Covid-19 Diagnostic Action

COVID-19 DIAGNOSTIC ACTION

Standard Operating Procedure and

Risk Assessment

Prepared by:

Alexandra Fraga

Ana Sofia Lima

Eduarda Correia

Liliana Santos

Maria Belém Marques

Maria Isabel Veiga

Approved by:

João Carlos Sousa

V1.8|13.05.2020 CONTENTS CONTENTS ...... 1 ABREVIATIONS ...... 4 CODING SYSTEM ...... 5 COVID-19 DIAGNOSTIC ACTION ORGANIZATIONAL STRUCTURE ...... 6 SECTION A – SCOPE ...... 7 SECTION B – GRAPHICAL PRESENTATION OF THE WORKFLOW ...... 8 SECTION C – PERSONNEL ENTRANCE REGISTRATION, BELONGINGS and MEALS ...... 9 SECTION D - DATABASES AND LABELLING OF SAMPLES ...... 10 D1 – VOLUNTEERS’ DATABASE ...... 10 D2 – SAMPLES’ DATABASE ...... 10 SECTION E – DETAILED STANDARD OPERATING PROCEDURE ...... 11 E1 – SAMPLES’ TRANSPORT TO ICVS ...... 11 E2. SAMPLE LABELING ...... 11 E3. VIRUS INACTIVATION AND RNA EXTRACTION ...... 12 E3. 1 – VIRUS INACTIVATION AND RNA EXTRACTION USING FOSUN Viral DNA and RNA Purification Kit ...... 13 E3. 1 A – VIRUS INACTIVATION ROOM ...... 13 E3. 1 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES ...... 14 E3. 1 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – FOSUN Viral DNA and RNA Purification Kit ...... 15 E3. 1 B RNA EXTRACTION ROOM ...... 18 E3. 1 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES ...... 19 E3. 1 B2 DETAILED PROCEDURES FOR RNA EXTRACTION – FOSUN Viral DNA and RNA Purification Kit ...... 20 E3.2 – VIRUS INACTIVATION AND RNA EXTRACTION USING GeneJet Viral DNA and RNA Purification Kit (ThermoScientific) ...... 21 E3. 2 A – VIRUS INACTIVATION ROOM ...... 21 E3. 2 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES ...... 22 E3. 2 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – GeneJET Viral DNA and RNA Purification Kit ...... 23 E3. 2 B RNA EXTRACTION ROOM ...... 26 E3. 2 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES ...... 26 E3. 2 B2 DETAILED PROCEDURES FOR RNA EXTRACTION – GeneJET Viral DNA and RNA Purification Kit (ThermoScientific) ...... 28 E3.3 – VIRUS INACTIVATION AND RNA EXTRACTION USING NZYTech Total RNA Isolation Kit ...... 30 1 V1.8|13.05.2020

E3. 3 A – VIRUS INACTIVATION ROOM ...... 30 ONLY AUTHORIZED BSL3 USERS ARE ALLOWED TO ENTER THE BSL3 ROOM AND PERFORM THE VIRUS INACTIVATION PROTOCOL...... 31 E3. 3 A1 – VIRUS INACTIVATION TEAM: RESPONSIBILITIES ...... 31 E3. 3 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – NZY Total RNA Isolation kit ...... 32 E3. 3 B RNA EXTRACTION ROOM ...... 35 E3. 3 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES ...... 35 E3. 3 B2 DETAILED PROCEDURES FOR RNA EXTRACTION - NZY Total RNA isolation kit ..... 36 E3. 4 – VIRUS INACTIVATION AND RNA EXTRACTION USING THE NYZOL METHOD (NZytech) ...... 38 E3. 4 A VIRUS INACTIVATION ROOM ...... 38 E3. 4 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES ...... 39 E3. 4 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – TRIZOL ...... 40 E3. 4 B RNA EXTRACTION ROOM - BSL2 ...... 42 E3. 4 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES ...... 43 E3. 4 B2 DETAILED PROCEDURES FOR RNA EXTRACTION - TRIZOL ...... 44 E4. RT-qPCR RUN (This section of the document is still being updated) ...... 46 E4. 1 RT-qPCR RUN USING FOSUN 2019-nCoV qPCR kit plus a human control gene, RNP, using SensiFAST One-Step Probe kit (BioLine) ...... 46 E4. 1 A RT-qPCR STATION ...... 46 E4. 1 A1 RT-qPCR TEAM'S RESPONSABILITIES ...... 47 E4. 1 A2 DETAILED PROCEDURES FOR RT-qPCR PROTOCOL – FOSUN 2019-nCoV qPCR kit 49 E4. 2 RT-qPCR RUN with ICVS protocol USING SensiFAST Probe One-Step kit, Low ROX (BioLine) ...... 53 E4. 2 A RT-qPCR STATION ...... 53 E4. 2 A1 RT-qPCR TEAM'S RESPONSABILITIES ...... 54 E4. 2 A2 DETAILED PROCEDURES FOR RT-qPCR ICVS PROTOCOL – using SensiFAST Probe One-Step kit, Low ROX (BioLine) ...... 55 E4. 3 RT-qPCR RUN with ICVS PROTOCOL USING One-Step NZYSpeedy RT-qPCR Probe kit, no ROX (NZYTech) ...... 60 E4. 3 A RT-qPCR STATION ...... 60 E4. 3 A1 RT-qPCR TEAM'S RESPONSABILITIES ...... 61 E4. 2 B1 DETAILED PROCEDURES FOR RT-qPCR ICVS PROTOCOL - One-Step NZYSpeedy RT- qPCR Probe kit, No ROX (NZYTech) ...... 63 E5. RESULTS ANALYSIS...... 67

2 V1.8|13.05.2020

E5. 1 RESULTS ANALYSIS FOR THE RT-QPCR DESCRIBED IN E4.1 USING THE COMMERCIAL DETECTION KIT FOSUN 2019-NCOV QPCR ...... 67 E5.2 ANALYSIS INTERPRETATION FOR THE RT-QPCR ICVS PROTOCOL – USING SENSIFAST PROBE ONE-STEP KIT, LOW ROX (BIOLINE) ...... 70 E6. RESULTS COMMUNICATION ...... 71 SECTION F - RISK ASSESSMENT AND CONTINGENCY MEASURES ...... 72 F1. RISK DESCRIPTION AND RESPECTIVE CONTINGENCY MEASURES ...... 73 F2. EMERGENCY PROCEDURES (EP) ...... 76 ATTACHED DOCUMENTS ...... 77 1. Statement of Responsibility ...... 78 2. ICVS Covid-19 Diagnostic - Teams' Daily Registration ...... 79 3. Covid-19: Waste management and disposal guidelines ...... 80 4. Primers and probes used in RT-PCR for 2019 novel coronavirus diagnostic...... 82 5. ICVS Covid-19 Diagnostic Report Template ...... 83 6. Biosafety Level 3 Manual ...... 84 7. University of Minho Contingency Plan ...... 122

3 V1.8|13.05.2020

ABREVIATIONS

SOP – Standard Operating Procedures

ICVS – Instituto de Investigação em Ciências da Vida e Saúde

BSC – Biosafety Cabinet

PPE – Personnel Protective Equipment

PCR – Polymerase Chain Reaction

BSL3 – Biosafety Level 3

BSL2 – Biosafety Level 2

RT-qPCR – Real-Time quantitative Polymerase Chain Reaction

PC – Positive Control

NTC – Non-Template Control

EtOH – Ethanol

WHO – World Health Organization

EP – Emergency Procedures

CDC – Centers for Disease Control and Prevention

4 V1.8|13.05.2020

CODING SYSTEM Date dd-mm-yyyy

Entry Time hh:mm

Swab Boxes – Original Swab Box #XXX

ICVS ID – ICVS ID XXXX

Samples’ RNA Boxes – Covid-19 RNA (first sample on the box) - (last sample on the box)

RT-qPCR Run Files – SARS-CoV-2_(first sample)-(last sample)_dd-mm-yyyy_(mastermix used)

5 V1.8|13.05.2020

COVID-19 DIAGNOSTIC ACTION ORGANIZATIONAL STRUCTURE

School of Medicine Presidency and ICVS Direction took the initiative to implement the Covid-19 Diagnostic Action at ICVS.

João Carlos Sousa, as ICVS Deputy Director, launched the initiative, coordinating the overall mission and designating:

- Maria Isabel Veiga – to coordinate the overall optimization and implementation of the the SARS-COV-2 detection protocols based on RT-qPCR.

- Alexandra Fraga - to supervise and coordinate the Virus Inactivation Team and Egídio Torrado as co-supervisor.

- Maria Belém Marques - to supervise and coordinate the RNA Extraction Team and Rute Moura and Ana João Rodrigues as co-supervisors.

- Eduarda Correia - to supervise and coordinate the RT-qPCR Team; Claudia Escórcio and Ana Lima as co-supervisors.

- Maria Isabel Veiga, Ana Falcão, Nuno Osório and Nuno Cerca - to perform the results validation and analysis.

- Liliana Santos and João Carlos Sousa – To double-check the sample IDs and prepare the final reports.

- Lucília Goreti Pinto - to supervise and coordinate the logistic operations.

All designated coordinators are "on call", and their emergency contacts available to the volunteers.

The volunteers will be distributed in several shifts and teams according to the needs and expertise. A timetable indicating the teams' coordinator and the designated volunteers is available on a shared platform.

6 V1.8|13.05.2020

SECTION A – SCOPE

This document presents the Standard Operating Procedure (SOP) and the Risk Assessment Protocol prepared by the Life and Health Sciences Research Institute (ICVS) from the School of Medicine, University of Minho in order to assist on the diagnostic for COVID-19. The samples consist of specimens from suspected and/or confirmed cases for COVID-19.

All ICVS staff participating in this procedure must follow the Standard Operations Procedures and Risk Control Measures listed in this document.

This document will be made available in the ICVS webpage. Under no circumstances is ICVS liable for any decisions regarding the procedures implemented by third parties.

!!!NOTICE!!!

This is an evolving document subject to frequent updates. For the more recent version please go to: http://www.icvs.uminho.pt/services-resources/covid19-diagnostic.

7 V1.8|13.05.2020

SECTION B – GRAPHICAL PRESENTATION OF THE WORKFLOW

8 V1.8|13.05.2020

SECTION C – PERSONNEL ENTRANCE REGISTRATION,

BELONGINGS and MEALS

Particular attention should be given to the clothes you ware: full cover clothes (no shorts or skirts), no open shoes. Hair should be tied and no long beards. Bring the minimum possible things with you to the laboratory.

Upon arrival to the ICVS, according to the team schedule, the staff must go to the meeting room I1.14. Each team member must fill in the Teams' daily registration sheet (check-in/check-out date and time, check-in/check-out temperature and confirm that is not experiencing any symptoms).

There will be closets to leave personal belongings (coats, mobile phones, purses, backpacks). Keep the key. Cell phones are exceptionally allowed if an urgent call is expected. In such case the phone must be placed in a ziplock bag and left by the computer present in each room.

Meals room

The meals room is in the 1st floor, in front of the personal belongings room (I1.14). A maximum of 5 people can be at the room at any given time. The social distance should be ensured.

Meals will be provided.

Wipe your table once used.

Use the trash to discard any leftovers.

Keep the microwave clean.

Wash your hands upon arrival and on departure.

9 V1.8|13.05.2020

SECTION D - DATABASES AND LABELLING OF SAMPLES

D1 – VOLUNTEERS’ DATABASE

All volunteers' personal data (name, phone and e-mail), availability and details about lab experience (the type of tasks and years of experience) are included in a spreadsheet to allow distribution of volunteers in teams according to the number of samples to be processed. All personal data will be destroyed after the end of the COVID19 Diagnostic action.

D2 – SAMPLES’ DATABASE

Upon arrival, samples' information will be registered in the Sample ID form. Sample ID form spreadsheet is deposited in a shared folder accessible only to the ICVS overseers registered for the molecular detection of SARS-CoV-2 protocol described in this SOP, using their own ICVS login credentials.

The Sample ID form spreadsheet is protected against unintended editing and overseers may only include information regarding their own station.

Original Swab Boxes will be stored at –80°C, upon available capacity.

Samples RNA will be stored at –80°C.

10 V1.8|13.05.2020

SECTION E – DETAILED STANDARD OPERATING PROCEDURE

E1 – SAMPLES’ TRANSPORT TO ICVS

Transport of biological samples should follow the rules for packaging of infectious substances recommended by the WHO - category B (UN 3373). A triple packaging system should be used with the following characteristics:

a. Primary container is the one that contains the sample; must be properly identified and must be liquid and solid-tight; must be packed in enough absorbent material to absorb the entire contents in case of breakage or spill; b. Secondary container is the one that holds the primary containers; should be resistant, waterproof and leakproof to liquids and solids; may contain several sample tubes as long as they are individually and separately packed, in order to avoid contact, and protected with absorbent material and shock absorber; c. Outer container is the transport packaging with adequate padding and ice-cold blocks, where the secondary containers are placed.

Samples will enter through the research wing of the School of Medicine from University of Minho. The meeting point is the lateral door that accesses the parking.

Samples will be received ONLY by authorized ICVS staff, who’s responsible to

a. keep samples' physical records (if any); b. store the samples in appropriate conditions.

E2. SAMPLE LABELING

1. Samples will be delivered to the antechamber of BSL3, where Virus Inactivation Team Check-in Overseer will register samples in the Sample ID form, recording: a. Date and time of arrival at the ICVS, b. Origin of the samples (Health Care/Care Taker Entity), c. BSL3 Inactivation team members, d. Health Care/Care Taker Entity ID number.

11 V1.8|13.05.2020

2. In the Virus Inactivation Room, check-in overseer reads out loud the Health Care/Care Taker Entity ID of each sample and assigns the sample an internal ICVS ID. Check-in operator labels each swab falcon tube with its respective ICVS ID. 3. In the RNA Extraction Room, the overseer will be able to: a. add the name of the RNA Extraction Room operators, overseers and notes, if needed, b. print final RNA eppendorf tube labels containing the ICVS ID as well as the original Health Care/Care Taker Entity ID. 4. In the RT-qPCR Room, the overseer will be able to: a. add the name of PCR operators, overseers and notes, if needed, b. information on PCR ID, c. test conclusion, d. sample storage and notes.

E3. VIRUS INACTIVATION AND RNA EXTRACTION

IMPORTANT CONSIDERATIONS

Concerning the actual situation of pandemic, the reagents’ supply is often delayed or out-of-stock. To overcome the issue of possible stock rupture, we developed and validated alternative protocols to continuously provide the diagnostic of SARS-CoV-2 at ICVS. Protocols to be used for Virus Inactivation and Extraction are, in order of preference, E3. 1 – FOSUN Viral DNA and RNA Purification Kit, E3. 2 – GeneJet Viral DNA and RNA Purification Kit (ThermoScientific), E3. 3 – NZYTech Total RNA Isolation Kit (NZYTech) and E3. 4 Nyzol RNA Extraction Method.

12 V1.8|13.05.2020

E3. 1 – VIRUS INACTIVATION AND RNA EXTRACTION USING FOSUN

Viral DNA and RNA Purification Kit

E3. 1 A – VIRUS INACTIVATION ROOM

Room: BSL3 - Virus Inactivation Room, (I3γ04), ICVS 3rd floor Virus Inactivation Station: Team:

BSC 1: Virus Inactivation station 1 - One check-in operator and one check-in overseer for BSC 1 BSC 2: Virus Inactivation station 2 - One operator and one overseer for BSC 2

PPE: a. coveralls b. FFP2 or N95 face mask c. hair cover Maximum and minimum capacity with 2 BSC running: 4 people d. two pairs of gloves e. clogs f. two pairs of shoe covers g. sleeve covers/disposable gowns h. safety glasses/face visor

13 V1.8|13.05.2020

IMPORTANT INFORMATION

ALL FOLLOWING RECOMMENDATIONS FOR THE SARS-COV-2 INACTIVATION PROTOCOL ADD ON TO THE BSL3 GUIDELINES ALREADY IMPLEMENTED AT THE ICVS. IN CASE OF EMERGENCY (SPILL, POWER FAILURE…), PLEASE FOLLOW EMERGENCY PLANS DESCRIBED ON THE ICVS BSL3 MANUAL. SEE ALSO THE GUIDELINES IN THE RISK ASSESSMENT SECTION BELOW.

ONLY AUTHORIZED BSL3 USERS ARE ALLOWED TO ENTER THE BSL3 ROOM AND PERFORM THE VIRUS INACTIVATION PROTOCOL.

E3. 1 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES

OVERSEER

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and must be ready to help in any emergency. In addition, the overseer must:

a. pick up samples from the antechamber of the Virus Inactivation Room (BSL3), b. fill in the Sample ID form with Health Care/Care Taker ID and a correspondent internal ICVS ID, c. place Rack 3 with inactivated samples in the clean area of the antechamber and call the RNA Extraction Room for sample pick up.

OPERATORS

Operators will proceed with the virus inactivation protocol in the BSC. Operators are also responsible to set up the BSC with all essential reagents, materials and equipment provided in a checklist:

a. Benchcoat, b. Vortex, c. Solid waste bag, d. Liquid waste container with 10% bleach, e. 1000 µL and 200 µL pipette tip Box, f. 1000 µL and 200 µL pipette, g. Bleach wipes,

14 V1.8|13.05.2020

h. Disinfectant squirt bottle, i. EtOH squirt bottle, j. Rack 1 and Rack 2 for eppendorfs, k. Rack A and Rack B for swab falcon tubes, l. RNase-free eppendorfs, m. Lysis Solution supplemented with Carrier RNA (to be prepared by the RNA EXTRACTION team's Overseer), n. Proteinase K, o. Heated thermoblock at 70ºC, p. Rack 3 and Rack C on adjacent table.

E3. 1 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – FOSUN Viral DNA and RNA Purification Kit

MATERIAL PREPARATION

1. Inside the BSC, prepare and label eppendorf tubes with ICVS ID (ICVS XXXX) and place them on Rack 1 (This should be prepared in sets of 48 samples to inactivate. Every set MUST include a PC and NTC in the samples to inactivate, as a control quality measure). 2. Close flask of eppendorf tubes and move it to the side to be immediately removed from BSC by overseer. 3. Add 400 µl of lysis buffer to each eppendorf. 4. Close eppendorf tubes in Rack 1 and move Rack 1 to the back of the benchcoat area.

SAMPLE CHECK-IN

1. Samples arrive at the antechamber in a container, containing the swab falcon tubes in viral transport medium. 2. Check-in overseer collects samples from antechamber and moves sample container into the check-in working area (onto the benchcoat). 3. Check-in operator opens the container and removes and counts the swab falcon tubes.

15 V1.8|13.05.2020

4. One-by-one, in sets of 48 samples, operator wipes the swab falcon tubes with bleach wipes, check that the lid is tightly screwed on, and place tubes onto Rack A. 5. Discard any plastic bag(s) in solid waste bag. 6. Check-in overseer registers check-in team details: a. the person who deposits the sample container in the antechamber room; b. BSL3 team information and date/time of sample arrival at the ICVS, 7. In parallel for all samples (one-by-one): a. Check-in operator reads the Health Care/Care Taker Entity ID on the swab falcon tube - each tube should be removed from the Rack to be annotated, to avoid errors, b. Check-in overseer registers a corresponding ICVS ID to the Health Care/Care Taker Entity ID, c. Check-in operator labels the swab falcon tube with the internal ICVS ID and wipes the swab falcon tubes with bleach wipes.

SAMPLE TRANSFER (FROM SWAB FALCON TUBE TO EPPENDORF) AND INACTIVATION

8. Overseer brings Rack A to the BSC. 9. For all samples one-by-one, the operator: a. vortex each swab tube for 10 seconds. b. Pick-up 1000ul micropipette with extra-long 1000 ul tips. c. Open the eppendorf tube with ICVS ID (on rack 1) and place it on Rack 2, d. Open the swab falcon tube with the same ICVS ID, holding the swab falcon tube at an elevated position so that the operator is protected by the BSC sash, e. Transfer 200 µl of sample from swab tube to the eppendorf tube, f. Place the swab falcon tube to Rack B, g. Discard tip in liquid waste container, h. Close the swab falcon tube. 10. Close the eppendorf tube. 11. For all samples on Rack 2, one-by-one: a. Open the Proteinase K tube and Tips Box, b. Put a tip onto the P200 pipette, 16 V1.8|13.05.2020

c. Pipette 20 µl of Proteinase K and add to the eppendorf tube, d. Close the eppendorf tube and put it back in the same position in Rack 2, e. Discard the tip into liquid waste, f. Repeat for each eppendorf tube. 12. Vortex each eppendorf tube for 10 seconds and return to the same position. 13. Wipe the eppendorf tubes, one-by-one, and move to Rack 3, outside of the BSC. 14. Place tubes alternately on the thermoblock and incubate for 10 minutes at 70ºC. 15. In the meanwhile, wipe the swab falcon tubes, one-by-one, with wipes and move back to Rack B. 16. When all the swab tubes are disinfected, remove outer gloves and place in the liquid waste container with 10% bleach. 17. Put on new gloves.

EXIT OF INACTIVATED MATERIAL

18. Move the swab falcon tubes from Rack B to Rack C, being held by the overseer outside of the BSC. 19. After the 10min incubation period, move eppendorf tubes back to Rack 3. 20. Overseer places Rack 3 in the antechamber in the clean zone. 21. Overseer calls RNA Extraction Room to announce samples are ready for pick up.

CLEANING PROCEDURES: END OF SHIFT OR END OF DAY

If closing for the day OR for the next team, proceed with full decontamination procedure:

27. Discard all wipes in the solid waste bag. 28. Close the solid waste bag with tape inside the hood (do not close too tightly), disinfect surface area and place trash to autoclave. 29. Overseer closes the sash, turns off light and air flow, and turns ON the UVs. 30. After each exit of the Virus Inactivation Room, all PPE should be discarded or properly disinfected. 31. The swab falcon tubes on Rack C are placed in a designated box stored at -80ºC, labelled “Original Swab Box #X”.

E3. 1 B RNA EXTRACTION ROOM

Room: BSL2 - RNA Extraction Room (I3α05), ICVS 3rd floor RNA Extraction Station Team:

BSC 1: RNA extraction station 1 - One operator for BSC 1 BSC 2: RNA extraction station 2 - One operator for BSC 2 BSC 3: RNA extraction station 3 - One operator for BSC 3 - One overseer for BSC 1, BSC 2 and BSC 3 PPE: Maximum capacity with 3 Hoods running: 4 people a. labcoat Maximum capacity with 2 Hoods running: 3 people b. gloves Minimum capacity 1 Hood working: 2 people c. surgical mask

18 V1.8|13.05.2020

E3. 1 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES

OVERSEER

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

a. add information of the working team to the file “Sample ID form” previously filled-in by the team present in the BSL3 - Virus Inactivation room, b. Prepare fresh Lysis Solution supplemented with the Carrier RNA (supplied with the kit- to 400 µl of Lysis buffer add 4 µl of Carrier RNA) and mix by pulse-vortexing) and deliver it to the antechamber. c. pick up Rack 3 with samples from the antechamber of the BSL3 - Virus Inactivation Room, once a phone call is received from the BSL3 Virus Inactivation Room announcing that samples are ready, d. deliver Rack 3 to the operator of BSC. e. deliver the samples to the RT-qPCR Team.

OPERATORS

Operators will proceed with the RNA extraction protocol, in the BSC. Operators are responsible to set up BSC with all essential reagents, materials and equipment provided in a checklist:

a. Waste bottle with 10% bleach, b. 100% EtOH, c. P200 micropipette, d. p1000 micropipette, e. p200 tips box, f. p1000 tips box, g. Wash Buffer W1B (supplied with the kit), with absolute EtOH added, h. Wash Buffer W2B (supplied with the kit), with absolute EtOH added, i. Collection tubes (supplied with the kit), j. Elution Buffer (preheated to 70°C).

19 V1.8|13.05.2020

E3. 1 B2 DETAILED PROCEDURES FOR RNA EXTRACTION – FOSUN Viral DNA and RNA Purification Kit

RNA EXTRACTION PROTOCOL

1. Add 500 µL of EtOH (96-100%) and mix by vortexing. 2. Centrifuge for 3-5 seconds at full speed to collect contents at the bottom's tube. 3. Transfer 550 µL of the lysate to the Spin, centrifuge at 13.000g for 1 minute, and discard the filtrate. Repeat this step one more time. 4. Add 500 µL of buffer W1B into the column, centrifuge at 13.000g for 1 minute, and discard the filtrate. 5. Add 500 µL of buffer W2 into the column, centrifuge at 13.000g for 1 minute, and discard the filtrate. Repeat this step one more time. 6. Centrifuge the column at 13.000g for 1 min and place the column in a new 1.5 mL Eppendorf. 7. Add 40μL of elution buffer solution preheated at 70℃ in the center of the column. 8. Incubate for 1 minutes at room temperature. 9. Centrifuge the column for 1 minute at 13.000 g. 10. Discard the Spin Column. 11. Keep the elution tube containing pure viral nucleic acids. 12. Label each RNA sample with the labels brought to the room by the overseer. Store the RNA on ice in a styrofoam box.

Overseer will transport the RNA samples on the styrofoam box to the first floor to proceed to RT- qPCR.

20 V1.8|13.05.2020

E3.2 – VIRUS INACTIVATION AND RNA EXTRACTION USING GeneJet

Viral DNA and RNA Purification Kit (ThermoScientific)

E3. 2 A – VIRUS INACTIVATION ROOM

Room: BSL3 - Virus Inactivation Room, (I3γ04), ICVS 3rd floor Virus Inactivation Station: Team:

BSC 1: Virus Inactivation station 1 - One check-in operator and one check-in overseer for BSC 1 BSC 2: Virus Inactivation station 2 - One operator and one overseer for BSC 2

21 V1.8|13.05.2020

IMPORTANT INFORMATION

ONLY AUTHORIZED BSL3 USERS ARE ALLOWED TO ENTER THE BSL3 ROOM AND PERFORM THE VIRUS INACTIVATION PROTOCOL.

E3. 2 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES

OVERSEER

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and must be ready to help in any emergency. In addition, the overseer must:

OPERATORS

Operators will proceed with the virus inactivation protocol in the BSC. Operators are also responsible to set up the BSC with all essential reagents, materials and equipment provided in a checklist:

a. Benchcoat, b. Vortex, c. Solid waste bag, d. Liquid waste container with 10% bleach, e. 1000 µL and 200 µL pipette tip Box, f. 1000 µL and 200 µL pipette, g. Bleach wipes, 22 V1.8|13.05.2020

h. Disinfectant squirt bottle, i. EtOH squirt bottle, j. Rack 1 and Rack 2 for eppendorfs, k. Rack A and Rack B for swab falcon tubes, l. RNAse-free eppendorfs, m. Parafilm strips, n. Lysis Solution supplemented with Carrier RNA (to be prepared by the RNA EXTRACTION team's Overseer), o. Proteinase K, p. Heated thermoblock at 56ºC, q. Rack 3 and Rack C on adjacent table.

E3. 2 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – GeneJET Viral DNA and RNA Purification Kit

MATERIAL PREPARATION

1. Inside the BSC, prepare and label eppendorf tubes with ICVS ID (ICVS XXXX) and place them on Rack 1 (This should be prepared in sets of 48 samples to inactivate. Every set MUST include a PC and NTC in the samples to inactivate, as a control quality measure). 2. Close flask of eppendorf tubes and move it to the side to be immediately removed from BSC by overseer. 3. Add 200ul of lysis buffer to each eppendorf. 4. Close eppendorf tubes in Rack 1 and move Rack 1 to the back of the benchcoat area.

SAMPLE CHECK-IN

23 V1.8|13.05.2020

8. One-by-one, in sets of 48 samples, operator wipes the swab falcon tubes with bleach wipes, check that the lid is tightly screwed on, and place tubes onto Rack A. 9. Discard any plastic bag(s) in solid waste bag. 10. Check-in overseer registers check-in team details: a. the person who deposits the sample container in the antechamber room; b. BSL3 team information and date/time of sample arrival at the ICVS, 11. In parallel for all samples (one-by-one): a. Check-in operator reads the Health Care/Care Taker Entity ID on the swab falcon tube - each tube should be removed from the Rack to be annotated, to avoid errors, b. Check-in overseer registers a corresponding ICVS ID to the Health Care/Care Taker Entity ID, c. Check-in operator labels the swab falcon tube with the internal ICVS ID and wipes the swab falcon tubes with bleach wipes.

SAMPLE TRANSFER (FROM SWAB FALCON TUBE TO EPPENDORF) AND INACTIVATION

12. Overseer brings Rack A to the BSC. 13. For all samples one-by-one, the operator: 14. vortex each swab tube for 10 seconds. 15. Pick-up 1000ul micropipette with extra-long 1000 ul tips. 16. Open the eppendorf tube with ICVS ID (on rack 1) and place it on Rack 2, 17. Open the swab falcon tube with the same ICVS ID, holding the swab falcon tube at an elevated position so that the operator is protected by the BSC sash, 18. Transfer 200 µl of sample from swab tube to the eppendorf tube, 19. Place the swab falcon tube to Rack B, 20. Discard tip in liquid waste container, 21. Close the swab falcon tube. 22. Close the eppendorf tube. 23. For all samples on Rack 2, one-by-one: 24. Open the Proteinase K tube and Tips Box, 25. Put a tip onto the P200 pipette, 24 V1.8|13.05.2020

26. Pipette 50 µl of Proteinase K and add to the eppendorf tube, 27. Close the eppendorf tube and put it back in the same position in Rack 2, 28. Discard the tip into liquid waste, 29. Repeat for each eppendorf tube. 30. Vortex each eppendorf tube for 10 seconds and return to the same position. 31. Wipe the eppendorf tubes, one-by-one, and move to Rack 3, outside of the BSC. 32. Place tubes alternately on the thermoblock and incubate for 15 minutes at 56ºC. 33. In the meanwhile, wipe the swab falcon tubes, one-by-one, with wipes and move back to Rack B. 34. When all the swab tubes are disinfected, remove outer gloves and place in the liquid waste container with 10% bleach. 35. Put on new gloves.

EXIT OF INACTIVATED MATERIAL

36. Move the swab falcon tubes from Rack B to Rack C, being held by the overseer outside of the BSC. 37. After the 15min incubation period, move eppendorf tubes back to Rack 3. 38. Overseer places Rack 3 in the antechamber in the clean zone. 39. Overseer calls RNA Extraction Room to announce samples are ready for pick up.

CLEANING PROCEDURES: END OF SHIFT OR END OF DAY

If closing for the day OR for the next team, proceed with full decontamination procedure:

40. Wipe all items OUTSIDE the working area with bleach wipes (squirt bottles, box of bleach wipes, solid waste container, liquid waste container, samples container, parafilm box, Rack 2 and Rack B). 41. Wipe all items INSIDE the working area with bleach wipes (Rack A, Tip Box, Pipette, Buffer, Buffer Rack). 42. Carefully close the benchcoat of the working area and throw it in the solid waste bag. 43. Wipe the entire surface of the hood with disinfectant.

25 V1.8|13.05.2020

44. Wipe the surface of hood with 70% ethanol to remove traces of disinfectant. 45. Discard all wipes in the solid waste bag. 46. Close the solid waste bag with tape inside the hood (do not close too tightly), disinfect surface area and place trash to autoclave. 47. Overseer closes the sash, turns off light and air flow, and turns ON the UVs. 48. After each exit of the Virus Inactivation Room, all PPE should be discarded or properly disinfected. 49. The swab falcon tubes on Rack C are placed in a designated box stored at -80ºC, labelled “Original Swab Box #X”.

E3. 2 B RNA EXTRACTION ROOM

Room: BSL2 - RNA Extraction Room (I3α05), ICVS 3rd floor RNA Extraction Station Team:

E3. 2 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES

26 V1.8|13.05.2020

OVERSEER

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

a. add information of the working team to the file “Sample ID form” previously filled-in by the team present in the BSL3 - Virus Inactivation room, b. print the labels according to the information received from the BSL3 - Virus Inactivation Room and bring them to the RNA Extraction room, c. Prepare fresh Lysis Solution supplemented with the Carrier RNA (supplied with the kit- to 220 µl of Lysis buffer add 25 µl of Carrier RNA) and mix by pulse-vortexing) and deliver it to the antechamber. d. pick up Rack 3 with samples from the antechamber of the BSL3 - Virus Inactivation Room, once a phone call is received from the BSL3 Virus Inactivation Room announcing that samples are ready, e. deliver Rack 3 to the operator of BSC. f. deliver the samples to the RT-qPCR Team.

OPERATORS

Operators will proceed with the RNA extraction protocol, in the BSC. Operators are responsible to set up BSC with all essential reagents, materials and equipment provided in a checklist:

a. Waste bottle with 4% deconnex, b. Column Preparation Liquid (red cap), c. 100% EtOH (ice cold), d. p100 micropipette, e. p1000 micropipette, f. p100 tips box, g. p1000 tips box, h. Wash Buffer 1 (supplied with the kit), with absolute EtOH added i. Wash Buffer 2 (supplied with the kit), with absolute EtOH added, j. Collection tubes (supplied with the kit),

27 V1.8|13.05.2020

k. Eluent (white cap) (preheated to 56°C).

E3. 2 B2 DETAILED PROCEDURES FOR RNA EXTRACTION – GeneJET Viral DNA and RNA Purification Kit (ThermoScientific)

MATERIAL PREPARATION

1. Prepare a rack with 5 rows of Spin Columns preassembled with the wash tube (number of tubes per row equal to the number of samples to be extracted) and label the lid with internal ICVS ID. 2. Add 50 µL of Column Preparation Liquid (red cap) to the center of Spin Column membrane. Do not centrifuge and store at room temperature until used for sample processing. 3. Preheat the eluent (white cap) to 56°C using the thermoblock presented in bench. 4. Ready to receive the samples in Rack 3 by the overseer.

RNA EXTRACTION PROTOCOL

5. Centrifuge tubes for 3-5 seconds at full speed to collect contents at the bottom´s tube. 6. Add 300 µL of EtOH (96-100%) and mix by vortexing. 7. Incubate the sample at room temperature for 3 minutes. 8. Centrifuge for 3-5 seconds at full speed to collect contents at the bottom's tube. 9. Transfer the lysate to the prepared Spin Column preassembled the wash tube. 10. Centrifuge the column for 1 minute at 6.000 g. 11. Discard the Wash Tube containing flow-through. 12. Place the Spin Column into a new 2 mL Wash Tube. 13. Add 700 µL of Wash Buffer 1 supplemented with EtOH to the Spin Column. 14. Centrifuge the column for 1 minute at 6.000 g. 15. Discard the Wash Tube containing flow-through. 16. Place the Spin Column into a new 2 mL Wash Tube. 17. Add 500 µL of Wash Buffer 2 supplemented with EtOH to the Spin Column. 18. Centrifuge the column for 1 minute at 6.000 g.

28 V1.8|13.05.2020

19. Discard the Wash Tube containing flow-through. 20. Place the Spin Column into a new 2 mL Wash Tube. 21. Add 500 µL of Wash Buffer 2 supplemented with EtOH to the Spin Column. 22. Centrifuge the column for 1 minute at 6.000 g. 23. Discard the Wash Tube containing flow-through. 24. Place the Spin Column into a new 2 mL Wash Tube. 25. Centrifuge the column for 3 minutes at 16.000 g. 26. Discard the Wash Tube containing remaining flow-through. 27. Place the Spin Column into a new 1.5 mL elution tube. 28. Add 40 µL of Eluent (white cap) preheated to 56°C to the center of Spin Column membrane. 29. Incubate for 2 minutes at room temperature. 30. Centrifuge the column for 1 minute at 13.000 g. 31. Discard the Spin Column. 32. Keep the elution tube containing pure viral nucleic acids. 33. Label each RNA sample with the labels brought to the room by the overseer. Store the RNA on ice in a styrofoam box. 34. Overseer will transport the RNA samples on the styrofoam box to the first floor to proceed to RT-qPCR.

29 V1.8|13.05.2020

E3.3 – VIRUS INACTIVATION AND RNA EXTRACTION USING NZYTech Total RNA Isolation Kit

E3. 3 A – VIRUS INACTIVATION ROOM

Room: BSL3 - Virus Inactivation Room, (I3γ04), ICVS 3rd floor Virus Inactivation Station: Team:

BSC 1: Virus Inactivation station 1 - One check-in operator and one check-in overseer for BSC 1 BSC 2: Virus Inactivation station 2 - One operator and one overseer for BSC 2

30 V1.8|13.05.2020

ONLY AUTHORIZED BSL3 USERS ARE ALLOWED TO ENTER THE BSL3 ROOM AND PERFORM THE VIRUS INACTIVATION PROTOCOL.

E3. 3 A1 – VIRUS INACTIVATION TEAM: RESPONSIBILITIES

OVERSEER

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and must be ready to help in any emergency. In addition, the overseer must:

a. pick up samples from the antechamber of the BSL3-Virus Inactivation Room (BSL3); b. fill in the Sample ID form with Health Care/Care Taker ID and a correspondent internal ICVS ID (ICVS XXXX); c. place Rack 3 with inactivated samples in the clean area of the antechamber and call the RNA Extraction Room for sample pick up.

OPERATORS

Operators will proceed with the virus inactivation protocol in the BSC. Operators are also responsible to set up the BSC with all essential reagents, materials and equipment provided in a checklist:

a. Benchcoat, b. Vortex, c. Solid waste bag, d. Liquid waste container with 10% bleach, e. 1000 µL pipette tip Box, f. 1000 µL pipette, g. Bleach wipes, h. Disinfectant squirt bottle,

31 V1.8|13.05.2020

i. EtOH squirt bottle, j. Rack 1 and Rack 2 for eppendorfs, k. Rack A and Rack B for swab falcon tubes, l. RNAse-free eppendorfs, m. Rack 3 and Rack C on adjacent table.

E3. 3 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – NZY Total RNA Isolation kit

MATERIAL PREPARATION

1. Inside the BSC, prepare and label eppendorf tubes with ICVS ID (ICVS XXXX) and place them on Rack 1 (This should be prepared in sets of 48 samples to inactivate. Every set MUST include a PC and NTC in the samples to inactivate, as a control quality measure). 2. Close flask of eppendorf tubes and move it to the side to be immediately removed from BSC by overseer. 3. Add 350ul of NVL buffer to each eppendorf. 4. Close eppendorf tubes in Rack 1 and move Rack 1 to the back of the benchcoat area.

SAMPLE CHECK-IN

32 V1.8|13.05.2020

11. In parallel for all samples (one-by-one): a. Check-in operator reads the Health Care/Care Taker Entity ID on the swab falcon tube - each tube should be removed from the Rack to be annotated, to avoid errors, b. Check-in overseer registers a corresponding ICVS ID to the Health Care/Care Taker Entity ID, c. Check-in operator labels the swab falcon tube with the internal ICVS ID and wipes the swab falcon tubes with bleach wipes.

SAMPLE TRANSFER (FROM SWAB FALCON TUBE TO EPPENDORF) AND INACTIVATION

12. Overseer brings Rack A to the BSC. 13. Operator vortexes each swab falcon tube for 10 seconds and return to Rack A. 14. For all samples one-by-one, the operator: a. vortex each swab tube for 10 seconds. b. Pick-up 1000ul micropipette with extra-long 1000 ul tips. c. Open the eppendorf tube with ICVS ID (on rack 1) and place it on Rack 2, d. Open the swab falcon tube with the same ICVS ID, holding the swab falcon tube at an elevated position so that the operator is protected by the BSC sash, e. Transfer 200 µl of sample from swab tube to the eppendorf tube, f. Place the swab falcon tube to Rack B, g. Discard tip in liquid waste container, h. Close the swab falcon tube. i. Close the eppendorf tube. j. Vortex each eppendorf tube for 10 seconds and return to the same position. k. Wipe the eppendorf tubes, one-by-one 15. One-by-one, wipe the swab falcon tubes, with bleach wipes, and move to Rack B. 16. When all the swab falcon tubes are disinfected and in Rack B remove outer gloves and place in the liquid waste container with 10% bleach. 17. Put on new gloves.

33 V1.8|13.05.2020

EXIT OF INACTIVATED MATERIAL

18. Move the swab falcon tubes from Rack B to Rack C, being held by the overseer outside of the BSC. 19. Move eppendorf tubes from Rack 2 to Rack 3, being held by the overseer outside of the BSC. 20. Overseer places Rack 3 in the antechamber in the clean zone. 21. Overseer calls RNA Extraction Room to announce samples are ready for pick up.

CLEANING PROCEDURES: END OF SHIFT OR END OF DAY

If closing for the day OR for the next team, proceed with full decontamination procedure:

22. Wipe all items OUTSIDE the working area with bleach wipes (squirt bottles, box of bleach wipes, solid waste container, liquid waste container, samples container, parafilm box, Rack 2 and Rack B). 23. Wipe all items INSIDE the working area with bleach wipes (Rack A, Tip Box, Pipette, Buffer, Buffer Rack). 24. Carefully close the benchcoat of the working area and throw it in the solid waste bag. 25. Wipe the entire surface of the hood with disinfectant. 26. Wipe the surface of hood with 70% ethanol to remove traces of disinfectant. 27. Discard all wipes in the solid waste bag. 28. Close the solid waste bag with tape inside the hood (do not close too tightly), disinfect surface area and place trash to autoclave. 29. Overseer closes the sash, turns off light and air flow, and turns ON the UVs. 30. After each exit of the Virus Inactivation Room, all PPE should be discarded or properly disinfected. 31. The swab falcon tubes on Rack C are placed in a designated box stored at -80ºC, labelled “Original Swab Box #X”.

34 V1.8|13.05.2020

E3. 3 B RNA EXTRACTION ROOM

Room: BSL2 - RNA Extraction Room (I3α05), ICVS 3rd floor RNA Extraction Station Team:

E3. 3 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES

OVERSEER

Overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

a. Add information of the working team to the file “Sample ID form” previously filled-in by the team present in the BSL3 - Virus Inactivation Room, b. Print the labels according to the information received from the BSL3 - Virus Inactivation Room and bring them to the BSL2 - RNA Extraction room,

35 V1.8|13.05.2020

c. Pick up the Rack 3 with samples from the antechamber of the BSL3 - Virus Inactivation Room, once a phone call is received from the BSL3 - Virus Inactivation Room announcing that the samples are ready, d. Deliver Rack 3 to the operator of BSC. e. Deliver the samples to the RT-qPCR Team, ICVS first floor.

OPERATORS

Operators will proceed with the RNA extraction protocol in the BSC. Operators are also responsible to set up BSC with all essential reagents, materials and equipment provided in a checklist

a. Waste bottle with 10% bleach, b. absolute EtOH c. Buffer NVL (supplied with kit), d. p200 micropipette, e. p1000 micropipette, f. p200 tips box, g. p1000 tips box, h. Buffer NV (supplied with kit), i. Buffer NVW (supplied with kit), with absolute EtOH added, j. RNase-free Water (supplied with kit), k. Collection tubes (supplied with kit).

E3. 3 B2 DETAILED PROCEDURES FOR RNA EXTRACTION - NZY Total RNA isolation kit

MATERIAL PREPARATION

1. In the BSC, label the NZYSpin Binding column (blue ring) with the internal ICVS ID (ICVS- XXXX). 2. Prepare a rack with 5 rows of collection tubes (number of collection tubes per row equal to the number of samples to be extracted, in multiples of 16)

36 V1.8|13.05.2020

3. Label 2 sets of 1.5 mL RNAse-free eppendorf tubes for RNA elution with the internal ICVS ID (ICVS-xxx) written on the lid. 4. Ready to receive the samples in Rack 3 by the overseer.

RNA EXTRACTION PROTOCOL

1. Centrifuge the sample tubes at 11.000 g for 1 minute to collect contents at the tubes' bottom. 2. One-by-one, add 350 µL of absolute ethanol and mix immediately by pipetting up and down. Do not centrifuge. 3. Pipette the lysate onto the NZYSpin column. Centrifuge at 6.000 g for 1 min. Discard the flow-through and replace the collection tube. 4. Add 200 µL of Buffer NW and centrifuge at 6.000 g for 1 minute. Discard the flow-through and place the column in the collection tube. 5. Add 600 µL of Buffer NVW and centrifuge at 6.000 g for 1 minute. Discard the flow-through and place the column back in the collection tube. 6. Add 300 µL of Buffer NVR into each column. Centrifuge at6.000 g for 1 minute. Discard the flow-through and place the column in the collection tube. 7. Centrifuge again at 13.000 g for 2 minutes, to dry the membrane. 8. Place the NZYSpin Column in a clean 1.5 mL RNase-free microcentrifuge tube. Add 40 µL RNase-free water directly to the column membrane. Incubate for 4 minute and centrifuge at 13.000 g for 1 min to elute the RNA. Store the RNA at -20°C for short-term or at -70°C for long-term. 9. Label each RNA sample with the labels brought to the room by the overseer. Store the RNA on ice on a styrofoam box. 10. Overseer will transport the RNA sample on a styrofoam box to the first floor to proceed to RT-qPCR.

37 V1.8|13.05.2020

E3. 4 – VIRUS INACTIVATION AND RNA EXTRACTION USING THE NYZOL METHOD (NZytech)

E3. 4 A VIRUS INACTIVATION ROOM

Room: BSL3 - Virus Inactivation Room, (I3γ04), ICVS 3rd floor Virus Inactivation Station: Team:

BSC 1: Virus Inactivation station 1 - One check-in operator and one check-in overseer for BSC 1 BSC 2: Virus Inactivation station 2 - One operator and one overseer for BSC 2

ONLY AUTHORIZED BSL3 USERS ARE ALLOWED TO ENTER THE BSL3 ROOM AND PERFORM THE VIRUS INACTIVATION PROTOCOL. 38 V1.8|13.05.2020

E3. 4 A1 VIRUS INACTIVATION TEAM'S RESPONSIBILITIES

The overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and must be ready to help in any emergency. In addition, the overseer must:

a. pick up samples from the antechamber of the Virus Inactivation Room (BSL3); b. fill in the Sample ID form with Health Care/Care Taker ID and a correspondent internal ICVS ID; c. place Rack 3 with inactivated samples in the clean area of the antechamber and call the RNA Extraction Room for sample pick up.

OPERATORS

Operators will proceed with the virus inactivation protocol in the BSC. Operators are also responsible to set up the BSC with all essential reagents, materials and equipment provided in a checklist:

a. Benchcoat, b. Vortex, c. Solid waste bag, d. Liquid waste boat with 10% bleach, e. 1000 µL pipette tip Box, f. 1000 µL pipette, g. Bleach wipes, h. Disinfectant squirt bottle, i. EtOH squirt bottle, j. Rack 1 and Rack 2 for Eppendorf tubes, k. Rack A and Rack B for swab tubes, l. RNA-free eppendorfs, m. RNase-free water, n. Trizol at 4°C, o. Rack 3 and Rack C on adjacent table.

39 V1.8|13.05.2020

E3. 4 A2 DETAILED PROCEDURES FOR VIRUS INACTIVATION – TRIZOL

MATERIAL PREPARATION

1. Inside the BSC, prepare and label eppendorf tubes with ICVS ID (ICVS XXXX) and place them on Rack 1 (This should be prepared in sets of 48 samples to inactivate. Every set MUST include a PC and NTC in the samples to inactivate, as a control quality measure). 2. Close flask of eppendorf tubes and move it to the side to be immediately removed from BSC by overseer. 3. Add 700 µl of Nyzol at 4ºC to each eppendorf. 4. Close eppendorf tubes in Rack 1 and move Rack 1 to the back of the benchcoat area.

SAMPLE CHECK-IN

5. Samples arrive at the antechamber in a container, containing the swab falcon tubes in viral transport medium. 6. Check-in overseer collects samples from antechamber and moves sample container into the check-in working area (onto the benchcoat). 7. Check-in operator opens the container and removes and counts the swab falcon tubes. 8. One-by-one, in sets of 48 samples, operator wipes the swab falcon tubes with bleach wipes, check that the lid is tightly screwed on, and place tubes onto Rack A. 9. Discard any plastic bag(s) in solid waste bag. 10. Check-in overseer registers check-in team details: a. the person who deposits the sample container in the antechamber room; b. BSL3 team information and date/time of sample arrival at the ICVS, 11. In parallel for all samples (one-by-one): a. Check-in operator reads the Health Care/Care Taker Entity ID on the swab falcon tube - each tube should be removed from the Rack to be annotated, to avoid errors, b. Check-in overseer registers a corresponding ICVS ID to the Health Care/Care Taker Entity ID, c. Check-in operator labels the swab falcon tube with the internal ICVS ID and wipes the swab falcon tubes with bleach wipes. 40 V1.8|13.05.2020

SAMPLE TRANSFER (FROM SWAB FALCON TUBE TO EPPENDORF) AND INACTIVATION

12. Overseer brings Rack A to the BSC. 13. Operator vortexes each swab falcon tube for 10 seconds and return to Rack A. 14. For all samples one-by-one, the operator: c. vortex each swab tube for 10 seconds. d. Pick-up 1000 µl micropipette with extra-long 1000 ul tips. e. Open the eppendorf tube with ICVS ID (on rack 1) and place it on Rack 2, f. Open the swab falcon tube with the same ICVS ID, holding the swab falcon tube at an elevated position so that the operator is protected by the BSC sash, g. Transfer 300 µl of sample from swab tube to the eppendorf tube, h. Mix by inverting up and down 5 times (sample lysis). i. Place the swab falcon tube to Rack B, j. Discard tip in liquid waste container, k. Close the swab falcon tube. l. Close the eppendorf tube. 15. Wipe the eppendorf tubes, one-by-one. Incubate eppendorf sample tubes for 5 minutes at room temperature (this step inactivates de virus). There is no need to incubate the samples inside the BSC. The samples MUST get into BSL2 within 10 minutes. 16. One-by-one, wipe the swab falcon tubes, with bleach wipes, and move to Rack B. 17. When all the swab falcon tubes are disinfected and in Rack B remove outer gloves and place in the liquid waste container with 10% bleach. 18. Put on new gloves.

EXIT OF INACTIVATED MATERIAL

19. Move the swab falcon tubes from Rack B to Rack C, being held by the overseer outside of the BSC. 20. Move eppendorf tubes from Rack 2 to Rack 3, being held by the overseer outside of the BSC. 21. Overseer places Rack 3 in the antechamber in the clean zone. 22. Overseer calls RNA Extraction Room to announce samples are ready for pick up.

41 V1.8|13.05.2020

CLEANING PROCEDURES: END OF SHIFT OR END OF DAY

If closing for the day OR for the next team, proceed with full decontamination procedure:

23. Wipe all items OUTSIDE the working area with bleach wipes (squirt bottles, box of bleach wipes, solid waste container, liquid waste container, samples container, parafilm box, Rack 2 and Rack B). 24. Wipe all items INSIDE the working area with bleach wipes (Rack A, Tip Box, Pipette, Buffer, Buffer Rack). 25. Carefully close the benchcoat of the working area and throw it in the solid waste bag. 26. Wipe the entire surface of the hood with disinfectant. 27. Wipe the surface of hood with 70% ethanol to remove traces of disinfectant. 28. Discard all wipes in the solid waste bag. 29. Close the solid waste bag with tape inside the hood (do not close too tightly), disinfect surface area and place trash to autoclave. 30. Overseer closes the sash, turns off light and air flow, and turns ON the UVs. 31. After each exit of the Virus Inactivation Room, all PPE should be discarded or properly disinfected. 32. The swab falcon tubes on Rack C are placed in a designated box stored at -80ºC, labelled “Original Swab Box #X”.

E3. 4 B RNA EXTRACTION ROOM - BSL2

42 V1.8|13.05.2020

Room: BSL2 - RNA Extraction Room (I3α05), ICVS 3rd floor RNA Extraction Station Team:

E3. 4 B1 RNA EXTRACTION TEAM'S RESPONSIBILITIES

OVERSEER

Overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

a. Add information of the working team to the file “Sample ID form” previously filled-in by the team present in the BSL3 - Virus Inactivation Room; b. Print the labels according to the information received from the BSL3 - Virus Inactivation Room and bring them to the BSL2 - RNA Extraction room. c. Pick up the Rack 3 with samples from the antechamber of the BSL3 - Virus Inactivation Room, once a phone call is received from the BSL3 - Virus Inactivation Room announcing that the samples are ready. d. Deliver Rack 3 to the operator of BSC, e. Deliver the samples to the first floor to the RT-qPCR Team.

43 V1.8|13.05.2020

OPERATORS

Operators will proceed with the virus inactivation protocol in the BSC. Operators are also responsible to set up the BSC with all essential reagents, materials and equipment provided in a checklist:

a. Waste bottle with 10% bleach, b. Chloroform, c. Isopropyl alcohol (ice cold), d. 75% EtOH (ice cold), e. RNase-free water, f. 1.5mL microcentrifuge tubes (in multiples of 16), g. 200 µL Micropipette, h. 1000 µL Micropipette, i. 200 µL Tips for micropipettes, j. 1000 µL Tips for micropipettes, k. Ensure a rack is at -20°C freezer, l. Ensure microcentrifuge is at 4°C.

E3. 4 B2 DETAILED PROCEDURES FOR RNA EXTRACTION - TRIZOL

MATERIAL PREPARATION

1. In the BSCs, label the eppendorfs with the internal ICVS ID (ICVS-XXXX). 2. Prepare a rack with 5 rows of collection tubes (number of collection tubes per row equal to the number of samples to be extracted) 3. Label 2 sets of 1.5mL RNAse-free eppendorf tubes for RNA elution with the internal ICVS ID (ICVS XXXX) written on the lid. 4. Ready to receive the samples in Rack 3 by the overseer.

RNA EXTRACTION PROTOCOL

5. Centrifuge tubes for 3-5 seconds at full speed to collect contents at the tubes' bottom.

44 V1.8|13.05.2020

6. In the BSC, add 200 µL of chloroform to the samples present in the Rack 3 brought by the overseer from the antechamber of Virus Inactivation Room (BSL3). 7. Cap tubes securely and shake vigorously by hand for 15 seconds. 8. Incubate samples for 2-3 minutes at room temperature. 9. Centrifuge samples at 12.000 g for 15 minutes at 4 °C. Note: The sample will separate into a lower green phenol-chloroform phase, an interphase, and a colorless upper aqueous phase that contains the RNA. 10. During the 15 minutes centrifugation, prepare new 1.5 mL centrifuge tubes on a new rack to collect final RNA sample. Label the eppendorf tubes with printed labels prepared by the overseer. 11. Take the tubes from the centrifuge and transfer 550 µL of the aqueous phase VERY carefully, without disturbing the interphase or organic layer, to the tube labeled with the printed labels. 12. Add 500 µL of ice-cold isopropyl alcohol to the aqueous phase and mix by gently inverting the tube (this step will precipitate the RNA). 13. Incubate samples for 10 minutes in -20°C freezer inside the rack present there. 14. Centrifuge at 12.000 g for 10 minutes at 4°C. Discard the supernatant with a micropipette. Note: Total RNA precipitate forms a white gel-like pellet at the bottom of the tube. 15. Resuspend the pellet in 1 mL of ice cold 75% EtOH. 16. Mix samples briefly, and then centrifuge at 12.000 g for 5 minutes at 4 °C. Carefully, discard the supernatant with a micropipette. 17. Air dry the pellet for 5-10 minutes. 18. Gently resuspend the pellet in 40 µL of RNase-free water by pipetting up and down. (Incubate for 10 minutes at 55-60°C, if necessary). 19. Place the RNA tubes on a styrofoam box with ice. 20. Overseer will transport the RNA samples on the styrofoam box to the first floor to proceed to RT-qPCR.

45 V1.8|13.05.2020

E4. RT-qPCR RUN (This section of the document is still being updated)

Concerning the actual situation of pandemic, the reagents’ supply is often delayed or out-of-stock. To overcome the issue of possible stock rupture, we developed and validated alternative protocols to continuously provide the diagnostic of SARS-CoV-2 at ICVS. Protocols to be used for RT-qPCR are, in order of preference, E4. 1 Commercial kit: FOSUN 2019-nCoV qPCR, E4. 2 ICVS detection protocol with SensiFAST One-Step Probe kit (BioLine) and E4. 3 ICVS detection protocol with One-

Step NZYSpeedy RT-qPCR Probe kit (NZYTech).

E4. 1 RT-qPCR RUN USING FOSUN 2019-nCoV qPCR kit plus a human control gene, RNP, using SensiFAST One-Step Probe kit (BioLine)

E4. 1 A RT-qPCR STATION

46 V1.8|13.05.2020

RT-qPCR Room: Services Laboratory (I1.01, I1.β02 and I1.α06), ICVS 1st floor RT-qPCR Stations: Team: Pre-PCR room: assay and mix preparation One operator Assembling station: Plate loading and sealing. One overseer PCR Station: experiment design and RT-qPCR run. One supervisor

PPE: a. lab coat Minimum capacity 1 Hood working: 2 people b. gloves Maximum capacity with 4 RT-PCR running: 2 people c. surgical mask

E4. 1 A1 RT-qPCR TEAM'S RESPONSABILITIES

SUPERVISORS

Supervisors are responsible to turn ON the RT-qPCR equipment and to set up the different stations for RT-qPCR Run protocol (Pre-PCR Station, Assembling Workstation and PCR Station) with all essential reagents and materials the operators will need for the day.

a. At the beginning and the end of the day, turn on UV lights on the Pre-PCR and Assembling Stations. b. Turn ON the RT-qPCR Equipment: 2x ABI 7500 Fast Real-Time PCR System, 2x Bio-Rad CFX96, c. FOSUN RT-qPCR kit, d. qPCR RNP primers/probe set, e. Nuclease-free PCR grade 1.5 mL tubes, f. SensiFAST Probe One-Step mix, Low Rox, g. Molecular grade water, nuclease-free, h. One full set of micropipettes (P10 to P1000) (pre-PCR room), i. One vortex and mini-centrifuges per station (Pre-PCR Station and Assembling Workstation), j. A P200, P20, P10 pipette and an 8-channel P10 pipette (Assembling WorkStation), k. P2/P10, P20, P100, P300 and P1000 aerosol barrier tips to be distributed in each hood and never interchanged, l. 96-well RT-qPCR reaction plates and optical seals compatible with each equipment, m. Surface decontaminants: RNase away, 10% Bleach and 70% EtOH. 47 V1.8|13.05.2020

Supervisor must also use the templates present on each equipment and fill sample information on its respective well. Additionally, supervisor will receive RNA samples delivered by the RNA Extraction team, send result file to the analysis team and update the file “sample labeling” with the following information for each sample.

a. RNA check-in time; b. Operator; c. Overseer; d. Mastermix(es) used; e. Equipment; f. PCR check-out time; g. Notes (if needed).

OVERSEER

Overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

1. Assist during plate loading: a. Switching waste containers between mix and RNA; b. Mix the RNA, using the vortex, and performing a spin down on the PCR tubes; c. Confirming sample distribution. 2. Perform spin down the plate and transport it to the PCR station.

OPERATORS

Operators will proceed with the RT-qPCR protocol:

a. Prepare mix; b. Assemble plate according to template; c. Seal plate.

48 V1.8|13.05.2020

E4. 1 A2 DETAILED PROCEDURES FOR RT-qPCR PROTOCOL – FOSUN 2019-nCoV qPCR kit

IMPORTANT INFORMATION

The kit includes a reagent named Internal Reference A that will not be used. Instead, RNA extraction validation will be performed using another mastermix described below (SensiFAST) to detect the presence of a human gene (RNP) with primers and probes according with CDC protocol (https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html).

Reagents MUST NEVER go to the sample preparation area (Virus Inactivation Room) or the plate loading area (Assembling Workstation).

MATERIAL PREPARATION

1. STORAGE - PCR ROOM a. Store all reagents at –20ºC in the freezer of the Pre-PCR room.

2. PREPARATION OF REACTION MIXES FOR RT-qPCR - PRE - PCR ROOM a. Clean and decontaminate all work surfaces, pipettes, centrifuges and other equipment prior to use, using RNase away, followed by 70% EtOH. b. In the Preparation Hood, thaw 2019 n-CoV Reaction Reagent and RT-PCR Enzyme, on ice. c. Label one 1.5 mL eppendorf for FOSUN mixture and protect it from the light with aluminum foil.

3. AMPLIFICATION REACTION MIXES PREPARATION - PRE - PCR ROOM

Plate is to be run with 40 samples, among which an Internal Extraction Control (IEC) is included (blindly to the operator and overseer) plus a No-Template Control (NTC), a Negative Control (C-, for the FOSUN mixture) and Positive Control (C+ or PC for FOSUN or RNP, respectively) to be analyzed per plate. However, plate set-up configuration can vary with the number of specimens and work day. 49 V1.8|13.05.2020

NOTE: IEC is a RNase/DNase free water, used during RNA extraction process. This sample cannot not exhibit a Ct value in any gene being analyzed.

A) REACTION MIX FOR ORF1ab, N and E Genes AMPLIFICATION (FOSUN)

Mix component Volume/Sample (µL) 43 Reactions+10% (µL) 2019 n-CoV Reaction Reagent 14 662.2 RT-PCR Enzyme 6 283.8

B) REACTION MIX FOR RNP Gene (control gene) AMPLIFICATION (SensiFAST)

Mix component Volume/Sample (µL) 42 Reactions+10% (µL)

Nuclease free H2O 2.6 120.12 SensiFAST Probe Low-ROX One-Step Mix (2x) 10 462 10 µM RNP primer Forward 0.8 36.96 10 µM RNP primer Reverse 0.8 36.96 10 µM Probe RNP 0.2 9.24 RiboSafe RNase Inhibitor 0.4 18.48 Reverse transcriptase 0.2 9.24

a. Pipette reaction mix reagents into the respective labelled 1.5 mL eppendorf tube, according the order described on each table. Close the tube. DO NOT VORTEX. b. Transport all the reaction mixes to the ASSEMBLING WORKSTATION.

RT-qPCR PROTOCOL

50 V1.8|13.05.2020

e. Turn off flow hood ventilation and introduce RNA waste container and samples inside the workstation. f. Using a multichannel micropipette, transfer 10 µL of RNA to the designated FOSUN wells and 5 µL of those same templates into the designated RNP wells. Overseer will assist the operator, directing samples’ loading order according to the template file present on the computer near the Assembling Workstation. g. Add 10 µL and 5 µL of nuclease free water into the FOSUN and RNP NTC wells, respectively. h. Add 10 µL of C- provided with the FOSUN kit and stored in the freezer near the Assembling Workstation to its respective well (only for the FOSUN section). i. Add 10 µL of the C+ provided with the FOSUN kit and stored in the freezer near the Assembling Workstation to its respective well (only for the FOSUN section). j. Add 5 µL of the PC (provided by the RNA Extraction team) to its respective well (only for the RNP section). Note: PC will always be a positive patient sample (previously diagnosed using the protocols described here but whose RNA was again extracted on the day being used). k. Seal the plate, using the appropriate optical seal and the plate sealer. Protect from the light using aluminum foil. l. Using the centrifuge near the Assembling Workstation, centrifuge the plate for about 10 seconds. m. Clean the Assembling WorkStation with RNase away and 70% Ethanol and turn on UV light. Attention: This procedure must be performed after each time RNA enters the BSC.

ADDITIONAL INFORMATION

Figure 1. Plate set up example

51 V1.8|13.05.2020

2. RT-qPCR EQUIPMENT SET UP AND RUN – PCR ROOM a. Transfer plate into PCR room, on ice. b. Name the run using the code: SARS-CoV-2_(first sample)-(last sample)_dd-mm- yyyy_FOSUN-RNP c. . Note: Use ONLY the symbols “_” or “-”. d. Check if plate run and cycling parameters on the RT-qPCR equipment are as follows: I. Detector i. ORF1ab - FAM; ii. N Gene – JOE (on ABI 7500 Fast) and VIC (on BIO-Rad); iii. E Gene – ROX; iv. RNP - FAM; II. Quencher (None); III. Passive Reference: (None); IV. Run Mode: (Standard); V. Sample volume: 30 µL; VI. Cycling parameters

50ºC – 15’

95°C – 3’

95°C – 5’’

60°C – 40’’

Repeat last two steps 4 times

95°C – 5’’

60°C – 40’’

Repeat last two steps 39 times Note: fluorescence acquisition selected to occur during the annealing/extension step (only on these last 40 cycles)

VII. Sample attribution on the plate; e. Insert plate into the designated RT-qPCR Equipment;

52 V1.8|13.05.2020

f. Save file to the server and start the run. It takes about one and a half hour to be completed. g. When qPCR run is finished, send raw data to the analysis team and discard plate into the appropriate waste bin.

E4. 2 RT-qPCR RUN with ICVS protocol USING SensiFAST Probe One-Step kit, Low ROX (BioLine)

E4. 2 A RT-qPCR STATION

PPE: a. lab coat Minimum capacity 1 Hood working: 2 people Maximum capacity with 4 RT-PCR running: 2 b. gloves people c. surgical mask

53 V1.8|13.05.2020

E4. 2 A1 RT-qPCR TEAM'S RESPONSABILITIES

SUPERVISORS

a. At the beginning and the end of the day, turn on UV lights on the Pre-PCR and Assembling Stations. b. Turn ON the RT-qPCR Equipment: 2x ABI 7500 Fast Real-Time PCR System, 2x Bio-Rad CFX96, c. qPCR primers/probe sets, d. Nuclease-free PCR grade 1.5 mL tubes, e. SensiFAST Probe One-Step Low Rox kit, f. Molecular grade water, nuclease-free, g. One full set of micropipettes (P10 to P1000) (pre-PCR room), h. One full set of micropipettes (P10 to P1000) (pre-PCR room), i. One vortex and mini-centrifuges per station (Pre-PCR Station and Assembling Workstation), j. A P200, P20, P10 pipette and an 8-channel P10 pipette (Assembling WorkStation), k. P2/P10, P20, P100, P300 and P1000 aerosol barrier tips to be distributed in each hood and never interchanged, l. 96-well RT-qPCR reaction plates and optical seals compatible with each equipment, m. Surface decontaminants: RNase away, 10% Bleach and 70% EtOH.

a. RNA check-in time; b. Operator; c. Overseer; d. Mastermix used; e. Equipment; 54 V1.8|13.05.2020

f. PCR check-out time; g. Notes (if needed).

OVERSEER

Overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

OPERATORS

Operators will proceed with the RT-qPCR protocol:

a. Prepare mix; b. Assemble plate according to template; c. Seal plate.

E4. 2 A2 DETAILED PROCEDURES FOR RT-qPCR ICVS PROTOCOL – using SensiFAST Probe One-Step kit, Low ROX (BioLine)

IMPORTANT INFORMATION - PRIMERS AND PROBES

Primers and probes specific for SARS-CoV-2 refer to those published by Victor M. Corman from Charité Virology and approved by World Health Organization (WHO), with an extra set of primers and probe for a human control gene - Ribonucleoprotein (RNP):

1. https://eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045 2. https://www.who.int/docs/default-source/coronaviruse/protocol-v2- 1.pdf?sfvrsn=a9ef618c_2

55 V1.8|13.05.2020

The set includes:

a. 2 primers +1 probe set for RdRP gene region [one probe specific for SARS-CoV-2 (s-SARS- CoV-2)]. b. 2 primers + 1 probe set for E gene. c. 2 primers + 1 probe set for RNP gene.

Primers and Probes MUST NEVER go to the sample preparation area (Virus Inactivation Room) or the plate loading area (Assembling Workstation).

MATERIAL PREPARATION

1. PREPARATION OF PRIMER AND PROBES STOCK AND WORKING SOLUTIONS - PRE - PCR ROOM a. Clean and decontaminate all work surfaces, pipettes, centrifuges and other equipment prior to use, using RNase away followed by 70% EtOH. b. In the Mix Preparation Hood, resuspend the primers and probes with RNase-free water to a final concentration of 100 µM. Prepare aliquots of 100 µL at 10 µM final concentration for each primer and 30 µL at 10 µM final concentration for each probe. Store at –20ºC in the freezer of the Pre-PCR room.

2. PREPARATION OF REACTION MIXES FOR RT-qPCR - PRE - PCR ROOM a. Clean and decontaminate all work surfaces, pipettes, centrifuges and other equipment prior to use, using RNase away, followed by 70% EtOH. b. In the Preparation Hood, thaw SensiFAST Probe Low-ROX One-Step mix, primers and probes aliquots, on ice. c. Label one 1.5 mL eppendorf for each primers/probe set mix and protect it from the light with aluminum foil.

56 V1.8|13.05.2020

3. AMPLIFICATION REACTION MIXES PREPARATION - PRE - PCR ROOM

Plate is to be run with 30 samples, among which an Internal Extraction Control (IEC) is included (blindly to the operator and overseer), plus a No-Template Control (NTC) and Positive Control (PC) to be analyzed per plate. However, plate set-up configuration can vary with the number of specimens and work day.

NOTE: IEC is a RNase/DNase free water, used during RNA extraction process. This sample cannot not exhibit a Ct value in any gene being analyzed.

A) REACTION MIX FOR E Gene AMPLIFICATION

32 Reactions+10% Mix component Volume/Sample (µL) (µL)

Nuclease free H2O 2.6 91.52 SensiFAST Probe Low-ROX One-Step Mix (2x) 10 352 10 µM E gene primer Forward 0.8 28.2 10 µM E gene primer Reverse 0.8 28.2 10 µM Probe E Gene SARS-CoV-2 0.2 7.04 RiboSafe RNase Inhibitor 0.4 14.08 Reverse transcriptase 0.2 7.04

B) REACTION MIX FOR RdRP Gene AMPLIFICATION

32 Reactions+10% Mix component Volume/Sample (µL) (µL)

Nuclease free H2O 2.6 91.52 SensiFAST Probe Low-ROX One-Step Mix (2x) 10 352 10 µM RdRP primer Forward 0.8 28.2 10 µM RdRP primer Reverse 0.8 28.2 10 µM Probe RdRP SARS-CoV-2 0.2 7.04 RiboSafe RNase Inhibitor 0.4 14.08 Reverse Transcriptase 0.2 7.04

57 V1.8|13.05.2020

C) REACTION MIX FOR RNP Gene (control gene) AMPLIFICATION

32 Reactions+10% Mix component Volume/Sample (µL) (µL)

Nuclease free H2O 2.6 91.52 SensiFAST Probe Low-ROX One-Step Mix (2x) 10 352 10 µM RNP primer Forward 0.8 28.2 10 µM RNP primer Reverse 0.8 28.2 10 µM Probe RNP 0.2 7.04 RiboSafe RNase Inhibitor 0.4 14.08 Reverse transcriptase 0.2 7.04

RT-qPCR PROTOCOL

1. SET UP THE REACTION PLATE – ASSEMBLING WORKSTATION a. On the BSC, set up a reaction plate in a 96-well rack, on ice. Attention: Use 96- well plates compatible with equipment (Applied Biosystems and Bio-Rad). b. Turn off the BSC light (to protect probes’ fluorescence). Mix by pipetting up and down 10 times with a p200 micropipette. Attention: Do not create bubbles. c. Centrifuge for 5 seconds at maximum speed to collect contents at the tubes' bottom. Place the eppendorf tube on ice. d. Pipette 15 µL of each mix into the appropriate wells. e. Turn off flow hood ventilation and introduce RNA waste container and samples inside the workstation. f. Using a multichannel micropipette, transfer 5 µL of RNA int the appropriate wells. Overseer will assist the operator, directing samples’ loading order according to the template file present on the computer near the Assembling Workstation. g. Add 5 µL of nuclease free water into the NTC well.

58 V1.8|13.05.2020

h. Add 5 µL of the PC to the respective well. Note: positive control will always be a positive patient sample (previously diagnosed using the protocols described here whose RNA was again extracted on the day being used). i. Seal the plate, using the appropriate optical seal and the plate sealer. Protect from the light using aluminum foil. j. Using the centrifuge near the Assembling Workstation, centrifuge the plate for about 10 seconds. k. Clean the Assembling WorkStation with RNase away and 70% Ethanol and turn on UV light. Attention: This procedure must be performed after each time RNA enters the BSC.

ADDITIONAL INFORMATION

Figure 1. Plate set up example

2. RT-qPCR EQUIPMENT SET UP AND RUN – PCR ROOM a. Transfer plate into PCR room, on ice. b. Name the run using the code: SARS-CoV-2_(first sample)-(last sample)_dd-mm- yyyy_SensiFAST. Note: Use ONLY the symbols “_” or “-”. c. Set up plate run and cycling parameters on the RT-qPCR equipment as follows: I. Detector (FAM); II. Quencher (None); III. Passive Reference: (ROX);

59 V1.8|13.05.2020

IV. Run Mode: (Fast); V. Sample volume: 20 µL; VI. Cycling parameters

45ºC – 10’

95°C – 2’

95°C – 5’’

58°C – 30’’

Repeat last two steps 44 times

Note: fluorescence acquisition selected to occur during the annealing/extension step

VII. Sample attribution on the plate; d. Insert plate into the designated RT-qPCR Equipment; e. Save file to the server and start the run. It takes about one hour to be completed. f. When qPCR run is finished, send raw data to the analysis team and discard plate into the appropriate waste bin.

E4. 3 RT-qPCR RUN with ICVS PROTOCOL USING One-Step NZYSpeedy RT-qPCR Probe kit, no ROX (NZYTech)

E4. 3 A RT-qPCR STATION

60 V1.8|13.05.2020

PPE: a. lab coat Minimum capacity 1 Hood working: 2 people b. gloves Maximum capacity with 4 RT-PCR running: 2 people c. surgical mask

E4. 3 A1 RT-qPCR TEAM'S RESPONSABILITIES

SUPERVISORS

a. At the beginning and the end of the day, turn on UV lights on the Pre-PCR and Assembling Stations. b. Turn ON the RT-qPCR Equipment: 2x ABI 7500 Fast Real-Time PCR System, 2x Bio-Rad CFX96, c. qPCR primers/probe sets, d. Nuclease-free PCR grade 1.5 mL tubes, e. One-step NZYSpeedy qPCR Probe master mix kit, f. Molecular grade water, nuclease-free, g. One full set of micropipettes (P10 to P1000) (pre-PCR room), h. One vortex and mini-centrifuges per station (Pre-PCR Station and Assembling Workstation), i. A P200, P20, P10 pipette and an 8-channel P10 pipette (Assembling WorkStation), j. P2/P10, P20, P100, P300 and P1000 aerosol barrier tips to be distributed in each hood and never interchanged, k. 96-well RT-qPCR reaction plates and optical seals compatible with each equipment, l. Surface decontaminants: RNase away, 10% Bleach and 70% EtOH.

61 V1.8|13.05.2020

a. RNA check-in time; b. Operator; c. Overseer; d. Mastermix used; e. Equipment; f. PCR check-out time; g. Notes (if needed).

OVERSEER

Overseer must stand behind the operator during the procedure to ensure the operator follows all the procedures and be ready to help in any emergency. The overseer must also:

OPERATORS

Operators will proceed with the RT-qPCR protocol:

a. Prepare mix; b. Assemble plate according to template; c. Seal plate.

62 V1.8|13.05.2020

E4. 2 B1 DETAILED PROCEDURES FOR RT-qPCR ICVS PROTOCOL - One-Step NZYSpeedy RT-qPCR Probe kit, No ROX (NZYTech)

IMPORTANT INFORMATION - PRIMERS AND PROBES

Primers and probes specific for SARS-CoV-2 (E gene and RdRP) refer to those published by Victor M. Corman from Charité Virology and approved by World Health Organization (WHO), with an extra set of primers and probe for a human control gene - Ribonucleoprotein (RNP) and from CDC protocol.

1. https://eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045 2. https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html

The set includes:

a. 2 primers +1 probe set for RdRP gene region [one probe specific for SARS-CoV-2 (s-SARS- CoV-2)]. b. 2 primers + 1 probe set for E gene. c. 2 primers + 1 probe set for RNP gene.

Primers and Probes MUST NEVER go to the sample preparation area (Virus Inactivation Room) or the plate loading area (Assembling Workstation).

MATERIAL PREPARATION

63 V1.8|13.05.2020

2. PREPARATION OF REACTION MIXES FOR RT-qPCR - PRE - PCR ROOM a. Clean and decontaminate all work surfaces, pipettes, centrifuges and other equipment prior to use, using RNase away, followed by 70% EtOH. b. In the Preparation Hood, thaw NZYSpeedy qPCR Probe master mix, primers and probes aliquots, on ice. c. Label one 1.5 mL eppendorf for each primers/probe set mix and protect it from the light with aluminum foil.

3. AMPLIFICATION REACTION MIXES PREPARATION- PRE - PCR ROOM

NOTE: IEC is a RNase/DNase free water, used during RNA extraction process. This sample cannot not exhibit a Ct value in any gene being analyzed.

A) REACTION MIX FOR E Gene AMPLIFICATION

Mix component Volume/Sample (µL) 32 Reactions+10% (µL)

Nuclease free H2O 2.4 84.48 One-step NZYSpeedy qPCR Probe master mix (2x) 10 352 10 µM E gene primer Forward 0.8 28.2 10 µM E gene primer Reverse 0.8 28.2 10 µM Probe E Gene SARS-CoV-2 0.2 7.04 NZYRT mix 0.8 28.2

B) REACTION MIX FOR RdRP Gene AMPLIFICATION

Mix component Volume/Sample (µL) 32 Reactions+10% (µL)

Nuclease free H2O 2.4 84.48 One-step NZYSpeedy qPCR Probe master mix (2x) 10 352 10 µM RdRP primer Forward 0.8 28.2 10 µM RdRP primer Reverse 0.8 28.2 10 µM Probe RdRP SARS-CoV-2 0.2 7.04 NZYRT mix 0.8 28.2 64 V1.8|13.05.2020

C) REACTION MIX FOR RNP Gene (control gene) AMPLIFICATION

Mix component Volume/Sample (µL) 32 Reactions+10% (µL)

Nuclease free H2O 2.4 84.48 One-step NZYSpeedy qPCR Probe master mix (2x) 10 352 10 µM RNP primer Forward 0.8 28.2 10 µM RNP primer Reverse 0.8 28.2 10 µM Probe RNP 0.2 7.04 NZYRT mix 0.8 28.2

RT-qPCR PROTOCOL

1. SET UP THE REACTION PLATE – ASSEMBLING WORKSTATION a. On the BSC, set up a reaction plate in a 96-well rack, on ice. Attention: Use 96- well plates compatible with equipment (Applied Biosystems and Bio-Rad). b. Turn off the BSC light (to protect probes’ fluorescence). Mix by pipetting up and down 10 times with a p200 micropipette. Attention: Do not create bubbles. c. Centrifuge for 5 seconds at maximum speed to collect contents at the tubes’ bottom. Place the eppendorf tube on ice. d. Pipette 15 µL of each mix into the appropriate wells. e. Turn off flow hood ventilation and introduce RNA waste container and samples inside the workstation. f. Using a multichannel micropipette, transfer 5 µL of RNA int the appropriate wells. Overseer will assist the operator, directing samples’ loading order according to the template file present on the computer near the Assembling Workstation. g. Add 5 µL of nuclease free water into the NTC wells. h. Add 5 µL of the PC to the respective well. Note: positive control will always be a positive patient sample (previously diagnosed using the protocols described here whose RNA was again extracted on the day being used).

65 V1.8|13.05.2020

i. Using the centrifuge near the Assembling Workstation, centrifuge the plate for about 10 seconds. j. Clean the Assembling WorkStation with RNase away and 70% Ethanol and turn on UV light. Attention: This procedure must be performed after each time RNA enters the BSC.

ADDITIONAL INFORMATION

Figure 1. Plate set up example

2. RT-qPCR EQUIPMENT SET UP AND RUN – PCR ROOM

a. Transfer plate into PCR room, on ice. b. Name the run using the code: SARS-CoV-2_(first sample)-(last sample)_dd-mm- yyyy_NZYTech. Note: Use ONLY the symbols “_” or “-”. c. Set up plate run and cycling parameters on the RT-qPCR equipment as follows: i. Detector (FAM); ii. Quencher (None); iii. Passive Reference: (None); iv. Run Mode: (Fast); v. Sample volume: 20 µL; vi. Cycling parameters 50ºC – 15’

95°C – 5’

66 V1.8|13.05.2020

95°C – 5’’

58°C – 30’’

Repeat last two steps 44 times

Note: fluorescence acquisition selected to occur during the annealing/extension step

vii. Sample attribution on the plate; a. Insert plate into the designated RT-qPCR System, b. Save file to the server and start the run. It takes about one hour and 15 minutes to be completed. c. When qPCR run is finished, send raw data to the analysis team and discard plate into the appropriate waste bin.

E5. RESULTS ANALYSIS

Results analysis is performed by two operators independently, using the criteria for results validation and analysis described below. Final conclusions are compared and if not concordant are discussed individually. Then, the Analysis Coordinator will update Sample ID form with the results for each diagnostic, including ICVS ID and the original IDs for each sample. The Sample ID form with the diagnostics is shared on a common platform, for double-check ID and preparation of final reports for communication.

E5. 1 RESULTS ANALYSIS FOR THE RT-QPCR DESCRIBED IN E4.1 USING THE COMMERCIAL DETECTION KIT FOSUN 2019-NCOV QPCR

1. PCR PLATE VALIDATION

To consider a PCR plate valid for COVID19 diagnosis,

a. Negative control from the detection kit (FOSUN 2019-nCoV qPCR) have to present, no amplification signal in any channel (FAM, JOE, ROX),

67 V1.8|13.05.2020

b. Positive control from the detection kit (FOSUN 2019-nCoV qPCR) have to present amplification signal, with Ct <30 and an amplification curve with typical S shape.

2. PROCESS VALIDATION – INTERNAL EXTRACTION CONTROL

As an additional control, for every 50 samples processed in the inactivation room, a water sample is added to the set, as an internal extraction control (IEC). This sample is labeled with an ICVS ID and processed blindly as a diagnostic sample, following the RNA extraction and RT-qPCR protocols. The inactivation team informs ONLY the analysis team of the ICVS ID of those IECs samples. If IEC presents any of the genes, RNP, ORF1ab, N gene or E gene with an amplification signal, with Ct <34, and an amplification curve with typical S shape, the 50 samples preceding this IEC are re- tested.

3. SAMPLE TEST VALIDATION

For each test to be valid, the human control gene (RNP) with FAM channel must present an amplification signal with Ct <28, and an amplification curve with typical S shape. If not, a problem with the sample or operation is considered and the sample is re-tested.

4. RESULTS INTERPRETATION

After all the previous described validations are fulfilled, diagnostic samples are then analyzed for the SARS-COV-2 detection, using the following criteria:

• Positive Diagnostic

- ORF1ab with FAM channel, N gene with JOE channel and E gene with ROX channel presents an amplification signal, Ct <36, and an amplification curve with typical S shape.

- any two of the three genes mentioned above presents an amplification signal, Ct <36, and an amplification curve with typical S shape.

68 V1.8|13.05.2020

• Negative Diagnostic - ORF1ab with FAM channel, N gene with JOE channel and E gene with ROX channel present no amplification signal, Ct >37, or amplification curve with no typical S shape.

• Inconclusive Diagnostic - only one of the genes, N gene with JOE channel or E gene with ROX channel, present amplification signal, Ct <36 and with amplification curve with typical S shape. In this case, it is advised for a new swab sample collection.

NOTE: A re-test for RT-qPCR is performed if only ORF1ab gene with FAM channel present valid signal. After re-testing, if valid signal remain, sample is considered positive. If no signal is detected in any of the channels, sample is considered negative. If valid signal is detected in the N gene with JOE channel or E gene with ROX channel, sample remains inconclusive and it is advised for a new swab sample collection.

GRAPHICAL REPRESENTATION OF THE WORKFLOW RESULTS’ ANALYSIS

69 V1.8|13.05.2020

E5.2 ANALYSIS INTERPRETATION FOR THE RT-QPCR ICVS PROTOCOL – USING SENSIFAST PROBE ONE-STEP KIT, LOW ROX (BIOLINE)

1. PCR PLATE VALIDATION

To consider a PCR plate valid for COVID19 diagnosis,

a. Negative controls (NTC and C-) have to present no amplification signal in the FAM channel b. Positive control (a positive sample previously validated) with amplification signal, Ct <30 for E gene, RdRP and the control RNP gene.

2. PROCESS VALIDATION – INTERNAL EXTRACTION CONTROL

As an additional control, for every 50 samples processed in the inactivation room, a water sample is added to the set, as an internal extraction control (IEC). This sample is labeled with an ICVS ID and processed blindly as a diagnostic sample, following the RNA extraction and RT-qPCR protocols. The inactivation team informs ONLY the analysis team of the ICVS ID of those IECs samples. If IEC presents any of the genes, E gene, RdRP gene or RNP gene with an amplification signal, Ct <34, and an amplification curve with typical S shape, the 50 samples preceding this IEC are re-tested.

3. SAMPLE TEST VALIDATION

For each test to be valid, the human control gene (RNP) with FAM channel must present an amplification signal, Ct <28, and an amplification curve with typical S shape. If not, a problem with the sample or operation is considered and the sample is re-tested.

4. RESULTS INTERPRETATION

After all the previous described validations are fulfilled, diagnostic samples are then analyzed for the SARS-COV-2 detection, using the following criteria:

70 V1.8|13.05.2020

• Positive Diagnostic - E gene with FAM channel and RdRP gene with FAM channel (run in separate wells) presents amplification signal, Ct <36, and an amplification curve with typical S shape.

• Negative Diagnostic - E gene with FAM channel and RdRP gene with FAM channel (run in separate wells) present no amplification signal, Ct >37, or an amplification curve with no typical S shape.

• Inconclusive Diagnostic - only one of the genes, E gene or RdRP, with FAM channel present valid signal, present amplification signal, Ct <36 and with amplification curve with typical S shape. In this case, a third gene (N gene) is tested (probe N2 with FAM channel as described on CDC protocol (https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html). After re-testing, if valid signal is presented, sample is considered positive. If no signal is detected, sample is considered inconclusive. In this case, it is advised a new swab sample collection.

E6. RESULTS COMMUNICATION

After receiving the results analysis from the Analysis Team, the samples IDs are double checked, using the sample IDs provided by the Health Care/Care Taker Entities and final reports are prepared containing a table with the ICVS ID, Health Care/Care Taker entity name, Health Care/Care Taker entity ID, National Health System ID and conclusion of the test for each sample, using the template report (appendix 5). Diagnostic reports are then sent, via e-mail, to the designated responsible person(s) from each Health Care/Care Taker entities that provided the samples on both excel (xlsx) and portable document (.pdf) files.

71 V1.8|13.05.2020

SECTION F - RISK ASSESSMENT AND CONTINGENCY

MEASURES

The risk assessment described below is based on the orientations of the document "Laboratory Biosafety Guidance related to coronavirus disease 2019 (COVID-19), Interim Guidance, 19th March 2020" from the WHO and the UK Guidance "COVID-19: Safe Handling and Processing for samples in laboratories", 28 march 2020".

Before starting the procedures, everyone must be trained on the procedure that will participate and then sign the responsibility term.

While in the Building of the ICVS/School of Medicine of the University of Minho and through all the procedures, you must follow the COVID-19’s prevention rules: social distance (especially if someone is sick - more than 1 meter); wash hands frequently or disinfect them; do not touch eyes, mouth and nose with unclean hands.

OTHER IMPORTANT CONSIDERATIONS

1. DISINFECTANTS TO BE USED (following WHO guidelines) • 70% ethanol; 0.5% hydrogen peroxide; quaternary ammonium compounds; and phenolic compounds, if used according to the manufacturer’s recommendations. • Other biocidal agents such as 0.05–0.2% benzalkonium chloride or 0.02% chlorhexidine digluconate can be less effective.

Particular attention should be paid not only to the selection of the disinfectant but also to the contact time (e.g., 10 minutes), dilution, and expiry date after the working solution is prepared.

2. RISK OF PPE DEPLETION

In the eventual scenario of a risk of PPE depletion, there is a need to conserve supplies, namely masks/respirators. Measures described in the document from the CDC “Recommended Guidance for Extended Use and Limited Reuse of N95 Filtering Facepiece Respirators in Healthcare Settings”, from 28 March 2018, will be implemented.

72 V1.8|13.05.2020

F1. RISK DESCRIPTION AND RESPECTIVE CONTINGENCY MEASURES

RISK DESCRIPTION CONTINGENCY MEASURES

Biological Hazard - Maintain, whenever possible, a safe social distance.

Picking up samples in a health care entity

- The sample must be transported in a triple container, following the WHO-category B (UN 3373) recommendations.

- The sample tube and transport box must be decontaminated by the personnel from the provider, before delivering it.

- Do not accept a sample box in bad shape, dirty or with leakage signs.

If the person needs to enter the sample provider facilities:

- Use adequate PPE: lab coat, gloves and a surgical mask (optional).

- Before entering the ICVS, remove the mask and one glove to open doors and push elevator buttons.

- Do not touch the mask or eyes with gloves or unclean hands.

- Wash your hands after delivery of the samples.

Biological Hazard - Work must be performed under BSL3 conditions.

Virus Inactivation Room COVID-19 - Medium risk

- Use a validated BSC.

- Follow good practices when working in the BSC (ex: slow movements; only the essential material inside, without covering the BSC grids).

- Use absorbent material to cover the surface of the BSC, where contaminated material is going to be used.

- Use of PPE: coveralls, double gloves, safety goggles, disposable safety mask (FFP2/ FFP3), cap, sleeve covers, clogs and shoe covers.

- Follow the donning and removal procedures, in the following order:

Correct donning of PPE upon entry:

73 V1.8|13.05.2020

- Register the name, date, and time in the logbook located in the locker room;

- Put on and zip up the coveralls;

- Put on your personal clogs at the entry of the common corridor;

- Put on the headcover, making sure that all hair is tucked in and the forehead is covered;

- Put on a facemask;

- Put on two pairs of gloves;

- Secure with tape the coveralls and the first pair of gloves;

- Put on two pairs of shoe covers;

- Put on sleeve covers and safety glasses;

- Once you have double-checked that all PPE is correctly worn (use mirror located within the locker room), enter the BSL‑3, Virus Inactivation Room.

Correct removal of PPE upon exit:

Before you exit the first experimental room:

- Remove the outer pair of shoe covers;

- Remove the cover sleeves;

- Remove the outer pair of gloves;

- Remove the safety glasses, disinfect and store in an appropriate container;

- Dispose of coveralls in the dedicated container to be autoclaved;

- Remove the face mask, hair cover and gloves while holding your breath. Dispose of in the appropriate bin;

- Open the door and step into the common corridor;

- Make sure you close the door behind you;

- Wash and disinfect your hands.

- All contaminated or possibly contaminated material must be disposed of at the end of the procedure.

- Clean and decontaminate work area at the end of the procedure.

- The person that is working in the BSC must always be overseen by someone, to help him/her in case of need/emergency.

- Before leaving the BSC, all tubes with inactivated samples must be decontaminated and transferred to a clean rack.

74 V1.8|13.05.2020

Chemical Hazard - Work must be performed in BSL2.

RNA Extraction Room - Low Risk

- Use a validated BSC.

- Follow good practices when working with BSC (ex: slow movements; only the essential material inside, without covering the BSC grids).

- Use of PPE: lab coat, wrist-length gloves, surgical mask.

- Disposable PPE material must be disposed of in a white waste bag.

- All material must be disposed at the end of the procedure.

- Clean and decontaminate work area at the end of the procedure.

- Wash your hands at the end of the procedure.

Chemical Hazard - Use a validated BSC.

Prepare Lysis Buffer - Medium risk

- Follow good practices when working with BSC (ex: slow movements; only the essential material inside, without covering the BSC grids).

- Use of PPE: lab coat, gloves, surgicval mask.

- Wash hands at the end of the procedure.

Generation of aerosols and droplets - Aerosol production must be avoided.

- All practices that may produce aerosols must be performed inside the BSC (ex.: vortexing).

- The use of cleaning sprays is forbidden; use only wipes with disinfectant.

- In the Virus Inactivation Room wear FFP2/FFP3 masks.

75 V1.8|13.05.2020

F2. EMERGENCY PROCEDURES (EP)

INCIDENT EMERGENCY PROCEDURE Biological spill/leaking sample - If a spill occurs inside the BSC: - Cover with paper towels and soak with disinfectant.

- Remove the absorbent benchcoat in the BSC and put it in the waste bag inside the BSC. - Close the bag.

- Discard contaminated wrist gloves and put new ones on.

- Decontaminate all the materials and the work surface of the BSC with wipes soaked in disinfectant. - Discard contaminated wrist gloves and put new ones on.

- Place a new absorbent benchcoat on the work area of the BSC and continue to work. - Spill Kit is available near the BSC in Virus Inactivation Room:

- It contains a box of wipes soaked in disinfectant and a bottle of 4% deconnex. - Should never be used except for spills.

- Prepare fresh every 7 days!!

- The person handling the spill must be fully equipped with the PPE mandatory for the room.

Active biological material in contact with - Undress PPE. skin, eyes, mouth or nose

- Clean the affected area with plenty of water and soap.

- Contact the overseeing person to follow the ICVS/EM/UMinho contingency plan for COVID-19. - The overseeing person must inform the Safety and Health Compliance.

Chemical/inactivated biological material in - Clean the affected area with water and soap. contact with skin, eyes, mouth or nose

- Follow the instructions in the respective Safety Data Sheet.

76 V1.8|13.05.2020

ATTACHED DOCUMENTS

1. Statement of Responsibility 2. ICVS Covid-19 Diagnostic Action - Teams' Daily Registration 3. Covid-19: Waste management and disposal guidelines 4. Primers and probes used in RT-PCR for 2019 novel coronavirus diagnostic 5. ICVS Covid-19 Diagnostics’ Report Template 6. Biosafety Level 3 Manual 7. UMinho COVID-19 Contingency Plan

77 V1.8|13.05.2020

1. Statement of Responsibility

78 V1.8|13.05.2020

2. ICVS Covid-19 Diagnostic - Teams' Daily Registration

ICVS/School of Medicine - University of Minho Covid-19 Team Daily Registration

Date

Name Signature Check-in Check-out Check-in Check-out Covid-19 Time Time Temp. (°C) Temp(°C) Symptoms

79 V1.8|13.05.2020

3. Covid-19: Waste management and disposal guidelines

80 V1.8|13.05.2020

81 V1.8|13.05.2020

4. Primers and probes used in RT-PCR for 2019 novel coronavirus diagnostic.

Table 1 - Primers and probes used in RT-PCR for 2019 novel coronavirus.

Gene Name Oligonucleotide Name Sequence 5'-3' a) RdRP_SARSr-F GTGARATGGTCATGTGTGGCGG RdRP gene RdRP_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ RdRP_SARSr-R CARATGTTAAASACACTATTAGCATA E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT E gene E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ E_Sarbeco_R ATATTGCAGCAGTACGCACACA RNP_F AGATTTGGACCTGCGAGCG RNP gene RNP_R GAGCGGCTGTCTCCACAAGT RNP_P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ

a) W is A/T; R is G/A; M is A/C; S is G/C. FAM: 6-carboxyfluorescein; BHQ: Black Hole Quencher.

82 V1.8|13.05.2020

5. ICVS Covid-19 Diagnostic Report Template

Diagnóstico SARS-CoV-2

Relatório dd-mm-yyyy_#report

TOTAL Negativo Positivo Inconclusivo

ICVS ID ID 1 ID 2 ID 3 Conclusões Sample1 Sample2 Sample3

Notes

ID 1: Health Care/Care Taker name

ID 2: Health Care/Care Taker samples’ ID

ID 3: National Health System ID

83 V1.8|13.05.2020

6. Biosafety Level 3 Manual

BIOSAFETY LEVEL 3

MANUAL

84 V1.8|13.05.2020

1. SCOPE

The present Biosafety Level 3 (BSL-3) Manual describes the rules and guidelines for the use of the BSL-3 facility of all Institutions from Portugal. The BSL-3 laboratories are a potentially hazardous work area due to pathogen species diagnosis or research projects proposed to take place therein. All rules, definitions and procedures in this manual follow CDC, WHO and/or OIE guidelines. All laboratory procedures will follow the guidelines of BSL-3 for each facility and BSL-3 practices. Because of the biohazards associated with diagnosis and research on BSL-3 pathogen species, all such operations will be confined to the designated research area. Adherence to proper standard operating procedures protects everyone from exposure to infectious agents in the BSL-3 laboratory. Working with BSL-3 pathogens requires diligence from the laboratory worker to maintain safe laboratory conditions. This includes extensive knowledge of both the pathogen and the procedures, proper training and certification, and rigorous adherence to safety practices. Universal precautions will underlie all aspects of work undertaken in the BSL-3 implying that all procedures performed within the BSL-3 laboratory will be planned and executed as if all cultured organisms are extremely dangerous and infectious pathogens. Failure to meet any of these expectations will result in removal of BSL-3 access privileges. The user is responsible for being well versed in the experimental design and execution of each protocol to be done in the BSL-3. Also, all procedures must be approved by the Biosafety Committee and the Biosafety Coordinator prior to being performed in the BSL-3 facility. Training of users will take place prior to any work in the BSL-3. Each user is required to take BSL-3 specific training. An unsafe worker jeopardizes the health and safety of all workers in the BSL-3. This document describes all standard operating procedures associated with the BSL-3 Facility.

Remember that safety is a shared responsibility. Attitude and work practices are critical for one’s own health and safety, and for the welfare of others and the environment.

1.1. RISK OF INFECTION Inside the BSL-3 facility, there is a risk of infection by pathogens that are dangerous to humans (BSL-3 agents, according to the Diretiva 2000/54/CE do Parlamento Europeu e do Conselho de 18 de Setembro de 2000, relativa à Proteção dos Trabalhadores contra Riscos Ligados à Exposição a Agentes Biológicos durante o Trabalho).

2. DESCRIPTION 2.1. BIOSAFETY COMMITTEE The Biosafety Committee of each Institution is responsible to recommend a safety policy and to formulate a code of practice or safety or operations manual to serve as the basis of safety practices in the individual laboratories, as advised by the biosafety officer. The Biosafety Committee also reviews and updates periodically the safety policy as necessary. Safety problems brought to the attention of the Biosafety Officer, along with information about how they were dealt with, is presented to the safety committee at regular meetings. Other functions of the committee include risk assessments of research plans, formulation of new safety policies, and arbitration in disputes over safety matters. They also evaluate investigation projects that apply for the use of the BSL-3 laboratory. 85 V1.8|13.05.2020

2.2. BIOSAFETY COORDINATOR The Biosafety Coordinator has the responsibility, authority, and support from the Biosafety Committee for establishing and maintaining policies and procedures, training personnel and maintaining the facility and equipment. The Biosafety Coordinator will be responsible for managing the BSL-3 Facility’s operation, for supervising the technical conditions of the Facility and for issuing authorizations to use the BSL-3 Facility. The Biosafety Coordinator also provides technical support and consultation on biological safety practices, laboratory facility and engineering controls, and regulatory matters. In particular, the Biosafety Coordinator has responsibility for the issues relating to health and safety such as reviewing and monitoring the BSL-3 Facility design and renovation projects, advising project managers on acceptance criteria and tests, initial and periodic assessment of critical facility and component performance, consultation and technical assistance in response to incidents and facility decontamination. In addition, the Biosafety Coordinator will be involved in the safety training and testing of candidate BSL-3 Facility users. Alexandra Fraga ([email protected])

3. GAINING ACCESS TO THE BSL-3 FACILITY 3.1. GENERAL ACCESS RULES • Access to the BSL-3 laboratories will be restricted to authorized and approved personnel. Access to the BSL-3 facility is via a personal electronic card. Code readers are located at the entry of the BSL-3 facility. Individual cards will only be issued to approved personnel. This card must NOT be shared. • All individuals working in the laboratory must be fully trained and approved as capable of handling the pathogen(s) being studied. Individuals must be able to demonstrate proficiency in laboratory procedures prior to working with BSL-3 agents. New personnel shall not perform any work in the BSL-3 laboratory until they have completed the Biosafety Training Program. Training includes orientation and review of general safety practices, biosafety/biosecurity, BSL-3 practices, emergency operations, waste management, medical surveillance, and site specific standard operating procedures topics. In addition to the safety orientation, new personnel should familiarize themselves with the BSL-3 manual. • All personnel with access to the BSL-3 laboratory will perform a baseline IFNgamma release assay (IGRA) test prior to BSL-3 entry and will have continued upon departure or if requested. • Individuals at an increased risk for acquiring infection must consult with the Biosafety Coordinator before working in the BSL-3 laboratory area. Individuals at risk include pregnant women, individuals who are immunosuppressed or undergoing immunosuppressive therapy and individuals having recent surgical procedures or injuries in which the integrity of the skin has been compromised. • Children under 18 years of age are not permitted in the laboratory area. • Pregnant women are not allowed in the BSL-3 Facility according to Lei 102/2009, art. 58. • Emergency crews and fire personnel may respond to emergencies in the area but may not enter unless the Biosafety Coordinator authorizes entry.

86 V1.8|13.05.2020

3.2. RESEARCH PROTOCOL SUBMISSION No manipulations or operations involving BSL-3 agents are allowed unless they are previously approved in the scope of a project proposal. The submission of protocols for the use of new microrganisms, techniques and/or equipments in the BSL-3 facility, requires a previous analysis by the BSL-3 Coordinator to guarantee that the biosafety guidelines are followed. The protocol requires a written proposal to be submitted by the Principal Investigator (see submission form in Annex 1). The proposal should describe all manipulations/operations involving BSL-3 agents required in the protocol.

3.3. USERS The Principal Investigator of the project is responsible for the use of appropriate safety practices and procedures by their staff. It is the responsibility of each Principal Investigator to ensure that all individuals working under his or her direction are appropriately trained for working with pathogens. Access to BSL-2 laboratories will be restricted to authorized and approved personnel. The following criteria MUST be met before entry: • Notification of the user must be made by a Principal Investigator, including information regarding the user and justification for their entry in the BSL-3 facility. Annex 2 must be filled out and sent to the BSL-3 Coordinators. • Children under 18 years of age and BSc students (ex: interns, medical students-projecto de opção) are not allowed in the BSL-3 laboratory area. • Individuals at an increased risk for acquiring infection must consult with the Biosafety Coordinators before working in BSL-3 laboratories. Individuals at risk include individuals who are immunosuppressed or undergoing immunosuppressive therapy; individuals having recent surgical procedures or injuries, in which the integrity of the skin has been compromised and pregnant women (Lei 102/2009, art. 58). • All individuals working in the laboratory must be fully trained and approved as capable of handling the pathogen(s) being studied. New personnel shall not perform any work in the BSL-3 laboratories until they have: o completed the BSL-3 Biosafety Training Program. Training includes orientation and review of general safety practices, biosafety/biosecurity, BSL-3 practices, emergency operations, waste management, medical surveillance, and site specific standard operating procedures topics. o familiarized themselves with the BSL-3 manual and ensure that all work is conducted in compliance with the BSL-3 manual. o learned the operating procedures for the laboratory, the potential hazards of the infectious agents in use and emergency procedures. o commit in maintaining the BSL-3 laboratories in good working conditions. • After completing the BSL-3 Biosafety Training Program (see section 3.4), users must always be accompanied by authorized personnel during a 60-80h trial period (see section 3.4.1) • Following completion of the evaluation trial period, the user will be tested under mock BSL-3 conditions and evaluated for knowledge of procedures and technique. Only then will the user receive approval and individual access to BSL-3 facility.

87 V1.8|13.05.2020

• Access to the BSL-3 facility may be canceled by the Biosafety Coordinator without prior warning in the event of non compliance with the present rules and guidelines.

3.3.1 TEMPORARY MAINTENANCE VISITORS Temporary visitors (e.g. maintenance technicians) must always be accompanied by authorized personnel into the containment facility. The following criteria MUST be met before entry: • Notification of the visitor must be made, including information regarding the visitor and justification for the visit to the BSL-3. • No work with open cultures or infected materials can be carried out while the visitor is present within the barrier. The BSL-3 Biosafety Coordinator is responsible for providing adequate notification, and ensuring that no work with infected material will be performed while the visitor is within the facility. • The visitor will be required to wear face mask, gloves, hair net, coveralls, and shoe covers.

3.3.2 TEMPORARY VISITING WORKERS When appropriate, temporary visiting workers (e.g. researchers from other labs) may accompany authorized personnel into the containment facility if the following criteria are met: • Notification of the visitor must be made by a Principal Investigator, including information regarding the visitor and justification for their entry in BSL-3 facility. Annex 2 must be filled out and sent to the BSL-3 Coordinators. • Prior to entry into the BSL-3, the temporary visiting worker must perform an IGRA test. • Temporary visiting workers must complete the BSL-3 Biosafety Training Program. • Temporary visiting workers must ALWAYS be accompanied by authorized personnel at all times and will NOT be allowed to handle infectious microorganisms on their own.

3.3.3 LONG-TERM WORKERS The following criteria MUST be met by long-term workers (e.g. master/PhD students; researchers) before entry: • Notification of the visitor must be made by a Principal Investigator, including information regarding the visitor and justification for their entry in BSL-3 facility. Annex 2 must be filled out and sent to the BSL-3 Coordinators. • Prior to entry into the BSL-3, the long-term worker must perform an IGRA test. • Long-term workers must complete the BSL-3 Biosafety Training Program. • Long-term workers must always be accompanied by authorized personnel during the trial period. • Long-term workers may only work independently within the BSL-3 facility after evaluation and approval from the Biosafety Coordinators.

3.4. BSL-3 BIOSAFETY TRAINING PROGRAM • The Biosafety Training Program aims at disseminating biosafety work practices, building a solid foundation of theoretical and practical skills in biosafety, and homogenizing the concepts and the procedures in BSL-3. • The attendance of the training course is mandatory for new users before entering the BSL3 facility. • The applicant is expected to have thoroughly read this manual before training begins. 88 V1.8|13.05.2020

• BSL 3 Biosafety Training Program will include a theoretical course during which all main aspects of working in a BSL-3 facility will be presented and explained, such as: o Biosafety in microbiology laboratory: evaluation and risk management. o Laboratory Biosafety Levels. o Legislation and guidelines on risk and levels of biological containment. o Management of human resources and stocks. o Infrastructure and laboratory organization. o Good laboratory practices in BSL 3. o Good practices and biosafety in the handling of vertebrates animals. o Procedures for decontamination: disinfection and sterilization. o Emergency procedures in case of accident in the laboratory. o Transportation of biological samples.

3.4.1. SUPERVISED TRIAL PERIOD • Given the complexities and risks associated with BSL-3 work, authorized access to the BSL-3 facility is not automatic and must first follow a supervised trial period. For the first 60-80h of work in the BSL 3, an authorized BSL 3 user (mentor) must be present to observe the user’s technique and to help the new user if needed. • The mentor is RESPONSIBLE for the new researcher. The mentor must NEVER leave the new researcher unattended in the BSL3 facilities. The mentor’s priority should be the safety of the new researcher. • An active BSL-3 user (mentor) will be chosen by the Biosafety Coordinator to introduce the applicant to general BSL-3 procedures and provide specific technical training based on the submitted protocols. All training must include identification and control of the hazards with which the person will be working. Furthermore, the training program must include performing procedures that cover the following topics: o Correctly donning and remove the appropriate protective equipment. o Adherence to general lab safety procedures. o Setting up, cleaning up, and properly using the biosafety cabinets (BSC). o Culturing and manipulating airborne BSL-3 pathogens safely, with emphasis on the importance of avoiding aerosol generation during all operations. o Performing the essential procedures required of most protocols, such as centrifugation, plating, and incubating. o Disposing of waste. o Running the autoclave. o Taking materials out of the BSL-3. o Following emergency procedures, especially what to do in the event of a spill. o Standard Operating Procedures for individual laboratory tasks should be written out and published. Knowledge of these protocols will be required for BSL-3 training certification, and the specified techniques will be followed by everyone.

89 V1.8|13.05.2020

• When the 60-80h of work have been fulfilled, the user may request for a practical exam. The user will be tested under mock BSL-3 conditions and evaluated for knowledge of procedures and technique. Only then will the user receive approval and individual access to BSL-3 facility.

3.5. MANAGERIAL RESPONSIBILITY • Responsibility for enforcing the provisions of the BSL3 Manual lies with the BSL-3 Coordinator. • It is the responsibility of the BSL-3 Coordinator to ensure that workers are competent to work in the BSL-3 facility. • It is the responsibility of the Principal Investigator to ensure that their staff receives adequate training and supervision. • Any failure to comply with the methods of procedures will be discussed within the BSL-3 Coordinator and the Principal Investigator to determine disciplinary measures.

4. BSL3 FACILITY FEATURES 4.1. BLUEPRINT OF ICVS BSL-3 FACILITY

4.2. NEGATIVE AIR PRESSURE • A negative pressure room includes a ventilation system designed so that air flows from the corridors, or any adjacent area, into the negative pressure room, ensuring that contaminated air cannot escape from the negative pressure room to other parts of the facility. • Negative pressure is created by balancing the room’s ventilation system so that more air is mechanically exhausted from a room than is mechanically supplied. This creates a ventilation imbalance, which the room ventilation makes up by continually drawing in air. • Negative pressure in a room can be altered by changing the ventilation system operation or by the opening and closing of the room's doors, or corridor doors. When an operating configuration has been established, it is

90 V1.8|13.05.2020

essential that ALL doors remain properly CLOSED in the negative pressure room and other areas (e.g., doors in corridors that affect air pressure) except when persons need to enter or leave the room or area. • Passage between rooms should always done through an “interlocked” door system. This means that when entering or exiting the BSL-3 facility, only one door may be opened at a time. • Within the BSL-3 experimental handling rooms, above the exit doors, there are air pressure panels that display the pressures of each room relative to the adjacent room, which should be between -15 and -20. In the laboratory I3.02, there is an air pressure panel that displays the pressures of the BSL-3 experimental handling rooms relative to the atmospheric pressure, which should be between -35 and -40. • The correct pressure values will be indicated next to the air pressure panels. Any alterations in these values should be immediately notified to the BSL-3 Coordinators.

4.3. ETAR – WATER TREATMENT • BSL-3 facility has an infrastructure that decontaminates water originating from the BSL-3 laboratories, with the objective to produce an environmentally-safe fluid waste suitable for sewage disposal. • The water waste from the BSL-3 laboratories is stored in a large container located in the lower level, which automatically and periodically dispenses sodium hypochlorite.

5. USING THE BSL-3 FACILITY 5.1. BSL3 WORKING HOURS

• For your own safety, experiments that require the use of the BSL-3 facility outside regular working days (ex: at night, weekends and holidays) should only be conducted under the following situations: o If the procedures are performed under 1h (ex: changing water/food for animals; harvesting supernatants; fixating samples; counting CFU, etc.), the BSL-3 user may enter the facilities alone but must warn another authorized BSL-3 user upon entry and exit. o If the procedures require >1h of work or require the use of sharp objects (ex: in vivo or in vitro infections, harvesting organs, handling of concentrated stocks of inocula, etc.), the BSL-3 user must be accompanied in the experimental handling room by another authorized BSL-3 user or an authorized BSL-3 user must be present in the laboratory and frequently call the user in the BSL-3 experimental handling room.

5.2. BEFORE ENTERING Before opening the main door to the BSL-3 facility: • If you need to retrieve any samples from the -80 freezer, collect them before entering the BSL-3 facility. Samples must be carried from the – 80ºC freezer to the BSL-3 facility inside a closed secondary container (provided). The containers can only be open inside the BSC. • Ensure you have everything you need to take inside. Each entry is costly, time consuming and constitutes a potential contamination hazard, so avoid unnecessary visits to the BSL-3 facility.

91 V1.8|13.05.2020

5.3. ENTERING THE LOCKER ROOM. DONNING PERSONAL PROTECTION EQUIPMENT (PPE) • Enter the main door to the BSL-3 facility and enter the locker room. Personal items and clothing (coat, heavy clothing, jewelry and other belongings), must be stored in the lockers provided. PLEASE NOTE THAT THE USE OF MOBILE PHONES OR MP3/MP4 PLAYERS INSIDE THE FACILITY IS STRICTLY FORBIDDEN. • Designated personal protective equipment (PPE) must be worn by every person entering the BSL-3. All PPE will be provided and will be stocked in the locker room. Change into all PPE in the locker room and common corridor before entering the BSL 3 facility. • Required PPE includes: o Clogs o Facemask (FFP2/FFP3) o Head covers o Overalls o Shoe covers o Gloves

* The ONLY circumstance in which it is permissible to enter the BSL-3 laboratory without the appropriate protective clothing is in the case of EXTREME emergency. You must be able to later show that the act of donning protective clothing or equipment would have adversely affected your health or that of another.

Correct donning of PPE upon entry: • Enter the locker room o Register the name, date, and time in the log book located in the locker room o Put on and zip up the coveralls. o Put on your personal clogs at the entry of the common corridor. o Put on head cover, making sure that all hair is tucked in and forehead is covered. o Put on facemask. o Put on two pair of gloves. o Secure with tape the coveralls and the first pair of gloves. o Put on two pair of shoe covers. o Sleeve covers and safety glasses are available if required • Once you have double-checked that all PPE is correctly worn (use mirror located within the locker room), enter the BSL-3 experimental handling rooms.

5.4. ENTERING THE EXPERIMENTAL HANDLING ROOMS • Before entering the experimental handling rooms where you will carry out your work, please o Observe the pressure indicator panels located above each door to the BSL-3 laboratories, to ensure the facility is operating correctly. If the yellow warning light is permanently on (lights may

92 V1.8|13.05.2020

temporarily turn yellow if doors are not securely closed), DO NOT ENTER and immediately notify BSL-3 Coordinators. o Check that there is no spillage or other warning signs on the door. o If you need to retrieve any samples from the -80 freezer, collect them before entering the room. Samples must be carried from the -80ºC freezer to the BSL-3 facility inside closed a secondary container (provided). The containers can only be open inside the biosafety cabinet (BSC). o Ensure you have everything you need to take inside. Each entry is costly, time-consuming and constitutes a potential contamination hazard, so avoid unnecessary visits to the BSL-3 facility. o In the BSL-3 facility, do not leave until your task has been completed and the laboratory has been cleaned. AVOID LEAVING EXPERIMENTS UNATTENDED. o Any incidents involving potential exposure to mycobacteria/paracoccidioides, spills, or improper use of the BSL-3 facility must be reported immediately to BSL-3 Coordinators and an incident report must be filled out.

5.5. MOVING FROM ONE EXPERIMENTAL ROOM TO ANOTHER • If you need to carry out work in more than one experimental handling room, and if you are carrying samples, make sure you follow the following guidelines: o Before you exit the first experimental room, remove the outer pair of shoe covers and place clean feet on the mat. o If sleeve covers are being worn, remove and dispose of. o Remove the outer pair of gloves and dispose of them in the bin. o If safety glasses are being worn remove, disinfect and store in appropriate container. o Remove face mask, hair cover, and gloves while holding your breath. Dispose in appropriate bin. o Open the door and step into the common corridor. o Make sure you close the door behind you. o In the locker room, don PPE as explained in section 5.3. o Upon entering the second experimental handling room, pick up a clean labcoat and a pair of safety glasses

5.6. EXITING THE BSL-3 FACILITY • Before exiting the experimental handling room, make sure everything is left clean and in order. • Biological samples from the BSL-3 facility must be rendered inactive before exiting the BSL-3 facility (formol, trizol, heat killed, etc.) and inactive samples must be double bagged. The only exception regards vials of inocula, which must be first packaged in a primary container (zip-lock bag) and then in a leakproof, screwtop secondary container lined with absorbent material (bubble-wrap or paper). Label the container with the date and the strain of inocula. These containers are to be placed in the -80ºC freezer on a designated and exclusive shelf and registered on the log outside of the freezer.

93 V1.8|13.05.2020

Correct removal of PPE upon exit: • Before you exit the first experimental room, remove: o the outer pair of shoe covers; o the cover sleeves (if being used); o the outer pair of gloves: o safety glasses, disinfect and store in appropriate container (if being used); o Coveralls: if they are to be used again place them on your individual hanger. If they are to be autoclaved, dispose them in the dedicated container; o face mask, hair cover, and gloves while holding your breath. Dispose of in appropriate bin. • Open the door and step into the common corridor. • Make sure you close the door behind you. • Once in the locker room, disinfect your hands with the solution provided. • Collect any personal belongings. • Register the name and time of exit in the log book. • Exit the locker room.

6. WORKING IN THE BSL-3 EXPERIMENTAL HANDLING ROOMS 6.1. RESTRICTIONS AND RULES OF CONDUCT The following rules apply to ANY work carried out in the BSL-3 laboratory and must be adhered to at all times. • Children under 18 years old and pregnant women are not allowed in the BSL-3 facility. • Use of chemical compounds and solvents must be specifically approved by the Biosafety Committee. • Eating, drinking, smoking, handling contact lenses, applying cosmetics, and storing food for human consumption inside the BSL-3 facility is strictly forbidden. • Mobile phones, electronic diaries, personal music players and other personal electronic devices, which will not remain in the BSL-3 facility, are not allowed in the facility. • Shorts and skirts cannot be worn in the facility. • Once stationery (paper, pens, books, etc.) has entered the facility, it must not be taken out. Minimize transit of written documents. Use the computers instead. • Jewelry cannot be worn inside the BSL-3 facility. Rings must be removed as they may pierce the safety gloves. • More than one person in a Biosafety Cabinet (BSC) at the same time is not allowed. • Mouth pipetting is strictly prohibited; mechanical pipetting devices must be used. • Limit the use of glassware and sharps in the facility. • Disposal of contaminated needles or sharp objects in an appropriate puncture resistant, leak-proof container. NEEDLES ARE NOT TO BE RECAPPED, BENT BACK, CUT, OR PLACED IN INAPPROPRIATE CONTAINERS. • Users should only stay inside the BSL-3 facility up to 3 hours at a time. Take breaks to avoid fatigue. • Any skin cuts or abrasions on the hands, face, arms or other exposed areas of skin must be covered with a band-aid before entering the BSL-3 facility. If necessary, bandages are available in the locker room. • Certify that laboratory doors are closed. 94 V1.8|13.05.2020

• Organize your work time to avoid rushing. Keep the amount of work to be done realistic within the time frame. As a rule, you should double the amount of time you would normally require to carry out the same procedure(s) in normal conditions. • Negative pressure below -40 Pa could be unpleasant and some people may feel dizzy. Depending on the room pressure, work sessions in the handling room of more than 3 hours are prohibited. If you feel uncomfortable in the experimental handling room please notify the Biosafety Coordinators immediately. • All procedures involving the manipulation of infectious material are conducted within class II BSC. • Appropriate PPE must be worn at all times. Two pairs of gloves must be worn at all times. Gloves must always be changed when contaminated or when integrity has been compromised. • While working, do not touch your face, eyes, mouth or other exposed body parts. Once you are in the BSL-3 facility, the outer gloves should be considered to be "contaminated". If absolutely necessary, remove the outer glove first before touching mask, glasses, hair or any exposed skin and immediately put on a new outer glove. • PREVENT AEROSOLIZATION OF ORGANISMS, EVEN WITHIN THE BSC. All aerosol-producing equipment, such as that used for vortexing, must be kept in the BSC. All centrifugation must be performed with adapters designed for containment purposes. Aerosol resistant centrifuge canisters/buckets must only be opened in a BSC. • No work with open vessels containing BSL-3 agents is allowed on the bench. When such a procedure cannot be performed within a BSC. • Organize your work time to avoid rushing. • The BSC must be maintained in a CLEAN and ORDERLY manner. Avoid cluttering the BSC as it will affect the air flow. • All contaminated trash must be rendered inactive by both disinfectant and autoclave. • Upon completion of a work session, the individual using the BSC is responsible for THOROUGHLY cleaning and decontaminating the inside surfaces.

6.2. TRANSFER OF MATERIALS 6.2.1. ENTRY OF BIOLOGICAL MATERIALS • Biological materials potentially containing BSL-3 agents that must enter and be transported across the BSL-3 Facility areas in a viable or intact state will be in sealed a primary container and a leakproof, screwtop secondary container lined with absorbent material (bubble-wrap). • Packages containing viable agents may only be opened inside containment and within the confines of a BSC.

6.2.2. REMOVAL OF BIOLOGICAL MATERIALS • Any biological material transported out of the BSL-3 facility must be inactivated. • Method of inactivation must be proved appropriate for agent and sample, requiring prior approval by the Biosafety Coordinator. • Viable materials MUST NOT be removed from the BSL-3 facility, except with specific permission of the Biosafety Coordinator. • Inactivated samples for lab processing must be double contained: 95 V1.8|13.05.2020

o Spray the samples thoroughly with an appropriate disinfectant and time exposure, and place inside two sealable bags. o Spray and disinfect both bags with an appropriate disinfectant.

6.2.3. BRINGING PRINTED PROTOCOLS IN / TAKING DATA OUT Transit of printed and stationery material in the facility should be minimized. Once such material has been taken inside, it cannot be removed from the facility other than through the autoclave. Likewise, no written notes or data produced inside can be removed from the facility. The following rules must therefore be observed at all times:

Bringing Printed Protocols In: • Printed protocols must be taken inside enclosed in a plastic sheet protector, which must be SEALED with tape before entering the facility. • During work in the BSC, protocols can be fixed with tape to the OUTSIDE of the cabinet. NEVER PLACE THEM INSIDE THE CABINET OR ON THE GRILL AT THE FRONT OF THE CABINET. • If you need to turn, change or otherwise touch the protocol during work BE SURE TO CHANGE OUTER GLOVES FIRST. • Once work is completed, the protocol’s plastic sheet protector must be surface decontaminated with an appropriate disinfectant and the encased protocol stored in the appropriate folder in the room. • If you will be using (a) protocol(s) that is(are) already in the folder, DO NOT bring an additional one inside. Instead, collect the protocol(s) you need from the folder BEFORE you start working. • If a protocol becomes obsolete and is to be replaced by an updated one, surface decontaminate the old plastic sheet protected protocol and discard as solid waste.

Taking Data Out: • As much as possible, avoid taking written notes during work. • NEVER PLACE PENS OR PAPER INSIDE THE CABINET OR ON THE GRILL AT THE FRONT OF THE CABINET. • Written data cannot be removed from the facility. Use the computer to e-mail your data or save it on a network disk. BE SURE TO CHANGE OUTER GLOVES FIRST. • Once you have finished using the computer to export your data, discard the encased notes as solid waste. • Using the computer and discarding the notes are the LAST things you should do before following the exit procedures.

6.2.4. MAINTENANCE, REPAIR AND REMOVAL OF EQUIPMENT • Equipment in the facility will undergo periodic maintenance. • Maintenance and repair work will be carried out inside or outside the BSL-3 facility depending on the size of the equipment, contamination of surface/internal components, ability to decontaminate equipment, ability to remove equipment and ability to bring tools and specialty equipment into the facility. • Equipment maintenance or removal must be supervised by the Biosafety Coordinator. 96 V1.8|13.05.2020

• All equipment must be decontaminated inside and out prior to removal from the BSL-3 facility (including for repair or maintenance). Always contact the Biosafety Coordinator for these ends. Most equipment must be fumigated before removal. • All non-hazardous materials leaving the BSL-3 facility must be decontaminated. • It is the responsibility of the Biosafety Coordinator to advise personnel of the hazards and safety issues while working in the BSL-3 facility. • No work is allowed in the facility while maintenance or repair is being carried out in any area of the facility, unless specifically authorized by the Biosafety Coordinator. • Maintenance personnel who will be working in the BSL-3 must be accompanied and a ‘decontaminated’ area will be provided for their instruments. • Members of the BSL-3 facility staff will always enter the facility AHEAD of any maintenance or repair workers, wearing the same PPE. • All tools shall be wiped with an appropriate disinfectant before removal from the area. • Decontamination of highly technical or sensitive equipment or equipment with limited access to contaminated areas may not be possible. The equipment will be decontaminated to the degree possible.

6.2.5. PERIODIC CLEANING/MAINTENANCE, WASTE REMOVAL, AND AUTOCLAVING • Users are responsible for strictly following rules about cleaning surfaces and equipment used in the experimental rooms. • Tasks related with housekeeping/maintenance of the BSL-3 facility will be assigned to all BSL-3 users, as scheduled in the housekeeping calendar and registered in the cleaning log. • Housekeeping of BSC o DAILY: Thorough disinfection of all surfaces in the BSC with disinfectant for appropriate contact time and 70% ethanol after use. Turn on UV lights after each use. o EVERY 6 MONTHS: Disinfection of all surfaces in the BSC with disinfectant and 70% ethanol, including beneath the work tray and grates. Cleaning is to be performed by BSL-3 users, as scheduled in the Housekeeping Calendar posted in the BSL-3 laboratories. After cleaning, complete cleaning log. o YEARLY: Technical Safety Services will complete recertification and inspection of BSC; HEPA filters will be changed as needed. • Housekeeping of centrifuges o DAILY: Disinfection of all inside surfaces of the centrifuge with disinfectant for appropriate contact time and 70% ethanol after use. o EVERY 6 MONTHS: Disinfection of all inside surfaces of the centrifuge with disinfectant for appropriate contact time and 70% ethanol. Buckets and rotors are to be soaked in disinfectant for appropriate contact time, followed by 70% ethanol. Cleaning is to be performed by BSL-3 users, as scheduled in the Housekeeping Calendar posted in the BSL-3 laboratories. After cleaning, complete cleaning log. 97 V1.8|13.05.2020

• Housekeeping of incubators o Material in incubators must be stored in an orderly fashion. Cultures should be checked regularly for contamination before mold becomes a chronic problem for everyone. o EVERY 6 MONTHS: Disinfection of all surfaces in the incubators, first with disinfectant and then

with 70% ethanol. In the case of CO2 incubators, water should be replaced with fresh sterilized distilled water. Cleaning is to be performed by BSL-3 users, as scheduled in the Housekeeping calendar posted in the BSL-3 laboratories. After cleaning, complete cleaning log. • HVAC o YEARLY: The maintenance and supervising of the HVAC system, will be carried out by the Technical Services of the University of Minho and by an external certified company. • Autoclaving of waste o All waste must be double bagged. o Each worker is responsible for correctly bagging their own waste. o Autoclaving will be carried out regularly by technical staff. Nevertheless, BSL-3 users are obliged to know how to work with the autoclave: Autoclave Warm up Cycle • Before using the autoclave, turn on the compressor located in the autoclave room I3.γ02. • Turn on the autoclave located in the interior hallway. • On the autoclave screen, select P → 1 → menu → start. This will initiate the warm-up cycle of the autoclave. This should be the first cycle of the day. • At the end of this cycle, the message “processo válido” will appear on the screen.

Autoclave Sterilization of High Risk Material • After the warm up cycle, you may autoclave trash within the BSL-3 facility.

• To open the autoclave door press the button on the screen. • While you are loading the cart with trash place the metallic probe in a container with cold water to cool off the probe before the next cycle. The cooling of the probe is extremely important. • Place the cart within the autoclave, along with the probe immersed in a container filled with water.

• Securely close the door and press on the screen. • Press P → 15 → menu → start • At the end of this cycle, the message “processo válido” will appear on the screen located on the opposite side of the autoclave in room I3.γ02.

• Press to open the door and remove the sterilized trash from the autoclave.

• Place the cart inside the autoclave and press to close the door. • If more trash needs to be autoclaved, repeat all steps. Be sure to verify the validation of each cycle on the report.

98 V1.8|13.05.2020

• NOTE: During the cycle please check if an error has occurred (an alarm signal appears on the screen) and eliminate it by pressing the alarm signal on the screen. If the alarm is not eliminated, the cycle will not proceed and will stay in admission of vapor.

6.3. WORKING IN BSL3 All procedures involving the manipulation of infectious materials must be conducted within BSC. The following rules constitute General Procedures that apply to work carried out in the BSC in ANY of the experimental handling rooms.

6.3.1. PRELIMINARY CHECKS Before you start work: • Check that there are enough autoclave bags and waste containers. • Check that fresh disinfectant solution is prepared. • Check that there is enough disinfectant solution inside bottles.

6.3.2. SETTING-UP THE BSC To set up the BSC for work: • Check that the airflow in cabinet is working properly. • Adjust the height of your chair so that your armpits are approximately level with the bottom of the front sliding sash • Disinfect BSC surfaces • Place a fresh benchcoat sheet inside the cabinet (absorbent side up); make sure that the grid at the front is not covered. • Spray all equipment/materials with disinfectant before placing them inside the cabinet (micropipettes, tube holders, pipettors, pipettes, pipette tips, sterile culture flasks, centrifugation tubes, media, etc.) • Place a pipette boat containing fresh disinfectant (1/3 full) for tip and pipette disposal inside cabinet. • Put a plastic bag inside the BSC for the disposal of solid waste. The trash bags on the floor beside the BSC are NOT for trash that has been generated within the BSC (e.g. contaminated gloves, used plates, toweling, disposable loops, etc.). • An appropriate container is provided for disposal of needles. Contaminated needles/scalpels/glass and broken glass should be placed in this container which is always partially filled with disinfectant. After each usage, add an extra 2 cm of disinfectant. • After BSC set up, work is performed following protocol and guidelines previously approved by the Biosafety Coordinator.

6.3.3. WORKING IN THE BSC During work: • Be organized, practical and work safely at all times. • Work centrally in the BSC well back from the grill. 99 V1.8|13.05.2020

• No items should be resting on any part of the BSC grill as this will affect air flow and therefore the functioning of the air curtain. • Do not store excess material in the hood as this will affect air flow. • Avoid a cluttered work area in the BSC – it will minimize accidents and contaminations. • Avoid having two people working simultaneously in the BSC. • Always move your arms slowly and avoid swaying or sudden swift movements. Do not cross your arms while working. • Always walk slowly in front of a BSC to avoid disturbing the airflow. • Avoid creating aerosols. • Two pairs of gloves must be worn at all times. Always change or decontaminate gloves (spray them with disinfectant) when taking hands out the BSC. • Never touch equipment with potentially contaminated gloves. • Never scratch nose/eyes, get hair out of face with gloves on. If absolutely necessary, remove the outer glove first before touching mask, glasses, hair or any exposed skin and immediately put on a new outer glove • Discard liquids into the pipette boat with disinfectant (do not fill over 2/3 of capacity; if needed get another pipette boat with disinfectant). Please be aware that this procedure is prone to generating aerosols and spills. Exert extreme caution in discarding contaminated liquids • Never overfill waste containers. • TAKE PARTICULAR CARE when opening tubes. Always open tubes slowly. Be aware that supernatant may leak or spurt out when opened. If outer gloves become contaminated, discard them into the bin within the BSC and apply fresh outer gloves. • Flaming in the BSC should NEVER be done, as it could result in burnt HEPA filters or cause other serious damage. • Inoculating metal hoops are not allowed in the BSL-3, since flaming a contaminated loop directly can lead to aerosols. Disposable, one-use loops should be used. • Pipettes are NEVER to be placed into autoclave bags alone, because they often puncture the bags on closing it. • BSC air flow should NEVER be turned off with contaminated material inside.

6.3.4. WORK WITH AIRBORNE ORGANISMS In a laboratory setting, mechanical aerosol generation can lead to the release of particles which can cause infection if inhaled. • Direct manipulation of airborne organisms is ONLY allowed inside a prepared BSC. • Once containers of airborne organisms have been placed inside the BSC NOTHING is to be removed without being wiped with disinfectant. • The outer layer of gloves should be discarded, and a new pair donned, whenever there is the possibility of contamination with airborne organisms. • All disposable materials that come into contact with airborne organisms are to be decontaminated with disinfectant in the pipette boat.

100 V1.8|13.05.2020

• Objects are not to be removed from the BSC if there are open containers of airborne organisms. Objects to be removed will be wiped thoroughly with disinfectant and can be carried directly out, if gloves have been wiped with disinfectant.

6.3.5. PIPETTING Pipetting can generate aerosols. All pipetting must be done inside the BSC. • Only pipettes and pipette tips with filters are allowed in the BSL-3 facility. • Aerosols are minimized by avoiding blowing out the contents of a pipette completely and by preventing the formation of bubbles. • To avoid aerosol generation, whenever pipetting into a container, pipette onto the side wall of the container, and be careful not to blow out any air after all of the liquid has been ejected (use reverse pipetting). Similarly, avoid accidental intake of air when drawing liquid into a pipette or pipette tip. • After pipetting, rinse the inside and outside of the pipette by drawing disinfectant into the pipette and then allowing it to drain back into the pipette boat of disinfectant. After the pipette has been rinsed, it can be disposed of in the pipette boat. • For micropipette tips, following ejection of liquid, do not release the micropipette piston allowing air to be drawn into the pipette tip. Instead, holding the piston depressed, immerse the tip in disinfectant and draw disinfectant into the tip. The tip can then be disposed of into the pipette boat.

6.3.6. VORTEXING Vortexing generates aerosols. Avoid vortexing aerosolisable material. All vortexing must be done inside the BSC and should be avoided if possible. • Only use screw-cap tubes for vortexing. • Vortex for the minimal amount of time possible. • Centrifuge tube briefly after vortexing or mix by inversion.

6.3.7. SHARPS HANDLING • Limit the use of hypodermic needles and syringes. • Needles must NEVER BE RECAPPED. • Needles must NOT be bent, sheared, broken, removed from disposable syringes, or otherwise manipulated by hand before disposal. • Used disposable sharps must be carefully disposed in appropriated sharps containers. • Non-disposable sharps must be placed in a hard walled container for transport to a processing area for decontamination.

6.3.8. CLEARING THE BSC AFTER WORK When work has been completed, disinfect the exterior surfaces of potentially contaminated materials and supplies with an appropriate disinfectant before removing them from the BSC. Objects are not to be removed from the BSC if there 101 V1.8|13.05.2020 are open containers with pathogen. Objects to be removed will be wiped thoroughly with disinfectant and can be carried directly out, if gloves are clean. • Close or cover open containers • Allow the BSC to run for at least 5 minutes with no activity • Always decontaminate all surfaces and material coming out of the BSC. Objects are not to be removed from the BSC if there are open containers with pathogens. • All biological or non-biological materials that need to be incubated should be wiped down. Objects can then be carried directly out of the BSC, if gloves are clean. • Ensure that there is enough disinfectant to cover all the material in the pipette boat. Then put lid on pipette boat and surface decontaminate it. Double bag the pipette boat and spray with disinfectant before removing from within the BSC. Do not seal the bags so tightly that sterilizing steam cannot completely permeate the contents of the bags. • Put all solid waste material inside solid waste bag. Paper material, including benchcoat, pipette wrappers and paper towels must be sprayed with disinfectant. • Disinfect the interior BSC surfaces, including the inside of the view screen, with disinfectant followed by 70% ethanol. Discard waste papers into solid waste bag. NEVER PLACE YOUR HEAD INSIDE THE BSC. • Close waste in a waste bag with tape. Do NOT seal the bags so tightly that sterilizing steam cannot completely permeate the contents of the bags. • When all work in the BSC is completed and the hood properly cleaned, lower the front sash, and turn on UV light (programmed for 30-60 min). • Decontaminate plastic protocol protector and return protocol to the folder. • Use the computer to export data. • Follow appropriate instructions for either moving to a different experimental handling room in the Facility or for exiting the Facility

7. GENERAL EQUIPMENT USAGE 7.1. CENTRIFUGES The following procedures must be followed whenever working with a centrifuge in the BSL-3 facility: • In the BSL-3 laboratory all centrifugation steps are performed with sealed rotors or buckets. The rotors and buckets are designed to contain any aerosols that may be generated during centrifugation. • Examine tubes for cracks or stress marks before using them. Cracked or damaged buckets MUST NOT be used as they can fail during centrifugation. • Leakage may occur if tubes collapse due to underfilling or overfilling. The maximum fill level for centrifuge bottles is 2/3 full unless otherwise specified by the manufacturer. • Centrifuge buckets must be balanced. Use balance tubes as required. When placing tubes inside ENSURE that the caps are on firmly. • Use the BSC to load and unload centrifuge safety buckets. When removing buckets from the BSC, decontaminate by spraying with disinfectant and wiping dry before placing buckets in the centrifuge. 102 V1.8|13.05.2020

• When using the microcentrifuge, eppendorfs must be placed in the rotor inside the BSC and the closed rotor must be disinfected before being taken to the centrifuge. After centrifugation, eppendorfs must be carried to the BSC within the rotor and only opened inside the BSC. • The centrifuge must be monitored until it reaches the selected speed. • Thoroughly inspect the buckets after the completion of work for any spills. If any liquid is present, decontaminate the buckets. • Metal centrifuge buckets and microcentrifuge rotors should be decontaminated and dried thoroughly. Plastic inserts should be decontaminated in freshly prepared disinfectant solution. • O-rings should be inspected for integrity and coated with vacuum grease. • If a small centrifuge is used and aerosol-containing rotors are not available, centrifugation shall be performed in the BSC. • Wait at least 15 minutes before opening any tube following centrifugation of aerosolisable material.

7.2. INCUBATORS, REFRIGERATORS, AND FREEZERS (-20ºC AND -80ºC) • ANY material in incubators or stored in the refrigerators or freezers MUST be properly labeled. Proper labeling includes a description of the contents of the vial/flask/plate, the name of the user, and date. • Absent or incorrect labeling of ANY ITEM in the incubators, refrigerators or freezers MAY RESULT IN THE ITEM BEING DISCARDED WITHOUT PRIOR WARNING. • All items must be surface decontaminated before being placed in incubators, refrigerators or freezers. • ALL ITEMS in incubators MUST be placed in a zip lock bag or tupperware, which must be surface decontaminated before being placed in the incubator. • Material must be stored in an orderly fashion. • Check cultures regularly to avoid unnecessary clutter on shelves and dispose of contaminated plates before mold becomes a chronic problem for everyone. • Storage of samples in the -80ºC freezer must follow the rules above. In addition: o Samples can only be transported to and from the -80ºC freezer inside leakproof secondary containers with lids (provided). o Users must respect the space allocations to their respective groups. o Vials containing concentrated stocks of pathogen MUST be stored inside a leakproof secondary container. o The contents of the -80ºC freezer must be recorded in the appropriate form.

7.3. ORBITAL SHAKERS • Inspect all flasks to be used on orbital shakers. All flasks MUST be plastic. Glass flasks should NEVER be used. Any flask that shows signs of damage is NOT to be used. • All culture flasks must be clearly labeled with the following information: microorganism; date and name of researcher manipulating the culture. • Tightly screw the cap of the flask. 103 V1.8|13.05.2020

• Position flasks on shakers so that flasks do not bump together or into any other object. • Make sure the flasks are securely adhered to the green mat.

7.4. VACUUM PUMP • Aspiration of contaminated material must be done with a vacuum pump composed by a container with disinfectant and an in-line sterilizing, hydropobic membrane air filter (Vacusafe System). • After completion of work, disinfectant should be aspirated to decontaminate the tube. • After each usage, the container with the aspirated contaminated liquid must be closed with the appropriate screw-cap, placed in two autoclave bags, and sprayed with disinfectant, before placing the bags at the entry of the BSL-3 laboratory for autoclaving. Do not seal the bags so tightly that sterilizing steam cannot completely permeate the contents of the bags.

7.5. AUTOCLAVE • Part of the BSL 3 Biosafety Training Program includes autoclave training. All authorized personnel will be required to autoclave trash from the BSL-3 facility. Section 6.2.5 contains a step-by-step protocol on how to use the autoclave. • All items should be securely double bagged, sprayed with disinfectant and stored at the entry of each BSL-3 laboratory until disposal by autoclaving. Do NOT leave nonautoclaved trash in the common corridor. • Do not seal the bag so tightly that sterilizing steam cannot completely permeate the contents of the bag. • All contaminated items should be autoclaved as soon as possible after completion of your task. • After autoclaving, sterilized trash will be removed from the autoclave and placed in the autoclave room until disposed of by available personnel. To prevent unnecessary exposure to disinfectant fumes, autoclaved material must be allowed to cool sufficiently before any containers are opened.

8. ANIMAL EXPERIMENTAL HANDLING ROOM (ABSL-3) • Work with animal models must be carried out in the animal experimental handling room (ABSL-3). The following rules, in addition to those defined in the previous sections of this manual, apply to work carried out inside the ABSL-3. • Previous experience with animal work and Animal Experimentation accreditation is required. • Master all techniques with animal experimentation before performing work within the ABSL-3 • Please note that infection may occur following contact with inocula, microbial cultures and/or tissues, body fluids, or secretions from infected animals through the following routes: o Inhalation of aerosols o Bite and/or scratch wounds o Oral route o Skin/mucosal contact o Accidental inoculation

104 V1.8|13.05.2020

• Do not perform necropsy or organ collection while cages or no longer required equipment are still inside the BSC. • If you must use boards and pins, dispose of them as infected material. • Position and secure the animals on the necropsy board in a way that is convenient. • Perform the necropsy and/or collect the organs according the respective procedures. • Take all precautions to avoid/minimize blood spillage, fluid splashes, and aerosolization. • Avoid working directly with your hands: use the appropriate blunt tools instead, dipping them frequently in 70% ethanol. • If collecting organs or samples, place them inside the appropriate containers, always avoiding touching the outer surfaces. • When finished, place unwanted carcasses inside a plastic bag without touching the outer surface. • Organ homogenizations must be carried out inside the type III BSC. • When clearing-off BSC, double bag the carcasses, spray with disinfectant, and store inside the freezer. • Animal carcasses will be autoclaved prior to incineration.

9. SPILLS, INCIDENTS AND ACCIDENTS; EMERGENCY PROCEDURES Incidents include spills, leaks, pricks with infectious material, whether or not personal injury or contamination has occurred. ASSUME THAT ALL SPILLS ARE BIOHAZARDOUS. In considering the response to any incident: • The FIRST PRIORITY is the safety of the people involved. Your immediate task is to ensure that appropriate action is taken to attend to any serious injuries or life-threatening situations, and to ensure that yourself and others are not exposed to liquid or aerosols from the leaked material. • The SECOND PRIORITY is to take whatever immediate action is required to limit the spread of infectious material where this can be done without increasing the danger to you or others. Action will depend on the nature of the substance (e.g. liquid or aerosol) and the type of incident. • As the THIRD PRIORITY, the spilled or leaked material is to be cleaned up or disinfected, and the area or equipment made safe again. Whether the staff involved in the incident do this themselves, or whether the incident is immediately referred to the Biosafety Corrdinators for action, will again depend upon what the material is and where the incident occurred. Incidents must be reported to the Biosafety Coordinator. The reporting procedure should NOT be seen as leading to punitive action; most incidents occur as a result of an accident, application of inappropriate procedure or equipment failure and rarely as a result of disregard for accepted practices and procedures. An incident report MUST be completed.

9.1. EMERGENCY CLEAN UP KIT • KNOW THE EMERGENCY KIT’S LOCATION BEFORE WORKING WITH PATHOGENIC ORGANISMS. • This kit contains: o Spill containment sponges 105 V1.8|13.05.2020

o Paper towels o Shoe covers o Gloves o Plastic bags o Metallic forceps o Warning sign o Disinfectant

9.2. EMERGENCY MASK (RESPIRATOR) The 3M headtops combine face, hair, shoulder and respiratory protection and are designed to be used with an approved Air Filter Unit to form a respiratory protection device. The air will be fed via a breathing tube from a belt mounted Air Filter Unit to the back of the headtop. The air flows over the top of the wearer’s head and down in front of the face. The visor and face seal prevent ingress of contaminated air. Before entering the BSL-3 facility know the location of the respirators within the laboratory, marked with  in the following diagram.

The emergency Powered Air Purifying Respirator should be worn during cleaning of spills of aerosilisable material outside the BSC or for specific procedures (e.g. aerosol infection). The following rules should be followed: • Don normal PPE required prior to entering the BSL-3 facility, which is available in the locker room. Enter the BSL-3 experimental handling room in which the incident has occurred. • Once in the BSL-3, locate the respirator. Place headtop over head, WITHOUT removing the face mask and hair cover, adjust headband and ensure neck seal is providing an effective seal. • Switch on the Air Filter Unit. • Ensure that airflow into the headtop is achieved and adjust for maximum comfort. • If during use the air supply stops or is reduced, vacate the contaminated area immediately and investigate the cause.

106 V1.8|13.05.2020

• The “in-use” life of the headtops will vary with frequency and conditions of use. In everyday use, it is recommended that these headtops are discarded after 5 years service, although some extreme conditions may result in deterioration over a shorter period. • Only remove the headtop or turn off the air supply until you have reached the blue mat at entry of the BSL-3 experimental handling room. • Grasp the face seal and lift the headtop off the head. Be careful NOT to remove the face mask or hair cover during this process. • Switch off the Air Filter Unit. • Unbuckle the waist belt. • If the respirator has been used in an area that has caused it to become contaminated with a substance requiring special decontamination procedures it should be placed in a suitable container and sealed until it can be decontaminated.

9.3. SPILLS INVOLVING PATHOGENS In the event of ANY spill involving pathogens STOP WORK IMMEDIATELY and ALERT OTHERS IN THE ROOM. Then act according to the instructions in the following sections. 9.3.1. SPILLS INSIDE THE BSC In the event of a spill inside the BSC, always leave the BSC ON. Small Spills inside the BSC • Small spills (of less than 1ml) will probably be contained by the benchcoat on the workspace and can be decontaminated IMMEDIATELY. o Place absorbent, add disinfectant, allow it to act for an appropriate amount of time. o Discard the benchcoat into the primary solid waste bag or appropriate container. o Close the bag with tape, spray it and place in another autoclave bag for disposal. o Continue work, if necessary (using a fresh benchcoat) after wiping the area clean with 70% ethanol.

Large Spills inside the BSC • If there is a large spill in the BSC of an aerosolisable agent, IMMEDIATELY EVACUATE THE FACILITY. Inform all others in the area that an aerosol may have been generated. All persons shall evacuate the facility immediately. Remove any contaminated clothing/PPE according to the procedures: o Check personal clothing visually for contamination. If your overall is not contaminated leave the facility according to normal procedures. If present or suspect, remove clothes, placing them in the autoclave bag. Seal bag. If in contact with skin, wash affected area, using the antiseptic wash gel. Put on emergency clothing provided. o Prevent others from entering the facility involved, by placing the “Biohazard: Spillage – DO NOT ENTER” sign, on the exterior door of the BSL-3 Facility, found in the common corridor. o Report the spill directly to the Biosafety Coordinator and fill out an incident report. o Do not attempt to clean the spill for at least 30 minutes (to allow aerosols to settle). 107 V1.8|13.05.2020

o After 30min, don the respirator located at the entry of the BSL3 experimental room and use the emergency kit and to aid in the cleaning of the spillage. o All surfaces and items shall be surface decontaminated before being removed from the BSC. Discard any item that may have become contaminated and cannot be autoclaved. o Broken glass and sharp items have to be picked up with forceps. o Cover spill with paper towels and soak with disinfectant. Use enough material to absorb the spill entirely. o Allow the disinfectant to act for an appropriate amount of time. o Wipe area clean with tongs, dispose of waste materials into a waste bag, close and spray the bag, and place it inside a second autoclave bag. o Repeat disinfection procedure. o Thoroughly wipe the area clean with 70% ethanol and discard waste into the primary solid waste bag or appropriate container. Seal the bag, spray it and place in a second autoclave bag for disposal. o DO NOT put your head inside the BSC.

9.3.2. SPILLS OUTSIDE THE BSC • DO NOT ATTEMPT TO CLEAN THE SPILL. Presume a contaminated aerosol has been generated. The incident should be treated as a potential exposure. o IMMEDIATELY EVACUATE THE FACILITY. Inform all others in the area that an aerosol may have been generated. All persons shall evacuate the facility immediately following normal exit procedures. o Check personal clothing visually for contamination. If present or suspect, remove clothes, placing them in the autoclave bag. Seal bag. If in contact with skin, wash affected area, using the antiseptic wash gel. Put on emergency clothing provided. o Prevent others from entering the facility involved, by placing the “Biohazard: Spillage – DO NOT ENTER” sign, on the exterior door of the BSL-3 Facility, found in the common corridor. o Immediately notify the Biosafety Coordinators. o Only after 30 minutes (to allow aerosols to settle/dissipate by the ventilation system) can the decontamination procedure be carried out as described below. DO NOT re-enter the facility unless you have been instructed to do so by the Biosafety Coordinator. o Don PPE required prior to entering the BSL-3 facility, which is available in the locker room. Enter the BSL-3 experimental handling room in which the incident has occurred. o Once in the BSL-3, put on the respirator located at the entrance of the experimental handling room and locate the emergency cleaning kit. o Surround the area of the spill with the spill dikes to keep it from spreading. ALWAYS start for the outside and work your way inwards.

108 V1.8|13.05.2020

o Cover spill with paper towels and a sponge and soak with disinfectant. Use enough material to absorb the spill entirely. NEVER pour disinfectant directly on the spill. o Swab area around spill, including floor, walls, counters, using paper towels soaked in disinfectant. Use tongs. o Thoroughly wipe the area clean with tongs, dispose of waste materials into a waste bag, close and spray the bag, and place it inside a second autoclave bag. o Repeat disinfection procedure. o Thoroughly wipe the area clean with 70% ethanol and discard waste into a solid waste bag. Seal the bag, spray it and place in the autoclave bag for disposal. o Broken glass and sharp items have to be picked up with tongs. o During the clean-up process, all contaminated clothing, footwear and contaminated material used in cleanup must be double-bagged and autoclaved at the soonest opportunity. o The Biosafety Coordinator will evaluate the situation and decide whether fumigation of the room is necessary. o Fill out an incident report. o Medical surveillance may be required for potentially affected workers. o No one can re-enter the Facility until authorization is granted by the Biosafety Coordinators.

9.4. SPILLS IN BSL3 EQUIPMENT 9.4.1 SPILLS IN INCUBATORS Spills in incubators should follow the procedures outlined above for large spills involving pathogens (section 9.3.2). In addition: • All materials have to be removed from the incubator and decontaminated. All items shall be surface decontaminated with an appropriate disinfectant before being removed from the contaminated incubator and placed in another incubator. • Decontaminate the water on the floor of the incubator with disinfectant. Remove the water to an appropriate container to be autoclaved. • Place absorbent material soaked with disinfectant on each shelf and let sit for an appropriate amount of time. • Wipe incubator surfaces. • Repeat disinfection procedure, followed by 70% ethanol. • The incubator will undergo a sterilization cycle in accordance with the manufacturer’s instructions.

9.4.2 SPILLS IN CENTRIFUGES If unusual sounds from the centrifuge with pathogens suggest that breakage and a spill has occurred, or, if breakage and a spill is discovered after the machine has stopped, CLOSE LID, evacuate room for at least 30 minutes to allow hazardous aerosols to settle in the centrifuge. Spills in centrifuges should follow the procedures outlined above for large spills involving pathogens (section 9.3.2). In addition: 109 V1.8|13.05.2020

• WITHOUT OPENING THE ROTOR decontaminate all exposed centrifuge (interior centrifuge sides and rotor surfaces) and environmental surfaces by wiping with an appropriate disinfectant, followed by 70% ethanol. • Remove rotor and place in a BSC. Wipe rotor surfaces again with disinfectant. • Open rotor inside BSC. Disinfect by submersion in appropriate disinfectant allowing appropriate contact time. • Repeat disinfection procedure, followed by 70% ethanol.

9.5.3 SPILLS IN REFRIGERATORS/FREEZERS Spills in refrigerators/freezers should follow the procedures outlined above for large spills involving pathogens (section 9.3.2). In addition: • After decontamination of the spill, remove and disinfect each item separately. Transfer to a new box. • Check all tubes, plates, etc. for cracks and other damage. • Wipe surfaces with disinfectant, followed by 70% ethanol. • Repeat disinfection procedure.

9.6. ELECTRICAL POWER FAILURES, FIRE OR EMERGENCY EVACUATION Continuous maintenance of room-to-room differential pressures and appropriate directional bulk airflow through the BSL-3 experimental handling room is essential for safe operations. • Loss of negative pressure may occur due to leaving doors open for too long of a period of time, due to mechanical failure or due to fire. • If loss of negative pressure occurs the yellow warning light will turn on permanently. Within the BSL-3experimental handling rooms, above the exit doors, there are air pressure panels that display the pressures of each room relative to the adjacent room, which should be between -15 and -20. In the laboratory I3.02, there is an air pressure panel that displays the pressures of the BSL-3 experimental handling rooms relative to the atmospheric pressure, which should be between -35 and -40.

In the case of electrical failure, a back-up generator will turn on within 5 seconds after the power outage has been detected. However, in case of fire, all electrical outlets will be automatically deactivated and the generator will not be turned on. Therefore, everyone in the BSL-3 experimental handling room must: • Stop all work and cover or secure exposed materials (e.g. CLOSE BSC). • If working with animals, ensure that all live animals are inside the cages and that all cages are locked and on the IVC system. • Exit the experimental handling room following normal exit procedures. • Place “Biohazard: Technical failure – DO NOT USE”” sign on the door. • Contact the Biosafety Coordinators. • Do not re-enter the experimental handling room until advised by the Biosafety Coordinators that it is safe to do so.

110 V1.8|13.05.2020

In the case of fire, fire responders must wear respiratory protection when accessing the area.

9.7. FLOODS OR LEAKS FROM CEILING The ceiling of the BSL-3 Facility is also the floor of the technical area above the facility. Any leaks from the ceiling must be treated as potentially contaminated. • Immediately notify Biosafety Coordinator. • Place absorbent material soaked in disinfectant on any pools of liquid that are forming. • If leak is small and in an area that does not contain material or equipment, finish work and then leave the facility following the normal exit procedures. • If leak is substantial or above material or equipments, stop work immediately and leave the facility following the normal exit procedures.

9.8. PERSONAL INJURY • Needle punctures or cuts involving potential pathogen exposure: o Allow wound to bleed under running water. o Wash area with disinfectant and 70% ethanol. o If bleeding has not stopped, cover the wound with 70% ethanol soaked tissue until you reach the exit common corridor. o Leave the experimental handling room following exit procedures. o Disinfect the wound again with disinfectant in the common corridor. o Wash affected area with germicidal soap and water for at least 15 minutes. o Report to Biosafety the Coordinator. o Seek medical attention. • Splashes to nose, mouth and eyes o Splashes to the nose and mouth require flushing with water or saline for at least 15 minutes. o Splashes to eyes: remove contact lenses immediately (if worn). Rinse eyes and inner surfaces of eyelids continuously for 15 minutes. o Report to the Biosafety Coordinator and seek medical attention.

111 V1.8|13.05.2020

FACTS SHEET: GENERAL INFORMATION ON THE MICRORGANISMS USED IN THE BSL-3 FACILITY 10.1. TUBERCULOSIS – Mycobacterium tuberculosis 10.1.1. INFECTION AND TRANSMISSION • Tuberculosis remains one of the most important public health problems worldwide and is a leading cause of mortality and morbidity among infectious diseases, despite all the effort devoted to the study of this infection. • Tuberculosis is caused by Mycobacterium tuberculosis. Tuberculosis commonly attacks the lungs but can also affect other parts of the body. Most infections in humans result in an asymptomatic, latent infection, but about one in ten latent infections eventually progress to active disease, and if left untreated can kill more than 50% of its victims. • Transmission of M. tuberculosis can only occur from people with active, not latent, tuberculosis. When individuals with active pulmonary tuberculosis cough, sneeze, speak, or spit, they expel infectious aerosol droplets. Each one of these droplets may transmit the disease, since the infectious dose of tuberculosis is very low and inhaling fewer than ten bacteria may cause infection. An individual with active but untreated tuberculosis can infect 10– 15 other people per year. • The probability of transmission from one person to another depends upon the number of infectious droplets expelled by a carrier, the effectiveness of ventilation, the duration of exposure, and the virulence of the M. tuberculosis strain. The chain of transmission can, therefore, be broken by isolating patients with active disease and starting effective anti-tuberculous therapy. After two weeks of such treatment, people with non-resistant active tuberculosis generally cease to be contagious.

10.1.2. GLOBAL AND REGIONAL INCIDENCE • It has been estimated that one-third of the world's population has been infected with M. tuberculosis. However, not all infections with M. tuberculosis cause active disease and many infections are asymptomatic. In 2007, an estimated 13.7 million people had active tuberculosis disease, with 9.3 million new cases and 1.8 million deaths. • Tuberculosis is the leading cause of death among people with HIV/AIDS. The rise in HIV infections has enabled a resurgence of tuberculosis. In Africa, HIV is the single most important factor contributing to the increase in the incidence of tuberculosis since 1990. • The emergence of drug-resistant strains has also contributed to this new epidemic with 20% of tuberculosis cases being resistant to standard treatments and 2% resistant to second-line drugs, from 2000 to 2004. A particularly dangerous form of drug-resistant tuberculosis is multidrug-resistant tuberculosis, which is defined as M. tuberculosis being resistant to at least isoniazid and rifampicin While drug-resistant tuberculosis is generally treatable, it requires extensive chemotherapy (up to two years of treatment) with second-line anti- tuberculous drugs which are more costly than first-line drugs, and which produce adverse drug reactions that are more severe, though manageable.

112 V1.8|13.05.2020

10.1.3. CLINICAL FORMS AND SYMPTOMS • About 90% of those infected with M. tuberculosis have asymptomatic, latent tuberculosis infection, with only a 10% lifetime chance that a latent infection will progress to active tuberculosis disease. However, if untreated, the death rate for these active tuberculosis cases is more than 50%. • When the disease becomes active, 75% of the cases are pulmonary tuberculosis. Symptoms include chest pain, coughing up blood, and a prolonged cough for more than three weeks. Systemic symptoms include fever, chills, night sweats, appetite loss, weight loss, pallor, and fatigue. • In the other 25% of active cases, the infection disseminates from the lungs, causing extrapulmonary tuberculosis. This occurs more commonly in immunosuppressed individuals and young children. Extrapulmonary infection sites include the pleura, the central nervous system (meningitis), the lymphatic system, the genitourinary system, and bones and joints (Pott's disease of the spine). An especially serious form is disseminated tuberculosis, more commonly known as miliary tuberculosis.

10.1.4. PREVENTION AND TREATMENT • BCG is a live attenuated strain of M. bovis derived from a virulent strain that was continuously passaged in vitro. BCG is used in the prevention of tuberculosis and is currently the most widely used vaccine. Even though BCG vaccination is very effective at preventing childhood tuberculosis and to some extent miliary tuberculosis, its protection against adult pulmonary tuberculosis, can range anywhere from 0 to 80%. Furthermore, the protection afforded by BCG is not life-long, having an estimated duration period of only 10-20 years. • Treatment for tuberculosis requires the use of antibiotics. Effective tuberculosis treatment is difficult, due to the unusual structure and chemical composition of the mycobacterial cell wall, which makes many antibiotics ineffective and hinders the entry of drugs. However, tuberculosis can almost always be cured using a strict regimen of anti-tuberculosis drugs. People who develop active tuberculosis may have to be quarantined. • The two antibiotics most commonly used are isoniazid and rifampicin. However, instead of the short course of antibiotics typically used to cure other bacterial infections, tuberculosis requires much longer periods of treatment (around 6 to 24 months) to entirely eliminate mycobacteria. Latent tuberculosis treatment usually uses a single antibiotic, while active tuberculosis disease is best treated with combinations of several antibiotics, to reduce the risk of the bacteria developing antibiotic resistance. Individuals with latent infections are treated to prevent them from progressing to active tuberculosis disease later in life. • Primary resistance occurs in people infected with a resistant strain of tuberculosis. A patient with fully susceptible tuberculosis develops secondary resistance (acquired resistance) during tuberculosis therapy because of inadequate treatment, non-compliance, or using low-quality medication. Drug-resistant tuberculosis is a public health issue in many developing countries, as treatment is longer and requires more expensive drugs. Multi-drug- resistant tuberculosis is defined as resistance to the two most effective first-line tuberculosis drugs: rifampicin and isoniazid. Extensively drug-resistant tuberculosis is also resistant to three or more of the six classes of second- line drugs.

113 V1.8|13.05.2020

10.1.5. MEDICAL EVALUATION • Medical evaluation and treatment for a person exposed to airborne M. tuberculosis will include the following (puncture wound or ingestion exposure routes are not as serious as aerosol exposure, but these would likely be treated in a similar manner): o MEDICAL EXAMINATION: includes a baseline IGRA. o FOLLOW UP IGRA TEST THREE MONTHS AFTER EXPOSURE: if the test has converted to positive at 3 months, a chest radiograph will be evaluated, and antibiotherapy will be initiated. o ANTIBIOTHERAPY: if the strain to which the employee has been exposed is known to be (or likely to be) Isoniazid (INH)-sensitive, treatment will probably include a 6-month regimen of INH; a strain known to be INH-resistant will probably be treated with Rifampin; strains known to be Multiple Drug Resistant M. tuberculosis will probably be treated with a combination of drugs of the physicians’ choice (e.g. pyrazinamide, afloxacin, etc.).

10.2. BURULI ULCER – Mycobacterium ulcerans 10.2.1. INFECTION AND TRANSMISSION • Buruli ulcer is a progressive necrotizing cutaneous disease caused by infection with Mycobacterium ulcerans. This disease is closely related with the low temperature requirement of M. ulcerans (30-33ºC), which favors the development of cutaneous lesions; with its slow growth rate that translates into slowly progressing lesions; and, most importantly, with the secretion of a lipidic exotoxin known as mycolactone, which is responsible for the induction of cell death and tissue necrosis. • Exactly how M. ulcerans is introduced into the skin of humans still remains unknown, but unlike tuberculosis or leprosy, the infection is acquired from the environment and not from contact with other patients. An important mode of transmission is thought to be mediated by traumatic introduction of M. ulcerans into the subcutaneous tissue from superficially contaminated skin or by inoculation of the mycobacterium through minor penetrating injuries when in direct contact with mycobacteria-contaminated environments. Another proposed mode of transmission involves insects. Since the initial detection of M. ulcerans DNA in Naucoridae and Belostomatidae from Benin, aquatic insects have been suspected to play a role in transmission. However, whether insects transmit M. ulcerans to humans; are passive reservoirs; or just indicate its presence in the environment has yet to be definitively established.

10.2.2. GLOBAL AND REGIONAL INCIDENCE • Since its first description in 1948, Buruli ulcer has been reported in over 30 countries of Africa, Australia, Southeast Asia, central Pacific and Latin America; however, it is in Africa that the highest incidence rates are reported. Although BU remains the third most common mycobacterial disease worldwide, exceeded only by tuberculosis and leprosy, specific information on its global prevalence and distribution is scarce. Despite this underreporting, the existing data highlight a highly focalized distribution of the disease within endemic areas and an overall underestimation of its impact.

114 V1.8|13.05.2020

10.2.3. CLINICAL FORMS AND SYMPTOMS • Early presentations of active Buruli ulcer usually include nonulcerative nodules or papules. The initial indolent nature of these lesions often results in a delay in health-care seeking, and if left untreated, lesions can evolve into more severe clinical forms, namely nonulcerative plaques with large indurated areas; edematous forms with extensive and diffuse swelling of the affected area; or ulcers with necrosis of the overlying skin, undermined edges, and a necrotic sloughed center. In the most extreme cases, M. ulcerans may also invade bone either by contiguous spreading or by lymphatic or hematogenous dissemination.

10.2.4. PREVENTION AND TREATMENT • To date, there is no specific vaccine against M. ulcerans infection, but evidence in the literature has suggested a cross-reactive protective effect of the BCG vaccine, conferring a significant but short-lived protection against new lesions • Until recently, treatment for Buruli ulcer has relied on surgery. The surgical procedure involves the removal of all necrotic tissue with excision extending into healthy tissue, so as to prevent persistent subcutaneous infection from residual bacilli, followed by primary closure or skin grafting. • Efforts have been made towards the development of an effective drug treatment that could limit the spread of ulceration and consequently decrease the extent of surgery. Based on a preliminary clinical trial, the WHO Advisory Committee issued provisional guidelines recommending the daily intramuscular injection of streptomycin and the oral administration rifampicin for 8 weeks, as the first-line treatment for all forms of M. ulcerans disease, with or without additional surgical debridement or skin grafting.

10.2.5. MEDICAL EVALUATION • Medical evaluation and treatment for a person exposed to M. ulcerans will include the following (puncture wounds are considered extremely serious): o MONITORING: Given the inexistence of a specific diagnostic test for Buruli ulcer, the punctured wound should be monitored during the next six months for changes. If signs of disease are observed, the prophylactic treatment should be started. o CHEMICAL PROPHYLAXIS: treatment will probably include a daily 8-12 week regimen of oral Rifampicin (10 mg/kg body weight) and intramuscular streptomycin (15 mg/kg body weight). If antibiotic treatment fails, surgical intervention of the affected area should be carried out.

10.3. PARACOCCIDIOIDOMYCOSIS – Paracoccidioides brasiliensis 10.3.1. INFECTION AND TRANSMISSION • The pathogenic dimorphic fungi Paracoccidioides brasiliensis is the etiologic agent of the systemic mycosis known as paracoccidioidomycosis. P. brasiliensis is characterized by an in vivo transformation from a mycelia phase (non pathogenic) at room temperature to a yeast form (pathogenic) at 37ºC.

115 V1.8|13.05.2020

• P. brasiliensis capacity to alternate between the 2 morphologic forms, depending on temperature requirements, is closely related with its virulence. Another important pathogenicity factor includes extracellular components, synthesized during the yeast form, that interact with the host immune system. • Curiously, paracoccidioidomycosis occurs in a higher frequency in adult men than in women, with ratios man:woman reaching values of 78:1. This discrepancy suggests the involvement of hormonal regulation in the pathogenic mechanisms of P. brasiliensis.

10.3.2. GLOBAL AND REGIONAL INCIDENCE • This pathology has a particular importance in Latin America, with increased incidence in Brazil (80% of the cases), Colombia and Venezuela. Epidemiological studies indicate that in endemic areas, approximately 10 million individuals may present some form of clinical infection. 10.3.3. CLINICAL FORMS AND SYMPTOMS • Regarding the infectious form of the microrganism, it is thought that, given the appropriate environmental conditions, the formation of conidia can occur. The small size of the conidia (5um) favors aerosol infection and can reach the distal areas of the lung. Once in the lung, the morphologic transition to yeast occurs, leading to progressive disease that can disseminate to other organs or not. • There are 2 main clinical forms of paracoccidiodomycosis: acute form (juvenile) and chronic form (adult). • The adult form comprises more that 90% of the clinical cases (in individuals between 30-60 years old). This form of the disease evolves progressively and slowly, mainly affecting the lungs, which results in high morbidity. In addition, infection can disseminate to other organs/tissues and lead to ulceration of the mucosa. • On the other hand, the juvenile form is characterized by a much quicker and severe progression, resulting in an increased mortality rate due to hypertrophy of the reticuloendothelial system. • Regardless the clinical form or the affected organ, the treatment of this mycosis is normally associated with the formation of fibrotic sequelae, one of the main factors that diminish the quality of life of the affected individuals. • It is important to highlight that paracoccidiodomycosis is not contagious.

10.3.4. PREVENTION AND TREATMENT • Treatment for P. brasiliensis infection is normally prolonged and in some cases therapy may take as long as 1- 2 years. Without treatment, paracoccidiodomycosis is fatal. Currently, cetaconazole and itraconazol are the drugs of choice for the treatment of this systemic mycosis. Although the treatment is characterized by a high success rate, infection may reappear after a prolonged period of dormancy.

10.3.5. MEDICAL EVALUATION • Medical evaluation and treatment for a person exposed to P. brasiliensis will include the following (puncture wound or ingestion exposure routes are not as serious as aerosol exposure, but these would likely be treated in a similar manner): o MEDICAL MONITORING: the adequate protocol includes a general physical exam for the detection of specific symptoms of the disease and/or serologic detection of specific antibodies. 116 V1.8|13.05.2020

o CHEMICAL PROPHYLAXIS: Treatment for P. brasiliensis infection includes a 1-2 year regimen with cetaconazole and itraconazol.

11. IGRA FACT SHEET FOR WORKERS/VISITORS OF THE BSL-3 FACILITY • BSL-3 facility is used to conduct research on Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycobacterium avium and Paracoccidoides brasiliensis. Within the BSL-3 laboratories live cultures are present and every effort is made to prevent exposure to live organisms. • In addition to environmental control, all individuals who work in this facility are monitored for tuberculosis exposure by periodic IGRA testing. IGRA testing is performed at the Centro Diagnóstico Pneumológico de Braga. • This test only identifies tuberculosis infections and does not provide any protection against tuberculosis. The current surveillance program is not rendered ineffective due to prior BCG vaccination. • The IGRA assay used is the QuantiFERON-TB Gold test (QFT-G). QFT-G is a whole-blood test for use as an aid in diagnosing Mycobacterium tuberculosis infection, including latent tuberculosis infection and tuberculosis disease. o Blood samples are stimulated with mycobacterial antigens or controls. For QFT-G, the antigens include mixtures of synthetic peptides representing two M. tuberculosis proteins, ESAT-6 and CFP- 10. After incubation of the blood with antigens for 16 to 24 hours, the amount of IFN-gamma is measured. o If the patient is infected with M. tuberculosis, their lymphocytes will release IFN-gamma in response to contact with the M. tuberculosis antigens. The QFT-G results are based on the amount of IFN- gamma that is released in response to the antigens. o Clinical evaluation and additional tests, such as a chest radiograph, sputum smear, and culture, are needed to differentiate between a diagnosis of latent tuberculosis or active tuberculosis. • Advantages of the test: o Requires a single patient visit to draw a blood sample. o Results can be available within 24 hours. o Does not boost responses measured by subsequent tests, which can happen with tuberculin skin tests. o Is not subject to reader bias that can occur with tuberculin skin tests. o Is not affected by prior BCG (bacille Calmette-Guérin) vaccination. • Limitations of the test: o Blood samples must be processed within 12 hours after collection while lymphocytes are still viable. o Errors in collecting or transporting blood specimens or in running and interpreting the assay can decrease the accuracy of QFT-G. o False positive results can occur with Mycobacterium szulgai, Mycobacterium kansasii, and Mycobacterium marinum.

117 V1.8|13.05.2020

• A certificate of attendance will be issued pending the evaluation process, which includes a written exame and a hands-on evaluation of procedures. For the new users, authorized access to the BSL-3 facility is not automatic and must first follow a supervised trial period.

118 V1.8|13.05.2020

ANNEX 1: PROTOCOL SUBMISSION FORM

All research protocols for the use of new microrganisms, techniques and/or equipment in the BSL-2/BSL-3 facility must first be approved by the Biosafety Coordinators to guarantee that biosafety guidelines are followed. The protocol requires a written proposal submitted by the Principal Investigator, which describes all microrganisms/manipulations/operations involving BSL-2/BSL-3 agents required in the protocol.

Identification of the person applying for protocol authorization

Name

E-mail

Describe the biological agent to be used

Bacteria Virus Fungi Parasite

Species/Strain

BSL Classification *1

Describe in detail the protocol to be implemented, including inactivation procedures if required

119 V1.8|13.05.2020

ANNEX 2: PERSONNEL ACCESS FORM

No one, irrespective of their background and previous experience, will be permitted to work in the BSL-2 facility unsupervised before they have demonstrated a practical and theoretical knowledge of the procedures involved. This will invariably require: - an initial theoretical training course given by the Biosafety Coordinator, during which you will receive a copy of the Biosafety manual; - a period in which the trainee is required to observe an experienced BSL-2 worker carrying out experimental work; - a period in which the trainee is observed carrying out BSL-2 work by the mentor. Upon completion of the hands-on training period, the Biosafety Coordinator will receive a verbal assessment from the mentor. When the Biosafety Coordinator is satisfied with (i) the level of training, (ii) the care and competence demonstrated by the trainee, and (iii) the knowledge of the Biosafety Manual, the ICVS Biosafety Committee will endorse unsupervised access to the BSL-2 facilities.

Identification of the person applying for authorization to work in the BSL-2/BSL-3 facility

Name

Supervisor

e-mail

*1 According to Portaria nº 405/98 Describe the biological agents you are going to use

Bacteria Virus Fungi Parasite

Species/Strain

BSL Classification *1

1- ______(print name) has completed the required theoretical training course and has received the Biosafety Manual.

______(signature/date)

2- Authorization to enter the BSL-2 facilities ______(Biosafety Coordinator signature/date)

120 V1.8|13.05.2020

ANNEX 3: INCIDENT REPORT FORM

Any incidents involving potential exposure to microrganisms or improper use of the BSL-2 facility must be reported immediately to the BSL-2 Coordinators and an incident report must be filled out.

Name of people involved

Date/Time

Laboratory (room #)

Nature of incident Spill Cuts/NeedleS Bites/Scratches Others______

Biological agent Bacteria Virus Fungi Parasite

Species/Strain

BSL classification

Description of the incident

(please provide a thorough description of the incident and include any additional information you think is relevant)

Description of the actions implemented after the incident

121 V1.8|13.05.2020

7. University of Minho Contingency Plan

Plano de Contingência – Vol. 1: Azurém e Gualtar Versão 1.1

5 de março de 2020

122 V1.8|13.05.2020

1. Introdução

O presente Plano descreve os procedimentos a adotar perante docentes, estudantes, investigadores, “trabalhadores, técnicos, administrativos e de gestão” e aqueles que, por motivos profissionais ou outros, se desloquem às instalações da Universidade do Minho – doravante designados genericamente por Trabalhador com Sintomas (caso suspeito de infeção pelo novo Coronavírus SARS-CoV-2, agente causal da COVID-19). Este Plano pode ser atualizado a qualquer momento, tendo em conta a evolução do quadro epidemiológico da COVID-19. As situações não previstas neste Plano devem ser avaliadas caso a caso pela Comissão de Elaboração e Gestão do Plano de Contingência Interno COVID-19 da Universidade do Minho, nomeada pelo Despacho RT-21/2020. A definição apresentada na tabela 1 é baseada na informação disponível, à data, no Centro Europeu de Prevenção e Controlo de Doença Transmissíveis (ECDC), e é a adotada pela Universidade do Minho.

Tabela 1. Critérios clínicos e critérios epidemiológicos.

Critérios clínicos Critérios epidemiológicos

História de viagem para áreas com transmissão comunitária ativa1 nos 14 dias antes do início de Infeção respiratória sintomas. aguda (febre ou tosse ou ou dificuldade e Contacto com caso confirmado ou provável de infeção por SARS-CoV-2/COVID-19, nos 14 dias antes respiratória) do início dos sintomas. requerendo ou não ou hospitalização. Profissional de saúde ou pessoa que tenha estado numa instituição de saúde onde são tratados doentes com COVID-19.

Caso apareça algum dos sintomas referidos (no próprio ou nos seus conviventes), não se desloque à Universidade do Minho nem aos serviços de saúde, mas ligue para a linha Saúde 24 (808 24 24 24). Siga as orientações que lhe forem transmitidas e informe a sua chefia direta (ver Anexo I).

2. Procedimentos específicos

1 Consulte a informação atualizada das áreas afetadas pelo COVID-19 em https://www.dgs.pt/corona-virus.aspx

123 V1.8|13.05.2020

Este plano define os seguintes procedimentos: − Procedimentos perante um Caso Suspeito (ponto 8); − Procedimentos perante um Caso Suspeito Validado (ponto 9); − Procedimento de Vigilância de Contactos Próximos (ponto 10); − Processo de Alerta e Comunicação Interna (ponto 11); − Processo de Registo de Contactos com o Caso Suspeito (ponto 12).

3. Responsabilidades

Principais responsabilidades inerentes a este plano:

− Todos os trabalhadores devem reportar à sua chefia direta (ver Anexo I) uma situação de doença enquadrada como trabalhador com sintomas e ligação epidemiológica compatíveis com a definição de caso possível de COVID-19 (Trabalhador com Sintomas). Em caso de impedimento por isolamento ou internamento de algum elemento de chefia direta o Anexo I será devidamente atualizado identificando essa exceção; − Sempre que for reportada uma situação de Trabalhador com Sintomas, a chefia direta do trabalhador informa, de imediato, a Linha COVID-19 - UMinho (253 601 601) e a Segurança do respetivo campus (Azurém: 253 510 603; Gualtar 253 604 135); − A segurança informa qual a área de isolamento mais próxima disponível bem como o respetivo circuito para a ela aceder e acompanha o Trabalhador com Sintomas no percurso. Deverá isolar a área, e oportunamente, se necessário, encaminhar e acompanhar o INEM até à área de isolamento; − A chefia direta indica um trabalhador que preste assistência telefónica ao Trabalhador com Sintomas durante o período de isolamento. Por defeito considerar-se-á o trabalhador indicado no Anexo II.

4. Áreas de “isolamento” e circuitos até às mesmas

A colocação de um Trabalhador com Sintomas numa área de “isolamento” visa impedir que outros trabalhadores possam ser expostos e infetados. Tem como principal objetivo evitar a propagação da doença transmissível na Universidade do Minho e na comunidade. As áreas de “isolamento” têm como finalidade evitar ou restringir o contacto direto dos trabalhadores com o trabalhador doente (com sinais e sintomas e ligação epidemiológica compatíveis com a definição de caso suspeito, critérios referidos no ponto 1) e permitir um distanciamento social deste, relativamente aos restantes trabalhadores. As áreas de “isolamento” têm ventilação natural, ou sistemas de ventilação mecânica, e possuem revestimentos lisos e laváveis. Estas áreas estão equipadas com: telefone; cadeira ou marquesa (para descanso e conforto do Trabalhador com Sintomas, enquanto aguarda a validação de caso e o eventual

124 V1.8|13.05.2020 transporte pelo INEM); kit com água e alguns alimentos não perecíveis; contentor de resíduos (com abertura não manual e saco de plástico); solução antisséptica de base alcoólica (disponível no interior e à entrada desta área); toalhetes de papel; máscara(s) cirúrgica(s); luvas descartáveis; termómetro. Nestas áreas, ou próximo destas, deve existir uma instalação sanitária devidamente equipada, nomeadamente com doseador de sabão e toalhetes de papel, para a utilização exclusiva do Trabalhador com Sintomas. No Anexo III apresenta-se a localização das áreas de isolamento. Os seguranças conhecerão os circuitos a privilegiar quando um Trabalhador com Sintomas se dirige para uma área de “isolamento”. Na deslocação do Trabalhador com Sintomas, devem ser evitados os locais de maior aglomeração de pessoas/trabalhadores nas instalações.

5. Disponibilização de equipamentos e produtos

A Universidade do Minho compromete-se a disponibilizar os seguintes equipamentos e produtos:

− Solução antisséptica de base alcoólica em sítios estratégicos (ex. zona de refeições, registo biométrico, áreas de “isolamento”), conjuntamente com informação sobre os procedimentos de higienização das mãos; − Máscaras cirúrgicas para utilização do Trabalhador com Sintomas (caso suspeito); − Máscaras cirúrgicas e luvas descartáveis, a utilizar, enquanto medida de precaução, pelo(s) segurança(s) que acompanhe(m); − Toalhetes de papel para secagem das mãos, nas instalações sanitárias e noutros locais onde seja possível a higienização das mãos; − Contentor de resíduos com abertura não manual e saco plástico.

6. Informação e formação

A Universidade do Minho compromete-se a:

− Divulgar o Plano de Contingência específico a todos os trabalhadores, nomeadamente na página https://www.uminho.pt/PT/viver/COVID-19/; − Esclarecer os trabalhadores, mediante informação precisa e clara, sobre a COVID-19 de forma a, por um lado, evitar o medo e a ansiedade e, por outro, estes terem conhecimento das medidas de prevenção que devem instituir; − Informar e formar os trabalhadores quanto aos procedimentos específicos a adotar perante um caso suspeito.

125 V1.8|13.05.2020

7. Diligências a efetuar na presença de trabalhadores suspeitos de infeção por SARS-CoV-2

A Universidade do Minho compromete-se a:

− Acionar o Plano de Contingência para COVID-19; − Confirmar a efetiva implementação dos procedimentos específicos previstos no Plano de Contingência para COVID-19; − Procurar manter atualizada a informação sobre COVID-19, na página https://www.uminho.pt/PT/viver/COVID-19/, de acordo com o disponibilizado pela Direção-Geral da Saúde, Autoridade de Saúde Local e meios de comunicação oficiais.

8. Procedimentos num Caso Suspeito

No Anexo IV apresenta-se o fluxograma a seguir numa situação de Trabalhador com sintomas de COVID- 19. Neste ponto descreve-se os passos a seguir. Qualquer trabalhador com sinais e sintomas de COVID-19 e ligação epidemiológica, ou que identifique um trabalhador com critérios compatíveis com a definição de caso suspeito, informa preferencialmente por via telefónica a chefia direta (ver Anexo I). A chefia direta deve contactar, de imediato, a Linha COVID-19 - UMinho (253 601 601) e a Segurança do respetivo campus (Azurém: 253 510 603; Gualtar 253 604 135). A chefia direta indicará um trabalhador que preste assistência telefónica ao Trabalhador com Sintomas durante o período de isolamento. Por defeito considerar-se-á o trabalhador indicado no Anexo II. A segurança informa qual a área de isolamento mais próxima disponível bem como o respetivo circuito para a ela aceder e acompanha o Trabalhador com Sintomas no percurso. Sempre que possível deve-se assegurar a distância de segurança (superior a 1 metro) do doente. Deverá isolar a área e perante um caso suspeito validado deverá encaminhar e acompanhar o INEM até à área de isolamento. O(s) segurança(s) que acompanha(m)/presta(m) assistência ao Trabalhador com sintomas, deve(m) colocar, momentos antes de se iniciar esta assistência, uma máscara cirúrgica e luvas descartáveis, para além do cumprimento das precauções básicas de controlo de infeção quanto à higiene das mãos, após contacto com o Trabalhador doente. O Trabalhador doente (caso suspeito de COVID-19) já na área de “isolamento”, contacta o SNS 24 (808 24 24 24). Este trabalhador deve usar uma máscara cirúrgica, se a sua condição clínica o permitir. A máscara deverá ser colocada pelo próprio trabalhador. Deve ser verificado se a máscara se encontra bem ajustada (ou seja: ajustamento da máscara à face, de modo a permitir a oclusão completa do nariz, boca e áreas laterais da face. Em homens com barba, poderá ser feita uma adaptação a esta medida - máscara cirúrgica 126 V1.8|13.05.2020 complementada com um lenço de papel). Sempre que a máscara estiver húmida, o trabalhador deve substituí-la por outra. O profissional de saúde do SNS 24 questiona o Trabalhador doente quanto a sinais e sintomas e ligação epidemiológica compatíveis com um caso suspeito de COVID-19. Após avaliação, o SNS 24 informa o Trabalhador: − Se não se tratar de caso suspeito de COVID-19: define os procedimentos adequados à situação clínica do trabalhador; − Se se tratar de caso suspeito de COVID-19: o SNS 24 contacta a Linha de Apoio ao Médico, da Direção- Geral da Saúde, para validação da suspeição. Desta validação o resultado poderá ser: − Caso Suspeito Não Validado, este fica encerrado para COVID-19. O SNS 24 define os procedimentos habituais e adequados à situação clínica do trabalhador. O trabalhador informa a chefia direta da não validação. − Caso Suspeito Validado, a DGS ativa o INEM, o INSA e Autoridade de Saúde Regional, iniciando-se a investigação epidemiológica e a gestão de contactos. A chefia direta do Trabalhador informa o empregador da existência de um caso suspeito validado na Universidade do Minho. Na situação de Caso suspeito validado: − O trabalhador doente deverá permanecer na área de “isolamento” (com máscara cirúrgica, desde que a sua condição clínica o permita), até à chegada da equipa do Instituto Nacional de Emergência Médica (INEM), ativada pela DGS, que assegura o transporte para o Hospital de referência, onde serão colhidas as amostras biológicas para testes laboratoriais; − O acesso dos outros trabalhadores à área de “isolamento” fica interditado, exceto aos trabalhadores designados para prestar assistência (ver anexo II); − A Universidade do Minho colabora com a Autoridade de Saúde Local na identificação dos contactos próximos do doente (Caso suspeito validado); − A Universidade do Minho informa os restantes trabalhadores da existência de Caso suspeito validado, a aguardar resultados de testes laboratoriais, mediante os procedimentos de comunicação estabelecidos no Plano de Contingência. O Caso suspeito validado deve permanecer na área de “isolamento” até à chegada da equipa do INEM ativada pela DGS, de forma a restringir, ao mínimo indispensável, o contacto deste trabalhador com outro(s) trabalhador(es). Devem-se evitar deslocações adicionais do Caso suspeito validado nas instalações da Universidade do Minho.

9. Procedimentos perante um Caso Suspeito Validado

A DGS informa a Autoridade de Saúde Regional dos resultados laboratoriais, que por sua vez informa a Autoridade de Saúde Local. A Autoridade de Saúde Local informa a Universidade do Minho dos resultados dos testes laboratoriais e: 127 V1.8|13.05.2020

− Se o Caso for infirmado, este fica encerrado para COVID-19, sendo aplicados os procedimentos habituais da Universidade do Minho, incluindo de limpeza e desinfeção; − Se o Caso for confirmado, a área de “isolamento” deve ficar interditada até à validação da descontaminação (limpeza e desinfeção) pela Autoridade de Saúde Local. Esta interdição só poderá ser levantada pela Autoridade de Saúde.

Na situação de Caso confirmado: − A Universidade do Minho deve:

▪ Providenciar a limpeza e desinfeção (descontaminação) da área de “isolamento”;

▪ Reforçar a limpeza e desinfeção, principalmente nas superfícies frequentemente manuseadas e mais utilizadas pelo doente confirmado, com maior probabilidade de estarem contaminadas. Dar especial atenção à limpeza e desinfeção do posto de trabalho do doente confirmado (incluindo materiais e equipamentos utilizados por este);

▪ Armazenar os resíduos do Caso Confirmado em saco de plástico (com espessura de 50 ou 70 mícron) que, após ser fechado (ex. com abraçadeira), deve ser segregado e enviado para operador licenciado para a gestão de resíduos hospitalares com risco biológico.

▪ A Autoridade de Saúde Local, em estreita articulação com o médico do trabalho, comunica à DGS informações sobre as medidas implementadas na Universidade do Minho, e sobre o estado de saúde dos contactos próximos do doente.

10. Procedimento de vigilância de contactos próximos

Considera-se “contacto próximo” um trabalhador que não apresenta sintomas no momento, mas que teve ou pode ter tido contacto com um caso confirmado de COVID-19. O tipo de exposição do contacto próximo, determinará o tipo de vigilância (Anexo V). O contacto próximo com caso confirmado de COVID-19 pode ser de: − “Alto risco de exposição”, é definido como:

▪ Trabalhador do mesmo posto de trabalho (gabinete, sala, secção, zona até 2 metros) do Caso;

▪ Trabalhador que esteve face-a-face com o Caso Confirmado ou que esteve com este em espaço fechado;

▪ Trabalhador que partilhou com o Caso Confirmado loiça (pratos, copos, talheres), toalhas ou outros objetos ou equipamentos que possam estar contaminados com expetoração, sangue, gotículas respiratórias. − “Baixo risco de exposição” (casual), é definido como:

▪ Trabalhador que teve contacto esporádico (momentâneo) com o Caso Confirmado (ex. em movimento/circulação durante o qual houve exposição a gotículas/secreções respiratórias através de conversa face-a-face superior a 15 minutos, tosse ou espirro).

▪ Trabalhador(es) que prestou(aram) assistência ao Caso Confirmado, desde que tenha(m) seguido as medidas de prevenção (ex. utilização adequada da máscara e luvas; etiqueta respiratória; higiene das mãos).

128 V1.8|13.05.2020

Perante um Caso Confirmado por COVID-19, além do referido anteriormente, deverão ser ativados os procedimentos de vigilância ativa dos contactos próximos, relativamente ao início de sintomatologia. Para efeitos de gestão dos contactos a Autoridade de Saúde Local, em estreita articulação com a Universidade do Minho, deve: − Identificar, listar e classificar os contactos próximos (incluindo os casuais); − Proceder ao necessário acompanhamento dos contactos (telefonar diariamente, informar, aconselhar e referenciar, se necessário). O período de incubação estimado da COVID-19 é de 2 a 12 dias. Como medida de precaução, a vigilância ativa dos contactos próximos decorre durante 14 dias desde a data da última exposição a caso confirmado. A vigilância de contactos próximos deve ser a apresentada na tabela 2.

Tabela 2. Vigilância de contactos próximos.

“Alto risco de exposição” “Baixo risco de exposição” − Monitorização ativa pela Autoridade de Saúde Local durante 14 dias desde a última exposição; − Auto monitorização diária dos sintomas da COVID-19, incluindo − Auto monitorização diária dos sintomas febre, tosse ou dificuldade em respirar; da COVID-19, incluindo febre, tosse ou dificuldade em respirar; − Restringir o contacto social ao indispensável; − Acompanhamento da situação pelo − Evitar viajar; médico do trabalho. − Estar contactável para monitorização ativa durante os 14 dias desde a data da última exposição.

129 V1.8|13.05.2020

De referir que: − A auto monitorização diária, feita pelo próprio trabalhador, visa a avaliação da febre (medir a temperatura corporal duas vezes por dia e registar o valor e a hora de medição) e a verificação de tosse ou dificuldade em respirar; − Se se verificarem sintomas da COVID-19 e o trabalhador estiver na Universidade do Minho, devem-se iniciar os “Procedimentos num Caso Suspeito”, estabelecidos no ponto 8; − Se nenhum sintoma surgir nos 14 dias decorrentes da última exposição, a situação fica encerrada para COVID-19.

11. Processo de alerta e comunicação interna

Quaisquer novas instruções aplicáveis à Administração Pública, em geral, ou às Instituições de Ensino Superior Publico e à Universidade do Minho, em particular, serão imediatamente comunicadas à comunidade académica, nomeadamente através da página https://www.uminho.pt/PT/viver/COVID-19/.

12. Processo de registo de contactos com o Caso Suspeito

O registo de contactos com o Caso Suspeito deverão ser efetuados no formulário que se apresenta no Anexo VI.

130 V1.8|13.05.2020

Anexo I

Chefias Diretas

Trabalhador Investigador Docente Estudante Reitoria Reitor Serviços Diretor Serviços de Ação Social Administrador Unidades de Interface Diretor Centros de Investigação Diretor Diretor Unidades Orgânicas sem Presidente do Presidente Presidente Presidente Departamentos Conselho Pedagógico Unidades Orgânicas com Diretor Diretor Diretor Diretor de Curso Departamentos

131 V1.8|13.05.2020

Anexo II

Trabalhadores que prestam apoio a Trabalhadores com Sintomas

Trabalhador Investigador Docente Estudante Reitoria Chefe de Gabinete Serviços Chefe de Divisão Serviços de Ação Social Diretor de Departamento Unidades de Interface Secretário Secretário de Secretário de Centros de Investigação Escola Escola Unidades Orgânicas sem Secretário de Secretário de Secretário de Secretário de Departamentos Escola Escola Escola Escola Unidades Orgânicas com Secretário do Secretário do Secretário do Secretário do Departamentos Departamento Departamento Departamento Departamento

132 V1.8|13.05.2020

Anexo III

Áreas de Isolamento

Campus de Azurém

133 V1.8|13.05.2020

Campus de Gualtar

Anexo IV

134 V1.8|13.05.2020

Fluxograma de situação de Trabalhador com sintomas de COVID-19

Trabalhador com sintomas

Trabalhador informa chefia direta

Chefia direta contacta o 253 601 601 e a Segurança do Campus

Segurança identifica a área de “isolamento” e circuito

Segurança acompanha o trabalhador com sintomas à área de “isolamento

Trabalhador contacta SNS 24 (808 24 24 24)

SNS 24 questiona o trabalhador

Caso não suspeito Caso suspeito

SNS 24 adota o SNS 24 contacta Linha Apoio procedimento de acordo com ao Médico a situação clínica

135 V1.8|13.05.2020 A

Caso Suspeito Não Validado Caso Suspeito Validado

Trabalhador informa a chefia INEM transporta Trabalhador Chefia direta informa 253 601 direta para Hospital de referência 601 do caso validado

Chefia direta informa o Colheita de amostras biológicas 253 601 601 no Hospital de referência

Universidade: Processo encerrado Caso Caso − Veda acesso à área de Infirmado Confirmado para COVID-19 isolamento − Colabora com Autoridade de Saúde Local de contactos próximos do SNS 24 define os Autoridade de trabalhador procedimentos adequados à Saúde Local Autoridade de − Informa os trabalhadores situação clínica do informa a Saúde Local dos procedimentos Trabalhador Universidade informa a dos resultados Universidade laboratoriais dos resultados negativos laboratoriais positivos e procede à gestão de Processo contactos encerrado para COVID-19

Universidade providencia a limpeza e desinfeção da área de “isolamento”

Autoridade de Saúde Local levanta interdição após descontaminação

Autoridade de Saúde Local informa a DGS das medidas implementadas136 V1.8|13.05.2020

Anexo V

Fluxograma de monitorização dos contactos próximos (trabalhadores assintomáticos) de um

Caso confirmado de COVID-19 (trabalhador)

Trabalhador assintomático

Tipo de exposição

Baixo risco de Alto risco de exposição exposição

Auto monitorização diária dos sintomas − Monitorização ativa pela Autoridade de Saúde Local durante 14 dias desde de COVID-19, última exposição. incluindo febre, tosse − Auto monitorização diária dos ou dificuldade em sintomas da COVID-19, incluindo respirar. febre, tosse ou dificuldade em respirar. − Restringir o contacto social ao indispensável. − Evitar viajar. − Estar contactável para monitorização ativa durante 14 dias desde a exposição.

Tem sintomas de COVID-19?

Sim Não

Procedimentos de “Caso Situação encerrada para Suspeito” COVID-19 137 V1.8|13.05.2020

Anexo VI

Formulário de registo de contactos com o Caso Suspeito

REGISTO DOS TRABALHADORES EXPOSTOS COM EQUIPAMENTO DE PROTEÇÃO INDIVIDUAL ADEQUADO

Serviço / Unidade: ______Data: ___/_____/______

Nome N.º Mec. Procedimentos Realizados

IDENTIFICAÇÃO DOS TRABALHADORES EXPOSTOS SEM EQUIPAMENTO DE PROTEÇÃO INDIVIDUAL ADEQUADO

138 V1.8|13.05.2020

Serviço / Unidade: ______Data: ___/_____/______

Categoria Data do Hora do Nome N.º Mec. Morada Telefone Profissional Contacto Contacto ___/___/___

___/___/___

139 V1.8|13.05.2020

Anexo VII

Serviços Imprescindíveis na Escola de Medicina

Atendendo à especificidade de algumas das atividades desenvolvidas na Escola de Medicina e no seu laboratório de investigação (ICVS) definem-se as funções que têm que ser asseguradas em situação de elevação do nível do Plano de Contingência e encerramento total do edifício.

Assim, definem-se como serviços imprescindíveis:

Unidade Serviços Número de Trabalhadores (Horas/dia por trabalhador) Unidade de Biotério 1. Colocação de água e dieta 5 trabalhadores (5 horas) 2. Higiene de gaiolas e jaulas (incluindo esterilização) 3. Vigilância de bem-estar animal 4. Desmame de colónias de roedores 5. Reparação de equipamentos essenciais Unidade 1. Receção de encomendas imprescindíveis 1 trabalhador (1 hora) Laboratorial para a manutenção da cultura de células e amostras biológicas e outro material imprescindível ao funcionamento do Biotério 2. Monitorização da qualidade da coleção de amostras biológicas humanas não substituíveis 3. Reparação de equipamentos essenciais

140 V1.8|13.05.2020