Genome-Wide CRISPR Screens Reveal a Wnt–FZD5 Signaling Circuit As a Druggable Vulnerability of RNF43-Mutant Pancreatic Tumors

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. Texas, USA (T.H.). Correspondence should be addressed to S.A. ( Toronto, Toronto, Ontario, Canada. Organoid Technology, Utrecht, the Netherlands. Biologics, Toronto, Ontario, Canada. Toronto, Ontario, Canada. 1 RNF43 non-synonymous recurrent identified have carcinoma, endometrial and adenocarcinoma to colorectal in addition neoplasias, pancreatic Wnt challenging the proven has pathway inhibit to designed drugs developing thus, (LRP5/6); LRP6 or LRP5 either proteins, receptor–related lipoprotein low-density co-receptor two the of one and proteins (FZD) Frizzled ten the of one of composed is complex This surface. cell the at complex Wntreceptor the from ( axin ( ( coli polyposis adenomatous as such pathway, this signaling regulate negatively that proteins encoding genes in mutations Wnt– malignancies human several in maintenance and Wnt– of during cells progenitor embryonic and development and adult stem tissue homeostasis of differentiation and liferation pro influence pathways signaling Wnt organisms, multicellular In cell surface targets for antibody development and therapy. of these findings beyond PDAC. Our results show that CRIPSR-based genetic screens can be leveraged to identify and validate patients that carried antibodies, further their demonstrating use as a potential targeted therapy. Tumor organoid cultures from colorectal carcinoma of Proliferation a PDAC patient-derived cell line harboring an cells grown patterns. Additionally, antibodies that specifically bind FZD5 and FZD8 robustly inhibited the growth of the expression of nine FZD proteins and confirms that level of specificity at context-dependent the Wnt receptor level. We further derived a panel of recombinant antibodies that reports circuit: engaging FZD5, one of the ten Frizzled receptors encoded in the human genome. Our results uncover an underappreciated which rely on Wnt signaling for Through proliferation. these screens, we discovered a unique requirement for a Wnt signaling cells. We conducted genome-wide CRISPR–Cas9 screens in Forward genetic screens with CRISPR–Cas9 genome editing enable detection high-resolution of genetic in vulnerabilities cancer Jarrett Adams Zhang Xiaoyu Steinhart Zachary of signaling circuit as a druggable vulnerability Genome-wide CRISPR screens reveal a Wnt–FZD5 nature medicine nature Received 8 August; accepted 30 September; published online 21 November 2016; Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, Toronto, Ontario, Canada. CTNNB1) Recent next-generation sequencing studies of gastric, ovarian and ovarian of gastric, studies sequencing next-generation Recent β AXIN1 RNF43 -catenin signaling is increased as is a increased signaling -catenin result of inactivating either mutations β -catenin signaling has been linked to tumor initiation initiation tumor to linked been has signaling -catenin 4 . In these cases, the signaling . pathway In the is signaling distally cases, these activated ) ) or mutations activating in the gene encoding in in vitro 2 2 6– , , James Pan ,

3 1 and as xenografts , , Mélanie Robitaille 1 advance online publication online advance 3 that appear to be mutually exclusive with with exclusive mutually be to appear that Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Canada. 1 RNF43 -mutant pancreatic tumors , , Zvezdan Pavlovic 8 Present address: Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, 5 mutations were also sensitive to the FZD5 antibodies, highlighting the potential generalizability Hubrecht Institute for Developmental Biology and Stem Cell Research, University Medical Centre, Utrecht, Foundation, Hubrecht 2 , 4 , , Hans Clevers 6 in in vivo Canadian Institute for Advanced Research, Toronto, Ontario, Canada. 1 , , Kevin R Brown 2 , , providing orthogonal support for the functional specificity observed genetically. , , Megha Chandrashekhar 5 . 3 . In most tumors, tumors, most In . 1

5 , [email protected] 2 , Sachdev , Sidhu Sachdev . Deregulation APC FZD5 β -catenin -catenin ) and and ) APC functional specificity cannot be explained by protein expression RNF43 2 RNF43 , Sridevi Jaksani, Sridevi -

d o PORCN inhibitor LGK974 revealed three lines to be highly sensitive sensitive highly to be lines three revealed LGK974 inhibitor PORCN 39 human (PDAC)pancreatic adenocarcinoma ductal cell lines to the ZNRF3 Wnt of upstream overactive activity pathway block to exists window therapeutic a that revealing intact, crypt mal nor adjacent leaving while tumors of intestinal growth the represses of Wnt of proteins, a indicates which requirement for Wntactivity ligands and maturation the for required O-acyltransferase an (PORCN), porcupine of inhibition by blocked is organoids these Wnt to hypersensitivity their lights ligases E3 these downregulate that proteins secreted are which R-spondins, Wnt amplifier the of absence the in from isolated tumors from derived Wnt on proliferation and survival dependent their for ligands cells tumor render and surface cell the at sion expres FZD high to lead gene either of mutations loss-of-function thus, receptors; FZD target that ligases ubiquitin E3 transmembrane and i -mutant -mutant pancreatic ductal (PDAC) adenocarcinoma cells, : 1 2 variant was also selectively inhibited by the FZD5 , 0 RNF43 3 . CTNNB1 , , Jason Moffat 1 0 ), J.M. ( -mutant cancers -mutant 3 2 , 8 3 / , , Traver Hart n −/− m [email protected] . ; 4 ZNRF3 mutations. mutations. 2 5 1 , , René Overmeer 9 4 The Centre for the Commercialization of Antibodies and −/− 2 , 1 3 mutant mice with a PORCN inhibitor inhibitor PORCN a with mice mutant 3 , 6 . Furthermore, screening the sensitivity of of sensitivity the screening Furthermore, . 2 7 & Stéphane Angers RNF43 Department of Biochemistry, University of , 8 , , Xiaowei Wang 2 ) or S.S. ( Donnelly Centre, University of Toronto, and its homolog homolog its and

RNF43 1 5 1 [email protected] , , Sylvia F Boj . Importantly, the growth of of growth the Importantly, . RNF43 11 1 −/− 2 , β —a response that high that response —a 1 2 ; -catenin in -catenin ZNRF3 . Epithelial organoids organoids Epithelial . 2 -mutant -mutant PDAC , 4 s e l c i t r a 1 , ,

7 ZNRF3 −/− 5 1 , 3

. . Treatment mice grow grow mice RNF43 encode encode ).

- - or - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. Based on the list of genes identified in this screen, we generated generated we screen, this in identified genes of list the on Based these of ( cells HPAF-II to knockout advantage proliferation a that provides genes suggesting scores, BF lowest the amongst including pathway, catenin Wnt– the of regulators negative core encoding genes contrast, In essential: were genes 3 only Frizzled (FZD) receptors and 19 Wnts encoded in the human genome, PORCN including pathway, Wnt the fitness core identified genes previously (83%) 1,580 of 1,315 including 5%), < (FDR) rate discovery (false cells HPAF-II in identified were and recall plots ( genes and nonessential of essential results in a in decrease reference fitness). Empirically determined sets (high BF indicates increased confidence that the knockout of the gene confidence that knockout of a specific gene causes a decrease in fitness ( gene each for (BF) algorithm BAGEL the used then time, indicating that time, as ( indicating the designed functioned screens relative to those targeting nonessential genes; this shift increased with distribution of gRNAs targeting essential genes was significantly shifted deep sequencing of gRNAs ( library, we monitored evolving cell populations over ~20 doublings by these of proliferation the of the HPAF-II-Cas9 with TKO cells for infection Following gRNA cells. required genes fitness of set the iden tify to order in performed was screen This genes. human 17,232 library gRNA TKO the A forward genetic screen was out carried in HPAF-II-Cas9 cells using sensitivity to the PORCN inhibitor LGK974 ( pyogenes expressing cells clonal generated Wethen status. tion bition inhi to PORCN HPAF-II sensitive is the that PDAChuman line cell using screen genome-wide a out carried first we cells, cancer creatic in genes fitness context-dependent Toidentify PDAC cells CRISPR–Cas9 screen for vulnerabilities of RESULTS antibodies. antagonistic with therapeutically that can be exploited as a vulnerability common the Wnt and identified (FZD5) adenocarcinomas Frizzled-5 receptor in vulnerabilities identify to technology pancreatic cancer, we applied genome-scale pooled CRISPR screening gets studied, exposing vulnerabilities that may be tractable therapeutic tar lines cell of the each for identified also were genes fitness dependent genes core essential common ~1,600 a of including line, cell each in genes essential ~2,000 lines cell human in genes to fitness identify screens genetic perform to libraries (gRNA) RNA guide pooled human in screens genetic cells of power the unlocked has and editing inhibitors. Wntto signaling that loss-of-function homozygous have to tumors on depend Wnt signaling pancreatic of subset a that suggesting assays, growth clonogenic in A

The CRISPR–Cas9 system has enabled simple, efficient genome genome efficient simple, enabled has system CRISPR–Cas9 The s e l c i t r 16 RNF43 1 5 1 , 1 1 . We and other researchers have developed lentiviral-based lentiviral-based developed have researchers other and We . 6 4 8 . As expected, several genes encoding core components of of components core encoding genes several expected, As . . Prior to performing this screen, we validated validated we screen, this performing to Prior . . Because . of Because the urgent need for new strategies fortherapeutic , were essential in HPAF-II cells. Surprisingly, out of the 10 10 the of out Surprisingly, cells. HPAF-II in essential were , Cas9 (HPAF-II-Cas9) using lentivirus and validated their their validated and lentivirus using (HPAF-II-Cas9) Cas9 mutant status could act as a biomarker to predict response Supplementary Fig. 2a Supplementary Table 2 Supplementary 1 6 , which contains 91,320 gRNAs targeting targeting gRNAs 91,320 contains which , 16 Supplementary Table 1 , FZD5 1 APC 8 ~0 gntp-pcfc r context- or genotype-specific ~400 . L, TN1 TFL, LRP5 TCF7L2, CTNNB1, WLS, 1 16 , , 4 , , . Each . of Each cell lines was these found 2 , GSK3B WNT7B 2 1 0 were used to calculate precision precision were to used calculate to calculate a log Bayes factor factor Bayes log a calculate to RNF43 ). A total of 2,174 fitness genes 16– RNF43 and and Supplementary Fig. 1a and and 1 ). BF is a measure of the the of measure a is BF ). 9 RNF43 . This work uncovered uncovered work This . mutations, signifying signifying mutations, RNF43 ZNRF3 WNT10A -mutant pancreatic pancreatic -mutant ). The fold-change -mutant RNF43 -mutant pan -mutant Streptococcus Streptococcus , were found found were , Fig. Fig. 1 ( Fig. 1 Fig. Fig. 1 Fig. muta a ). ). We and and – b b c β ). ). ). ). ). ------

was most similar to those of DLD-1 and HCT116 colorectal can colorectal ( cells HCT116 cer and DLD-1 of those to similar most was of HPAF-II profile gene and PaTu8988S ( fitness The to was converted then a difference viously screens reported (HCT116, DLD-1, RPE1, GBM, HeLa). That mutant PDAC and lines cell the average BF across the scores five pre difference between average normalized BF scores in observed library TKO the with screened for type wild are which lines, PDAC cell to specific ( of members the Wnt several genes encoding included which pathway ( respectively 5%), < genes (FDR genes nonessential fitness to of comparison distribution in ( the genes in essential shifts reference substantial exhibited screens Both in ( screens PaTu8988S fitness genome-wide additional performed two we line, cell PDAC Wnt– in involved proteins HPAF-II ( in PDAC cells transduction the of schematic a FZD7 (ref. LGK974 to insensitive are which lines, YAPCcell PDAC and BxPC-3 PANC-1, transduced the or with LGK974 with treated cells in those to to similar cells levels AsPC-1 and PaTu8988S HPAF-II, of growth the inhibited that indicated Results lines. cell required specifically for the growth of the other growth ( normal exhibited ( of each for gRNAs validated and unique two ( targeting gRNA a with TKO library led to robust growth inhibition, comparable to treatment assays. growth of clonogenic Knockout performed then We expressing gRNAs. lentivirus targeting individual with cells PDAC human HPAF-II-Cas9 mutant infected we results screen the validate To FZD5 is required for the growth of RNF43 only genome, human the in encoded genes ( genes fitness lineage-specific and/or and survival exclude the possibility that these genes are merely on depend Wnt–selectively inhibitors lines cell PDAC additional cells, L3.3 excluding and pipeline BAGEL the to (according high-quality and screens our from in genes essential high-confidence compared next CTNNB1 TCF7L2, having pathway this of regulators positive as described proteins encoding previously genes Wnt– to cells PDAC of these addiction known the highlighted readily genes fitness ential differ top the of Examination lines. cell these of origin endodermal Fig. 1 Fig. Fig. 2 Fig. Supplementary Fig. 2b Fig. Supplementary i. 2 Fig. We next examined the context-dependent fitness genes that were were that genes fitness context-dependent the examined Wenext HPAF-II the to specific are findings these if determine To RNF43- or or e a -mutant PDAC -mutant cells. b , , ). In contrast, cells transduced with a control control a with transduced cells contrast, In ). , , Supplementary Fig. 2d Fig. Supplementary CTNNB1 CTNNB1 1 Supplementary Fig. 2f Fig. Supplementary upeetr Fg 11a Fig. Supplementary 4 Supplementary Fig. 2g Fig. Supplementary mutant PDAC cells with a panel of recently published published recently of panel a with cells PDAC mutant RNF43 . These analyses revealed that revealed . analyses These upeetr Fg 1d Fig. Supplementary FZD5 advance online publication online advance RNF43 1 -mutant PDAC cells in comparison to other non- other to comparison in cells PDAC -mutant 4 ( gRNA ( gRNA ( using two individual gRNAs selected from the the from selected gRNAs individual two using ), was not inhibited by gRNAs targeting targeting gRNAs by inhibited not was ), β Fig. 2 Fig. β -catenin), -catenin), -catenin signaling, since we observed several several observed we since signaling, -catenin z -mutant human PDAC lines, AsPC-1 and and AsPC-1 lines, PDAC human -mutant β -scores of of -scores , -catenin or the PORCN inhibitor LGK974 LGK974 inhibitor PORCN the or -catenin c Fig. Fig. 2 ). These screens identified 936 and 2,071 2,071 and 936 identified screens These ). c β Fig. 2 Fig. 2 ). The editing efficiency of each gRNA gRNA each of efficiency editing The ). 2 -catenin signaling for -catenin signaling their proliferation , which are all insensitive to PORCN PORCN to insensitive all are which , Fig. 1 Fig. 1 a LRP6, LRP5, WNT7B LRP5, LRP6, FZD5 6 , ). ). We whether tested also e . For each gene, we calculated the the calculated we gene, each For . ), which may reflect the common common the reflect may which ), c z ). ≥ ). In contrast, the growth of the the of growth the contrast, In ). ) CRISPR–Cas9 screens in seven seven in screens CRISPR–Cas9 ) -score ( -score 2 ( 2 and and RNF43 e gRNAs, but not ). Intriguingly, of the ten FZD FZD ten the of Intriguingly, ). – Fig. 1 Fig. FZD5, WLS, PORCN, WNT3, WNT3, PORCN, WLS, FZD5, i , , RNF43 RNF43 upeetr Tbe 1 Table Supplementary Supplementary Table 2 Table Supplementary upeetr Tbe 4 Table Supplementary Supplementary Table Supplementary 3 c -mutant PDAC cells ). FZD5 FZD4 RNF43

and were previously previously were and -mutant -mutant PDAC cells nature medicine nature β was essential in in essential was , , -catenin signal signal -catenin RNF43 FZD7 -mutant PDAC ) ( ) LacZ FZD7 Fig. 1 Fig. FZD5 gRNA or gRNA or or mutant) gRNAs, RNF43 RNF43 d FZD5 FZD8 ). We). was ). ). ), ), ). ). - - - - - ) ,

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. lines using CRISPR screens (this study and ref. ref. and study (this screens CRISPR using lines a to converted and GBM and RPE-1 DLD-1, HCT116, HeLa, from BF mean to compared were screens PDAC from BF Mean cells. PDAC in vulnerabilities dependent context reveals score fitness differential ( AXIN2). and AXIN1 and DVL3, and DVL2 DVL1, example, (for present are isoforms multiple when BF average or BF its to according shaded on inhibition on relief for allows This CSNK1A1. and GSK3B APC, AXIN2, AXIN1, of composed complex, destruction the inhibits nonessential), three (all DVL3 and DVL2 DVL1, of action the through which complex, receptor FZD5–LRP5 the to binds WNT7B autocrine proposal, this In screen. CRISPR–Cas9 the in HPAF-II ( indicated. are signaling Wnt in function known with genes Selected ( library. gRNA TKO the with cells HPAF-II of infection after d) 35 and 31 (27, points time indicated the at lines) (dashed genes nonessential or lines) (solid genes essential targeting 1 Figure get genes Editing of ( assay I endonuclease T7 a with (TIDE) DEcomposition targeting nature medicine nature compared. are (indicated) lines cell resistant inhibitor PORCN seven and

Genome-wide CRISPR–Cas9 screens identify genetic vulnerabilities of of vulnerabilities genetic identify screens CRISPR–Cas9 Genome-wide AXIN2 FZD5 FZD5 e c a Porcupine Density 0.20 0.30 0.40 inhibitor Porcupine inhibitor 0.00 0.10 or or

sensitive resistant led to marked inhibition of expression of the Wnt tar –10 and

FZD7 PaTu8988S PaTu8988T Panc-03.27 Panc-08.13 PORCN β advance online publication online advance PaTu8902 NKD1 -catenin (CTNNB1), which can now translocate to the nucleus and activate the TCF7L2 transcription factor. Each protein is protein Each factor. transcription TCF7L2 the activate and nucleus the to translocate now can which (CTNNB1), -catenin SU86.86 –8 PANC-1 HPAF-II AsPC-1 BxPC-3 Essential Nonessential T35 T31 T27 2 was quantified using Tracking of Indels by Indels of Tracking using quantified was 3 ( Supplementary Fig. 3a Fig. Supplementary –6 , , which is consistent with aforementioned WL FZD1 CTNNB1 log S b

FZD2 TCF7L2 2 ) Ranked gene-level fitness scores (Bayes factors) from genome-wide CRISPR fitness screen in HPAF-II cells. cells. HPAF-II in screen fitness CRISPR genome-wide from factors) (Bayes scores fitness gene-level ) Ranked (foldchange) −4 Supplementary Figs. 3d Figs. Supplementary FZD3 Essential at5%FDR

FZD4 –2 FZD5 CSNK1A1 1/2/3 DVL FZD6 GSK3B FZD5 0 2 FZD7 CTNNB1 2

). Three PORCN inhibitor sensitive lines that are are that lines sensitive inhibitor PORCN Three ). FZD8 2 z FZD9 AXIN1/2 -score. ( -score.

FZD10 – APC c

Missing data ) or confirmed confirmed or ) 4 Factor WNT1 Bayes WNT7B LRP5

WNT2 b and and e

–50 0 50 100 Bayes Factor

) High-confidence Wnt pathway essential genes identified across various PDAC cell cell PDAC various across identified genes essential pathway Wnt ) High-confidence WNT2B –60 –40 –20 100 20 40 60 80

WNT3 0 11b c 1 ) Schematic of factors implicated as essential for Wnt signal transduction in transduction signal Wnt for essential as implicated factors of ) Schematic WNT3A d FZD5 ). ). WL - WNT4 Differential essentiality (z-score) TCF7L2 CTNNB1

LRP5 WNT5A S −5 10 0 5 WNT7B WNT5B differentiation the of expression increased to led LGK974, with cells ( with transduced cells in observed was change no or Wnt–autocrine of role key a for support provides and results Fig. Fig. 2d RNF43 PORCN WNT6 0 WNT7A ,

WNT7B e -mutant PDAC cells. ( cells. PDAC -mutant WL LRP6 TCF7L2 CTNNB1 WNT3 PORCN FZD5 WNT7B LRP5 ). ). Furthermore, knocking out 5,000 WNT8A S WNT8B

WNT9A β -catenin signaling in signaling -catenin 5,000 WNT9B Genes withgreater screens and PaTu8988SPDAC in HPAF-II,AsPC-1 essentiality scores RNF43 WNT10A Gene rank WNT10B Gene rank -mutant (HPAF-II, AsPC-1 and PaTu8988S) PaTu8988S) and AsPC-1 (HPAF-II, -mutant WNT11 10,000 a WNT16 DLD-1 TKO screens essentiality scoresinother Genes withgreater ) Fold change distributions of gRNA gRNA of distributions change ) Fold AXIN1 5% FDR 10,000 WLS Core Wntpathway

PORCN , HeLa

TCF7L2 components RNF43

CTNNB1 FZD5 , RPE1 ( APC HCT116

LRP5 GSK3B , or GBM LRP6 cells -mutant , 15,000 15,000

PSMD1 FZD5 CTNNB1 ) POLR2D AXIN2 s e l c i t r a Reference essentials ZNRF3

KRAS transducing in FZD7 , , or treating d . ) Ranked ) Ranked Minimal Minimal gRNAs gRNAs

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. GPI anchor (CHO-myc-FZD-GPI). Despite the high sequence iden sequence high the Despite (CHO-myc-FZD-GPI). anchor GPI a through membrane plasma the at anchored receptor FZD tagged myc- of a different domain CRD the expressing each lines, cell CHO ten of panel a generated we cells, on Fabs the of specificity binding Fabs. To to Fab the purified these and ELISAs converted characterize phage- on based FZD-CRDs the of each for Fabs selective most the proteins we which except FZD3, ( not could purify (FZD-CRDs) ( domains cysteine-rich purified the on selections binding performed we Briefly, receptors. used a (Fab) antigen-binding fragment phage-displayed library FZD ten the of one but all detect discriminate can and which antibodies recombinant of panel a generated we in PDACRNA for receptors FZD the levels and lines, protein the cell ( teins not is of due pro FZD likely to of other circuit lack FZD5 expression the on dependence specific their that suggests which cells, these in expressed are genes FZD and Wnt the genes of several that revealed RNF43 each in essential as identified were Wnt ligands encoding or genes two one only Furthermore, cells. AsPC-1 and PaTu8988S HPAF-II, homolog, FZD single a that find to surprised were we FZDs), 10 Wntsand 19 (i.e., pathway Wnt the of complexity combinatorial potential the Given or protein expression FZD5 dependency is not explained by cell-specific mRNA of proliferation the for PDAC cells. essential is FZD5 that for out knocked cells PDAC mutant marker mean represent bars All triplicate. technical in performed experiment, independent an of mean represent dots All gRNA. indicated delivering lentivirus with gene, induced differentiation and contain and inhibition pathway Wnt to sensitive are AsPC-1 and PaTu8988S HPAF-II, gRNAs. indicated delivering lentivirus with transduced (polyclonal), Cas9 in ( experiments. independent three of Representative gRNA. indicated delivering lentivirus with transduced and Cas9 expressing stably cells HPAF-II in 2 Figure A ( members family Frizzled between tity b c a

) T7 endonuclease I cleavage assay confirms gRNA-mediated gene editing in transduced HPAF-II-Cas9 cells. Expected digest products are located located are products digest Expected cells. HPAF-II-Cas9 transduced in editing gene gRNA-mediated confirms assay I cleavage endonuclease ) T7

Supplementary Table 4 Supplementary Relative cell viability s e l c i t r 0.0 0.5 1.0 1.5 gRNA: gRNA: gR ± Fig. 3 Fig. s.e.m., s.e.m., -mutant PDAC cell line ( line cell PDAC -mutant RNF43

NA MUC5AC * HPAF-II FZD5 * : * CTNNB1 LacZ CT La a ). To examine the possibility of a disconnect between between disconnect a of possibility the Toexamine ). knockout inhibits proliferation of of proliferation inhibits knockout mutations. PANC-1, BxPC-3 and YAPC are insensitive to Wnt pathway inhibition. ( inhibition. pathway Wnt to YAPCinsensitive and are BxPC-3 PANC-1, mutations. cZ NNB n Supplementary Fig. Supplementary 4a * PaTu8988 = 3 independent experiments unless otherwise noted. *** noted. otherwise unless experiments = 3 independent FZD5 * 1 1 * ** 4 , whereas no change was observed in in observed was change no whereas , FZ FZ FZD4-2 FZD4-1 , is required to drive cellular proliferation in in proliferation cellular drive to required is , D5 D5 * A S . Representative of three independent experiments. ( experiments. independent three of . Representative -2 -1 sPC- * ** FZ FZ FZD5-1 FZD5-2 P 1 D7 D7 * MUC5AC -2 -1 Fig. 1 Fig. ANC- F La ZD7- ) ) of each of the ten human FZD cZ B 1 FZD7 e FZD7-2 FZD7-1 (

). RNA-sequencing analysis analysis RNA-sequencing ). Supplementary Fig. 4b Fig. Supplementary + 3 n 100 nM 100 xPC- = 2 independent experiments for PaTu8988S), in HPAF-II and PaTu8988S Cas9 cell lines transduced transduced lines cell Cas9 PaTu8988S and HPAF-II in PaTu8988S), for experiments = 2 independent ( RNF43 Y 3 Fig. 2 Fig. *

LG FZD8-2 FZD8-1 * Fig. Fig. 3 K AP 974 -mutant PDAC cell lines and Wnt target genes activation. ( activation. genes target Wnt and lines cell PDAC -mutant f C ). We conclude conclude We ). RNF43 d b

). ). We chose Fold change in expression LGK974 DMSO 0. 0. 1. 1. 0 5 0 5 -mutant -mutant RNF43

2 4 ** HPAF-II and – ** d ** ), ), AX - - -

b P IN ***

< 0.001, ** < 0.001, Base pairs 2 1,000 1,500 and Fab-2921) that exhibited high-affinity binding to human human to binding FZD8-CRD to reactivity cross high-affinity some exhibited also but exhibited FZD5-CRD that Fab-2921) (Fab-2919 Fabs and two isolated we FZD5-CRD, purified on selecting and above described system phage-display antibody the Using cells. in efficacy and properties binding their both and evaluated antibodies human recombinant full-length anti-FZD5 of growth the for tial essen receptor FZD the is FZD5 that showing results our on Based Anti-FZD5 antibodies inhibit the growth of RNF43-mutant PDAC of context the in FZD5 acts as the chief receptor to transduce Wnt–ligands, Wnt of levels endogenous at that conclude We prediction. of the Wnt target genes medium (CM) rescued their growth ( WNT7B by imparted inhibition the growth and rescue could this pair specificity, ligand-receptor the bypass would Wnt3A exogenous of levels high with receptors these of stimulation that predicted we HPAF-IIcells, ( surface cell at the FZD8, possibly and FZD6, and FZD5 FZD1, minimum, at express, cells HPAF-II that confirm to used then was profiler FZD The homologs. FZD different of sion of expres Fabs consists ten that different can to be used discriminate ( FZD3 excluding FZDs remaining of the expression to discriminate used be can which FZD4/9/10, or FZD1/2/5/7/8 FZD5/8, FZD2/7, FZD1/7), (hereafter FZD7 and FZD1 to bound that Fabs found we Moreover, FZD10 and as assessed byFZD6 flow cytometry ( FZD5, FZD4, for Fabs selective identify to able were we c

mR 200 400 600 800 ) Cell viability assays in various PDAC cell lines stably expressing expressing stably lines cell PDAC various in assays viability ) Cell PaTu8988S Since multiple FZD receptors are expressed at the surface of of surface the at expressed are receptors FZD multiple Since ** WNT7B gRNA: NA PCR: * * Fig. 3 Fig. (but not ** P * or – – Exon1 FZD4 < 0.01, and * and < 0.01, e c FZD5 , , Fold change in expression 1 0. 0. 1. 1. Supplementary Fig. 5 Fig. Supplementary advance online publication online advance

0 5 0 5 RNF43 CTNNB1 d – knockout in HPAF-II cells. Treatment of ** Exon2 f FZD4 HPAF-II ) RT-qPCR of Wnt target genes ( genes ) RT-qPCR target Wnt of RNF43 ** AXIN2 * -mutant PDAC -mutant cells. 2 NK P < 0.05, one-sample one-sample < 0.05, D1 ) knockout cells with Wnt3A-conditionedwith cells ) knockout *** -mutant PDAC cells, we next developed developed next we PDAC-mutant cells, –

mR and PaTu8988S * FZD5 NA ** 1 a ** NKD1 ) Clonogenic proliferation assay assay proliferation ) Clonogenic Fig. 3 2 Fig. 3 *** ). The ‘FZD profiler’ therefore therefore profiler’ ‘FZD The ). ( f – f Fig. Fig. 3g Fold change in expression ), ), as well as the expression c 80 20 40 60 , 0 FZD7 Supplementary Supplementary Fig. 5 t 1 RNF43 Fig. 3d Fig. -test.

HPAF-II , β nature medicine nature h MU 2 AXIN2, NKD1 AXIN2, -catenin -catenin signaling ), ), confirming this C5 -mutant PDAC -mutant , e – AC ).

mR PaTu8988S FZD8 1 FZD5 NA

) 2

or * ). - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. experiments) and ( experiments) 20 bars, Scale duplicate. in technical performed one from experiment 15 of images at minimum in HPAF-IIare representative Images expression cells. surface cell showing Fabs, anti-Frizzled different ( to of be at HPAF-IIabove. found the surface determined are indicated FZD receptors a experiment. single in per sample cells 10,000 of, at minimum, is representative figure This in case. this filled were and histograms expression of endogenous as evidence was taken alone antibody for that the secondary 1.35× than MFI greater (MFI). intensity in fluorescence HPAF-II median Values expression cells. indicate ( the Fab in FZD CRD to used selections. to isolate of the color the purified of ID each box corresponds ( CHO lines cell in FZD-CRD-overexpressing by cytometry flow as determined the profiler’, ‘FZD forming Fabs of anti-FZD WNT 3 Figure a OMP-18R5, with directly compared were IgG-2921 and IgG-2919 of proliferation the inhibited IgGs these whether tested and IgG-2921) and (IgG-2919 proteins IgG1 length ( nature medicine nature mean represent Bars triplicate. in technical performed experiment independent upeetr Fg 5 Fig. Supplementary ligand and ligand

Wnt and Frizzled expression patterns are not predictive of essentiality. ( are not predictive patterns expression Wnt and Frizzled WNT10B a WNT10A e 20 20 20 20 WNT9B WNT8B WNT7B WNT5B WNT2B WNT9A WNT8A WNT7A WNT5A WNT3A WNT16 WNT11 FZD10

µ µ µ µ WNT WNT WNT WNT WNT LRP6 LRP5 FZD9 FZD8 FZD7 FZD6 FZD5 FZD4 FZD3 FZD2 FZD1 m m m m LRP5 g 6 4 3 2 1

, HPAF-II h

−2 ) Wnt target gene expression in ) expression gene Wnt target and advance online publication online advance (normalized BF Fitness score AsPC-1 2928 5027 2894 2872 4 2 0 . e hn ovre tee as o full- to Fabs these converted then We ). LRP6 PaTu8988S 20 20 2 2 0 0 µ µ µ µ m m m m Hoechst 33342 co-receptor genes in indicated PDAC cell lines. ( lines. cell PDAC in genes indicated co-receptor )

HPAF-II 2921 2919 2746 AsPC-1 183

PaTu8988S RNF43 (log mRNA expression −4 20 20 20 20

µ µ µ µ m m m m 2 (RPKM +0.01)) µ m. m. (

PANC-1 4 0 -mutant PDAC cells. PDAC -mutant cells. Unstained FZD5 f 2 ) Wnt3A conditioned media (CM) rescues proliferation defect (representative of 4 independent of 4 independent (representative defect proliferation rescues (CM) media ) conditioned Wnt3A ° alone

5328 2968 BxPC-3

- - and 8 g gRNA: YAPC

WNT7B Fold change in expression 0. 0. 1. 0 5 0 f b LacZ c Control Wnt3A gRNA: - - but not in CM CM Fab ID Identify positiveclones 5027 2894 2872 5328 2968 2746 2921 2919 2928 P 183 by phageELISAan

FZD5 =0.00 Phage Fablibrar sequencing AXIN2 with the FZD5 IgGs led to dose-dependent anti-proliferative effects, effects, anti-proliferative dose-dependent to led IgGs FZD5 the with of reactivity to FZD1, FZD2, FZD5, FZD7 and FZD8 (ref. antibody currently which in shows trials, FZD7-derived clinical cross P LacZ 2 1 ± WNT7B =0.000 1 a s.e.m., s.e.m., RNF43 b ) ) ) Schematic for Fab selection by display. phage for Fab selection ) ( Schematic mRNA z CTNNB1 -score-normalized BF and mRNA expression for all BF and expression mRNA -score-normalized CTNNB1 4 3 P

LacZ 7 Validate Fabspecificitywit =0.997 CHO-GPI-FZD 1–10cell FZD5-1 Wnt3a CM Control CM y n -mutant PDAC cell lines HPAF-II, PDACPaTu8988S lines -mutant AsPC-1 and cell + d

= 3 independent experiments. Two-tailed experiments. unpaired = 3 independent LGK974 P panel byFACS =0.004 6 5 FZ -knockout HPAF-II cells. Each dot represents mean of mean one HPAF-II dot Each represents -knockout cells. Pick singlephage D WNT7B clones 8 7 recombinant CR d h Immobilized gRNA ) Determination of FZD receptor membrane membrane of FZD receptor ) Determination Fold change in expression 1 9 0. 0. 1. 1. e 0 5 0 5 h CTNNB ) Indirect immunofluorescence, using the using immunofluorescence, ) Indirect :

LacZ 0 d non-bound phage D 1 P Wash away 100 nM =0.004 unstaine FZD5 FZD expresse Elute andamplif 2 bound phage 292 291 292 502 289 287 532 296 274 ° (3–4 rounds) 18 alon LacZ NKD1 P WNT7B 3 1 9 8 7 4 2 8 8 6 Supplementary Fig. 5 Fig. Supplementary =0.009 LGK974 e d + 1 0 mRNA CTNNB1 P d 0

LacZ 5 =0.25 2 y 1 + 10 LGK974 3 P 6 5 c =0.002 10 ) Specificity profile profile ) Specificity 2. 3. 1. 2. 2. 1. s e l c i t r a 4 0 4 9 4 6 4 FZD 10 8 5 2 receptor, 5 ). ). Treatment ). Color ). Color t -test. © 2016 Nature America, Inc., part of Springer Nature. All rights reserved. cell-cycle analysis in HPAF-II, AsPC-1 and YAPC, treated with PBS performedcontrol, inIgG-2919, technical IgG-2921 triplicate. or LGK974Bars represent(200 nM meaneach). Bars represent meanLGK974. GP2A contains a homozygous experiments. Two-tailed unpaired PORCN inhibitor LGK974. Dots represent mean of t one independent experiment performed in technical2919, IgG-2921triplicate. or OMP-18R5. BarsPoints representrepresent mean mean cell lines (HPAF-II, AsPC-1 and PaTu8988S) and Wnt inhibitor insensitiveFigure 4 cell lines (PANC-1, BxPC-3 and YAPC). Cells were treated with indicated doses of IgG- at liferation ( tested the doses at high doses but no significant effects on HPAF-II or PaTu8988S pro whereas OMP-18R5 had some effects on AsPC-1 cellular proliferation A independent experiments, all statistical tests based on proportion of cells in G -test. (

s e l c i t r g

) RT-qPCR of Wnt– Anti-FZD5 antibodies inhibit growth of g a d Fold change in expression Relative cell viability Relative cell viability 0.0 0.5 1.0 0.0 0.5 1.0 1.0 0.0 0.5 0 0 P P =0.001 =0.002 IgG-2921 IgG-2919 Control IgG IgG-2921 IgG-2919 Control IgG OMP-18R5 AXIN2 β -catenin target genes P 1 1 i =0.14 3

Cells (%) 100 Dose (nM 50 t PANC-1 Fig. Fig. 4a Dose (nM 0 -test. ( * Control HPAF-II P

IgG-2919 = RNF43 h ) 0.011 0 – 3 ) Cell viability assays in three PDAC patient-derived cell lines, each treated with 300 nM IgG-2919, IgG-2921 or 100 nM ) HPAF-II 0 c IgG-2921 P ). ). Additionally, the FZD5 IgGs =0.018 P ** ** 0.008 =0.024 NKD1 variant, whereas GP3A and GP7A are

RNF43 LGK974 P AXIN2 100 =0.19 ** ** 0.005 300 ± -mutant PDAC through cell-cycle arrest. ( *** ± s.e.m., ** and s.d., e Cells (%) 100 Relative cell viability 50 0 NKD1 Control 0.0 0.5 1.0 n OMP-18R5 100 nMLGK974 IgG-2921 IgG-2919 Control IgG PBS b = 3 independent experiments. *** n P 0 = 2 independent experiments. Two-tailed unpaired

Relative cell viability IgG-2919 = 0.0 0.5 1.0 in HPAF-II after treatment with 300 nM IgG-2919, IgG-2921, OMP-18R5 or 100 nM of the 0.009 AsPC-1 0 IgG-2919 Control IgG IgG-2921 IgG-2921 0.004 OMP-18R5 IgG-2921 IgG-2919 Control IgG LGK974 3 0 - Dose (nM) /G 0.008 BxPC-3 h 1 Relative cell viability 3 3 , compared to control. Two-tailed unpaired PaTu8988S FZD5 FZD5 Fabs to these cell lines via immunofluorescence, we consistently ( cells YAPC or the in or effect no negligible had 0.0 0.5 1.0 Dose (nM RNF43 100 Cells (%) 3 50 0 0 P

Control P ) =0.015 P GP2A =0.021 * 0 =0.027 WT. Each dot represents mean of one independent experiment P

IgG-2919 = a 0.78 – 300 P f

IgG-2921 YAPC ) Cell viability assays in advance online publication online advance < 0.001, ** Fig. 4d Fig. 300 ** 0.43 GP3A

LGK974 f

Relative cell viability c 0.60 0.5 1.0 0.0

Relative cell viability – 0.0 0.5 1.0 f ). When we examined the binding of the the of binding the examined we When ). 0 Phase: Cell Cycle P 0 < 0.01, and * G S G 0 2 t /G /M -test. ( IgG-2919 Control IgG IgG-2921 1 GP7B OMP-18R5 IgG-2921 IgG-2919 Control IgG RNF43 RNF43- *** 3 i t ) DNA-content staining based 3 3 -test. Dose (nM Dose (nM YAPC AsPC-1 wild-type PANC-1, BxPC-3 PANC-1, BxPC-3 wild-type P < 0.05, two-tailed unpaired mutant and Wnt dependent ± s.e.m., ) 100 nMLGK974 IgG-2921 IgG-2919 Control IgG PBS ) 3 ** 0 0 nature medicine nature n = 3 independent 300 300 ** ± s.d., n = 2

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. bioluminescence images obtained at day 34 in in 34 day at obtained images bioluminescence flux. photon of quantification by measured Tumorwas size OMP-18R5. 5 mg/kg or IgG-2919 2 mg/kg in 32 day at obtained images flux. photon of quantification by measured Tumorwas size OMP-18R5. 2 mg/kg or IgG-2919 2 mg/kg control, vehicle PBS with dosed and xenografts orthotopic as grown were cells HPAF-II ( conditions, mm 200 reached tumors when and xenografts, 5 Figure anti-prolifera significant ( cells GP2A in observed efficacy tive and lines cell early-passage PDAC patient-derived individual three in IgG-2921 of and IgG-2919 effects the tested we models, tumor PDAC representative more of proliferation knockout cells the genetic inhibit the and mimic FZD5 of IgGs anti-FZD5 that demonstrate ( cells treated IgG-2919 of growth the rescue to able was Wnt3A-CM exogenous Wnt– specific of inhibition to led treatment, IgG control to comparison in treatment, IgG anti-FZD5 detected ( level. protein we the at FZD5 of but sion lines, cell overexpres possible indicating sensitive lines, resistant in binding no to little the to binding clear found nature medicine nature ( i c e a ) Weights of AsPC-1 tumors after dissection ( dissection after tumors AsPC-1 of ) Weights ) Histological staining of representative tumors from control and antibody-treated xenograft models. Scale bars, 100 100 bars, Scale models. xenograft antibody-treated and control from tumors representative of staining ) Histological 3 Tumor volume (mm ) in IgG-2921 or IgG-2919 using of utility the explore further To 2,000 1,000 OMP-18R5 IgG-2919 Vehicle control vitro in 0

Anti-FZD5 antibodies inhibit growth of of growth inhibit antibodies Anti-FZD5 6 treatment n Start of = 10 for human human for = 10 . 10 Supplementary Fig. 7a Fig. Supplementary Days posttumorcellinoculation β IgG-2919 (2mg/kg) IgG-2919 (1mg/kg) Human Vehicle buffer -catenin pathway inhibition ( inhibition pathway -catenin advance online publication online advance AXIN2 γ -globulin (10mg/kg) 20 d γ and and -globulin and 2 mg/kg IgG-2919 conditions). ( conditions). IgG-2919 2 mg/kg and -globulin . . ( Fig. 4 Fig. f ) Luciferase-expressing AsPC-1 cells were grown as orthotopic xenografts and dosed with PBS vehicle control, control, vehicle PBS with dosed and xenografts orthotopic as grown were cells AsPC-1 ) Luciferase-expressing 30

2 NKD1

photons/sec/mm h Supplementary Fig. 6 Fig. Supplementary h OMP-18R5 ). GP2A cells harbor an an harbor cells GP2A ). IgG-2919 ). Taken together, these results results these Takentogether, ). 2.0 2.8 5.4 8.0 Vehicle control n mRNA; this demonstrates demonstrates this mRNA; = 8 for each condition, except vehicle control day 32 ( 32 day control vehicle except condition, each = 8 for × × × × 10 10 10 10 n

3 P = 9E-5 f = 8). All data are represented as mean mean as represented are data All = 8). , mice were divided into groups and dosed intraperitoneally ( intraperitoneally dosed and groups into divided were , mice 6 7 7 7 . . ( RNF43 RNF43 M2 M14 M0 P = 4E-8 h Fig. 4 Fig. ) Representative images of AsPC-1 tumors dissected at 37 d post inoculation. Scale bar, 1 cm. Scale inoculation. d post 37 at dissected tumors AsPC-1 of images ) Representative (10 mg/kg) 4 M 4 f b γ (1 mg/kg) (2 mg/kg) IgG-2919 IgG-2919 -globulin Human Vehicle M25 M15 -mutant PDAC in in PDAC -mutant 05 Total flux (photons/sec 107)

× PDAC -mutant

g 100 200 ). Addition of of Addition ). M2 M06 0 M16 6 6 ). Notably, ). treatment Start of M27 M07 M17 Days posttumorcellinoculation 10 RNF43 OMP-18R5 (5mg/kg) IgG-2919 (2mg/kg) Vehicle control i in vivo in - - Tumor weight (mg) c

1,000 Human 500 20 b

IgG-2919 IgG-2919 γ-globulin this in ( context apoptosis to lead not does signaling Wnt of inhibition that suggesting cleavage, caspase-3 detectable no induced IgG-2919 with cells HPAF-II of treatment Finally, YAPC cells. LGK974-insensitive 7b Fig. Supplementary of percentage cells in G the in increase a significant HPAF-IIcaused in AsPC-1 and LGK974 in the G content staining, followed by flow cytometry, revealed cell cycle arrest the anti-FZD5 IgGs was a result of cytostasis and/or cytotoxicity. DNA ( proliferation for type mRNA stability study association genome-wide a in ( (R117H) variant ) Representative images of xenograft tumors obtained in in obtained tumors xenograft of images ) Representative 0

xenograft models. ( models. xenograft (1 mg/kg) (2 mg/kg) (10 mg/kg) Control We were also interested in whether the in decrease cells’ viability by P H&E =0.0003 0 ±

IgG-2919 RNF43 /G Supplementary Figs. 7c Figs. Supplementary 30 s.e.m., two-tailed unpaired unpaired two-tailed s.e.m., P =0.15 1 cell-cycle phase. Treatment phase. or IgG-2921 IgG-2919, with cell-cycle Alcian Blue

OMP-18R5 4 Fig. 2 , with IgG-2919 or IgG-2921 had no effects on cell cell on effects no had IgG-2921 or IgG-2919 with , 7

P = 0.27 wild are which cells, or GP7B . Treatment of GP3A Supplementary Fig. 8 Fig. Supplementary n a P = 0.050 h = 7). ( = 7). ) HPAF-II cells were grown as subcutaneous subcutaneous as grown were cells ) HPAF-II ). n 0 = 9 per group. ( group. = 9 per d /G

7 in detected was change no Conversely, ). g Total flux (photons/sec× 10 ) 1 400 200 and in decrease S, G e

n OMP-18R5 IgG-2919 Vehicle control 0 ) Representative bioluminescence bioluminescence ) Representative = 9 for vehicle and 1 mg/kg IgG-2919 IgG-2919 1 mg/kg and vehicle = 9 for treatment Start of 7 and and Days posttumorcellinoculation OMP-18R5 (2mg/kg) IgG-2919 (2mg/kg) Vehicle control 10 t -test. 2 µ 6 g m. ( m. 11c and shown to affect affect to shown and ) Representative ) Representative ) previously linked to PDAClinked ) previously ). We conclude that FZD5 FZD5 that We ). conclude d ) Luciferase-expressing ) Luciferase-expressing 20 2 or M phase ( s e l c i t r a a .

photons/sec/mm2 30 1.7 ×10 3.4 ×10 5.0 ×10

8 ×10 RNF43 Fig. Fig. 4

P = 0.082

5 7 7 7 P = 0.0097 i ,

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. ( P control, of (51% IgG-2919 of effects inhibitory growth the confirm to them weighed and site orthotopic the from tumors the dissected 10c Fig. ( Supplementary tumors control with compared respectively, inhibition, 5 mg/kg OMP-18R5 to ( 60% led Similarly, AsPC-1 orthotopic tumors treated with 2 mg/kg IgG-2919 or ( Supplementary tumors control Fig. 10a with compared experiment 32-d a over 74% ( topic tumors treated with 2 mg/kg IgG-2919 or OMP-18R5,InHPAF-II (HPAF-II d 7 inoculation. tumorcell after ortho model) we observed week with either IgG-2919 or OMP-18R5 starting 6 (AsPC-1 model) or bioluminescence imaging and initiated therapeutic treatments twice a WeAsPC-1 cells. monitored then tumor growth live in using animals topic pancreatic tumors in mice with luciferase-expressing HPAF-II or mutant PDAC tumors with anti-FZD5 antibodies, we established ortho underestimated. be may antibodies the of efficacy the that note to important is it mucin, with filled are ( differentia tion cellular with consistent staining, Blue Alcian and PAS by visualized as production, mucin increased revealed tumors of the visual signs of toxicity ( 9a Fig. Supplementary ( respectively inhibition, growth tumor 73% or 46% to 200mm at IgG-2919 mg/kg 2 or 1 with Treatment HPAF-II subcutaneous mice bearing in immunodeficient xenografts. G through culture of proliferation the inhibit antibodies *** regression. nonlinear using fitted were Data IWP2. inhibitor PORCN the of dose a maximal with or IgG-2919 anti-FZD of doses various with treated when ( ( organoids. (CRC) cancer 6 Figure A likely present in subcutaneous and orthotopic PDAC tumors, the effects a Supplementary Fig. 10e Fig. Supplementary c a

= 0.0003) ( 0.0003) = , To further explore the therapeutic potential of targeting targeting of potential therapeutic the explore further To growth tumor on IgG-2919 of effect the We evaluated next b

Relative cell viablity Relative cell viablity s e l c i t r P 100 100 ) and two two ) and 50 50 < 0.001, extra sum of squares squares of sum extra < 0.001, 0 0 0.01 P

Fig. 5 Fig. 0.01 P19Tb -RNF43AA355fsmutation = 0.0097) and 42% (

Anti-FZD5 IgG inhibits survival of of survival inhibits IgG Anti-FZD5

n 0.1

0.1 IWP2 Control IgG IgG-2919 P14T -APCmutation c = 2 independent experiments run in technical triplicates. triplicates. technical in run experiments = 2 independent IWP2 IgG-2919 Control IgG RNF43 , , Fig. 5h Fig. Supplementary Fig. 9d Fig. Supplementary Dose (nM Dose (nM 1 1 0 /G -mutant ( -mutant , i 10 10 , , 1 ) Supplementary Fig. 10d Fig. Supplementary cell-cycle arrest. cell-cycle ) Supplementary Fig. Supplementary 9c ) with no weight loss ( a , b – ). At the endpoint of the AsPC-1 study, we study, AsPC-1 the of endpoint the At ). 100 ). There were no changes in body weight or weight ). were in no There body changes ). Thus, although different Wntare different ligands although Thus, ).

d 100 ) Cell viability assays for two two for assays viability ) Cell P c = 0.082) growth inhibition, respectively, , 1,000 1,000 d ) CRC-patient-derived organoid lines lines organoid ) CRC-patient-derived ** P * F = 0.05) and = 0.05) ( 32% d b -test. Relative cell viablity Relative cell viablity 100 150 100 50 ) 50 RNF43 0 1 0.01 0.01 0 RNF43 4 . Since the residual tumors tumors residual the Since . P1947 -RNF43AA224fs/AA659f Supplementary Fig. 10b 0.1 0.1 IWP2 IgG-2919 Control IgG -mutant PDAC cells in in PDAC cells -mutant P18T -APCmutation IgG-2919 IWP2 Control IgG ). ). Histological analysis -mutant colorectal colorectal -mutant ) with no weight loss loss weight no with ) Dose (nM) Dose (nM 1 1 P 3 tumor size led led size tumor = 0.27) growth = 0.27) APC

Fig. 5a Fig. 10 10 ) -mutant -mutant i. 5d Fig. i. 5f Fig. 100 100 RNF43 in vivo in , b 1,000 1,000 and and ** s , , g * e ). - - - - , ,

FZD5 antibodies as a targeted cancer therapy. cancer targeted a as antibodies FZD5 of anti- utility potential the broadening types, cancer multiple across agent therapeutic, OMP-18R5 was less effective in blocking the the blocking in effective less was OMP-18R5 therapeutic, agent inhibitors. FZD to resistance of mechanism a represent could of tion Wntother threshold a certain beyond ligands endogenous doses of Wnts; this suggests the possibility that upregula to be in FZD the to single capable response of signals the transducing a mounting of capable are and cells these of surface the at functional are receptors Frizzled that indicates circuit WNT–FZD5 endogenous the bypass and cells of growth the rescue can Wnt3A-CM ectopic with stimulation That levels. expression normal under tion discrimina provide may affinities binding in differences small that indicates expressed.This being FZDs and Wnts many despite cells, ten PDAC of the proliferation for of important one functionally are receptors FZD only and ligands Wnt two or one that shows study doses endogenous at interactions of representative being not of proteins to due overexpression possibly inconclusive, largely have been receptors Frizzled different the with interaction of specificity Wnt may by ligands governed be in contexts. expression some with the other PDAC cell lines ( PaTu8988Scomparison in in cells expressed highly mRNAis WNT3 for role a supported further down mesenchyme signaling in the epithelium and paracrine response in the surrounding tor cell growth coordinating pancreas development through autocrine previously identified as a physiological regulator of pancreatic progeni WNT3 WNT7B of Wnt ligands was found to be essential in the different cell lines, with Wnt– of bulk the transducing for responsible solely and proliferation lular only FZD receptor in encoded the human genome as for essential cel independent Our results, which integrated genome-wide screens performed in three DISCUSSION indicate that FZD5 dependency may be linked with with may be linked dependency that FZD5 indicate organoids to were ( treatments sensitive both ( IWP2 and IgG-2919 to the that found We IWP2. of activation distal to due insensitive be to predicted are which organoids, CRC patient-derived inhibitors PORCN to an harbor to found was drugs ent differ of panel a to sensitivity their examined and patients 20 from organoids cancer colorectal generated A study recent context. in this tal cancer (CRC) Given the findings that CRC-patient-derived organoids Anti-FZD5 antibodies block the growth of opportunity for treatment of FZD5 with specific antagonistic antibodies represents a tumor new therapeutic different microenvironments. in potent Taken equally together, are these antibodies results anti-FZD5 indicate that the targeting of Unexpectedly, when compared to our anti-FZD5 IgGs as a single- a as IgGs anti-FZD5 our to compared when Unexpectedly, exhibit ligands Wnt whether determining at attempts Previous β in PaTu8988S ( -catenin signaling in -catenin signaling this context. Similarly, a limited selection and and 2 8 . Interestingly, one of the tumor organoids (id P19Tb) P19Tb) (id organoids tumor the of one Interestingly, . 2 WNT10A RNF43 9 β . Gene expression analysis and shRNA-mediated knock -catenin, to IgG-2919 and to the PORCN inhibitor inhibitor PORCN the to and IgG-2919 to -catenin, advance online publication online advance RNF43- 9 , , we reasoned that may FZD5 dependency also exist -mutant PDAC cell lines, identified FZD5 as the the as FZD5 identified lines, PDAC -mutant cell 2 Fig. Fig. 1 essential in HPAF-II, in essential 8 RNF43 β . Therefore, we tested the sensitivity of two two of sensitivity the tested we Therefore, . mutant mutant CRC and organoids two Fig. 6a Fig. -catenin response. However, FZD5 appears appears FZD5 However, response. -catenin RNF43 APC e RNF43 , , mutations frequently occur in colorec Supplementary TableSupplementary 2 , Fig. Fig. b -mutant organoids were insensitive insensitive were organoids -mutant mutation and displayed sensitivity sensitivity displayed and mutation ), whereas the the whereas ), -mutant pancreatic cancer. WNT7B 3 a ), suggesting the essentiality of ), the essentiality suggesting FZD5 in PDAC cell growth cell PDAC in RNF43 Fig. Fig. 6c WNT7B or or

RNF43 nature medicine nature WNT7B , RNF43 d -mutant in AsPC-1 and AsPC-1 in ). These ). results These ). ). WNT7B was -mutant CRC -mutant APC knockout knockout mutation mutant 3

1 . Our Our . 3 0 ------.

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. S.A., S.A., J.M., S.A., S.S.; J.M.,supervision, S.S., H.C., and J.P. S.J.,M.R., R.O., S.F.B., J.A., K.R.B.; writing, S.A., Z.S., J.M.; funding acquisition, Conceptualization, S.A., J.M., S.S.; investigation, Z.S., Z.P., M.C., T.H., X.W., X.Z., Innovation and Ontario Research Fund, project numbers 19442 and 30961. (Diet, Digestive Tract and Centre Disease) funded by the Canadian Foundation for Transduction. Some of the equipment used in this study was supported by The 3D and S.A. holds a Canada Research Chair in Functional Architecture of Signal to S.S. J.M. holds a Canada Research Chair in Functional Genomics of Cancer (CIHR-273548) and J.M. (CIHR-342551) and by the Ontario Research Fund from grants funded by the Canadian Institutes for Health Research to S.A. xenograft cells; P. Mero (Moffat lab) for help with images. This work was supported (Ontario Cancer Institute, Toronto, Canada) for providing the patient-derived to thankful D. Hedley (Princess Margaret Hospital, Toronto, Canada) and M. Tsao We wish to thank members of the Angers and Moffat labs for discussions. We are o Note: Any Supplementary Information and Source Data files are available in the t the in available are references, and codes accession statements of including Methods, and data availability any associated M Wnt signaling. antibodies may be less toxic than other approaches that broadly target FZD-specific diseases, or tumors various in activated circuit naling is compromised. Moreover, by the targeting Wntexact selectively sig where cancers other to possibly findings, these expand further also in organoids CRC of PDACs. Experiments multiple in and vivo cells patient-derived models, culture cell standard in of growth the at inhibiting effective were antibodies anti-FZD5 Our of novel biologics. development the guide in gene fitness context-dependent top the as FZD5 context- identified we Herein cancer. as identify to means powerful specific fitness genes and that can be harnessed unbiased to treat an human diseases screens such provides genetic CRISPR-based genome-wide genetic using specific of vulnerabilities of identification The prediction difficult. the targets makes therapeutic components signaling intracellular co-receptors and and receptors FZD ligands, Wnt of number of terms in axis effect. therapeutic maximal for important are which antibodies of anti-FZD properties the understand to better needed be Future will work CRDs. FZD5 with interaction the underlying cooperativity negative or co-receptors LRP6 or LRP5 the of engagement the interference with binding, ligand Wnt for compete to antibodies the of ability differential the include reasons potential Other shown). not data (J.A., differences significant reveal not did resonance plasmon but surface reason, using antibodies one the of be affinity the of could determination careful FZD5 binding of affinities Differential increased of IgG-2919 efficacies and the IgG-2921 over OMP-18R5 for remain unclear. basis molecular The proliferation. cell tumor for suggesting that residual IgG-2921, and IgG-2919 than degree lesser a to but expression gene target Wnt reduced OMP-18R5 Notably, xenografts. orthotopic as of growth nature medicine nature AUTHOR CO A h n ck l et e Despite the known requirement of the Wnt– the of requirement known the Despite i n

p e n h

a v ow p e models, corroborating FZD5 as a therapeutic target in a subset ods r RNF43 e s i r o . ledg n

RNF43 o N f

t TRIBUTIO h -mutated PDAC -mutated m RNF43 e

p en a p -mutant PDAC cells grown grown cells PDAC -mutant

e ts r advance online publication online advance . -mutated PDAC and leveraged this finding to to finding this leveraged PDACand -mutated N β -catenin -catenin signaling may be sufficient to allow S 1 4 , the complexity of this pathway in in pathway this of complexity the , RNF43 RNF43 -mutant PDAC-mutant cells β or n vitro in -catenin signaling signaling -catenin o ZNRF3

n l i n or or e

v function function e r

n vivo in s i o n

o - f

12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 1. r at online available is information permissions and Reprints The authors declare no competing interests.financial 31. 30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13. COMP e p

Hao, H.X. Hao, B.K. Koo, candidate Identifying Y. Ionov, & J.K. Cowell, L., Hawthorn, K.C., Lo, I., Ivanov, M. Giannakis, K. Wang, G.L. Ryland, N. Waddell, new mechanisms, source--new the at Wnts Targeting D.M. Virshup, & B. Madan, cancer. in signaling Wnt P. in Polakis, targets therapeutic as pathways signalling WNT R.T. Moon, & J.N. Anastas, and Lgr5 Wnt, of role the cells: stem mammalian Adult H. Clevers, & J. Schuijers, development. in signaling Wnt of Mechanisms R. Nusse, & A. Wodarz, Dijksterhuis, J.P. M.D. Arensman, for required is Wnt7b J. Jensen, & C. Penton, M., Schmerr, B., Pool, S., Afelik, M. Wetering, de van Jo, Y.S. S.K. Low, A. Gurney, H. Persson, quantitative Easy B. Steensel, van & M. Amendola, T., Chen, E.K., Brinkman, Aguirre, A.J. error Measuring J. Moffat, & R. Rottapel, F., Sircoulomb, K.R., Brown, T., Hart, essential identifying for framework computational a BAGEL: J. Moffat, & T. Hart, cells human in screens Genetic E.S. Lander, & D.M. Sabatini, J.J., T.,Wei,Wang, T.Wang, O. Shalem, Hart, T. P.D.,Hsu, F.CRISPR-Cas9 Zhang, Lander,of & applications E.S. and Development X. Jiang, inhibitor Porcupine H. Clevers, & M. Born, den van J.H., Es, van B.K., Koo, manner. receptors. Wnt of endocytosis cells. cancer colon in decay mRNA nonsense-mediated of inhibition using genes suppressor tumor cancer colon cancers. cancer.gastric in mutationsdriver new identify precursors. neoplastic cancer. drugs. new biomarkers, (2012). cancer. R-spondins. Biol. Dev. Cell (2015). WNT-FZDpairs. distinct by selectivity functional adenocarcinoma. pancreatic (2014). 899–908 in growth anchorage-independent development. pancreatic in epithelial progenitor growth and operates during epithelial-to-mesenchymal signaling patients. cancer colorectal 46 cancers. colorectal and gastric in heterogeneity regional its and gene population. USA Sci. tumors. human of tumorigenicity and growth decreased in results antibodies. synthetic decomposition. trace Res. sequence by editing genome of assessment targeting. CRISPR/Cas9 to functional human for standards gold screens: genomics. perturbation genomic in rates screens. library pooled from genes system. CRISPR-Cas9 the using genome. Science Liabilities. Cancer Specific engineering. genome for (2013). neoplasia. pancreatic ductal adenocarcinoma. Rnf43;Znrf3-mutant of growth USA Sci. Acad. Wnt-driven Natl. Proc. paracrine suppresses i n t , 1640–1646 (2015). 1640–1646 , s E /

i n 42 TI d

e et al. NG et al. , e168 (2014). e168 , Nature Nat. Rev. Cancer Rev. Nat. 343 Nature x

Nat. Genet. Nat. Science et al. et 109 t al. et . et al. et et al. et t al. et et al. et Mol. Syst. Biol. Syst. Mol. h FI t al. et et al. et PLoS One PLoS t et al. et EMBO J. EMBO et al. , 84–87 (2014). 84–87 , Frequent frameshift mutations in 2 mononucleotide repeats of RNF43 High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype- m t al. et t al. et , 11717–11722 (2012). 11717–11722 ,

Identification and characterization of essential genes in the human the in genes essential of characterization and Identification

N l t al. et 14 hl-eoe eunig n cmrhnie oeua profiling molecular comprehensive and sequencing Whole-genome .

518 ZNRF3 promotes Wnt receptor turnover in an R-spondin-sensitive an in turnover receptor Wnt promotes ZNRF3 Genome-wide association study of pancreatic cancer in Japanese in cancer pancreatic of study association Genome-wide Tumour suppressor RNF43 is a stem-cell E3 ligase that induces that ligase E3 stem-cell a is RNF43 suppressor Tumour 485 nciaig uain o RF3 ofr n dpnec in dependency Wnt confer RNF43 of mutations Inactivating A

Genome-scale CRISPR-Cas9 knockout screening in human cells. human in screening knockout CRISPR-Cas9 Genome-scale et al. n ptwy niiin i te agtn o Fize receptors Frizzled of targeting the via inhibition pathway Wnt Whole genomes redefine the mutational landscape of pancreatic of landscape mutational the redefine genomes Whole t al. et Genomic copy number dictates a gene-independent cell response 350 , 59–88 (1998). 59–88 , N D-3 iest i nt eurd o atgn eonto by recognition antigen for required not is diversity CDR-H3 uainl adcp o mcnu oain acnm ad its and carcinoma ovarian mucinous of landscape Mutational , 495–501 (2015). 495–501 , CIA N4 i feunl mttd n ooetl n endometrial and colorectal in mutated frequently is RNF43 , 195–200 (2012). 195–200 ,

J. Mol. Biol. Mol. J. 46 t al. et

, 1096–1101 (2015). 1096–1101 , Systematic mapping of WNT-FZD protein interactions reveals 31 Genome Med. Genome 5 N7 mdae atcie Wnt/ autocrine mediates WNT7B Mol. Cancer Ther. Cancer Mol. , e11824 (2010). e11824 , , 1264–1266 (2014). 1264–1266 , L

Cell , 2685–2696 (2012). 2685–2696 , 13 I

rsetv drvto o a iig raod ibn of biobank organoid living a of derivation Prospective 10 Cancer Discov. Cancer Cell Cell N Dev. Biol. Dev. 112 , 11–26 (2013). 11–26 ,

Oncogene 157 T , 733 (2014). 733 , Nature

E 161 , 7548–7550 (2015). 7548–7550 , 163 Science RSTS , 1262–1278 (2014). 1262–1278 ,

425 Proc. Natl. Acad. Sci. USA BMC Bioinformatics BMC , 933–945 (2015). 933–945 , , 1515–1526 (2015). 1515–1526 ,

488 399

, 87 (2015). 87 , , 803–811 (2013). 803–811 , 26

343

od pig ab Prpc. Biol. Perspect. Harb. Spring Cold , 665–669 (2012). 665–669 , , 2873–2884 (2007). 2873–2884 , , 204–217 (2015). 204–217 , 6 14 , 914–929 (2016). 914–929 , , 1087–1094 (2015). 1087–1094 , , 80–84 (2014). 80–84 , Nat. Genet. Nat. J. Biol. Chem. Biol. J.

17 h β , 164 (2016). 164 ,

s e l c i t r a ctnn inln and signaling -catenin t 46 t p

110 : , 573–582 (2014). 573–582 , /

/ w 290 Proc. Natl. Acad. Natl. Proc. w , 12649–12654 Oncogene w uli Acids Nucleic , 6789–6798 , . Hum. Pathol. Hum. n a Annu. Rev. Annu. t u r e .

c o 33

m 4 , /

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. f Aguirre from data count read Raw data. screen CRISPR–Cas9 genome-wide published previously of Analysis h points were summed to a final BF for each gene. BAGEL software is available at ure that the gene knockout results in a fitness defect. Bayes Factors at each time used to calculate a Bayes Factor for each gene, representing a confidence meas with gRNA T31, T35) and a log fold change relative to control (T0) was calculated for each (T27, points time indicated the of each at replicate each for normalized were screen. selection negative CRISPR of Analysis at approximatelyT35, 10, and 18, 21 and 23 doublings respectively.T31 T27, T15, at collected were Samples population. per plates cm 15 five over seeded cells million 18 with days, four every parallel in saged (18 million cells) for genomic DNA extraction. Replicate collected populationswere were samples library pas reference T0 addition, 200-fold In cells). minimum million (18 coverage of populations replicate independent two into were splitpost-puromycincells h (and48 selection) post-infection h 72 cells). transduced million (~27 300× offold-coverage library a and 0.3 of MOI an at sensitivity as their parental population ( same the exhibit to found was clone Each inhibitor,LGK974. PORCN the to their parental populations through viability assay and dose response sensitivity to compared were Clones fragments. PCR digested to undigested of ratio the that is interrupted when indels are formed. Indel formation by can assessed be ( targeting gRNA delivered pLCKO a with activity cleavage Cas9 for screened and expanded were Clones dilution. limited by isolated were clones selected with blasticidin. A polyclonal stable cell line and was above established and single described as Cas9-2A-BsdR Lenti with transduced were lines cell Lentiviral gRNA library essentiality screens. STR profiling at The Centre for Applied Genomics (Toronto, Ontario, Canada). D.Hedley and M.Tsao, Toronto, Canada. byAllcell lines were authenticated provided generously with were lines cell PDAC derived Spain.Patient Madrid, BxPC-3 cell lines were sourced from ATCC. PaTu8988S was a gift from F. Real, mycoplasma detection kit (Lonza # LT07-118). HPAF-II, AsPC-1, PANC-1 MycoAlert a and using studies follow-up during and screens before mycoplasma for tested were Cells #BLA477). Canada (BioShop hydrochloride blasticidin 5 were selected in medium containing 10 cells selection, blasticidin For #PUR333). Canada (BioShop dihydrochloride 2 containing medium in selected were cells selection, cin penicillin/ and CO 5% FBS and 37° at maintained were lines cell streptomycin. All 10% with supplemented #11320-033) (ThermoFisher patient derived cell lines (GP2A, GP3A, GP7B) were maintained in DMEM/F12 and CHOPenicillin/Streptomycin. and FBS 10% with supplemented #11875) YAPC cell and lines BxPC-3 were maintained AsPC-1, in RPMI #15140-163). 1640 with (ThermoFisher L-glutamine Penicillin/Streptomycin (ThermoFisher (ThermoFisher #11965) and supplemented with 10% FBS (ThermoFisher) and D-glucose, g/L 4.5 containing DMEM in maintained were lines culture. Cell Toronto).of University Biophysics, Medical of Department Centre, Cancer Margaret (Princess lab Ailles the by for cells AsPC1-luc and HPAF-II-luc generating for used GFP-IRES-LUCIFERASE) (PGK- construct luciferase firefly lentiviral The FZD_CRD-MYC-GPI. sette: cloned into the expression lentiviral plasmid pLenti-puro in the following cas previously described were gRNAs # (Addgene vector lentiviral pLCKO the and Cas9 expressing stably lines cell Plasmids. ONLINE MET nature medicine nature i Supplementary Fig. 1b,e,hSupplementary 7 t g t µ 3 s The selected Cas9-2A-BsdR clone was transduced with the 90k gRNA library p h g/ml (PANC-1), 2 2 (PANC-1), g/ml 3 s 1 a : / r 1 / e s ) was used for TKO library construction and expression of individual individual of expression and construction TKO library for used was ) . o c in vivo in u o Lenti Cas9-2A-BsdR vector (Addgene # r m c ≥ e HPAF-II, PaTu8988S, cell L-cell mouse PANC-1,and HEK293T / 30 reads in the T0 control sample. The BAGELalgorithm The sample. control T0 the in reads 30 f a o r r t orthotropic model mice experiments was kindly supplied supplied kindly was experiments mice model orthotropic H i g c e l ODS . e n s e / t A / µ p g g/ml (BxPC-3) or 1 1 or (BxPC-3) g/ml r u o i r j e r ). ). Briefly, gRNAthis targetssite a restriction SacII c e t M s / e b y a e 1 g r 6 e s . Each of the ten human FZD CRDs was was CRDs FZD human ten the of Each . l / t al. et - 3 f µ o 4 Supplementary Supplementary Fig. 1c,f,i g/ml (HPAF-II), 8 r 2 - 0 k 2 9 n 2 0 were downloaded from from downloaded were HPAF-II, AsPC-1 and PaTu8988S o 7 c µ . Data from pancreatic cancer cancer pancreatic from Data . k /l AP- ad AC of YAPC) and (AsPC-1 g/ml o Read counts for each gRNA each for counts Read u 7 t 3 - 3 s c 1 r 0 e ) ) was used to generate e n µ s g/ml (PaTu8988S), µ / . g/ml puromycin g/ml 2 . Forpuromy . l ). -glutamine -glutamine FAM83G h 2 t 0 t p was was s : / - - - - /

Cell viability assays. viability Cell control or Wnt3A CM from initial infection onwards. For Wnt3A conditioned cells wereexperiment, rescue media treated with 25% solutionstaining removed dH was in times and plates were several washed methanol 25% violet, solutiontal for 20 atmin room temperature, after which using 100% ice-cold methanol. After fixation cells were stained with 0.5% crys Medium was renewed 3–4 every days and cells were fixed, 10 days post plating, Chemical #14072) (note that these wells were from the indicated wells were treated with DMSO control or 100 nM LGK-974 (Cayman were re-seeded in 24-well format in media without puromycin. 24 hcells were post PBS washed extensively,seeding, dissociated and counted. 2,000 cells per well selection, of h puromycin.48 with After treated were cells infection after h 24 with lentivirus generated with the indicated pLCKO plasmid as described above. Crystal violet staining proliferation assay. genes train BAGEL and nonessential to generate precision/recall curves. and essential of sets Reference line. cell BAGEL and used to calculate a Bayes Factor sample), of gene essentiality using all replicateseach for each to added was reads 0.5 of pseudocount (a ( guides remaining all For discarded. were Achilles_v3.3.8.reagent.table.txt file the FALSE in = isUsed flag the with gRNAs and pXPR003_120K_20140624) (pDNA_ sample control the in reads 30 < with sequences gRNA reads. lion cell lines were and extracted each replicate was normalized to a total of 10 mil 5% CO 5% Alamar Blue was added to 100 Alamar Blue (ThermoFisher #DAL1025) 7–11 days post plating. well Briefly, 96 10 in with measured was gRNA, viability and days 3–4 per every changed was Medium plates. wells six well, per cells 1,000 at re-seeded were Cells counted. and dissociated extensively, PBS with washed were wells selection, were cells treated puromycin. with infection after of h puromycin 48–72 After h 24 above. described as lentivirus indicated with transduced were lines cell isolated from a synthetic human Fab phage-displayed library (Library F) (Library library phage-displayed Fab human synthetic a from isolated Isolation and characterization of Fabs against FZD. at (2015) analysis. RNAseq all samples normalized to ( threshold comparative the cycle using done was Analysis Mix on the 7900HT Fast Real-Time PCR system. Primer pairs are listed below. Master Green SYBR Power using performed was PCR Real-time #4368813). (ThermoFisher Kit Transcription Reverse cDNA High-Capacity with cDNA make to used was RNA treated DNase #AM2222). (ThermoFisher treated I with Nanodrop1000 (Thermo Scientific) and 2 extracted using the manufacturer’s protocol. RNA concentration was quantified PCR. real-time treatments, cells were lysed quantitative in Tri-reagent and (BioShop Canada #TSS120) and transcription RNA Reverse after plating, using the same procedureabove. described days six Blue, Alamar with measured was Viability days. three after renewed plicates, at indicatedthe concentrations. Medium was changed and antibodies 96-well plates. 24 h after cells wereseeding, treated with antibodies in quadru with XS Gemini Spectramax plate reader (Molecular Devices). n = 65,721), a log a 65,721), = h in well per cells 1,000–2,000 at seeded were cells treatments, antibody For t t p MUC5AC MUC5AC NKD1 NKD1 AXIN2 AXIN2 PPIB PPIB 3 : / 3 2 / . Gene expression RPKMs were taken from supplementary data available . Fluorescence was measured at 560 nm excitation, 590 nm emission emission nm 590 excitation, nm 560 at measured was Fluorescence . r e Reverse: GCCCGTAGTGCTTCAGTTTReverse: Forward: GGAGATGGCACAGGAGGAA s Reverse: GGTGACCTTGCCGTTGTTGTCAAA Reverse: Forward: TGAGAAGATGGAGAGAGTGAGCGA e Reverse: TGGCTGGTGCAAAGACATAGReverse: Forward: CTCCCCACCTTGAATGAAGA a r c Reverse: AAGTGGTCATAGGCTTCGTGCReverse: Forward: AGCCGGGAACCTACTACTCG h - p Gene level expression levels were derived from Klijn Klijn from derived were levels expression level Gene 2 u fold change was calculated relative to the control sample control the to relative calculated was change fold b For FZD5/7 gRNA experiments, Cas9 expressing stable stable expressing Cas9 experiments, gRNA FZD5/7 For . g e n e PPIB . c o m µ (cyclophilin B) expression. / l l medium per well and incubated 1–4 h at 37°, K l i j n E t A l 2 HPAF-II Cas9 cells were transduced 0 1 µ 4 g of RNA per sample was DNase / . The anti-FZD Fabs were LacZ doi: gRNA population). CT After indicated indicated After 10.1038/nm.4219 ) method ) 2 1 were used to to used were 3 2 2 0 with with et al. et was was µ 2 l of 2 O. 4 - - - .

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. the group treated with human with treated group the with comparedwere test) (Ab antibody with treated groups (TGI), inhibition ( injection intraperitoneal via weekly twice mg/kg), (1 IgG-2919 or mg/kg) (2 lowing treatments: Human fol the of one received group Each started. treatment the after excluded were tumor sizes of each group were very close before the treatment started. No mice mean the that so excluded weretumors small or largeanomalously with mice 10 mice/group) and mean the tumor volumes of groupeach were similar. Two mm approximately200 Width × (Length ½ formula: the using calculated weekly.Tumor twice was volumeweighed were mice the and calipers vernier 10 cells were inoculated subcutaneously ( and D-PBS were used as the controlsexperimental in this study. from Thermo Fisher Scientific Inc. obtained (Burlington, was magnesium) no ON, calcium, Canada). no (DPBS, Humansaline phosphate-buffered Dulbecco’sand PA,USA), (WestGrove, Inc. Laboratories, ImmunoResearch Human above. described as purified of Toronto. approved by the University Animal Care Committee (UACC) at the University of the Canadian Council on Animal Care (CCAC) and the animal use protocols the University of Toronto. The study was conducted according to the guidelines The mice were housed in a pathogen-free environment at the animal facility at Canada). QC, Constant, (St. Laboratories River Charles from purchased were Mouse xenograft studies. data were analyzed with FlowJo Software (FlowJo, LLC). flow cytometry was completed on BD FACSCanto II (BD Biosciences). Acquired 1% FBS in PBS solution and were subsequently subjected to Flow Cytometry. All with 50 fixed cells per samples were washed in PBS + 1% FBS solution and were stained cycle analysis, cells were dissociated with trypsin and fixed with ethanol. 1 cell- manufacturer’sFor× per 10 instructions. as used were reagents All 65-0864). by staining with Fixable Viability Dye eFluor 660 (eBioscience, catalog number Life technologies, lot #1458649) were used as controls. Dead cells were excluded antibody, Santa Cruz, lot # D0306) and Alexa Fluor 488 IgG body (Jackson(secondary ImmunoResearch # 109-546-097). antibody,c-Myc (9E10) IgG1 (primary profiler Fab. Alexa Fluor 488 AffiniPure F(ab cytometry. Flow University of Toronto). QEHS and acquired images were using Columbusprocessed software (CCBR, Opera PerkinElmer on imaged were Cells Probes). (Molecular solution drate in 4% PFA and nuclei were stained with Hochest 33342, trihydrochloride trihy ImmunoResearch, catalog #109-546-097). Subsequently, cells were washed, fixed Alexa Fluor488 AffiniPure F(ab Fabs diluted in PBS containing Ca nM 200 with performed was Staining overnight. cultured and (PerkinElmer) Immunofluorescence. affinity columns (GE Healthcare, Mississauga, ON, Canada). San Diego, CA, USA). Fab and IgG proteins were affinity-purified on Protein A (Invivogen, cells 293F IgGsfromand cells bacterial from Fabsexpressed were and respectively, chain, heavy IgG1 or chain light or Fabs of production for designed into vectors cloned were binders positive the domainsof light-chain were subjected to DNA sequencing. The DNAs encoding for variable heavy- and were performed to detect bindingspecific clones. Clones with positive binding produced from individual clones grown in a 96-well format and phage ELISAs werephage selection, roundsoffour captureAfter target. the as Canada) ON, Nepean, Scientific, (Fisher Immunoplates Maxisorp 96-well on immobilized cycled through rounds of panning with purified FZD-Fc fusion (R&D Systems) as described Binding selections, phage ELISAs and Fab protein purification were performed doi: i.p. 6 To test the efficacy of the antibodies in subcutaneous tumor model, HPAF-II The recombinant antibodies, IgG-2919 and OMP-18R5, were developed and cells in DPBS injected per mouse. Tumor volumes were measured using using measured were Tumor volumes mouse. per injected DPBS in cells 10.1038/nm.4219 ) for four and a half weeks. For calculation of percentage of tumorgrowthof percentage of For calculation weeks. half a forandfour ) µ g/ml propidium iodide/50 34– 3 6 . Briefly, phage particles displaying the Fabs from Library F were Primary staining of cells was performed with a 200 nM FZD FZD nM 200 a with performed staining of was cells Primary Cells were seeded in Cell carrierTM-96 well plates plates well carrierTM-96 Cell in seeded were Cells 3 , mice were randomly divided into four groups (9 or (9 groups four into divided randomly were mice , CB-17 Fox Chase SCID mice (six weeks old, female) γ -globulin (10 mg/kg), DPBS (15 mL/kg), IgG-2919 ′ ) γ 2 -globulin (control). TGI (%) was calculated calculated was (%) TGI (control). -globulin 2+/ was used as the secondary antibody (Jackson µ Mg g/ml RNase A (ThermoFisher #EN0531) / γ s.c. -globulin was purchased from Jackson from purchased was -globulin 2+ ) ) into the right offlank mice with 3 × in the presence of 5% donkey serum. ′ ) 2 was used as the secondary anti 2 ). When tumors reached reached tumors When ). γ -globulin 6 - - -

tumors were similar, as were mean photon the cohorts with of three fluxes the HPAF-II with cohorts three the of fluxes photon mean The inoculation. cell tumors were randomly divided into 3 groups (9 mice/group) 6 days after tumor (8 mice/group) groups 7 days after three tumor into cell inoculation and divided 27 mice bearing randomly AsPC-1 were tumors HPAF-II bearing mice 24 USA). MA, Billerica, (Bruker, Software Imaging Molecular using tumor each of flux photon total of quantification by analyzed were images tumor the and inoculation, cell tumor after days (HPAF-IImodel) seven orsix model) from (AsPC1 week every once USA) MA, Billerica, Bruker, II, Xtreme (In-Vivo system imaging bioluminescence 2D a by imaged were animals living the in Tumorssurgery. the after days 3 for h 12 every once and surgery the before were of mg/kg Buprenorphine 0.1 with of andMice mg/kg Ketoprofendosed 5 suture. absorbable 4-0 with closed was incision the and tail, atic pancre the into injected carefully was solution BME the in suspension cell cavity. 50 creas along and with the spleen gentlywas exposed outpulled from peritoneal pan The flank. abdominal upper left the in made was incision cm 1.0 a and Trevigen, (BME, Gaithersburg, Extract MD) in Membrane DPBS. Mice Basement were anesthetized mg/mL by 8.3 inhalation of of isoflurane, solution cold ice- an in suspended were luciferase firefly expressing stably cells AsPC-1 or the of day first dosing. the volume tumor mean – day study defined a at volume tumor mean = growth) volume (tumor TVG mean the where 100, × control} TVG using the formula: TGI (%) = {(mean TVG control – mean TVG Ab test)/mean and expanded in order to generate a clonal line. clonal organoids by wereusing TrypLEtrypsinized (Thermo Fisher Scientific) Membrane matrix (BME, Amsbio) in 96 well-plate and left to grow. Established any Around antibodies. intowerecells 50 sorted embedded 10 were established organoids and dissociated into pieces single cells by different trypsinization, and sorted in by FACS subdivided without using was tumor described previously as way same the in cultured and previously described as ( P19TB reported previously as identified, are Colorectal cancer organoid studies. were as exported .png using files ZEN software. images of the whole tumor sections at 40× in brightfield mode, and the images to system generatewas slide scanner used An Axioscan resolution high digital ab150662). – (Abcam 2.5 pH Blue Blue Alcian and Alcian ab150661), – ab150680), (Abcam 1.0 – pH (Abcam PAS or Schiff Acid Periodic Eosin, and Hematoxylin with staining routine for slide microscope a onto mounted and sections thin into cut were tumors embedded paraffin and block wax a into lin at 10 mg/kg, IgG-2919 at 1 mg/kg and IgG-2919 at 2 mg/kg) were embedded Briefly,Network. three Health representativeUniversity the tumors at from lab each treatment processing grouptissue (human and histopathology staining. Histological group the day of the first dosing. Investigators were not blinded for studies. mean photon flux of the group at a defined study day – mean photon flux of the test)/mean LucI control} × where 100, mean the LucI (photon Increase) flux = was calculated using the formula: TGI (%) = {(mean LucI control (Ab test) –were compared with meanthe group treated with DPBS (control). TGILucI (%) Ab of percentage of tumor growth inhibition groups(TGI), treated antibodywith to failure to recover from anesthesia and the imaging procedure. For calculation tumors (one from each treatment group) died after the last imaging (day 34) due group was foundon deceased day 32 of this study. Three mice bearing AsPC-1 and before the treatment started. A single mouse in the HPAF-II vehicle control imaging time first group the of after each fluxes were mean similar that the so for four weeks. Six mice from HPAF-II and four mice (10 mL/kg), OMP-18R5 from (5 mg/kg) or IgG-2919AsPC-1 (2 mg/kg) via were excluded DPBS treatments: following the of one received tumors AsPC-1 bearing mice via mg/kg), (2 the following treatments: DPBS (10 mL/kg), OMP-18R5 (2 mg/kg) or IgG-2919 AsPC-1 tumors. Each group of the mice bearing HPAF-II tumors received one of To test the efficacy of the antibodies in orthotopic tumor models, HPAF-II models, tumororthotopic in antibodies the of Toefficacy the test RNF43 µ L of HPAF-II (1.5 × 10 i.p. mutant). The organoid lines were expanded and processed processed and expanded were lines organoid The mutant). twice weekly for three and a half weeks; each group of the the of group each weeks; half a and three for weekly twice uo sann ws are ot t h immuno- the at out carried was staining Tumor 2 8 . P1947 is a clonal organoid line that was generated was that line organoid clonal a is P1947 . 6 cells/mouse) or AsPC1 (1 × 10 Organoid lines derived from CRC patients 2 8 , as P14T and P18T ( P18T and P14T as , 2 8 . Briefly, the resected resected the Briefly, . nature medicine nature APC i.p. µ 6 , , twice weekly l l of Basement mutant)and cells/mouse) s.c. γ -globu 5 min min 5 - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. assays and RT-qPCR in in RT-qPCR and assays Prism 6 (GraphPad Software, La Jolla, California, USA). analysis. For Statistical gRNA based viability werethese divided by the resulting average of the DMSO condition. line the average value for Staurosporin was subtracted from all of the values, and (Staurosporin) and the Negative control (DMSO). Essentially, for each organoid control). For analysis, Staurosporin thein data DMSO was for sorted and(0.1% normalized concentration to highest the positivethe controlto normalize to wells all to added organoidwas DMSO line. per replicates wererun biological measurement. 5 min, incubated for an additional 25 min and centrifuged before luminescence as and 100% survival Staurosporin values as 0% survival). DMSO and Staurosporin (2 used we controls, internal As 0. day at added were antibodies and drug Fresh dilution forseries each antibody and one concentrationfixed of IWP2 (1 8-point an to exposed Dispenser.were OrganoidsTecan a Digital using D300 containWnt.distributed notwere antibodies inhibitor)and PORCN (a IWP2 40 plates (coated with BME). ~500 organoids were resuspended 40 a in a through total volumefiltered were of organoids nature medicine nature In each experiment, all conditions were run in triplicate and at least three three least at and triplicate in run were conditions all experiment, each In 40 days, 4 After (Promega), Titer-Glo 3D Cell using test viability cell a perform to order In µ l l of medium (with 5% BME) per well. Importantly, the culture medium did µ All statistical analyses were completed with Graphpad Graphpad with completed were analyses statistical All l of Cell Titer-Glo 3D was added, plates were shaken for shaken were plates added, was 3D Titer-Glo Cell of l Figure Figure µ m) m) in order to normalize the data (DMSO values 2 , each experiment was normalized to to normalized was experiment each , µ m filter and were seeded in 384 well well 384 in seeded were and filter m LacZ µ m). m).

36. 35. 34. 33. 32. chosen to have adequate confidence in the mean. Welch’s so variance, different appliedto was correction 2 mg/kg IgG-2919Invariances. treatment some cases, group significantly had distributed and Mann-Whitney normally not was data cases, some D’AgastinoIn test. normality Pearson and with distribution standard of be to confirmed were weights and sizes tumor studies, xenograft mouse For size. sample pre-determine to used was method statistical No variance. equal of and distributed normally be to assumed was tailed unpaired pleted by one-sample control values. Statistical analysis of multiple independent experiments was com

Rajan, S. & Sidhu, S.S. Simplified synthetic antibody libraries. antibody synthetic Simplified S.S. Sidhu, & S. Rajan, highly from antibodies synthetic of generation F.A.High-throughput Fellouse, al. et to roadmap A S. Graslund, & Group Working Binder Protein Renewable K. Colwill, lines. cell cancer human of portrait transcriptional comprehensive A al. et C. Klijn, M.F. Kramer, & J.M. Pesola, D.J., Mangelsdorf, C.L., Cummins, A.L., Bookout, 502 libraries. phage-displayed minimalist functional proteome. human the (2011). 551–558 to binders protein renewable generate Biotechnol. Nat. Biol. Mol. (2007). PCR. transcription reverse quantitative real-time High-throughput , 3–23 (2012). 3–23 ,

73 t , 15.18.1–15.8.28 (2006). 15.18.1–15.8.28 , -tests in cell lines, data from multiple independent experiments

33 , 306–312 (2015). 306–312 , t -test, -test, compared to value ofa hypothetical one. For two- U test was used. F -test was used to verify equal . o. Biol. Mol. J. t -test. Sample size was was Samplesize -test. doi: 10.1038/nm.4219 Methods Enzymol. Methods

a. Methods Nat. 373 ur Protoc. Curr. 924–940 ,

8 - ,