. The adjacent region 66- Protein 447 aa contains the substrate domain (SD) Note comprised of 15 YxxP motifs that when BCAR1 isoforms phosphorylated by tyrosine kinases provides Isoform 1: 916 aa, calc MW= 97,7 kDa. Isoform 2: canonical binding sites for proteins containing SH2 888 aa, (alternate 5' sequence compared to variant domains such as Crk, mechanical forces and 1) calc MW= 95,1 kDa. Isoform 3: 888 aa, stretching of SD may induce conformational (alternate 5' sequence compared to variant 1) calc changes that allows phosphorylation by kinases and MW= 95,3 kDa. Isoform 4: 888 aa, (alternate 5' this stretching may promote protein-protein sequence and alternate splice site in the substrate interactions in this domain (Sawada et al., 2006). domain compared to variant 1 resulting in a The serine rich domain within 448-610 aa (serine different N-terminus and additional segment in the rich protein interaction domain) contains a four- middle region compared to isoform 1) calc MW= helix bundle that functions as a scaffold for BCAR1 95,3 kDa. Isoform 5: 870 aa, (lacks an exon in the binding proteins such as Grb2 and 14-3-3 5' region, alternate AUG start codon, has a different (Nasertorabi et al., 2004; Briknarová et al., 2005). N-terminus compared to isoform 1) calc MW= The C-terminal domain of 746-870 aa has a 93,16 kDa. Isoform 6: 870 aa, (different N-terminus potential FAT (focal adhesion targeting) domain compared to isoform 1) calc MW= 93,2 kDa. and a helix-loop-helix domain with homology to Isoform 7, 868 aa (shorter, alternate 5' sequence, the transcription factor Id. different N-terminus compared to isoform 1) calc This region contains the YDYVHL motif that is MW= 93 kDa. Isoform 8, 722 aa, (alternate internal phosphorylated during cell adhesion. sequence compared to isoform 1, different N- BCAR1 interacting proteins (BioGRID) terminus compared to isoform 1) calc MW= 77,6 CRKII, p60-Src, PTPN12, PTK2 (FAK), RapGEF1 kDa. Isoform 9: 660 aa, (shorter alternate 5' (C3G), NPHP1, PTPN1 (PTP1B), FES, SHIP2 sequence, different N-terminus compared to (INPPL1), ARHGAP32 (p250GAP), Pyk2 isoform 1) calc MW= 70,7 kDa. (PTK2B), Fyn, CRKL, YWHAZ, SrcIN1 (SNIP), BCAR proteins migrate during SDS-PAGE p85-alpha (PI3KR1), c-ABL (bcr/abl), Lyn, Grb2, electrophoresis at a significantly higher molecular Dock1, paxillin, TRIP6, SH-PTP2, ID2A, UHRF2, weight than predicted from sequence analysis NEDD9, NCK1, VCL, SAP1, Zyxin, BCAR3 perhaps due to the extensive phosphorylation of (AND-34), CD2AP, LCK, SFN, SH2D3C, BCAR proteins. Calculated MW 93,2 kDa, SDS- JNK/SAPK1, SH3KBP1, tensin 1 (TNS1), HCK, PAGE observed MW 130 kDa. Potential sites of EFS, E2F2, VPS11, HspA5, TUBA1A, GADD34, human BCAR1 phosphorylation (PhosphoSitePlus): p140Cap, BCAR1 (p130CAS), PTP-PEST, CIZ, tyrosine residues aa 12, 128, 165, 192, 222, 224, Aurora-A, 14-3-3, CHAT-H, AIP4, APC/C and 234, 249, 267, 287, 306, 327, 362, 372, 387, 410, CDH1. 653, 664, 666; serine residues aa 134, 139, 292, Expression 437, 639; and threonine residues aa 269, 326, 385. BCAR1 is ubiquitously expressed and is reportedly Inducers of BCAR1 phosphorylation include cell detectable in all phases of the cell cycle. In matrix adhesion, extracellular matrix rigidity, lymphoid development, BCAR is expressed at growth factors, hormones and progression through higher levels in differentiated cells compared to the cell cycle. Phosphorylation of BCAR1 regulates precursors. Barrett's esophagus cancer cell line BCAR1 dependent activities through altering compared to normal tissue 2,51 increase in BCAR1 protein interactions, protein localization and expression (Oncomine). Colorectal cancer signaling cascades (Tikhmyanova et al., 2010). Ramaswamy multi-cancer there is a 4,2 fold Description increase in BCAR1 expression compared to other BCAR1 domains as described in Tikhmyanova et cancers (Oncomine). Gastric cancer cell line al., 2010 are shown in the schematic diagram in Gyorffy cell line 2 there is a 5,0 fold reduction in figure 2. The amino terminal 1-65 aa contain the BCAR 1 expression (Oncomine). In lymphomas, Src homology 3 domain (SH3) domain that binds BCAR1 expression is reduced 2,5 fold (Oncomine).

Figure 2. Schematic diagram containing BCAR1 protein domains.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 329

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

Localisation It was also identified as a protein that is tyrosine phosphorylated after clustering integrin β1 in T- Cytoplasm, ruffles, cell junctions (Donaldson et al., lymphocytes. NEDD9 (neural precursor cell 2000), nucleus (Kim et al., 2004) and focal expressed, developmentally down-regulated 9) is a adhesions (Nakamoto et al., 1997; Volberg et al., gene restricted in expression to early embryonic, 1995; Winograd-Katz et al., 2009). but not adult mouse brain. Function The fourth family member is CASS4 ((HEF-EFS- BCAR1 regulates numerous cellular processes such P130CAS-like)/CAS4) that maps to chromosome as invasion, migration, transformation, survival and 20q13.2-q13.31 and is the newest member of the drug resistance (Di Stefano et al., 2011; Brábek et family that was identified by genomic and al., 2004; Brábek et al., 2005) (summarized in transcript homology and demonstrated to function figure 3). BCAR1 lacks intrinsic enzymatic activity, similarly to other BCAR family members. yet it is a substrate for several kinases including the These 4 proteins are conserved from jawed Src tyrosine kinase. vertebrates through mammals. One BCAR member The original name for BCAR1 was p130CAS is found in lower vertebrates and insects. abbreviated from Crk-associated substrate because However, no BCAR family member is detectable in it was first identified as a tyrosine phosphorylated C. elegans, S. cerevisiae and other lower protein in cells transformed by v-src and v-crk eukaryotes. oncogenes. BCAR1 regulates cellular behavior by controlling signaling cascades and the dynamic Mutations localization of multi-protein complexes. The BCAR1 phosphorylation state is regulated during Somatic the cell cycle. During the exit of G2, BCAR1 serine Catalogue of somatic mutations in cancer: there are and threonine phosphorylation levels increase and currently 10 known somatic mutations in BCAR1. these events disrupt the interactions of BCAR1 with Proceeding from the N-terminus to the C-Terminus Src and FAK and thus dissociates this complex and of BCAR1, aa 118 proline (identified in the central contributes to the disassembly of focal adhesions nervous system), 185 alanine (identified in the allowing cells to loosen matrix adhesions and thus central nervous system), 407 threonine (identified permitting cell rounding in mitosis. The subsequent in breast tissue), 430 serine (upper aerodigestive reformation of matrix adhesions promotes tract), 583 serine (identified in prostate tissue), 592 progression through the cell cycle from mitosis to histidine (identified in liver), 708 lysine (identified G1 (Pugacheva et al., 2006). in the central nervous system), 759 threonine Homology (identified in central nervous system), 780 valine (identified in central nervous system), 795 There is a family containing four proteins related to isoleucine (identified in upper aerodigestive tract). BCAR1 (breast cancer resistance) that possess Mutations at aa 118 and 185 are in the substrate names related to the prior nomenclature for BCAR1 domain, 407 and 430 are amino-terminal to the 4 homologs in the rat and mouse. helical bundle, 583 and 592 are in the 4-helix The non-human homologs of BCAR1 were named bundle, whereas 759, 780 and 795 localize to the C- CAS for Crk-associated substrate. terminal domain. This family of proteins includes the protein EFS (embryonal Fyn-associated substrate) (CAS3, Implicated in CASS3, EFS1, EFS2, HEFS, SIN) identified because of interactions with the Src-family kinases Various cancers Fyn and Yes and maps to chromosome 14q11.2- Note q12. Overexpression of BCAR1 is linked to poor A third family member is HEF1 (human enhancer prognosis and increased cancer metastasis in many of filamentation 1 known as CASL, CAS-L, cancers. BCAR1 can be upregulated by gene NEDD9, CAS2 and CASS2) that maps to amplification, transcriptional upregulation and chromosome 6p25-p24 and was isolated as a human changes in protein stability. Hyperphosphorylation gene that promotes filamentous growth in yeast. of BCAR1 drives cell migration, invasion, cell This screen was performed to identify regulators of survival and drug resistance. the cell cycle and polarity.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 330

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

Figure 3. Extracellular cues that control CAR1 phosphorylation and cellular processes that are regulated by BCAR1.

Breast cancer poor prognosis correlate with overexpression of BCAR1 and reductions in E-cadherin and β-catenin Prognosis levels (Guo et al., 2008). In breast cancers that express high levels of BCAR1, the cancer is more likely to relapse and the Nasal polyps tumors frequently have an intrinsic reduced Oncogenesis response to tamoxifen (van der Flier et al., 2000; Nasal polyps can express high levels of BCAR1 Dorssers et al., 2004). (Zhang et al., 2003). Oncogenesis Colorectal cancer Elevated BCAR levels in breast cancers correlates Oncogenesis with increased expression of HER2/neu and Celecoxib cytotoxicity in colorectal cancer is linked enhanced cell proliferation (Cabodi et al., 2006; to cleavage of BCAR1 and apoptosis. Cabodi et al., 2010). BCAR1 overexpression in Overexpression of BCAR1 in colorectal cancer cell breast cancer cells is linked to resistance to the lines is linked to resistance to celecoxib (Casanova cytotoxic agent Adriamycin (Ta et al., 2008). et al., 2006; Weyant et al., 2000). BCAR1 overexpression is sufficient to induce hyperplasia in the mammary pad during Non-small-cell lung cancer (NSCLC) development and pregnancy. Oncogenesis Prostate cancer BCAR1 is not detected in normal lung tissue, however in non-small-cell lung cancer and Oncogenesis tuberculosis and other pulmonary disorders In prostate cancer, BCAR1 expression is higher elevated levels of BCAR1 are observed in both the compared to control tissue and expression of diseased tissue and elevated levels are noted in BCAR1 in prostate cancer correlates with elevated serum (Deng et al., 2011). In patients with NSCLC EGFR expression levels (Fromont et al., 2007; the serum levels of BCAR1 proportionally increase Fromont et al., 2011; Cabodi et al., 2010). with the progression of tumor stage. Interestingly, Hepatocellular carcinoma in patients with elevated serum BCAR1 levels, the Prognosis serum levels of BCAR1 diminish after removal of In hepatocellular carcinoma, tumor invasion and the pulmonary lesion or tumor.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 331

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

Ovarian cancer the bacterium triggers BCAR1 phosphorylation to promote the uptake of the organism in non- Prognosis phagocytic cells (Weidow et al., 2000). S. In ovarian cancer, an increase in BCAR1 typhimurium is an obligate intracellular bacterial expression correlates with poor 5 year survival rates pathogen that requires eukaryotic cellular uptake and reductions in BCAR1 expression result in for infection. These bacteria utilize host eukaryotic reduced tumor growth following docetaxel BCAR1 for efficient bacterial uptake and their chemotherapy (Nick et al., 2011). infectious cycle (Shi et al., 2006). In addition to Oral cancer bacteria, many viruses also utilize the host protein Oncogenesis machinery and BCAR1 for their viral propagation. In oral cancers elevated levels of UPAR are For instance, internalization of adenovirus is indicative of more invasive tumors and enhanced initiated by virus binding to host integrin receptors lymph node metastasis. The levels of UPAR in oral and virus internalization requires BCAR1 cancer correlate with the levels of BCAR1 (Shi et phosphorylation (Li et al., 1998; Li et al., 2000). al., 2011). References Anaplastic large-cell lymphomas Sakai R, Iwamatsu A, Hirano N, Ogawa S, Tanaka T, Oncogenesis Mano H, Yazaki Y, Hirai H. A novel signaling molecule, In anaplastic large-cell lymphomas, the anaplastic p130, forms stable complexes in vivo with v-Crk and v-Src lymphoma kinase (ALK) is frequently translocated in a tyrosine phosphorylation-dependent manner. EMBO J. and a fusion protein with nucleophosmin (NPM)- 1994 Aug 15;13(16):3748-56 ALK is generated that contains kinase activity. Volberg T, Geiger B, Kam Z, Pankov R, Simcha I, NPM-ALK transforms fibroblasts, however in Sabanay H, Coll JL, Adamson E, Ben-Ze'ev A. Focal adhesion formation by F9 embryonal carcinoma cells after BCAR1-/- fibroblasts NPM-ALK fails to induce vinculin gene disruption. J Cell Sci. 1995 Jun;108 ( Pt transformation. Hence, BCAR1 is critical for ALK 6):2253-60 transformation activity (Ambrogio et al., 2005). Vuori K, Ruoslahti E. Tyrosine phosphorylation of p130Cas Chemotherapeutic resistance and cortactin accompanies integrin-mediated cell adhesion to extracellular matrix. J Biol Chem. 1995 Sep Note 22;270(38):22259-62 Overexpression of BCAR1 is linked to drug Burnham MR, Harte MT, Richardson A, Parsons JT, resistance in multiple tumor types such as breast Bouton AH. The identification of p130cas-binding proteins cancer, lung cancers, glioblastoma and melanoma and their role in cellular transformation. Oncogene. 1996 (Ta et al., 2008). BCAR1 and NEDD9 interact with Jun 6;12(11):2467-72 BCAR3 to mediate anti-estrogen resistance and to Harte MT, Hildebrand JD, Burnham MR, Bouton AH, control Rap1 GTPase activation (Cai et al., 2003). Parsons JT. p130Cas, a substrate associated with v-Src In a screen of an estrogen dependent cell line, and v-Crk, localizes to focal adhesions and binds to focal adhesion kinase. J Biol Chem. 1996 Jun 7;271(23):13649- BCAR1 was identified as a gene required for 55 tamoxifen resistance (Brinkman et al., 2000; van Khwaja A, Hallberg B, Warne PH, Downward J. Networks der Flier et al., 2000). of interaction of p120cbl and p130cas with Crk and Grb2 Role of BCAR1 in other pathological adaptor proteins. Oncogene. 1996 Jun 20;12(12):2491-8 conditions or diseases Vuori K, Hirai H, Aizawa S, Ruoslahti E. Introduction of p130cas signaling complex formation upon integrin- Note mediated cell adhesion: a role for Src family kinases. Mol BCAR1 dysfunction is linked to inflammatory Cell Biol. 1996 Jun;16(6):2606-13 disorders, ischemic stroke (Ziemka-Nalecz et al., Astier A, Avraham H, Manie SN, Groopman J, Canty T, 2007; Zalewska et al., 2005) and developmental Avraham S, Freedman AS. The related adhesion focal defects. Knockout of BCAR1 is lethal at embryonic tyrosine kinase is tyrosine-phosphorylated after beta1- integrin stimulation in B cells and binds to p130cas. J Biol stages days 11,5 to 12,5 as a result of Chem. 1997 Jan 3;272(1):228-32 cardiovascular dysfunction (Honda et al., 1998). BCAR1 is critical for the pathology of many Nakamoto T, Sakai R, Honda H, Ogawa S, Ueno H, Suzuki T, Aizawa S, Yazaki Y, Hirai H. Requirements for infectious diseases. The bacterial species Yersinia localization of p130cas to focal adhesions. Mol Cell Biol. encodes and secretes a phosphatase YOP that 1997 Jul;17(7):3884-97 inactivates/dephosphorylates BCAR1 and YOP Honda H, Oda H, Nakamoto T, Honda Z, Sakai R, Suzuki activity minimizes phagocytosis by macrophages T, Saito T, Nakamura K, Nakao K, Ishikawa T, Katsuki M, and neutrophils facilitating Yersinia evasion of Yazaki Y, Hirai H. Cardiovascular anomaly, impaired actin components of the cellular immune response which bundling and resistance to Src-induced transformation in disrupts clearance of the bacteria by the host mice lacking p130Cas. Nat Genet. 1998 Aug;19(4):361-5 (Deleuil et al., 2003; Hamid et al., 1999). In Klemke RL, Leng J, Molander R, Brooks PC, Vuori K, contrast, in epithelial cells, Yersinia uptake is Cheresh DA. CAS/Crk coupling serves as a "molecular switch" for induction of cell migration. J Cell Biol. 1998 Feb associated with phosphorylation of BCAR1, thus 23;140(4):961-72

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 332

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

Li E, Stupack D, Klemke R, Cheresh DA, Nemerow GR. Moespot A, Span PN, Foekens JA, Sweep FC. The Adenovirus endocytosis via alpha(v) integrins requires prognostic value of BCAR1 in patients with primary breast phosphoinositide-3-OH kinase. J Virol. 1998 cancer. Clin Cancer Res. 2004 Sep 15;10(18 Pt 1):6194- Mar;72(3):2055-61 202 Hamid N, Gustavsson A, Andersson K, McGee K, Persson Kim W, Kook S, Kim DJ, Teodorof C, Song WK. The 31- C, Rudd CE, Fällman M. YopH dephosphorylates Cas and kDa caspase-generated cleavage product of p130cas Fyn-binding protein in macrophages. Microb Pathog. 1999 functions as a transcriptional repressor of E2A in apoptotic Oct;27(4):231-42 cells. J Biol Chem. 2004 Feb 27;279(9):8333-42 Brinkman A, van der Flier S, Kok EM, Dorssers LC. Nasertorabi F, Garcia-Guzman M, Briknarová K, Larsen E, BCAR1, a human homologue of the adapter protein Havert ML, Vuori K, Ely KR. Organization of functional p130Cas, and antiestrogen resistance in breast cancer domains in the docking protein p130Cas. Biochem Biophys cells. J Natl Cancer Inst. 2000 Jan 19;92(2):112-20 Res Commun. 2004 Nov 19;324(3):993-8 Donaldson JC, Dempsey PJ, Reddy S, Bouton AH, Coffey Ambrogio C, Voena C, Manazza AD, Piva R, Riera L, RJ, Hanks SK. Crk-associated substrate p130(Cas) Barberis L, Costa C, Tarone G, Defilippi P, Hirsch E, Boeri interacts with nephrocystin and both proteins localize to Erba E, Mohammed S, Jensen ON, Palestro G, Inghirami cell-cell contacts of polarized epithelial cells. Exp Cell Res. G, Chiarle R. p130Cas mediates the transforming 2000 Apr 10;256(1):168-78 properties of the anaplastic lymphoma kinase. Blood. 2005 Dec 1;106(12):3907-16 Gotoh T, Cai D, Tian X, Feig LA, Lerner A. p130Cas regulates the activity of AND-34, a novel Ral, Rap1, and R- Brábek J, Constancio SS, Siesser PF, Shin NY, Pozzi A, Ras guanine nucleotide exchange factor. J Biol Chem. Hanks SK. Crk-associated substrate tyrosine 2000 Sep 29;275(39):30118-23 phosphorylation sites are critical for invasion and metastasis of SRC-transformed cells. Mol Cancer Res. Li E, Stupack DG, Brown SL, Klemke R, Schlaepfer DD, 2005 Jun;3(6):307-15 Nemerow GR. Association of p130CAS with phosphatidylinositol-3-OH kinase mediates adenovirus cell Briknarová K, Nasertorabi F, Havert ML, Eggleston E, Hoyt entry. J Biol Chem. 2000 May 12;275(19):14729-35 DW, Li C, Olson AJ, Vuori K, Ely KR. The serine-rich domain from Crk-associated substrate (p130cas) is a four- Nakamoto T, Yamagata T, Sakai R, Ogawa S, Honda H, helix bundle. J Biol Chem. 2005 Jun 10;280(23):21908-14 Ueno H, Hirano N, Yazaki Y, Hirai H. CIZ, a zinc finger protein that interacts with p130(cas) and activates the Hanks SK, Brabek J.. p130Cas. UCSD Nature Molecule expression of matrix metalloproteinases. Mol Cell Biol. Pages. 2005 Oct 10; Protein A001708. 2000 Mar;20(5):1649-58 Zalewska T, Makarewicz D, Janik B, Ziemka-Nalecz M.. van der Flier S, Brinkman A, Look MP, Kok EM, Meijer-van Neonatal cerebral hypoxia-ischemia: involvement of FAK- Gelder ME, Klijn JG, Dorssers LC, Foekens JA. dependent pathway. Int J Dev Neurosci. 2005 Bcar1/p130Cas protein and primary breast cancer: Nov;23(7):657-62. Epub 2005 Aug 10. prognosis and response to tamoxifen treatment. J Natl Cancer Inst. 2000 Jan 19;92(2):120-7 Cabodi S, Tinnirello A, Di Stefano P, Bisaro B, Ambrosino E, Castellano I, Sapino A, Arisio R, Cavallo F, Forni G, Weidow CL, Black DS, Bliska JB, Bouton AH. CAS/Crk Glukhova M, Silengo L, Altruda F, Turco E, Tarone G, signalling mediates uptake of Yersinia into human Defilippi P.. p130Cas as a new regulator of mammary epithelial cells. Cell Microbiol. 2000 Dec;2(6):549-60 epithelial cell proliferation, survival, and HER2-neu oncogene-dependent breast tumorigenesis. Cancer Res. Weyant MJ, Carothers AM, Bertagnolli ME, Bertagnolli 2006 May 1;66(9):4672-80. MM. Colon cancer chemopreventive drugs modulate integrin-mediated signaling pathways. Clin Cancer Res. Casanova I, Parreno M, Farre L, Guerrero S, Cespedes 2000 Mar;6(3):949-56 MV, Pavon MA, Sancho FJ, Marcuello E, Trias M, Mangues R.. Celecoxib induces anoikis in human colon Yi J, Kloeker S, Jensen CC, Bockholt S, Honda H, Hirai H, carcinoma cells associated with the deregulation of focal Beckerle MC. Members of the Zyxin family of LIM proteins adhesions and nuclear translocation of p130Cas. Int J interact with members of the p130Cas family of signal Cancer. 2006 May 15;118(10):2381-9. transducers. J Biol Chem. 2002 Mar 15;277(11):9580-9 Pugacheva EN, Roegiers F, Golemis EA.. Cai D, Iyer A, Felekkis KN, Near RI, Luo Z, Chernoff J, Interdependence of cell attachment and cell cycle Albanese C, Pestell RG, Lerner A. AND-34/BCAR3, a signaling. Curr Opin Cell Biol. 2006 Oct;18(5):507-15. GDP exchange factor whose overexpression confers Epub 2006 Aug 17. (REVIEW) antiestrogen resistance, activates Rac, PAK1, and the cyclin D1 promoter. Cancer Res. 2003 Oct Sawada Y, Tamada M, Dubin-Thaler BJ, Cherniavskaya 15;63(20):6802-8 O, Sakai R, Tanaka S, Sheetz MP.. Force sensing by mechanical extension of the Src family kinase substrate Deleuil F, Mogemark L, Francis MS, Wolf-Watz H, Fällman p130Cas. Cell. 2006 Dec 1;127(5):1015-26. M. Interaction between the Yersinia protein tyrosine phosphatase YopH and eukaryotic Cas/Fyb is an important Shi J, Casanova JE.. Invasion of host cells by Salmonella virulence mechanism. Cell Microbiol. 2003 Jan;5(1):53-64 typhimurium requires focal adhesion kinase and p130Cas. Mol Biol Cell. 2006 Nov;17(11):4698-708. Epub 2006 Aug Zhang PJ, Weber R, Liang HH, Pasha TL, LiVolsi VA. 16. Growth factors and receptors in juvenile nasopharyngeal angiofibroma and nasal polyps: an immunohistochemical Fromont G, Vallancien G, Validire P, Levillain P, Cussenot study. Arch Pathol Lab Med. 2003 Nov;127(11):1480-4 O.. BCAR1 expression in prostate cancer: association with 16q23 LOH status, tumor progression and EGFR/KAI1 Brábek J, Constancio SS, Shin NY, Pozzi A, Weaver AM, staining. Prostate. 2007 Feb 15;67(3):268-73. Hanks SK. CAS promotes invasiveness of Src-transformed cells. Oncogene. 2004 Sep 23;23(44):7406-15 Van Slambrouck S, Grijelmo C, De Wever O, Bruyneel E, Emami S, Gespach C, Steelant WF.. Activation of the Dorssers LC, Grebenchtchikov N, Brinkman A, Look MP, FAK-src molecular scaffolds and p130Cas-JNK signaling van Broekhoven SP, de Jong D, Peters HA, Portengen H, Meijer-van Gelder ME, Klijn JG, van Tienoven DT, Geurts-

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 333

BCAR1 (breast cancer anti-estrogen resistance 1) Berrier A

cascades by alpha1-integrins during colon cancer cell Di Stefano P, Leal MP, Tornillo G, Bisaro B, Repetto D, invasion. Int J Oncol. 2007 Dec;31(6):1501-8. Pincini A, Santopietro E, Sharma N, Turco E, Cabodi S, Defilippi P.. The adaptor proteins p140CAP and p130CAS Ziemka-Nalecz M, Zalewska T.. Transient forebrain as molecular hubs in cell migration and invasion of cancer ischemia effects FAK-coupled signaling in gerbil cells. Am J Cancer Res. 2011;1(5):663-73. Epub 2011 hippocampus. Neurochem Int. 2007 Nov-Dec;51(6-7):405- May 2. 11. Epub 2007 Apr 22. Fromont G, Cussenot O.. The integrin signalling adaptor Berrier AL, Jones CW, LaFlamme SE.. Tac-beta1 inhibits p130CAS is also a key player in prostate cancer. Nat Rev FAK activation and Src signaling. Biochem Biophys Res Cancer. 2011 Mar;11(3):227. Commun. 2008 Mar 28;368(1):62-7. Epub 2008 Jan 14. Nick AM, Stone RL, Armaiz-Pena G, Ozpolat B, Tekedereli Guo C, Liu QG, Yang W, Zhang ZL, Yao YM.. Relation I, Graybill WS, Landen CN, Villares G, Vivas-Mejia P, among p130Cas, E-cadherin and beta-catenin expression, Bottsford-Miller J, Kim HS, Lee JS, Kim SM, Baggerly KA, clinicopathologic significance and prognosis in human Ram PT, Deavers MT, Coleman RL, Lopez-Berestein G, hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int. Sood AK.. Silencing of p130cas in ovarian carcinoma: a 2008 Oct;7(5):490-6. novel mechanism for tumor cell death. J Natl Cancer Inst. Ta HQ, Thomas KS, Schrecengost RS, Bouton AH.. A 2011 Nov 2;103(21):1596-612. Epub 2011 Sep 28. novel association between p130Cas and resistance to the Eberle KE, Sansing HA, Szaniszlo P, Resto VA, Berrier chemotherapeutic drug adriamycin in human breast cancer AL.. Carcinoma matrix controls resistance to cisplatin cells. Cancer Res. 2008 Nov 1;68(21):8796-804. through talin regulation of NF-kB. PLoS One. Winograd-Katz SE, Itzkovitz S, Kam Z, Geiger B.. 2011;6(6):e21496. Epub 2011 Jun 24. Multiparametric analysis of focal adhesion formation by Shi Z, Liu Y, Johnson JJ, Stack MS.. Urinary-type RNAi-mediated gene knockdown. J Cell Biol. 2009 Aug plasminogen activator receptor (uPAR) modulates oral 10;186(3):423-36. cancer cell behavior with alteration in p130cas. Mol Cell Cabodi S, del Pilar Camacho-Leal M, Di Stefano P, Biochem. 2011 Nov;357(1-2):151-61. Epub 2011 Jun 1. Defilippi P.. Integrin signalling adaptors: not only figurants Sansing HA, Sarkeshik A, Yates JR, Patel V, Gutkind JS, in the cancer story. Nat Rev Cancer. 2010 Dec;10(12):858- Yamada KM, Berrier AL.. Integrin alphabeta1, alphavbeta, 70. Epub 2010 Nov 24. (REVIEW) alpha6beta effectors p130Cas, Src and talin regulate Cabodi S, Tinnirello A, Bisaro B, Tornillo G, del Pilar carcinoma invasion and chemoresistance. Biochem Camacho-Leal M, Forni G, Cojoca R, Iezzi M, Amici A, Biophys Res Commun. 2011 Mar 11;406(2):171-6. Epub Montani M, Eva A, Di Stefano P, Muthuswamy SK, Tarone 2011 Feb 1. G, Turco E, Defilippi P.. p130Cas is an essential Tikhmyanova N, Golemis EA.. NEDD9 and BCAR1 transducer element in ErbB2 transformation. FASEB J. negatively regulate E-cadherin membrane localization, and 2010 Oct;24(10):3796-808. Epub 2010 May 26. promote E-cadherin degradation. PLoS One. Tikhmyanova N, Little JL, Golemis EA.. CAS proteins in 2011;6(7):e22102. Epub 2011 Jul 12. normal and pathological cell growth control. Cell Mol Life Zhao M, Vuori K.. The docking protein p130Cas regulates Sci. 2010 Apr;67(7):1025-48. Epub 2009 Nov 25. cell sensitivity to proteasome inhibition. BMC Biol. 2011 (REVIEW) Oct 28;9:73. Deng B, Huang W, Tan QY, Fan XQ, Jiang YG, Liu L, Zhong YY, Liang YG, Wang RW.. Breast cancer anti- This article should be referenced as such: estrogen resistance protein 1 (BCAR1/p130cas) in Berrier A. BCAR1 (breast cancer anti-estrogen resistance pulmonary disease tissue and serum. Mol Diagn Ther. 1). Atlas Genet Cytogenet Oncol Haematol. 2012; 2011 Feb 1;15(1):31-40. doi: 10.2165/11588850- 16(5):328-334. 000000000-00000.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 334

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Short Communication

CEP57 (centrosomal protein 57kDa) Sandra Hanks, Katie Snape, Nazneen Rahman Institute of Cancer Research, Division of Genetics and Epidemiology, Brookes Lawley Building, 15 Cotswold Road, Sutton, Surrey SM2 5NG, UK (SH, KS, NR)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/CEP57ID43008ch11q21.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CEP57ID43008ch11q21.txt

Identity Expression Ubiquituously expressed. Other names: PIG8, TSP57, Translokin, KIAA0092 Localisation HGNC (Hugo): CEP57 Nucleus, cytoplasm, cytoskeleton, centrosome. Location: 11q21 Function Centrosomal protein required for microtubule DNA/RNA attachment to centrosomes. Also involved in intracellular bidirectional Description trafficking of factors such as FGF2 along CEP57 spans over 42 kb and is composed of 11 microtubules. exons. Homology Protein The CEP57 gene is conserved in chimpanzee, dog, cow, mouse, rat, chicken, and zebrafish. Description 500 amino acids, 57 kDa.

Figure 1. Schematic representation of CEP57 demonstrating the relative exon sizes.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 335

CEP57 (centrosomal protein 57kDa) Hanks S, et al.

Figure 2. Schematic representation of CEP57 demonstrating significant functional or structural domains.

Figure 3. Schematic representation of CEP57 demonstrating the relative exon sizes and positions of known mutations. Biallelic mutations are represented by coloured lines, with mutations in the same individual in matching colours.

Mutations Cytogenetics Germinal MVA is characterised by mosaic aneuploidies, Biallelic, loss-of-function mutations in CEP57 have predominantly trisomies and monosomies, been found in three MVA pedigrees (figure 3). involving multiple different chromosomes and tissues. The proportion of aneuploid cells varies but Implicated in is usually >10% and is substantially greater than in normal individuals. Some patients with MVA also Mosaic variegated aneuploidy demonstrate premature chromatid separation in syndrome (MVA) colchicine-treated blood lymphocyte and fibroblast cultures. Note MVA is a rare recessive condition characterised by Oncogenesis mosaic aneuploidies, predominantly trisomies and The risk of malignancy in MVA is high with Wilms monosomies, involving multiple different tumour, rhabdomyosarcoma, leukaemia and chromosomes and tissues. granulosa cell tumour of the ovary reported in Affected individuals typically present with severe several cases. Myelodysplastic syndrome has also intrauterine growth retardation and microcephaly. been observed. Eye anomalies, mild dysmorphism, variable developmental delay and a broad spectrum of To be noted additional congenital abnormalities and medical Note conditions may also occur. Biallelic mutations in BUB1B have also been Prognosis identified in individuals with MVA syndrome. The prognosis for an individual with MVA syndrome is based on the malformations present in References the individual. There is early mortality in a significant proportion Lane AH, Aijaz N, Galvin-Parton P, Lanman J, Mangano R, Wilson TA.. Mosaic variegated aneuploidy with growth of cases due to failure to thrive and/or hormone deficiency and congenital heart defects. Am J complications of congenital abnormalities, epilepsy, Med Genet. 2002 Jul 1;110(3):273-7. infections or malignancy.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 336

CEP57 (centrosomal protein 57kDa) Hanks S, et al.

Hanks S, Coleman K, Reid S, Plaja A, Firth H, Fitzpatrick microtubule and centrosomal localization domains. D, Kidd A, Mehes K, Nash R, Robin N, Shannon N, Biochem J. 2008 Jun 1;412(2):265-73. Tolmie J, Swansbury J, Irrthum A, Douglas J, Rahman N.. Meunier S, Navarro MG, Bossard C, Laurell H, Touriol C, Constitutional aneuploidy and cancer predisposition Lacazette E, Prats H.. Pivotal role of translokin/CEP57 in caused by biallelic mutations in BUB1B. Nat Genet. 2004 the unconventional secretion versus nuclear translocation Nov;36(11):1159-61. Epub 2004 Oct 10. of FGF2. Traffic. 2009 Dec;10(12):1765-72. Epub 2009 Sep 14. Matsuura S, Matsumoto Y, Morishima K, Izumi H, Matsumoto H, Ito E, Tsutsui K, Kobayashi J, Tauchi H, Snape K, Hanks S, Ruark E, Barros-Nunez P, Elliott A, Kajiwara Y, Hama S, Kurisu K, Tahara H, Oshimura M, Murray A, Lane AH, Shannon N, Callier P, Chitayat D, Komatsu K, Ikeuchi T, Kajii T.. Monoallelic BUB1B Clayton-Smith J, Fitzpatrick DR, Gisselsson D, mutations and defective mitotic-spindle checkpoint in Jacquemont S, Asakura-Hay K, Micale MA, Tolmie J, seven families with premature chromatid separation (PCS) Turnpenny PD, Wright M, Douglas J, Rahman N.. syndrome. Am J Med Genet A. 2006 Feb 15;140(4):358- Mutations in CEP57 cause mosaic variegated aneuploidy 67. syndrome. Nat Genet. 2011 Jun;43(6):527-9. Epub 2011 May 8. Garcia-Castillo H, Vasquez-Velasquez AI, Rivera H, Barros-Nunez P.. Clinical and genetic heterogeneity in This article should be referenced as such: patients with mosaic variegated aneuploidy: delineation of clinical subtypes. Am J Med Genet A. 2008 Jul Hanks S, Snape K, Rahman N. CEP57 (centrosomal 1;146A(13):1687-95. (REVIEW) protein 57kDa). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):335-337. Momotani K, Khromov AS, Miyake T, Stukenberg PT, Somlyo AV.. Cep57, a multidomain protein with unique

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 337

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Short Communication

CLDN10 (claudin 10) Madhu Lal-Nag Laboratory of Cellular and Molecular Biology, National Institute on Aging, National Institutes of Health Biomedical Research Center, Baltimore, MD 21224, USA (MLN)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/CLDN10ID45827ch13q32.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI CLDN10ID45827ch13q32.txt

in-frame splice site in the 5' coding region, Identity compared to claudin 10 isoform a. The resulting Other names: CPETRL3, OSP-L isoform (a_i1) lacks an internal segment near the N- HGNC (Hugo): CLDN10 terminus, compared to isoform a. Its composition is as follows: exons: 2; transcript length: 701 bps; Location: 13q32.1 translation length: 73 residues AK055855, BG697724, DA636757, DB544708 (source DNA/RNA sequences NCBI). Transcription Protein Claudin 10 has 3 different transcripts. NP_878268.1 [NCBI Entrez] claudin-10 isoform a: Note This variant (a) is the longest transcript and encodes Claudin 10 plays a major role as a component of claudin-10 isoform a. Its composition is as follows: tight junctions. CLDN10 encodes a member of the exons: 5; transcript length: 2549 bps; translation claudin family. Claudins are integral membrane length: 226 residues. proteins and components of tight junction strands. NP_008915.1 [NCBI Entrez] claudin-10 isoform b Tight junction strands function as a physical barrier precursor: This variant (b) is different from the to prevent solutes and water from passing freely isoform (a) above in the 5' UTR and 5' coding through the paracellular space between epithelial or region. It uses an alternate promoter, compared to endothelial cell sheets. They are also critical in variant a. The resulting isoform (b) has a longer and maintaining cell polarity and mediating signals. The more distinct N-terminus. Its composition is as expression level of this gene is associated with follows: exons: 5; transcript length: 949 bps; recurrence of primary hepatocellular carcinoma. Six translation length: 228 residues. alternatively spliced transcripts encoding different NP_001153572.1 [NCBI Entrez] claudin-10 isoforms of CLDN10 have been reported, but not isoform a_i1: This variant (a_v1) uses an alternate all of them have been recorded.

The three different isoforms of claudin 10; claudin 10 (a), claudin 10 (b) and claudin 10 (a_i1).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 338

CLDN10 (claudin 10) Lal-Nag M

The four transmembrane, two extracellular, 3 helical and two cytoplasmic domains of claudin protein.

Description Localisation 228 amino acids. Modified amino acid residue at Cell membrane. position 94 is a phosphoserine. Human and mouse isoforms of CLDN10 have been cloned. Claudin-10 Function shares between 20 and 45% sequence similarity From the KEGG pathway. between other claudin family members at the amino Claudin 10 as an integral part of tight junction acid level, displaying highest sequence similarity to composition plays an important role in Leukocyte claudin-15. migration. CLAUDIN10 is a 4-element fingerprint that They are also important components of cell provides a signature for claudin-10 proteins. The adhesion molecules and serve as a receptor for the fingerprint was derived from an initial alignment of HCV virus via their extracellular loop. 2 sequences: the motifs were drawn from conserved hsa04514: Cell adhesion molecules (CAMs) regions spanning virtually the full alignment length, hsa04530: Tight junction focusing on those sections thatcharacterize claudin- hsa04670: Leukocyte transendothelial migration 10 and distinguish it from other family members - hsa05160: Hepatitis C motif 1 lies in the first TM domain; motif 2 resides Homology within in the second TM domain; motifs 3 spans part of the fourth TM domain and part of the C- The CLDN10 gene is conserved in chimpanzee, terminal region; and motif 4 resides within the dog, cow, mouse, rat, chicken, and zebrafish. cytoplasmic C-terminus. Mutations Expression At the cell membrane in 85 organs and 13 Note developmental stages (Bgee)[P78369]. Total disease mutations: 0; total SNPs: 5.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 339

CLDN10 (claudin 10) Lal-Nag M

Sequence similarity between the various claudins showing that claudin 10 has the highest sequence similarity to claudin 15.

Implicated in References Hepatocellular carcinoma (HCC) Cheung ST, Leung KL, Ip YC, Chen X, Fong DY, Ng IO, Fan ST, So S.. Claudin-10 expression level is associated Prognosis with recurrence of primary hepatocellular carcinoma. Clin Claudin 10 is highly expressed in patients suffering Cancer Res. 2005 Jan 15;11(2 Pt 1):551-6. from HCC and is an independent prognostic Gunzel D, Stuiver M, Kausalya PJ, Haisch L, Krug SM, survival factor after surgery. Rosenthal R, Meij IC, Hunziker W, Fromm M, Muller D.. It is closely related to microvessel density and Claudin-10 exists in six alternatively spliced isoforms that exhibit distinct localization and function. J Cell Sci. 2009 angiogenesis. May 15;122(Pt 10):1507-17. Epub 2009 Apr 21. Ovarian cancer Lal-Nag M, Morin PJ.. The claudins. Genome Biol. Disease 2009;10(8):235. Epub 2009 Aug 26. (REVIEW) Ovarian cancer in a chicken model to be used as a Seo HW, Rengaraj D, Choi JW, Ahn SE, Song YS, Song basis to study the relevance of CLDN10 expression G, Han JY.. Claudin 10 is a glandular epithelial marker in the chicken model as human epithelial ovarian cancer. Int in ovarian cancer in humans. J Gynecol Cancer. 2010 Dec;20(9):1465-73. Prognosis Huang GW, Ding X, Chen SL, Zeng L.. Expression of Claudin 10 mRNA expression was significantly claudin 10 protein in hepatocellular carcinoma: impact on upregulated in cancerous chicken ovaries with survival. J Cancer Res Clin Oncol. 2011 Aug;137(8):1213- respect to normal ovaries implicating it in the 8. Epub 2011 Jun 7. etiology of this disease. This article should be referenced as such:

Lal-Nag M. CLDN10 (claudin 10). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):338-340.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 340

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

GATA3 (GATA binding protein 3) Mathieu Tremblay, Maxime Bouchard Goodman Cancer Research Centre, Department of Biochemistry, McGill University, Montreal, Canada (MT, MB)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/GATA3ID107ch10p14.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI GATA3ID107ch10p14.txt

two variant exons 6 (6a and 6b respectively) giving Identity rise to isoform a (1a-2-5-6a) and isoform b (1b-2-5- 6b) (see figure 1) (Asnagli et al., 2002). The Other names: HDR, HDRS, MGC2346, functional significance of these isoforms is unclear. MGC5199, MGC5445 HGNC (Hugo): GATA3 Protein Location: 10p14 Description DNA/RNA The full length GATA3 protein contain either 443 AA (isoform a) or 444 AA (isoform b), Description corresponding to molecular weights of 47,9 kDa The GATA3 locus spans 20,51 kb and contains 6 and 48,0 kDa respectively. The GATA3 protein exons. contains two zinc finger motifs of a distinctive form CXNCX (17) and CNXC as well as two Transcription transactivation domains (TA1 and TA2). The N- Two alternative exons 1 (1a and 1b) of the Gata3 terminal Zn finger (Zn1) is known to stabilize DNA locus are spliced to a common second exon, which binding and interact with other zinc finger proteins, contains the translation start site. All transcripts whereas the C-terminal Zn finger (Zn2) binds share exons 2 to 5 but transcript 1a and 1b splice to DNA.

Figure 1. White boxes indicate a non-coding exonic sequence, and black boxes indicate coding sequences. Gata3 encodes a protein containing 2 transactivation domains (TA1 and TA2) and 2 Zn Finger domains (Zn1 and Zn2).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 341

GATA3 (GATA binding protein 3) Tremblay M, Bouchard M

Expression Moreover, Gata3 interact with BRCA1 to repress the expression of genes associated with triple- Hematopoietic system (blood, bone marrow, negative and basal-like breast cancer (BLBCs) thymus, B, T, erythroid and myeloid lineages), including Foxc1, Foxc2, Cxcl1 and P-cadherin. blood vessels (endothelial cells), adipocytes, Loss of GATA3 expression also contributes to drug adrenal gland, ear, eye, bladder, mammary gland, resistance and epithelial-to-mesenchymal transition- prostate, seminal vesicle, kidney, CNS, hair follicle. like phenotypes associated with aggressive BLBCs Localisation (Tkocz et al., 2011). Mostly nuclear. In T cells, Gata3 acts at multiple stages of thymocyte differentiation. It is indispensable for Function early thymic progenitor differentiation (Hosoya et GATA3 acts as a transcription factor which binds to al., 2009) and for thymocytes to pass through beta the consensus DNA sequence 5'-(A/T)GATA(A/G)- selection and T cell commitment. 3'. Gata3 is also necessary for single-positive CD4 Gata3 gene inactivation in the mouse is embryonic thymocyte development as well as for Th1-Th2 lethal at mid-gestation (between embryonic days lineage commitment (Ting et al., 1996; Zhang et al., E11 and E12) (Tsai et al., 1994; Pandolfi et al., 1997; Zheng and Flavell, 1997; Zhang et al., 1998; 1995). These mice display massive internal Pai et al., 2003). As master regulator of Th2 lineage bleeding, marked growth retardation, severe commitment, GATA3 acts either as a deformities of the brain and spinal cord, and gross transcriptional activator or repressor through direct aberrations in fetal liver hematopoiesis. Lethality of action at many critical loci encoding cytokines, Gata3 mutant embryos can be rescued by cytokine receptors, signaling molecules as well as administration of catechol intermediates during transcription factors that are involved in the pregnancy as it corrects the reduction in regulation of T(h)1 and T(h)2 differentiation noradrenalin synthesis in the sympathetic nervous (Jenner et al., 2009). system (SNS) caused by reduced expression of For example, it regulates the expression of Th2 tyrosine hydroxylase (TH) and dopamine beta- lineage specific cytokine gene such as IL5 and hydroxylase (DBH). Pharmacologically rescued repress the Th1 lineage specific genes IL-12 mutant embryos present developmental defects in receptor β2 and STAT4 as well as neutralizing structures derived from cephalic neural crest cells RUNX3 function through protein-protein (Lim et al., 2000). interaction. In the kidney, Gata3 is important for nephric Mice lacking Gata3 produce IFN-gamma rather (Wolffian) duct elongation and metanephric kidney than Th2 cytokines (IL5 and IL13) in response to induction (Grote et al., 2006; Grote et al., 2008). infection (Zhu et al., 2004). It acts in mutual Conditional inactivation of Gata3 in the nephric opposition to the transcription factor T-bet, as T-bet duct leads to hydronephrosis and defective ureter promotes whereas GATA3 represses Fut7 maturation, partly due to the downregulation of the transcription (Hwang et al., 2005). receptor tyrosine kinase gene Ret (Song et al., It also acts with Tbx21 to regulate cell lineage- 2009; Chia et al., 2011). specific expression of lymphocyte homing Gata3 plays an important role in mammary gland receptors and cytokine in both Th1 and Th2 maturation and cancer. The conditional deletion of lymphocyte subsets (Chen et al., 2006). Enforced Gata3 in the mouse mammary epithelium is expression of Gata3 during T cell development associated with a failure in terminal end bud induced CD4(+)CD8(+) double-positive (DP) T cell formation at puberty causing severe defects in lymphoma (Nawijn et al., 2001a; Nawijn et al., mammary development. 2001b). Moreover, Gata3 loss in adult mice leads to an Gata3 is essential for the expression of the expansion of undifferentiated luminal cells and cytokines IL-4, IL-5 and IL-13 that mediate allergic basement-membrane detachment, which promotes inflammation. tumor dissemination (Kouros-Mehr et al., 2006; Gata3 overexpression causes enhanced allergen- Asselin-Labat et al., 2007; Kouros-Mehr et al., induced airway inflammation and airway 2008; Kouros-Mehr et al., 2008; Dydensborg et al., remodeling, including subepithelial fibrosis, and 2009). smooth muscle cell hyperplasia (Kiwamoto et al., Reexpression of Gata3 drives invasive breast cancer 2006). cells to undergo the reversal of epithelial- It additionally has a critical function in regulatory T mesenchymal transition, reducing both the cells and immune tolerance since deletion of Gata3 tumorigenicity and metastatic potential through specifically in regulatory T cells led to a reduction of lysyl oxidase (LOX) expression, a spontaneous inflammatory disorder in mice (Wang metastasis-promoting, matrix-remodeling protein et al., 2011). (Chu et al., 2011; Yan et al., 2010).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 342

GATA3 (GATA binding protein 3) Tremblay M, Bouchard M

Gata3 is critical for the differentiation and survival of parathyroid progenitor cells through regulation Mutations of GCM2/B (Grigorieva et al., 2010). Germinal Gata3 is essential for the survival but not the differentiation of sympathetic neurons and adrenal Deletion of chromosome 10 (del10p) and GATA3 chromaffin cells (Tsarovina et al., 2010) and acts gene mutations leading to haploinsufficiency with Hand2 to induce noradrenergic genes during associated with HDR syndrome (Van Esch et al., development (Pellegrino et al., 2011). 2000; Nesbit et al., 2004; Ali et al., 2007; Gata3 drives trophoblast differentiation and has Lindstrand et al., 2010). been shown to induce a trophoblast cell fate in Somatic embryonic stem cells (Ralston et al., 2010). Gata3 Heterozygous frameshift mutations close to the and its close paralog Gata2 are important for second Zn finger domain of GATA3 are associated trophectoderm lineage specification (Ray et al., with familial and sporadic breast tumors (Ciocca et 2009). al., 2009; Arnold et al., 2010). During adipogenesis, Gata3 is a negative regulator of differentiation which needs to be downregulated Implicated in to permit expression of the peroxisome proliferator- activated receptor-gamma and preadipocyte to Sporadic breast cancer and familial adipocyte transition (Tong et al., 2000). breast cancer In keratinocytes, Gata3 is a key regulator of KLK1 expression and is involved in growth control and Cytogenetics the maintenance of a differentiated state in Somatic mutations in GATA3: familial breast epithelial cells (Son do et al., 2009). In hair follicle tumors harbored heterozygous frameshift somatic morphogenesis Gata3 controls cell fate decision mutations close to the second Zn finger domain. between the inner root sheath and hair shaft cell Oncogenesis (Kaufman et al., 2003; Kurek et al., 2007). GATA3 is mutated in ~5% of sporadic and ~13% Gata3 is essential for lens cells differentiation and of familial breast tumors (Usary et al., 2004; Mehra proper cell cycle control (Maeda et al., 2009) as et al., 2005; Arnold et al., 2010). well as in the morphogenesis of the mouse inner ear GATA3 is an important predictor of disease (Karis et al., 2001; Lilleväli et al., 2004). It plays an outcome in breast cancer patients whereby low essential role during angiogenesis through GATA3 expression was a significant predictor of ANGPT1-TEK and Ang-1-Tie2-mediated signaling disease-related death (Yoon et al., 2010). in large vessel endothelial cells. HDR (Barakat) syndrome A role for Gata3 in the developing heart was revealed by pharmacological rescue of Gata3-null Disease embryos, which survive until birth and harbor Familial hypoparathyroidism - deafness - renal ventricular septal defect (VSD), double-outlet of defects syndrome. right ventricle (DORV), anomalies of the aortic - Hypoparathyroidism. arch (AAA) and persistent truncus arteriosus (PTA) - Sensorineural deafness, bilateral, symmetric, (Raid et al., 2009). deficit affecting all frequencies but slightly more marked at the higher end of the frequency range. Homology - Renal defects such as aplasia, dysplasia and GATA3 is a member of the GATA family of vesicoureteral reflux, associated or not to genital proteins comprising 6 paralogs. GATA1, GATA2 tract malformation. and GATA3 are mainly expressed in Prognosis hematopoiesis, whereas GATA4, GATA5 and Depends on the penetrance of renal defects. GATA6 are expressed in mesoderm and endoderm- derived tissue. All six GATA family members share Cytogenetics a highly conserved double zinc-finger DNA- - Deletion of chromosome 10 (del10p). binding domain. GATA3 Zn fingers are most - GATA3 gene mutations leading to functional closely conserved with those of GATA1. haploinsufficiency.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 343

GATA3 (GATA binding protein 3) Tremblay M, Bouchard M

Figure 2. Both chromosome deletion and point mutations of the GATA3 locus have been associated with HDR syndrome.

Nawijn MC, Ferreira R, Dingjan GM, Kahre O, Drabek D, References Karis A, Grosveld F, Hendriks RW. Enforced expression of GATA-3 during T cell development inhibits maturation of Tsai FY, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt CD8 single-positive cells and induces thymic lymphoma in M, Alt FW, Orkin SH. An early haematopoietic defect in transgenic mice. J Immunol. 2001b Jul 15;167(2):715-23 mice lacking the transcription factor GATA-2. Nature. 1994 Sep 15;371(6494):221-6 Asnagli H, Afkarian M, Murphy KM. Cutting edge: Identification of an alternative GATA-3 promoter directing Pandolfi PP, Roth ME, Karis A, Leonard MW, Dzierzak E, tissue-specific gene expression in mouse and human. J Grosveld FG, Engel JD, Lindenbaum MH. Targeted Immunol. 2002 May 1;168(9):4268-71 disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Kaufman CK, Zhou P, Pasolli HA, Rendl M, Bolotin D, Lim Nat Genet. 1995 Sep;11(1):40-4 KC, Dai X, Alegre ML, Fuchs E. GATA-3: an unexpected regulator of cell lineage determination in skin. Genes Dev. Ting CN, Olson MC, Barton KP, Leiden JM. Transcription 2003 Sep 1;17(17):2108-22 factor GATA-3 is required for development of the T-cell lineage. Nature. 1996 Dec 5;384(6608):474-8 Pai SY, Truitt ML, Ting CN, Leiden JM, Glimcher LH, Ho IC. Critical roles for transcription factor GATA-3 in Zhang DH, Cohn L, Ray P, Bottomly K, Ray A. thymocyte development. Immunity. 2003 Dec;19(6):863-75 Transcription factor GATA-3 is differentially expressed in murine Th1 and Th2 cells and controls Th2-specific Lilleväli K, Matilainen T, Karis A, Salminen M. Partially expression of the interleukin-5 gene. J Biol Chem. 1997 overlapping expression of Gata2 and Gata3 during inner Aug 22;272(34):21597-603 ear development. Dev Dyn. 2004 Dec;231(4):775-81 Zheng W, Flavell RA. The transcription factor GATA-3 is Nesbit MA, Bowl MR, Harding B, Ali A, Ayala A, Crowe C, necessary and sufficient for Th2 cytokine gene expression Dobbie A, Hampson G, Holdaway I, Levine MA, in CD4 T cells. Cell. 1997 May 16;89(4):587-96 McWilliams R, Rigden S, Sampson J, Williams AJ, Thakker RV. Characterization of GATA3 mutations in the Zhang DH, Yang L, Ray A. Differential responsiveness of hypoparathyroidism, deafness, and renal dysplasia (HDR) the IL-5 and IL-4 genes to transcription factor GATA-3. J syndrome. J Biol Chem. 2004 May 21;279(21):22624-34 Immunol. 1998 Oct 15;161(8):3817-21 Usary J, Llaca V, Karaca G, Presswala S, Karaca M, He X, Lim KC, Lakshmanan G, Crawford SE, Gu Y, Grosveld F, Langerød A, Kåresen R, Oh DS, Dressler LG, Lønning PE, Engel JD. Gata3 loss leads to embryonic lethality due to Strausberg RL, Chanock S, Børresen-Dale AL, Perou CM. noradrenaline deficiency of the sympathetic nervous Mutation of GATA3 in human breast tumors. Oncogene. system. Nat Genet. 2000 Jun;25(2):209-12 2004 Oct 7;23(46):7669-78 Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil Zhu J, Min B, Hu-Li J, Watson CJ, Grinberg A, Wang Q, GS. Function of GATA transcription factors in Killeen N, Urban JF Jr, Guo L, Paul WE. Conditional preadipocyte-adipocyte transition. Science. 2000 Oct deletion of Gata3 shows its essential function in T(H)1- 6;290(5489):134-8 T(H)2 responses. Nat Immunol. 2004 Nov;5(11):1157-65 Van Esch H, Groenen P, Nesbit MA, Schuffenhauer S, Hwang ES, Szabo SJ, Schwartzberg PL, Glimcher LH. T Lichtner P, Vanderlinden G, Harding B, Beetz R, Bilous helper cell fate specified by kinase-mediated interaction of RW, Holdaway I, Shaw NJ, Fryns JP, Van de Ven W, T-bet with GATA-3. Science. 2005 Jan 21;307(5708):430-3 Thakker RV, Devriendt K. GATA3 haplo-insufficiency causes human HDR syndrome. Nature. 2000 Jul Mehra R, Varambally S, Ding L, Shen R, Sabel MS, Ghosh 27;406(6794):419-22 D, Chinnaiyan AM, Kleer CG. Identification of GATA3 as a breast cancer prognostic marker by global gene Karis A, Pata I, van Doorninck JH, Grosveld F, de Zeeuw expression meta-analysis. Cancer Res. 2005 Dec CI, de Caprona D, Fritzsch B. Transcription factor GATA-3 15;65(24):11259-64 alters pathway selection of olivocochlear neurons and affects morphogenesis of the ear. J Comp Neurol. 2001 Chen GY, Osada H, Santamaria-Babi LF, Kannagi R. Jan 22;429(4):615-30 Interaction of GATA-3/T-bet transcription factors regulates expression of sialyl Lewis X homing receptors on Th1/Th2 Nawijn MC, Dingjan GM, Ferreira R, Lambrecht BN, Karis lymphocytes. Proc Natl Acad Sci U S A. 2006 Nov A, Grosveld F, Savelkoul H, Hendriks RW. Enforced 7;103(45):16894-9 expression of GATA-3 in transgenic mice inhibits Th1 differentiation and induces the formation of a T1/ST2- Grote D, Souabni A, Busslinger M, Bouchard M. Pax 2/8- expressing Th2-committed T cell compartment in vivo. J regulated Gata 3 expression is necessary for Immunol. 2001a Jul 15;167(2):724-32 morphogenesis and guidance of the nephric duct in the developing kidney. Development. 2006 Jan;133(1):53-61

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 344

GATA3 (GATA binding protein 3) Tremblay M, Bouchard M

Kiwamoto T, Ishii Y, Morishima Y, Yoh K, Maeda A, conotruncal heart anomalies in mouse. Mech Dev. 2009 Ishizaki K, Iizuka T, Hegab AE, Matsuno Y, Homma S, Jan-Feb;126(1-2):80-9 Nomura A, Sakamoto T, Takahashi S, Sekizawa K. Transcription factors T-bet and GATA-3 regulate Ray S, Dutta D, Rumi MA, Kent LN, Soares MJ, Paul S. development of airway remodeling. Am J Respir Crit Care Context-dependent function of regulatory elements and a Med. 2006 Jul 15;174(2):142-51 switch in chromatin occupancy between GATA3 and GATA2 regulate Gata2 transcription during trophoblast Kouros-Mehr H, Slorach EM, Sternlicht MD, Werb Z. differentiation. J Biol Chem. 2009 Feb 20;284(8):4978-88 GATA-3 maintains the differentiation of the luminal cell fate in the mammary gland. Cell. 2006 Dec 1;127(5):1041-55 Son do N, Li L, Katsuyama H, Komatsu N, Saito M, Tanii H, Saijoh K. Abundant expression of Kallikrein 1 gene in Ali A, Christie PT, Grigorieva IV, Harding B, Van Esch H, human keratinocytes was mediated by GATA3. Gene. Ahmed SF, Bitner-Glindzicz M, Blind E, Bloch C, Christin 2009 May 1;436(1-2):121-7 P, Clayton P, Gecz J, Gilbert-Dussardier B, Guillen- Navarro E, Hackett A, Halac I, Hendy GN, Lalloo F, Mache Song H, Suehiro J, Kanki Y, Kawai Y, Inoue K, Daida H, CJ, Mughal Z, Ong AC, Rinat C, Shaw N, Smithson SF, Yano K, Ohhashi T, Oettgen P, Aird WC, Kodama T, Tolmie J, Weill J, Nesbit MA, Thakker RV. Functional Minami T. Critical role for GATA3 in mediating Tie2 characterization of GATA3 mutations causing the expression and function in large vessel endothelial cells. J hypoparathyroidism-deafness-renal (HDR) dysplasia Biol Chem. 2009 Oct 16;284(42):29109-24 syndrome: insight into mechanisms of DNA binding by the Arnold JM, Choong DY, Thompson ER, Waddell N, GATA3 transcription factor. Hum Mol Genet. 2007 Feb Lindeman GJ, Visvader JE, Campbell IG, Chenevix-Trench 1;16(3):265-75 G. Frequent somatic mutations of GATA3 in non- Asselin-Labat ML, Sutherland KD, Barker H, Thomas R, BRCA1/BRCA2 familial breast tumors, but not in BRCA1-, Shackleton M, Forrest NC, Hartley L, Robb L, Grosveld BRCA2- or sporadic breast tumors. Breast Cancer Res FG, van der Wees J, Lindeman GJ, Visvader JE. Gata-3 is Treat. 2010 Jan;119(2):491-6 an essential regulator of mammary-gland morphogenesis Grigorieva IV, Mirczuk S, Gaynor KU, Nesbit MA, and luminal-cell differentiation. Nat Cell Biol. 2007 Grigorieva EF, Wei Q, Ali A, Fairclough RJ, Stacey JM, Feb;9(2):201-9 Stechman MJ, Mihai R, Kurek D, Fraser WD, Hough T, Kurek D, Garinis GA, van Doorninck JH, van der Wees J, Condie BG, Manley N, Grosveld F, Thakker RV. Gata3- Grosveld FG. Transcriptome and phenotypic analysis deficient mice develop parathyroid abnormalities due to reveals Gata3-dependent signalling pathways in murine dysregulation of the parathyroid-specific transcription hair follicles. Development. 2007 Jan;134(2):261-72 factor Gcm2. J Clin Invest. 2010 Jun 1;120(6):2144-55 Grote D, Boualia SK, Souabni A, Merkel C, Chi X, Lindstrand A, Malmgren H, Verri A, Benetti E, Eriksson M, Costantini F, Carroll T, Bouchard M. Gata3 acts Nordgren A, Anderlid BM, Golovleva I, Schoumans J, downstream of beta-catenin signaling to prevent ectopic Blennow E. Molecular and clinical characterization of metanephric kidney induction. PLoS Genet. 2008 patients with overlapping 10p deletions. Am J Med Genet Dec;4(12):e1000316 A. 2010 May;152A(5):1233-43 Kouros-Mehr H, Bechis SK, Slorach EM, Littlepage LE, Ralston A, Cox BJ, Nishioka N, Sasaki H, Chea E, Rugg- Egeblad M, Ewald AJ, Pai SY, Ho IC, Werb Z. GATA-3 Gunn P, Guo G, Robson P, Draper JS, Rossant J. Gata3 links tumor differentiation and dissemination in a luminal regulates trophoblast development downstream of Tead4 breast cancer model. Cancer Cell. 2008a Feb;13(2):141- and in parallel to Cdx2. Development. 2010 52 Feb;137(3):395-403 Kouros-Mehr H, Kim JW, Bechis SK, Werb Z. GATA-3 and Tsarovina K, Reiff T, Stubbusch J, Kurek D, Grosveld FG, the regulation of the mammary luminal cell fate. Curr Opin Parlato R, Schütz G, Rohrer H. The Gata3 transcription Cell Biol. 2008b Apr;20(2):164-70 factor is required for the survival of embryonic and adult sympathetic neurons. J Neurosci. 2010 Aug Ciocca V, Daskalakis C, Ciocca RM, Ruiz-Orrico A, 11;30(32):10833-43 Palazzo JP. The significance of GATA3 expression in breast cancer: a 10-year follow-up study. Hum Pathol. Yan W, Cao QJ, Arenas RB, Bentley B, Shao R. GATA3 2009 Apr;40(4):489-95 inhibits breast cancer metastasis through the reversal of epithelial-mesenchymal transition. J Biol Chem. 2010 Apr Dydensborg AB, Rose AA, Wilson BJ, Grote D, Paquet M, 30;285(18):14042-51 Giguère V, Siegel PM, Bouchard M. GATA3 inhibits breast cancer growth and pulmonary breast cancer metastasis. Yoon NK, Maresh EL, Shen D, Elshimali Y, Apple S, Oncogene. 2009 Jul 23;28(29):2634-42 Horvath S, Mah V, Bose S, Chia D, Chang HR, Goodglick L. Higher levels of GATA3 predict better survival in women Hosoya T, Kuroha T, Moriguchi T, Cummings D, Maillard I, with breast cancer. Hum Pathol. 2010 Dec;41(12):1794- Lim KC, Engel JD. GATA-3 is required for early T lineage 801 progenitor development. J Exp Med. 2009 Dec 21;206(13):2987-3000 Chia I, Grote D, Marcotte M, Batourina E, Mendelsohn C, Bouchard M. Nephric duct insertion is a crucial step in Jenner RG, Townsend MJ, Jackson I, Sun K, Bouwman urinary tract maturation that is regulated by a Gata3- RD, Young RA, Glimcher LH, Lord GM. The transcription Raldh2-Ret molecular network in mice. Development. 2011 factors T-bet and GATA-3 control alternative pathways of May;138(10):2089-97 T-cell differentiation through a shared set of target genes. Proc Natl Acad Sci U S A. 2009 Oct 20;106(42):17876-81 Chu IM, Michalowski AM, Hoenerhoff M, Szauter KM, Luger D, Sato M, Flanders K, Oshima A, Csiszar K, Green Maeda A, Moriguchi T, Hamada M, Kusakabe M, Fujioka JE. GATA3 inhibits lysyl oxidase-mediated metastases of Y, Nakano T, Yoh K, Lim KC, Engel JD, Takahashi S. human basal triple-negative breast cancer cells. Transcription factor GATA-3 is essential for lens Oncogene. 2011 Sep 5; development. Dev Dyn. 2009 Sep;238(9):2280-91 Pellegrino MJ, Parrish DC, Zigmond RE, Habecker BA. Raid R, Krinka D, Bakhoff L, Abdelwahid E, Jokinen E, Cytokines inhibit norepinephrine transporter expression by Kärner M, Malva M, Meier R, Pelliniemi LJ, Ploom M, decreasing Hand2. Mol Cell Neurosci. 2011 Sizarov A, Pooga M, Karis A. Lack of Gata3 results in Mar;46(3):671-80

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 345

GATA3 (GATA binding protein 3) Tremblay M, Bouchard M

Tkocz D, Crawford NT, Buckley NE, Berry FB, Kennedy This article should be referenced as such: RD, Gorski JJ, Harkin DP, Mullan PB. BRCA1 and GATA3 corepress FOXC1 to inhibit the pathogenesis of basal-like Tremblay M, Bouchard M. GATA3 (GATA binding protein breast cancers. Oncogene. 2011 Nov 28; 3). Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):341-346. Wang Y, Su MA, Wan YY. An essential role of the transcription factor GATA-3 for the function of regulatory T cells. Immunity. 2011 Sep 23;35(3):337-48

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 346

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

HTRA2 (HtrA serine peptidase 2) Miroslaw Jarzab, Dorota Zurawa-Janicka, Barbara Lipinska Department of Biochemistry, University of Gdansk, Kladki 24, 80-822 Gdansk, Poland (MJ, DZJ, BL)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/HTRA2ID41879ch2p13.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI HTRA2ID41879ch2p13.txt

thymic B-cell lymphoma and in some cases of Identity neuroblastoma, ovarian cancer, squamous cell Other names: OMI, PARK13, PRSS25 carcinoma of the head and neck, non-small cell lung HGNC (Hugo): HTRA2 cancer and synovial sarcoma (Knuutila et al., 1998). Translocations and deletions of region 2p12 were Location: 2p13.1 found in acute and chronic lymphocytic leukaemias Local order: Genes flanking HTRA2 in telomere as well as nonlymphocytic leukaemia and Hodgkin to centromere direction: disease (Shapiro et al., 1994). Genetic variations on - DQX1: DEAQ box RNA-dependent ATPase 1 chromosome 2p12-p13 have been associated with - AUP1: ancient ubiquitous protein 1 the development of Parkinson's disease (Gasser et - HTRA2 al., 1998), Miyoshi myopathy, limb-girdle muscular - LOXL3: lysyl oxidase-like 3 dystrophy (Liu et al., 1998), Welander myopathy - DOK1: docking protein 1 (Ahlberg et al., 1999), acute lymphoblastic Note childhood leukaemia (Inaba et al., 1991), chronic Amplification of 2p13-16 has frequently been lymphocytic leukaemia (Richardson et al., 1992) found in non-Hodgkin's lymphoma, mediastinal and Burkitt's lymphomas (Lenoir et al., 1982).

Figure 1. Localization and schematic organization of the HTRA2 gene on chromosome 2. The numbers indicate the length in kilo bases. Green boxes represent exons. Exons present in the full-length HTRA2 mRNA (A) and in the short form HTRA2 mRNA (B) are shown. Black boxes indicate untranslated regions.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 347

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

in HeLa cells and primary mouse thymocytes DNA/RNA treated with etoposide - an agent inducing apoptotic Description cell death triggered by DNA damage (Jin et al., 2003). The HTRA2 gene encompasses 4152 bases of DNA. HTRA2 has a promoter region of about 300 Pseudogene bp which includes putative binding sites for Sp1, No pseudogenes have been identified. AP-2, Elk-1 and Nrf-2. The coding part is composed of eight exons (Figure 1). The 3' end of Protein HTRA2 cDNA contains a 35 bp noncoding sequence (Faccio et al., 2000b). Note HtrA2 belongs to the HtrA family of evolutionarily Transcription conserved ATP-independent serine proteases, Two alternatively spliced variants of HTRA2 homologues of the HtrA (DegP) serine protease mRNA have been sequenced, a full-length variant, from the bacterium Escherichia coli. HtrA proteins length of 2550 bases, and a short form mRNA, are characterized by the presence of a trypsin-like length of 2259 bases (Figure 1). Additional protease domain with the catalytic triad His-Asp- transcript variants have also been described but Ser and at least one PDZ domain at the C-terminal their sequences have not been determined. end. General function of the HtrA proteins is the The full-length HTRA2 mRNA has an open frame defence against cellular stresses (such as heat of 1377 bases and is expressed ubiquitously. The shock, oxidative stress) causing aberrations in gene encodes a 50 kDa protein of 458 amino acids protein structure. At least, four human HtrA residues (Faccio et al., 2000a). The short form proteins have been identified. They are involved in HTRA2 mRNA, lacking two exons: III and VII, is protein quality control, apoptosis and regulation of expressed predominantly in the kidney, colon and cell signaling. Disturbances in their functions thyroid (Faccio et al., 2000b). contribute to neurodegenerative disorders and A single-nucleotide polymorphism (SNP) development of various types of cancer (reviewed rs1183739 located in the HTRA2 5'UTR has been by Chien et al., 2009; Clausen et al., 2011; Singh et found in patients with Parkinson's disease (PD). al., 2011; Zurawa-Janicka et al., 2010). The sequence change is located 586 base pairs upstream of the transcriptional start site of the Description HTRA2 gene (-586G>C). In vitro transcriptional The HTRA2 gene encodes a polypeptide of 458 aa, study revealed that the SNP is associated with an mass of about 50 kDa. The full-length HtrA2 increased expression of the HTRA2 gene in SH- contains the N-terminal mitochondrial targeting SY5Y and HEK293 cells (Bogaerts et al., 2008a). sequence (1-40 aa), a transmembrane domain (105- Other SNPs, the -442C>T mutation identified in the 125 aa), followed by a serine protease domain (150- HTRA2 5'UTR and the g.53572436C>G mutation 343 aa) with the catalytic triad His198-Asp228- identified in the regulatory region of the gene were Ser306, and one PDZ domain (364-445 aa) at the found to decrease the HTRA2 expression (Bogaerts C-terminal end (Figure 2). The transmembrane et al., 2008a). domain (TM) determines the topology of HtrA2 in The HTRA2 gene expression increases in response the mitochondrial intermembrane space and anchors to cellular stresses causing aberrations in protein the proform of the protease in the inner membrane. structure such as the heat or oxidative shocks, The protease and the PDZ domains are exposed into tunicamycin or cisplatin treatment (Gray et al., the mitochondrial intermembrane space 2000; Faccio et al., 2000a; Cilenti et al., 2005; Han (Kadomatsu et al., 2007). et al., 2008; Zurawa-Janicka et al., 2008). Upon Upon activation HtrA2 undergoes proteolysis accumulation of misfolded proteins in the generating a 36 kDa mature form of the protease mitochondrial intermembrane space an enhanced (134-458 aa) with the N-terminal AlaValProSer expression of HTRA2 as a consequence of ligand- motif governing interaction with the Inhibitor of independent activation of estrogen receptor alpha Apoptosis Proteins (IAPs). activity has been demonstrated (Papa and Germain, Following apoptotic stresses the mature HtrA2 is 2011). It was also shown that transcription of the released from the mitochondria into the cytosol HTRA2 gene is controlled by p53 protein. (Suzuki et al., 2001; Hegde et al., 2002; Martins et Enhanced expression of the gene has been observed al., 2002; Verhagen et al., 2002).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 348

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

Figure 2. Domain organization of human HtrA2 protein. MTS: mitochondrial targeting signal, TM: transmembrane domain, PROTEOLYTIC: trypsin-like domain, PDZ: PDZ domain, AVPS: amino acids of the IAPs binding motif. Amino acid residues of the HtrA2 catalytic triad are marked (numbers indicate the position of the given residue in the polypeptide chain).

An X-ray crystallographic study showed that HtrA2 oxygen species, and result in a loss of molecule is a pyramid-shaped homotrimer. The N- mitochondrial competence (Jones et al., 2003; terminal IAPs binding motifs of monomers form Martins et al., 2004; Krick et al., 2008; Moisoi et the top of the trimer and the PDZ domains are al., 2009). The Mnd2 (Motor neuron degeneration located at the bottom of the structure (Li et al., 2) mice carrying a loss-of-function missense 2002). Formation of the homotrimeric stucture has HTRA2 Ser276 mutation as well as the knockout been confirmed by experimental data (Li et al., mice carrying a homologous deletion of the 2002; Nam et al., 2006). Oligomerization is HTRA2 gene exhibit phenotypes with features mediated by the trimerization motif of the protease typical for the Parkinsonian syndrome. Both, the domain (146-151 aa) wherein phenylalanine at the mnd2 cells and the HTRA2-/- cells contain an residue 149 is suggested to be a major determinant increased number of atypical mitochondria and are of the trimeric assembly. It was also demonstrated more prone to death triggered by agents inducing that the formation of the homotrimer is required for intrinsic pathway of apoptosis (e.g. etoposide) and the HtrA2 proteolytic activity (Li et al., 2002; Nam affecting mitochondrial functions (e.g. rotenone) et al., 2006). (Jones et al., 2003; Martins et al., 2004). Expression In stressful conditions HtrA2 switches its function from protective to proapoptotic. HtrA2 induces HTRA2 is expressed ubiquitously and quite apoptosis in a caspase-dependent manner as well as uniformly among human tissues. However, the in a caspase-independent manner via its proteolytic highest expression of HTRA2 was detected in fetal activity. Upon apoptosis-inducing agents such as liver (Nie et al., 2003). ultraviolet radiation (Martins et al., 2002; Trencia et Localisation al., 2004), staurosporine (Hegde et al., 2002; Munoz-Pinedo et al., 2006), cisplatin (Cilenti et al., HtrA2 is predominantly localized in the 2004), etoposide (Jin et al., 2003), imatinib mitochondrium (Martins et al., 2002; Hegde et al., mesylate (Okada et al., 2004), botrezomib (Baou et 2002; Verhagen et al., 2002). The proform of al., 2010), H O (Ding et al., 2009) HtrA2 HtrA2 possessing the transmembrane region is 2 2 undergoes proteolytic processing, resulting in the anchored in the inner membrane with the exposure of the N-terminal AlaValProSer motif proteolytic domain and the PDZ domain exposed which mediates interaction with the Inhibitor of into the intermembrane space (IMS). Mature form Apoptosis Proteins (IAPs). Mature HtrA2 is then of HtrA2 without the TM region largely resides in released from the mitochondria into the cytosol the IMS as a soluble protein (Kadomatsu et al., where it interacts with the IAPs such as XIAP (X- 2007). The protein was also detected in the linked inhibitor of apoptosis protein), cIAP1 endoplasmic reticulum and nucleus (Faccio et al., (cellular inhibitor of apoptosis protein-1), cIAP2, 2000a; Gray et al., 2000; Marabese et al., 2008). Apollon/BRUCE, through their BIR domains Function (Martins et al., 2002; Hegde et al., 2002; Verhagen HTRA2 functions as an ATP-independent serine et al., 2002; Yang et al., 2003; Srinivasula et al., protease. 2003; Jin et al., 2003; Sekine et al., 2005). It is believed that the primary function of HtrA2 is Degradation of the IAPs by HtrA2 leads to the maintenance of mitochondrial homeostasis. activation of caspases 3, 7 and 9, and facilitates cell Under normal physiological conditions HtrA2 acts death (Martins et al., 2002; Hegde et al., 2002; as a quality control factor and promotes cell Verhagen et al., 2002; Seong et al., 2004). survival. Disturbances of the HtrA2 proteolytic Kuninaka et al. (2005) showed that the serine- activity lead to the accumulation of unfolded threonine kinase WARTS serves as a regulator of proteins in mitochondria, dysfunction of the the HtrA2 proteolytic activity towards IAPs. mitochondrial respiration, generation of reactive Depletion of WARTS diminishes degradation of

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 349

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

XIAP and cIAP1, and prevents HtrA2-mediated apoptosis. Mutations HtrA2 contributes to the induction of apoptosis by Germinal degradation of antiapoptotic proteins other than the IAPs, such as cytoplasmic ped/pea15 (Trencia et Two heterozygous missense mutations in the al., 2004) and mitochondrial HAX-1 (Cilenti et al., HTRA2 gene have been identified in patients with 2004), and also by proteolysis of p73 protein which sporadic form of Parkinson's disease (PD) in a enhances its proapoptotic activity. Upon induction German population (Strauss et al., 2005). A G421T of apoptosis HtrA2 is translocated to the nucleus mutation in exon 1 leading to a A141S substitution where it cleaves p73. Proteolytically modified p73 was found predominantly in PD patients and stimulates transcription of the BAX gene, whose defined as a polymorphism associated with PD. A protein product exhibits proapoptotic function G1195A mutation in exon 7 resulting in a G399S (Marabese et al., 2008). substitution was identified exclusively in the PD The protease is an inductor of anoikis, cell death patients. Both mutations caused a decrease of the induced by cell detachment or loss of cell contact HtrA2 proteolytic activity in vitro and affected with the extracellular matrix. Resistance to anoikis morphology and function of mitochondria. is a common feature of cancer cells contributing to Additionally, the G399S mutation caused an metastasis. Anoikis of non-maliganant intestinal increased susceptibility to stress-induced cell death epithelial cells triggered by cell detachment is (Strauss et al., 2005). Further study revealed that neither the A141S mutation nor the G399S mediated by down-regulation of Bcl-XL followed by the release of mitochondrial HtrA2 into the substitution were associated with the susceptibility cytosol. However, oncogenic Ras blocks the HtrA2 to the PD development in a North American translocation and HtrA2-mediated cell death (Liu et population (Simon-Sanchez and Singleton, 2008). al., 2006). Another PD-specific HTRA2 mutation in the PDZ HtrA2 may also function as a chaperone protein. domain, R404W was identified, in a mutation Results of the in vitro experiments revealed that analysis of Belgian PD patients (Bogaerts et al., 2008a). Theoretically, this mutation should affect HtrA2 prevents the aggregation of amyloid β42, a major element of neurotoxic deposits in brains of HtrA2 protease activity. Eight novel mutations in the Alzheimer's disease (AD) patients, keeping the the HTRA2 coding region have been found: the peptide in the monomeric state (Kooistra et al., non-synonymous W12C, P128L, F172V and A227S substitutions, and the synonymous V109V, 2009). HtrA2 interacts with Aβ40 and Aβ42 but the peptides are not direct substrates for the protease L118L, R203R and L367L mutations. These (Park et al., 2004). It is sugested that HtrA2 could changes were found in both the PD cases and protect from the AD development due to its healthy controls and did not show an association chaperone function. Liu et al. (2009) confirmed the with the PD development (Simon-Sanchez and interaction of HtrA2 with Aβ in neuronally Singleton, 2008). differentiated human NT2N cells (clonal human neurons) and also in brain tissue from Tg2576 Implicated in mice. HtrA2 binds preferentially to oligomeric Aβ, Various cancers the most neurotoxic form of Aβ inside neural cells, via the PDZ domain of the protease. Moreover, the Note interaction attenuates the HtrA2 proapoptotic Analysis of available microarray data indicated that activity and prevents the neuronal death (Liu et al., expression of HTRA2 in different cancers varies 2009). according to tumor type (Chien et al., 2009). HTRA2 expression was up-regulated in lung Homology adenocarcinoma, superficial or invasive transitional The HtrA2 protein is evolutionarily conserved cell carcinoma of bladder, oligodendroglioma among mammalian species. (brain) and squamous cell carcinoma of head and At the amino acid level homology between human neck. HTRA2 was also up-regulated in B-cell acute HtrA2 and its orthologs from oppossum, cow, rat, lymphoblastic and T-cell lymphoblastic leukaemia mouse and chimpanzee reaches 82%, 90%, 87%, compared to the acute myeloid leukaemia, in 85% and 100%, respectively. The identity between Wilm's tumors compared to normal fetal kidney or HtrA2 and these orthologs reaches 88%, 92%, 91%, clear cell sarcoma, and in microsatellite unstable 89% and 100%, respectively. colorectal carcinoma compared to the microsatellite At least three paralogs of human HtrA2 have been stable colorectal carcinoma. In contrast, a identified: HtrA1 (L56, ORF480, PRSS11, diminished expression of HTRA2 was observed in ARMD7), HtrA3 (PRSP) and HtrA4. HtrA2 shares ovarian cancer, metastatic prostate cancer and adult the 75, 75 and 71% homology with HtrA1, HtrA3 male germ cell tumor. In breast cancer HTRA2 and HtrA4, respectively. The identity between expression was reduced with the increasing tumor HtrA2 and its paralogs reaches 54, 52 and 49%, staging. respectively.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 350

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

Oncogenesis prostate cancer. Yeast two-hybrid analysis revealed HtrA2 acts as a regulator of mitochondrial that the C-terminus of ITGA7 interacts with HtrA2 homeostasis facilitating cell survival rather than cell and it was shown that expression of ITGA7 death. However, under stressful conditions its increased the HtrA2 protease activity both in vitro function changes into proapoptotic. Since HtrA2 and in vivo, whereas down-regulation of HtrA2 plays a crucial role in the induction of apoptosis dramatically reduced cell death mediated by there is an obvious link with cancer development ITGA7. In addition, protease-null mutant because dysfunction of apoptosis facilitates HtrA2S306A expression blocked apoptosis induced neoplastic transformation. Disturbances in the by ITGA7. HtrA2 proapoptotic activity may also contribute to Lymphoma and leukaemia metastasis since the implication of HtrA2 in anoikis has been reported. Several studies argue the Note involvement of HtrA2 in oncogenesis. However, Results of Okada et al. (2004), concerning BCR- variable expression of HTRA2 depending on cancer ABL-positive human leukaemic cells (BV173 and type complicates unambiguous definition of the K562) indicated HtrA2 as a caspase-independent, HtrA2 role in carcinogenesis. necrosis-like programmed cell death factor. They observed the mitochondrial release of HtrA2 into Gastric cancer the cytosol of the cells treated with imatinib Note mesylate and, furthermore, serine protease Lee et al. (2003) showed that the reduction of the inhibitors prevented the caspase-independent HTRA2 expression correlated with advanced necrosis. gastric adenocarcinomas, irrespective of histologic Work of Li et al. (2011) on HTRA2 expression subtype, in comparison to normal gastric mucosal using immunohistochemistry showed a weak and cells. Immunohistochemistry results suggest that comparable expression in all normal lymph nodes, HtrA2 plays a role in the development of stomach diffuse large B-cell lymphomas and small cancer (Lee et al., 2003). lymphocytic lymphomas, suggesting a rather minor Ovarian cancer role of HtrA2 in the regulation of apoptosis in these types of cancer. On the other hand, Baou et al. Note (2010) showed that cytosolic level of HtrA2 in Work of Yang et al. (2005) on chemoresistance of chronic lymphocytic leukaemia cells increased after ovarian cancer cells (A2780 and COC1) to cisplatin bortezomib treatment, suggesting HtrA2's role in points to the HtrA2 protein level as a one of the key the bortezomib-mediated caspase-dependent factors in response to the treatment. The cisplatin- apoptosis. induced increase of the cytosolic HtrA2 level was associated with the down-regulation of XIAP, Parkinson's disease (PD) activation of caspase-3 and apoptotic response in Note cisplatin-sensitive ovarian cancer cells, but not in Several single nucleotide polymorphisms (SNPs) of resistant cells. the HTRA2 gene have been identified and their The HTRA2 mRNA level was reported to be down- relevance in PD has been studied. regulated in ovarian tumors (most evidently in The mouse mutation mnd2 resulting in the missense borderline tumors) (Narkiewicz et al., 2008) and the substitution S276C in the HtrA2 protease domain HtrA2 protein levels were significantly lower in causes a phenotype resembling PD (Jones et al., endometrial cancer tissues compared to normal 2003). In humans, genetic variation analyses have controls (Narkiewicz et al., 2009). provided conflicting results regarding the Prostate cancer involvement of the HTRA2 gene in PD. Results of Ross et al. (2008), Simón-Sánchez and Singleton Note (2008), Sutherland et al. (2009), Krüger et al. Immunohistochemical analysis showed that (2011) revealed no significant associations between HTRA2 was overexpressed in prostate cancer the studied polymorphisms and PD, whereas studies compared to the normal prostate and benign of Strauss et al. (2005) and Bogaerts et al. (2008a, prostatic hyperplasia, and the overexpression 2008b) did associate HTRA2 SNPs with PD. correlated with prostate cancer differentiation. The Westerlund et al. (2011) found a weak association semiquantitative RT-PCR assay showed a much of HtrA2 A141S with Alzheimer's disease. higher expression of HTRA2 in the prostate cancer The first connection between HtrA2 dysfunction group compared to the benign prostatic hyperplasia and PD came from the study of Jones et al. (2003) group (Hu et al., 2006). Additional link between on the motor deficient (mnd2) mutant mice. The HTRA2 and prostate cancer (in cell lines PC3 and mnd2 mutation, leading to neurodegeneration, DU145) was provided by Zhu et al. (2010) who muscle wasting, involution of the spleen and demonstrated a connection between HTRA2 and thymus and death by 40 days of age, was identified integrin alpha7 (ITGA7). ITGA7 acts as a in the HTRA2 gene. Moreover, a neurodegenerative proapoptotic factor and is down-regulated in phenotype with parkinsonian features has been

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 351

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

described in the HTRA2 knockout mice (Martins et A pathological hallmark of PD is the presence of al., 2004). A loss-of-HTRA2 study on the mouse Lewy bodies and the loss of dopaminergic neurons model showed accumulation of unfolded proteins in in the substantia nigra pars compacta leading to a mitochondria, a defective mitochondrial respiration dopamine deficit in the striatum. Clinically, PD and an enhanced production of reactive oxygen manifests with bradykinesia, hypokinesia, rigidity, species in the brain tissue cells (Moisoi et al., resting tremor and postural instability, with an onset 2009). Study of Strauss et al. (2005) determined of symptoms occurring generally between the fifth mutations (A141S - rs72470544, G399S - and seventh decade of life. Patients may also rs72470545) in the HTRA2 gene leading to a loss develop autonomic dysfunction, cognitive changes, of or a reduced protease activity, respectively, in psychiatric symptoms, sensory complaints and German PD patients. Immunohistochemistry sleep disturbances. A number of environmental revealed that both mutations induced mitochondrial factors and gene mutations (for a minority of cases) dysfunction associated with the altered have been implicated in PD (Bogaerts et al., 2008a; mitochondrial morphology. The A141S Plun-Favreau et al., 2008; Winlklhofer and Haass, polymorphism was associated with PD (p<0,05) 2010; De Castro et al., 2011). and G399S mutation was identified in four patients Alzheimer's disease (AD) and was absent in healthy controls. Plun-Favreau et al. (2007) showed that point mutation in HTRA2 Note resulted in impairment of HtrA2 protease activity in The first association of HtrA2 with Alzheimer's PD patients carrying PTEN-induced kinase 1 disease (AD) was shown by a study, in which (PINK1) mutations - mutations which were HtrA2 was identified as a presenilin-1 (PS1)- connected with the early onset parkinsonism. Later interacting factor in a yeast two-hybrid screen on, PINK1 was found to enhance HtrA2 activity by (Gray et al., 2000). PS1 is a catalytic subunit of its phosphorylation and thus to participate in the gamma-secretase involved in amyloid beta- maintenance of mitochondrial homeostasis precursor (APP) processing and it is suggested that (Whitworth et al., 2008). It should be noted that mutations in the gene encoding PS1 selectively Yun et al. (2008) found that HtrA2 null mutants in elevate the levels of highly amyloidogenic peptide Drosophila, in contrast to pink1 or parkin null Aβ42 and cause an increased death of neural cells by mutants, do not show mitochondrial morphological apoptosis and necrosis. The HtrA2-presenilin defects. They questioned the role of HTRA2 as a interactions were confirmed by Gupta et al. where component of the PINK1 pathway and an important the C-terminus of PS1 peptide has been shown to player in PD pathogenesis. Several single interact with HtrA2 and stimulate HtrA2 protease nucleotide polymorphisms within HTRA2 gene activity in vitro. Ectopic expression of PS1 have been tested for association with PD in large- potentiated HtrA2-induced cell death. These results scale studies. Study of Ross et al. (2008) on suggested that PS1 may regulate the protease rs1183739, rs2241028, rs2231250, rs10779958 and activity after its release from mitochondria during rs72470544 (890 PD patients and 1479 controls apoptosis (Gupta et al., 2004). Recently, association from US, Ireland, Norway and Poland); of Simón- of HtrA2 with gamma-secretase and its positive Sánchez and Singleton (2008) on rs2231248, effect on gamma-secretase activity in isolated rs2231249, rs2241027, rs2241028 and rs11538692 mitochondria have been shown (Behbahani et al., (644 PD patients and 828 controls from North 2010). Using yeast two-hybrid assays, Park et al. America); of Sutherland et al. (2009) on rs1183739 found that the amyloid beta-peptide (Aβ) also (PD cases: 331 and controls: 296, Australia) and of interacts with HtrA2. Although HtrA2 interacts Krüger et al. (2011) on rs1183739, rs2231250, with Aβ40 and Aβ42, the Aβ peptides do not serve as rs2241028, rs10779958 and rs72470544 (large- direct substrates for the protease. However, scale genetic association study on total sample of overproduction of HtrA2 in K269 cells reduced the 6378 PD patients and 8879 controls throughout Aβ levels up to 30 %. The function of HtrA2 as an Europe, North America, Asia and Australia) inhibitor of Aβ oligomerization suggested a revealed no statistically significant associations for chaperone role for HtrA2 in the metabolism of any of the SNPs with PD. This set of recent studies intracellular Aβ in AD (Kooistra et al., 2009; Park indicates that the role of HTRA2 in the et al., 2004). Liu et al. (2009) demonstrated that development of PD remains to be clarified (De HtrA2 selectively interacts with oligomeric Aβ. The Castro et al., 2011), even though HtrA2 protein interaction protects neurons from the neurotoxic Aβ plays a protective role during stress in the accumulation and also causes the reduction of the mitochondria of healthy cells (Martins et al., 2004). HtrA2 proapoptotic activity preventing death of neural cells. In addition, the proteins of APP Disease family: APP, APLP1, APLP2 are direct substrates Parkinson's disease is a progressive for HtrA2 in vitro (Park et al., 2006). Moreover, a neurodegenerative disorder of central nervous novel function of HtrA2 as a regulator of APP system and the most common movement disorder metabolism through ER-associated degradation has (about 1% of the population over 60 years of age). been demonstrated (Huttunen et al., 2007).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 352

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

Furthermore, Ucf-101, an HtrA2 inhibitor, protects and variant translocation in Burkitt's lymphoma. Nature. against cerebral ischemia/reperfusion injury in 1982 Jul 29;298(5873):474-6 mice, providing neuroprotection in vivo (Su et al., Inaba T, Oku N, Gotoh H, Murakami S, Oku N, Itoh K, Ura 2009). Taken together, interactions between HtrA2 Y, Nakanishi S, Shimazaki C, Nakagawa M. Philadelphia chromosome positive precursor B-cell acute lymphoblastic and Aβ, presenilin or APP suggest a possible link leukemia with a translocation t(2;14)(p13;q32). Leukemia. between HtrA2 and AD (Gupta et al., 2004; Park et 1991 Aug;5(8):719-22 al., 2006). Among many studies, HtrA2 has been Richardson AL, Humphries CG, Tucker PW. Molecular suggested to be a potential target in AD (reviewed cloning and characterization of the t(2;14) translocation by Bhuiyan and Fukunaga, 2009). associated with childhood chronic lymphocytic leukemia. Disease Oncogene. 1992 May;7(5):961-70 Alzheimer's disease is a progressive Shapiro DN, Valentine V, Eagle L, Yin X, Morris SW, neurodegenerative disorder. AD is characterized by Prochownik EV. Assignment of the human MAD and MXI1 genes to chromosomes 2p12-p13 and 10q24-q25. cognitive dysfunction, various behavioural and Genomics. 1994 Sep 1;23(1):282-5 neuro-psychiatric disturbances and on cellular/ biochemical level by the deposition of extracellular Gasser T, Müller-Myhsok B, Wszolek ZK, Oehlmann R, Calne DB, Bonifati V, Bereznai B, Fabrizio E, Vieregge P, plaques, which consist of amyloid beta (Aβ) Horstmann RD. A susceptibility locus for Parkinson's peptides and intracellular neurofibrillary tangles. disease maps to chromosome 2p13. Nat Genet. 1998 Mar;18(3):262-5 Major components of the senile plaques are Aβ40 and Aβ42 peptides generated from the COOH- Knuutila S, Björkqvist AM, Autio K, Tarkkanen M, Wolf M, terminal end of amyloid precursor protein (APP) by Monni O, Szymanska J, Larramendy ML, Tapper J, Pere action of beta and gamma-secretases. H, El-Rifai W, Hemmer S, Wasenius VM, Vidgren V, Zhu Y. DNA copy number amplifications in human neoplasms: Huntington's disease (HD) review of comparative genomic hybridization studies. Am J Pathol. 1998 May;152(5):1107-23 Note Study of Inagaki et al. (2008) on rat primary Liu J, Wu C, Bossie K, Bejaoui K, Hosler BA, Gingrich JC, Ben Hamida M, Hentati F, Schurr E, de Jong PJ, Brown neurons revealed a connection between the RH Jr. Generation of a 3-Mb PAC contig spanning the neuronal death and a selective down-regulation of Miyoshi myopathy/limb-girdle muscular dystrophy HTRA2 gene by mutant huntingtin (htt) in striatal (MM/LGMD2B) locus on chromosome 2p13. Genomics. neurons. Furthermore, at the protein level both the 1998 Apr 1;49(1):23-9 full-length and the mature forms of HtrA2 were not Ahlberg G, von Tell D, Borg K, Edström L, Anvret M. affected in primary cortical or cerebellar neurons Genetic linkage of Welander distal myopathy to but were reduced in striatal neurons. These findings chromosome 2p13. Ann Neurol. 1999 Sep;46(3):399-404 suggest a link between HTRA2 selective down- Gray CW, Ward RV, Karran E, Turconi S, Rowles A, regulation and striatal neuron-specific pathology in Viglienghi D, Southan C, Barton A, Fantom KG, West A, Savopoulos J, Hassan NJ, Clinkenbeard H, Hanning C, HD. Amegadzie B, Davis JB, Dingwall C, Livi GP, Creasy CL. Disease Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur J Huntington's disease is one of neurodegenerative Biochem. 2000 Sep;267(18):5699-710 disorders manifested by unwanted choreatic movements, behavioural and psychiatric Faccio L, Fusco C, Chen A, Martinotti S, Bonventre JV, Zervos AS. Characterization of a novel human serine disturbances and dementia. Brains of HD patients protease that has extensive homology to bacterial heat are characterised by selective degeneration of shock endoprotease HtrA and is regulated by kidney medium-sized spiny neurons in the striatum and ischemia. J Biol Chem. 2000a Jan 28;275(4):2581-8 later on, in the disease progression, of cortical Faccio L, Fusco C, Viel A, Zervos AS. Tissue-specific neurons. HD belongs to a family of polyglutamine splicing of Omi stress-regulated endoprotease leads to an disorders and is caused by an autosomal dominant inactive protease with a modified PDZ motif. Genomics. mutation of Huntingtin (Htt) gene. CGG repeats in 2000b Sep 15;68(3):343-7 the DNA sequence of the Htt gene result in variably Suzuki Y, Imai Y, Nakayama H, Takahashi K, Takio K, extended polyglutamine (polyQ) repeats in htt Takahashi R. A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell protein - repeats exceeding 35-40 are associated death. Mol Cell. 2001 Sep;8(3):613-21 with HD. Hegde R, Srinivasula SM, Zhang Z, Wassell R, Mukattash R, Cilenti L, DuBois G, Lazebnik Y, Zervos AS, Fernandes- Breakpoints Alnemri T, Alnemri ES. Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts Note inhibitor of apoptosis protein-caspase interaction. J Biol No breakpoints described so far. Chem. 2002 Jan 4;277(1):432-8 Li W, Srinivasula SM, Chai J, Li P, Wu JW, Zhang Z, References Alnemri ES, Shi Y. Structural insights into the pro-apoptotic function of mitochondrial serine protease HtrA2/Omi. Nat Lenoir GM, Preud'homme JL, Bernheim A, Berger R. Struct Biol. 2002 Jun;9(6):436-41 Correlation between immunoglobulin light chain expression

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 353

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

Martins LM, Iaccarino I, Tenev T, Gschmeissner S, Totty Seong YM, Choi JY, Park HJ, Kim KJ, Ahn SG, Seong GH, NF, Lemoine NR, Savopoulos J, Gray CW, Creasy CL, Kim IK, Kang S, Rhim H. Autocatalytic processing of Dingwall C, Downward J. The serine protease Omi/HtrA2 HtrA2/Omi is essential for induction of caspase-dependent regulates apoptosis by binding XIAP through a reaper-like cell death through antagonizing XIAP. J Biol Chem. 2004 motif. J Biol Chem. 2002 Jan 4;277(1):439-44 Sep 3;279(36):37588-96 Verhagen AM, Silke J, Ekert PG, Pakusch M, Kaufmann H, Trencia A, Fiory F, Maitan MA, Vito P, Barbagallo AP, Connolly LM, Day CL, Tikoo A, Burke R, Wrobel C, Moritz Perfetti A, Miele C, Ungaro P, Oriente F, Cilenti L, Zervos RL, Simpson RJ, Vaux DL. HtrA2 promotes cell death AS, Formisano P, Beguinot F. Omi/HtrA2 promotes cell through its serine protease activity and its ability to death by binding and degrading the anti-apoptotic protein antagonize inhibitor of apoptosis proteins. J Biol Chem. ped/pea-15. J Biol Chem. 2004 Nov 5;279(45):46566-72 2002 Jan 4;277(1):445-54 Cilenti L, Kyriazis GA, Soundarapandian MM, Stratico V, Jin S, Kalkum M, Overholtzer M, Stoffel A, Chait BT, Yerkes A, Park KM, Sheridan AM, Alnemri ES, Bonventre Levine AJ. CIAP1 and the serine protease HTRA2 are JV, Zervos AS. Omi/HtrA2 protease mediates cisplatin- involved in a novel p53-dependent apoptosis pathway in induced cell death in renal cells. Am J Physiol Renal mammals. Genes Dev. 2003 Feb 1;17(3):359-67 Physiol. 2005 Feb;288(2):F371-9 Jones JM, Datta P, Srinivasula SM, Ji W, Gupta S, Zhang Kuninaka S, Nomura M, Hirota T, Iida S, Hara T, Honda S, Z, Davies E, Hajnóczky G, Saunders TL, Van Keuren ML, Kunitoku N, Sasayama T, Arima Y, Marumoto T, Koja K, Fernandes-Alnemri T, Meisler MH, Alnemri ES. Loss of Yonehara S, Saya H. The tumor suppressor WARTS Omi mitochondrial protease activity causes the activates the Omi / HtrA2-dependent pathway of cell death. neuromuscular disorder of mnd2 mutant mice. Nature. Oncogene. 2005 Aug 11;24(34):5287-98 2003 Oct 16;425(6959):721-7 Sekine K, Hao Y, Suzuki Y, Takahashi R, Tsuruo T, Naito Lee SH, Lee JW, Kim HS, Kim SY, Park WS, Kim SH, Lee M. HtrA2 cleaves Apollon and induces cell death by IAP- JY, Yoo NJ. Immunohistochemical analysis of Omi/HtrA2 binding motif in Apollon-deficient cells. Biochem Biophys expression in stomach cancer. APMIS. 2003 Res Commun. 2005 Apr 29;330(1):279-85 May;111(5):586-90 Strauss KM, Martins LM, Plun-Favreau H, Marx FP, Nie GY, Hampton A, Li Y, Findlay JK, Salamonsen LA. Kautzmann S, Berg D, Gasser T, Wszolek Z, Müller T, Identification and cloning of two isoforms of human high- Bornemann A, Wolburg H, Downward J, Riess O, Schulz temperature requirement factor A3 (HtrA3), JB, Krüger R. Loss of function mutations in the gene characterization of its genomic structure and comparison encoding Omi/HtrA2 in Parkinson's disease. Hum Mol of its tissue distribution with HtrA1 and HtrA2. Biochem J. Genet. 2005 Aug 1;14(15):2099-111 2003 Apr 1;371(Pt 1):39-48 Yang X, Xing H, Gao Q, Chen G, Lu Y, Wang S, Ma D. Srinivasula SM, Gupta S, Datta P, Zhang Z, Hegde R, Regulation of HtrA2/Omi by X-linked inhibitor of apoptosis Cheong N, Fernandes-Alnemri T, Alnemri ES. Inhibitor of protein in chemoresistance in human ovarian cancer cells. apoptosis proteins are substrates for the mitochondrial Gynecol Oncol. 2005 May;97(2):413-21 serine protease Omi/HtrA2. J Biol Chem. 2003 Aug 22;278(34):31469-72 Hu XY, Xu YM, Chen XC, Ping H, Chen ZH, Zeng FQ. Immunohistochemical analysis of Omi/HtrA2 expression in Yang QH, Church-Hajduk R, Ren J, Newton ML, Du C. prostate cancer and benign prostatic hyperplasia. APMIS. Omi/HtrA2 catalytic cleavage of inhibitor of apoptosis (IAP) 2006 Dec;114(12):893-8 irreversibly inactivates IAPs and facilitates caspase activity in apoptosis. Genes Dev. 2003 Jun 15;17(12):1487-96 Liu Z, Li H, Derouet M, Berezkin A, Sasazuki T, Shirasawa S, Rosen K. Oncogenic Ras inhibits anoikis of intestinal Cilenti L, Soundarapandian MM, Kyriazis GA, Stratico V, epithelial cells by preventing the release of a mitochondrial Singh S, Gupta S, Bonventre JV, Alnemri ES, Zervos AS. pro-apoptotic protein Omi/HtrA2 into the cytoplasm. J Biol Regulation of HAX-1 anti-apoptotic protein by Omi/HtrA2 Chem. 2006 May 26;281(21):14738-47 protease during cell death. J Biol Chem. 2004 Nov 26;279(48):50295-301 Muñoz-Pinedo C, Guío-Carrión A, Goldstein JC, Fitzgerald P, Newmeyer DD, Green DR. Different mitochondrial Gupta S, Singh R, Datta P, Zhang Z, Orr C, Lu Z, Dubois intermembrane space proteins are released during G, Zervos AS, Meisler MH, Srinivasula SM, Fernandes- apoptosis in a manner that is coordinately initiated but can Alnemri T, Alnemri ES. The C-terminal tail of presenilin vary in duration. Proc Natl Acad Sci U S A. 2006 Aug regulates Omi/HtrA2 protease activity. J Biol Chem. 2004 1;103(31):11573-8 Oct 29;279(44):45844-54 Nam MK, Seong YM, Park HJ, Choi JY, Kang S, Rhim H. Martins LM, Morrison A, Klupsch K, Fedele V, Moisoi N, The homotrimeric structure of HtrA2 is indispensable for Teismann P, Abuin A, Grau E, Geppert M, Livi GP, Creasy executing its serine protease activity. Exp Mol Med. 2006 CL, Martin A, Hargreaves I, Heales SJ, Okada H, Brandner Feb 28;38(1):36-43 S, Schulz JB, Mak T, Downward J. Neuroprotective role of the Reaper-related serine protease HtrA2/Omi revealed by Park HJ, Kim SS, Seong YM, Kim KH, Goo HG, Yoon EJ, targeted deletion in mice. Mol Cell Biol. 2004 Min do S, Kang S, Rhim H. Beta-amyloid precursor protein Nov;24(22):9848-62 is a direct cleavage target of HtrA2 serine protease. Implications for the physiological function of HtrA2 in the Okada M, Adachi S, Imai T, Watanabe K, Toyokuni SY, mitochondria. J Biol Chem. 2006 Nov 10;281(45):34277-87 Ueno M, Zervos AS, Kroemer G, Nakahata T. A novel mechanism for imatinib mesylate-induced cell death of Huttunen HJ, Guénette SY, Peach C, Greco C, Xia W, Kim BCR-ABL-positive human leukemic cells: caspase- DY, Barren C, Tanzi RE, Kovacs DM. HtrA2 regulates independent, necrosis-like programmed cell death beta-amyloid precursor protein (APP) metabolism through mediated by serine protease activity. Blood. 2004 Mar endoplasmic reticulum-associated degradation. J Biol 15;103(6):2299-307 Chem. 2007 Sep 21;282(38):28285-95 Park HJ, Seong YM, Choi JY, Kang S, Rhim H. Kadomatsu T, Mori M, Terada K. Mitochondrial import of Alzheimer's disease-associated amyloid beta interacts with Omi: the definitive role of the putative transmembrane the human serine protease HtrA2/Omi. Neurosci Lett. 2004 region and multiple processing sites in the amino-terminal Feb 26;357(1):63-7

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 354

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

segment. Biochem Biophys Res Commun. 2007 Sep expression of serine proteases HtrA1 and HtrA2 during 21;361(2):516-21 estrogen-induced oxidative stress and nephrocarcinogenesis in male Syrian hamster. Acta Plun-Favreau H, Klupsch K, Moisoi N, Gandhi S, Kjaer S, Biochim Pol. 2008;55(1):9-19 Frith D, Harvey K, Deas E, Harvey RJ, McDonald N, Wood NW, Martins LM, Downward J. The mitochondrial protease Bhuiyan MS, Fukunaga K. Mitochondrial serine protease HtrA2 is regulated by Parkinson's disease-associated HtrA2/Omi as a potential therapeutic target. Curr Drug kinase PINK1. Nat Cell Biol. 2007 Nov;9(11):1243-52 Targets. 2009 Apr;10(4):372-83 Bogaerts V, Nuytemans K, Reumers J, Pals P, Chien J, Campioni M, Shridhar V, Baldi A. HtrA serine Engelborghs S, Pickut B, Corsmit E, Peeters K, proteases as potential therapeutic targets in cancer. Curr Schymkowitz J, De Deyn PP, Cras P, Rousseau F, Theuns Cancer Drug Targets. 2009 Jun;9(4):451-68 J, Van Broeckhoven C. Genetic variability in the mitochondrial serine protease HTRA2 contributes to risk Ding X, Patel M, Shen D, Herzlich AA, Cao X, Villasmil R, for Parkinson disease. Hum Mutat. 2008a Jun;29(6):832- Klupsch K, Tuo J, Downward J, Chan CC. Enhanced 40 HtrA2/Omi expression in oxidative injury to retinal pigment epithelial cells and murine models of neurodegeneration. Bogaerts V, Theuns J, van Broeckhoven C. Genetic Invest Ophthalmol Vis Sci. 2009 Oct;50(10):4957-66 findings in Parkinson's disease and translation into treatment: a leading role for mitochondria? Genes Brain Kooistra J, Milojevic J, Melacini G, Ortega J. A new Behav. 2008b Mar;7(2):129-51 function of human HtrA2 as an amyloid-beta oligomerization inhibitor. J Alzheimers Dis. Han C, Nam MK, Park HJ, Seong YM, Kang S, Rhim H. 2009;17(2):281-94 Tunicamycin-induced ER stress upregulates the expression of mitochondrial HtrA2 and promotes apoptosis Liu ML, Liu MJ, Shen YF, Ryu H, Kim HJ, Klupsch K, through the cytosolic release of HtrA2. J Microbiol Downward J, Hong ST. Omi is a mammalian heat-shock Biotechnol. 2008 Jun;18(6):1197-202 protein that selectively binds and detoxifies oligomeric amyloid-beta. J Cell Sci. 2009 Jun 1;122(Pt 11):1917-26 Inagaki R, Tagawa K, Qi ML, Enokido Y, Ito H, Tamura T, Shimizu S, Oyanagi K, Arai N, Kanazawa I, Wanker EE, Moisoi N, Klupsch K, Fedele V, East P, Sharma S, Renton Okazawa H. Omi / HtrA2 is relevant to the selective A, Plun-Favreau H, Edwards RE, Teismann P, Esposti vulnerability of striatal neurons in Huntington's disease. MD, Morrison AD, Wood NW, Downward J, Martins LM. Eur J Neurosci. 2008 Jul;28(1):30-40 Mitochondrial dysfunction triggered by loss of HtrA2 results in the activation of a brain-specific transcriptional stress Krick S, Shi S, Ju W, Faul C, Tsai SY, Mundel P, Böttinger response. Cell Death Differ. 2009 Mar;16(3):449-64 EP. Mpv17l protects against mitochondrial oxidative stress and apoptosis by activation of Omi/HtrA2 protease. Proc Narkiewicz J, Lapinska-Szumczyk S, Zurawa-Janicka D, Natl Acad Sci U S A. 2008 Sep 16;105(37):14106-11 Skorko-Glonek J, Emerich J, Lipinska B. Expression of human HtrA1, HtrA2, HtrA3 and TGF-beta1 genes in Marabese M, Mazzoletti M, Vikhanskaya F, Broggini M. primary endometrial cancer. Oncol Rep. 2009 HtrA2 enhances the apoptotic functions of p73 on bax. Cell Jun;21(6):1529-37 Death Differ. 2008 May;15(5):849-58 Su D, Su Z, Wang J, Yang S, Ma J. UCF-101, a novel Narkiewicz J, Klasa-Mazurkiewicz D, Zurawa-Janicka D, Omi/HtrA2 inhibitor, protects against cerebral Skorko-Glonek J, Emerich J, Lipinska B. Changes in ischemia/reperfusion injury in rats. Anat Rec (Hoboken). mRNA and protein levels of human HtrA1, HtrA2 and 2009 Jun;292(6):854-61 HtrA3 in ovarian cancer. Clin Biochem. 2008 May;41(7- 8):561-9 Sutherland GT, Halliday GM, Silburn PA, Mastaglia FL, Rowe DB, Boyle RS, O'Sullivan JD, Ly T, Wilton SD, Plun-Favreau H, Gandhi S, Wood-Kaczmar A, Deas E, Mellick GD. Do polymorphisms in the familial Parkinsonism Yao Z, Wood NW. What have PINK1 and HtrA2 genes told genes contribute to risk for sporadic Parkinson's disease? us about the role of mitochondria in Parkinson's disease? Mov Disord. 2009 Apr 30;24(6):833-8 Ann N Y Acad Sci. 2008 Dec;1147:30-6 Baou M, Kohlhaas SL, Butterworth M, Vogler M, Dinsdale Ross OA, Soto AI, Vilariño-Güell C, Heckman MG, Diehl D, Walewska R, Majid A, Eldering E, Dyer MJ, Cohen GM. NN, Hulihan MM, Aasly JO, Sando S, Gibson JM, Lynch T, Role of NOXA and its ubiquitination in proteasome Krygowska-Wajs A, Opala G, Barcikowska M, Czyzewski inhibitor-induced apoptosis in chronic lymphocytic K, Uitti RJ, Wszolek ZK, Farrer MJ. Genetic variation of leukemia cells. Haematologica. 2010 Sep;95(9):1510-8 Omi/HtrA2 and Parkinson's disease. Parkinsonism Relat Disord. 2008 Nov;14(7):539-43 Behbahani H, Pavlov PF, Wiehager B, Nishimura T, Winblad B, Ankarcrona M. Association of Omi/HtrA2 with Simón-Sánchez J, Singleton AB. Sequencing analysis of γ-secretase in mitochondria. Neurochem Int. 2010 OMI/HTRA2 shows previously reported pathogenic Nov;57(6):668-75 mutations in neurologically normal controls. Hum Mol Genet. 2008 Jul 1;17(13):1988-93 de Castro IP, Martins LM, Tufi R. Mitochondrial quality control and neurological disease: an emerging connection. Whitworth AJ, Lee JR, Ho VM, Flick R, Chowdhury R, Expert Rev Mol Med. 2010 Apr 19;12:e12 McQuibban GA. Rhomboid-7 and HtrA2/Omi act in a common pathway with the Parkinson's disease factors Winklhofer KF, Haass C. Mitochondrial dysfunction in Pink1 and Parkin. Dis Model Mech. 2008 Sep-Oct;1(2- Parkinson's disease. Biochim Biophys Acta. 2010 3):168-74; discussion 173 Jan;1802(1):29-44 Yun J, Cao JH, Dodson MW, Clark IE, Kapahi P, Zurawa-Janicka D, Skorko-Glonek J, Lipinska B. HtrA Chowdhury RB, Guo M. Loss-of-function analysis suggests proteins as targets in therapy of cancer and other that Omi/HtrA2 is not an essential component of the diseases. Expert Opin Ther Targets. 2010 Jul;14(7):665-79 PINK1/PARKIN pathway in vivo. J Neurosci. 2008 Dec Clausen T, Kaiser M, Huber R, Ehrmann M. HTRA 31;28(53):14500-10 proteases: regulated proteolysis in protein quality control. Zurawa-Janicka D, Kobiela J, Stefaniak T, Wozniak A, Nat Rev Mol Cell Biol. 2011 Mar;12(3):152-62 Narkiewicz J, Wozniak M, Limon J, Lipinska B. Changes in

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 355

HTRA2 (HtrA serine peptidase 2) Jarzab M, et al.

de Castro IP, Martins LM, Loh SH. Mitochondrial quality Papa L, Germain D. Estrogen receptor mediates a distinct control and Parkinson's disease: a pathway unfolds. Mol mitochondrial unfolded protein response. J Cell Sci. 2011 Neurobiol. 2011 Apr;43(2):80-6 May 1;124(Pt 9):1396-402 Li S, Wan M, Cao X, Ren Y. Expression of AIF and Singh N, Kuppili RR, Bose K. The structural basis of mode HtrA2/Omi in small lymphocytic lymphoma and diffuse of activation and functional diversity: a case study with large B-cell lymphoma. Arch Pathol Lab Med. 2011 HtrA family of serine proteases. Arch Biochem Biophys. Jul;135(7):903-8 2011 Dec 15;516(2):85-96 Krüger R, Sharma M, Riess O, Gasser T, Van Westerlund M, Behbahani H, Gellhaar S, Forsell C, Belin Broeckhoven C, Theuns J, Aasly J, Annesi G, Bentivoglio AC, Anvret A, Zettergren A, Nissbrandt H, Lind C, Sydow AR, Brice A, Djarmati A, Elbaz A, Farrer M, Ferrarese C, O, Graff C, Olson L, Ankarcrona M, Galter D. Altered Gibson JM, Hadjigeorgiou GM, Hattori N, Ioannidis JP, enzymatic activity and allele frequency of OMI/HTRA2 in Jasinska-Myga B, Klein C, Lambert JC, Lesage S, Lin JJ, Alzheimer's disease. FASEB J. 2011 Apr;25(4):1345-52 Lynch T, Mellick GD, de Nigris F, Opala G, Prigione A, Quattrone A, Ross OA, Satake W, Silburn PA, Tan EK, This article should be referenced as such: Toda T, Tomiyama H, Wirdefeldt K, Wszolek Z, Xiromerisiou G, Maraganore DM. A large-scale genetic Jarzab M, Zurawa-Janicka D, Lipinska B. HTRA2 (HtrA association study to evaluate the contribution of Omi/HtrA2 serine peptidase 2). Atlas Genet Cytogenet Oncol (PARK13) to Parkinson's disease. Neurobiol Aging. 2011 Haematol. 2012; 16(5):347-356. Mar;32(3):548.e9-18

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 356

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

MIR196B (microRNA 196b) Deepak Kaul, Deepti Malik Molecular Biology Unit, Department of Experimental Medicine and Biotechnology, Post Graduate Institute of Medical Education and Research, Chandigarh, India (DK, DM)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR196BID51736ch7p15.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MIR196BID51736ch7p15.txt

region between HOXC10 and HOXC9 on Identity chromosome 12 (12q13.13). Other names: MIRN196B, miR-196b, The gene for miR-196b is located in a highly miRNA196B evolutionarily conserved region between HOXA9 HGNC (Hugo): MIR196B and HOXA10 genes, on chromosome 7 (7p15.2) in human beings. miR-196a-1 and miR-196a-2 genes Location: 7p15.2 transcribe the same functional mature miRNA sequence (3- GGGUUGUUGUACUUUGAUGGAU-5), whereas miR-196b gene produces a small RNA (3- GGGUUGUUGUCCUUUGAUGGAU-5), which differs from the sequence of miR-196a by one Stem-loop structure of miR-196b. nucleotide. Pre-miRNA DNA/RNA The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha Description (RNase III enzyme) and DGCR8 (dsRNA binding miR-196 is non-coding vertebrate specific micro- protein) from their 3' and 5' cleavage sites into an RNA (MI0000238, MI0000279) and has been intermediate stem-loop precursor or pre-miRNA in experimentally confirmed in a wide range of the nucleus. The precursor of miR-196b is 84 bases vertebrate species (MIPF0000031). miR-196b is long (pre-miR-196b), forms a secondary structure, expressed from intergenic regions in HOX gene and contains the mature miRNA sequence, stem clusters that are the targets of miR-196b. and terminal loop structures with 2-nt 3' overhang. The hairpin precursors are predicted based on base The precursor is then transferred from nucleus to pairing and cross-species conservation - their cytoplasm by the enzyme exportin 5. In cytoplasm, extents are not known. a second RNase III enzyme, Dicer, removes In this case the mature sequence is excised from the terminal loop generating about 20-bp RNA duplex. 5' arm of the hairpin. Length: 84 bases. Three miR-196 genes have been found. Sequence: The miR-196a-1 gene is located on chromosome 17 ACUGGUCGGUGAUUUAGGUAGUUUCCUGU (17q21.32) at a site between HOXB9 and HOXB10 UGUUGGGAUCCACCUUUCUCUCGACAGCA genes, and the miR-196a-2 gene is located at a CGACACUGCCUUCAUUACUUCAGUUG

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 357

MIR196B (microRNA 196b) Kaul D, Malik D

hsA-miR-196 (chromosome 7).

HOXB8: target of miR-196b.

Mature miR-196b was associated with an immature The mature miRNA forms one strand of the RNA immunophenotype, and expression of CD34 and duplex. One strand is degraded and other is CD33. Hence, these miRNAs were identified as incorporated in to a protein complex, RNA induced ERG regulators and implicate a potential role in silencing complex (RISC), targeting a partially acute leukemia. complementary target mRNA. miR-196b is 22 Comparison of AML patients with normal nucleotide long. karyotype (NK-AML) showed down-regulation of Sequence: miR-196b in AML patients with abnormal UAGGUAGUUUCCUGUUGUUGGG karyotypes. HOXB8: target of miR-196b Within the hematopoietic lineage, miR-196b is HOXB8 mRNA was shown to be a natural target most abundant in short-term hematopoietic stem for miR-196b-directed cleavage through a perfectly cells and is down-regulated in more differentiated complementary miR-target site. Other HOX genes hematopoietic cells. Analysis of 55 primary have imperfect miR-196 complementary sites leukemia samples reported over-expression of miR- indicative of regulation by translational repression. 196b specifically in patients with MLL associated leukemias and its enhanced expression in bone Implicated in marrow progenitor cells leads to increased proliferative capacity and survival as well as partial Leukemia block in differentiation. This suggests a mechanism Note that how increased expression of miR-196b by Significant down-regulation of miR-196b for the MLL fusion proteins significantly contributes to first time was reported in EB-3, MOLT-4 cell lines leukemia development. as well as in B and T-cell ALL patients as Another report suggests that expression of miR- compared to their corresponding controls. miR- 196b is not exclusively MLL-driven but is linked to 196b restoration in EB-3 cells leads to significant activation of HOXA genes in pediatric acute down-regulation of c-myc (over-amplified in B and lymphoblastic leukemia and its over-expression is T-cell ALL patients) and its effector genes i.e., not unique to MLL-rearranged acute lymphoblastic human telomerase reverse transcriptase (hTERT), leukemia but also occurs in patients with T-cell B-cell lymphoma/leukemia-2 (Bcl-2), apoptosis acute lymphoblastic leukemia patients carrying antagonizing transcription factor (AATF), CALM-AF10, SET-NUP214 and inversion of confirming miR-196b functions as tumor chromosome 7. Like MLL-rearrangements, these suppressor miRNA in B-cell ALL (acute abnormalities are functionally linked with up- lymphoblastic leukemia) however, transfection regulation of HOXA. In correspondence, miR-196b experiments in MOLT-4 cell line revealed that expression in these patients correlated strongly with miR-196b is not able to knock down the expression the levels of HOXA family genes (Spearman's of c-myc gene as it was found that miR-196b loses correlation coefficient ≥ 0,7; P≤ 0,005). Since miR- its ability to down-regulate c-myc gene expression 196b is encoded on the HOXA cluster, these data in T-cell ALL as a consequence of mutations in suggest co-activation of both miR-196b and HOXA target 3'-untranslated region (3'-UTR) of the c-myc genes in acute lymphoblastic leukemia. Up- gene. regulation of miR-196b coincides with reduced Expression of miR-196a and miR-196b is higher in DNA methylation at CpG islands in the promoter AML patients with NPM1 gene (nucleophosmin) regions of miR-196b and the entire HOXA cluster mutations as compared to NPM1-wildtype. In T- in MLL-rearranged cases compared to the cases of ALL patients, miR-196a and miR-196b expression non-MLL precursor B-cell acute lymphoblastic

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 358

MIR196B (microRNA 196b) Kaul D, Malik D

leukemia and normal bone marrow (P< 0,05), metastatic status of these samples instead, the ratio suggesting an epigenetic origin for miR-196b over- of miR-196s to HOXC8 mRNA was significantly expression. miR-196b possess an oncogenic activity lower in metastatic tissues than that of metastasis- in bone marrow progenitor cells, these findings free specimens or normal breast tissues. imply a potential role for miR-196b in the These results suggest that the ratio of miR-196s to underlying biology of all HOXA-activated HOXC8 mRNA may be specifically correlated with leukemias. the metastasis status of breast tumors. Gastric cancer Pancreatic cancer Note Note Hypomethylation status of miR-196b CpG islands Reports in the literature reveal that miR-196a and and overexpression of this miRNA was observed in miR-196b levels were significantly increased in primary gastric tumors providing a link that DNA pancreatic ductal adenocarcinoma (PDAC) hypomethylation induces overexpression of miR- compared with normal tissue, as well as normal 196b in gastric cancer. pancreatic lines and acute pancreatitis specimens. Glioblastoma Myelopoiesis Note Note Expression profiles in glioblastomas and anaplastic Gfi1 is a master regulator of miR expression in astrocytomas suggested that miR-196a and miR- hematopoietic cells and it directly regulates miR-21 196b showed increased expression levels in and miR196b during myelopoiesis. Deregulation of glioblastomas relative to both anaplastic their expression distorts myelopoiesis. The miR- astrocytomas and normal brains. miR-196a showed 196b expression specifically and significantly the most significant difference (P= 0,0038), with controls granulocytic colony numbers and miR-196b also having a high significance (P= significantly (but not completely) blocks G-CSF- 0,0371). Furthermore, patients with high miR-196 stimulated granulopoiesis, acting as a negative expression levels showed significantly poorer regulator of granulocytic differentiation. Recently, survival by the Kaplan-Meier method (P= 0,0073). it has been shown that PRDM5 transcription factor Analysis of expression of miR-196b in a group of regulates miR-21 and miR-196b through its 38 patients with primary glioblastoma multiforme interaction with Gfi1. GFI1 function is required for (GBM) showed that miR-196b (P= 0,0492; log- normal expression of miR-21 and miR-196b in rank test) positively correlated with overall survival healthy individuals and Gfi1 loss of function further confirming that miR-196 may play a role in (GFI1N382S (mutant) SCN patient) and the higher the malignant progression of gliomas and may be a steady-state levels of miR-21 and miR-196b prognostic predictor in glioblastomas. overexpression propagate the dominant-negative Breast cancer effect of the GFI1N382S protein and disrupts granulocytic differentiation. Note miR-196s function as potent metastasis suppressors References and the ratio of miR-196s to HOXC8 mRNA might be an indicator of the metastatic capability of breast Duan Z, Person RE, Lee HH, Huang S, Donadieu J, Badolato R, Grimes HL, Papayannopoulou T, Horwitz MS. tumors. Transfection studies in metastatic MDA- Epigenetic regulation of protein-coding and microRNA MB-231 breast cancer cells identified members of genes by the Gfi1-interacting tumor suppressor PRDM5. the miRNA-196 family (miR-196a1, miR-196a2, Mol Cell Biol. 2007 Oct;27(19):6889-902 and miR-196b) suppresses in vitro invasion and in Paranjape T, Slack FJ, Weidhaas JB. MicroRNAs: tools for vivo spontaneous metastasis of breast cancer cells. cancer diagnostics. Gut. 2009 Nov;58(11):1546-54 Further evidence providing the association between Popovic R, Riesbeck LE, Velu CS, Chaubey A, Zhang J, miR-196b and the transcription factor HOXC8 was Achille NJ, Erfurth FE, Eaton K, Lu J, Grimes HL, Chen J, that miR-196 inhibits the expression of HOXC8. Rowley JD, Zeleznik-Le NJ. Regulation of mir-196b by Functional linkage was implied by small interfering MLL and its overexpression by MLL fusions contributes to RNA-mediated knockdown of HOXC8, which immortalization. Blood. 2009 Apr 2;113(14):3314-22 suppressed cell migration and metastasis, and by Velu CS, Baktula AM, Grimes HL. Gfi1 regulates miR-21 ectopic expression of HOXC8, which prevented the and miR-196b to control myelopoiesis. Blood. 2009 May 7;113(19):4720-8 effects of miR-196 on cell migration and metastasis. Bhatia S, Kaul D, Varma N. Potential tumor suppressive function of miR-196b in B-cell lineage acute lymphoblastic RNAs from 25 breast cancer tumors (8 metastatic leukemia. Mol Cell Biochem. 2010 Jul;340(1-2):97-106 tumor specimens and 17 metastasis-free tumor samples) and 4 normal breast tissues were analyzed Guan Y, Mizoguchi M, Yoshimoto K, Hata N, Shono T, Suzuki SO, Araki Y, Kuga D, Nakamizo A, Amano T, Ma X, by using qRT-PCR, which showed that the levels of Hayashi K, Sasaki T. MiRNA-196 is upregulated in HOXC8 mRNA or miR-196s (miR-196a and miR- glioblastoma but not in anaplastic astrocytoma and has 196b together) were not correlated with the

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 359

MIR196B (microRNA 196b) Kaul D, Malik D

prognostic significance. Clin Cancer Res. 2010 Aug Bhatia S, Kaul D, Varma N. Functional genomics of tumor 15;16(16):4289-97 suppressor miR-196b in T-cell acute lymphoblastic leukemia. Mol Cell Biochem. 2011 Jan;346(1-2):103-16 Li Y, Zhang M, Chen H, Dong Z, Ganapathy V, Thangaraju M, Huang S. Ratio of miR-196s to HOXC8 messenger Chen C, Zhang Y, Zhang L, Weakley SM, Yao Q. RNA correlates with breast cancer cell migration and MicroRNA-196: critical roles and clinical applications in metastasis. Cancer Res. 2010 Oct 15;70(20):7894-904 development and cancer. J Cell Mol Med. 2011 Jan;15(1):14-23 Schotte D, Lange-Turenhout EA, Stumpel DJ, Stam RW, Buijs-Gladdines JG, Meijerink JP, Pieters R, Den Boer ML. Coskun E, von der Heide EK, Schlee C, Kühnl A, Expression of miR-196b is not exclusively MLL-driven but Gökbuget N, Hoelzer D, Hofmann WK, Thiel E, Baldus CD. is especially linked to activation of HOXA genes in The role of microRNA-196a and microRNA-196b as ERG pediatric acute lymphoblastic leukemia. Haematologica. regulators in acute myeloid leukemia and acute T- 2010 Oct;95(10):1675-82 lymphoblastic leukemia. Leuk Res. 2011 Feb;35(2):208-13

Tsai KW, Hu LY, Wu CW, Li SC, Lai CH, Kao HW, Fang This article should be referenced as such: WL, Lin WC. Epigenetic regulation of miR-196b expression in gastric cancer. Genes Chromosomes Cancer. 2010 Kaul D, Malik D. MIR196B (microRNA 196b). Atlas Genet Nov;49(11):969-80 Cytogenet Oncol Haematol. 2012; 16(5):357-360.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 360

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Gene Section Review

PRLR (prolactin receptor) Chon-Hwa Tsai-Morris, Maria L Dufau Section on Molecular Endocrinology, Program Developmental Endocrinology and Genetics, NICHD, National Institutes of Health, Bethesda, MD 20892-4510, USA (CHTM, MLD)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Genes/PRLRID42891ch5p14.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI PRLRID42891ch5p14.txt

This article is an update of : Tsai-Morris CH, Dufau ML. PRLR (Prolactin receptor). Atlas Genet Cytogenet Oncol Haematol 2004;8(4)

promoters belong to the TATA-less/non-initiator Identity class. The hPIII promoter contains Sp1 and C/EBP Other names: PRL-R elements that bind Sp1/Sp3 and C/EBPβ required HGNC (Hugo): PRLR for basal and regulated transcriptional activity, while hPN1 activity is conferred by domains Location: 5p13.2 containing an Ets element and an NR half-site. Note: The PRLR belongs to the class I cytokine hPN2-5 have not been characterized. receptor family. Estrogen regulates PRLR transcription through the This receptor binds the pituitary hormone prolactin preferentially utilized PIII promoter via a non- with high affinity. classical ERE independent mechanism in target cells. It contains an extracellular binding domain with 2 fibronectin-like type III domains, a single The protein association induced by estradiol of transmembrane domain, and an intracellular domain estrogen receptor α (ERα) with DNA-bound Sp1 required for signal transduction (via JAK-2/STAT5 (constitutive) and C/EBPβ (recruited by the ERα- and other pathways) that lacks intrinsic kinase SP1 complex) is essential for human prolaction activity. receptor gene transcription (figure 1C). Additional interaction between zinc fingers of Sp1 DNA/RNA and leucine zipper of C/EBPβ stabilizes the ERα- Sp1-C/EBPβ complex. Description The enhanced complex formation of ERα dimer (DNA binding domain) with Sp1 (zinc finger No known pseudogenes. motifs) and C/EBPβ (basic region and leucine Transcription zipper) by E2 plays an essential role in the Transcription of human prolactin receptor gene is transcriptional activation of the hPRLR gene. regulated by a multiple and tissue-specific promoter Pseudogene (hPIII for exons 1 species hE1 and hPN for 3 1-5 No known pseudogenes. exons 1 species hE1N ). The prolactin receptor 1-5

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 361

PRLR (prolactin receptor) Tsai-Morris CH, Dufau ML

Figure 1. A. Localization of multiple first exons and exons 2-11 of the human prolactin receptor gene in chromosome 5p 14-13. Alternative exons 1: hE13 (generic) and hE1N1-5 (human specific); exon 2: non-coding exon; exon 3: non-coding/coding ATG translation initiation codon; exons 4-11: coding exons.

Figure 1. B. Schematic representation of multiple exons 1 and alternative splicing to common exon 2.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 362

PRLR (prolactin receptor) Tsai-Morris CH, Dufau ML

Figure 1. C. Model for E2-ERα-Sp1-C/EBPβ formation and binding to the hPIII promoter of the human prolactin receptor gene. Schematic presentation of the functional domain of ERα, Sp1 and C/EBPβ and the cognate DNA binding site of Sp1 and C/EBPβ in the hPIII promoter. Each protein is constitutively present as a homodimer dimer. ERα:AF: transactivation domain, DBD: DNA binding domain, H: hinge region, LBD: ligand binding domain; C/EBPβ:BR: basic region, LZ: leucine zipper domain; Sp1:TAD: transactivation domain, ZF: zinc finger motif.

gland development (proliferation and Protein differentiation), initiation and maintenance of Description lactation, regulation of water and salt balance, reproduction, gonadal steroidogenesis, preservation Prolactin receptors have been identified in number of sperm integrity, embryonic implantation, brain of cells and tissues including the mammary gland, and behavior, and immune-regulation (see organs of the reproductive system, central nervous description). system, pituitary, adrenal cortex, skin, bone, lung, heart, liver, pancreas, GI tract, kidney, lymphoid Function tissue and spermatozoa. These are also present in The prolactin receptor mediates prolactin signaling breast cancer tissues and cells and in other tumoral and triggers intracellular responses that participate tissues/cells. in diverse biological functions including, mammary Expression gland development (proliferation and differentiation), initiation and maintenance of Localized in the cell membrane, but also present lactation, regulation of water and salt balance, intracellularly at various compartments. reproduction, gonadal steroidogenesis, preservation Localisation of sperm integrity, embryonic implantation, brain The prolactin receptor mediates prolactin signaling and behavior, and immune-regulation (see and triggers intracellular responses that participate description) in diverse biological functions including, mammary

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 363

PRLR (prolactin receptor) Tsai-Morris CH, Dufau ML

Figure 2. A. Schematic representation of human PRLR variants. Forms generated by alternative splicing.

Figure 2. B. Structure of human prolactin receptor variants. Receptor structure of the various forms. LF: long form; IF: intermediate form; S: short forms; 10': partial exon 10; Δ#: deleted exon; #/#: exon/exon splice variant; D1, D2: N-terminal subdomain; WS: WSXWS motif; C: cysteine; Y: tyrosine; EC: extracellular domain; TM: transmembrane domain; IC: intracellular domain. Blue boxes (dark and light) in IC represent two unique sequences of short forms derived from exon 11. Amino acid number includes the signal peptide.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 364

PRLR (prolactin receptor) Tsai-Morris CH, Dufau ML

Mellai M, Giordano M, D'Alfonso S, Marchini M, Scorza R, Implicated in Giovanna Danieli M, Leone M, Ferro I, Liguori M, Trojano M, Ballerini C, Massacesi L, Cannoni S, Bomprezzi R, Various diseases Momigliano-Richiardi P. Prolactin and prolactin receptor gene polymorphisms in multiple sclerosis and systemic Note lupus erythematosus. Hum Immunol. 2003 Feb;64(2):274- Changes in the expression of prolactin receptor 84 variants were found in breast cancer tissues and Trott JF, Hovey RC, Koduri S, Vonderhaar BK. Alternative cells lines when compared to adjacent normal splicing to exon 11 of human prolactin receptor gene tissues/cells. Polymorphism of prolactin receptor results in multiple isoforms including a secreted prolactin- may be related to breast carcinoma, multiple binding protein. J Mol Endocrinol. 2003 Feb;30(1):31-47 sclerosis and systemic lupus erythematosus. Two Canbay E, Degerli N, Gulluoglu BM, Kaya H, Sen M, missense variants found in patients with breast Bardakci F. Could prolactin receptor gene polymorphism tumor, Valine for Isoleucine 76 (I76V) and Leucine play a role in pathogenesis of breast carcinoma? Curr Med Res Opin. 2004 Apr;20(4):533-40 for Isoleucine 146 (I146L) with gain of function were proposed to participate in breast Meng J, Tsai-Morris CH, Dufau ML. Human prolactin receptor variants in breast cancer: low ratio of short forms tumorigenesis. to the long-form human prolactin receptor associated with mammary carcinoma. Cancer Res. 2004 Aug References 15;64(16):5677-82 Di Carlo R, Muccioli G, Bellussi G, Lando D, Mussa A. Dong J, Tsai-Morris CH, Dufau ML. A novel Presence and characterization of prolactin receptors in estradiol/estrogen receptor alpha-dependent human benign breast tumours. Eur J Cancer Clin Oncol. transcriptional mechanism controls expression of the 1984 May;20(5):635-8 human prolactin receptor. J Biol Chem. 2006 Jul 7;281(27):18825-36 Dowsett M, McGarrick GE, Staffurth J, Worth RW, Chapman MG, Jeffcoate SL. Absence of prolactin Qazi AM, Tsai-Morris CH, Dufau ML. Ligand-independent receptors in normal and malignant uterine cervix. Br J homo- and heterodimerization of human prolactin receptor Obstet Gynaecol. 1984 Sep;91(9):924-6 variants: inhibitory action of the short forms by heterodimerization. Mol Endocrinol. 2006 Aug;20(8):1912- Boutin JM, Edery M, Shirota M, Jolicoeur C, Lesueur L, Ali 23 S, Gould D, Djiane J, Kelly PA. Identification of a cDNA encoding a long form of prolactin receptor in human Bogorad RL, Courtillot C, Mestayer C, Bernichtein S, hepatoma and breast cancer cells. Mol Endocrinol. 1989 Harutyunyan L, Jomain JB, Bachelot A, Kuttenn F, Kelly Sep;3(9):1455-61 PA, Goffin V, Touraine P. Identification of a gain-of- function mutation of the prolactin receptor in women with Hu ZZ, Zhuang L, Meng J, Leondires M, Dufau ML. The benign breast tumors. Proc Natl Acad Sci U S A. 2008 Sep human prolactin receptor gene structure and alternative 23;105(38):14533-8 promoter utilization: the generic promoter hPIII and a novel human promoter hP(N). J Clin Endocrinol Metab. 1999 Xie YL, Hassan SA, Qazi AM, Tsai-Morris CH, Dufau ML. Mar;84(3):1153-6 Intramolecular disulfide bonds of the prolactin receptor short form are required for its inhibitory action on the Kline JB, Roehrs H, Clevenger CV. Functional function of the long form of the receptor. Mol Cell Biol. characterization of the intermediate isoform of the human 2009 May;29(10):2546-55 prolactin receptor. J Biol Chem. 1999 Dec 10;274(50):35461-8 Goffin V, Bogorad RL, Touraine P. Identification of gain-of- function variants of the human prolactin receptor. Methods Laud K, Gourdou I, Belair L, Peyrat JP, Djiane J. Enzymol. 2010;484:329-55 Characterization and modulation of a prolactin receptor mRNA isoform in normal and tumoral human breast Pujianto DA, Curry BJ, Aitken RJ. Prolactin exerts a tissues. Int J Cancer. 2000 Mar 15;85(6):771-6 prosurvival effect on human spermatozoa via mechanisms that involve the stimulation of Akt phosphorylation and Gill S, Peston D, Vonderhaar BK, Shousha S. Expression suppression of caspase activation and capacitation. of prolactin receptors in normal, benign, and malignant Endocrinology. 2010 Mar;151(3):1269-79 breast tissue: an immunohistological study. J Clin Pathol. 2001 Dec;54(12):956-60 Tan D, Walker AM. Short form 1b human prolactin receptor down-regulates expression of the long form. J Mol Hu ZZ, Meng J, Dufau ML. Isolation and characterization Endocrinol. 2010 Mar;44(3):187-94 of two novel forms of the human prolactin receptor generated by alternative splicing of a newly identified exon Kang JH, Tsai-Morris CH, Dufau ML. Complex formation 11. J Biol Chem. 2001 Nov 2;276(44):41086-94 and interactions between transcription factors essential for human prolactin receptor gene transcription. Mol Cell Biol. Hu ZZ, Zhuang L, Meng J, Tsai-Morris CH, Dufau ML. 2011 Aug;31(16):3208-22 Complex 5' genomic structure of the human prolactin receptor: multiple alternative exons 1 and promoter This article should be referenced as such: utilization. Endocrinology. 2002 Jun;143(6):2139-42 Tsai-Morris CH, Dufau ML. PRLR (prolactin receptor). Kline JB, Rycyzyn MA, Clevenger CV. Characterization of Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):361- a novel and functional human prolactin receptor isoform 365. (deltaS1PRLr) containing only one extracellular fibronectin- like domain. Mol Endocrinol. 2002 Oct;16(10):2310-22

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 365

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Leukaemia Section Short Communication t(3;11)(p25;p15) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: November 2011 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0311p25p15ID1509.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t0311p25p15ID1509.txt

Clinics and pathology Protein 1053 and 1086 amino acids isoforms. Disease Contains 30 ankyrin repeats (protein-protein Myelodysplastic syndrome (MDS) and acute interaction motifs). ANKRD28 forms a complex myeloid leukemia (AML) with BCAR1/p130Cas, CRK, and DOCK1 to enhance BCAR1 phosphorylation. ANKRD28 is Epidemiology required for cell migration (Kiyokawa and Matsuda, Two cases to date, with a possible identical 2009). rearrangement. PP6 is a multisubunit enzyme, comprising a A 32-year-old man have had a common acute catalytic subunit, a phosphatase-associated protein lymphoblastic leukemia (c-ALL) with a del(9p). A (SAPS) domain regulatory subunit and ankyrin bone marrow transplantation (BMT) was repeat domain subunits. PP6 holoenzyme, performed. The donor was his sister. Fifteen comprising PPP6C catalytic, SAPS1-3 regulatory, months later, a secondary AML with and ANKRD28 and ANKRD44 subunits, is erythrophagocytosis developped. The karyotype required for normal mitotic progression (Zeng et was 46,XX (suggesting that the leukemic clone al., 2010). derived from the sibling bone marrow donor), with NUP98 the following anomalies: a t(3;11)(p25;p15), but also the classical t(8;16)(p11;p13) with Location MYST3/REBBP rearrangement. The patient died a 11p15 month later. NUP98 was not tested (Schmidt et al., Protein 2004). Nucleoporin: associated with the nuclear pore A 33-year-old woman with a refractory anemia with complex. Role in nucleocytoplasmic transport excess of blasts in transformation exhibited a processes. t(3;5;11)(p24;q35;p15) with ANKRD28-NUP98 and NUP98-NSD1 rearrangements, Transformation Result of the chromosomal to AML occured 2 weeks later. In spite of a BMT, the patient died 7 months after diagnosis (Ishikawa anomaly et al., 2007). Hybrid gene Genes involved and Description Two in-frame fusion transcripts 5' ANKRD28 - 3' proteins NUP98 (exons 18 and 13 respectively), and 5' ANKRD28 NUP98 - 3' NSD1 (exons 12 and 7 respectively) were produced in the case reported by Ishikawa et Location al. in 2007. 3p25

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 366 t(3;11)(p25;p15) Huret JL

Fusion protein CBP transcripts: breakpoint cluster region and clinical implications. Leukemia. 2004 Jun;18(6):1115-21 Expression / Localisation Ishikawa M, Yagasaki F, Okamura D, Maeda T, Sugahara Although 5' NUP98 - 3' partner is the usual fusion Y, Jinnai I, Bessho M. A novel gene, ANKRD28 on 3p25, is transcript involved in leukemogenesis with 11p15 fused with NUP98 on 11p15 in a cryptic 3-way involvement, the present 5' ANKRD28 - 3' NUP98 translocation of t(3;5;11)(p25;q35;p15) in an adult patient fusion transcript may have played a role. with myelodysplastic syndrome/acute myelogenous leukemia. Int J Hematol. 2007 Oct;86(3):238-45 ANKRD28-NUP98 was localized in the nucleolus and cytoplasm and might have contributed to the Kiyokawa E, Matsuda M. Regulation of focal adhesion and cell migration by ANKRD28-DOCK180 interaction. Cell leukemogenesis process. Cells transfected with Adh Migr. 2009 Jul-Sep;3(3):281-4 ANKRD28-NUP98 formed more foci than cells transfected with the wild type ANKRD28 (Ishikawa Zeng K, Bastos RN, Barr FA, Gruneberg U. Protein phosphatase 6 regulates mitotic spindle formation by et al., 2007). controlling the T-loop phosphorylation state of Aurora A bound to its activator TPX2. J Cell Biol. 2010 Dec References 27;191(7):1315-32 Schmidt HH, Strehl S, Thaler D, Strunk D, Sill H, Linkesch This article should be referenced as such: W, Jäger U, Sperr W, Greinix HT, König M, Emberger W, Haas OA. RT-PCR and FISH analysis of acute myeloid Huret JL. t(3;11)(p25;p15). Atlas Genet Cytogenet Oncol leukemia with t(8;16)(p11;p13) and chimeric MOZ and Haematol. 2012; 16(5):366-367.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 367

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Short Communication

Bone: Aneurysmal bone cysts Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Tumors/AneurBoneCystID5133.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI AneurBoneCystID5133.txt

This article is an update of : Dal Cin P. Bone: Aneurysmal bone cysts. Atlas Genet Cytogenet Oncol Haematol 2004;8(3) Dal Cin P. Bone: Aneurysmal bone cysts. Atlas Genet Cytogenet Oncol Haematol 2002;6(2)

septa composed of mildly to moderately mitotically Clinics and pathology active spindle cells intermixed with scattered Etiology osteoclast-like multinucleated giant cells. Approximately 95% of ABC have typical histology The most widely accepted pathogenetic mechanism whereas the remaining 5% are "solid" variants in of aneurysmal bone cysts has long involved a local which the usual cavernous channels and spaces may circulatory disturbance leading to markedly not be identified. increased venous pressure and the development of a An extraosseous couterpart of ABC has been dilated and enlarged vascular bed within the described, sometimes referred to as ABC of soft affected bone area. However, the recent tissues, and is histologically identical to ABC but identification of recurrent chromosome diagnosed much less frequently. abnormalities has challenged this historical perception. May involve the arrest of maturation of Treatment the osteoblasts caused by USP6 overexpression and ABC is most frequently treated by curettage, but dysregulation of autocrine BMP (bone morphology local recurrences can still occur in about one fourth protein) signaling (Lau et al., 2010). of cases. Clinics Cytogenetics Aneurysmal bone cysts (ABC) are benign lesions, but locally aggressive, that occur more frequently in Cytogenetics Morphological the metaphyses of long bones, especially distal Chromosome bands 16q22 and/or 17p13 are non femur, the proximal tibia and vertebral posterior randomly rearranged in ABC, regardless of tumor bodies. Multiple involvement is frequent. It can type (classic, solid) and or location (osseous and occur at any age but most patients are diagnosed in extraosseous). A recurrent t(16;17)(q22;p13), with the first 2 decades of life. It can exist as primary CDH11 and USP6 involvements, has been bone lesion or as secondary lesions arising in identified in at least eleven cases to date, but other association with other osseous conditions, namely chromosomal segments as translocation partner for giant cell tumor, chondroblastoma, chondromyxoid each chromosome have been described: fibroma and fibrous dysplasia. Pain and swelling - A t(1;17)(p34;p13) THRAP3/USP6 was found in are the most common complaints. one case. Pathology - A t(3;17)(q21;p13) CNBP/USP6 was found in one As the name implies, the lesion is case. histopathologically characterized by hemorrhagic - A t(9;17)(q22;p13) OMD/USP6 was found in one cystic and cavernous spaces surrounded by fibrous case.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 368

Bone: Aneurysmal bone cysts Huret JL

- A t(17;17)(p13;q21) COL1A1/USP6 was found in testicular tissue, it has been suggested that USP6 two cases. contributed to hominoid speciation. Until recently Other translocations of note: USP6 function was poorly know but recent data - one case of t(2;17)(p23;p13) (Sciot et al., 2000), suggest that USP6 is a component of a novel - two cases of t(6;17)(p21;p13) (Winnepenninckx et effector pathway for Rho GTPases Cdc42 and Rac1 al., 2001; Althof et al., 2004), and stimulates actin remodeling. USP6, also called - two cases of t(11;16)(q13;q22-23), one with a TRE17/ubiquitin-specific protease 6 (USP6), is a classical bone tumor, the other with a tumor of the deubiquitinase. It is the first de-ubiquitinating soft tissues (Dal Cin et al., 2000; Oliveira et al., enzyme to activate NF-KB, and requires both 2004), catalytic subunits of IKK (IKKalpha and IKKbeta) - one case of del(16)(q22) (Panagopoulos et al., (Pringle et al., 2011). 2001), THRAP3 - three cases with a t(17;17)(p13;q12) or an inv(17)(p13q11-12) (Dal Cin et al., 2000; Nielsen Location et al., 2002; Althof et al., 2004). 1p34 Although additional cases should be studied, it Protein appears that in combined giant cell tumor and THRAP3, also called TRAP150, is made of an secondary aneurysmal bone cyst, both lesions can arginine/serine-rich sequence in the N-terminal retain their characteristic chromosomal aberrations. region and domains with similarity with BCLAF1 and with CASC3/MLN51 in the C-terminal region. Genes involved and It is part of the transcription regulatory complex proteins TRAP/Mediator, and a component of the spliceosome. It both activates pre-mRNA splicing Note and induces mRNA degradation. The So far, USP6 is constantly involved : arginine/serine-rich N-term of THRAP3 is - in the t(1;17)(p34;p13) THRAP3/USP6, responsible for its splicing activity, and the C-term - the t(3;17)(q21;p13) CNBP/USP6, part for its mRNA degradation activity (Lee et al., - the t(9;17)(q22;p13) OMD/USP6, 2010). - the t(16;17)(q22;p13) CDH11/USP6, CNBP - and the t(17;17)(p13;q21) COL1A1/USP6. However, as mentioned above, the 16q22 Location breakpoint has also been found recurrently in the 3q21 absence of an apparent 17p13 involvement, e.g. in Protein the t(11;16)(q13;q22-23) or in the del(16)(q22). CNBP, also called ZNF9, is made of 7 CCHC-type USP6 Zn fingers. Nucleic acid binding protein; binds single stranded DNA and RNA; act as a regulator Location of transcription and translation of many genes, 17p13 including MYC. CNBP may regulate gene DNA / RNA expression by catalyzing the formation of G4s (G- 7878 bp (major transcript). quadruplexes, formed by intramolecular four- stranded DNA structures). Protein 1406 amino acids; USP6 is a hominoid-specific Germinal mutations gene that was initially cloned from an Ewing Myotonic dystrophy DM2 is caused by expansion sarcoma cell line. It arose from an evolutionary of a (CCTG)(n) in CNBP. CNBP has also been chimeric gene fusion between the TBC1D3 (also implicated in sporadic inclusion body myositis known as PRC17) and USP32 (NY-REN-60) genes, (review in Calcaterra et al., 2010). which are both located on the long arm of OMD chromosome 17. Sequence comparisons indicate that the first 14 exons of USP6 are derived from Location TBC1D3 (PRC17) whereas exons 15 to 30 are 9q22 derived from USP32. TBC1D3 (PRC17) is located Protein at chromosome band 17q12 and encodes a protein OMD (osteomodulin), also called OSAD with a TBC/GAP domain involved in Rab/Ypt (osteoadherin), is a member of the small leucine GTPase signaling. USP32 is located at chromosome rich-repeat proteoglycan (SLRP) family. It is an band 17q23 and encodes a protein composed of two extracellular matrix keratan sulfate proteoglycan EF-hand calcium-binding motifs, a myristoylation restricted to mineralized tissues. OMD is a marker site, and a UBP domain. USP6 protein retains the for terminally differentiated matrix producing TBC domain of TBC1D3 (PRC17) and the UBP osteoblasts. OMD expression enhances the domain of USP32. Because USP6 is absent in non- differentiation and maturation of osteoblasts. It is hominoid primates and is primarily expressed in induced by osteoclast activity (Rehn et al., 2008).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 369

Bone: Aneurysmal bone cysts Huret JL

CDH11 Oncogenesis Location Upregulation of USP6 mediated by the highly active CDH11 (or other) promoter. 16q22 DNA / RNA References 3.6 and 3.8 kb mRNA (two major transcripts). Pfeifer FM, Bridge JA, Neff JR, Mouron BJ. Cytogenetic Protein findings in aneurysmal bone cysts. Genes Chromosomes 693 and 796 amino acids; membrane protein that Cancer. 1991 Nov;3(6):416-9 mediate calcium-dependent cell-cell adhesion, Bertoni F, Bacchini P, Capanna R, Ruggieri P, Biagini R, member of the cadherin superfamily. CDH11 seems Ferruzzi A, Bettelli G, Picci P, Campanacci M. Solid variant to be highly expressed during the development and of aneurysmal bone cyst. Cancer. 1993 Feb 1;71(3):729- differentiation of the osteoblastic lineage, indicating 34 an important role in bone development. Two splice Rodríguez-Peralto JL, López-Barea F, Sánchez-Herrera S, variants have been identified, one of which encodes Atienza M. Primary aneurysmal cyst of soft tissues (extraosseous aneurysmal cyst) Am J Surg Pathol. 1994 an isoform with a shorter cytoplasmic domain. Its Jun;18(6):632-6 intracellular domain is anchored to the actin cytoskeleton through alpha and beta-catenin. Role Dal Cin P, Kozakewich HP, Goumnerova L, Mankin HJ, Rosenberg AE, Fletcher JA. Variant translocations in maintaining tissue architecture and cell polarity, involving 16q22 and 17p13 in solid variant and limiting cell movement and proliferation. CDH11 extraosseous forms of aneurysmal bone cyst. Genes antagonizes Wnt/beta-catenin signaling pathway, Chromosomes Cancer. 2000 Jun;28(2):233-4 induces apoptosis, and regulates epithelial- Sciot R, Dorfman H, Brys P, Dal Cin P, De Wever I, mesenchymal transition (Li et al., 2011). CDH11 is Fletcher CD, Jonson K, Mandahl N, Mertens F, Mitelman involved in various cancers. Tumor suppressor F, Rosai J, Rydholm A, Samson I, Tallini G, Van den function. Berghe H, Vanni R, Willén H. Cytogenetic-morphologic correlations in aneurysmal bone cyst, giant cell tumor of COL1A1 bone and combined lesions. A report from the CHAMP study group. Mod Pathol. 2000 Nov;13(11):1206-10 Location Baruffi MR, Neto JB, Barbieri CH, Casartelli C. Aneurysmal 17q21 bone cyst with chromosomal changes involving 7q and Protein 16p. Cancer Genet Cytogenet. 2001 Sep;129(2):177-80 Two pro a1(I) chain associate in trimers with one Herens C, Thiry A, Dresse MF, Born J, Flagothier C, pro a2(I) chain to form the type I collagen fibrils Vanstraelen G, Allington N, Bex V. Translocation after proteolysis. Constituent of the extra cellular (16;17)(q22;p13) is a recurrent anomaly of aneurysmal bone cysts. Cancer Genet Cytogenet. 2001 matrix in connective tissue of bone, skin, tendon, May;127(1):83-4 ligament, teeth. Nielsen GP, Fletcher CD, Smith MA, Rybak L, Rosenberg Germinal mutations AE. Soft tissue aneurysmal bone cyst: a clinicopathologic COL1A1 has been found mutated in osteoporosis, study of five cases. Am J Surg Pathol. 2002 Jan;26(1):64-9 osteogenesis imperfecta types I-IV, Ehlers-Danlos Wyatt-Ashmead J, Bao L, Eilert RE, Gibbs P, Glancy G, types I and VIIA, and Caffey disease (Stover and McGavran L. Primary aneurysmal bone cysts: 16q22 Verrelli, 2011). and/or 17p13 chromosome abnormalities. Pediatr Dev Pathol. 2001 Jul-Aug;4(4):418-9 Result of the chromosomal Winnepenninckx V, Debiec-Rychter M, Jorissen M, Bogaerts S, Sciot R. Aneurysmal bone cyst of the nose anomaly with 17p13 involvement. Virchows Arch. 2001 Nov;439(5):636-9 Hybrid Gene Fletcher CDM, Unni KK, Mertens F.. World Health Description Organization Classification of Tumors. Pathology and Genetics of Tumors of Soft Tissue Tumor and Bone. 5' partner - 3' USP6 Aneurysmal bone cyst. IARC Press: Lyon 2002: 338-339. Fusion Protein Althof PA, Ohmori K, Zhou M, Bailey JM, Bridge RS, Description Nelson M, Neff JR, Bridge JA.. Cytogenetic and molecular cytogenetic findings in 43 aneurysmal bone cysts: Fusion of the promoter region of CDH11 aberrations of 17p mapped to 17p13.2 by fluorescence in (noncoding exons 1 and 2) to the entire coding situ hybridization. Mod Pathol. 2004 May;17(5):518-25. region of USP6, which starts on exon 2 in the Oliveira AM, Hsi BL, Weremowicz S, Rosenberg AE, Dal (16;17)(q22;p13). Therefore, there is only a fusion Cin P, Joseph N, Bridge JA, Perez-Atayde AR, Fletcher gene but not a fusion protein. This type of gene JA.. USP6 (Tre2) fusion oncogenes in aneurysmal bone fusion is known as promoter swapping and has been cyst. Cancer Res. 2004 Mar 15;64(6):1920-3. described in other solid tumors, including Oliveira AM, Perez-Atayde AR, Inwards CY, Medeiros F, pleomorphic adenoma and lipoblastoma. The same Derr V, Hsi BL, Gebhardt MC, Rosenberg AE, Fletcher model applies to translocations of USP6 with other JA.. USP6 and CDH11 oncogenes identify the neoplastic cell in primary aneurysmal bone cysts and are absent in partners.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 370

Bone: Aneurysmal bone cysts Huret JL

so-called secondary aneurysmal bone cysts. Am J Pathol. Nucleic Acids Res. 2010 Jun;38(10):3340-50. Epub 2010 2004 Nov;165(5):1773-80. Jan 31. Oliveira AM, Perez-Atayde AR, Dal Cin P, Gebhardt MC, Li L, Ying J, Li H, Zhang Y, Shu X, Fan Y, Tan J, Cao Y, Chen CJ, Neff JR, Demetri GD, Rosenberg AE, Bridge JA, Tsao SW, Srivastava G, Chan AT, Tao Q.. The human Fletcher JA.. Aneurysmal bone cyst variant translocations cadherin 11 is a pro-apoptotic tumor suppressor upregulate USP6 transcription by promoter swapping with modulating cell stemness through Wnt/b-catenin signaling the ZNF9, COL1A1, TRAP150, and OMD genes. and silenced in common carcinomas. Oncogene. 2011 Oncogene. 2005 May 12;24(21):3419-26. Dec 5. doi: 10.1038/onc.2011.541. [Epub ahead of print] Rehn AP, Cerny R, Sugars RV, Kaukua N, Wendel M.. Pringle LM, Young R, Quick L, Riquelme DN, Oliveira AM, Osteoadherin is upregulated by mature osteoblasts and May MJ, Chou MM.. Atypical mechanism of NF-kB enhances their in vitro differentiation and mineralization. activation by TRE17/ubiquitin-specific protease 6 (USP6) Calcif Tissue Int. 2008 Jun;82(6):454-64. oncogene and its requirement in tumorigenesis. Oncogene. 2011 Nov 14. doi: 10.1038/onc.2011.520. Calcaterra NB, Armas P, Weiner AM, Borgognone M.. [Epub ahead of print] CNBP: a multifunctional nucleic acid chaperone involved in cell death and proliferation control. IUBMB Life. 2010 Stover DA, Verrelli BC.. Comparative vertebrate Oct;62(10):707-14. evolutionary analyses of type I collagen: potential of COL1a1 gene structure and intron variation for common Lau AW, Pringle LM, Quick L, Riquelme DN, Ye Y, Oliveira bone-related diseases. Mol Biol Evol. 2011 Jan;28(1):533- AM, Chou MM.. TRE17/ubiquitin-specific protease 6 42. Epub 2010 Aug 19. (USP6) oncogene translocated in aneurysmal bone cyst blocks osteoblastic maturation via an autocrine mechanism This article should be referenced as such: involving bone morphogenetic protein dysregulation. J Biol Chem. 2010 Nov 19;285(47):37111-20. Epub 2010 Sep Huret JL. Bone: Aneurysmal bone cysts. Atlas Genet 23. Cytogenet Oncol Haematol. 2012; 16(5):368-371. Lee KM, Hsu IaW, Tarn WY.. TRAP150 activates pre- mRNA splicing and promotes nuclear mRNA degradation.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 371

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Short Communication

Bone: t(16;17)(q22;p13) in aneurysmal bone cyst Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Tumors/t1617q22p13BoneCystID6374.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t1617q22p13BoneCystID6374.txt

Clinics and pathology Prognosis Disease Recurrence occurs in one fourth of cases. Aneurysmal bone cysts Cytogenetics Note Benign but locally aggressive tumor. Cytogenetics Morphological In 8 of the 11 cases, the t(16;17)(q22;p13) was the Phenotype / cell stem origin sole anomaly. Occurs mainly in vertebrae and flat bones. Multiple involvement is frequent. Genes involved and Etiology proteins May involve the arrest of maturation of the osteoblasts caused by USP6 overexpression and CDH11 dysregulation of autocrine BMP (bone morphology Location protein) signaling (Lau et al., 2010). 16q22 Epidemiology Protein Usually seen in patients aged 10-20 years; Cell-cell adhesion molecule that mediates adhesion represents about 5% of primary bone tumours; by Ca2+-dependent interactions. Its intracellular slightly more frequent in female patients. domain is anchored to the actin cytoskeleton through alpha and beta-catenin. Clinics Role in maintaining tissue architecture and cell Forms a spongy hemorrhagic mass; symptoms are polarity, limiting cell movement and proliferation. pain, swelling, pathological fractures. About eleven CDH11 antagonizes Wnt/beta-catenin signaling cases to date have been described with a pathway, induces apoptosis, and regulates t(16;17)(q22;p13), 7 female patients aged 5, 7, 13, epithelial-mesenchymal transition (Li et al., 2011). 13, 14, 15, and 17 years, and 4 male patients aged CDH11 is involved in various cancers. Tumor 10, 12, 13, and 30 years (Panoutsakopoulos et al., suppressor function. 1999; Herens et al., 2001; Wyatt-Ashmead et al., 2001; Althof et al., 2004; Oliveira et al., 2004). USP6 Treatment Location 17p13 Surgical curetage.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 372

Bone: t(16;17)(q22;p13) in aneurysmal bone cyst Huret JL

Protein Althof PA, Ohmori K, Zhou M, Bailey JM, Bridge RS, Nelson M, Neff JR, Bridge JA. Cytogenetic and molecular USP6, also called TRE17/ubiquitin-specific cytogenetic findings in 43 aneurysmal bone cysts: protease 6 (USP6), is a deubiquitinase. It is the first aberrations of 17p mapped to 17p13.2 by fluorescence in de-ubiquitinating enzyme to activate NF-KB, and situ hybridization. Mod Pathol. 2004 May;17(5):518-25 requires both catalytic subunits of IKK (IKKalpha Oliveira AM, Hsi BL, Weremowicz S, Rosenberg AE, Dal and IKKbeta) (Pringle et al., 2011). Cin P, Joseph N, Bridge JA, Perez-Atayde AR, Fletcher JA. USP6 (Tre2) fusion oncogenes in aneurysmal bone Result of the chromosomal cyst. Cancer Res. 2004 Mar 15;64(6):1920-3 Oliveira AM, Perez-Atayde AR, Dal Cin P, Gebhardt MC, anomaly Chen CJ, Neff JR, Demetri GD, Rosenberg AE, Bridge JA, Fletcher JA. Aneurysmal bone cyst variant translocations Hybrid Gene upregulate USP6 transcription by promoter swapping with the ZNF9, COL1A1, TRAP150, and OMD genes. Description Oncogene. 2005 May 12;24(21):3419-26 5' CDH11 - 3' USP6 Lau AW, Pringle LM, Quick L, Riquelme DN, Ye Y, Oliveira Fusion Protein AM, Chou MM. TRE17/ubiquitin-specific protease 6 (USP6) oncogene translocated in aneurysmal bone cyst Description blocks osteoblastic maturation via an autocrine mechanism The promotor of CDH11 is juxtaposed to the entire involving bone morphogenetic protein dysregulation. J Biol sequence of USP6. Chem. 2010 Nov 19;285(47):37111-20 Li L, Ying J, Li H, Zhang Y, Shu X, Fan Y, Tan J, Cao Y, References Tsao SW, Srivastava G, Chan AT, Tao Q. The human cadherin 11 is a pro-apoptotic tumor suppressor Panoutsakopoulos G, Pandis N, Kyriazoglou I, Gustafson modulating cell stemness through Wnt/β-catenin signaling P, Mertens F, Mandahl N. Recurrent t(16;17)(q22;p13) in and silenced in common carcinomas. Oncogene. 2011 aneurysmal bone cysts. Genes Chromosomes Cancer. Dec 5; 1999 Nov;26(3):265-6 Pringle LM, Young R, Quick L, Riquelme DN, Oliveira AM, Herens C, Thiry A, Dresse MF, Born J, Flagothier C, May MJ, Chou MM. Atypical mechanism of NF-κB Vanstraelen G, Allington N, Bex V. Translocation activation by TRE17/ubiquitin-specific protease 6 (USP6) (16;17)(q22;p13) is a recurrent anomaly of aneurysmal oncogene and its requirement in tumorigenesis. bone cysts. Cancer Genet Cytogenet. 2001 Oncogene. 2011 Nov 14; May;127(1):83-4 This article should be referenced as such: Wyatt-Ashmead J, Bao L, Eilert RE, Gibbs P, Glancy G, McGavran L. Primary aneurysmal bone cysts: 16q22 Huret JL. Bone: t(16;17)(q22;p13) in aneurysmal bone and/or 17p13 chromosome abnormalities. Pediatr Dev cyst. Atlas Genet Cytogenet Oncol Haematol. 2012; Pathol. 2001 Jul-Aug;4(4):418-9 16(5):372-373.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 373

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Solid Tumour Section Short Communication

Bone: t(17;17)(p13;q21) in aneurysmal bone cyst Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Tumors/t1717p13q21BoneCystID5449.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI t1717p13q21BoneCystID5449.txt

Clinics and pathology Cytogenetics Disease Cytogenetics Morphological Aneurysmal bone cysts The t(17;17)(p13;q21) was the sole anomaly. Note Benign but locally aggressive tumor. Genes involved and Phenotype / cell stem origin proteins Occurs mainly in vertebrae and flat bones. Multiple COL1A1 involvement is frequent. Location Etiology 17q21 May involve the arrest of maturation of the Protein osteoblasts caused by USP6 overexpression and Two pro a1(I) chain associate in trimers with one dysregulation of autocrine BMP (bone morphology pro a2(I) chain to form the type I collagen fibrils protein) signaling (Lau et al., 2010). after proteolysis. Constituent of the extra cellular Epidemiology matrix in connective tissue of bone, skin, tendon, Usually seen in patients aged 10-20 years; ligament, teeth. represents about 5% of primary bone tumours; Germinal mutations slightly more frequent in female patients. COL1A1 has been found mutated in osteoporosis, Clinics osteogenesis imperfecta types I-IV, Ehlers-Danlos types I and VIIA, and Caffey disease (Stover and Forms a spongy hemorrhagic mass; symptoms are Verrelli, 2011). pain, swelling, pathological fractures. Two cases to date was found with a t(17;17)(p13;q21), a 8-year- USP6 old boy with a tumor of the soft tissues, and a 13- Location year-old boy with a tumor located in the tibia 17p13 (Oliveira et al., 2005; Panagopoulos et al., 2008). Protein Treatment USP6, also called TRE17/ubiquitin-specific Surgical curetage. protease 6 (USP6), is a deubiquitinase. It is the first de-ubiquitinating enzyme to activate NF-KB, and Prognosis requires both catalytic subunits of IKK (IKKalpha Recurrence occurs in one fourth of cases. and IKKbeta) (Pringle et al., 2011).

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 374

Bone: t(17;17)(p13;q21) in aneurysmal bone cyst Huret JL

Panagopoulos I, Mertens F, Löfvenberg R, Mandahl N. Result of the chromosomal Fusion of the COL1A1 and USP6 genes in a benign bone anomaly tumor. Cancer Genet Cytogenet. 2008 Jan 1;180(1):70-3 Lau AW, Pringle LM, Quick L, Riquelme DN, Ye Y, Oliveira Hybrid Gene AM, Chou MM. TRE17/ubiquitin-specific protease 6 (USP6) oncogene translocated in aneurysmal bone cyst Description blocks osteoblastic maturation via an autocrine mechanism 5' COL1A1 - 3' USP6 involving bone morphogenetic protein dysregulation. J Biol Chem. 2010 Nov 19;285(47):37111-20 Fusion Protein Pringle LM, Young R, Quick L, Riquelme DN, Oliveira AM, Description May MJ, Chou MM. Atypical mechanism of NF-κB Fusion of the exon 1 of COL1A1 to a splicing activation by TRE17/ubiquitin-specific protease 6 (USP6) oncogene and its requirement in tumorigenesis. variant of USP exon 1 in the case reported in Oncogene. 2011 Nov 14; Oliveira et al., 2005. Stover DA, Verrelli BC. Comparative vertebrate evolutionary analyses of type I collagen: potential of References COL1a1 gene structure and intron variation for common bone-related diseases. Mol Biol Evol. 2011 Jan;28(1):533- Oliveira AM, Perez-Atayde AR, Dal Cin P, Gebhardt MC, 42 Chen CJ, Neff JR, Demetri GD, Rosenberg AE, Bridge JA, Fletcher JA. Aneurysmal bone cyst variant translocations This article should be referenced as such: upregulate USP6 transcription by promoter swapping with the ZNF9, COL1A1, TRAP150, and OMD genes. Huret JL. Bone: t(17;17)(p13;q21) in aneurysmal bone Oncogene. 2005 May 12;24(21):3419-26 cyst. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):374-375.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 375

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Cancer Prone Disease Section Review

Mosaic variegated aneuploidy syndrome Sandra Hanks, Katie Snape, Nazneen Rahman Institute of Cancer Research, Division of Genetics and Epidemiology, Brookes Lawley Building, 15 Cotswold Road, Sutton, Surrey SM2 5NG, UK (SH, KS, NR)

Published in Atlas Database: December 2011 Online updated version : http://AtlasGeneticsOncology.org/Kprones/MVAID10167.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI MVAID10167.txt

and intervention and/or special education if Identity developmental delay is detected. Standard treatment Other names for specific neurological, ophthalmological, cardiac MVA or renal anomalies may also be indicated. Due to the increased cancer risk, cases with a Inheritance diagnosis of MVA syndrome should be offered Autosomal recessive; rare with unknown incidence. Wilms tumour surveillance. Current UK recommendations include renal ultrasonography Clinics every three to four months until five years. Phenotype and clinics There is no particular screening that is helpful for the other tumours known to be associated with A broad spectrum of clinical features has been MVA syndrome, but any suspicious clinical observed in individuals with MVA syndrome. symptoms should be investigated with minimal Microcephaly, pre- and/or postnatal growth delay. retardation, variable developmental delay and dysmorphic facial features are frequently described. Prognosis Seizures and other neurological abnormalities, eye The prognosis for an individual with MVA anomalies including cataracts and strabismus, syndrome is based on the malformations present in skeletal/hand and foot abnormalities including the individual. clinodactyly and dermatological anomalies such as There is early mortality in a significant proportion café au lait patches and haemangioma have also of cases due to failure to thrive and/or been described. Less common abnormalities complications of congenital abnormalities, epilepsy, include gastrointestinal defects, renal anomalies and infections or malignancy. cardiac defects. The clinical spectrum ranges from a severe and even lethal course to a mild phenotype Cytogenetics without microcephaly or mental retardation. Inborn conditions Neoplastic risk MVA is characterised by mosaic aneuploidies, The risk of malignancy in MVA is high with Wilms predominantly trisomies and monosomies, tumour, rhabdomyosarcoma, leukaemia and involving multiple different chromosomes and granulosa cell tumour of the ovary reported in tissues (examples are shown in figure 1). several cases. Myelodysplastic syndrome has also The proportion of aneuploid cells varies but is been observed. usually >10% and is substantially greater than in Treatment normal individuals. Some patients with MVA also Clinical management of patients with MVA demonstrate premature chromatid separation in syndrome is based upon the affected individual's colchicine-treated blood lymphocyte and fibroblast specific needs and may include surgical treatments cultures.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 376

Mosaic variegated aneuploidy syndrome Hanks S, et al.

Figure 1. Examples of karyotypic abnormalities identified in individuals with MVA.

Cytogenetics of cancer Protein Gain of chromosomes 8 and 13 and loss of Note chromosomes 9 and 14 have been observed in the Protein name: BUBR1 embryonal rhabdomyosarcoma from an individual Description with MVA. Gain of chromosome 8 has also been 1050 amino acids, 120 kDa. identified in the embryonal rhabdomyosarcoma from a further patient with MVA syndrome. Expression Ubiquituously expressed. Other findings Preferentially expressed in tissues with a high mitotic index. Cells from BUB1B mutation-positive cases demonstrate an abnormal response to nocodazole- Localisation induced mitotic checkpoint activation. Cytoplasmic in interphase cells. Bound to BUB3 or CENPE, it can be localised to Genes involved and nuclear kinetochores. BUBR1 also localises to centrosomes during proteins interphase. BUB1B Function Location A central component of the mitotic spindle 15q15.1 checkpoint that directly inhibits the anaphase- promoting complex/cyclosome until sister DNA/RNA chromatids are correctly attached to the spindle, Description thus ensuring proper chromosome segregation BUB1B spans 60 kb and is composed of 23 exons. during cell division.

Figure 2. Schematic representation of BUB1B demonstrating the relative exon sizes.

Figure 3. Schematic representation of BUBR1 demonstrating significant functional or structural domains.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 377

Mosaic variegated aneuploidy syndrome Hanks S, et al.

Figure 4. Schematic representation of BUB1B demonstrating the relative exon sizes and positions of known mutations. Truncating mutations are depicted above the figure, with missense mutations below. Biallelic mutations are represented by coloured lines, with mutations in the same individual in matching colours. Monoallelic mutations are represented by black lines and font.

Also binds the motor protein CENPE, an interaction Protein required for regulation of kinetochore-microtubule Description interactions and checkpoint signalling. 500 amino acids, 57 kDa. Homology Expression BUBR1 is the mammalian homologue of yeast Mad3, a significant difference being that BUBR1 Ubiquituously expressed. possesses a kinase domain which is absent in Mad3. Localisation Mutations Nucleus, cytoplasm, cytoskeleton, centrosome. Germinal Function Biallelic germline mutations have been found in Centrosomal protein required for microtubule eight MVA pedigrees (figure 4). attachment to centrosomes. Each family carries one missense mutation and one Also involved in intracellular bidirectional mutation that results in premature protein truncation trafficking of factors such as FGF2 along or an absent transcript. Monoalleic truncating microtubules. mutations have also been reported in several cases. Homology CEP57 The CEP57 gene is conserved in chimpanzee, dog, cow, mouse, rat, chicken, and zebrafish. Location Mutations 11q21 Germinal DNA/RNA Biallelic, loss-of-function mutations have been Description found in three MVA pedigrees (figure 7). CEP57 spans over 42 kb and is composed of 11 exons.

Figure 5. Schematic representation of CEP57 demonstrating the relative exon sizes.

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 378

Mosaic variegated aneuploidy syndrome Hanks S, et al.

Figure 6. Schematic representation of CEP57 demonstrating significant functional or structural domains.

Figure 7. Schematic representation of CEP57 demonstrating the relative exon sizes and positions of known mutations. Biallelic mutations are represented by coloured lines, with mutations in the same individual in matching colours.

patients with mosaic variegated aneuploidy: delineation of References clinical subtypes. Am J Med Genet A. 2008 Jul 1;146A(13):1687-95 Limwongse C, Schwartz S, Bocian M, Robin NH. Child with mosaic variegated aneuploidy and embryonal Momotani K, Khromov AS, Miyake T, Stukenberg PT, rhabdomyosarcoma. Am J Med Genet. 1999 Jan Somlyo AV. Cep57, a multidomain protein with unique 1;82(1):20-4 microtubule and centrosomal localization domains. Biochem J. 2008 Jun 1;412(2):265-73 Lane AH, Aijaz N, Galvin-Parton P, Lanman J, Mangano R, Wilson TA. Mosaic variegated aneuploidy with growth Izumi H, Matsumoto Y, Ikeuchi T, Saya H, Kajii T, hormone deficiency and congenital heart defects. Am J Matsuura S. BubR1 localizes to centrosomes and Med Genet. 2002 Jul 1;110(3):273-7 suppresses centrosome amplification via regulating Plk1 activity in interphase cells. Oncogene. 2009 Aug Hanks S, Coleman K, Reid S, Plaja A, Firth H, Fitzpatrick 6;28(31):2806-20 D, Kidd A, Méhes K, Nash R, Robin N, Shannon N, Tolmie J, Swansbury J, Irrthum A, Douglas J, Rahman N. Meunier S, Navarro MG, Bossard C, Laurell H, Touriol C, Constitutional aneuploidy and cancer predisposition Lacazette E, Prats H. Pivotal role of translokin/CEP57 in caused by biallelic mutations in BUB1B. Nat Genet. 2004 the unconventional secretion versus nuclear translocation Nov;36(11):1159-61 of FGF2. Traffic. 2009 Dec;10(12):1765-72 Hanks S, Coleman K, Summersgill B, Messahel B, Suijkerbuijk SJ, van Osch MH, Bos FL, Hanks S, Rahman Williamson D, Pritchard-Jones K, Strefford J, Swansbury J, N, Kops GJ. Molecular causes for BUBR1 dysfunction in Plaja A, Shipley J, Rahman N. Comparative genomic the human cancer predisposition syndrome mosaic hybridization and BUB1B mutation analyses in childhood variegated aneuploidy. Cancer Res. 2010 Jun cancers associated with mosaic variegated aneuploidy 15;70(12):4891-900 syndrome. Cancer Lett. 2006 Aug 8;239(2):234-8 Snape K, Hanks S, Ruark E, Barros-Núñez P, Elliott A, Matsuura S, Matsumoto Y, Morishima K, Izumi H, Murray A, Lane AH, Shannon N, Callier P, Chitayat D, Matsumoto H, Ito E, Tsutsui K, Kobayashi J, Tauchi H, Clayton-Smith J, Fitzpatrick DR, Gisselsson D, Kajiwara Y, Hama S, Kurisu K, Tahara H, Oshimura M, Jacquemont S, Asakura-Hay K, Micale MA, Tolmie J, Komatsu K, Ikeuchi T, Kajii T. Monoallelic BUB1B Turnpenny PD, Wright M, Douglas J, Rahman N. mutations and defective mitotic-spindle checkpoint in Mutations in CEP57 cause mosaic variegated aneuploidy seven families with premature chromatid separation (PCS) syndrome. Nat Genet. 2011 Jun;43(6):527-9 syndrome. Am J Med Genet A. 2006 Feb 15;140(4):358-67 This article should be referenced as such: Musacchio A, Salmon ED. The spindle-assembly checkpoint in space and time. Nat Rev Mol Cell Biol. 2007 Hanks S, Snape K, Rahman N. Mosaic variegated May;8(5):379-93 aneuploidy syndrome. Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5):376-379. García-Castillo H, Vásquez-Velásquez AI, Rivera H, Barros-Núñez P. Clinical and genetic heterogeneity in

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 379

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Deep Insight Section

Chromothripsis: a new molecular mechanism in cancer development Jian-Min Chen, Claude Férec, David N Cooper Institut National de la Sante et de la Recherche Medicale (INSERM), U613, Etablissement Français du Sang (EFS) - Bretagne, Faculte de Medecine et des Sciences de la Sante, Universite de Bretagne Occidentale (UBO), Brest, France (JMC), Institut de Recherche en Biotherapie, INSERM U847, Hopital Saint-Eloi, CHU de Montpellier, 80 av Augustin Fliche, 34295 Montpellier Cedex 5, France (CF), Institute of Medical Genetics, School of Medicine, Cardiff University, Heath Park, Cardiff CF14 4XN, UK (DNC)

Published in Atlas Database: November 2011 Online updated version : http://AtlasGeneticsOncology.org/Deep/ChromothripsisID20106.html Printable original version : http://documents.irevues.inist.fr/bitstream/DOI ChromothripsisID20106.txt

catastrophic phenomenon: the presence of tens or Introduction even hundreds of structural rearrangements, Conventional models of carcinogenesis are involving spatially localized genomic regions, in invariably based upon the cumulative acquisition of primary cancer samples as well as cancer cell lines point mutations and chromosomal rearrangements (Stephens et al., 2011). These alterations primarily in the genome(s) of the tumour cells allowing them affected a single chromosome, although in some to override the natural restraints on their growth cases, multiple apparently concomitant alterations (Stratton et al., 2009). This notwithstanding, cancer involved several different chromosomes. Stephens may also evolve through the sudden acquisition of et al. (2011) convincingly concluded that the multiple concurrent or quasi-concurrent mutations massive yet spatially localized genomic provoked by some catastrophic intracellular event rearrangements must have resulted from a single (Meyerson and Pellman, 2011). For example, a catastrophic event [termed chromothripsis (Greek, successive breakage-fusion-bridge cycle triggered chromos for chromosome, thripsis for shattered into by critical telomere attrition can result in the gene pieces)] rather than from a series of independent amplification often observed in different types of and progressive alterations. This conclusion was cancer (McClintock, 1941; Sahin and Depinho, based upon the following three lines of evidence: 2010). The failure of cytokinesis can also lead to - Many positions across the rearranged the formation of extensive aneuploidy which may chromosome exhibited copy number changes that also promote tumorigenesis (Fujiwara et al., 2005). alternated between just two states, namely one (indicating heterozygous deletion) or two copies Chromothripsis: a new (indicating no loss or gain). Monte Carlo simulations suggested that under the progressive catastrophic phenomenon in model, multiple copy number states would have cancer development been expected. Humpty Dumpty sat on a wall, - Heterozygosity was retained in regions with high Humpty Dumpty had a great fall. copy number. Under the progressive model, a All the king's horses and all the king's men deletion occurring early on in the process would Couldn't put Humpty together again. have permanently removed heterozygosity. [Traditional nursery rhyme.] - Chromosomal breakpoints exhibited a Using massively parallel paired-end sequencing, significantly higher degree of clustering along the Stephens and colleagues have described a new chromosome or chromosomal arm than would have

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 380

Chromothripsis: a new molecular mechanism in cancer Chen JM, et al. development been expected under a model of independently In short, NHEJ often results in the loss of genetic acquired alterations. material yielding deletions, balanced It would therefore seem that in a single catastrophic rearrangements such as inversions and event, "the chromosome or chromosomal region translocations, or a combination of any of these shatters into tens to hundreds of pieces, some (but (Chen et al., 2011). not all) of which are then stitched together by the DNA repair machinery in a mosaic patchwork of genomic rearrangements" (Stephens et al., 2011). Not all components of the The catastrophe model was given further support by observed massive two additional observations. First, sequencing of a rearrangements have necessarily relapse specimen from a chronic lymphocytic been derived from a single leukemia patient after alemtuzumab treatment, collected some 31 months after the initial sample, catastrophic event revealed that all rearrangements identified in the The above notwithstanding, Stephens and initial sample were also present in the relapse colleagues did not argue that every component of sample and, more importantly, no new the massive yet spatially localized genomic rearrangements were apparent in the relapse rearrangements would have necessarily been sample. This finding suggested that the process generated in one single mutational event but simply generating the massive rearrangements was not that the majority of these rearrangements probably ongoing in the patient and had been resolved before occurred in a single event. For example, some the first diagnosis was made (Stephens et al., 2011). regions of the affected chromosomes in some Second, there existed a significant overlap between samples appeared to have been duplicated (i.e., the somatic genomic rearrangements evident in copy number = 3), a finding which was assumed to primary colorectal cancers and those in their have resulted from the later partial duplication of corresponding metastases, suggesting that many the derivative chromosomes (Stephens et al., 2011). rearrangements occurred in the primary cancers Alternatively, such a duplication may have indeed (Kloosterman et al., 2011b). resulted from NHEJ repair of simultaneously generated double-strand breaks, provided that the The initiating cause and repair sister chromatid or homologous chromosome was also involved (Chen et al., 2011). mechanism of chromothripsis Nonetheless, on its own, NHEJ cannot readily Although both ionizing radiation (Stephens et al., explain rearranged regions with a copy number of 2011) and premature chromosome compaction ≥4 (Chen et al., 2011). In this regard, Magrangeas during mitosis (Meyerson and Pellman, 2011) have and colleagues recently claimed that genomic been suggested as initiating causes, the primary rearrangements in some 1.3% (10/764) of their cause of chromothripsis remains to be established. primary multiple myeloma samples recapitulated all Irrespective of the precise cause, the massive the hallmark characteristics of chromothripsis genomic rearrangements resembling "random stitch (Magrangeas et al., 2011). However, these samples of shattered pieces", together with the highly were often found to contain regions with a copy characteristic features of the junction sequences number of 3, 4 or 6. For samples exhibiting a copy (i.e., predominantly blunt junctions or junctions number higher than 4, additional independent with terminal microhomologies of <4-bp, as well as alterations may have occurred in the the presence of short non-templated sequences at chromothripsis-derived chromosomes. some of the junctions), point to non-homologous Alternatively, the complex rearrangements in some end joining (NHEJ) as being the most plausible of these samples may have resulted from the mutational mechanism (Kloosterman et al., 2011a; breakage-fusion-bridge cycle or alternatively could Kloosterman et al., 2011b; Stephens et al., 2011). be explicable in terms of replication-based NHEJ involves the ligation of any two broken DNA mechanisms (see below). Characterization of the ends, the enzymatic components (i.e., nuclease, breakpoint junctions in these samples may help to DNA polymerases and ligase) of its machinery clarify the underlying generative mechanisms. being the most mechanistically flexible in their respective classes (Lieber, 2010). Indeed, as opined Replication-based mechanisms by Chen and colleagues (Chen et al., 2010), "NHEJ of ends from simultaneous double-strand breaks has in the generation of chromosome the potential to account for a diverse range of catastrophes genomic rearrangements". Moreover, NHEJ can Since 2005, replication-based models including occur at any time during the cell cycle. It should serial replication slippage (SRS) (Chen et al., also be emphasized that, in principle, NHEJ does 2005a; Chen et al., 2005b; Chen et al., 2005c), fork not involve the synthesis of long templated stalling and template switching (FoSTeS) (Lee et sequence tracts that will be detected as duplications. al., 2007) and microhomology-mediated break-

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 381

Chromothripsis: a new molecular mechanism in cancer Chen JM, et al. development induced replication (MMBIR) (Hastings et al., observations together, Liu and colleagues envisaged 2009; Sheen et al., 2007) have been used the involvement of a replicative mechanism in the increasingly to account for the generation of diverse generation of this complex chromosome complex genomic rearrangements involving catastrophe event which comprised multiple duplications, triplications or more copy number duplications and/or triplications; they regarded gains (Chen et al., 2011). The hallmark MMBIR as the most likely underlying mechanism. characteristic of these replication-based models in They further suggested that a potential replication generating complex genomic rearrangements is fork collapse at 9q21 could account for the SRS or serial template switching during a single breakpoint clustering therein (Liu et al., 2011). cell cycle. All the steps of template switching are All the extremely complex rearrangements on thought to be microhomology-dependent. However, chromosome 9 were confirmed, by parental array whereas SRS or FoSTeS relies upon a stalled comparative genomic hybridization and replication fork (i.e., the original templated strand chromosome analyses, to have occurred de novo in remains intact during the process), MMBIR is patient BAB3105. All the additional copies of the predicated upon a collapsed replication fork (i.e., duplicated and triplicated genomic segments could one-ended DSB). Given that nicks, which will be then have been derived from the paternal allele that transformed to DSBs when encountered by a was not transmitted by high-density informative replication fork, are common in all living cells, single-nucleotide polymorphism analysis in the MMBIR is likely to have considerably greater case-parent trio (Liu et al., 2011). Therefore, the explanatory potential than either SRS or FosTes rearrangements must have occurred in the father, (Chauvin et al., 2009). either during early development as a postzygotic The potential contribution of replication-based event or in a germline during spermatogenesis; mechanisms to genome instability received a new further, the generation of this complex impetus from a recent study, in which Liu and rearrangement event must have involved the two colleagues investigated 17 subjects with various paternal chromosome 9 homologues (Liu et al., development abnormalities by means of high- 2011). resolution genome analysis (Liu et al., 2011). Liu and colleagues opined that chromothripsis is Constitutional multiple copy number changes, more likely to constitute an inherent cellular DNA including deletions, duplications and/or replicative/repair process designed to maintain triplications, as well as inversions were observed in genome stability rather than simply constituting the all cases. In each case, all rearrangements occurred "blowing apart" of a chromosome followed by within a single chromosome; in 15 of the 17 cases, putting the pieces of the puzzle together. the rearrangements were localized to the distal half Consequently, they proposed that the phenomenon of the affected chromosomal arms. In particular, termed chromothripsis might be more appropriately genomic rearrangements in four cases turned out to referred to as "chromoanasynthesis" (chromosome be extremely complex. For example, patient reconstitution or chromosome reassortment). In our BAB3105 had a total of 18 copy number changes view, there is a subtle distinction between the two on one or other of the chromosome 9 homologs; the concepts; whereas chromothripsis emphasizes the rearrangement pattern was nml-dup-nml-dup-nml- initial cause of genome instability, dup-nml-dup-nml-dup-nml-dup-nml-dup-nml-dup- chromoanasynthesis emphasizes the organism's nml-dup-trp-dup-nml-dup-nml-trp-dup-nml-dup- capability to cope with genome instability (Chen et nml-dup-nml-dup-nml-dup-nml (nml, normal copy; al., 2011). The Liu finding has important dup, duplication; del, deletion; tri, triplication). implications for cancer development; "on a cellular FISH and breakpoint junction data suggested that level, the mechanisms underlying these DNA all additional copies of the duplicated and rearrangements occurring in cells at different stages triplicated segments were randomly joined, forming of the human life (i.e., germline, postzygotic a large "breakpoint junction cluster" on 9q21. By development, somatic differentiated cells) are likely analogy with the phenomenon of chromothripsis, to be the same" (Liu et al., 2011). the observation of these extremely complex rearrangements in a single chromosome was also described as a chromosome catastrophe event (Liu The role of chromothripsis et al., 2011). However, this kind of chromosomal should not however be change cannot be easily explained by the previously overestimated described NHEJ repair of simultaneously generated Whereas the Stephen et al. study (2011) has double-strand breaks. established an entirely new model for cancer Sequencing of several breakpoint junctions in development, the role of chromothripsis should not patient BAB3105 revealed the frequent occurrence however be overestimated. The simple reason is of relatively long templated insertions (54-1542 that the vast majority of the cells harboring such bp), microhomologies and inversions at these extensive genomic rearrangements would be likely junctions. Taking this and the aforementioned to die. In other words, only those cells that acquired

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 382

Chromothripsis: a new molecular mechanism in cancer Chen JM, et al. development a newly-rearranged chromosome that happened to Chen JM, Chuzhanova N, Stenson PD, Férec C, Cooper confer some growth advantages e.g. loss of tumour DN. Intrachromosomal serial replication slippage in trans gives rise to diverse genomic rearrangements involving suppressor genes, amplification of oncogenes or a inversions. Hum Mutat. 2005b Oct;26(4):362-73 combination of these (Stephens et al., 2011), could Chen JM, Chuzhanova N, Stenson PD, Férec C, Cooper survive. Indeed, in the Stephen et al. study, DN. Meta-analysis of gross insertions causing human although chromothripsis was observed in up to genetic disease: novel mutational mechanisms and the ~25% of primary bone cancers, its detection role of replication slippage. Hum Mutat. 2005c frequency in many other cancer subtypes was only Feb;25(2):207-21 2-3%. Moreover, the pairwise comparison of Fujiwara T, Bandi M, Nitta M, Ivanova EV, Bronson RT, structural changes in colorectal tumors has Pellman D. Cytokinesis failure generating tetraploids demonstrated that primary and metastatic colorectal promotes tumorigenesis in p53-null cells. Nature. 2005 Oct 13;437(7061):1043-7 cancer genomes harbor distinct patterns of structural variation (Kloosterman et al., 2011b). Lee JA, Carvalho CM, Lupski JR. A DNA replication Furthermore, different cancers may have different mechanism for generating nonrecurrent rearrangements associated with genomic disorders. Cell. 2007 Dec rearrangement profiles. For example, 28;131(7):1235-47 rearrangements observed in breast or pancreatic Sheen CR, Jewell UR, Morris CM, Brennan SO, Férec C, cancer have a tendency to be either distributed George PM, Smith MP, Chen JM. Double complex fairly randomly over the genome or, if localized, to mutations involving F8 and FUNDC2 caused by distinct be associated with substantial genomic break-induced replication. Hum Mutat. 2007 amplification (Stephens et al., 2011). Dec;28(12):1198-206 Chauvin A, Chen JM, Quemener S, Masson E, Kehrer- Sawatzki H, Ohmle B, Cooper DN, Le Maréchal C, Férec Conclusions and perspectives C. Elucidation of the complex structure and origin of the The Stephen et al. study has not only significantly human trypsinogen locus triplication. Hum Mol Genet. 2009 Oct 1;18(19):3605-14 improved our understanding of cancer development but has also provided competing evidence that tens Hastings PJ, Ira G, Lupski JR. A microhomology-mediated break-induced replication model for the origin of human or even hundreds of double-strand breaks could be copy number variation. PLoS Genet. 2009 simultaneously repaired by the organism. With the Jan;5(1):e1000327 wide application of next-generation sequencing, we Stratton MR, Campbell PJ, Futreal PA. The cancer may reasonably expect to see many more examples genome. Nature. 2009 Apr 9;458(7239):719-24 that are compatible with the chromothripsis phenomenon as well as various novel mechanisms Chen JM, Cooper DN, Férec C, Kehrer-Sawatzki H, Patrinos GP. Genomic rearrangements in inherited of mutagenesis. It would also be worthwhile to disease and cancer. Semin Cancer Biol. 2010 attempt to experimentally replicate chromothripsis Aug;20(4):222-33 as a means to determine the exact initiating causes Lieber MR. The mechanism of double-strand DNA break and repair mechanisms. Finally, the concept of repair by the nonhomologous DNA end-joining pathway. chromothripsis also appears to be capable of Annu Rev Biochem. 2010;79:181-211 explaining the generation of some complex de novo Sahin E, Depinho RA. Linking functional decline of structural rearrangements in the germline telomeres, mitochondria and stem cells during ageing. (Kloosterman et al., 2011a) and could be helpful in Nature. 2010 Mar 25;464(7288):520-8 understanding the mutational mechanisms Chen JM, Férec C, Cooper DN. Transient hypermutability, underlying some previously reported germline chromothripsis and replication-based mechanisms in the complex rearrangements (Chen et al., 2011). generation of concurrent clustered mutations. Mutat Res. 2011 Nov 9; Kloosterman WP, Guryev V, van Roosmalen M, Duran KJ, Acknowledgement de Bruijn E, Bakker SC, Letteboer T, van Nesselrooij B, This article is based partly on a review article by Hochstenbach R, Poot M, Cuppen E. Chromothripsis as a mechanism driving complex de novo structural the authors, entitled "Transient hypermutability, rearrangements in the germline. Hum Mol Genet. 2011a chromothripsis and replication-based mechanisms May 15;20(10):1916-24 in the generation of concurrent clustered Kloosterman WP, Hoogstraat M, Paling O, Tavakoli-Yaraki mutations", published in Mutation Research - M, Renkens I, Vermaat JS, van Roosmalen MJ, van Reviews in Mutation Research (2011) Lieshout S, Nijman IJ, Roessingh W, van 't Slot R, van de doi:10.1016/j.mrrev.2011.10.002. Belt J, Guryev V, Koudijs M, Voest E, Cuppen E. Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal References cancer. Genome Biol. 2011b Oct 19;12(10):R103 McClintock B. The Stability of Broken Ends of Liu P, Erez A, Nagamani SC, Dhar SU, Kołodziejska KE, Chromosomes in Zea Mays. Genetics. 1941 Dharmadhikari AV, Cooper ML, Wiszniewska J, Zhang F, Mar;26(2):234-82 Withers MA, Bacino CA, Campos-Acevedo LD, Delgado MR, Freedenberg D, Garnica A, Grebe TA, Hernández- Chen JM, Chuzhanova N, Stenson PD, Férec C, Cooper Almaguer D, Immken L, Lalani SR, McLean SD, Northrup DN. Complex gene rearrangements caused by serial H, Scaglia F, Strathearn L, Trapane P, Kang SH, Patel A, replication slippage. Hum Mutat. 2005a Aug;26(2):125-34

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 383

Chromothripsis: a new molecular mechanism in cancer Chen JM, et al. development

Cheung SW, Hastings PJ, Stankiewicz P, Lupski JR, Bi W. McLaren S, Lin ML, McBride DJ, Varela I, Nik-Zainal S, Chromosome catastrophes involve replication mechanisms Leroy C, Jia M, Menzies A, Butler AP, Teague JW, Quail generating complex genomic rearrangements. Cell. 2011 MA, Burton J, Swerdlow H, Carter NP, Morsberger LA, Sep 16;146(6):889-903 Iacobuzio-Donahue C, Follows GA, Green AR, Flanagan AM, Stratton MR, Futreal PA, Campbell PJ. Massive Magrangeas F, Avet-Loiseau H, Munshi NC, Minvielle S. genomic rearrangement acquired in a single catastrophic Chromothripsis identifies a rare and aggressive entity event during cancer development. Cell. 2011 Jan among newly diagnosed multiple myeloma patients. Blood. 7;144(1):27-40 2011 Jul 21;118(3):675-8 Meyerson M, Pellman D. Cancer genomes evolve by This article should be referenced as such: pulverizing single chromosomes. Cell. 2011 Jan Chen JM, Férec C, Cooper DN. Chromothripsis: a new 7;144(1):9-10 molecular mechanism in cancer development. Atlas Genet Stephens PJ, Greenman CD, Fu B, Yang F, Bignell GR, Cytogenet Oncol Haematol. 2012; 16(5):380-384. Mudie LJ, Pleasance ED, Lau KW, Beare D, Stebbings LA,

Atlas Genet Cytogenet Oncol Haematol. 2012; 16(5) 384

Atlas of Genetics and Cytogenetics

in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription: The Atlas is FREE!

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS