Intestinal Bile Acids Directly Modulate the Structure and Function of C

Intestinal bile acids directly modulate the structure and function of C. difficile TcdB toxin

John Tama, Simoun Ichoa,b, Evelyn Utamaa,b, Kathleen E. Orrellb, Rodolfo F. Gómez-Biagia,c, Casey M. Theriotd, Heather K. Krohe, Stacey A. Rutherforde, D. Borden Lacye, and Roman A. Melnyka,b,c,1

aMolecular Medicine, Research Institute, The Hospital for Sick Children, Toronto, ON M5G 0A4, Canada; bDepartment of Biochemistry, University of Toronto, Toronto, ON M5S 1A8, Canada; cSickKids Proteomics Analytics Robotics Chemical Biology Drug Discovery Facility, Research Institute, Hospital for Sick Children, Toronto, ON M5G 0A4, Canada; dDepartment of Population Health and Pathobiology, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27606; and eDepartment of Pathology, Microbiology, and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232

Edited by John Collier, Harvard Medical School, Boston, MA, and approved February 13, 2020 (received for review September 29, 2019) Intestinal bile acids are known to modulate the germination and C. difficile has been observed, particularly in hospitals and growth of Clostridioides difficile. Here we describe a role for in- healthcare settings (18–20). Though it is not known what factors testinal bile acids in directly binding and neutralizing TcdB toxin, are responsible for rendering an individual susceptible to infection the primary determinant of C. difficile disease. We show that in- and disease by C. difficile, several studies have shown that individual primary and secondary bile acids reversibly bind and intestinal bile acids play a role in modulating various aspects of the hibit TcdB to varying degrees through a mechanism that requires C. difficile lifecycle. For instance, it has been established that the the combined oligopeptide repeats region to which no function primary bile acid taurocholic acid and other cholic acid derivatives has previously been ascribed. We find that bile acids induce TcdB trigger germination of C. difficile spores into their toxin-producing “ ” into a compact balled up conformation that is no longer able to vegetative state via the germinant receptor CspC (21–23), whereas bind cell surface receptors. Lastly, through a high-throughput screen chenodeoxycholate derivatives and other secondary bile acids designed to identify bile acid mimetics we uncovered nonsteroidal inhibit cholate-induced germination (22, 24). Moreover, the small molecule scaffolds that bind and inhibit TcdB through a bile microbial-derived secondary bile acids, including deoxycholic acid acid-like mechanism. In addition to suggesting a role for bile acids in and lithocholic acid, are able to inhibit growth of C. difficile (25). C. difficile pathogenesis, these findings provide a framework for development of a mechanistic class of C. difficile antitoxins. In a recent study investigating the gut metabolome in mice before and after antibiotic exposure, it was shown that C. difficile bacte- C. difficile | toxin | bile acid | pathogenesis | structure rium can exploit specific metabolites that become more abundant in the mouse gut after antibiotics, including the primary bile acid taurocholate for spore germination (26). Further, in a landmark lostridioides difficile is the most frequent cause of infectious study, Buffie et al. were able to pinpoint the single bacterium, Cdiarrhea in hospitals and has emerged as a major public-health Clostridium scindens, which they showed enhances resistance concern in recent decades (1). Antibiotic-induced disruption of the protective gut microbiota triggers C. difficile infections (CDIs) by to C. difficile infection by producing key bile acids that directly creating an environment in the gut that enables C. difficile germi- inhibit C. difficile outgrowth (27). Finally, a recent study showed nation and growth. Virulent strains of C. difficile produce protein differences in bile acid composition between asymptomatic car- toxins that are responsible for the clinical symptoms of disease, riers of C. difficile and patients with CDI (28). Taken together, which can range from self-limiting diarrhea to pseudomembranous these studies highlight a complex interplay between C. difficile and colitis, and potentially death in severe cases (2). In particular, the homologous toxins TcdA and TcdB produced by pathogenic Significance strains of C. difficile are capable of causing disease in animal models (3), with TcdB appearing to be the primary determinant of Clostridioides difficile is a bacterial pathogen of global impor- disease in humans (4). TcdA and TcdB are large homologous tance that is a major cause of hospital-acquired diarrhea. toxins (sharing 48% sequence identity) with similar multidomain Antibiotic-mediated disruptions to the gut microbiota and as- architectures consisting of a glucosyltransferase domain (GTD), sociated metabolome promote C. difficile growth and infection an autoprocessing domain (APD), a translocation domain, and a through mechanisms that are poorly understood. Here, we C-terminal domain consisting of oligopeptide repeats, known as show that intestinal bile acids, which are known to play a role the CROP domain (5). After binding to their cell surface recep- in C. difficile germination and outgrowth, also directly bind and tors (6–9), TcdA and TcdB are internalized into acidified endo- inhibit TcdB toxin, the primary virulence determinant of somes, whereupon the central translocation domain forms C. difficile. Bile acid binding induces a major conformational transmembrane pores that are thought to mediate entry of the change in TcdB structure that prevents receptor binding and upstream GTD and APD into the cytosol (10). Processed and uptake into cells. In addition to suggesting a role for bile acids released GTD enzymatically glucosylates, and thereby inactivate in protecting against C. difficile pathogenesis, these findings intracellular Rho and Ras family GTPases (11, 12), leading first to highlight an approach to block C. difficile virulence. cytopathic effects (i.e., cell rounding) (13), and later cytotoxic effects (i.e., apoptosis and necrosis) (14, 15). Blocking the actions Author contributions: J.T., C.M.T., D.B.L., and R.A.M. designed research; J.T., S.I., E.U., of TcdB has emerged as a promising nonantibiotic-based strategy K.E.O., H.K.K., and S.A.R. performed research; J.T., R.F.G.-B., C.M.T., H.K.K., S.A.R., to treat CDI in recent years. Indeed, bezlotoxumab, a monoclonal D.B.L., and R.A.M. analyzed data; and J.T. and R.A.M. wrote the paper. antibody against TcdB, was recently approved for recurrent CDI The authors declare no competing interest. prevention in adults (4), and small molecules blocking TcdB ac- This article is a PNAS Direct Submission. tion have shown efficacy in preventing CDI in preclinical animal Published under the PNAS license. models (16, 17). 1To whom correspondence may be addressed. Email: [email protected]. Although toxins are responsible for symptomatic CDI, the mere This article contains supporting information online at https://www.pnas.org/lookup/suppl/ presence of toxigenic C. difficile in an individual, however, does doi:10.1073/pnas.1916965117/-/DCSupplemental. not portend disease. Indeed, asymptomatic carriage of toxigenic First published March 9, 2020.

6792–6800 | PNAS | March 24, 2020 | vol. 117 | no. 12 www.pnas.org/cgi/doi/10.1073/pnas.1916965117 Downloaded by guest on October 2, 2021 the host, which is dictated by the host-produced and microbiota- are more potent than the corresponding α7-hydroxylated primary modified bile acid composition. bile acids TCDCA, glycocholic acid (GCA), and taurocholic acid In this study, we describe an entirely unexpected role for bile (31), respectively. The binding site in TcdB can accommodate and acids in the C. difficile lifecycle as directly binding to and tolerate substitutions at R2 while the degree of hydroxylation at α7 inhibiting toxin uptake into cells. This work stems from a recent and α12, which lie on the “alpha face” of bile acids, is important high-throughput phenotypic screen that we conducted to identify for the binding interaction (SI Appendix,Fig.S1). The complete small molecules that prevent TcdB-induced toxicity, where methyl lack of binding of TcdB to dehydrocholic acid (dCA or dehydrocholate—a synthetic methyl ester of cholic acid—was among the CA), oxidized at α3, α7, and α12, however, confirms that the ox- handful of hits in the primary screen that protected cells from idation state at these positions, and likely the stereochemistry of TcdB (29). Given that bile acids are abundant in the gut lumen the bile acid ring system, is important for binding. where C. difficile and its toxins act, we hypothesized that bile acids To evaluate the extent of protection by bile acids across a may, in addition to playing a role in spore germination and bac- range of different concentrations of TcdB that might be experi- terial viability, play a role in modulating virulence and therefore enced during an infection, cells were treated with a broad range disease. To explore the biological and therapeutic significance of TcdB concentrations at different fixed doses of TCDCA—a of this work we set out here to uncover the effects of natural highly soluble prototypic bile acid. In the absence of drug, TcdB bile acids on toxin pathogenesis and define the mechanism of dose-dependently rounds cells with an EC50 = 0.6 pM (Fig. 1D). inhibition. With increasing concentrations of TCDCA, the amount of TcdB required to reach equivalent levels of rounding increases and Results progressively shifts the dose–response curve to the right in ac- Primary and Secondary Bile Acids Bind TcdB and Inhibit Cellular cordance with the protection offered by bile acids (Fig. 1D). Intoxication. Building on our previous findings that a synthetic Finally, we tested the ability of TCDCA to protect human colonic bile acid derivative methyl cholate bound to and inhibited TcdB cells from TcdB, which compromises monolayer integrity and (29), we set out initially to evaluate whether and to what extent dissipates the transepithelial electrical resistance. TCDCA dose- each of the individual human intestinal bile acids are able to dependently resulted in complete protection that is equivalent to interact with and modulate the activity of TcdA and TcdB. To mock-treated cells (Fig. 1E). account for the fact that each of the individual human primary and secondary bile acids exist across a broad range of concen- The C-Terminal CROP Region Is Essential for Bile Acid Binding. In trations within the gastrointestinal tract, individual bile acids order to better understand the molecular determinants of bile and salts were evaluated over a range of concentrations that acid-induced neutralization of TcdB, we focused our attention MICROBIOLOGY encompassed physiological levels. To minimize any potential on where TcdA and TcdB diverge most in terms of sequence to artifacts that could arise due to nonspecific promiscuous effects narrow our search. The most striking differences are in the at higher concentrations of bile acids, care was taken to test all C-terminal combined repetitive oligopeptide repeats (CROP) bile acids well below their critical micelle concentrations (SI domains, where TcdB has fewer repeats than TcdA and shares Appendix, Table S1). Binding of each individual human bile acid only 38% sequence identity in the overlapping regions (SI Ap- to toxins was evaluated using differential scanning fluorimetry pendix, Fig. S2). To indirectly test the potential role of the CROP (DSF), which quantifies the denaturation temperature (T )of M in binding, we took advantage of the naturally “CROP-less” proteins. Binding of small molecule ligands to a defined site in a homolog TpeL from Clostridium perfringens (Fig. 2A). We ob- protein will often, but not always, stabilize the native state of a served no evidence of binding/stabilization of CROP-less TpeL target and lead to a measurable increase in the T (30). In par- M by TCDCA (Fig. 2 B, Inset), supporting a possible role for CROP allel, we evaluated the capacity of each bile acid to inhibit TcdA- in binding bile acids; however, based on this alone, we could not and TcdB-mediated intoxication of human IMR-90 fibroblast cells using an automated cell-rounding assay we developed previously exclude the possibility that other differences in the other three (29). The results for bile acid binding to and inhibition of TcdA domains could be involved in binding. To address this more di- and TcdB are summarized in Fig. 1A. rectly, we generated truncations within the TcdB CROP domain The most striking observation from this analysis is the differ- itself. Three C-terminal truncations were generated: TcdB1–2,283, ences between TcdA and TcdB with respect to binding and in- with 4 terminal repeats deleted; TcdB1–2,200, with 8 terminal hibition by bile acids. Whereas all bile acids tested showed evidence repeats deleted; and, TcdB1–2,101 with 12 terminal repeats de- of binding and inhibition of TcdB to varying extents, none inter- leted (Fig. 2A). Consistent with previous data showing that the acted with or inhibited TcdA (Fig. 1 A and B), suggesting that the terminal 15 repeats of TcdB could be removed without affecting bile acid binding site is either absent or inaccessible in TcdA (vide function (7), we found all three truncations generated here to be fully functional on cells (SI Appendix, Fig. S3A). infra). We also noted the concordance in binding EC50 (half maximal effective concentration) and inhibition of cell rounding To evaluate bile acid binding, DSF was used to determine the thermal stability of each truncation in the presence of TCDCA, IC50 (half maximal inhibitory concentration) values among the bile acids tested (Fig. 1A), indicating that binding and inhibition are initially. Whereas full-length TcdB displayed a dose-dependent coupled as exemplified clearly by taurochenodeoxycholic acid increase in thermal stability induced by TCDCA, we found that (TCDCA) (Fig. 1C). removing as few as four terminal repeats rendered TcdB insen- An examination of the differences in binding/inhibition of sitive to TCDCA. To corroborate these findings on cells, we TcdB by each of the individual bile acids reveals insights into the compared the ability of full-length TcdB and TcdB1–2,283 to be structure–activity relationship of different primary and secondary inhibited by a larger panel of inhibitory bile acids. Consistent bile acids. In general, it can be seen that secondary bile acids are with the binding data, none of the bile acids were able to block more potent than their corresponding primary bile acid precur- the action of TcdB1–2,283 (Fig. 2C). To show that TcdB1–2,283 was sors, which differ only by the presence of a hydroxyl group at otherwise sensitive to inhibition by other small molecule anti- the α7 position (Fig. 1A). For instance, the secondary bile acid toxins, we tested a panel of inhibitors of TcdB discovered pre- glycolithocholic acid (GLCA) is approximately an order of mag- viously (17, 29) that block TcdB intoxication through nonbile acid nitude more potent than its corresponding primary bile acid mechanisms on TcdB1–2,283 and found that these molecules glycochenodeoxycholic acid (GCDCA) with respect to binding retained the ability to inhibit truncated TcdB (SI Appendix,Fig. and inhibition of TcdB. Similarly, taurolithocholic acid (TLCA), S3B). These findings reveal an unexpected role for the CROP glycodeoxycholic (GDCA), and taurodeoxycholic acid (TDCA) domain in mediating the bile acid-induced neutralization of TcdB.

Tam et al. PNAS | March 24, 2020 | vol. 117 | no. 12 | 6793 Downloaded by guest on October 2, 2021 Fig. 1. Human bile acids binding and inhibition of TcdA and TcdB. (A) Structures of primary and secondary bile acids, and corresponding potency in the DSF

binding and cell rounding assays. Average binding EC50s were calculated from five to seven experiments. Average cell rounding IC50s were calculated from two to six biological replicates. n.d., not done. (B) Representative images of human IMR-90 fibroblasts from at least six biological replicates. Cells were treated with DMSO or TCDCA along with buffer or 0.5 pM TcdB (Left) or 1 nM TcdA (Right) and images were collected 3.5 h later. (Scale bars, 100 μm.) (C) Titration curves of TCDCA by DSF and cell rounding protection. Bars represent SEM of three biological replicates for DSF and seven biological replicates for cell rounding. (D) Intoxication of human IMR-90 cells by TcdB in the presence of different doses of TCDCA after 3.5 h. Protection factor, PF, represents the extent

to which TCDCA shifts the curve for TcdB (i.e., EC50TCDCA/EC50vehicle). Representative graph from four experiments. (E) Normalized transepithelial resistance measurements in human Caco-2 cells, 3 to 6 h posttreatment. A total of 200 μM TCDCA significantly increased resistance across Caco-2 monolayer cells compared to mock control values (n = 5). Bars represent SEM of mean. ****P = 0.000001.

Bile Acid Binding Induces a Major Conformational Change in TcdB. N-terminal domains (Fig. 3A). Similarly, in the presence of That bile acids could so dramatically affect both the thermal dehydrocholate, which does not bind or inhibit TcdB, no notice- stability and function of TcdB was surprising and led us to hy- able structural changes in the toxin were seen. With increasing pothesize that bile acids may induce a large conformational concentrations of methyl cholate and TCDCA, however, TcdB change in TcdB upon binding that affects both its structure and adopts an increasingly “balled up” conformation, with the toxin function. To monitor whether any major structural changes were adopting an overall more compacted conformation. Quantifica- inducedbybileacids,TcdBwasincubatedwithincreasingamounts tion of the distribution of sizes of TcdB in the absence and pres- of two inhibitory bile acids (methyl cholate and TCDCA) and a ence of bile acid shows an average decrease of ∼100 Å in overall nonbinding bile acid control (dehydrocholate), and the result- size of TcdB upon binding to bile acids (Fig. 3B). ing samples were imaged by negative-stain electron microscopy. In Consistent with bile acids inducing a major conformational the absence of ligand, we see as reported in previous studies, that change in TcdB, we observed significant differences in the sus- the C-terminal CROP of TcdB adopts a variety of conforma- ceptibility of TcdB to proteolysis by trypsin when bound to the tions relative to the main body of the toxin made up of the three bile acid TCDCA. Incubation of TcdB with increasing amounts

6794 | www.pnas.org/cgi/doi/10.1073/pnas.1916965117 Tam et al. Downloaded by guest on October 2, 2021 Bile Acid Binding to TcdB Is Reversible. The observation in the above studies that TCDCA was no longer able to protect against TcdB-induced cell rounding following the dilution by 6,000-fold from the gel-based assay to the functional assay in the above experiments (SI Appendix, Fig. S4B) prompted us to probe more directly whether the bile acid–TcdB interaction was reversible. To this end, we evaluated the reversibility of binding of TCDCA to TcdB by comparing the melting temperature of TcdB in the presence of 500 μM TCDCA at levels where TcdB is complexed with bile acid and after a 10-fold dilution to levels where TCDCA is only partially bound, using previous titrations as a guide (Fig. 2B). As expected, addition of 500 μM TCDCA (i.e., 1× TCDCA) to either 185 nM or 1,850 nM TcdB resulted in a significant increase in the melting temperature of TcdB of ∼3°C to 4 °C (Fig. 3D). Following a 10-fold dilution of the [high TcdB + 500 μM] complex, we see a significant decrease in the melting temperature of TcdB, further demonstrating that bile acid–TcdB interaction is reversible (Fig. 3D).

Bile Acids Prevent TcdB from Binding to Cell Surface Receptors. The major changes in TcdB stability, protease susceptibility, and structure induced by bile acids very clearly alter the toxin in a way that inhibits its ability to intoxicate cells. To demonstrate the mechanism by which bile acids protect cells from intoxication by TcdB, we investigated the ability of TcdB to bind the cell surface when bound to the prototypic bile acid TCDCA. Confluent HCT116 cells were mixed with TcdB and vehicle or TCDCA on ice for 60 min to prevent internalization, washed in ice-cold

phosphate buffered saline (PBS), then harvested for quantifica- MICROBIOLOGY tion of bound TcdB by Western blot. In the absence of bile acids, both full-length TcdB and truncated TcdB1–2,283 were recovered from the cell surface and could be visualized by Western blot (Fig. 4A). For full-length TcdB, preincubation with TCDCA blocked cell surface binding, whereas the noninhibitory control bile acid dehydro-CA had no effect on cell surface binding (Fig. 4 A and B). By contrast, cell surface binding of TcdB1-2,283 was unaffected in the presence of either TCDCA or dehydro-CA. Thus, bile acid acts by inducing a conformation in TcdB that is no longer able to bind to cell surface receptors—the first step in the intoxication pathway of TcdB.

Identification of Small Molecules with a Bile Acid-Like Mechanism of Action. The remarkable ability of bile acids to drive TcdB into a Fig. 2. Role of the C-terminal CROP region of TcdB in binding bile acids. stabilized, but nonfunctional state prompted us to next search for (A, Top) Domain architecture of TcdB and TpeL, highlighting the naturally other small molecules that act through this mechanism, both to occurring truncation of the CROP region in TpeL. Short repeats are colored probe the binding interaction further, and to identify other po- green; long repeats are colored blue. (A, Bottom) The three CROP truncations tentially more “drug-like” molecules that could act as novel an- in TcdB, generated by genetic mutation in order to approximate the natural titoxins. To this end, we conducted a high-throughput screen against deletion in TpeL. (B) DSF as a measure of TCDCA binding. TCDCA binds to full- the same chemical library consisting of approved drugs, bioactive length TcdB in a dose-dependent manner, but does not bind to TcdB CROP molecules, and natural products. To bias toward compounds with truncations, or TpeL (Inset). Bars represent SEM of six experiments for TcdB, three experiments for TpeL, and three experiments for the TcdB CROP trun- a bile acid-like mechanism, we screened for compounds that cations. (C) Dose- dependent protection by representative bile acids against increased the thermal stability of TcdB using a temperature- full-length TcdB challenge by cell rounding assay. Bars represent SEM of four dependent fluorescence binding assay. Hits emerging from this experiments. (Inset) No protection by the same panel of bile acids against screen were subsequently tested for their ability to protect cells TcdB1–2,283 challenge by cell rounding assay. Bars represent SEM of three ex- from TcdB-induced toxicity. Only molecules that were active in periments. Similar results observed for TcdB1–2,101 and TcdB1–2,200. both assays were characterized further to distinguish those that were binding and inhibiting through a bile acid-like mechanism. Of the 2,401 small molecules that were screened, we identified of trypsin, followed by visualization on SDS/PAGE shows that 15 small molecules that increased the TM of TcdB by greater than TcdB is progressively degraded with no full-length TcdB de- threeSDsofthemean(Fig.5A and SI Appendix,TableS2). As μ tectable at 100 g/mL trypsin (Fig. 3C). When bound to TCDCA, expected, on this short list of hits was methyl cholate (ΔTM = 6°C), TcdB showed increased resistance to trypsin-mediated degra- and the three bile acids chenodeoxycholic acid (ΔTM = 3.5 °C), dation. TcdB1–2,283, which is incapable of binding bile acid, cholic acid (ΔTM = 3 °C), and lithocholic acid (ΔTM = 3°C).Also however, was not protected from proteolytic degradation in the present on this list were four compounds, betulinic acid, oleanoic presence of TCDCA (Fig. 3C). Consistent with these results, acid, pregnanolone, and asiatic acid, with structures bearing sig- functional experiments show that intoxication by TcdB under the nificant structural similarity to the core bile acid scaffold (SI Ap- above conditions is correlated with the amount of remaining full- pendix, Fig. S5). Though just below the statistical cutoff for length toxin remaining (SI Appendix, Fig. S4). classification as hits, three additional bile acid-like compounds,

Tam et al. PNAS | March 24, 2020 | vol. 117 | no. 12 | 6795 Downloaded by guest on October 2, 2021 Fig. 3. Bile acids induce major conformational changes in TcdB that are reversible. (A) Negative-stain EM images of TcdB (100 nM) in the absence and presence of increasing concentrations of methyl cholate, TCDCA, and dehdydrocholate. TcdB was incubated with increasing concentrations of the individual bile salts, and the reactions were diluted 10-fold in reaction buffer immediately before grid preparation. Samples were applied to glow-discharged, carbon- coated copper grids and stained with uranyl formate (0.75%). Micrographs were collected at 44,000 magnification on a Morgagni (100 keV; FEI) transmission electron microscope equipped with an AMT CCD camera. (B) Dual histogram illustrates the relative size distribution of TcdB alone (blue bars) compared to the round structures observed in the presence of methyl cholate (red bars). Individual particles (160 to 180 total) from representative negative-stain EM images were measured manually in Photoshop, with lengths/diameters converted from pixels to Ångstroms based on the scale bar for each image. The length of each TcdB particle was measured from end to end (GTD region to end of delivery domain), and the diameters of the methyl cholate-bound TcdB were measured through the

center of the balls (C, Left), dose-dependent trypsin digestion of full-length TcdB is prevented by 1,000 μMTCDCA.(C, Right) TCDCA does not protect TcdB1–2,283 truncation from trypsin digestion. Representative gels from three experiments each. (D) Reversibility measured by DSF, showing reduction of temperature shift back toward baseline upon 10× dilution of TCDCA (500 μM diluted to 50 μM). Four biological replicate wells per condition. ***P = 0.008, *P = 0.0284.

6796 | www.pnas.org/cgi/doi/10.1073/pnas.1916965117 Tam et al. Downloaded by guest on October 2, 2021 from TcdB-mediated damage and loss of transepithelial resistance (Fig. 5E). Discussion In this study, we describe a role for bile acids in binding to and inhibiting the function of TcdB—the major determinant of virulence for C. difficile. The unexpected finding that the homologous toxins TcdA and TpeL were insensitive to bile acid binding and inhibition led us to uncover a role for a region within the poorly defined CROP domain in this interaction. The role of the CROP domain in the function of large clostridial toxins has been a matter of debate ever since their discovery (5), fueled in part by their demonstrated ability to bind carbohydrates (35) which were reasonably speculated to serve as receptors for toxin entry. The discovery of TpeL, which naturally lacked the CROP region, but was otherwise toxic to cells (36), along with the demonstration that removing the CROP had no impact on cytotoxicity (7, 37), however, challenged its role as the receptor-binding domain for this family of toxins. The recent discovery of cellular receptors for TcdA (9) and TcdB (6, 8, 38) that bind outside of, or at the junction of the CROP domain has further called the role of this enigmatic domain into question. Our findings here show that the C-terminal region of the TcdB CROP domain is required for the bile acid-induced effects on TcdB structure and function. Remarkably, we demonstrate that this massively compacted inhibited state of TcdB is reversible and thus in a dynamic active–inactive equilibrium that depends on the local concentrations of bile acids. The extent to which MICROBIOLOGY these phenomena contribute to colonization resistance (39, 40) and disease pathogenesis, particularly in asymptomatic carriers Fig. 4. Cell surface binding assay. TcdB (2 nM) and either 1,000 μM TCDCA of toxigenic C. difficile, where toxins are often present at similar or dehydro-CA were preincubated together for 30 min on ice in serum-free levels as CDI patients (41), will be an important aim of future media before adding to HCT116 cells. After incubating for 60 min on ice, studies aimed at better understanding the physiological impli- cells were harvested and lysed. (A) Clarified material was analyzed by cations of this interaction. It is tempting to speculate that bile Western blot by probing with anti-TcdB antibody (R&D Systems, AF6246) and acids may help in the timing of the action of TcdB, for instance anti-tubulin antibody (Sigma, T6074) as a loading control. (B) Cell-associated by protecting and inhibiting TcdB in the upper GI where bile TcdB bands were measured by densitometry using a ChemiDoc MP Imaging acid levels are highest and later allowing “release” of active toxin System (Bio-Rad). The TcdB-binding compound TCDCA, but not dehydro-CA, in the lower GI where bile acids are lower in concentration. prevented surface binding of TcdB to cells. Bars represent SEM of three biological replicates. From a therapeutic perspective, the demonstrated ability of bile acids to offer complete protection against TcdB—a major target in CDI drug development (4)—provides a mechanism- deoxycholic acid, madecassic acid, and ursolic acid increased the based approach to inhibit toxin action to prevent disease path- TM of TcdB (SI Appendix, Table S2). ogenesis through development of antitoxins. The therapeutic use From the remaining hits with no structural similarity to bile of bile acids themselves to this end, however, is problematic due acids, two compounds were capable of protecting cells from to the potential for overloading physiological functions of bile TcdB. The first, phenoxybenzamine, a nonselective irreversible acids, in particular with signal transduction pathways and the alpha-adrenoreceptor antagonist (32), was excluded from further recycling of bile acids (42). Moreover, disruption of the host follow-up owing to its potentially highly reactive carbonium ion microbiota itself through bile acid-mediated antimicrobial effects that results from cleavage of its tertiary amine ring (33). The (43) are not desired within the context of treating C. difficile second compound, a substituted benzylisoquinoline known as where the goal of therapy is to prevent further dysbiosis. Our ethaverine hydrochloride—the ethyl analog of papaverine, both discovery of ethaverine, an alternative nonsteroidal scaffold that of which are potent peripheral coronary vasodilator drugs (34)— is an already approved drug, and that binds and inhibits TcdB was characterized. Papaverine, which was in the primary screen, through a bile acid-like mechanism offers an ideal means to but was not identified as a hit, was also characterized alongside exploit this mechanism for the development of therapeutic inhib- ethaverine. By DSF, ethaverine dose-dependently increased the itors of TcdB action to treat CDI. thermal stability of TcdB, whereas papaverine increased the stability only marginally up to 100 μM (Fig. 5B). To determine Methods whether ethaverine acted in a similar fashion to bile acids, we Consumables, Cell Lines, and Reagents. Plasticware used for cell culture and next tested whether it was capable of inhibiting TcdB-ΔBASR. enzyme assays was purchased from Corning. Ethaverine displayed no affinity for truncated TcdB, consistent Cell lines HCT116, Caco-2, and IMR-90 were from ATCC. Natural and with its inhibiting TcdB in a bile acid fashion (Fig. 5C). Simi- synthetic bile acids were purchased from Sigma, and Ethaverine was pur- larly, ethaverine was specific for TcdB, as it was unable to inhibit chased from Onbio. Western blot reagents, including Amersham ECL Prime blocking, ECL Select Detection, and anti-mouse conjugated peroxidase anti- TcdA-induced cell rounding (SI Appendix,Fig.S6A). Moreover, body were from GE Healthcare. PCR and cloning reagents Q5 High Fidelity ethaverine and to a lesser extent papaverine, shared the same PCR polymerase (M0491) and NEBuilder HiFi DNA Assembly Master Mix mechanism of inhibition of TcdB by preventing cell surface bind- (E2621) were from New England Biolabs. The Spectrum library, consisting of ing of TcdB (Fig. 5D and SI Appendix,Fig.S6B). Lastly, we show 2,400 individual compounds formatted as 10 mM solutions in DMSO, was that ethaverine protects human colonic epithelial cell monolayers purchased from Microsource.

Tam et al. PNAS | March 24, 2020 | vol. 117 | no. 12 | 6797 Downloaded by guest on October 2, 2021 Fig. 5. Identification of nonsteroidal bile acid mimetics. (A) Results from high-throughput DSF screening of 2,400 drugs from the Microsource Spectrum collection. A statistical cutoff of ΔT = 3 °C inhibition of increase in stabilization was based on identification of molecules that were greater than 3 SDs above the mean of the data. Green dots represent hits that were bile acids or bile acid-like molecules. (B) Titration of ethaverine and parent compound papaverine against TcdB by DSF. Ethaverine dose dependently binds and thermally stabilizes TcdB with greater potency than papaverine. Bars represent SEM of four experiments. (C) Titration of ethaverine against full-length and CROP-less TcdB by DSF. Ethaverine dose dependently binds and thermally stabilizes full-length

TcdB but not CROP-truncated TcdB1–2,283.(D) Cell surface binding assay. TcdB (2 nM) and either 100 μM of positive control methyl cholate, 50 μM ethaverine, or 50 μM papaverine were preincubated together for 30 min on ice in serum-free media before adding to HCT116 cells. After incubating for 60 min on ice, cells were harvested and lysed. Clarified material was analyzed by Western blot by probing with anti-TcdB antibody (R&D Systems, AF6246) and anti-tubulin antibody as a loading control. Cell-associated TcdB bands were measured by densitometry using a ChemiDoc MP Imaging System (Bio-Rad). The TcdB-binding compound ethaverine and to a lesser extent papaverine, prevented surface binding of TcdB to cells. Bars represent SEM of four biological replicates. (E) Normalized transepithelial resistance measurements in human Caco-2 cells, 3 to 6 h posttreatment. Ethaverine preserved significantly increased resistance across Caco-2 monolayer cells compared to mock control values (n = 3 biological replicates). Bars represent SEM of mean. ***P < 0.0006.

Protein Expression and Purification. Plasmid pHis1522 encoding his-tagged pellets were collected, resuspended with 20 mM Tris pH 8/0.1 M NaCl, and TcdB was a kind gift from Hanping Feng (University of Maryland, Balti- passed twice through an EmulsiFlex C3 microfluidizer (Avestin) at 15,000 psi. more, MD) and plasmid pHis1522 encoding his-tagged TcdA was a kind gift The resulting lysate was clarified by centrifuging for 14,000 × g for 20 min. from Merck. Expression and isolation of recombinant TcdB and TcdA was as TcdB was purified by nickel affinity chromatography followed by anion ex- described by Yang et al. (44). Briefly, transformed Bacillus megaterium was change chromatography using HisTrap FF Crude and HiTrap Q columns (GE inoculated into Luria broth (LB) containing tetracycline and grown to an Healthcare), respectively. Fractions containing TcdB or TcdA were verified by A600 of 1.6, followed by overnight xylose induction at 30 °C. Bacterial SDS/PAGE, then pooled and diafiltered with a 100,000 molecular weight

6798 | www.pnas.org/cgi/doi/10.1073/pnas.1916965117 Tam et al. Downloaded by guest on October 2, 2021 cutoff (MWCO) ultrafiltration device (Corning) into 20 mM Tris PH 7.5/ of test compound. A Bio-Rad CFX96 qRT-PCR thermocycler was used to es- 150 mM NaCl. Finally, glycerol was added to 5% vol/vol, the protein con- tablish a temperature gradient from 30 °C to 80 °C in 0.5 °C increments, centration was estimated by A280, divided into single-use aliquots, and stored while simultaneously recording the increase in SYPRO Orange fluorescence at −80 °C. as a consequence of binding to hydrophobic regions exposed on unfolded To generate CROP truncations, plasmid pHis1522 encoding TcdB was used proteins. The Bio-Rad CFX Manager 3.1 software was used to integrate the as a DNA template along with the forward primer “upstreamBsrGI-Fwd” fluorescence curves to calculate the melting point. For the high-throughput (CTTGTTCACTTAAATCAAAGGGGG), plus the respective reverse primers screen, an Agilent Bravo liquid handler was used to deliver 0.3 μL from the “TcdB-2101-RevHis” (TAGTGATGGTGATGGTGATGACCTATATATGCTTCTGC- Microsource library plate to the assay plate containing 30 μL of the TcdB and TGTATCTTC), “TcdB-2200-RevHis” (TAGTGATGGTGATGGTGATGACCACTA- SYPRO Orange reaction mix, for a final compound concentration of 100 μM. TATTCAACTGCTTGTCC), and “TcdB-2283-RevHis” (TAGTGATGGTGATGGT- The reaction plate was read in the CFX96 thermocycler in a range of 42 °C to GATGAAATTGCATTTCACCATTCTCATTAAAG) for the three truncated DNA 65 °C in 0.5° increments, 5-s read per increment. products. To generate the accepting vector, the same template was used with “ ” “ primers TcdB-His-Fwd (CATCACCATCACCATCACTAAC) and upstreamBsrGI- Cell Surface Binding Assay. HCT116 cells in 10-cm dishes were grown to 90% ” Rev (CCCCCTTTGATTTAAGTGAACAAG). Q5 High Fidelity PCR polymerase confluence; one plate was used per condition. TcdB (2 nM) and test com- (M0491) and NEBuilder HiFi DNA Assembly Master Mix (E2621) were used for pounds were preincubated together for 30 min on ice in serum-free media PCR reactions and cloning, respectively. Protein expression and purifications of before adding to cells. After incubating for 60 min on ice, cells were washed the truncations were performed as for full-length TcdB. with PBS, harvested and lysed in 300 μL of 0.5% TX100/PBS. Clarified material was analyzed by Western blot by probing with anti-TcdB antibody (R&D ’ Arrayscan High-Content Imaging. IMR-90 cells were grown in Eagle s Mini- Systems, AF6246) first, followed by anti-tubulin antibody (Sigma, T6074) as a mum Essential Medium (EMEM) (Wisent) supplemented with 10% fetal bovine loading control. Secondary antibodies for detection were anti-sheep biotin serum (FBS) and penicillin–streptomycin (complete EMEM) and were seeded (Abcam, 6746) followed by streptavidin horseradish peroxidase (HRP) in 96-well Cellbind plates (Corning) at a density of 8,000 cells/well. The next (Abcam, 7403) for TcdB, and anti-mouse HRP (GE Healthcare, NA931V) for day, the media was exchanged with serum-free EMEM (SFM) containing tubulin. TcdB bands were measured by densitometry using a ChemiDoc MP 1 μM Celltracker Orange CMRA (Invitrogen C34551). After 60 min, excess dye Imaging System (Bio-Rad). was removed by media exchange with SFM. An Agilent Bravo liquid handler was used to deliver 0.4 μL of compound from the compound plate to the cell Protease Protection Assay. Reactions were set up on ice containing the fol- plate, immediately followed by 10 μL of 5 pM TcdB (diluted in SFM), rep- lowing components: 45 μL of 50 mM Tris pH 8/150 mM NaCl, 2.5 μg TcdB resenting a concentration of toxin previously established as ∼EC99 levels of (185 nM), plus/minus 1,000 μM TCDCA. Trypsin dilutions (Sigma, T1426) were cytopathology. The cell plates were returned to the incubator for 3.5 h μ before imaging. Celltracker-labeled cells were evaluated on a Cellomics added to a final reaction volume of 50 L and incubated for 15 min at 30 °C. μ ArrayScan VTI HCS reader (Thermo Scientific) using the Target Acquisition For the cell rounding assay, 5 L of the reaction was retained and diluted μ − mode, a 10× objective, and a sample rate of at least 150 objects per well. into 300 L complete EMEM before storage at 20 °C. A further 100-fold MICROBIOLOGY After recording all image data, the cell rounding and shrinking effects of dilution was performed prior to adding to cells; this represented a final TcdB intoxication were calculated using the cell rounding index (29), a 6,000-fold dilution of the trypsin and TCDCA for the cell assay. The remaining μ × combined measure of the length to width ratio (LWR) and area parameters. reaction was stopped by adding 15 Lof4 SDS sample buffer (Bio-Rad) and μ The % inhibition was calculated as the ratio between the sample well and heating to 90 °C for 10 min before loading 50 L for SDS/PAGE and the average toxin-untreated controls after subtracting the average dimethyl Coomassie staining. sulfoxide (DMSO) control values. Dose–response curves were created and evaluated using Prism software Negative-Stain Electron Microscopy. TcdB holotoxin was expressed in (Graphpad Software). B. megaterium and purified by nickel-chelating, anion exchange. Sodium dehydrocholate and sodium taurochenodeoxycholate were obtained from Transepithelial Electrical Resistance. Caco-2 cells (ATCC) were plated on Sigma-Aldrich, and methyl cholate was purchased from Alfa Aesar. Stock 12-well Transwell polyester, 0.4-μm pore size plates (Corning 3460), at a solutions of the bile salts were made in either methanol (methyl cholate) or density of 100,000 cells/well. Electrical resistance was monitored with a water (dehydrocholate and taurochenodeoxycholate), and working stocks Millicell ERS-2 V-ohm meter (Millipore). When resistance readings plateaued were further diluted into buffer for the experiments. Samples for negative- after 14 to 21 d, TcdB (20 pM final) and test compound were added to the stain electron microscopy were prepared in reaction buffer (20 mM Hepes basolateral side. Decline in resistance as a consequence of loss of cell barrier pH 6.9, 50 mM NaCl). In brief, TcdB (100 nM) was incubated with increasing integrity was measured over the next 3 to 6 h and reported as percentage of concentrations of the individual bile salts, and the reactions were diluted the baseline value. 10-fold in reaction buffer immediately before grid preparation. Samples were applied to glow-discharged, carbon-coated copper grids (400 mesh, Electron Differential Scanning Fluorometry. DSF was performed in a similar manner as Microscopy Sciences) and stained with uranyl formate (0.75%). Micrographs described previously (30). TcdB protein was diluted to 0.05 μg/μL, and TpeL were collected at 44,000 magnification on a Morgagni (100 keV; FEI) was diluted to 1 μg/μL using phosphate buffer (100 mM KPO4, 150 mM NaCl, transmission electron microscope equipped with an AMT 1 k × 1 k (1024 × pH 7) containing 5× SYPRO Orange (Invitrogen S6650), and a serial dilution 1024 pixels) charge-coupled device (CCD) camera.

1. R. B. Slayton et al., The cost-benefit of federal investment in preventing Clostridium 10. Z. Zhang et al., Translocation domain mutations affecting cellular toxicity identify the difficile infections through the use of a multifaceted infection control and antimi- Clostridium difficile toxin B pore. Proc. Natl. Acad. Sci. U.S.A. 111, 3721–3726 (2014). crobial stewardship program. Infect. Control Hosp. Epidemiol. 36, 681–687 (2015). 11. I. Just, J. Selzer, C. von Eichel-Streiber, K. Aktories, The low molecular mass GTP- 2. W. K. Smits, D. Lyras, D. B. Lacy, M. H. Wilcox, E. J. Kuijper, Clostridium difficile in- binding protein Rho is affected by toxin A from Clostridium difficile. J. Clin. Invest. fection. Nat. Rev. Dis. Primers 2, 16020 (2016). 95, 1026–1031 (1995). 3. S. A. Kuehne et al., Importance of toxin A, toxin B, and CDT in virulence of an epi- 12. H. Genth, K. Aktories, I. Just, Monoglucosylation of RhoA at threonine 37 blocks demic Clostridium difficile strain. J. Infect. Dis. 209,83–86 (2014). cytosol-membrane cycling. J. Biol. Chem. 274, 29050–29056 (1999). 4. M. H. Wilcox et al.; MODIFY I and MODIFY II Investigators, Bezlotoxumab for Pre- 13. I. Donta et al., Effect of beta-adrenergic blockade on physiologic growth in the Wistar vention of Recurrent Clostridium difficile infection. N.Engl.J.Med.376, 305–317 rat. Res. Commun. Chem. Pathol. Pharmacol. 37, 147–150 (1982). (2017). 14. S. Hippenstiel et al., Rho protein inactivation induced apoptosis of cultured human 5. C. von Eichel-Streiber, M. Sauerborn, Clostridium difficile toxin A carries a C-terminal endothelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 283, L830–L838 (2002). repetitive structure homologous to the carbohydrate binding region of streptococcal 15. N. M. Chumbler et al., Clostridium difficile Toxin B causes epithelial cell necrosis through glycosyltransferases. Gene 96, 107–113 (1990). an autoprocessing-independent mechanism. PLoS Pathog. 8, e1003072 (2012). 6. P. Yuan et al., Chondroitin sulfate proteoglycan 4 functions as the cellular receptor 16. K. O. Bender et al., A small-molecule antivirulence agent for treating Clostridium for Clostridium difficile toxin B. Cell Res. 25, 157–168 (2015). difficile infection. Sci. Transl. Med. 7, 306ra148 (2015). 7. P. Gupta et al., Functional defects in Clostridium difficile TcdB toxin uptake identify 17. J. Tam et al., Host-targeted niclosamide inhibits C. difficile virulence and prevents CSPG4 receptor-binding determinants. J. Biol. Chem. 292, 17290–17301 (2017). disease in mice without disrupting the gut microbiota. Nat. Commun. 9, 5233 (2018). 8. L. Tao et al., Frizzled proteins are colonic epithelial receptors for C. Difficile toxin B. 18. M. J. T. Crobach et al., Understanding Clostridium difficile Colonization. Clin. Microbiol. Nature 538, 350–355 (2016). Rev. 31, e00021-17 (2018). 9. L. Tao et al., Sulfated glycosaminoglycans and low-density lipoprotein receptor con- 19. L. Kyne, M. Warny, A. Qamar, C. P. Kelly, Asymptomatic carriage of Clostridium difficile tribute to Clostridium difficile toxin A entry into cells. Nat. Microbiol. 4,1760–1769 (2019). and serum levels of IgG antibody against toxin A. N. Engl. J. Med. 342,390–397 (2000).

Tam et al. PNAS | March 24, 2020 | vol. 117 | no. 12 | 6799 Downloaded by guest on October 2, 2021 20. L. V. McFarland, M. E. Mulligan, R. Y. Kwok, W. E. Stamm, Nosocomial acquisition of noncompetitive antagonism at G protein-coupled receptors. J. Pharmacol. Exp. Ther. Clostridium difficile infection. N. Engl. J. Med. 320, 204–210 (1989). 314, 891–905 (2005). 21. K. H. Wilson, J. N. Sheagren, R. Freter, Population dynamics of ingested Clostridium 33. H. Frang, V. Cockcroft, T. Karskela, M. Scheinin, A. Marjamäki, Phenoxybenzamine – difficile in the gastrointestinal tract of the Syrian hamster. J. Infect. Dis. 151, 355 361 binding reveals the helical orientation of the third transmembrane domain of adren- (1985). ergic receptors. J. Biol. Chem. 276,31279–31284 (2001). 22. M. B. Francis, C. A. Allen, R. Shrestha, J. A. Sorg, Bile acid recognition by the Clos- 34. C. M. Voyles, H. A. Sieber, E. S. Orgain, Ethaverine in the treatment of angina pectoris. tridium difficile germinant receptor, CspC, is important for establishing infection. J. Am. Med. Assoc. 153,12–14 (1953). PLoS Pathog. 9, e1003356 (2013). 35. C. von Eichel-Streiber, M. Sauerborn, H. K. Kuramitsu, Evidence for a modular structure 23. J. A. Sorg, A. L. Sonenshein, Bile salts and glycine as cogerminants for Clostridium of the homologous repetitive C-terminal carbohydrate-binding sites of Clostridium dif- difficile spores. J. Bacteriol. 190, 2505–2512 (2008). – 24. R. Thanissery, J. A. Winston, C. M. Theriot, Inhibition of spore germination, growth, ficile toxins and Streptococcus mutans glucosyltransferases. J. Bacteriol. 174,6707 6710 and toxin activity of clinically relevant C. difficile strains by gut microbiota derived (1992). secondary bile acids. Anaerobe 45,86–100 (2017). 36. K. Amimoto, T. Noro, E. Oishi, M. Shimizu, A novel toxin homologous to large clostridial 25. R. Thanissery, D. Zeng, R. G. Doyle, C. M. Theriot, A small molecule-screening pipeline cytotoxins found in culture supernatant of Clostridium perfringens type C. Microbiology to evaluate the therapeutic potential of 2-aminoimidazole molecules against Clostridium 153,1198–1206 (2007). difficile. Front. Microbiol. 9, 1206 (2018). 37. A. Olling et al., The repetitive oligopeptide sequences modulate cytopathic potency 26. C. M. Theriot et al., Antibiotic-induced shifts in the mouse gut microbiome and me- but are not crucial for cellular uptake of Clostridium difficile toxin A. PLoS One 6, tabolome increase susceptibility to Clostridium difficile infection. Nat. Commun. 5, e17623 (2011). 3114 (2014). 38. M. E. LaFrance et al., Identification of an epithelial cell receptor responsible for 27. C. G. Buffie et al., Precision microbiome reconstitution restores bile acid mediated Clostridium difficile TcdB-induced cytotoxicity. Proc. Natl. Acad. Sci. U.S.A. 112, 7073– resistance to Clostridium difficile. Nature 517, 205–208 (2015). 7078 (2015). 28. J. I. Robinson et al., Metabolomic networks connect host-microbiome processes to 39. R. A. Britton, V. B. Young, Interaction between the intestinal microbiota and host in human Clostridioides difficile infections. J. Clin. Invest. 130, 3792–3806 (2019). Clostridium difficile colonization resistance. Trends Microbiol. 20, 313–319 (2012). 29. J. Tam et al., Small molecule inhibitors of Clostridium difficile toxin B-induced cellular 40. C. G. Buffie, E. G. Pamer, Microbiota-mediated colonization resistance against intestinal damage. Chem. Biol. 22, 175–185 (2015). – 30. F. H. Niesen, H. Berglund, M. Vedadi, The use of differential scanning fluorimetry to pathogens. Nat. Rev. Immunol. 13,790 801 (2013). detect ligand interactions that promote protein stability. Nat. Protoc. 2, 2212–2221 41. G. A. Roldan, A. X. Cui, N. R. Pollock, Assessing the Burden of Clostridium difficile (2007). infection in Low- and Middle-Income Countries. J. Clin. Microbiol. 56, e01747-17 (2018). – 31. J. E. Blake, F. Mitsikosta, M. A. Metcalfe, Immunological detection and cytotoxic 42. A. Di Ciaula et al., Bile acid physiology. Ann. Hepatol. 16 (suppl. 1), S4 S14 (2017). properties of toxins from toxin A-positive, toxin B-positive Clostridium difficile variants. 43. T. Inagaki et al., Regulation of antibacterial defense in the small intestine by the J. Med. Microbiol. 53, 197–205 (2004). nuclear bile acid receptor. Proc. Natl. Acad. Sci. U.S.A. 103, 3920–3925 (2006). 32. J. Bodenstein, D. P. Venter, C. B. Brink, Phenoxybenzamine and benextramine, but 44. G. Yang et al., Expression of recombinant Clostridium difficile toxin A and B in Bacillus not 4-diphenylacetoxy-N-[2-chloroethyl]piperidine hydrochloride, display irreversible megaterium. BMC Microbiol., 10.1186/1471-2180-8-192 (2008).

6800 | www.pnas.org/cgi/doi/10.1073/pnas.1916965117 Tam et al. Downloaded by guest on October 2, 2021