DOCSLIB.ORG

3/13/2018 1 the Promise of Genomics and Epigenetics Studies in NASA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
3/13/2018 1 the Promise of Genomics and Epigenetics Studies in NASA 3/13/2018 The Promise of Goals for Today’s Talk Genomics and Epigenetics Studies . Genomics and Epigenetics In NASA Exercise relevant concepts in the evolving field Research Shlomit Radom‐Aizik PhD . MoTrPAC; new NIH initiative and its connection Director, Pediatric Exercise and Genomics Research Center (PERC) to NASA exercise research . Current genomic and epigenetic studies in NASA exercise research UC Irvine Health School of Medicine 13 Years $ 3 Billion ~ 48 Hours ~ $ 2000 GTACTCAAGTTTACTATACCCGATAGGATCCGATACT Agouti Gene Mom Mom = Methyl groups Obese Prone to cancer and diabetes These two mice are Thin Healthy genetically identical and the same age 1 3/13/2018 CHROMOSOME Epigenetic Mechanisms CHROMATIN HISTONE Histone tail letseatgrandma Methyl group donor Acetylation (epigenetic factors) (epigenetic factors) DNA accessible: DNA inaccessible: gene active gene inactive Lets eat, grandma! Methyl group binds only to cytosine Lets eat grandma! Epigenetics (Above the Genome) A whole range of External modifications to DNA that turn genes "on" or "off" environmental and lifestyle without changing the DNA sequence factors can trigger the “on/off switches” in our genes –factors like diet, genetics. stress, drugs, pollution epi˰ genetics MICROGRAVITY and EXERCISE Dr. Francis Collins, Director, National Institutes of Health talks about how the Molecular Transducers of Physical Activity Consortium (MoTrPAC) will allow PubMed Publications on Exercise and Epigenetic researchers to develop a comprehensive map of the molecular changes that occur in response to physical activity. 2 3/13/2018 NIH common fund groundbreaking exercise trial to create the molecular map in response to exercise Molecular Transducers of Physical Activity Consortium (MoTrPAC) Why now? . Technology . Databases‐Big data Long term goals: . Personalized exercise prescription . Exercise medicine Current Genomic and Epigenetic Studies in By generating a comprehensive map of NASA Exercise Research molecular responses to physical activity, MoTrPAC will lay the foundation for a new era of biomedical research on Precision Exercise Medicine. 3 3/13/2018 Genomic and epigenetic modifications during 70‐day bed rest Study Design with and without countermeasures to mitigate the negative consequences of weightlessness Protein Synthesis Inhibited 17 Oxidative Phosphorylation Pathway genes 17 Oxidative Phosphorylation Pathway genes were were down regulated in response to Bed Rest down regulated in response to Bed Rest (2) BR Exercise Training Attenuates the Muscle Selected MicroRNAs Down‐Regulated in Gene Expression Response to Bed Rest Bed Rest BR BR+ EX BR+EX (iRAT) (FLY) BR 4 3/13/2018 Exercise Training Attenuates the Muscle MicroRNA Response to Bed Rest Distinct DNA Methylation Response to Different Training Programs BR BR+ EX BR+EX (iRAT) (FLY) Five weeks of training increased peak VO2 only in Study Design the AE+RE , while leg press strength was significantly improved in both groups but to a greater extent in 32 subjects (20‐26 y/o, 15 females) the RE group 5 week exercise protocol Combined Aerobic (AE) & Resistance (RE), Resistance Exercise (RE) 5 days a week: 3 days of AE 2 days of RE 2 days a week Five Weeks of Exercise Altered DNA Insulin Signaling Pathway Methylation 2541 (AE+RE) vs. 229 (RE) genes were altered, p<0.0005 (75 common). 42 KEGG Pathways 229 genes (RE) 2541 genes (AE+RE) 5 3/13/2018 THE Mapping the genomic responses to exercise in altered gravity conditions, will THM allow us to develop Precision Exercise‐ Medicine Programs to be used in space and maintain our astronauts health Acknowledgments Pediatric Exercise and Genomics Research Center (PERC) University of California Irvine George Washington University, Washington DC Greg Adams PhD Joseph M Devaney PhD Biostatistician PI, Integrated Endurance And Resistance Exercise Eric P Hoffman MD Countermeasures To Unloading Induced Skeletal Muscle Director Research Center for Genetic Medicine, Dysfunction. NSBRI NCC 9‐58‐70 & MA01601 Children’s National Medical Center, Washington, DC Lead researcher UCI site 70 day Bed Rest Study, MA02801 Fadia Haddad PhD PERC Molecular Laboratory Manager Cherryl Nugas PERC Staff Research Associate Tomasz Owerkowicz PhD Project coordinator 6.
Load more

Recommended publications
  • 13 Genomics and Bioinformatics
    Enderle / Introduction to Biomedical Engineering 2nd ed. Final Proof 5.2.2005 11:58am page 799 13 GENOMICS AND BIOINFORMATICS Spencer Muse, PhD Chapter Contents 13.1 Introduction 13.1.1 The Central Dogma: DNA to RNA to Protein 13.2 Core Laboratory Technologies 13.2.1 Gene Sequencing 13.2.2 Whole Genome Sequencing 13.2.3 Gene Expression 13.2.4 Polymorphisms 13.3 Core Bioinformatics Technologies 13.3.1 Genomics Databases 13.3.2 Sequence Alignment 13.3.3 Database Searching 13.3.4 Hidden Markov Models 13.3.5 Gene Prediction 13.3.6 Functional Annotation 13.3.7 Identifying Differentially Expressed Genes 13.3.8 Clustering Genes with Shared Expression Patterns 13.4 Conclusion Exercises Suggested Reading At the conclusion of this chapter, the reader will be able to: & Discuss the basic principles of molecular biology regarding genome science. & Describe the major types of data involved in genome projects, including technologies for collecting them. 799 Enderle / Introduction to Biomedical Engineering 2nd ed. Final Proof 5.2.2005 11:58am page 800 800 CHAPTER 13 GENOMICS AND BIOINFORMATICS & Describe practical applications and uses of genomic data. & Understand the major topics in the field of bioinformatics and DNA sequence analysis. & Use key bioinformatics databases and web resources. 13.1 INTRODUCTION In April 2003, sequencing of all three billion nucleotides in the human genome was declared complete. This landmark of modern science brought with it high hopes for the understanding and treatment of human genetic disorders. There is plenty of evidence to suggest that the hopes will become reality—1631 human genetic diseases are now associated with known DNA sequences, compared to the less than 100 that were known at the initiation of the Human Genome Project (HGP) in 1990.
    [Show full text]
  • Genomics and Its Impact on Science and Society: the Human Genome Project and Beyond
    DOE/SC-0083 Genomics and Its Impact on Science and Society The Human Genome Project and Beyond U.S. Department of Energy Genome Research Programs: genomics.energy.gov A Primer ells are the fundamental working units of every living system. All the instructions Cneeded to direct their activities are contained within the chemical DNA (deoxyribonucleic acid). DNA from all organisms is made up of the same chemical and physical components. The DNA sequence is the particular side-by-side arrangement of bases along the DNA strand (e.g., ATTCCGGA). This order spells out the exact instruc- tions required to create a particular organism with protein complex its own unique traits. The genome is an organism’s complete set of DNA. Genomes vary widely in size: The smallest known genome for a free-living organism (a bac- terium) contains about 600,000 DNA base pairs, while human and mouse genomes have some From Genes to Proteins 3 billion (see p. 3). Except for mature red blood cells, all human cells contain a complete genome. Although genes get a lot of attention, the proteins DNA in each human cell is packaged into 46 chro- perform most life functions and even comprise the mosomes arranged into 23 pairs. Each chromosome is majority of cellular structures. Proteins are large, complex a physically separate molecule of DNA that ranges in molecules made up of chains of small chemical com- length from about 50 million to 250 million base pairs. pounds called amino acids. Chemical properties that A few types of major chromosomal abnormalities, distinguish the 20 different amino acids cause the including missing or extra copies or gross breaks and protein chains to fold up into specific three-dimensional rejoinings (translocations), can be detected by micro- structures that define their particular functions in the cell.
    [Show full text]
  • Genetic Effects on Microsatellite Diversity in Wild Emmer Wheat (Triticum Dicoccoides) at the Yehudiyya Microsite, Israel
    Heredity (2003) 90, 150–156 & 2003 Nature Publishing Group All rights reserved 0018-067X/03 $25.00 www.nature.com/hdy Genetic effects on microsatellite diversity in wild emmer wheat (Triticum dicoccoides) at the Yehudiyya microsite, Israel Y-C Li1,3, T Fahima1,MSRo¨der2, VM Kirzhner1, A Beiles1, AB Korol1 and E Nevo1 1Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel; 2Institute for Plant Genetics and Crop Plant Research, Corrensstrasse 3, 06466 Gatersleben, Germany This study investigated allele size constraints and clustering, diversity. Genome B appeared to have a larger average and genetic effects on microsatellite (simple sequence repeat number (ARN), but lower variance in repeat number 2 repeat, SSR) diversity at 28 loci comprising seven types of (sARN), and smaller number of alleles per locus than genome tandem repeated dinucleotide motifs in a natural population A. SSRs with compound motifs showed larger ARN than of wild emmer wheat, Triticum dicoccoides, from a shade vs those with perfect motifs. The effects of replication slippage sun microsite in Yehudiyya, northeast of the Sea of Galilee, and recombinational effects (eg, unequal crossing over) on Israel. It was found that allele distribution at SSR loci is SSR diversity varied with SSR motifs. Ecological stresses clustered and constrained with lower or higher boundary. (sun vs shade) may affect mutational mechanisms, influen- This may imply that SSR have functional significance and cing the level of SSR diversity by both processes. natural constraints.
    [Show full text]
  • Gene Prediction and Genome Annotation
    A Crash Course in Gene and Genome Annotation Lieven Sterck, Bioinformatics & Systems Biology VIB-UGent [email protected] ProCoGen Dissemination Workshop, Riga, 5 nov 2013 “Conifer sequencing: basic concepts in conifer genomics” “This Project is financially supported by the European Commission under the 7th Framework Programme” Genome annotation: finding the biological relevant features on a raw genomic sequence (in a high throughput manner) ProCoGen Dissemination Workshop, Riga, 5 nov 2013 Thx to: BSB - annotation team • Lieven Sterck (Ectocarpus, higher plants, conifers, … ) • Yao-cheng Lin (Fungi, conifers, …) • Stephane Rombauts (green alga, mites, …) • Bram Verhelst (green algae) • Pierre Rouzé • Yves Van de Peer ProCoGen Dissemination Workshop, Riga, 5 nov 2013 Annotation experience • Plant genomes : A.thaliana & relatives (e.g. A.lyrata), Poplar, Physcomitrella patens, Medicago, Tomato, Vitis, Apple, Eucalyptus, Zostera, Spruce, Oak, Orchids … • Fungal genomes: Laccaria bicolor, Melampsora laricis- populina, Heterobasidion, other basidiomycetes, Glomus intraradices, Pichia pastoris, Geotrichum Candidum, Candida ... • Algal genomes: Ostreococcus spp, Micromonas, Bathycoccus, Phaeodactylum (and other diatoms), E.hux, Ectocarpus, Amoebophrya … • Animal genomes: Tetranychus urticae, Brevipalpus spp (mites), ... ProCoGen Dissemination Workshop, Riga, 5 nov 2013 Why genome annotation? • Raw sequence data is not useful for most biologists • To be meaningful to them it has to be converted into biological significant knowledge
    [Show full text]
  • Small Variants Frequently Asked Questions (FAQ) Updated September 2011
    Small Variants Frequently Asked Questions (FAQ) Updated September 2011 Summary Information for each Genome .......................................................................................................... 3 How does Complete Genomics map reads and call variations? ........................................................................... 3 How do I assess the quality of a genome produced by Complete Genomics?................................................ 4 What is the difference between “Gross mapping yield” and “Both arms mapped yield” in the summary file? ............................................................................................................................................................................. 5 What are the definitions for Fully Called, Partially Called, Half-Called and No-Called?............................ 5 In the summary-[ASM-ID].tsv file, how is the number of homozygous SNPs calculated? ......................... 5 In the summary-[ASM-ID].tsv file, how is the number of heterozygous SNPs calculated? ....................... 5 In the summary-[ASM-ID].tsv file, how is the total number of SNPs calculated? .......................................... 5 In the summary-[ASM-ID].tsv file, what regions of the genome are included in the “exome”? .............. 6 In the summary-[ASM-ID].tsv file, how is the number of SNPs in the exome calculated? ......................... 6 In the summary-[ASM-ID].tsv file, how are variations in potentially redundant regions of the genome counted? .....................................................................................................................................................................
    [Show full text]
  • Epigenetics Analysis and Integrated Analysis of Multiomics Data, Including Epigenetic Data, Using Artificial Intelligence in the Era of Precision Medicine
    biomolecules Review Epigenetics Analysis and Integrated Analysis of Multiomics Data, Including Epigenetic Data, Using Artificial Intelligence in the Era of Precision Medicine Ryuji Hamamoto 1,2,*, Masaaki Komatsu 1,2, Ken Takasawa 1,2 , Ken Asada 1,2 and Syuzo Kaneko 1 1 Division of Molecular Modification and Cancer Biology, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045, Japan; [email protected] (M.K.); [email protected] (K.T.); [email protected] (K.A.); [email protected] (S.K.) 2 Cancer Translational Research Team, RIKEN Center for Advanced Intelligence Project, 1-4-1 Nihonbashi, Chuo-ku, Tokyo 103-0027, Japan * Correspondence: [email protected]; Tel.: +81-3-3547-5271 Received: 1 December 2019; Accepted: 27 December 2019; Published: 30 December 2019 Abstract: To clarify the mechanisms of diseases, such as cancer, studies analyzing genetic mutations have been actively conducted for a long time, and a large number of achievements have already been reported. Indeed, genomic medicine is considered the core discipline of precision medicine, and currently, the clinical application of cutting-edge genomic medicine aimed at improving the prevention, diagnosis and treatment of a wide range of diseases is promoted. However, although the Human Genome Project was completed in 2003 and large-scale genetic analyses have since been accomplished worldwide with the development of next-generation sequencing (NGS), explaining the mechanism of disease onset only using genetic variation has been recognized as difficult. Meanwhile, the importance of epigenetics, which describes inheritance by mechanisms other than the genomic DNA sequence, has recently attracted attention, and, in particular, many studies have reported the involvement of epigenetic deregulation in human cancer.
    [Show full text]
  • The Economic Impact and Functional Applications of Human Genetics and Genomics
    The Economic Impact and Functional Applications of Human Genetics and Genomics Commissioned by the American Society of Human Genetics Produced by TEConomy Partners, LLC. Report Authors: Simon Tripp and Martin Grueber May 2021 TEConomy Partners, LLC (TEConomy) endeavors at all times to produce work of the highest quality, consistent with our contract commitments. However, because of the research and/or experimental nature of this work, the client undertakes the sole responsibility for the consequence of any use or misuse of, or inability to use, any information or result obtained from TEConomy, and TEConomy, its partners, or employees have no legal liability for the accuracy, adequacy, or efficacy thereof. Acknowledgements ASHG and the project authors wish to thank the following organizations for their generous support of this study. Invitae Corporation, San Francisco, CA Regeneron Pharmaceuticals, Inc., Tarrytown, NY The project authors express their sincere appreciation to the following indi- viduals who provided their advice and input to this project. ASHG Government and Public Advocacy Committee Lynn B. Jorde, PhD ASHG Government and Public Advocacy Committee (GPAC) Chair, President (2011) Professor and Chair of Human Genetics George and Dolores Eccles Institute of Human Genetics University of Utah School of Medicine Katrina Goddard, PhD ASHG GPAC Incoming Chair, Board of Directors (2018-2020) Distinguished Investigator, Associate Director, Science Programs Kaiser Permanente Northwest Melinda Aldrich, PhD, MPH Associate Professor, Department of Medicine, Division of Genetic Medicine Vanderbilt University Medical Center Wendy Chung, MD, PhD Professor of Pediatrics in Medicine and Director, Clinical Cancer Genetics Columbia University Mira Irons, MD Chief Health and Science Officer American Medical Association Peng Jin, PhD Professor and Chair, Department of Human Genetics Emory University Allison McCague, PhD Science Policy Analyst, Policy and Program Analysis Branch National Human Genome Research Institute Rebecca Meyer-Schuman, MS Human Genetics Ph.D.
    [Show full text]
  • Mathematical Challenges from Genomics and Molecular Biology Richard M
    Mathematical Challenges from Genomics and Molecular Biology Richard M. Karp fundamental goal of biology is to un- algorithms and the role of combinatorics, opti- derstand how living cells function. This mization, probability, statistics, pattern recognition, understanding is the foundation for all and machine learning. higher levels of explanation, including We begin by presenting the minimal information Aphysiology, anatomy, behavior, ecology, about genes, genomes, and proteins required to and the study of populations. The field of molec- understand some of the key problems in genomics. ular biology analyzes the functioning of cells and Next we describe some of the fundamental goals of the processes of inheritance principally in terms of the molecular life sciences and the role of genomics interactions among three crucially important classes in attaining these goals. We then give a series of of macromolecules: DNA, RNA, and proteins. brief vignettes illustrating algorithmic and mathe- Proteins are the molecules that enable and execute matical questions arising in a number of specific most of the processes within a cell. DNA is the car- areas: sequence comparison, sequence assembly, rier of hereditary information in the form of genes gene finding, phylogeny construction, genome re- and directs the production of proteins. RNA is a key arrangement, associations between polymorphisms intermediary between DNA and proteins. and disease, classification and clustering of gene Molecular biology and genetics are undergoing expression data, and the logic of transcriptional revolutionary changes. These changes are guided by control. An annotated bibliography provides point- a view of a cell as a collection of interrelated sub- ers to more detailed information.
    [Show full text]
  • Genomics & Comp. Biology (GCB)
    Genomics & Comp. Biology (GCB) 1 GCB 535 Introduction to Bioinformatics GENOMICS & COMP. BIOLOGY This course provides overview of bioinformatics and computational biology as applied to biomedical research. A primary objective of the (GCB) course is to enable students to integrate modern bioinformatics tools into their research activities. Course material is aimed to address GCB 493 Epigentics of Human Health and Disease biological questions using computational approaches and the analysis Epigenetic alterations encompass heritable, non-genetic changes to of data. A basic primer in programming and operating in a UNIX chromatin (the polymer of DNA plus histone proteins) that influence enviroment will be presented, and students will also be introduced to cellular and organismal processes. This course will examine epigenetic Python R, and tools for reproducible research. This course emphasizes mechanisms in directing development from the earliest stages of direct, hands-on experience with applications to current biological growth, and in maintaining normal cellular homeostasis during life. We research problems. Areas include DNA sequence alignment, genetic will also explore how diverse epigenetic processes are at the heart of variation and analysis, motif discovery, study design for high-throughput numerous human disease states. We will review topics ranging from a sequencing RNA, and gene expression, single gene and whole-genome historical perspective of the discovery of epigenetic mechanisms to the analysis, machine learning, and topics in systems biology. The relevant use of modern technology and drug development to target epigenetic principles underlying methods used for analysis in these areas will mechanisms toincrease healthy lifespan and combat human disease. be introduced and discussed at a level appropriate for biologists The course will involve a ccombination of didactic lectures, primary without a background in computer science.
    [Show full text]
  • Genomics, Epigenetics and Their Application to Elucidate the Mechanism of Efficacious Actives for Personal Care
    Genomics, Epigenetics and Their Application to Elucidate the Mechanism of Efficacious Actives for Personal Care SCC Ontario Education Day Toronto, September 2011 Philip Ludwig Arch Personal Care Outline of the talk . The Human Genome: An Anniversary . Examination of Skin Antioxidants via Human Genomic Microarrays . Examination of Skin Lightening Ingredients via Human GiGenomic Microarrays . Examination of Epigenetic Methylation via Human Epigenomic Arrays . Conclusions Outline of the talk . The Human Genome: An Anniversary . Examination of Skin Antioxidants via Human Genomic Microarrays . Examination of Skin Lightening Ingredients via Human GiGenomic Microarrays . Examination of Epigenetic Methylation via Human Epigenomic Arrays . Conclusions The Human Genome: An Anniversary Science published a four part series celebrating the completion of the human genome sequencing. This occurred 10-years ago this year. The Human Genome 23 Human Chromosomes The Human Genome . Contains approximately 3 billion base pairs . We each vary by only 0.1 %, or approximately 3 million base pairs . The human genome has approximately 25,00025,000--30,00030,000 functioning genes . Approximately 1.5% of the genome codes for protein producing genes ––thethe rest is nonnon--cocoding RNA, in trons, nonnon--cocoding DNA . Our genes are provided to us equally by two parents . They define our physical makeup Outline of the talk . The Human Genome: An Anniversary . Examination of Skin Antioxidants via Human Genomic Microarrays . Examination of Skin Lightening Ingredients
    [Show full text]
  • Genomics Education in the Era of Personal Genomics: Academic, Professional, and Public Considerations
    International Journal of Molecular Sciences Review Genomics Education in the Era of Personal Genomics: Academic, Professional, and Public Considerations Kiara V. Whitley , Josie A. Tueller and K. Scott Weber * Department of Microbiology and Molecular Biology, 4007 Life Sciences Building, 701 East University Parkway, Brigham Young University, Provo, UT 84602, USA; [email protected] (K.V.W.); [email protected] (J.A.T.) * Correspondence: [email protected]; Tel.: +1-801-422-6259 Received: 31 December 2019; Accepted: 22 January 2020; Published: 24 January 2020 Abstract: Since the completion of the Human Genome Project in 2003, genomic sequencing has become a prominent tool used by diverse disciplines in modern science. In the past 20 years, the cost of genomic sequencing has decreased exponentially,making it affordable and accessible. Bioinformatic and biological studies have produced significant scientific breakthroughs using the wealth of genomic information now available. Alongside the scientific benefit of genomics, companies offer direct-to-consumer genetic testing which provide health, trait, and ancestry information to the public. A key area that must be addressed is education about what conclusions can be made from this genomic information and integrating genomic education with foundational genetic principles already taught in academic settings. The promise of personal genomics providing disease treatment is exciting, but many challenges remain to validate genomic predictions and diagnostic correlations. Ethical and societal concerns must also be addressed regarding how personal genomic information is used. This genomics revolution provides a powerful opportunity to educate students, clinicians, and the public on scientific and ethical issues in a personal way to increase learning.
    [Show full text]
  • Epigenetic Analysis: Bioinformatic Applications for Research
    Epigenetic Analysis: Bioinformatic Applications for Research Fios Genomics| Epigenetic Analysis: Bioinformatic Applications for Research 1 Index 1. What is epigenetics? 2. How to quantify epigenetic modification? 3. Challenges and resolutions for epigenetic research 4. Future of epigenetic research 5. Fios Genomics’ expertise 6. References Fios Genomics| Epigenetic Analysis: Bioinformatic Applications for Research 2 1.What is epigenetics analysis 1.1 What is epigenetics? Epigenetics is the study of physical Epigenetic modifications are dynamic modifications of DNA which do not alter and can occur naturally. However, several the underlying genetic sequence. This factors such as environment and lifestyle, encapsulates heritable changes which disease stage, and ageing, all affect the induce phenotypic variation without epigenome in context-specific ways. corresponding genotypic variation, and Epigenetic modification is a tightly includes DNA methylation and histone regulated process and in normal, healthy modifications. These modifications affect cells it is essential to regulate various how cells interpret gene sequences, which processes; inappropriate epigenetic in turn change the expression pattern of modification can have long-lasting effects genes. Epigenetic modifications essentially as well as deleterious results in a cell or underpin the cellular diversity within an tissue. organism. 1.2. Why analyse epigenetic modification? The understanding of epigenetic processes has an important role in the research of cancers, metabolic syndromes, brain disorders and development amongst other areas. By analysing epigenetic changes, investigations into disease mechanisms and the development of therapies which target the epigenome are Disease facilitated. Mechanisms Epigenetic modifications are influenced by the environment and lifestyle, which makes them important to consider as part of clinical research studies to further understand how a drug may specifically benefit certain sub-populations.
    [Show full text]