olg odn odnW1 B,UK. 6BT, WC1E London London, College eia nvriyo ina ina19,Austria. 1090, Vienna Vienna, of University Medical clßlt ,D419Mu D-48149 5, Schloßplatz u Yang Rui Par3 pathway through novel polarity a neuronal in regulate phosphorylation kinases Ndr and Rassf5 ARTICLE RESEARCH eevd2 oebr21;Acpe ue2014 June 2 Accepted 2013; November 20 Received " § USA 97239, Health OR Oregon Portland, Research, ` University, Neurosciences Science for and Center Jungers address: *Present Mu of University 1 with domain STK38L) kinase Mammalian as their known studied. conserved (also but well Ndr2 a and and 2006b), less share STK38) polarity as is al., known cell (also cells et Ndr1 Guan, in mammalian (Hergovich and in roles Yu yeast function important 2006b; in play al., morphogenesis et kinases as (Hergovich Ndr act human conserved 2013). kinases are to and distribution (Ndr) pathways yeast essential polarized from these Dbf2-related of the one nuclear of and components The cycle molecules. pathways cell conserved of growth, by controlled regulate are that morphology and size Cell INTRODUCTION as Par kinases, Ndr function formation, Axon conserved polarity, Cell WORDS: a KEY perform polarity. polarity kinases cell neuronal of Ndr regulators in the role during that Their Par3 polarity. suggests of neuronal transport of Rassf5–Ndr–Par3 the with establishment novel regulates interaction a that reinforcing identify cascade and its results signaling Par3 Our inhibit of specification. distribution by to axon the act polarizing Ser383 thereby kinases at dynein, of Ndr formation Par3 the the phosphorylating Mechanistically, prevent to axons. neurons supernumerary the during hippocampal required are of (also Ndr2 Par3 or polarization Ndr1 protein and polarity Rassf5 PARD3). the tumor as of known the of upstream downstream and act of Rassf5 they establishment suppressor that the show (also We in neurons. Ndr2 respectively) in and STK38L, polarity Ndr1 or mammalian is STK38 of as it function known cells. the but mammalian analyze in invertebrates we function similar Here, and cell a perform yeast in they whether in roles unclear morphogenesis important The play and factors. kinases polarity regulatory Ndr of conserved distribution evolutionarily asymmetric pathways on the depend control cells of that growth polarized and morphology The ABSTRACT aha,wihcnrl elgot n ra ieb promoting by size organ and The growth 2013). signaling cell Hippo Guan, controls the and which of pathway, Yu components (Hergovich 2006b; central 2 are al., kinases et and Lats/Warts Hergovich 1 2006a; (Lats) al., suppressor et tumor Large mammalian rsn drs:Dprmn fNuohsooyadNeuropharmacology, and Neurophysiology of Department address: Present hs uhr otiue qal oti work this to equally contributed authors These fu Institut uhrfrcrepnec ([email protected]) correspondence for Author 04 ulse yTeCmayo ilgssLd|Junlo elSine(04 2,36–46doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal | Ltd Biologists of Company The by Published 2014. ¨ oeuaeZlbooi,Westfa Zellbiologie, Molekulare r 1, ¨ ,EynKong Eryan *, se,D419Mu D-48149 nster, ¨ se,Germany. nster, ¨ se,Germany. nster, 1, ` ,§ ¨ 3 igJin Jing , iceWilhelms-Universita lische el-nMto lse fExcellence, of Cluster Cells-in-Motion 2 C acrIsiue University Institute, Cancer UCL Drosophila 1,§ lxne Hergovich Alexander , at and Warts ¨ tMu ¨ nster, tgr ta. 04 ihlosie l,20) eswell Less which 2008). themselves, al., kinases Mst et 2005; of 2004; Vichalkovski al., regulation al., et the 2004; et is Stegert Mst-kinase-mediated al., understood 2009; (Bichsel hydrophobic al., et by respectively) et activated Stegert their Hergovich T442, and are in 2011; and Hergovich, Ndr2 residues Mob1 (T444 and conserved motif Ndr1 with at and kinases, phosphorylation interaction YAP Lats of regulators the by homologs transcriptional Like the the TAZ. respectively), phosphorylate STK3, which (also al., and Mst2 et and Zhao STK4 Drosophila Mst1 2013; pathway, as Guan, Hippo and known mammalian Yu the 2007; In Pan, 2011). 2007; (Harvey proliferation Tapon, inhibiting and and differentiation and death cell htattruhtePrplrt ope Grao ta. 2007; al., et (Garvalov Pu complex and polarity of Cdc42 Par Schwamborn activity the and 4. sequential through Rap1 stage act the GTPases of that the on Kaibuchi, at and establishment depends 3-kinase and pathway phosphatidylinositol the (Arimura dendrites key remaining identified direct One been into 2007). The that have rapidly. polarity is differentiate cascades neuronal neurites elongates signaling the to and of Several one begin the axon when during the 3, neurites established stage as to is can 2 selected have polarity all stage and potentially Neuronal from unpolarized that transition axon. length are an similar neurons of become 2 neurites Stage minor 1977; 1988). Cowan, several al., and go (Banker et neurons differentiation Dotti of Hippocampal stages formation. five axon to through essential of therefore, how understanding is, Elucidating achieved the the factors. is distribution polarity At asymmetric of involves 2009). this polarity distribution Polleux, neuronal asymmetric and of an (Barnes establishment this axon polarized level, single a molecular to a neurites with short multiple neuron with neuron unpolarized an 2012). al., et Ultanir neuronal 2007; during al., formation et spine (Hergovich duplication and development centrosome arborization dendrite of regulation in kinases the and Ndr in Mammalian implicated 2000). been al., et have (Zallen far thus has kinases the function Ndr for similar reported a but been initiation not 2005). neurite al., regulates et also al., He SAX-1 et 2004; Emoto Bargmann, 2004; and al., Gallegos et 2006; (Emoto dendrites patterning in involved The mice 2006a). and elegans knockout al., Caenorhabditis et of Scheel Hergovich phenotype 2010; al., the 2004; et by (Cornils suggested al., as redundantly et act Khokhlatchev Praskova 2011). 2007; al., 2007; et al., Tapon, Pan, Zhao et 2003; and 2002; Hwang Hofmann, Harvey 2003; al., 2006; al., al., et et 1 et Hesson family (Calvisi 2007; domain Rassf5 Ras-associated like and proteins proteins scaffolding (Rassf1) on suppressor also tumor but kinases the on only not depends rca tpi ernldfeetaini h rniinfrom transition the is differentiation neuronal in step crucial A to appear and specificity substrate similar show Ndr2 and Ndr1 2 n nra .Pu W. Andreas and ip,tgte ihMb,atvt as n Lats2, and Lats1 activate Mob1, with together Hippo, shl 04.Ti ope sfre by formed is complex This 2004). ¨schel, d ooosTionrdadSX1are SAX-1 and Tricornered homologs Ndr Drosophila schel ¨ 1,3, rcree rmammalian or Tricornered " Drosophila .elegans C. 3463 and

Journal of Cell Science eoe etitdt h xna tg Shabr and (Schwamborn 3 specific stage its at on axon but 2 depends the stage at Par3 to neurites all of restricted in 2001; present function becomes is Jan, The it localization; and 2003). subcellular other Jan many al., Pu 2007; also and et Kaibuchi, but Khazaei and neurons 2000; is Kemphues, in (Arimura and only types (aPKC) not (also C cell Par6 kinase polarity protein PARD3), for atypical as required and known PARD6) also as (Par3, known 3 defective Partition ARTICLE RESEARCH omn utpeaosudrec odto a sfollows: as of was 3464 function condition neurons each redundant the under of a percentage axons (the multiple indicates polarity forming neuronal which double in kinases Ndr1/2 alone, Ndr Ndr1M the only Ndr2M confirming of Interestingly, expression 1C,D), or by effect. (Fig. rescued was and kinases the phenotype Ndr1 Ndr knockdown of Co- against of specificity shown). shRNAs loss the the the not time- and or rescued were (data Ndr1 later Ndr2M) Ndr2 RNAi-resistant and a formation for neurons (Ndr1M at vectors axon Ndr2 with transfection when neurons affect – of not only plating transfection after did detectable h point 2 with was at neurons 74 transfected of defect from 23 proportion from the reduced polarity increased whereas was axons Ndr2, supernumerary axon and Ndr1 percentage single both The a the axons. with (mean in Tau-1-positive resulted neurons and multiple suppressed of both polarity of of neuronal were detected knockdown disrupted formation was Ndr2 simultaneous Ndr2 axons and However, of Ndr1 or multiple shown). formation with the not Ndr1 or on (data axon effect When of no single individually, number 1C,D). a (Fig. with the on effect axon, quantifying axons the an by and without DIV, antibody analyzed 3 neurons with was at and Tau-1 marker polarity marker dendritic against neuronal axonal a an antibody as as MAP2 with against MAPT) stained as Ndr2 known or were (also Ndr1 Neurons suppress efficiently 1B). (Fig. that (shRNAs) neurons RNAs hippocampal days hairpin Ndr, 0 of at neurites function transfected minor the in were analyze present were To signals 1A). weak (Fig. mainly only detectable and were axon, neurons the kinases unpolarized in Ndr revealed polarization, of 2007) After al., neurites 1A). et all (Fig. (Hergovich in Ndr2 immunoreactivity and C-terminal Ndr1/2 Ndr1 conserved both the of recognizing region antibody polarity an neuronal with for Staining required are kinases Ndr RESULTS supernumerary the of Par3, formation of the distribution asymmetric axons. prevents the the pathway polarizing facilitates also By Rassf5–Ndr by (Dlic2, thereby Par3. 2 of and Par3 its localization chain DYNC1LI2) blocks of intermediate as phosphorylation distribution light known This dynein the with Ser383. regulate interaction at supernumerary Ndr2 disrupts it of 2 and formation phosphorylating and the Ndr1 Ndr1 induces axons. of and suppression polarity acts simultaneous loss neuronal Rassf5 The or activity. Par3. their pathway Rassf5 of stimulates signaling and of distribution kinases novel the Ndr the a polarize of in to upstream act required they is that that show and 2004). al., formation et Nishimura neuronal 2013; for al., essential et is axon (Funahashi Par3 the the polarity to of that Par3 showing of transport neurons, localization hippocampal restricted kinesin-2-dependent in defects the polarity causes with interfering by Pu shl 04 h ta. 03.Dsuto fPr localization Par3 of Disruption 2003). al., et Shi 2004; ¨schel, ee eivsiaetefnto fNr n d2i axon in Ndr2 and Ndr1 of function the investigate we Here, 6 ... ncnrl o50 to controls in s.e.m.) nvitro in shl 09 ho 01 Shi 2001; Ohno, 2009; ¨schel, DV ihvcosfrshort- for vectors with (DIV) 6 %atrkokonof knockdown after 2% 6 %t 47 to 2% 6 % This 1%. 6 2% from by polarity neuronal in T442. involved at Ndr2 pathway of novel phosphorylation the a of stimulating regulator upstream in an as Ndr2 acts Rassf5 Thus, knockdown. Rassf5 o ernlplrt.Terls ed otefrainof formation polarization. the during extended the to are restrict that leads Ndr2 required axons and are of loss Ndr1 number kinases that Their indicating Ndr axons, polarity. the supernumerary that neuronal show for results these together, 22 Ndr1M, 23 control, ern ihmlil xn nrae rm24 the by from rescued be could increased knockdown Rassf5 of axons the number of the phenotype multiple with 2B), transfection (Fig. in (mean with After shRNA detectable 2A). Rassf5 (Fig. mainly neurons expressing neurons was 3 vector but stage a of 2 2009; stage throughout axon present al., the is at et Rassf5 2009). neurons Oh al., 2003; et unpolarized Zhou al., 2010; al., et the et kinases, (Hesson Song Mst Rassf5 of regulator suppressor known of a tumor upstream Zhou targeted directly 2008; we redundancy Ndr2, al., this and et Ndr1 circumvent Vichalkovski Song To 2005; 2009; 2011b; 2009). al., al., al., et et al., act et Oh Stegert 2003; et 2010; that al., 442, al., (Cornils et kinases et Hesson and motif 2009; Mst al., Thr444 hydrophobic et different Hergovich of the by in phosphorylation regulated respectively, the are through 2 redundantly and upstream Ndr1 acts and polarity Ndr1/2 neuronal of for required is Rassf5 edfiutt eetb tiigalaos hrfr,we material 41 (supplementary Therefore, that DIV found axons. 3 We at all S1). them Fig. staining analyzed could and by formation embryos E17 their detect from neurons and hippocampal to isolated system, axon stable difficult nervous be in be developing not defects might the show axons in not supernumerary hippocampal did However, or formation. antibody with Staining layers shown). anti-neurofilament obvious not cortical any (data an (E)17 show of day not embryonic development do at structures and the 2010) in al., et defects (Park 2010). viable al., are et mice (Park polarity mice neuronal Rassf5-knockout in analyzed Rassf5 we of function the investigate To in polarization slices neuronal cortical blocks Rassf5 of Knockdown multiple with neurons of number the (39 as not axons Rassf5, did of loss Ndr2-T442A the mutant rescue multiple non-phosphorylatable with The neurons control. of number the (24 reduced axons the and rescue Rassf5 to of sufficient loss was Ndr2-T442D mutant After phospho-mimic 31 3B,C). kinases to (Fig. compared Rassf5 47 axons Mst of Rassf5, knockdown of by the suppression rescue phosphorylation to 3A) mimics mutant (Fig. Ndr2 an that of ability the (Ndr2-T442D) tested we polarity, neuronal regulate of that to similar is knockdown. that to double phenotype a Ndr1/2 axons in the multiple results loss with its and neurons polarity of number (Rassf5M), 23 the Rassf5 of reduced version which RNAi-resistant an of coexpression 13 as5i xnformation. axon in Rassf5 ocnimta as5adNr/ c ntesm aha to pathway same the in act Ndr1/2 and Rassf5 that confirm To 6 6 %(i.2,) hs as5i eurdfrneuronal for required is Rassf5 Thus, 2C,D). (Fig. 4% %i utrsfrom cultures in 3% Rassf5 6 ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal ... ntecnrlt 50 to control the in s.e.m.) 6 6 6 6 % a o infcnl ifrn rmta fthe of that from different significantly not was 3%) % oalvlta a oprbet hto the of that to comparable was that level a to 2%) 2 % d12sRA,47 shRNAs, Ndr1/2 2%; % d12sRA n d2,26 Ndr2M, and shRNAs Ndr1/2 3%; / 2 mro omdmlil xn oprdwith compared axons multiple formed embryos 6 %o oto ern.Epeso fthe of Expression neurons. control of 5% Rassf5 6 6 %o h ern omdmultiple formed neurons the of 1% %(mean 2% +/ 2 ris ofrigterl of role the confirming brains, 6 % d12sRA and shRNAs Ndr1/2 1%; 6 Rassf5 6 %(i.2,) The 2C,D). (Fig. 4% ... fteneurons the of s.e.m.) +/ 2 and 6 %.Taken 3%). Rassf5 Rassf5 nvivo in 6 2 2 2% / / 2 2 ,

Journal of Cell Science EERHARTICLE RESEARCH tg n tg n tie iha nioyaantteNrCD ihrmgiiaino h xna tg ssoni h oe-etcre.Scal corner. lower-left the in shown is 3 stage at axon the of magnification higher A Ndr-CTD. the axons. against supernumerary antibody an of with formation stained the and 10 in 3 bars: results stage Ndr2 and and 2 Ndr1 stage of Knockdown 1. Fig. ohtesRAaantRsf n F Fg ) RGCs 4). (Fig. GFP and Rassf5 against expresses that shRNA vector of a the with cortex transfected both the was imaging, is embryos live-cell of wild-type that phenotype by the process investigate neurons To as zone. Rassf5-knockdown leading extends intermediate that the process a in trailing axon a the extending and migration by radial for the bipolar required in Subsequently, become zone. morphology intermediate they multipolar and a (SVZ) zone assume subventricular migration, first the their generate transfection During neurons to 2009). newborn zone after Polleux, and ventricular (Barnes h the radial plate 36 leave from cortical and zone at ventricular (RGCs) the cells in cultures glial arise neurons by slice Cortical 4). polarization of (Fig. neuronal imaging analyzed and live-cell brains performed embryonic we E14.5 brain, developing the ecnaeo noaie ern ihu nao 0 ht) oaie ern ihasnl xn(,ga)adnuoswt utpeaos( axons multiple 50 with bars: neurons Scale and overlay). gray) in (1, (red axon antibody RNAi). single anti-MAP2 (Ndr1+2 a an Ndr2 with and and neurons overlay) Ndr1 polarized against in white), directed (blue mean (0, shRNAs antibody the and axon (WB) Tau-1 are N2M) blotting an the Values (Ndr2M, western without with shown. Ndr2 by tra neurons stained or were analyzed and unpolarized N1M) neurons was DIV of Hippocampal (Ndr1M, GFP–Ndr2 3 percentage (C) Ndr1 and at loading. shRNA-resistant GFP–Ndr1 fixed protein (green), and of were GFP efficiencies expression Neurons for transfection The vectors comparable indicated. with confirmed as DIV GFP (control), for 0 Staining pSM2 antibody. or anti-GFP (N2-sh) an Ndr2 using and (N1-sh) Ndr1 against ots hte as5i eurdfrnuoa oaiainin polarization neuronal for required is Rassf5 whether test To m .()HK23 el eetasetdwt etr o F,Nr,Nr rsRArssatNr NrM rNr NrM n shRNAs and (Ndr2M) Ndr2 or (Ndr1M) Ndr1 shRNA-resistant or Ndr2 Ndr1, GFP, for vectors with transfected were cells 293T HEK (B) m. 6 ...(he transfections, (three s.e.m. xvivo ex lcrprto of electroporation n . 0) s o-infcn;*** non-significant; ns, 100); irto ncnrlclue Fg AB.A 6hatrthe after 45 h SVZ, 36 34 or and At zone 4A,B). ventricular radial (Fig. the their cultures initiated 20 control and transfection, bipolar in became migration that neurons positive by transfected a oprbet htosre ncnrl,bt68 (20 but SVZ controls, in or after observed zone GFP- that blocked ventricular to of the was comparable number in was The plate present construct. to cells cortical knockdown positive increased the the had of into transfection plate the zone period, cortical imaging bipolar intermediate the the of of in end number 50 neurons the large At of a 4A,B). material percentage Fig. h, (supplementary 2; 23 plate 1, cortical of Movies the period into migrated a neurons Over 4C). (Fig. 6 %(i.4) ycnrs,temgainfo the from migration the contrast, By 4C). (Fig. 1% P 6 ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal # %hdrahdtecria lt ntecnrlslices control the in plate cortical the reached had 2% .0 oprdwt oto GPpM) w-a ANOVA. two-way (GFP+pSM2); control with compared 0.001 A ipcma ern rmE8rtebyswr ie at fixed were embryos rat E18 from neurons Hippocampal (A) 6 xvivo ex %o h F-oiieclswr rsn in present were cells GFP-positive the of 5% lcrprto aers oGFP- to rise gave electroporation 6 %i h nemdaezone intermediate the in 4% m 6 . .()The (D) m. %o the of 2% ,bak is black) 1, setdat nsfected 6 3465 3%) e

Journal of Cell Science EERHARTICLE RESEARCH utplrt ioa opooy upeso fRassf5 of Suppression after 3466 morphology. phase bipolar from suggest transition a multipolar the results to for these neurons the multipolar cortical together, in a in required Taken is Rassf5 neurons were remain Rassf5. that these they of of they why morphology knockdown The that explain 4B). after (Fig. might indicates migrate processes which to thin Rassf5, unable multiple of extended and knockdown zone zone intermediate change intermediate the the not in 62 did 20 remained h, only 23 neurons distribution After transfected period. This the imaging 11 plate. the only during and cortical significantly zone the intermediate the reached in found were cells 10 bars: Scale corner. lower-left the in shown is 3 stage at axon the of magnification polarity. higher neuronal A antibody. for anti-Rassf5 required the is Rassf5 2. Fig. as5o S2(oto) ern eefxda I n tie ihteTu1atbd bu noely n nat-A2atbd rdi vra) S overlay). in (red antibody anti-MAP2 against an shRNA and an overlay) and in (blue (R5M) antibody Rassf5A ANOVA. Tau-1 shRNA-resistant two-way the (green), with stained GFP efficien and for transfection DIV The vectors comparable 3 indicated. with confirmed at as GFP DIV fixed 50 (control), for were 0 bars: Staining Neurons pSM2 at antibody. (control). or transfected anti-HA pSM2 (R5-sh) were an or Rassf5 using neurons Rassf5 against (WB) Hippocampal blotting shRNA (C) western an loading. by and protein analyzed (R5M) was HA–Rassf5A Rassf5A shRNA-resistant of expression HA–Rassf5A, GFP, for vectors with xn ( axons . 6 m ,bak sson ausaetemean the are Values shown. is black) 1, .()Tepretg fuplrzdnuoswtota xn(,wie,plrzdnuoswt igeao 1 ry n ern ihmultiple with neurons and gray) (1, axon single a with neurons polarized white), (0, axon an without neurons unpolarized of percentage The (D) m. %wr rsn ntecria lt.Mn ern in neurons Many plate. cortical the in present were 2% 6 A ern rmtehpoapso 1 a mro eefxda tg n tg ,adsandwith stained and 3, stage and 2 stage at fixed were embryos rat E18 of hippocampus the from Neurons (A) ...(he transfections, (three s.e.m. 6 6 %had 2% %of 3% n . lcstefraino igelaigpoesadasingle a and process leading single a axon. of trailing formation the blocks eeldta h Rdmi,tePZ oanadteC- the and domain for sites PDZ1 binding as the act Par3 cells domain, of 1116–1356) 293T acids CR (HEK) (amino with terminus the kidney embryonic coexpressed that human GFP–Ndr2 revealed in or Mst1 and GFP–Ndr1 individual Mob1 neuronal and with assays Ndr1 domains for pulldown of GST partner Par3 required shown). interaction not an (data are as Ndr2 Par3 and that identified we proteins and tested polarity, with we formation, interaction axon regulate their kinases Ndr neurons how hippocampal elucidate in To Ser383 at Par3 phosphorylates Ndr2 5) s o-infcn;*** non-significant; ns, 150); ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal P # .0 oprdwt oto (GFP+pSM2); control with compared 0.001 m .()HK23 el eetransfected were cells 293T HEK (B) m. isand cies cale

Journal of Cell Science s o-infcn;* non-significant; ns, EERHARTICLE RESEARCH o1 s1adMcPr eeepesdi E 9Tcells 293T HEK in expressed GFP–Ndr2, were when Myc–Par3 observed and Ndr2-PIF- also Mst1 with was Mob1, detectable phosphorylation signal weak Ser383, Par3 a the KD. at only Ndr2-PIF was detected 5A). there by (Fig. whereas clearly GST–Par3-PDZ1/2 cells 293T of antibody HEK phosphorylation from anti-phospho-Ser383-Par3 purified were The that 2004) (Stegert (NDR2-PIF-KD) al., NDR2- mutant et by NDR2-PIF active kinase-dead a phosphorylated constitutively or PIF and is GST–Par3-PDZ1/2 Par3 an expressed that in confirmed Ndr2 phospho- The antibody neurons. in and specific system heterologous was a of in (phospho)-Ser383-Par3 specificity confirmed phosphorylated The against for below). antibody essential (see is polarity the that that neuronal showed site in phosphorylation function analysis Ndr2 Par3 of further main phosphorylation the Our is for successful. Ser383 Ser383. specific not at antibody were phosphorylation an Ser1196 obtain detects to that Attempts antibody the an in C-terminus. generated the (SPGRFpSPD) and at Ser383 (SGRHpSVS) Ser1196 Mob1 – and Par3 domain of PDZ1 in Ndr2 sites independent by Mass phosphorylation phosphorylated is was S2C). that an Fig. using Par3 Par3 interaction of material analysis the and (supplementary spectrometry that coexpression kinases indicating Mst1 cells, Ndr domains 293T Par3 of HEK different in for same proteins expressed The GST–Ndr1, GFP-fusion expressed and S2A,B). bacterially GST–Ndr2 using Fig. when obtained material was result (supplementary kinases both ( axons T multiple the with with stained neurons and and DIV (N2-442 50 gray) 3 Ndr2-Thr442 bars: (1, at phospho-mimic axon fixed Scale (green), were single (red). GFP Neurons a antibody for indicated. with as vectors anti-MAP2 neurons (control), with an pSM2 DIV and or 0 Rassf5 (blue) at against antibody shRNA transfected an were and neurons (N2-442A) Rassf5. Hippocampal Ndr2-Thr442 of (B) phosphorylatable suppression activity. the kinase rescue its to activate sufficient and is Ndr2-T442D 3. Fig. ocnimtepopoyaino a3b d iae,we kinases, Ndr by Par3 of phosphorylation the confirm To nvitro in nvitro in iaeasyrsle nteietfcto ftwo of identification the in resulted assay kinase P , .5 *** 0.05; hshrlto sa sn bacterially using assay phosphorylation P # .0,cmae ihcnrl(F+S2;towyANOVA. two-way (GFP+pSM2); control with compared 0.001, m .()Tepretg fuplrzdnuoswtota xn(,wie,polarized white), (0, axon an without neurons unpolarized of percentage The (C) m. . ,bak sson ausaetemean the are Values shown. is black) 1, A ceai ersnaino d2 s iae hshrlt d2a h42(p) Thr442 at Ndr2 phosphorylate kinases Mst Ndr2. of representation Schematic (A) hwta a3i hshrltda e33b d kinases Ndr by Ser383 at phosphorylated axon. results the these is in together, specifically Par3 Taken almost that shown). also was not show Par3 (data phospho-S383 lost for signal completely the shRNA, an by 7 knockdown, hshrltda e33wssgiiatyrdcdi the in reduced significantly 80 was [control, Par3 Ser383 for axon staining Ndr2, at and Ndr1 of phosphorylated knockdown 3, detected After stage be axon. At could the the in 5C). phospho-Ser383-Par3 of (Fig. using accumulation is brain brain strong the Par3 a in rat kinases that E18 Ndr by indicates from phosphorylated at lysates phospho-S383-Par3 which neurons in antibody, endogenous detected unpolarized anti-phospho-S383-Par3 be Moreover, in also dendrites 5B). could Par3 (Fig. and soma 2 stage for control, the of a staining signals as Par3. phosphorylated for Strong used antibody the of non- specificity was the when confirming shown). not Myc–Par3-S383A but anti-phospho-S383-Par3 Myc–Par3 phosphorylatable not for the detected were using phosphorylation (data precipitated was antibody Par3 and ecetels fNr n d2(i.5) efudthat found We 5F). (Fig. Ndr2 to non- and ability Ndr1 phosphorylation, their of test 50 Par3 loss to the used of rescue were phospho-mimicking (Par3-S383,1196D) function and mutants (Par3-S383,1196A) the phosphorylatable address for To required is Ndr1/2 polarity by neuronal Par3 of phosphorylation The h nipopoSr8-a3atbd eeldauniform a revealed antibody anti-phospho-Ser383-Par3 The 6 %o h ern omdmlil xn fe double after axons multiple formed neurons the of 3% ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal 6 .. Fg DE.We a3wssuppressed was Par3 When 5D,E). (Fig. a.u.] 2 6 4abtayuis(..;Nr/ double Ndr1/2 (a.u.); units arbitrary 14 6 ...(he transfections, (three s.e.m. n . 5 neurons); 150 ) non- D), 3467 au-1

Journal of Cell Science EERHARTICLE RESEARCH euto nteaon fPr hshrlto.I control In phosphorylation. 3468 Par3 of amount in the results anti-phospho- Rassf5 in of the stained loss reduction with the a We that Rassf5 confirm of to Rassf5. antibody knockdown Ser383-Par3 on whether the investigated depends after we regulates neurons also neurons, in Rassf5 phosphorylation kinases Because Ser383 Ndr of polarity. activity the for neuronal the required is of kinases and Ndr kinases by establishment Ndr Par3 of of was loss phosphorylation the the Par3-S383,1196A that rescue percentage to when sufficient the is axons phospho-mimic in multiple change (44 with coexpressed significant shRNAs. neurons no Ndr1/2 of was the there with However, coexpressed 28 was to reduced was Par3-S383,1196D number This Ndr1/2. of knockdown or axons trailing mark arrowheads black processes, leading 10 mark bars: Scale arrowheads Rassf5. Open of cortic shown. knockdown CP, aft are after shown. h neurons slices are unpolarized 36 Rassf5-knockdown time-points of at and processes performed indicated control was the cultures from 50 at slice bars: imaging slices of Scale cell cortical imaging zone. live-cell ventricular of VZ, and projection) zone; RNAi), (maximum-intensity intermediate (Rassf5 neurons. images Rassf5 of against Representative polarization shRNA (A) the an electroporation. with with interferes pCAGGS-U6-Rassf5 or Rassf5 (control) of pCAGGS-U6 knockdown The 4. Fig. oe(Z,itreit oeadcria lt t0 ,1 n 3hi hw.Vle r h mean the are Values shown. is h 23 and 12 6, 0, at plate **** cortical point); and zone intermediate (VZ), zone P , .01cmae ihcnrl w-a ANOVA. two-way control; with compared 0.0001 6 % Fg G.Teerslsso httePar3 the that show results These 5G). (Fig. 4%) m .()Rpeettv mgs(aiu-nest rjcin ftasetdnuosatr2 flive- of h 23 after neurons transfected of projection) (maximum-intensity images Representative (B) m. 6 %when 1% m .()Tepretg fGPpstv el ntevnrclradsubventricular and ventricular the in cells GFP-positive of percentage The (C) m. a3S8,16 a ufcett eceteRassf5-knockdown the Rassf5, rescue to of sufficient was knockdown Par3-S383,1196D the After were 6C,D). 15 and (Fig. and shRNA DIV DIV 43 3 Rassf5 0 at the at were analyzed neurons for Par3-S383,1196D Hippocampal Rassf5. vectors pseudophosphorylated of loss with the co-transfected rescue to able is Rassf5. on depends reduced phosphorylation strongly the was (9 in immunoreactivity observed was 36 phospho-Ser383-Par3 (intensity, Ser383 axon at distal phosphorylation Par3 neurons, AC 1. riswr rnfce by transfected were brains E14.5 (A–C) 6 et etse hte xrsino Par3-S383,1196D of expression whether tested we Next, 6 6 .. Fg AB.Ti eutcnimdta Par3 that confirmed result This 6A,B). (Fig. a.u.) 2 %o h ern omdmlil xn oprdwith compared phospho-mimic the axons of expression multiple The neurons. formed control of neurons 7% the of 1% ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal 6 ...(he experiments, (three s.e.m. 6 ...Atrsprsino Rassf5, of suppression After a.u.). 4 xvivo ex n 5 0–0 ern e time- per neurons 200–400 lcrprto ihempty with electroporation lpae IZ, plate; al er

Journal of Cell Science 3319A(a3S)adsRA ietdaantNr n d2(d12RA)o S2(oto) sidctd ern eefxda I and DIV 50 3 bars: at Scale fixed overlay). were in Neurons (red indicated. antibody as anti-MAP2 (control), an P transfections, pSM2 and non-phosphorylatable (three or or overlay) RNAi) (Par3-SD) in Par3-S383,1196D (Ndr1+2 (blue phospho-mimic Ndr2 antibody (green), and Tau-1 GFP Ndr1 the for against with vectors directed stained with shRNAs DIV and 0 (Par3-SA) at S383,1196A transfected were neurons Hippocampal (F) anti-phospho-Ser383-Pa the with stained were neurons Hippocampal expres (B) comparable kDa. 20 confirmed in bar: HA mass scale for neuron, molecular Blotting (unpolarized the 2 panel). indicate stage (upper Numbers at antibody panel). antibody (P)-Ser383-Par3 (lower phosphorylated constructs against Ndr2 antibody of using (WB) blotting western EERHARTICLE RESEARCH ihu nao 0 ht) oaie ern ihasnl xn(,ga)adnuoswt utpeaos( axons multiple with neurons and gray) (1, axon single a with neurons polarized white), (0, axon an without uni arbitrary in quantified was 50 mean bars: antibody the Scale anti-phospho-Ser383-Par3 are overlay). the Values in with bars). Ndr (red staining for black shRNAs antibody for RNAi, and dendrites anti-phospho-Ser-383Par3 Ndr1+2 (control), det pSM2 the and bars; and was with soma white overlay) protein axon, stained in control, phosphorylated (green the and of GFP DIV in for precipitation 3 vectors signal the with at and immunofluorescence DIV fixed control, 0 negative RNAi), at as transfected (Ndr1+2 were antibody 2 neurons anti-Myc Hippocampal an (D) or antibody. anti-Par3 anti-phospho-S383-Par3 an the using brain rat E18 an for cells 293T HEK from isolated HA–Ndr2-PIF-KD or Ser383. HA–Ndr2-PIF at with Par3 incubated phosphorylate and kinases Ndr 5. Fig. n . 8 ern) s o-infcn;*** non-significant; ns, neurons); 180 A atral xrse S rGTPr-D1(a3 eeprfe ipt omsi lestaining) Blue Coomassie (input, purified were (Par3) GST–Par3-PDZ1 or GST expressed Bacterially (A) m )adsae3(oaie ern cl a:50 bar: scale neuron, (polarized 3 stage and m) P # .0 oprdwt h oto GPpM) w-a ANOVA. two-way (GFP+pSM2); control the with compared 0.001 6 ...( s.e.m. n . 0;n,nnsgiiat ** non-significant; ns, 10); nvitro in ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal hshrlto sa.Pr hshrlto a nlzdby analyzed was phosphorylation Par3 assay. phosphorylation m ) C a3wsimnpeiiae rmlstsof lysates from immunoprecipitated was Par3 (C) m). P . # m ,bak sson ausaetemean the are Values shown. is black) 1, .1cmae ihcnrl w-a ANOVA. two-way control; with compared 0.01 .()Tepretg fuplrzdneurons unpolarized of percentage The (G) m. m .()Teitniyo the of intensity The (E) m. ce with ected s(a.u.; ts sion 6 s.e.m. 3469 and 1 r3 ar3-

Journal of Cell Science as5Nrsgaigi seta o h salsmn of establishment the for to of Par3 essential downstream and Par3 polarity. is neuronal experiments of kinases signaling phosphorylation these Ndr Rassf5–Ndr that together, the confirmed suggest Taken of results strongly polarity. upstream These neuronal (38 acts axons). regulate knockdown rescue Rassf5 multiple Rassf5 not the formed that did by neurons caused Par3-S383,1196A of defect of polarity expression the the contrast, EERHARTICLE RESEARCH 3470 (19 phenotype 6 %o ern omdmlil xn) By axons). multiple formed neurons of 2% 6 9% n tie iha niMcatbd Fg A supplementary 7A; (Fig. stages antibody different anti-Myc an at its expressed with fixed stained were affects and were Neurons neurons. kinases Myc-Par3-Ser383A hippocampal in Ndr non-phosphorylatable investigate Myc–Par3-Ser383D by To its or phospho-mimic 2003). for the phosphorylation localization, important al., subcellular is et Par3 axon (Shi distal polarity whether the neuronal to in Par3 function of localization The its changes Ndr1/2 by distribution Par3 of phosphorylation The ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal oprdwt h oto GPpM) two- ANOVA. (GFP+pSM2); way control the with compared ern) s o-infcn;** non-significant; ns, neurons); xn(,ga)adnuoswt utpeaxons multiple with neurons single and a gray) with (1, neurons axon polarized white), an (0, without axon neurons unpolarized of percentage mean ( noely.Saebr:50 bars: (red Scale antibody overlay). anti-MAP2 antibody in an Tau-1 and the overlay) with in DIV (blue 3 at Neurons stained indicated. as were (control), pSM2 against or shRNA Rassf5 an and (Par3-SD) Par3- S383,1196D GFP or for (Par3-SA) vectors Par3-S383,1196A with (green), DIV 0 at transfected t cnrl 0t 3 as5sRA o2) n 21). to 3 ** Rassf5-shRNA, 53; to maximum 20 and (control, minimum the 11). show Rassf5-shRNA, Whiskers 43; (control, percentile and 75th 5) Rassf5-shRNA, 29.22; 25th (control, (midline), percentile median (a.u.). the units show arbitrary Boxes in quantified was antibody anti-phospho-Ser383-Par3 for the immunofluorescence with the staining of intensity The overlay). (B) in (red antibody phosphorylated (P)-Ser-383Par3 against and DIV antibody 3 with at stained fixed or were RNAi) Neurons (Rassf5 (control). Rassf5 pSM2 against (green) shRNA GFP for an vectors and with DIV 0 at transfected Rassf5 of effects the knockdown. rescue to sufficient Par3-S383,1196D is phospho-mimic The 6. Fig. ts) C ipcma ern were neurons Hippocampal (C) -test). . P ,bak sson ausaethe are Values shown. is black) 1, # .1cmae ihcnrl(Student’s control with compared 0.01 6 ...(he transfections, (three s.e.m. A ipcma ern were neurons Hippocampal (A) m .()The (D) m. P # 0.01 n . 180 5 7;

Journal of Cell Science EERHARTICLE RESEARCH uhls a eetdi h xn(29 axon the in detected was less in (72 present much soma was Par3-S383A and of dendrites majority the the contrast, By axon. showed the intensity axon, staining the the 49 in of Par3-S383D that Quantification abundant and tip. was the Par3-S383D Par3-S383A including 7A). of (Fig. clear a accumulation distribution observed polarity, was the of higher establishment in the a After difference neurite. axon. displayed longest future the the Par3-Ser383D in is slightly contrast, presumably neurites, is which all neurites By one, in the present longest of was the one Par3-Ser383A including when others, the 3, than stage were longer to transition mutants S3). the Fig. material Par3 non- At (supplementary the neurites phospho-mimic both all throughout neurons, the detected 2 stage and unpolarized phosphorylatable In S3). Fig. material 6 %o h oa inlfrPr-33 a rsn in present was Par3-S383D for signal total the of 1% 6 %o h a3S8Asga)and signal) Par3-S383A the of 4% 6 % Fg B.The 7B). (Fig. 4%) h neato fPr ihDi2(i.7) hc ol lya play could which 7C), to (Fig. significant Dlic2 affected Par3-S383D with clearly no Par3 and Ser383 of of was Par3-S383A mutation interaction the the there of shown), not binding 2004; While (data KIF3A al., the 2009). et in (Nishimura al., difference Par3 et with two interact Schmoranzer Par3 Dlic2, subunit that between dynein proteins the interaction or motor KIF3A the subunit analyzed kinesin-2 the we and Par3, and of soma distribution non- the the to whereas mainly is axon, (data localized dendrites. Ser383 the is phospho- neurites mutant to at Par3-S383D phosphorylatable localizes The Par3 minor localization. preferentially of axonal and mimic phosphorylation its the show for axons required Thus, not between shown). did not Par3-S1196D difference and any Par3-S1196A of distribution oeuiaehwSr8 hshrlto fet the affects phosphorylation Ser383 how elucidate To ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal niaetemlclrms nkDa. in mass molecular Numbers the loaded. indicate and expressed of were amounts proteins comparable tubulin that and confirmed Myc RFP, (input) anti- for an Blotting using antibody. (WB) Myc blotting were western proteins by bound detected the an and with antibody, lysates anti-RFP cell from was (IP) Dlic2 immunoprecipitated cells. 293T HEK in S383A Par3- non-phosphorylatable or phospho-mimic Par3-S383D Par3, (WT) with wild-type coexpressed Myc-tagged were or control) (DIC) (negative RFP–Dlic2 RFP (C) ANOVA. two-way pairs; mean for the signal are total Values the phospho-Ser383-Par3. of percentage the as quantified with was staining antibody for anti-phospho-Ser383-Par3 bars) the (black or dendrites bars) and (gray soma axon the in immunofluorescence image. each 50 below bars: shown Scale is areas squares the by antibody of marked magnification anti-Myc an higher with A stained (Par3). and DIV fixed 3 were at Neurons Myc–Par3- Myc–Par3-S383D. and or GFP S383A encoding vectors with at DIV transfected 0 were neurons Hippocampal localization. (A) subcellular of show patterns Par3-S383D different and Par3-S383A 7. Fig. 6 ...( s.e.m. n m 5 .()Terltv nest fthe of intensity relative The (B) m. ) ** 6); P , .1btenindicated between 0.01 3471

Journal of Cell Science htPr hshrlto tSr8 irpsteinteraction the disrupts Ser383 reported at as phosphorylation Par3- suggests of which Par3 interaction binding abolished, completely that the almost strong but was Dlic2 2009), to a S383D al., et showed (Schmoranzer previously by Par3-S383A analyzed Par3 was RFP-tagged Wild-type interaction and antibody. their with anti-RFP and an using coexpressed cells, immunoprecipitation 239T Par3- were HEK Par3, in Myc-tagged Par3-S383D Dlic2 Par3. and of transport S383A retrograde the in role ARTICLE RESEARCH 3472 of stage neuronal early of an establishment at the redundantly promote to act novel differentiation that a neuronal kinases identifies Ndr pathway of Rassf5–Ndr–Par3 function the of Par3–Dlic2 analysis Our the kinases Ndr activates regulate turn, Rassf5 in to which, distribution. Ser383 Par3 kinases, polarize support Ndr on and data interaction activates our Par3 retrograde Rassf5 together, continuing Taken phosphorylate that of axon. the model the binding in in the the Par3 block results of to dynein transport interaction Failure unregulated to Dlic2. its subunit Par3-Ser383A by dynein explained the be The in with can dendrites. Par3-Ser383A neurons and 3 non-phosphorylatable stage soma of Par3-Ser383A the localization non-phosphorylatable to aberrant the localizes whereas preferentially enrichment mutant axon, the localization. axonal the reproduces its in Par3-Ser383D for phospho-mimic required is The phosphorylation this Par3 the and a rescue of to Rassf5. ability or Ndr1/2 Ndr1/2 the by of by knockdown phosphorylation relevance confirmed mimicking functional is construct The phosphorylation phosphorylation. this Ser383 the of in Par3 results Ndr1/2 of or Rassf5 loss of to knockdown the because indirectly Ser383 Ndr1/2, at acts Par3 phosphorylate novel which Rassf5 a vitro kinases, as Ndr Par3 that the identify for we indicating target Finally, activity. Rassf5, kinase Ndr of stimulate rescue to loss sufficient mutant is Ndr2 the kinases An Mst polarity. by neuronal phosphorylation cortical in mimicking in both function of Rassf5 its formation of neurons confirms knockdown the a slices and hippocampal of polarity analysis The in neuronal axons. of multiple Ndr2 disruption the and in result Ndr1 of knockdown in neurites ectopic form neurons 2000). function the as This of conserved, axons. mutants be supernumerary to of pathway formation this appears of the Inhibition in prevent axons. and results becoming polarity from Thus, neuronal neurites axon. of minor the establishment to the distribution promote its this they and polarize then kinases In to Ndr1 Ndr Par3 Activated of Par3. activity. phosphorylate kinase upstream their through stimulate acts to polarity Ndr2 Rassf5 neuronal regulates pathway, that of Rassf5–Ndr–Par3 cascade signaling establishment novel a the identify we study, this In neuronal and localization Par3 polarity regulates pathway its novel A on interaction depends DISCUSSION its Par3 affects of which kinases, distribution dynein. results with Ndr normal these by the together, phosphorylation Taken that Par3. distribution show aberrant pseudophosphorylated the cause might of dynein-mediated Par3 in of defect transport a retrograde Therefore, dynein. and Par3 between u eut hwta h oso as5o h simultaneous the or Rassf5 of loss the that show results Our a3popoyae tSr8 ssrnl nihdi h axon, the in enriched strongly is Ser383 at phosphorylated Par3 n nnuos hspopoyaindpnso as5and Rassf5 on depends phosphorylation This neurons. in and .elegans C. d ooo A- Zle tal., et (Zallen SAX-1 homolog Ndr in rsvrlo h e nw as rtis(hrode al., et (Sherwood proteins Rassf known one ten involve the might 2010). This of Rassf5. of several loss or The the overcome compensatory migrate. for to knockout time changes sufficient to constitutive allows a development able because throughout probably not displayed organization, were neurons cortical and axon, of trailing processes analysis single single a thin forming a of multiple and Instead zone. process intermediate leading the in by slices neurons cortical of polarity in neuronal Rassf5 of in knockdown vivo Rassf5 the of by function confirmed is The 2006a; neurons. central in al., as 2013). kinases et Guan, TAZ and (Hergovich Yu and pathway 2006b; al., at Hippo YAP et size Hergovich the closely through organ of and the level growth components involved from cell transcriptional kinases regulate proteins Ultanir Ndr that the 2013; kinases distinguishes two al., Lats This et related RAB3IP), 2012). (Chiba and al., neurons as Aak1 in et phosphorylate trafficking as known regulating to Dlic2, in known with (also also Par3 are Rabin8 of and interaction transport here, the intracellular reported target regulate to they appear processes; kinases Ndr The polarity. xn(it ta. 2008). the al., in et kinases (Witte these microtubule axon is activates of preferentially aspects it thereby specific to and dendrites, kinases dynamics Ndr and of Rassf5 activity the protein the axons microtubule-binding links Because the in that cytoskeleton. speculate differ to neuronal tempting microtubules changes the by of of regulated der dynamics is organization van pathway the 2008; Rassf5–Ndr in the that al., possibility of interesting et activity the suggests the Moshnikova This 2005). al., 2006; et Weyden al., et (Moshnikova Ndr regulates Mst3 functions whether these and settings. whether kinases, these growth- test Ndr in to the the interesting on be depend mediate (Lorber will also regeneration It to during 2009). and al., factors et trophic neurons of cortical regulate effects kinase to promoting of Mst shown been the growth has of STK24), member axon as One known detail. (also more 2004; dissect Mst3 in to family, al., Rassf5 warranted et of is Stegert research role 2005; future the al., 2008), 2011b; al., et al., et Stegert et Vichalkovski 2009; (Cornils Ndr al., of et different upstream Hergovich three function least Mst can at that kinases the given 2002; Mst However, al., activating 2004). et al., by et (Khokhlatchev Praskova polarization indirectly it been neuronal that has Ndr1/2 during suggesting kinases Rassf5 kinases, regulates Mst polarity. likely of normal activity most Ndr2- restore the whereas stimulate to Rassf5, to able of shown loss not the is rescue T442A to sufficient is kinases n itntfo h ie o uoaA OKadErk2 and Pu ROCK and 2006; A, al., Khazaei et 2013; Aurora (Chen al., polarity for neuronal et in sites Funahashi novel mass function are its the and regulate Par3 from that assays in distinct sites kinase al., phosphorylation and Ndr using et Ndr for Ser1196) The Par3 Ultanir spectrometry. in and 2011a; sites (Ser383 al., phosphorylation been two kinases et have arborization identified (Cornils dendrite We kinases in 2012). development Ndr function and spine their cycle, the mediate and cell the Rabin for control and to substrates Aak1 p21 few phosphorylate They only identified. kinases Ndr far, of substrate So novel a is Par3 h d2T4Dmtn htmmc hshrlto yMst by phosphorylation mimics that mutant Ndr2-T442D The Ndr of activator upstream new a as Rassf5 identify we Here, as5hsas ensont idt microtubules to bind to shown been also has Rassf5 lcrprto.Sprsino as5rsle ntearrest the in resulted Rassf5 of Suppression electroporation. ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal Rassf5 koku ieddntrva ao eet in defects major reveal not did mice -knockout shl 09 Nakayama 2009; ¨schel, ex

Journal of Cell Science eed nNr/ n as5 n nyteSr8 Par3 Ser383 the only Par3 and of Rassf5, phosphorylation and Ser383 largely of Ndr1/2 Ser1196 function and specification. on the for axon with axon depends distal consistent role in is the at neuronal which a Par3 in dendrites, phosphorylated in concentrated observe from Par3 absent highly involved not localization. is site Par3 did Ser383 regulatory in we phosphorylation major but the polarization confirmed we as antibody, phospho-specific a Ser383 using By 2008). al., et ARTICLE RESEARCH ta. 03.Pr neat o nywt I3 u also but The KIF3A 2009). with the al., et only of (Schmoranzer not transport Dlic2 the interacts subunit dynein-dependent Shi dynein disrupts Par3 2004; the al., 2003). axon with et al., (Nishimura the polarity et into neuronal uniform A of KIF3A- transport its 3. establishment of becomes stage block anterograde but a at or neurites formation Par3 dependent of all its overexpression in upon the after present axon distribution for is the 2003). to crucial Par3 al., et restricted neurons, is Shi of 2 2004; Ser383 Par3 stage al., transport et In of that (Nishimura neurons and/or distribution of suggests polarization asymmetric localization pattern The the axon, Par3. This distribution affects the soma. the the hippocampal in phosphorylation in in remains preferentially in Par3-S383A difference of located majority expressed the is whereas when Par3-S383D the neurons. localizations for kinases subcellular functional Ndr the polarity. by confirms neuronal of phosphorylation This establishment mutant Par3 normal activity. non-phosphorylatable of rescuing the importance show or whereas kinases not Rassf5, Ndr of did of loss loss the rescue the to sufficient is phospho-mimic ol nraeislclcnetaini h xn aoigits favoring Par3 axon, promoting extension. thereby the of axon and in transport microtubule-binding concentration and retrograde local oligomerization reduced its increase A would ability microtubules. Its 2013). bind its al., to determines et (Chen oligomerization stabilizes extension and concentration-dependent also axon bundles Par3 promote that that to protein shown microtubules microtubule-binding was a it Rassf5– as Recently, through the acts centrosomes. polarity that on neuronal unlikely effect regulates is an cascade it signaling Therefore, knockdown not neurons. Ndr–Par3 the but after in numbers duplication observed result Ndr1/2 centrosome as to reduced of axons multiple to expected centrosome of due be in formation axons would the kinases of affects thus, is loss Ndr and, the polarity 2007) in of negatively al., of suppression et (Hergovich initiation The cells 2014). the dividing al., in (Ga experiments et suggested role subsequent Sakakibara initially but its than Anda 2005) complicated (de al., that more suggested axons et indicated been Anda of has de formation have It 2010; the 2009). al., induces et al., centrosome et the Schmoranzer and that 2007; (Hergovich al., Par-Ser383D respectively et orientation, of and duplication distribution centrosome the explanation possible in a difference is Par-Ser383A. Their the dynein transport. with for retrograde Ser383 interaction dynein-mediated at of differential undergo phosphorylated and that not Par3 with Par3 does compared that of Dlic2 suggesting with transport Par3-Ser383A, interaction a retrograde shows reduced Par3-Ser383D the strongly properties. axonal mediate and dendritic function to segregate similar (Harris a localized neurons perform polarity might apically in epithelial dynein Thus, of of 2005). segregation Peifer, establishment and the the during for proteins required is Bazooka h a3S8AadPr-33 uat xiie different exhibited mutants Par3-S383D and Par3-S383A The d iae n a3hv enipiae nterglto of regulation the in implicated been have Par3 and kinases Ndr Drosophila rnre l,2012; al., et ¨rtner a3homolog Par3 iae,wihmgtas lyipratrlsi te ye of types other in Ndr roles and remains important Rassf5 play of also Ser383 function might novel which a axons. Par3 kinases, supernumerary identify of all we to formation together, kinases, distributed the Taken equally in be persists. results Ndr to which Par3 continues neurites, of Par3 consequence, of transport a retrograde As neurite. the absence single retrograde and a unphosphorylated anterograde in of the Par3 kinesin-2-mediated of suppression In enrichment with the minor establishes the together transport remaining transport Thus, contrast, the Par3 By in transport. continued by formation. processes phosphorylated these retrograde axon from not depletion Par3 promote its allowing of is neurites, to accumulation Ser383 neurite the Par3 single allows the which a retrograde prevents soma, its in blocks then the thereby kinases to and dynein transport Ndr with is Par3 2013). by it of al., interaction where Ser383 et axon (Funahashi at Erk2 the Phosphorylation by into phosphorylation Par3 after establishment transports released the During kinesin-2 2. polarity, distributes stage at of initially neurites The subunits all axon. to dynein the uniformly Par3 and in retention kinesin Par3 anterograde with between favor interaction balance to the transport changing localization retrograde by the and axon regulate the Ndr to and Par3 Rassf5 of that indicate results localization Our Par3 regulating axon by supernumerary formation suppresses pathway Rassf5–Ndr The ulonasy,bceilyepesdGTfso rtiswere proteins washing GST-fusion After Healthcare). were expressed (GE glutathione–Sepharose Pu blotting bacterially on and immobilized western (Khazaei assays, previously and pulldown described as immunoprecipitation performed assays, Pulldown Pu Biochemistry ANOVA. and two-way a of using stage (Schwamborn determined was The significance criteria to (Eurogenetec). according determined sequence was published formation Par3 axon and SPGRF-S[PO3H2]-PDSHC, mouse differentiation peptide neuronal the (Molecular phospho-Par3 the from against used using derived antibody generated NDR-CTD also rabbit was polyclonal (Ser383) were Alexa- 1:500), The 1:500). 1:1000). antibodies bs-11168R; Probes; (Bioss, (Eurogentec, secondary Rassf5 1:750), and Fluor-conjugated 2007) 07-330; (Ser383) al., (Upstate, et (Cell (Hergovich Par3 Par3 Myc 1:500), 1:1000), phosphorylated 2272; AB5622; room Technology, with (Chemicon, (Chemicon, at Tau-1 Signaling Incubation MAP2 h used: 1 were 1:500), PBS. buffer. proteins blocking for MAB3420; in following the the in blocked serum After performed against was ice. were Antibodies goat antibodies on secondary cells normal min and 3 fixed primary 10% for PBS, with PBS 0.1% in temperature with of citrate solution washes sodium a with 0.1% three permeabilized and and X-100 DIV 3 Triton at fixed cultures were hippocampal Neurons of imaging and Immunostaining ddH and (6 solution and calcium and DNA (Schwamborn the adding previously described Pu as calcium using co-precipitation by transfected phosphate and prepared were neurons hippocampal E18 transfection and culture Cell METHODS AND MATERIALS an performs Par3 where cells, function. epithelial important as such cells, polarized eimwsaddbc otecells. the to back added was medium eim(erbslMdu,Lf ehoois a elcdwith replaced was Technologies) Life 400 Medium, (Neurobasal medium eewse o 5mnwt lo piMM hc a enpre- been had which Opti-MEM, of ml 37 1 with at min incubated 15 for washed were de.Atricbto o 5mna 37 at min 45 for incubation After added. shl 04.Bify 1 ipcma ern eetasetdby transfected were neurons hippocampal E18 Briefly, 2004). ¨schel, m fOt-E Lf ehoois eoeteDAmxuewas mixture DNA the before Technologies) (Life Opti-MEM of l ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal 2 nattlvlm f25 of volume total a in O ˚ ne 0 CO 10% under C m 2 )a – fe ltn.Teculture The plating. after h 2–6 at l) n h odtoe Neurobasal conditioned the and , m fDA 6.25 DNA, of g ˚ ne %CO 5% under C shl 04.Statistical 2004). ¨schel, shl 09.For 2009). ¨schel, m f1MCaCl M 1 of l 2 h neurons the , 3473 2

Journal of Cell Science GGAG-3 GGAG-3 AGTAT-3 33,5 S383D, ATTACTATTCAAGCCGTTTTGCCCCTGACAGCCAGTAT-3 CTCAATTACGACTACAAAAGGTTTGAAG-3 Srtgn)acrigt h auatrrsisrcin sn the using kit 5 instructions site-directed Mutagenesis manufacturer’s Ndr2-T442A, CCTACAAAAGGTTTGAAG-3 by the Site-Directed primers: generated to following QuikChange were according non- the Par3 (Stratagene) or using phospho-mimic and for mutagenesis Ndr2 constructs The phosphorylatable sequencing. by confirmed TCCTGTTCCAGAAACTCTCCATTGCT-3 GCCCGGAAAGAAACAGAG-3 eune otiigtetomttoswr sda rmr na in target primers as shRNA used The were 5 AAAAAAGATACT-3 (Stratagene) mutations instructions. Ndr1M, two kit manufacturer’s PCR: the mutagenesis Mutagenesis containing the site-directed sequences Site-Directed to by QuikChange generated according the were Ndr2M) and (Rassf5M) using (Ndr1M Rassf5 Ndr2 Ndr1, and RNAi-resistant vector. pCAGGS-U6 eecoe nothe into cloned were olwn agtsqecswr sd D1 5 NDR1, 5 used: were TTTATTGA-3 sequences target following Not ihCoaseBu.Tebnscrepnigt h phosphorylated fu the the Zentrum staining at Bioanalytic, to spectrometry or mass Zentrale by corresponding blotting analyzed and western bands digested isolated, by were The substrates analyzed Blue. then was Coomassie by and followed with buffer min sample 5 of for addition the boiling by terminated was reaction The t4 at olda 95 30–50 at with boiled eluted were proteins bound 40], h ed ihlssbfe 5 MTi-C H74 5 MNaCl, mM 150 7.4, pH Tris-HCl MgCl mM mM [50 10 DTT, buffer mM lysis 1 with beads the ARTICLE RESEARCH 3474 the using FP142) number (catalog pTagRFP- Evrogen a purchased into from was cloned vector and (DYNC1LI2) MG207876) N 2 number (catalog chain GFP-tagged Origene intermediate described from 2004). light al., were 1 cytoplasmic et HA–NDR2-PIF-KD Alan (Stegert by and provided 8972, previously kindly HA–NDR2-PIF 1965, were 2005) numbers Engelman. al., and et (plasmid FLAG–Ndr1-K118A al., (Devroe pEGFP-Mob1b, Addgene FLAG–Ndr2-119A et respectively). 1979, (Ortiz-Vega FLAG–Ndr1, from and HA–Rassf5 2002), obtained 8931 and al., were 2004) et al., 2002) (Lin et (Devroe FLAG–Mst1 FLAG–Ndr2 for vectors Expression Plasmids muorcptto ahbfe 2 MTi-C H74 5 mM 150 7.4, pH Tris-HCl MgCl mM mM [20 5 NaCl, buffer wash immunoprecipitation :00 n R-ope eodr niois(inv;110) For BL21-Star in 1:1000). expressed (Dianova; were Roche, proteins antibodies assays, kinase secondary and HRP-coupled 23402290601; anti- 1:200 and (Evrogen, mouse anti-RFP 1:5000) rabbit H6908; 1:750), 1:1000), 07-330; 1667149; (Sigma, (Roche, (Upstate, Myc anti-Par3 anti-HA rabbit 1:500), mouse 1867423; MMS- 1:1000), (BabCo, anti-GFP mouse 118P; 1:1000), F3165; (Sigma, M2 anti-FLAG iaewsicbtdwt usrt rtisi 20 in proteins substrate immunoprecipitation, with or Pu incubated pulldown and was (Khazaei by kinase previously purified described and as cells respectively, 293T HEK or Protein-G 8hatrtaseto.Tecl yaewsicbtdwt 3–5 with incubated was lysate cell 4 The at transfection. antibody after were washed, h buffer. and they 48 sample with cells (Roche)], eluted 293T were HEK cocktail proteins bound transfected inhibitor the from and lysates protease with complete incubated and 100 otiig1 containing 9 GCATC CTTCCAGAA-3 -GACAAGTGCT etr ltigwspromduigtefloigatbde:mouse antibodies: following the using performed was blotting Western o muorcptto,tasetdHK23 el eelsdat lysed were cells 293T HEK transfected immunoprecipitation, For ie.T eeaetesRAvcos(adsne l,20) the 2002), al., et (Paddison vectors shRNA the generate To sites. I ˚ o – ihsaig fe he ahso h ed with beads the of washes three After shaking. with h 3–5 for C 9 9 2 h a3cntut R(mn cd –0) D1(amino PDZ1 1–200), acids (amino CR constructs Par3 The : a3S16,5 Par3-S1196D, ; 9 a3S16,5 Par3-S1196A, ; grs ed Rce a de otelst n incubated and lysate the to added was (Roche) beads agarose ˚ 9 o i n nlzdb etr blotting. western by analyzed and min 5 for C -CAATTACTATTCAAGCCGTTTTGACCCTGACAGCC- m ˚ o roengtwt hkn.Attlo 50 of total A shaking. with overnight or h 3 for C T t30 at ATP M 9 d2 5 Ndr2, ; 9 -GCCTGGAGGGGACATGATGACCTTGTTGATG- 2 MET,1%(/)gyeo,01 vv NP- (v/v) 0.1% glycerol, (v/v) 10% EDTA, mM 2 , Xho 9 d2,5 Ndr2M, ; and I 9 2 -GCAGCATGCTCGTAAAGAA-3 MET,1%gyeo,1 rtnX- Triton 1% glycerol, 10% EDTA, mM 4 , ˚ o 0mn(hze n Pu and (Khazaei min 30 for C 9 9 rMlklr eii Ko Medizin Molekulare ¨r -AGCGGGCGACACGACGTGTCCGT- -AGCGGGCGACACGCGGTGTCCGT- EcoR 9 d2T4D 5 Ndr2-T442D, ; 9 as5,5-CAAAGATGGACAAG- Rassf5M, ; ie ftepHGMGC or pSHAG-MAGIC2 the of sites I 9 9 -CTGGGTTTTTCTCAATTACG- 9 h mlfe C fragments PCR amplified The . -GTTACGTCGATCGCAGCAT- m 9 oiieclne were colonies Positive . lof2 9 u musculus Mus a3S8A 5 Par3-S383A, ; 6 TM 9 -GACATGATGAC- m D apebuffer, sample SDS shl 09.The 2009). ¨schel, 9 (Rosetta fkns buffer kinase of l -CTGGGTTTTT- ¨ln. shl 2009). ¨schel, 9 + Xho Rassf5, ; bacteria ) 9 Par3- ; dynein 9 m and I m -CA- gof lof 36 aebe ecie rvosy(hze n Pu 1116– and acids (Khazaei (amino previously ABD-Z described 1185– and been acids 1186–1356) have (amino 1356) acids CC2 (amino 1116–1184), acids CC3 (amino coiled- 1247), (CC1) 700–1356), 1 acids 561– region amino acids BD, coil (amino (aPKC PDZ3 domain 401–560), aPKC-binding acids 780), (amino PDZ2 201–400), acids f95 of G-3 CCAGACTGCCTTGGGAAAAGC CCCAGTGTTCTCACCTGGAGAATC-3 rmr o h uat(2-ppout;Rsf_U_1 5 Rassf5_MUT_S1, product); (228-bp mutant the for primers h etiua oeo V,itreit oeadcria plate. cortical transfected and in zone of cells intermediate distribution GFP-positive SVZ, The of or h. percentage zone 24 the ventricular of Images determining the Germany) period by MicroImaging). a analyzed Zeiss for Jena, was min (Carl neurons 30 Software MicroImaging, every ZEN taken Zeiss were Zeiss the with (Carl equipped microscope laser-scanning 4Vfr5 sa nevl,uigteEM80BXsur wave square BTX ECM-830 the using 290 intervals, of thickness a s with low-melting Slices 1 3% (Biozym). in for agarose embedded at were brains The used ms Gentronic). (0.5%) (BTX, 50 electroporator at dye were pulses for five Green by transfected V Fast embryos were 54 Embryos with ventricle. lateral E14.5 the mixed into injected were and CD1 plasmids Briefly, wild-type electroporation. from Brains vivo Ex 5 Rassf5_WT_S1, product); (177-bp 5 wild-type the for primers following of the Genotyping 2010). al., et Rassf5 Rassf5 avs,D . au . odn . aia . onr .A,Le .S,Factor, S., J. Lee, A., E. Conner, M., Farina, A., Gorden, S., Ladu, F., D. Calvisi, F. Polleux, and P. A. Barnes, M. W. Cowan, and A. G. Banker, K. Kaibuchi, and N. Arimura, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.146696/-/DC1 online available material Supplementary material Supplementary for PMC in Deposited months. Institute. 6 fellow Cancer after Development UCL release Career the Research at Trust (DAAD) 090090/Z/09/Z] Wellcome Service number a [grant Exchange is Academic A.H. E.K. German number to a [grant fellowship and Forschungsgemeinschaft A.W.P.]; Deutsche to the 102/12-1 by PU funded was work This Funding and A.H. R.Y., data. analyzed manuscript. and the experiments wrote the A.W.P. performed J.J. and E.K. R.Y., contributions Author interests. competing no declare authors The interests Competing and mice manuscript. knockout the for MD) for Bethesda, Kla MA) (NIDDK, Christian Cambridge, Lee School, Bong Medical Sean (Harvard plasmids, Engelman Alan thank We Acknowledgements t37 at ihe,S . aakvc . tgr,M .adHmig,B A. B. Hemmings, and R. M. Stegert, R., Tamaskovic, J., S. Bichsel, ne %CO 5% under 0m;Mlioe n utrda h i–iuditraeuigneurobasal 37 using at dishes interface culture tissue air–liquid 35-mm in the N2 and at (0.4 B27 insert with cultured supplemented culture medium and tissue Millicell Millipore) a mm; of 30 membrane the onto placed (Leica), 9 9 -GTCAGCTCATGTCACTGGCAATAAGC-3 -CCCAGTGTTCTCACCTGGAGAATC-3 ttptwy nhmnHCC. human S. in pathways S. Stat Thorgeirsson, and M. V. culture. cell mechanisms. intracellular to ehns fatvto fNR(ula b2rltd rti iaeb the by kinase protein Dbf2-related) (nuclear NDR protein. of hMOB1 activation of Mechanism neurons. developing ˚ n ne %CO 5% under and C ˚ o 0s 58 s, 30 for C koku iewr eeosypoie ySa ogLe(Park Lee Bong Sean by provided generously were mice -knockout koku mice -knockout ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal lcrprto n iecl imaging live-cell and electroporation mt(nttt fNuoilg,Mu Neurobiology, of (Institute ¨mbt 2 ri Res. Brain n 0 O 40% and .Bo.Chem. Biol. J. ˚ o 0sad72 and s 30 for C nu e.Neurosci. Rev. Annu. 126 2 2 t3 fe lcrprto,uigaZisLM700 LSM Zeiss a using electroporation, after h 36 at mgn a efre na nuainchamber incubation an in performed was Imaging . 397-425. , 20) ernlplrt:fo xrclua signals extracellular from polarity: Neuronal (2007). a.Rv Neurosci. Rev. Nat. 20) salsmn fao-edieplrt in polarity axon-dendrite of Establishment (2009). Rassf5 Gastroenterology 279 17) a ipcma ern ndispersed in neurons hippocampal Rat (1977). 20) bqiosatvto fRsadJak/ and Ras of activation Ubiquitous (2006). 35228-35235. , koku iewspromdusing performed was mice -knockout ˚ o 0s. 30 for C 9 h odtoswr 5cycles 35 were conditions The . ntr emn)frcmet on comments for Germany) ¨nster, 32 9 347-381. , n as5MTA1 5 Rassf5_MUT_AS1, and 9 m eectuigavibratome a using cut were m 8 130 194-205. , 9 n Rassf5_WT_AS1, and n h following the and , 1117-1128. , shl 2009). ¨schel, xvivo ex (2004). m m, ˚ C 9 9 - -

Journal of Cell Science uaah,Y,Nma . uiu,S,Io,N,Nkmt,S,Kt,K., Kato, S., Nakamuta, Gallegos,M.E.andBargmann,C.I. N., Itoh, N. S., Y. Fujisue, Jan, T., and Namba, Y. Y., L. Funahashi, Jan, Z., J. Parrish, K., Emoto, A. G. Banker, and A. C. Sullivan, G., C. Dotti, egvc,A. N. P. Hergovich, Adler, and N. Y. Jan, K., Emoto, X., Fang, Y., He, mt,K,H,Y,Y,B,Gubr .B,Alr .N,Jn .Y n Jan, and Y. L. Jan, N., P. Adler, B., W. Grueber, B., Ye, Y., He, K., Emoto, A. Engelman, and A. P. Silver, E., Devroe, A. P. Silver, and P. Tempst, H. H., L. Erdjument-Bromage, E., Tsai, Devroe, and D. Rei, X., Ge, K., Meletis, and C., F. F. Feiguin, Anda, G., de P. Camoletto, S., J. Silva, Da G., Pollarolo, C., F. Anda, de A. B. Hemmings, and A. Hergovich, S., R. Kohler, H., Cornils, Hwang,E.,Ryu,K.S.,Pa F. Latif, and R. E. Maher, D., J. Minna, A., Dallol, L., Hesson, Hergovich,A.,Lamla,S.,Nigg,E.A.andHemmings,B.A. A. B. Hemmings, and D. Schmitz, R., M. Stegert, A., Hergovich, A. B. Hemmings, and D. Schmitz, A., Hergovich, N. Tapon, and K. Harvey, M. Peifer, and J. X., T. Wu, Harris, N., Teusch, L., Meyn, D., Neukirchen, C., K. Flynn, K., B. Garvalov, hn . hn . h,H,Wi . atnd-atlao,D . Bultje, R., D. G., Castaneda-Castellanos, Drewes, M., Wei, J., H., Zhu, Shi, C., J., Chen, P. S., Yu, Chen, S., H. Hu, J., Q. Wang, M., Y. Chen, ARTICLE RESEARCH onl,H,Khe,R . egvc,A n emns .A. B. Hemmings, and A. Hergovich, S., R. Kohler, H., S. Cornils, Dirnhofer, D., Schmitz, D., Hynx, A., Hergovich, R., M. Stegert, H., Cornils, egvc,A,Khe,R . cmt,D,Vcakvk,A,Cris .and H. Cornils, A., Vichalkovski, D., Schmitz, S., R. Kohler, A., Hergovich, Ga hb,S,Aaa,Y,Hma . uua .adMzn,K. Mizuno, and M. Fukuda, Y., Homma, Y., Amagai, S., Chiba, rnr . onseo .F,Mnk . enkn,K,Sutes E., Seuntjens, K., Vennekens, S., Munck, F., E. Fornasiero, A., ¨rtner, hmd,A,X,C,Sa,W,Nsik,T tal. et T. Nishioka, polarization. 13285. W., neuronal regulates Shan, Par3 of C., phosphorylation Xu, A., Shimada, maintenance. and tiling dendritic in kinases NDR Nature the with acts Hippo suppressor 256. e/h rti iaei euae ypopoyainaditrcswt furry with interacts and development. phosphorylation hair by wing Drosophila regulated during is kinase protein Ser/Thr iaeFrysgaigptwyi rspiasnoyneurons. sensory Drosophila in pathway signaling kinase/Furry Y.-N. culture. in neurons hippocampal by kinases. polarity serine-threonine NDR2 and NDR1 Virology human processes proteolytically kinases. serine-threonine NDR2 and NDR1 the Chem. regulate proteins Mob neocortex. the in formation axon initial 10391-10406. for essential is motility p21 regulating G. Nature directly C. by Dotti, transition cycle cell G(1)/S stability. control kinases NDR ooou fRSFAtmu upesrgn siatvtdi human in inactivated is gene suppressor tumour RASSF1A cancers. of homologue a humans. to yeast Biol. from processes Cell cell essential regulate membrane. kinases the at MOB1 human Commun. by Res. activated Biophys. is LATS1 suppressor regulators. network. tumour-suppressor emerging Drosophila. in 823. establishment polarity epithelial during cues polarity. F. neuronal of Bradke, establishment and 13129. the R. during J. cofilin Bamburg, C., Brakebusch, ontemo ua D iae:ipcigo -y n 2 protein p21 and c-myc on progression. impacting cycle cell kinases: control NDR to stability human of Downstream lymphoma. cell T of development the A. B. Hemmings, and specifying in Par3 mammalian by organization H. S. polarity. Shi, and and neuronal M. stability Zhang, R., A. microtubule Kriegstein, X., Pei, S., R. in complex PKC PAR-3/PAR-6/atypical 8539. the polarity. G. neuronal of hippocampal downstream Z. regulating functions Luo, 2 and kinase H. Piwnica-Worms, ute,W . atra .adDti .G. C. neurons. Dotti, developing and in F. asymmetry Valtorta, kinase. B., SAX-1 W. Huttner, the and SAX-2 on depend 239-249. tiling and termination i,D . e,J . en .H n hog C. Cheong, and RASSF and H. Mst1 Y. from domains Jeon, SARAH O., the of J. interaction dimeric Lee, into S., insight D. Lim, phosphorylation. kinase NDR Biol. regulating by duplication centrosome human A. B. Hemmings, duplication. centrosome regulates Cell kinase NDR Centrosome-associated pcfct rmpopaiysrn oSec15. binding to switching by phosphatidylserine ciliogenesis from for specificity crucial is phosphorylation Rabin8 mediated 25 19 20) oto fdnrtcbacigadtln yteTricornered- the by tiling and branching dendritic of Control (2004). 625-634. , 279 443 436 1692-1702. , o.Cl.Biol. Cell. Mol. 331 Oncogene 7 253-264. , 24444-24451. , 210-213. , 704-708. , el Signal. Cell. 181-189. , 21) O oto:rveigacnevdfml fkinase of family conserved a reviewing control: MOB (2011). 20) etooelclzto eemnsnuoa polarity. neuronal determines localization Centrosome (2005). e.Cell Dev. 20) h S1adhO1tmrsprsoscontrol suppressors tumor hMOB1 and MST1 The (2009). 22 21) baino h iaeNR rdsoe ieto mice predisposes NDR1 kinase the of Ablation (2010). 947-954. , 31 23 345 1382-1395. , 1433-1440. , 20) h avdrWrsHpoptwy–an – pathway Salvador-Warts-Hippo The (2007). 20) h oiinn n ergto fapical of segregation and positioning The (2005). 24 ¨a 50-58. , ¨kko 26-40. , nn . Gu K., ¨nen, MOJ. EMBO c.Signal. Sci. a.Rv Cancer Rev. Nat. 20) irtbl affinity-regulating Microtubule (2006). rc al cd c.USA Sci. Acad. Natl. Proc. elCycle Cell o.Bo.Cell Biol. Mol. 20) ehnsnoyneurite Mechanosensory (2004). .Neurosci. J. 31 MOJ. EMBO 21) -ahrnseiisfirst specifies N-cadherin (2012). 20) I- noprtsand incorporates HIV-1 (2005). 1893-1903. , ¨ntert,P.,Cheong,H.K., 18) h salsmn of establishment The (1988). 3 20a.Tehmntumour human The (2006a). ra47. , 10 20) d4 regulates Cdc42 (2007). .Neurosci. J. 21) ERK2-mediated (2013). 1897-1904. , 32 20) h tricornered The (2005). .Neurosci. J. 8 7 16 .Cl Biol. Cell J. 21) euainof Regulation (2013). 874-885. , 1454-1468. , 20) h tumour The (2006). 182-191. , 21) Centrosome (2010). 689-700. , 20) Structural (2007). 20) NORE1A, (2003). .Neurosci. J. Human (2011b). 20) Human (2004). 21) NDR2- (2013). a.Rv Mol. Rev. Nat. Cell 20b.NDR (2006b). Neuron 27 103 33 119 Biochem. 170 13117- , (2011a). 13270- , (2007). .Biol. J. 8534- , 245- , 813- , Curr. Mol. 30 44 , , tgr,M . egvc,A,Tmsoi,R,Bcsl .J n Hemmings, and J. S. Bichsel, R., Tamaskovic, A., Hergovich, R., M. Stegert, B R., Tamaskovic, R., M. Stegert, K. Hofmann, and H. Scheel, epus K. Kemphues, og . a,K . oo,L,Yn . u . art,L,Ce,Y,Pr,O., Park, Y., Chen, L., Garrett, J., Hu, K., Yun, L., Topol, K., K. Mak, H., Song, Pu and C. J. Schwamborn, T. Pawson, B., R. Vallee, S., Tan, M., Segura, P., J. Fawcett, J., Schmoranzer, T. Miyata, and M. Masaoka, N., Noguchi, R., Ando, T., Sato, J. A., Avruch, Sakakibara, and S. Ortiz-Vega, A., Khoklatchev, M., Praskova, a,Y .adJn .Y. L. Jan, and N. Y. Jan, obr . oe .L,Bnwt,L .adIwn N. Irwin, and I. L. Benowitz, L., M. Howe, B., Lorber, J. Avruch, and D. Figeys, A., Khokhlatchev, Y., Zhang, Lin, T., Chen, M., Nedwidek, R., Xavier, S., Rabizadeh, A., Khokhlatchev, Pu and R. M. Khazaei, h,S . a,L .adJn .N. Y. Jan, and Y. L. Jan, H., S. Shi, D. A. Chalmers, and A. Ward, A., Jeffries, A., Recino, V., Sherwood, S., D. Lim, F., L. Beers, S., M. Kim, F., X. Zhang, Y., S. Lee, I., S. Kang, J., Park, D. Pan, h . e,D,Km . i,T . h .J,Hag .Y,Kn,Y Y., Y. Kong, Y., C. Hwang, J., H. Oh, S., T. Kim, T., Kim, D., Lee, S., K. Oh, Kaibuchi, and S. Ohno, Y., Fukata, T., Yamaguchi, K., Kato, T., Nishimura, Ohno, T., Shinagawa, T., Nishimura, M., Sugimoto, M., T. Goto, M., Nakayama, V. A. Khokhlatchev, and S. Kuznetsov, A., V. Moshnikova, A. Khokhlatchev, and D. J. Minna, W., J. Shay, J., Frye, A., Moshnikova, adsn .J,Cuy .A,Brsen . ann .J n oki,D S. D. Conklin, and J. G. Hannon, E., Bernstein, A., A. Caudy, J., P. Paddison, R., Dammann, F., X. Zhang, M., Nedwidek, A., Khokhlatchev, S., Ortiz-Vega, S. Ohno, .A. B. protein. calcium-binding S100B 23806-23812. the and phosphorylation A. B. Hemmings, 1301-1310. lyesnilrlsi ra iecnrladtmrsuppression. tumor and control size USA organ Sci. in Acad. al. roles et essential M. play R. Simpson, J., Chang, 63-75. migration. during orientation 19 centrosome and dynamics G. microtubule G. Gundersen, and suppressor. tumor of classes three polarization. of modes in distinct organization microtubule during and growth neurons translocation neocortical centrosome the of Dynamics by (2014). autophosphorylation, Ras. by by and kinase NORE1, and 462. MST1 RASSF1 proteins, the inhibitory of Regulation evu system. nervous pathway. 9241. apoptosis the in proteins family rti id S1adaget S1idcdapoptosis. MST1-induced augments and 277 MST1 binds 4 protein a aurora J. Avruch, by pathway. and proapoptotic B. mediated Seed, F., is X. polarity. 962 neuronal serine in function at 33579. its Par3 regulates protein and complex polarity pcfe ysailylclzdma3ma6adP -iaeactivity. 3-kinase PI and mPar3/mPar6 Ras-association-domain- localized spatially of by specified group formation. new cancer to a links 303-311. emerging family: with proteins, RASSF containing N-terminal The polarity. neuronal determines Cdc42 923-929. and Rap1B GTPases ligand-induced receptor death mediates (RASSF5/NORE1) apoptosis. 5 B. S. family Lee, and domain S. H. Kim, J., Avruch, 897. neryebyncdvlpeto h mouse. the of development S. embryonic D. neuronal early Lim, of and in establishment S. K. the Kwon, in complex PAR-3-KIF3 the polarity. of Role (2004). formation. K. complex PAR Kaibuchi, disrupts and and M. Amano, required S., not is microtubules with function. NORE1A growth-suppressive suppressor its for tumour and growth the pathway. ERK that the protein of 8152. cytoskeletal inhibition a is by NORE1A growth suppressor suppresses tumor pathways. and growth PNS The and (2006). CNS mature in regeneration Neurosci. axon Nat. regulates kinase, like 20) hr ari Ns(hNs nuesqec-pcfcslnigin silencing sequence-specific induce (shRNAs) RNAs cells. mammalian hairpin Short (2002). Nore1. protein binding Ras-GTP the Oncogene with heterodimerizes and J. homodimerizes Avruch, and P. polarity. G. Pfeifer, cell in roles fundamental Biol. playing Cell cassette Opin. Curr. core conserved a complex, 6320. 1065-1074. , 47991-48001. , 20) ip inln nognsz control. size organ in signaling Hippo (2007). ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal 20) euaino D rti iaeb yrpoi motif hydrophobic by kinase protein NDR of Regulation (2005). a.Cl Biol. Cell Nat. 20) neclua ucin n ellrplrt:tePAR-aPKC the polarity: cellular and junctions Intercellular (2001). .Bo.Chem. Biol. J. 21 20) Asn mroi polarity. embryonic PARsing (2000). 1381-1390. , 12 107 a.Rv Neurosci. Rev. Nat. 1407-1414. , ee Dev. Genes 20) euaino D2poenkns ymulti-site by kinase protein NDR2 of Regulation (2004). 1431-1436. , 13 ur Biol. Curr. 6 ce,A W. A. schel, ¨ 641-648. , 328-334. , 20) a3addni soit orglt local regulate to associate dynein and Par3 (2009). 285 ce,A W. A. schel, ¨ 20) smerccl iiini h Drosophila the in division cell Asymmetric (2001). 20) oe neato oi,SRH connects SARAH, motif, interaction novel A (2003). 20) h uaietmrsprso RASSF1A suppressor tumor putative The (2002). 35029-35038. , 20) rca oefrMt n s2kinases Mst2 and Mst1 for role Crucial (2009). 16 20) dniiaino oe Ras-regulated novel a of Identification (2002). 948-958. , 12 21) amla s1adMt kinases Mst2 and Mst1 Mammalian (2010). ur Biol. Curr. 20) h-iaepopoyae PAR-3 phosphorylates Rho-kinase (2008). M e.Notes Res. BMC 253-265. , 21) uo upesrrsassociation ras suppressor Tumor (2010). 2 e.Cell Dev. 772-779. , 20) ipcma ernlpolarity neuronal Hippocampal (2003). csl .J,He J., S. ichsel, 20) hshrlto ftepar the of Phosphorylation (2009). rc al cd c.USA Sci. Acad. Natl. Proc. 20) h eunilatvt fthe of activity sequential The (2004). 13 14 R899-R900. , .Bo.Chem. Biol. J. Cell 205-215. , o.Cl.Biol. Cell. Mol. .Bo.Chem. Biol. J. 20) Death-associated (2002). 1 20) s3,a Ste20- an Mst3b, (2009). 13. , 101 ice.J. Biochem. ee Dev. Genes 20) neato of Interaction (2008). .Bo.Chem. Biol. J. 345-348. , gvc,A and A. rgovich, ee.Cortex Cereb. a.Neurosci. Nat. ice.J. Biochem. .Bo.Chem. Biol. J. 284 rc Natl. Proc. 281 104 ur Biol. Curr. 29 381 Cell 21 33571- , 6309- , (2004). (2010). 8143- , 9236- , 3475 886- , 453- , 279 425 112 24 7 , , , , ,

Journal of Cell Science ihlosi . rso . onl,H,Hroih . cmt,D and D. Schmitz, A., Hergovich, H., Cornils, E., Gresko, A., Vichalkovski, a e edn . ahbn,K . ozlz .A,Aas .J,N,B L., B. Ng, J., D. Adams, A., M. Gonzalez, K., K. Tachibana, Pleasure, L., Weyden, L., der van A. Burlingame, P., W. Ge, G., Li, T., N. Hertz, K., S. Ultanir, EERHARTICLE RESEARCH 3476 epnet a eetrsiuainadpooe apoptosis. promotes and stimulation receptor 1889-1895. Fas to response A. B. Hemmings, AS1 sfr fRSF rmtsmcouuesaiiyadsuppresses A. and Bradley, stability and microtubule J. promotes M. RASSF1 tumorigenesis. Arends, of N. R., isoform Y. RASSF1A A. Rabin8 Venkitaraman, Jan, R., and development. Petty, and AAK1 spine Y. and substrates arborization L. dendrite kinase in Jan, 73 NDR1/2 roles M., their of Uncovers K. identification Shokat, genetic J., S. hshrlto eitdb h amla t2-iekns MST3. kinase Ste20-like Biol. mammalian the by mediated phosphorylation 1127-1142. , 25 11019-11029. , o.Cl.Biol. Cell. Mol. 20) D iaei ciae yRSFAMT in RASSF1A/MST1 by activated is kinase NDR (2008). 25 8356-8367. , 21) Chemical (2012). ur Biol. Curr. 20) The (2005). o.Cell. Mol. Neuron 18 , hu . ord . i,F,Pr,J . ae,B,Yn . awr,G Y., G. Lauwers, Y., Yin, B., Payer, S., J. Park, F., Xia, C., Conrad, D., Zhou, ho . uaeg .adGa,K L. K. Guan, and K. Tumaneng, B., Zhao, I. C. Bargmann, and M. D. Tobin L., E. Peckol, A, J. Zallen, L. F. K. Guan, Bradke, and X. and F. Yu, D. Neukirchen, H., Witte, eaoyeqisec n upeshptclua acnm development oncogene. al. Yap1 carcinoma et the hepatocellular of J. inactivation suppress Avruch, through and T., quiescence J. hepatocyte Lee, W., Thasler, 877-883. iecnrl isergnrto n tmcl self-renewal. cell stem and regeneration tissue control, size 3190. Dev. Genes polarization. neuronal initial specifies hp n ert ntainaergltdb h d iaeSX1 ebrof member a family. SAX-1, kinase kinase Ndr serine/threonine the by Orb6/COT-1/warts regulated the are initiation neurite and shape ora fCl cec 21)17 4337 doi:10.1242/jcs.146696 3463–3476 127, (2014) Science Cell of Journal 27 355-371. , 21) h ip aha:rgltr n regulations. and regulators pathway: Hippo The (2013). .Cl Biol. Cell J. 21) h ip aha norgan in pathway Hippo The (2011). acrCell Cancer 20) s1adMt maintain Mst2 and Mst1 (2009). 20) irtbl stabilization Microtubule (2008). 180 619-632. , o.Bo.Cell Biol. Mol. 16 20) ernlcell Neuronal (2000). 425-438. , a.Cl Biol. Cell Nat. 11 3177- , 13 ,

Journal of Cell Science