An Investigation of Fusarium Basal Rot of Onion and Candidate Biocontrol Agents in the Annapolis Valley, Nova Scotia

by

Adèle L. Bunbury-Blanchette

Thesis submitted in partial fulfillment of the requirements for the Degree of Master of Science (Biology)

Acadia University Spring Convocation 2018

© by Adèle L. Bunbury-Blanchette, 2018 This thesis by Adèle L. Bunbury-Blanchette was defended successfully in an oral examination on 2018-04-16.

The examining committee for the thesis was:

______Dr. P. Pufahl, Chair

______Dr. G. Kernaghan, External Examiner

______Dr. M. R. Coombs, Internal Examiner

______Dr. A.K. Walker, Supervisor

______Dr. B. C. Wilson, Department Head

This thesis is accepted in its present form by the Division of Research and Graduate Studies as satisfying the thesis requirements for the degree Master of Science (Biology).

...... ……………………………………………..

ii

I, Adèle L. Bunbury-Blanchette, grant permission to the University Librarian at Acadia University to archive, preserve, reproduce, loan or distribute copies of my thesis in microform, paper, or electronic formats on a non-profit basis. I undertake to submit my thesis, through my University, to Library and Archives Canada to allow them to archive, preserve, reproduce, convert into any format, and to make available in print or online to the public for non-profit purposes. I, however, retain the copyright in my thesis.

______Author

______Supervisor

______Date

iii

Table of Contents

Title Page i Approval of Thesis ii Permission to Head Librarian iii Table of Contents iv List of Tables vi List of Figures viii Abstract xi List of Abbreviations xii Acknowledgements xiii

CHAPTER 1: INTRODUCTION TO FUSARIUM BASAL ROT OF BULB ONION IN THE ANNAPOLIS VALLEY, NS, AND TO BIOLOGICAL CONTROL METHODS The pathogen: Fusarium oxysporum f. sp. cepae (FOC)……………….. 1 Fusarium basal rot in the Annapolis Valley, Nova Scotia……………… 3 Genetics of FOC; theories of pathogenicity and virulence……………... 6 Biological control agents, including Trichoderma species……………... 9 ITS barcoding…………………………………………………………… 13 Biological assessments………………………………………………….. 14

CHAPTER 2: FIELD SITES……………………………………...…………….....… 16

CHAPTER 3: CHARACTERIZATION OF FUSARIUM OXYSPORUM F. SP. CEPAE PRESENT IN THE ANNAPOLIS VALLEY Objectives……………………………………………………………………….. 21 Methods Isolation and identification of FOC isolates from symptomatic onions… 21 Morphological characterization………………………………………... 23 Virulence bioassays…………………………………………………….. 26 Pathogenicity test…………………………………………………….…. 30 Results Identification of FOC isolates from symptomatic onions………………. 31 Morphological characterization………………………………………... 32 Virulence bioassays…………………………………………………….. 39 Pathogenicity test…………………………………………………….…. 43 Discussion…………………………………………………………….………… 44

CHAPTER 4: TESTING BIOLOGICAL CONTROL POTENTIAL OF TRICHODERMA SPECIES ISOLATED FROM LOCAL ONION FIELD SOIL AGAINST NOVA SCOTIAN FUSARIUM OXYSPORUM F. SP. CEPAE Objectives……………………………………………………………………….. 51 Methods Isolation of fungi from onion field soil………………………………….. 51 DNA barcoding and identification of Trichoderma species…………….. 53 Dual culture experiments……………………………………………….. 55

iv

Greenhouse bioassays to test biocontrol activity of locally isolated Trichoderma species…………………………………………….………. 59 Results Isolation of fungi and DNA barcoding………………………….………. 61 Dual culture experiments……………………………………….………. 64 Greenhouse bioassays to test biocontrol activity of locally isolated Trichoderma species……………………………………………………. 84 Discussion………………………………………………………………………. 87

CHAPTER 5: TESTING EFFICACY OF COMMERCIAL BIOCONTROL PRODUCTS AGAINST FUSARIUM OXYSPORUM F. SP. CEPAE Objectives……………………………………………………………………….. 97 Methods 2016 field trial design…………………………………………………... 97 2017 field trial design…………………………………………………... 102 Evaluation of onions postharvest, in storage………………………….... 105 Greenhouse bioassays to test commercial biocontrol products against Fusarium basal rot………………………………….…………………... 106 Results 2016 field trial……….…………………………………………………... 108 2017 field trial and evaluation of onions postharvest…………………... 110 Greenhouse bioassays to test commercial biocontrol products against Fusarium basal rot………………………………………………..…….. 113

Discussion………………………………………………………………….…… 116

CHAPTER 6: CONCLUSIONS………………………………………...……….…… 121

References………………………………………………………………….…… 125

Appendix A………………………………………………………….………….. 142

v

List of Tables (captions abbreviated)

1.1 Examples of pathogenic formae speciales of Fusarium oxysporum and their respective agricultural host plants……………….…...... 1

2.1 Characteristics of field sites…………………………………………….. 19

2.2 Soil type and drainage by field site……………………………………... 19

2.3 Mean soil temperature of all sample points from all sites by month, and mean air temperature for Kentville NS on each sampling day..… 19

3.1 Conditions of FOC growth trials to characterize morphology using four medium types……………..…………………………………..…… 25

3.2 Experimental concentrations of FOC spores used in greenhouse trials… 27

3.3 Disease symptom key for onion seedlings rated in greenhouse bioassays…………..……………………………………...……... 29

3.4 Estimates of effect sizes, standard errors, and P values of each FOC inoculant concentration used in virulence assays, as compared to the control (0 s/g FOC)………………………………..……... 41

41. Fungal isolates from field soil, by site. Fusarium and closely related species are marked by (*); Trichoderma species by (**)…….…. 62

4.2 Morphological observations of dual culture plates, given in percentage of plates in which each observation was present, on the first day it was noted, and after one and two weeks of dual culture growth…...………………………………………………………. 66

4.3 Percent growth inhibition of FOC by seven Trichoderma species in two inoculation conditions: Trichoderma added simultaneously with FOC, or after 48 h growth of FOC (delayed…….………...……. 84

5.1 Field experiment treatment conditions, 2016…………………………… 99

5.2 Disease symptom key for ‘Mountaineer’ onion bulbs rated at harvest in 2016 field experiment……………………..………..…………… 101

5.3 Field experiment treatment conditions, 2017…………………………… 103

5.4 Disease symptom key for onion bulbs rated at harvest in 2017 field experiment………………………………………………………. 105

vi

5.5 Treatment conditions for greenhouse antagonism bioassays…………… 107

5.6 Estimates of effect sizes, standard errors, and P values for three commercial biocontrol treatments in comparison to the 1000 s/g FOC condition (no commercial treatment applied)……………... 115

vii

List of Figures (captions abbreviated)

1.1 One half of a tandem of a SSU rRNA gene repeat……………………… 13

2.1 Field site region in the Annapolis Valley, Nova Scotia (red box); locations of field sites, with scale bar (insert)………………...… 17

2.2 Four of five agricultural fields from which soil samples were taken in 2016, photographed 2016/07/04….……………………………... 18

2.3 Two agricultural fields cropped for onion during the 2017 growing season, used as sites to test commercial biocontrol products against FBR……………………………………………………... 18

3.1 Greenhouse bioassay setup in Phytotron E, in KCIC, Acadia University 28

3.2 Pots of onion seedlings grown in the greenhouse………………………. 29

3.3 FOC grown at room temperature (21°C) in the dark for seven days…… 33

3.4 FOC grown at room temperature (21°C), experiencing a natural daylight cycle for seven days…………………………………… 34

3.5 FOC grown in the greenhouse at 27°C with a 16 h photoperiod for seven days…………………………………………………….… 35

3.6 FOC grown in a growth chamber at 27°C with a 12 h photoperiod for seven days……………………………………………………..... 36

3.7 Mean number of spores per mm2 of hyphal growth of FOC cultures after seven days growth on four medium types each grown in five different conditions………………………………………… 37

3.8 Hyphae, spore bearing structures, and spores of FOC, visualized from slides produced from seven day cultures on either a PDA or DG18 medium at 100X magnification………….………………. 38

3.9 Mean diameter (mm) at three, five, and seven days of FOC grown in 8.5 cm Petri dishes on four different media, each in five different conditions……………………….…………………….. 39

3.10 Mean health of pots sown with 25 onion seedlings for eight FOC inoculation concentrations……………………………………… 41

3.11 Mean percent of symptomatic seedlings 28 days after planting per concentration of FOC inoculant added to the soil in spores per

viii

gram of soil………...……………………………………………. 42

3.12 Mean health of pots sown with 25 onion seedlings and using the 1000 s/g FOC inoculant concentration, for each of the three bioassays which tested this concentration…….…………………………… 43

3.13 Petri dishes to which onion basal plate tissue was added, which was taken from plants showing basal rot symptoms grown in pots which received a 1000 s/g FOC treatment in the greenhouse…... 44

4.1 Location of primers used in relation to fungal rDNA ITS gene region… 54

4.2 Axenic culture of 14-day Fusarium oxysporum f. sp. cepae (FOC)……. 56

4.3 Axenic 14-day cultures of each: a. Trichoderma atroviride, b. T. brevicompactum, c. T. gamsii, d. T. hamatum, e. T. harzianum, f. T. viride, and g. T. virdidescens……….…………………….... 57

4.4 Dual culture plate with simultaneous inoculation, at time of inoculation 57

4.5 Dual culture plate (PDA) with delayed inoculation of Trichoderma, at time of Trichoderma inoculation, 48 hours post inoculation of FOC……………………………………………………………... 58

4.6 Measurement of radial growth (R) of F. oxysporum isolate (F) when grown in control plates and dual culture plates with a Trichoderma species (T)………………………………..………. 59

4.7 Dual culture plates at fourteen days growth of FOC and Trichoderma species from simultaneous inoculation……….………………… 77/78

4.8 Dual culture plates at sixteen days growth of FOC and fourteen days growth of Trichodermas from delayed inoculation, on PDA…… 79/80

4.9 Mean radial growth per hour of FOC along the central plane of a Petri dish when grown alone (Trichoderma Present: None) and mean radial growth per hour of FOC cultures grown in dual culture plates which experienced a simultaneous inoculation of one of seven Trichoderma species……………………………..………. 82

4.10 Mean radial growth per hour of FOC along the central plane of a Petri dish when grown alone (Trichoderma Present: None) and mean radial growth per hour of FOC cultures grown in dual culture plates which experienced an inoculation two days after establishment of FOC of one of seven Trichoderma species….... 83

ix

4.11 Mean health of pots sown with 25 onions seedlings for control treatment (0 s/g FOC; 0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment (0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment with 100 000 s/g T. harzianum added…… 85

4.12 Mean health of pots sown with 25 onions seedlings for control treatment (0 s/g FOC; 0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment (0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment with 1000 s/g T. atroviride added, vs. 1000 s/g FOC inoculation treatment with 10 000 s/g T. brevicompactum added, vs. 1000 s/g FOC inoculation treatment with 10 000 s/g T. viridescens added…………………...………. 86

5.1 a. Sowing of treated onion seeds at site F1 (April 2016), b. Site F1 at harvest (September 2016)………………………………………. 99

5.2 Onion at harvest from site F1, with symptoms of Fusarium basal rot (2016)…………………………………………………………… 101

5.3 Number (a) and diameter (b) of onions for each of the seven treatment conditions and the control condition used in the 2016 field experiment………………………………………………………. 109

5.4 Mean symptoms level of onions for each of the seven treatment conditions and the control condition used in the 2016 field experiment……………………………………………………..... 110

5.5 Number of onions per plot by treatment, shown separately for each 2017 field site………………...…………………………………. 111

5.6 Mean number of FBR symptomatic onions per treatment, shown separately for each 2017 field site ……………………………… 112

5.7 Mean symptoms severity of FBR symptomatic onions per treatment, shown separately for each 2017 field site…...………………….. 113

5.8 Mean health of pots sown with 25 onions seedlings for control treatment (0 s/g FOC; no commercial biocontrol product), vs. 1000 s/g FOC inoculation treatment (no commercial biocontrol product), vs. 1000 s/g FOC inoculation and the addition of one of three commercial biocontrol product: Prestop, RootShield, and Trianum……………………………………………...……… 115

x

Abstract

The fungal pathogen Fusarium oxysporum f. sp. cepae (FOC) has recently caused increased basal rot symptoms of locally grown bulb onions, leading to declined crop yield and quality. Current control strategies have not reduced symptoms. This research characterizes a local strain of FOC and identifies and tests local fungi for potential as biocontrol agents. Fungi from soil collected from onion fields in the Annapolis Valley were isolated and identified using DNA barcoding; seven belonged to the genus Trichoderma. Dual culture trials revealed signs of antagonism between FOC and all identified Trichoderma species. Virulence of FOC on onion was determined using greenhouse bioassays; 1000 spores/g soil resulted in ~50% onion seedling mortality. T. harzianum and T. atroviride were ascertained to decrease the presence and severity of FOC symptoms in greenhouse grown onions. Field and greenhouse testing of commercial products containing biocontrol agents including T. harzianum were inconclusive.

xi

List of abbreviations and symbols (alphabetical order)

Bioassay: biological assay m: minute

Biocontrol: biological control mL: millilitre bp: base pair mm: millimetre

°C: degrees Celsius MEA: malt extract agar cm: centimetre NS: Nova Scotia

DG18: dichloran 18% glycerol agar PDA: potato dextrose agar

EF-1α: elongation factor 1-alpha PIRG: percent inhibition of radial growth ETS: external transcribed spacer pmol: picomole endo-PTE: endo-pectin-trans-eliminase µL: microlitre exo-PG: exo-polygalacturonase µm: micrometre F: field µM: micromole FBR: Fusarium basal rot R: radius FOC: Fusarium oxysporum f. sp. cepae RO: reverse osmosis ftf: Fusarium transcription factor rRNA: ribosomal RNA g: gram s: second h: hour s/g: spores per gram IGS/NTS: non-transcribed intergenic spacer SIX: secreted in xylem

ITS: internal transcribed spacer SNA: synthetic low nutrient agar

KCIC: Kenneth Cole Irving SSU: small sub-unit Environmental Science Centre temp.: temperature L: litre VCG: vegetative compatibility group

xii

Acknowledgements

Thanks to Dr. Allison Walker for bringing me over to the fungal dark side, being enthusiastic in taking me on as her first MSc student, and for valuable insight, good humour, and facilitation of this project as my supervisor. Additional thanks to all concurrent Walker Lab members for always helping when needed, and for being great people. Special appreciation to Sarah J. Adams for sharing of knowledge, and many hours of assistance both in the lab and in the field. Also deserving of specific mention are Roshni Kollipara and Madeleine Killacky (isolation and identification of fungal cultures), and Dominique Taylor (care and observation of greenhouse plants).

Thanks to Dr.’s Trevor Avery and David Kristie for thoughtful counsel and revisions on proposal and final thesis drafts, and to Dr.’s Anna Redden and Phil Taylor for providing direction, advice, and positive feedback. I am also appreciative of my examining committee (Dr. Gavin Kernaghan and Dr. Melanie Coombs) for feedback on my final draft.

Thanks to family and friends who advised, supported, and encouraged me through this degree. My husband Wyatt Keenan, who was there for every moment and has bottomless belief in me. Veronika L. Wright, who went through this process before me understood the ups and the downs. And my parents Theresa Bunbury and Pierre Blanchette, who got me here, and inspire me to always give my best. A final mention to the late Dr. David L. Bunbury, who is a reminder of the joy that is found in a love of learning.

Thanks for financial support to Acadia University, NSERC, Growing Forward 2 funding, and the onion growers of Nova Scotia: Scott Newcomb, Peter Sawler, William Spurr, and Peter Swetnam. Further thanks to the onion growers for their interest in this project and the knowledge they shared, and to Peter Sawler for providing field sites and storage space. Thanks as well to Rosalie Madden (Perennia), for helping to facilitate this collaboration.

Finally, thanks to the K. C. Irving Centre for the use of a phytotron and potting space, to biology technicians Alanna Maynard and Heather Elliott, and to volunteer waterers: all assistance has been greatly appreciated, and to Acadia University for being the right place for me and providing me with so many opportunities.

xiii

CHAPTER 1: INTRODUCTION TO FUSARIUM BASAL ROT OF BULB ONION IN THE

ANNAPOLIS VALLEY, NOVA SCOTIA, AND TO BIOLOGICAL CONTROL METHODS

The pathogen: Fusarium oxysporum f. sp. cepae (FOC)

Fusarium oxysporum (family Nectriaceae, phylum Ascomycota) is an abundant and widespread soilborne anamorphic fungus. It is one of many Fusarium species that exhibit a broadly similar life history; while saprobic and nearly ubiquitous in native environments, some F. oxysporum strains are important plant pathogens of agricultural crops (Gordon and Martyn, 1997). Pathogenic strains affect many economically important crop plants (Table 1.1), possibly in part through the maintenance of aggressive colonization of plant roots and flexible ecology, combined with the evolution of parasitic traits (Gordon and Martyn, 1997). As a pathogen, F. oxysporum is classified by host specificity, denoted by forma specialis, of which over 120 have been identified. This classification refers only to the host species of a pathogenic F. oxysporum strain; knowledge of genetic diversity among strains is limited.

TABLE 1.1. Examples of pathogenic formae speciales of Fusarium oxysporum and their respective agricultural host plants. Forma Specialis Host Plant F. oxysporum f. sp. albedinis Pheonix dactylifera (date palm) F. oxysporum f. sp. asparagi Asparagus officinalis (asparagus) F. oxysporum f. sp. batatas Ipomoea batatas (sweet potato) F. oxysporum f. sp. cannabis Canabis sativa (hemp) F. oxysporum f. sp. ciceris Cicer arietinum (chickpea) F. oxysporum f. sp. cubense Musa spp. (banana) F. oxysporum f. sp. lycopersici Solanum lycopersicum (tomato) F. oxysporum f. sp. pisi Pisum sativum (pea)

1

Determination of vegetative compatibility groups (VCGs) has been employed for the past several decades to classify F. oxysporum strains (Puhalla, 1985; Yoo et al.,

1993). This technique involves observing if successful vegetative heterokaryon formation occurs between different fungal individuals, indicating that alleles are identical at loci governing this process, and it is assumed that F. oxysporum individuals belonging to the same VCG are clones (Leslie, 1993). While determination of VCGs for strains of FOC is useful for many applications, it does not provide a complete picture; only heterokaryon- formation genes are considered, degree of relatedness between non-VCGs cannot be inferred, exceptions of non-clonal strains within a VCG have been identified, and heterokaryon self-incompatible strains may exist, complicating interpretation (Leslie,

1993). For the purposes of my research, VCGs were not determined, and the forma specialis terminology is used, although research does support a correlation between VCG and forma specialis (Puhalla, 1985).

Fusarium oxysporum f. sp. cepae (Hanzawa) WC Snyder and HN Hanson 1940, causes Fusarium basal rot (FBR) of onions: rotting that begins in the basal plate of onion bulbs, spreads to outer bulbs scales, and eventually reaches the inner, upper levels of the bulb where leaves emerge (Holz and Knox-Davies, 1985). Bulb onions (Allium cepa) and other Allium species are susceptible to this variant of F. oxysporum.

Like other crop diseases caused by Fusarium pathogens, FBR of onions is widespread throughout the world: infection can occur wherever onions are grown.

Currently, onions are cultivated in over 140 countries, using an estimated area of at least five million hectares worldwide to produce over 88 million tonnes of dry onions yearly

(FAOSTAT). Onions are a versatile and nutritionally valuable food source, and are

2

widely used by many cuisines; worldwide, most onions are consumed domestically rather than exported.

FOC causes rot in onion bulbs via the production of pectic enzymes, chiefly exo- polygalacturonase (exo-PG) and endo-pectin-trans-eliminase (endo-PTE) (Holz and

Knox-Davies, 1985). Exo-PG activity begins and is the most acute in the early stages of infection, while endo-PTE is secreted in later stages, once rot becomes visible to the naked eye (Holz and Knox-Davies, 1985). Both enzymes break down the pectin in onion cell walls. The fungus feeds as apoplast sugar is released as the bulb tissue decays.

Disease progression is similar in all onions, regardless of whether the onion cultivar shows some resistance to the disease, although spread may occur more slowly in resistant cultivars, and so secretion of endo-PTE and the associated decay may be delayed (Holz and Knox-Davies, 1985).

Fusarium basal rot in the Annapolis Valley, Nova Scotia

Recently, an increase in incidence and severity of FBR symptoms in the

Annapolis Valley, Nova Scotia (NS) has led to significant crop losses for onion growers.

Growers have been unable to harvest substantial portions of their onion crop due to FOC infection and have lost harvested product once in storage. Entire fields have been abandoned due to this pathogen. This has led to an estimated annual loss of up to $600

000 for onion growers and impacts the economics of the region (Sawler, personal comm.,

September 2015). Ongoing research has focused on the identification, genetic characterization, and control of FOC strains, but to the best of my knowledge, no

3

research investigation of Fusarium basal rot or control measures has been done in

Canada.

Despite the magnitude of effect that FBR has on growers in the Annapolis Valley, relatively little research has been conducted even in North America. Although still of use today, much of the research completed in the USA is more than twenty years old (e.g.

Abawi and Lorbeer, 1972; 1985; Kehr et al., 1962; Kawamoto and Lorbeer, 1976), while more recent research has focussed on topics not immediately relevant to control strategies implementable in Canada, such as the use of resistant short-day onion cultivars not suited to more northern latitudes (Saxena and Cramer, 2009). As more work from different research groups around the world becomes available, however, this knowledge can be considered in bearing to application in the Annapolis Valley.

FOC strain virulence is a variable factor and can differ even between farms in the same geographic area (Cramer, 2000; Taylor et al., 2013). Resistance of onion cultivars is also variable, and interacts with strain virulence (Taylor et al., 2013). Climate affects the timing of infection and subsequent disease progression, as do the presence of other onion pathogens and pests, and the soil microbiota (Abawi and Lorbeer, 1972, Cramer, 2000).

For example, infection in the Annapolis Valley is thought to begin later in the summer, as

FOC spores germinate most readily at soil temperatures between 25-32°C, although temperatures as low as 15°C may be suitable. Disease progression can continue in storage even if onions were not visibly infected at harvest, increasing crop loss (Jones and Mann,

1963). To develop an effective control strategy of FOC for implementation in Nova

Scotia, we require greater knowledge of the factors that affect FOC infection in this region.

4

Currently, onion growers in Nova Scotia use 4-year+ crop rotation using onion varieties marketed as resistant to FOC infection, alternate crops unaffected by FOC in the intervening years, and use fungicide-treated seeds and regular fungicide applications as

FOC control measures. Crop rotations allow FOC populations to naturally decrease due to a lack of host but are limited as a control measure. FOC can remain dormant in the soil for an indeterminate length of time as chlamydospores, and likely remains viable between crop rotations (Cramer, 2000). FOC may also harmlessly colonize and remain active in

Oxalis corniculata, or other common weeds in agricultural fields (Abawi and Lorbeer,

1972). Few, if any, chemical fungicides can be recommended as effective and economic strategies, as many field trials have failed to decrease FBR symptoms and the fungicides are otherwise environmentally damaging. Aggressive fungicide use can disrupt the soil microbiota, reducing the numbers of beneficial soil microorganisms (Martinez-Toledo et al., 1998). This can worsen the infection, or lead to other disease problems, as harmful microorganisms may survive fungicide treatment or recolonize the soil and plant rhizosphere more quickly than beneficial species.

Fungicides become ineffective in controlling fungal diseases in crop plants due to the evolution of resistance genes in the pathogen, and the selection for strains with increased resistance through the repeated application of specific fungicides. This has occurred in Fusarium species via mutation of the β-tubulin gene, possibly stabilizing microtubules to resist inhibition of microtubule assembly caused by benomyl, (F. moniliforme resistance to benomyl; Yan and Dickman, 1996), the CYP51 gene, potentially active in enhancing activity of efflux transporters and/or regulating membrane sterol composition (F. graminearum resistance to azoles and amines; Becher et al., 2010),

5

and the FgRRG-1 gene, which is involved in the osmotic stress response (F. graminearum resistance to dicarboximides and phenylpyrroles; Jiang et al., 2011). I did not find any research specific to genes implicated or mechanisms of resistance to fungicides in F. oxysporum, but the description of increased disease severity given by onion growers in Nova Scotia, despite continued use of fungicides, supports the conclusion that FOC in the Annapolis Valley possesses fungicide resistance genes.

A more effective control strategy would consistently and significantly decrease crop loss due to Fusarium basal rot while better maintaining a more natural soil ecosystem, while being economically viable for onion growers. Controlling FOC in the

Annapolis Valley will positively benefit onion growers and the local economy. This research will also further the knowledge of FOC that can be applied to other regions suffering from Fusarium-caused infections in onions as well as other crop plants.

Genetics of FOC; theories of pathogenicity and virulence

While the genetics of FOC are still being researched, recent work using the housekeeping gene EF-1α and/or intergenic spacer region (IGS) indicates that all F. oxysporum strains confirmed as highly pathogenic to onions are members of a single clade, which can be divided into two sub-clades (Sasaki et al., 2015; Taylor et al., 2016).

This is supported by whole genome sequencing and analyses (Armitage et al., unpublished) but contradicts earlier research which proposed that FOC strains belonged to two different clades within the larger classification of F. oxysporum (Bayraktar et al.,

2010; Galván et al., 2008, Taylor et al., 2013). Although it has until recently been unclear whether different FOC strains evolved pathogenicity toward onions separately, a clonal

6

origin theory is garnering increasing substantiation (Armitage et al., unpublished; Taylor et al., 2016).

Chromosomal polymorphisms are common between strains of the same Fusarium species, explaining why different FOC strains differ in virulence (Brown and Proctor,

2013). These differences present themselves as differing lengths of chromosomes or even differences in the number of chromosomes. Different chromosome lengths are likely due to changes in dispersed repetitive elements: transposable elements (sequences that can change location in the genome, creating or reversing mutations) are duplicated or removed (Brown and Proctor, 2013). Extra chromosomes are referred to as supernumerary chromosomes, and code for pathogenicity to alternate hosts (Brown and

Proctor, 2013). The more supernumerary chromosomes present in a strain, the more hosts it could potentially attack.

Some Fusarium studies implicate a transcription factor (Fusarium transcription factor – ftf1) in pathogenic aggressiveness, as more copies are present in more aggressive strains, and are expressed only during infection (e.g. Taylor et al., 2013). First identified in chromosome 14 (a supernumerary chromosome) of F. oxysporum f. sp. lycopersici

(FOL), genes responsible for secreting small proteins in the xylem (SIX genes) have been found to impart pathogenicity by causing wilt symptoms in the host (Brown and Proctor,

2013; Gawehns et al., 2015). SIX genes are also present in FOC and similarly play a role in pathogenicity (Sasaki et al., 2015; Taylor et al., 2016). In addition, FOL has several large chromosome segment duplications, primarily made up of highly transposable elements. This chromosomal feature is likely present in FOC as well and is thought to allow for easier adaptation to a specific host plant.

7

In addition to mutations within the genome of a strain of FOC, supernumerary chromosomes may also be transferred horizontally from a foreign fungal source (Brown and Proctor, 2013). These chromosomes have been found to contain unique genes that are not characteristic of the FOC core genome (Brown and Proctor, 2013). This means that the genes coding for the ability to be pathogenic to a specific host plant may be transferred in one event, immediately giving this ability to the receiving FOC strain. This can increase disease severity if the recipient strain has other adaptations that make it better suited to the environment, and additional genetic recombination can allow for the development of pathogenicity to entirely new hosts.

It should also be noted that the phylogenetics of the genus Fusarium is often the subject of some confusion. Fusaria are the anamorphs (asexual stages) of other species within the order Hypocreales (Guadet et al., 1989). Thus, some species historically researched using Fusarium nomenclature are also referred to according to their associated teleomorph (sexual stage), although sometimes these names are used interchangeably and/or inconsistently. Molecular research has shown that Fusarium oxysporum is an asexual Gibberella species, although it has consistently retained its name, unlike the more complex taxonomy of some other Fusarium species (e.g. Fusarium graminearum is so named according to The Index Fungorum [www.indexfungorum.org] but is often referred to as its teleomorph Gibberella zeae and is considered a biological species within the

Gibberella pulicaris species complex) (Guadet et al., 1989; Samuels et al., 2001). The most recent consensus among researchers and taxonomists has established that the

Fusarium name is prioritized over teleomorph nomenclature (O’Donnell et al., 2015).

8

Biological control agents, including Trichoderma species

Fungal biological control agents have been found to be ideal control strategies for fungal pathogens such as F. oxysporum (Klokočar-Šmit et al., 2008). Fungal biocontrol agents are generally self-propagating, confer resistance in multiple ways, have low toxicity, are otherwise beneficial to the plants, and can be used in accordance with organic farming practices. Ideal species are common and abundant in most soil types, so increasing their numbers does not cause detrimental changes to the soil microbiota or biochemistry. Their ability to self-propagate decreases the need for frequent application, lowering costs, and multiple modes of action can mean they are more effective than a fungicide.

Biocontrol agents that act against fungi like F. oxysporum can operate in two ways: direct or indirect antagonism (Fravel et al., 2003). These can occur simultaneously, sequentially, or independently. Direct antagonism occurs through competition for resources and/or colonization sites on the roots and interior tissues of the host plant.

Indirect antagonism occurs when the antagonist prompts a general growth or defense response in the host plant. This could be through the induction of physical barriers within the plant, or increased plant enzyme activity such as the production of pathogenesis- related proteins. Factors that need to be considered when selecting an antagonist include competitive ability, compatibility with the host plant, and ability to thrive in the soil type.

Trichoderma is a fungal genus containing species that are well documented biocontrol agents of many plant pathogens, including Fusarium species (Degenkolb et al.,

2015; Reino et al., 2008; Vinale et al., 2008). Species within this genus may employ either direct or indirect antagonism, or both. For example, inhibition of F. oxysporum

9

mycelial growth by a Trichoderma species may be achieved via the production of toxins

(e.g. fungal inhibiting antibiotics, enzymes such as chitinases), mycoparasitism (physical disruption of pathogen hyphal growth: coiling, penetration, dissolution of cytoplasm), induction of a host defence response, or success in monopolizing nutrients and space in the rhizosphere (Howell, 2003). Method of antagonism is variable depending on

Trichoderma species, pathogen species, host plant species, and environment. There are currently at least eight commercially available products containing Trichoderma strains that have been suggested as part of a control strategy for Fusarium crop pathogens

(Klokočar-Šmit et al., 2008).

T. harzianum is perhaps the most commonly encountered Trichoderma species regarding biocontrol of fungal plant pathogens, possibly due to a mycoparasitic mode of nutrition (Degenkolb et al., 2015). In onions, seeds treated with T. harzianum were found to have a reduced incidence of basal rot in both pot and field growing conditions

(Coşkuntuna and Özer, 2008). The reduction in basal rot was thought to be caused by an increased production of antifungal compounds by the onion plant itself, induced by the presence of T. harzianum. T. harzianum and, along with T. viride, also reduces the growth of FOC in dual culture trials (Malathi and Mohan, 2011). T. harzianum and T. viride have also been tested as biocontrol agents of F. oxysporum strains pathogenic to other crop plants and shown to be effective (Cherif and Benhamou, 1990; Dubey et al.,

2007; John et al., 2010; Perveen at al., 2012).

Other Trichoderma species such as T. asperellum, and T. hamatum have been used to control Fusarium species other than F. oxysporum (Klokočar-Šmit et al., 2008;

Hajieghrari et al., 2008). T. asperellum was found to be most effective against F. solani,

10

at least in lab conditions, and somewhat effective against F. proliferatum (Klokočar-Šmit et al., 2008). T. hamatum was effective against F. graminearum (Hajighrari et al., 2008).

These results suggest that additional trials using F. oxysporum would be worthwhile.

As noted above, Trichoderma (and related) species are employed in many commercially available biocontrol products, including Esquive® WP Biofungicide (T. atroviride; Agrauxine, Beaucouzé, France), Prestop Biological Fungicide Wettable

Powder (Gliocladium catenulatum; Verdera Oy/Lallemand Plant Care, Espoo, Finland),

RootShield WP Biological Fungicide (T. harzianum; BioWorks, Victor, NY), SoilGard

Microbial Fungicide (G. virens; Certis USA, Columbia MD), and Trianum-P Biological

Fungicide (T. harzianum; Koppert Biological Systems, Scarborough, ON). Although listed as Gliocladium species in Prestop and SoilGard, G. virens (SoilGard) has been transferred to the genus Trichoderma, and G. catenulatum (Prestop) may follow suit, although it is currently classified as Clonostachys rosea (Mill et al., 1987; Schroers et al.,

1999). Currently, no commercial Trichoderma biocontrol products are marketed for control of Fusarium basal rot of onion in Canada, nor have any been reported as effective if they have been used in research or other agricultural trials for this purpose. The three products used in this research (Prestop, RootShield and Trianum) are all available and approved for use in Canada.

Non-pathogenic F. oxysporum strains have also been used with success as biocontrol agents of pathogenic strains (Minerdi et al., 2008). However, there are some concerns associated with this approach. A high inoculum density needed is required, which can be difficult to achieve in an agricultural setting due to production, storage, and application constraints (Fravel et al., 2003). Direct antagonism by a non-pathogenic strain

11

requires a population that is greater than the pathogenic population, and while indirect antagonism can occur even when the non-pathogenic population is comparatively very small, this mode of action is less common. The potential trading of genetic information between strains is also a challenge. The genus Fusarium is known for horizontally transferring genes conferring pathogenicity, which could lead to development of pathogenicity in the non-pathogenic strain and an increased incidence of disease (Brown and Proctor, 2013). Finally, there has been difficulty achieving consistent results in field trials using non-pathogenic F. oxysporum strains as biocontrol agents for pathogenic strains (Shishido et al., 2005).

As an alternative to direct application of dormant, but living, fungal propagules as a biocontrol product, antifungal compounds can be extracted to create the product.

Examples exist of potential for biofungicide development specific to Fusarium species from both bacterial (Zhang et al., 2015) and fungal origins, using Trichoderma species among others (Calistru et al., 1997; Dubey et al., 2007). Another alternative is the creation of transgenic crop strains using genes involved in pathogen resistance or antagonism in the mycoparasitic fungal species (Bolar et al., 2000).

While there is a large existing body of Trichoderma biocontrol research, practical application regarding control of FBR of onion in the Annapolis Valley has not been addressed. Research using Trichoderma species as control agents of Fusarium species, and F. oxysporum and FOC specifically, provide strong support that one or more

Trichoderma species would be effective antagonists of FOC in the Annapolis Valley, however this remains to be experimentally tested (Coşkuntuna and Özer, 2008; Malathi and Mohan, 2011).

12

ITS barcoding

Currently, the internal transcribed spacer (ITS) gene region is accepted as the universal fungal barcode sequence (Schoch et al., 2012). The ITS region consists of two spacer regions (ITS1 and ITS2) of nuclear DNA between the 18S, 5.8S and 28S small sub-unit (SSU) rRNA genes in eukaryotes and is adjacent to the external transcribed

(ETS) region (Figure 1.1). This region occurs in thousands of copies of tandem repeats separated by non-transcribed intergenic spacer (IGS or NTS) regions. The degree of variation in the ITS region between genera and often even species is high enough to consistently allow for distinction between sequences at least at the species level, without being so high as to have divergent sequences within species (Schoch et al., 2012). This region is readily amplified and sequenced due to its high copy numbers, small size, and location between more highly conserved regions of DNA (Schoch et al., 2012).

FIG. 1.1. One half of a tandem of a SSU rRNA gene repeat. Adapted from Hillis and Davis, 1986.

There are concerns with using solely the ITS gene region for species identification in the genus Fusarium, which are explored regarding the interpretation of results in chapter 3 (O’Donnell et al., 1998; O’Donnell et al., 2009; O’Donnell et al., 2015). The

ITS region is considered more reliable for distinguishing between and identifying

Trichoderma species, however, any research focused on conclusive identification of fungal species and/or determining phylogenetic relationships strongly benefits from the

13

sequencing of multiple gene regions (Kubicek et al., 2008; O’Donnell et al., 2015;

Schoch et al., 2012). Keeping limitations in mind, ITS barcoding remains an essential tool in fungal species identification, although additional genetic markers such as the EF-

1α sequence can be used to increase confidence (Geiser et al., 2004).

Biological assessments

There are emerging molecular tools that assist in identifying biocontrol agents, but methods for finding an effective biocontrol strain of F. oxysporum have been limited to biological assessments (bioassays): systematically testing individual biocontrol agents

(Fravel et al., 2003). This is due to a lack of knowledge of any genetic markers that are related to biocontrol abilities. While a bioassay is a time-consuming method, it has proven to be a thorough approach to finding a biocontrol agent. A bioassay can inform which species or strains to use per host plant, soil type, and other environmental conditions, of interactions with the pathogen, how much to use when inoculating, and how effective the treatment is expected to be.

Dual culture methods can be used to determine the biological control potential of a fungus (or bacterium) against a pathogen. Previous studies have successfully tested various Trichoderma species for signs of inhibition towards many plant pathogens, including Sclerotium rolfsii (Mukherjee and Raghu, 1997), Lasiodiplodia theobromae

(Mortuza and Ilag, 1999), Ceratocystis paradoxa (Rahman et al., 2009), and Phoma and

Glocladium species (Mokhtar and Dehimat, 2015) using dual culture methods in which growth is measured and compared to growth of the pathogen grown individually, and morphological interactions are observed. At least one study has shown that T. harzianum

14

inhibits growth of FOC in dual culture, while additional studies have tested T. harzianum or other Trichoderma species against other strains of F. oxysporum (Dubey et al., 2007;

Hajighrari et al., 2008; Malathi and Mohan, 2011). Dual culture methods exclude many factors that may impact the practical application of a fungal antagonist as a biocontrol product, but are an excellent preliminary screening tool, allowing specific observation of the interaction between an antagonist and pathogen.

Testing of potential biocontrol agents is also commonly carried out in greenhouse and field settings. T. harzianum has shown success as a seed treatment on onion to protect against FBR in both growth chamber and field trials in Turkey (Coşkuntuna and

Özer, 2008) and on chickpea to protect against Fusarium wilt in field trials (Dubey et al.,

2007). Although onion cultivar resistance was tested, research specific to FOC showed that relatively short greenhouse assays (approximately four weeks) in which onions were grown from seed resulted in seedling symptom levels comparable to bulb symptom levels in assays lasting eleven weeks (Taylor et al., 2013).

15

CHAPTER 2: FIELD SITES

The sites used in this study were agricultural fields in the Annapolis Valley, NS, most of which were either cropped for onion during the season when sampling and/or biocontrol trials took place or had been cropped for onion within the past two years

(Figures 2.1-2.3; Table 2.1). Fields were chosen through collaboration with commercial bulb onion growers in Nova Scotia to sample fields both known to be infected and fields thought to be free of FOC, and to use fields with a history of infection when testing possible biocontrol products. All fields could broadly be described as consisting of well- drained sandy loam soil, with of slope of <20%, and low stoniness (Table 2.2; Cann et al., 1965). Average soil temperatures during the 2016 sampling season are shown in

Table 2.3.

16

FIG. 2.1. Field site region in the Annapolis Valley, Nova Scotia (red box); locations of field sites, with scale bar (insert).

17

a b

c d

FIG. 2.2. Four of five agricultural fields from which soil samples were taken in 2016, photographed 2016/07/04. a. F1 (used for testing of commercial biocontrol products against FBR in onion), b. F2, c. F6, d. F4.

a b

FIG. 2.3. Two agricultural fields cropped for onion during the 2017 growing season, used as sites to test commercial biocontrol products against FBR, photographed 2017/07/11. a. F7, b. F8.

18

TABLE 2.1. Known characteristics of field sites. Site Latitude Longitude Sampled 2015 crop 2016 2017 FOC (N) (W) 2016 crop crop History F1 45.031500 -64.814072 May-Sep carrot onion - Yes F2 45.089145 -64.710560 May-Sep uncropped wheat - No F3 45.134619 -64.438872 May onion - Yes F4 45.134013 -64.411592 May-Sep onion - No F5 45.086329 -64.662213 Sep wheat onion - Yes F6 45.132435 -64.449907 Jun-Aug oat - No F7 45.064982 -64.740249 - onion Yes F8 45.087794 -64.636277 - onion Yes

TABLE 2.2. Soil type and drainage by field site. Site Soil Type Drainage F1 Coarse loamy sand High F2 Sandy loam Good F3 Sandy loam Good F4 Sandy loam to loam Fair F5 Sandy loam Good F6 Sandy loam to loamy sand Good to fair F7 Loamy sand to sandy loam Good F8 Sand High

TABLE 2.3. Mean soil temperature of all sample points from all sites by month, and mean air temperature for Kentville NS on each sampling day, obtained from the Government of Canada’s Historical Climate Data records. Values reflect the approximate climate in the Annapolis Valley for the summer of 2016. May 4 Jun 4 Jul 4 Aug 3 Sep 7 Soil Temperature 3°C 12°C 20°C 18°C 26°C Air Temperature 6°C 15°C 21°C 18°C 24°C

Field sites 1 and 5 (F1 and F5) had a history of FOC infection and were cropped for the onion cultivar ‘Mountaineer’ (Mountaineer filmcoat onion hybrid; produced by

American Takii, Inc., 1293 Harkins Rd., Salinas CA; coating by Incotec Integrated

Coating and Seed Technology Inc., 201 North Michogan St., Oxford IN; distributed by

Stokes Seeds Ltd., 296 Collier Rd. S., Thorold, ON) during the 2016 growing season.

Site F2 was not previously used for farmland, thus was not reported to have any prior

FOC infection. It was cropped with wheat for the 2016 growing season. Site F3 had been

19

cropped for onion during the 2015 growing season, at which time FOC infection was reported, but was not cropped for onion for 2016. Sites F1-F3, and F5, were subject to typical commercial farming practices, including regular pesticide, herbicide, and fungicide application. Site F4 was part of an organic farm and was subject to organic farming practices. It was cropped for onion during the 2016 growing season and had no previous history of FOC.

Sites F7 and F8 both had a history of FOC infection, were cropped for the onion cultivar ‘Mountaineer’ during the 2017 growing season and were subject to non-organic commercial farming practices.

20

CHAPTER 3: CHARACTERIZATION OF FUSARIUM OXYSPORUM F. SP. CEPAE PRESENT IN

THE ANNAPOLIS VALLEY

Objectives

I confirmed the identification (using ITS barcoding) and pathogenicity of a FOC strain which was isolated from an infected onion collected in a local onion field. I then characterized this local strain of FOC by observation of morphological traits on four medium types (DG18, MEA, PDA, and SNA), and virulence assays on onion in the greenhouse. I also identified additional FOC strains for use in future research.

Methods

Isolation and identification of FOC isolates from symptomatic onions

The FOC isolate used for all morphological observations, pathogenicity tests, dual culture experiments, and all greenhouse biological assays was cultured from an onion exhibiting symptoms of FBR collected from site F3 at time of harvest in 2015. Culturing,

DNA extraction, and DNA barcoding of the ITS gene region were completed to identify the isolate as F. oxysporum prior to my experimental use of this isolate. However, I prepared a new sub-culture of this isolate from which a new DNA sample was extracted, and the sequence confirmed to be F. oxysporum before the steps listed above were undertaken (September 2016). Sub-culturing, DNA extraction, DNA barcoding and identification of species were completed as per the methods detailed in chapter 4.

21

Identification of fungi from additional onions was undertaken to isolate additional

FOC strains. Although the characterization of these strains is not covered by the scope of this thesis, the methods are described here. An additional ten ‘Mountaineer’ onions with visible basal rot were collected from sites F1 and F5 during the first week of September

2016. One onion was randomly selected from a random plot of each of the eight treatment conditions at site F1 (see chapter 2), while two infected onions were randomly selected from control site F5, (no experimental treatments for FBR).

Cultures were then obtained from these onions using two methods: directly plating infected onion tissue, or plating a solution resulting from agitating onion tissue in sterile RO water. All materials and instruments described as “sterile” throughout this thesis were autoclaved. In both cases, a 2x5x5 cm piece of onion tissue was cut from (or adjacent to, depending on the level of rot) the basal plate using a sterile razor blade. This tissue was either placed directly onto antibiotic-amended potato-dextrose agar (PDA) medium (see Appendix A for media recipes) in an 8.5 cm Petri dish or submerged in sterile RO water topped up to a final volume of 10 mL. From these solutions, 1 mL was directly plated, and 1 mL was used to create a second, 10% dilution of the original solution, from which 1 mL was plated. These solutions were spread onto antibiotic- amended PDA as was described for the soil dilution culture technique. In this manner, three amended-PDA plates were produced for each onion: one using infected onion tissue, one using a full strength “onion dilution” and one using a 10% dilution.

Subsequent sub-culturing to obtain axenic cultures, DNA extraction and DNA barcoding of the ITS gene region proceeded as described in chapter 4.

22

Both procedures detailed above were also used to grow fungal cultures from infected onion tissue (directly from tissue and from dilution) using three each

‘Mountaineer’ onions collected from sites F7 and F8 during September 2017. These infected onions were randomly selected from an area of the field that did not experience any experimental treatments to control FBR. Cultures obtained that were not F. oxysporum based on morphology were removed from the 2017 cultures.

Morphological characterization

FOC was grown in 8.5 cm Petri dishes on PDA, malt extract agar (MEA), dichloran 18% glycerol agar (DG18), and synthetic low nutrient agar (SNA) medium.

PDA, MEA, and SNA are media that are relatively non-selective to fungal species. They are commonly used to culture and characterize fungi and allow for comparison between researchers. DG18 is a selective medium that suppresses growth of bacteria and other fungi for isolation of F. oxysporum from plant material. Although it is not commonly used specifically for characterization, because it is often used expressly to culture F. oxysporum we considered it to be a suitable supplemental medium for morphological observation.

No media were amended with antibiotics so that observations would reflect only differences in nutrient availability, rather than differences in antibiotic activity: it was previously noted that the presence of antibiotics affects growth of FOC on PDA (personal observation), and different concentrations and types of antibiotics are recommended depending on medium type. Instances of contamination were rare, as new cultures were only propagated from axenic cultures, using aseptic techniques.

23

Diameter of mycelium was measured after three, five, and seven days growth in each plate. The following observations were also made: texture, height (hyphae in culture vs. aerial), shape, colour (upper surface), reverse pigmentation (lower surface), and presence and characteristics of exudates.

Three repeats per trial were measured; there were five conditions: 1. 24 hr darkness at room temperature (21°C) and ambient humidity (~40%) in a cupboard in a windowless room, 2. a natural daylight cycle of 11 h light at room temperature and ambient humidity on a counter next to a window, 3. a natural daylight cycle of 11 h extend to 16 h using artificial lights at a constant temperature of 25°C in a greenhouse with approximately 60% humidity, 4. a 12 h photoperiod achieved entirely with artificial lights adjusted to 300 µM·m-2·s-1 in a growth chamber at a constant temperature of 27°C

– humidity was not adjusted but was assumed to rise above ambient due to the temperature and enclosed space, and 5. a 12 h photoperiod using artificial light adjusted to 100 µM·m-2·s-1 in a growth chamber at a “daytime” temperature of 25°C and

“nighttime” temperature of 20°C – humidity was not adjusted and was assumed to be close to ambient (Table 3.1). These conditions were chosen to allow comparison to characterization growth trials of other F. oxysporum strains, and in the case of the greenhouse, to reflect growth in conditions used for bioassays in this thesis (Burgess et al., 1994; Samson et al., 2010).

24

TABLE 3.1. Conditions of FOC growth trials to characterize morphology using four medium types. Trial Location Light Type Photoperiod Day/Night Humidity (Light/Dark) Temp. 1 Cupboard in NA 0/24 ~21°C ~40% windowless room 2 Counter next to Natural daylight 11/12 ~21°C ~40% window 3a, b Greenhouse Natural daylight extended 16/8 ~25°C ~60% with artificial light 4 Growth chamber Artificial; 300 µM·m-2·s-1 12/12 27°C ~50% 5 Growth chamber Artificial; 100 µM·m-2·s-1 12/12 25/20°C ~40%

Conidia were collected using a 5 mm diameter plastic borer tube after seven days incubation; a 5 mm cube of medium containing mycelium from the mid-point between the centre and growing edge of the cultures was removed and placed into a 2000 µL microcentrifuge tube. A volume of 500 µL RO water was added, and then the tube was agitated by vortexing for 5 s to release conidia into a suspension. Conidia from this suspension were counted using a haemocytometer to determine approximate production by area of mycelium, and length and width of conidia were measured, using a stage micrometer; morphological observations were made. Few strands of hyphae were observed using the prepared suspension, thus, straining to remove mycelium was not deemed necessary. Micromorphology was also observed, by preparing slides directly from growing, seven day cultures. Slides prepared from cultures grown on either PDA or

DG18 media were most useful for micromorphological observations, as sporulation was more abundant than in cultures grown on MEA and SNA. Structure of conidiophores was noted.

25

Virulence bioassays

FOC was used to inoculate soil in which onion seeds were germinated, grown, and evaluated for disease. A spore suspension was obtained by adding 10 or 15 mL sterile

RO water to a culture of FOC after two weeks of growth, swirling gently for 30 s, and then pouring into a sterile 50 mL Falcon tube. Spore concentration was determined using a hemocytometer: four squares in each of the corner chambers were counted in a diamond pattern; spores were counted on the right hand and bottom boundary lines only. In assay

3, second and third haemocytometer slides were prepared, and the counts of all slides were averaged to reduce any variability due to uneven distribution of spores within the suspension. Average counts from the three slides were within a 12% margin of error.

In assay 1, the volume of spore suspension to use for soil inoculation was calculated for 1000, 10 000, or 100 000 spores per gram (s/g) of soil, depending on treatment, and in assay 2, final spores per gram of soil were 5, 10, or 50. In assay 3, spore concentrations of 10 and 50 s/g were repeated. A calculation error occurred when determining spore suspension concentrations for assays 2 and 3. The goal was to choose concentrations to pinpoint the concentration required for 50% seedling mortality at the end of a four week period – it was thought at the time that the concentrations being tested were 500, 1000, and 5000 s/g.

In assay 4, the calculation error was amended, and concentrations of 1000 and

5000 s/g were successfully tested. A control concentration of 1000 s/g was again used in assay 5. FOC concentrations tested in assays 1-5 are shown in Table 3.2.

26

TABLE 3.2. Experimental concentrations of FOC spores used in greenhouse trials to determine virulence of FOC, shown in spores per gram of soil for each of the five assays conducted. Number of pots per trial also shown. 5 s/g 10 s/g 50 s/g 1000 s/g 5000 s/g 10 000 s/g 100 000 s/g Repeats Assay 1 ✓ ✓ ✓ 24 Assay 2 ✓ ✓ ✓ 24 Assay 3 ✓ ✓ 24 Assay 4 ✓ ✓ 18 Assay 5 ✓ 18

Soil was steam sterilized in 800 g portions at 121°C and 15 psi for 30 m using an autoclave, to remove other microorganisms that may have impacted disease progression.

Each portion was within a loosely tied plastic biohazard bag placed in metal tray, was immediately transferred into a sterile container upon completion of the steam sterilization cycle and was then stored in a sterile environment until needed. All soil was sterilized within 36 hrs of use for potting. The appropriate volume of spore suspension per treatment was mixed into 5 L RO water, added to 4.8 kg of soil, and thoroughly mixed by hand. Fresh disposable nitrile gloves were worn to mix each treatment, to decrease the possibility of contamination. 200 g of soil was added to each 15 cm pot, in which 25 onion seeds were planted at a 1 cm depth. Each treatment consisted of 24 pots in assays

1-3, and eighteen pots in assays 4-5.

The onion seeds used were sterilized ‘Mountaineer’ seeds obtained from a Nova

Scotia commercial bulb onion grower (a common variety planted in the Annapolis

Valley). Seeds were surface sterilized as follows: approximately 8 g seeds were placed in each of two, 5 cm metal mesh balls, rinsed in running, RO water for 1 h, agitated in a

50% ethanol solution for 30 s, rinsed thoroughly with RO water, agitated in a 20%

NaClO solution (40 mL NaClO and 2 drops of Tween®20 in 200 mL RO per each mesh ball) for 10 m, thoroughly rinsed with RO water, agitated for 60 s in RO water, rinsed,

27

agitated for a further 80 s in fresh RO water, then thoroughly rinsed a final time. Seeds were sterilized to remove possible contaminants that may have affected disease progression.

Once prepared, pots were kept in a controlled greenhouse (phytotron) in the K. C.

Irving Environmental Science Centre (KCIC) under the following conditions: 27°C, 16 h photoperiod, and approximately 60% humidity. Pots were randomly distributed with 24 pots per bench, with approximately 5 cm between pots on a bench. All pots were watered daily using a watering can, using RO water, as needed. Experimental setup is shown in

Figure 3.1. All pots, potting equipment, potting surfaces, containers used to store soil, and benches in the phytotron were sterilized prior to each trial using a 10% bleach solution. New soil was used for each assay; soil from previous assays was discarded and not reused.

FIG. 3.1. Greenhouse bioassay setup in Phytotron E, in K. C. Irving Environmental Science Centre (KCIC), Acadia University.

Seeds were monitored for emergence, and then seedlings were observed for disease symptoms and survival over a four week period. Pots were assigned a health score in which each seedling was rated as asymptomatic, with symptoms, or dead and this count was totalled (Table 3.3). This variable is referred to as “onion health”. Symptoms

28

were evaluated in comparison to control plants (0 s/g FOC), as the outer leaves of onion seedlings naturally wilt with maturation, meaning that a strict score using level of wilt as a measure would not have accurately captured presence of FBR symptoms as plants matured. It can be summarized that any wilt uncharacteristic of control plants was considered a disease symptom, as were shrivelling, softness (“mushy” seedlings), and visible mould, as these latter three symptoms were never observed in control plants

(Figure 3.2). Pots were labelled and so observations were not blind.

TABLE 3.3. Disease symptom key for onion seedlings rated in greenhouse bioassays. Rating Symptom Key 0 Dead 0.5 Showing symptoms 1 Asymptomatic

a b

FIG. 3.2. Pots of onion seedlings grown in the greenhouse. a. Seedlings showing symptoms attributed to FOC (wilt, shrivelling, browning, death) in a pot containing 1000 spores of FOC per gram of soil; b. asymptomatic seedlings in a control pot.

Data were analysed with R version 3.3.1 (R Foundation for Statistical Computing,

Vienna, Austria) and RStudio version 1.1.414 (RStudio Inc., Boston, MA). Symptoms were considered as proportional data (proportion of seedlings with symptoms per pot) on the final day of observations (day 28). A general linear model was fit by assessing

29

residual plots. Estimates of fixed effects were determined individually for inoculant concentrations; results of P < 0.05 were considered significant. To determine a concentration of FOC inoculant to result in ~50% seedling mortality in a four week assay, a lethal dose plot was also constructed using proportion of symptomatic seedlings at day 28.

Pathogenicity test

Pathogenicity was tested using the FOC strain used for morphological characterization (described above), which was also used in further experimentation for this thesis (chapters 4-5). This F. oxysporum isolate was used to inoculate soil and was shown to cause disease symptoms in onion seedlings (see ‘Greenhouse virulence bioassays’, above). One onion showing signs of wilt, four weeks post-emergence, was randomly selected from each of three pots which received an initial inoculation of 1000 s/g of soil. These were surface sterilized according to a standard plant tissue sterilization procedure used in the Seed Bank and Tissue Culture Program in the KCIC at Acadia

University to target isolation of fungi that had colonized internal plant tissues.

Portions of onion tissue measuring 6 cm, consisting of 3 cm both above and below the basal plate, were excised using sterile scissors. This tissue gently washed in cool, soapy water, then rinsed with RO; a mild hand soap was used. They were then immersed in 70% ethanol for 5 s, rinsed in sterile RO water, immersed in a 10% NaOH solution for 10 m, then rinsed three successive times in sterile RO water. Sections of 5 mm of each root, basal plate, and leaf tissue were taken from each plant and plated on antibiotic-amended PDA. Leaf and root tissue sections were selected from the mid-point

30

of each the 3 cm above- and below-ground portions, respectively; the entire shoot/root matter within the 5 mm section was plated (i.e. several roots rather than a single root strand). Basal plates did not exceed 5 mm, allowing the entire basal plate to remain intact.

Plates were incubated at room temperature in the dark, and fungal cultures morphologically identified as F. oxysporum were confirmed using ITS sequencing, as described in chapter 4.

Results

Identification of FOC isolates from symptomatic onions

From 2016 collections (pooling isolates from both isolation techniques), five isolates were determined to be FOC from a total of 21 isolates ITS rDNA barcoded, while from 2017 collections, three of eight cultures obtained were ITS rDNA barcoded and determined to be FOC. It is reasonable to assume isolates from infected onions to be

FOC, although this cannot be confirmed without a separate test of pathogenicity to onion.

Five isolates from 2016 collections were confidently identified as being in the family Nectriaceae (phylum Ascomycota), as is the Fusarium genus, but could not be identified to the species level by comparison to sequences in Genbank. These isolates may represent new species, or the inability to narrow the identification to species level may simply reflect insufficient sequence quality and/or a lack of accurate Fusarium data in the database. Additionally, two each isolates from infected onions in 2016 were identified as F. avenaceum and F. solani. All other isolates belonged to the genera

Geotrichum (phylum Ascomycota, family Dipdascaceae), Penicillium (phylum

31

Ascomycota, family Trichocomaceae), or Rhizopus (phylum Zygomycota, family

Mucoraceae). Four isolates from the 2017 collections were identified as F. solani. The final remaining isolate was identified as Clonostachys rosea (phylum Ascomycota, family Bionectriaceae).

Morphological characterization

The strain of FOC analyzed was recognizable as F. oxysporum when grown on all medium types in all growth conditions upon observation of macromorphological traits, as per descriptions and photographs in either Burgess et al., (1994) and/or Samson et al.,

(2010). Descriptive observations and photographs taken after seven days of growth are provided here (Figures 3.3-3.6). The only feature that did not differ according to growth conditions or medium was that all FOC cultures were circular.

In trial 1, FOC produced an opaque, white, floccose culture with aerial hyphae when grown on PDA in the dark, at room temperature (Figure 3.3a-b). Texture appeared almost velvety; aerial strands extended up to 4 mm. Reverse pigmentation was a creamy, slightly yellow, off-white. Two of the three plates displayed a ‘hyaline ring’ morphology:

12-15 mm of appressed, hyaline, filiform hyphae at the extremities of growth, bordering

5-7 mm of dense floccose growth, within which growth was as described above (Figure

3.3a). The third plate contained a ‘uniform’ morphology, with uniform growth as described above (Figure 3.3b). On MEA, a hyaline culture was produced, with sparse white aerial strands (Figure 3.3c). A ‘wavy’ texture of individual hyphae was evident.

The culture produced on SNA was as observed on MEA, except without any aerial hyphae, and the texture of hyphae was less wavy and more dense; individual hyphae were

32

difficult to distinguish (Figure 3.3d). Cultures on both MEA and SNA had more dense hyphae toward the outer extremities, giving this portion of the culture a white, although still transparent, appearance. On DG18, FOC produced short aerial hyphae (<2 mm) with a ‘sharp’ velvety texture: hyphae formed small spikes rather than giving a ‘soft’ appearance (Figure 3.3e). The culture was opaque, and creamy-gray in colour fading to a pale pink at the centre. Reverse pigmentation was a pale, creamy orange-pink.

a b c

d e

FIG. 3.3. FOC grown in 8.5 cm Petri dishes at room temperature (21°C) in the dark for seven days (trial 1). a. Culture showing ‘hyaline ring’ morphology on PDA; b. culture showing ‘uniform’ morphology on PDA; c. culture on MEA; d. culture on SNA; e. culture on DG18.

In trial 2, FOC grown at room temperature experiencing a natural daylight photoperiod produced similar cultures as when grown in the dark with the following exceptions: the number of aerial strands produced on MEA were fewer and grew more horizontally (<2 mm upwards height); and very sparse, tangled, floccose white aerial

33

strands were produced on SNA. There were again two different growth morphologies observed on PDA, although in reversed proportion as when grown in the dark (one

‘hyaline ring’ and two ‘uniform’) and the differences between the two were less pronounced than in cultures grown in the dark (Figure 3.4). Differences in growth from the dark condition were not deemed noticeable enough to warrant including photographs for the natural daylight condition on the MEA, SNA, and DG18 media.

a b

FIG. 3.4. FOC grown in 8.5 cm Petri dishes at room temperature (21°C), experiencing a natural daylight cycle for seven days (trial 2). a. Culture showing ‘hyaline ring’ morphology on PDA; b. culture showing ‘uniform’ morphology on PDA.

Growth of FOC in the same greenhouse conditions used for virulence trials had some differences from growth at room temperature with a natural daylight regime. Trials

3a and 3b are described here for a total of six plates observed per medium type, but all photographs were taken from trial 3b. Photographs are only provided for cultures grown on PDA and DG18, and subtle differences between trials in growth on MEA and SNA were not easily distinguishable in photographs. When differences from the cultures grown in trial 1 are not noted, it should be assumed there was no difference in that feature.

Growth on PDA again followed one of the two growth forms previously described: four plates had 5-10 mm of flat, hyaline, filiform growth at the outermost

34

extremities; two had white aerial hyphae that extended to the edge of growth (Figure

3.5a-b). Reverse pigmentation was a pale, creamy peach colour. A more extensive

‘ringed’ growth pattern was evident in four of the six plates, more notably from the reverse of the plate: alternating bands of growth regarding density of hyphae.

Cultures on MEA and SNA plates displayed a distinct ringed pattern in all plates from trial 3a and all SNA plates from trial 3b. There was no aerial growth in any MEA plates, but aerial growth was present in all SNA plates from trial 3a as like described for trial 2. There was no aerial growth on SNA in trial 3b. Cultures on DG18 were slightly more intensely coloured than in previous trials: a pale peach to salmon pink fading to a creamy yellow at the extremities (Figure 3.5c). Reverse pigmentation was less pale but still peach to salmon pink. A single noticeable ring was present.

a b c

FIG. 3.5. FOC grown in 8.5 cm Petri dishes in the greenhouse at 27°C with a 16 h photoperiod for seven days (trial 3b). a. Culture showing ‘hyaline ring’ morphology on PDA; b. culture showing ‘uniform’ morphology on PDA; c. culture on DG18.

The most obvious differences in macromorphology were observed in cultures grown in the growth chamber conditions (trials 4 and 5). FOC cultures grown on PDA produced low (<2 mm), velvety, opaque, peachy-coloured aerial growth (Figure 3.6a).

Growth occurred in distinct rings of more/less dense hyphae. Reverse pigmentation was a distinct peachy-salmon pink. All three cultures produced on PDA exhibited similar

35

morphology in both growth chamber trials. Cultures produced on MEA and SNA were comparable to those in previous trials; distinctive features were ringed pattern in all plates for both medium types, albeit ‘messier’ and less defined on MEA (Figure 3.6b-c).

Low, sparse, wispy aerial growth was present in cultures grown on both MEA and SNA in both trials 4 and 5, although was more sparse in trial 5. Growth on DG18 was also comparable to earlier trials, although without any ring pattern present (Figure 3.6d). The hyphae and reverse pigment were both a pale peachy-salmon colour throughout. Texture was ‘softer’ and more velvety in comparison to grown on DG18 in other conditions.

Cultures were similar for trials 4 and 5; photographs have been provided from trial 4.

a b

c d

FIG. 3.6. FOC grown in 8.5 cm Petri dishes in a growth chamber at 27°C with a 12 h photoperiod for seven days (trial 4). a. Culture PDA; b. culture on MEA; c. culture on SNA; d. culture on DG18.

Within each trial, the greatest number of spores were produced in cultures grown on DG18, followed by PDA. Fewer spores were produced by FOC when grown on MEA

36

or SNA. The greatest number of spores were produced on DG18 and PDA in the growth chamber (trial 4), which experienced the most consistently warm temperature, the highest light level, and the most even night/day photoperiod. On MEA and SNA, number of spores produced at room temperature in the dark (trial 1) was comparable to number of spores produced in trial 4. Spore counts are shown in Figure 3.7.

FIG 3.7. Mean number of spores per mm2 of hyphal growth of FOC cultures after seven days growth on four medium types (DG18, MEA, PDA, SNA) each grown in five different conditions (trials 3a and 3b amalgamated), measured by creating spore suspensions and observing under the microscope. Three plates were assessed for each medium in each trial. Error bars show standard error; scale of y axis differs per media type.

Microconidia were abundant and had a consistent width, (3-5 µm wide), but were variable in length (5-25 µm). Cells were non-septate, smooth-walled, and oval or

37

reniform (Figure 3.8c-d). All microconidia were observed as arising from monophialides

(Figure 3.8a-c). Very few macroconidia were observed, but those present were short in length, falcate with tapered ends, and 3-septate (Figure 3.8d). No chlamydospores were observed.

a b

c d

FIG. 3.8. Hyphae, spore bearing structures, and spores of FOC, visualized from slides produced from seven day cultures on either a PDA or DG18 medium at 100X magnification. Arrows point to: a-b. microconidia in early stages of development at the tips of monophialides; c. microconidia at later stages of development at the tips of monophialides, and to the right of these structures, a possible macroconidium released into liquid of the slide; d. macroconidia developing from an intercalary phialide arising from the hyphae. Microconidia are abundantly visible in the slides created for images c-d.

Colony diameters on PDA were between 25 and 40 mm after three days of growth and between 30 and 55 mm after four days of growth, regardless of condition (Figure

3.9). These values were within the expected growth rates on PDA at both 25°C and 30°C

(Burgess et al., 1994; Samson et al., 2010). Diameters were smallest regardless of

38

medium or day when grown at room temperature, experiencing a natural daylight cycle

(trial 2).

FIG. 3.9. Mean diameter (mm) at three, five, and seven days of FOC grown in 8.5 cm Petri dishes on four different media (red – DG18, green – MEA, blue – PDA, purple – SNA): each in five different conditions (trials 3a and 3b amalgamated). Different days are shown in different panels, while conditions are compared within panels (trials 1-5). Three plates of each medium were assessed in each trial; error bars show standard error.

Virulence bioassays

The average score of health per pot across assays increased for all treatments from first emergence (day five or six) to approximately day eleven (Figure 3.10). This measure continued to increase indefinitely, albeit at a reduced rate, for the control, 5, 10, and 50 s/g of soil conditions. In the 1000, 5000, 10 000, and 100 000 s/g conditions, this measured then decreased until approximately day 21, after which point it remained

39

constant. Although health appears to increase at the end of the assays in Figure 3.10, this was likely due to lowered a threshold for symptom identification, as outer leaves of plants naturally senesced. All treatments greater than 5 s/g FOC had a significant effect on the presence of symptoms; estimate values of effect increased with increased FOC concentration (Table 3.4). Peak and final health values in the control condition were alike in all assays, and thus average values are provided here for comparison to treatment conditions: 22.14 at day 20, and 21.62 at day 28.

All following numbers are reflected in Figure 3.10 and refer to assays described in

Table 3.2. In assay 1 for the 1000, 10 000, and 100 000 s/g treatments, peak values occurred near day eleven, and were 13.35, 9.35, and 6.15, respectively. At the four week mark, the 1000, 10 000, and 100 000 s/g treatments had health scores of 9.04, 3.88, and

1.25, respectively. Peak health values in assay 2 were 21.90 at day 28 for the 5 s/g condition, 18.85 at day twenty for the 10 s/g condition, and 14.64 at day 28 for the 50 s/g condition. The final health value for the 10 s/g condition was 18.52. In assay 3, final health values were also peak values for both the 10 and 50 s/g conditions: 19.38, and

16.58, respectively. Peak and final health in assay 4 for the 1000 s/g condition were 13.31 and 7.67; they were 10.53 and 5.47 for the 5000 s/g condition. In assay 5, peak and final health values were 16.14 and 12.92 for the 1000 s/g condition. Peak values occurred near day eleven in assays 4 and 5.

40

FIG. 3.10. Mean health of pots sown with 25 onion seedlings for eight FOC inoculation concentrations (0, 5, 10, 50, 1000, 5000, 10 000, and 100 000 s/g), with each condition consisting of 24 pots. Mean health shown per day, from emergence to 28 days post- sowing. At day 28, order of FOC concentration from highest to lowest onion health is: 5 s/g, 0 s/g, 10 s/g, 50 s/g, 1000 s/g, 5000 s/g, 10 000 s/g, 100 000 s/g). Shading shows standard error for each curve.

TABLE 3.4. Estimates of effect sizes, standard errors, and P values of each FOC inoculant concentration used in virulence assays, as compared to the control (0 s/g FOC). FOC concentration Estimate Standard Error P value 5 s/g 0.27 0.63 0.673 10 s/g -2.75 0.49 5.32 x 10-8 50 s/g -6.23 0.49 < 2 x 10-16 1000 s/g -12.27 0.46 < 2 x 10-16 5000 s/g -16.44 0.71 < 2 x 10-16 10 000 s/g -17.73 0.63 < 2 x 10-16 100 000 s/g -20.36 0.63 < 2 x 10-16

The lethal dose plot constructed shows that the lethal dose resulting in approximately 50% symptomatic onion seedling at the end of a four week assay is

41

between the 50 s/g and 1000 s/g FOC concentrations (Figure 3.11). It should be noted that the FOC concentrations on the x axis are not shown proportionally to one another to better visualize the relationship between seedling symptoms and FOC concentration. The

5 s/g FOC concentration was not significantly different from the 0 s/g concentration.

FIG. 3.11. Mean percent of symptomatic seedlings 28 days after planting per concentration of FOC inoculant added to the soil in spores per gram of soil. Note that the x axis is organized categorically and not proportionally.

Average health was also plotted for only the 1000 s/g treatments, considering this treatment was repeated in three trials and was chosen as the inoculant concentration when later testing treatments against FBR on onion in greenhouse trials (Figure 3.12).

42

FIG. 3.12. Mean health of pots sown with 25 onion seedlings and using the 1000 s/g FOC inoculant concentration, with each condition consisting of 24 pots, for each of the three bioassays which tested this concentration. Mean health shown per day, from emergence to 28 days post-sowing. Shading shows standard error for each curve.

Pathogenicity test

All three Petri dishes prepared with basal plate tissue produced an axenic fungal culture (Figure 3.13); two of the dishes prepared using root tissue did so. None of the three Petri dishes prepared with onion leaf tissue, or the third root tissue dish, produced any fungal growth. All five isolates were positively identified as Fusarium oxysporum using ITS rDNA barcoding.

43

FIG. 3.13. 8.5 cm Petri dishes containing a PDA medium amended with antibiotics, to which onion basal plate tissue was added, which was taken from plants showing basal rot symptoms grown in pots which received a 1000 s/g FOC treatment in the greenhouse, shown five days after the basal plate tissue was added.

Discussion

It is necessary to identify pathogenic fungal isolates by DNA barcoding because identification of fungal species using only morphological traits can be inaccurate and can not provide the level of resolution of molecular analyses. Fusarium is a phylogenetically complex genus and species may be confused with one another when only morphological traits are considered (Burgess et al., 1994). Although there are known drawbacks to fungal DNA barcoding using the ITS gene region, it was deemed sufficient for the purposes of confirming F. oxysporum identity in this case, as FOC is the known cause of

FBR in bulb onions, and FBR symptoms were observed in the onions from which cultures were produced.

Six isolates from infected onions being identified as F. solani does, however, indicate at least one of the following three circumstances to be true: ITS barcoding was not sensitive enough to consistently distinguish between the F. oxysporum and F. solani strains isolated, both F. oxysporum and F. solani cause FBR of onions in the Annapolis

44

Valley, or non-pathogenic F. solani was present in high enough concentrations in the onion rhizosphere or within the onion tissue to regularly recur in culture plates from onion tissue.

One drawback of sequencing the ITS gene region is that, used alone, it does not differentiate precisely enough to determine accurate phylogenetic relationships within the

F. oxysporum species complex (O’Donnell et al., 2009; O’Donnell et al., 2015). FOC has been linked to at least eight other formae speciales of F. oxysporum even when using two loci (IGS rDNA and EF-1α) to create “sequence type” groups (O’Donnell et al., 2009).

Different related species within the Fusarium genus have also been shown possess nonorthologous ITS sequences (O’Donnell et al., 1998). So, although there is no specific evidence suggesting that ITS gene region sequences would not show differentiation between F. oxysporum and F. solani, the ITS gene region is not always enough to discriminate between strains of F. oxysporum or even different Fusarium species

(O’Donnell et al., 1998; O’Donnell et al., 2009).

It is possible, alternatively, that GenBank, which I used to determine species identification, was not accurate enough for that purpose. A recent study states that at least

50% of ITS sequences from Fusarium species are misidentified in the NCBI database

(O’Donnell et al., 2015). Sequences are often named and deposited using the closest hit of a BLASTn query, which increasingly perpetuates the number of incorrect species assignments. To increase species identification confidence, additional gene regions should be sequenced; the Walker lab at Acadia University is currently working on obtaining EF-1α, β-tubulin, and SIX gene sequences for the FOC strain used within this thesis, as well as other FOC and F. oxysporum strains.

45

There are numerous instances of F. solani being shown as pathogenic to bulb onions; F. solani was categorized as pathogenic and highly virulent to onions in a pathogenicity test that soaked onion seeds directly in a spore suspension, as well as when using pathogenicity tests like the one used in the present study (Bayraktar and Dolar,

2011; Klokočar-Šmit et al., 2008). F. solani is also frequently found in agricultural fields cropped for onion alongside F. oxysporum, although F. oxysporum is consistently found to be the more prevalent cause of FBR in onion (Bayraktar and Dolar, 2011; Boehnke et al., 2015).

Further testing would be required to elucidate the role of F. solani and other

Fusarium species in causing Fusarium basal rot of bulb onions in the Annapolis Valley.

A pathogenicity test like the one used for F. oxysporum would determine if strain(s) of F. solani are pathogenic to onion, and more thorough sequencing of soil DNA might clarify relative levels of F. oxysporum and F. solani. More comprehensive sequencing from infected onions would also better inform levels of each fungus within the onion tissue.

Use of novel molecular marks such as the SIX genes along with traditional markers such as the ITS region has proved effective in differentiating between strains of F. oxysporum, between F. oxysporum and other Fusarium species, and in determining pathogenicity

(Sasaki et al., 2015; Taylor et al., 2016).

Observation of morphological traits strengthens our understanding of this specific strain of FOC, and of the differences that exist between strains. This additional characterization was helpful in supplementing the results of ITS barcoding in Fusarium species. Colony morphology of F. oxysporum in culture is variable and may resemble other Fusarium species such as F. solani (Burgess et al., 1994; Samson et al., 2010).

46

Additionally, differences in macromorphology are generally observed depending on growth conditions as well as culture medium type. Nevertheless, all cultures were identifiable as F. oxysporum. In summary, the FOC strain used in this research produces a circular, white, opaque, floccose culture when grown on a PDA media, and develops a pink-orange hue with age. This colour appeared within three days of growth when experiencing daytime temperature of 25°C or above. The pink-orange colour may appear after approximately two weeks of growth at room temperature (personal observation; not recorded as part of an experimental trial).

It is likely that cultures with the hyaline ring growth form were degenerate cultural variants, which are commonly produced through frequent sub-culturing of mycelia on nutrient-rich media (Burgess et al., 1994). This growth form seems to be an intermediate between the pionnotal (flat, slimy, lacking aerial mycelium) and mycelial

(usually white) types described in Burgess et al., (1994). Other possible explanations for the observance of alternate growth forms are rather speculative: differences in amount of growth media, differences in amount of inoculation material, and/or differences in maturity of inoculation material. Attempts to control all these factors were made; differences in amount of growth medium is likely the most variable.

Spores are most abundantly produced on PDA and DG18 media, and at warmer temperatures. Some (although few) macroconidia were observed in slides created from seven day cultures, thus evidently macroconidia were present even though none were observed in the spore suspensions created to quantify number of spores. It is possible that a different method of creating slides would have been better for observing macroconidia, although macroconidia have been noted to be sparse in some strains of F. oxysporum, and

47

so this may be one such strain (Samson et al., 2010). Microconidia were abundant and formed on monophialides, as expected for F. oxysporum (Burgess et al., 1994). Both observed micro- and macroconidia conformed to known dimensions and morphology in

F. oxysporum. Although chlamydospores are expected to be abundant in F. oxysporum cultures, they require three to six weeks to form in some strains, so it is not unusual that none were observed (Burgess et al., 1994).

It is possible that the ‘ringed’ pattern visible in cultures is a product of the amount of medium available, a result of growing conditions, or due to a combination of these factors. Much of the medium in the warmer conditions evaporated, leaving only a thin layer available for the fungus to use. I also speculate that some other differences in morphology could be due to this effect. It would be difficult to control for this as evaporation is intrinsically linked to the temperature, but plates for use in warmer conditions could be prepared with a greater amount of starting medium. I could find no research linking a ring pattern to amount of medium available. Concentric rings have been connected to sporulation in response to photoperiod, however (Gressel and

Hartmann, 1968).

A pathogenicity test is a necessary step to confirm that symptoms seen in the assays were indeed caused by the FOC strain I used to inoculate the soil. As all cultures produced from onion samples showing symptoms after being inoculated with the local F. oxysporum isolate were confirmed to be F. oxysporum, we can confidently call this isolate Fusarium oxysporum f. sp. cepae, as it caused disease in Allium cepa. No fungal cultures except the FOC isolate were present in plates produced from diseased onion samples, indicating that the sterile practices used in greenhouse assays were successful.

48

Subsequent virulence bioassays then provided a baseline from which assays testing different potential antagonists of FOC to reduce disease symptoms could be measured. I determined that 1000 s/g soil was an appropriate inoculation concentration because it resulted in approximately 50% seedling mortality in a four week assay as assessed by plotting health by day and creating a lethal dose plot. This concentration is within the range of natural levels of infection in agricultural soils; one study found levels in New York soils to range from 300-6500 propagules per gram of dry soil (Abawi and

Lorbeer, 1972). My assays also revealed that virulence, at least this strain of FOC, is proportional to the amount of FOC spore suspension inoculant, as demonstrated by relative estimates of effect sizes and creation of the lethal dose plot. Additional confidence would be leant to results by completing blinded assays, in which pots are randomly numbered rather than labelled by treatment to reduce observer bias.

Although sterilization of soil and onion seeds removed contaminants and thus possible confounding factors to the results, the sterile growth environment did not reflect a natural soil environment, which would be rich in microbial life. To create baseline information, as was my intention, as many confounding factors as possible should be removed. Additional assays varying factors such as photoperiod, temperature, humidity, soil type, and soil microbiota would provide a more complete picture of how disease progression occurs in a natural system. Alternative methods of soil sterilization should also be considered as steam sterilization has some drawbacks: complete sterility may not be achieved with one cycle, and physical properties of the soil such as particle size may be affected (Lotrario et al., 1995). There are conflicting data on whether soil organic content is significantly altered by autoclaving (Coûteaux, 1992; Jenkinson, 1966; Lotrario

49

et al., 1995). γ-irradiation is generally concluded to be the soil sterilization method that least impacts soil properties, but the infrastructure is not available at many institutions

(including Acadia University) and there may still be some effects to soil chemistry

(Lotrario et al., 1995; McNamara et al., 2003).

A strain of F. oxysproum isolated from an infected onion in the Annapolis Valley was confirmed to be FOC (pathogenic to onion) and virulence to ‘Mountaineer’ onions was determined in controlled greenhouse conditions. Morphological features were successfully characterized in a range of conditions and culture media. This new information creates a robust baseline for further research of pathogenic F. oxysporum and

FOC in the Annapolis Valley.

50

CHAPTER 4: TESTING BIOLOGICAL CONTROL POTENTIAL OF TRICHODERMA SPECIES

ISOLATED FROM LOCAL AGRICULTURAL SOIL AGAINST NOVA SCOTIAN FUSARIUM

OXYSPORUM F. SP. CEPAE

Objectives

I evaluated the biocontrol potential of Trichoderma species isolated from local agricultural soils used for cropping onion, against the FOC strain identified in chapter 3. I used isolation culture techniques and DNA barcoding to identify fungal species in soil samples, then tested the Trichoderma species found for antagonistic activity toward FOC in both controlled laboratory and greenhouse settings (nutrient agar and onion plant bioassays, respectively). I hypothesized that all Trichoderma species tested would show some antagonism toward FOC in both types of experimental trials.

Methods

Isolation of fungi from onion field soil and infected onions

To isolate and identify local Trichoderma species for further testing as biocontrol agents of local FOC, the following steps were completed. Soil samples were collected from the upper 10 cm of soil using a sterile metal scoopula and kept in sterile 50 mL

FalconTM tubes at 4°C. Collection occurred once per month, at the beginning of the month, from May to September 2016, for sites F1, F2, and F4. Soil was collected from site F3 in May, from F5 in September, and F6 from June to August. Each sample

51

consisted of an amalgamation of soil from three different collection points at least 10 metres apart within the field. Soil temperature and moisture were measured using soil probes at approximately a 10 cm depth, at each collection point (Rapitest Digital Soil

Thermometer, Luster Leaf Products Inc., Woodstock IL; Combination pH and Moisture

Meter, Gardman, Peterborough UK). Temperature measurement was not determined to be accurate enough to provide information specific to site, as time of day of measurement differed between sites and a general trend of warmer temperatures later in the day was observed. Values were thus averaged to provide an approximate soil temperature reflective of climate in the Annapolis Valley (Table 2.3).

Soil was diluted in sterile reverse osmosis (RO) water to a 0.005% soil concentration in a final volume of 10 mL, to create dilutions using soil from each site for each collection month. 1 mL of each dilution was transferred using a sterile transfer pipette to both an 8.5 cm plastic Petri dish containing PDA and an 8.5 cm plastic Petri dish containing dextrose-peptone-yeast extract agar (DPYA) and was spread with a sterile metal microbiological spreader. Fungal growth occurs more slowly on DPYA so its use allowed isolation of species that may be quickly overtaken by rapidly growing species on the more nutrient-rich PDA media. Both media were amended with antibiotics.

At least two plates of each type were used per soil sample.

All plates were sealed with Parafilm and incubated at room temperature (21°C) under a natural daylight regime until distinct fungal colonies were observed (two to five days) then incubated at 4°C to slow further fungal growth. A 5 mm cube from the growing edge of each distinct fungal colony from each plate was sub-cultured to a 5.5 cm

Petri dish containing PDA and again incubated at room temperature. Plates containing

52

axenic cultures were transferred to 4°C when fungal growth reached to or near the perimeter of the growth medium (three to seven days). Plates containing two or more fungal species were sub-cultured using the above technique. This process was repeated until an axenic culture was obtained, or it was deemed that the fungal species could not be separated in this manner. These dishes, as well as those containing a fungal culture representing a duplicate morphology to an existing isolate, were removed from the study.

All culture initiation methods and subculturing were undertaken employing sterile techniques in a laminar flow hood. From 2016 collections, 130 cultures from onion field soil were grown and subsequently ITS rDNA barcoded.

DNA barcoding and identification of Trichoderma species

5 mm cubes of medium containing hyphae were taken from the growing edge of each axenic culture from each field site. DNA was extracted from these samples using the

UltraClean® Microbial DNA Isolation Kit, Catalog #12224 (MO BIO Laboratories, Inc.,

Carlsbad, CA), following the manufacturer’s protocol. PCR was performed using a 25 µL reaction mix composed of 12.5 µL VWR Life Science AMRESCO Ready PCR mix, 9.5

µL dd’H2O, 10 pmol each of forward (ITS5: GGAAGTAAAAGTCGTAACAAGG,

White et al. 1990) and reverse (ITS4: TCCTCCGCTTATTGATATGC, White et al.

1990) primers, and 1 µL DNA. This amplified a ~700 bp sequence including the ITS1 and ITS2 regions and 5.8S gene between the nuclear rRNA SSU and LSU gene regions

(Figure 4.1). A negative control reaction of PCR mix substituting dd’H2O for DNA was also prepared for each PCR run. Amplification took place in a Biometra® TGradient

PCR thermocycler programmed with the following conditions: initial denaturing at 94°C

53

for 3 m, followed by 34 cycles of denaturing at 95°C for 1 m, annealing at 56°C for 45 s, and extension at 72°C for 90 s, and a final extension at 72°C for 10 m.

FIG. 4.1. Location of primers used in relation to fungal rDNA ITS gene region. Scale represents base pairs. Adapted from Martin and Rygiewicz (2005).

PCR products were run on a 1% w/v agarose gel at 95 V for approximately 30 m to confirm presence and purity of DNA amplicons. The gel was stained with 3 µL EtBr for a concentration of 7.5%. Each sample well contained 3 µL dd’H2O, 4 µL loading dye, and 3 µL PCR product (or dd’H2O instead of PCR product for the negative control). At least one lane per gel contained 5 µL of O’GeneRuler 100 bp ladder (Thermo Scientific,

Waltham, MA) to determine band size. PCR products of samples yielding visible DNA bands of the appropriate size were then shipped overnight to Génome Québec Innovation

Centre (McGill University) for Sanger sequencing in the forward direction using primer

ITS5.

54

Sequence identification was made using the NCBI Blast search engine (BLAST-

N), relying on ≥97% sequence identity to assign genus and/or species identification. The

Index Fungorum website (www.indexfungorum.org) was consulted to confirm current fungal taxonomy. All seven Trichoderma species used in this project were isolated from soil sample dilutions and identified in this manner.

Dual culture experiments

Cubes of medium with a 5 mm width were cut from the growing edge of seven day old cultures of each F. oxysporum f. sp. cepae and each of seven Trichoderma species isolated from local field soil, and were used to inoculate 8.5 cm Petri dishes containing PDA. FOC was isolated from an infected onion obtained from F3 in fall 2015.

Three of the Trichoderma species were also isolated from F3 soil (T. gamsii, T. hamatum,

T. harzianum), two were isolated from F2 (T. viride, T. viridescens), and one each were isolated from F1 (T. atroviride) and F4 (T. brevicompactum). Axenic cultures were grown in the dark to simulate the natural soil environment (Figures 4.2 and 4.3). A cube of FOC and a cube of a Trichoderma species were placed 2 cm from opposite edges of the plate (4.5 cm apart from each other), along the same diameter. Ten plates of each combination (FOC + Trichoderma sp.) were made in which the plates were simultaneously inoculated (Figure 4.4). Ten plates of each combination were additionally composed in which the Trichoderma species was added after 72 hrs to compensate for the faster growth rate of Trichoderma species compared to FOC (Figure 4.5). At least five control plates containing sole cultures of each of the fungal species were also observed.

55

Both control and dual cultures were incubated in the dark, at room temperature, for fourteen days.

FIG. 4.2. Axenic culture of 14-day Fusarium oxysporum f. sp. cepae (FOC) in an 8.5 cm Petri dish containing a standard PDA medium.

56

a b c

d e f

g

FIG. 4.3. Axenic 14-day cultures of each: a. Trichoderma atroviride, b. T. brevicompactum, c. T. gamsii, d. T. hamatum, e. T. harzianum, f. T. viride, and g. T. virdidescens, in 8.5 cm Petri dishes containing a standard PDA medium.

FIG. 4.4. Dual culture plate with simultaneous inoculation, at time of inoculation. Note placement of fungal cubes 4 cm apart along the diameter of the plate at 2 cm (FOC) and 6.5 cm (Trichoderma sp.) from the left edge.

57

FIG. 4.5. Dual culture plate (PDA) with delayed inoculation of Trichoderma, at time of Trichoderma inoculation, 48 hours post inoculation of FOC. Plate was photographed on a black background.

Radial fungal colony growth of both species in the direction of the opposite colony was measured daily for seven days, ensuring measurements up to the point that the Petri dish became filled with hyphal growth, and every second day until a final measurement at fourteen days. Depending on pattern of growth, once the species began to overlap measurements of radii became less precise. Macroscopic morphological observations were also recorded, including those indicating an interaction between species: formation of hyphal barrier (thickened mycelial growth between cultures), development of an inhibition zone (reduced mycelial growth between cultures), colour change, exudate production, overlapping growth. If it occurred, the number of days required for the Trichoderma species to produce spores was noted (along with location of spores, i.e. within exclusive Trichoderma growth or in area of overlapping growth), as well as if overgrowth the entire FOC colony occurred. Photographs of representative plates were taken during daily observations, and each plate was photographed at seven and fourteen days of growth.

58

Percent inhibition of radial growth (PIRG) was calculated after seven days growth

푅 − 푅 using Skidmore and Dickinson’s (1976) formula: 푃퐼푅퐺 = 1 2⁄ 푥 100 (Figure 푅1

4.6).

F F T

R1 R2

Control Dual culture FIG. 4.6. Measurement of radial growth (R) of F. oxysporum isolate (F) when grown in control plates and dual culture plates with a Trichoderma species (T). Figure adapted from Rahman et al. (2009).

Greenhouse bioassays to test biocontrol activity of locally isolated Trichoderma species

FOC was used to inoculate soil which was distributed into 15 cm pots, in which

‘Mountaineer’ onion seeds were germinated, grown, and evaluated for disease. A spore suspension of FOC was obtained as described in chapter 3. Bioassays testing local

Trichoderma species as biocontrol agents took place in the same Acadia phytotron as was used in FOC virulence assays; conditions remained the same: 27°C, 16 h photoperiod, and approximately 60% humidity. Pots were randomly distributed with 24 pots per bench, with approximately 5 cm between pots on a bench. All pots were watered daily using a watering can, using RO water, as needed.

In assay 4, a treatment using a strain of T. harzianum isolated from the F3 site in

2016 was tested. A T. harzianum spore suspension was prepared in the same manner as

FOC inoculant (both species grown for two weeks), and both were added at the potting stage: 1000 s/g FOC and 100 000 s/g T. harzianum. There were eighteen pots prepared per treatment condition. T. harzianum colony forming unit (cfu) density is typically very

59

high in commercial treatments, prompting the selection of a higher concentration of T. harizianum s/g. While much higher than the FOC concentration, the T. harzianum spore concentration used was approximately 2% of the cfu concentration that would be present in the recommended dose of Trianum for a treatment of 450 seedlings (25 seeds per pot x

18 pots).

In assay 5, T. atroviride, T. brevicompactum and T. viridescens were used to create spore suspensions and used as treatments in the same manner as T. harzianum in assay 4. These Trichoderma species were allowed to grow for four weeks yet still did not sporulate as profusely as T. harzianum in culture, thus spore suspensions were of lower concentrations: 10 000 s/g were used for both T. brevicompactum and T. viridescens, while 1000 s/g was used for T. atroviride. Again, eighteen pots were prepared per treatment. It was not possible to test T. gamsii, T. hamatum or T. viride in the method described above because these species did not sporulate profusely enough even given a growth time of six weeks.

Soil, onion seed, and equipment sterilization were as described in chapter 3 for virulence assays, as were size of pot and volume of soil added to each pot. Seeds were monitored daily for emergence, and then seedlings were observed daily for disease symptoms and survival over a four week period. Symptoms were also recorded as in virulence assays and pooled to create a variable reflecting the health of onion seedlings per pot (“onion health”). Observations were not blind to treatment; pots were labelled.

Data were analysed with R version 3.3.1and RStudio version 1.1.414. Symptoms were considered as proportional data (proportion of seedlings with symptoms per pot) on the final day of observations (day 28). Treatment conditions were compared to the FOC-

60

only condition. A general linear model was fit and estimates of fixed effects with P <

0.05 were considered significant.

Results

Isolation of fungi and DNA barcoding

DNA sequences of the ITS gene region were obtained for 130 isolates from soil samples taken from May to September 2016. All were identified at least to the family level, with all but twelve being identified to species (Table 4.1). An estimated 59 unique species were identified, belonging to twelve orders and eighteen families. All were species commonly isolated from soil. Although most isolates belonged to the phylum

Ascomycota, representatives from the phyla Zygomycota and Basidiomycota were also identified.

61

TABLE 4.1. Fungal isolates identifiable to species or unique genus from field soil listed by site, with accession number of best BLAST match, query cover, E value, and identity to that match. Fusarium species are marked by (*); Trichoderma species by (**). Duplicate species found within a site are not listed; alternate matches for duplicates not shown. Best hit Query cover E value Identity F1 Actinomucor elegans FJ176396 99% 0.0 99% Cladorrhinum bulbillosum KC254016 100% 0.0 99% * Fusarium commune KU891512 100% 0.0 100% * Fusarium equiseti KY945342 100% 0.0 100% * Fusarium oxysporum MH165246 100% 0.0 100% * Fusarium solani MH094663 100% 0.0 99% * Fusarium tricinctum MH071363 100% 0.0 99% Gibellulopsis nigrescens KX067810 100% 0.0 100% Monocillium mucidum MG826924 100% 0.0 100% Mortierella alpina MF939653 100% 0.0 99% Mortierella elongata KF944458 100% 0.0 99% Mortierella exigua JX975863 98% 0.0 100% Mucor circinelloides KR709187 100% 9e-57 100% Mucor moelleri KJ170313 100% 0.0 100% Penicillium canescens KY458474 100% 0.0 100% Penicillium simplicissimum MH161250 100% 0.0 100% Plectosphaerella cucumerina MH063755 100% 0.0 100% Rhizopus arrhizus KY260672 100% 0.0 100% ** Trichoderma atroviride MG980593 97% 0.0 100% ** Trichoderma gamsii KX343117 100% 0.0 100% ** Trichoderma harzianum MF326430 100% 0.0 100% F2 Apriotrichum laibachii KY101678 100% 0.0 100% Cladorrhinum sp. KU556533 100% 0.0 99% Epicoccum nigrum MF188976 100% 0.0 100% * Fusarium oxysporum MH171926 100% 0.0 100% * Fusarium solani KU712219 100% 0.0 100% Mortierella elongata MG052958 100% 0.0 99% Mortierella exigua JX975863 98% 0.0 100% Mucor circinelloides KX620480 100% 0.0 100% Mucor moelleri KJ170313 99% 0.0 100% Penicillium canescens KY458474 100% 0.0 100% ** Trichoderma harzianum MG572195 100% 0.0 100% ** Trichoderma viride KX379164 100% 0.0 100% ** Trichoderma viridescens KX357861 100% 0.0 100% F3 Apiotrichum dulcitum KY101666 100% 0.0 99% Gibellulopsis nigrescens KX067810 100% 0.0 99% Mortierella elongata FJ161928 100% 6e-155 100% Mucor moelleri KJ170313 99% 0.0 100% Mucor racemosus KT780848 98% 0.0 100% Paraphaeosphaeria sporulosa KY977581 100% 0.0 100% Penicillium brasilianum KY701767 100% 0.0 100% ** Trichoderma gamsii KX343117 100% 0.0 100% ** Trichoderma hamatum AB737864 100% 0.0 100% ** Trichoderma harzianum MG572195 100% 0.0 100% F4 Acrostalagmus luteoalbus MH063783 100% 0.0 100% Alternaria alternata MH221088 100% 0.0 100%

62

Apiotrichum dulcitum KY101666 100% 0.0 100% Arthrobotrys oligosporus MF926586 100% 0.0 99% Cladosporium cladosporioides MH169187 100% 0.0 100% * Fusarium avenaceum KU891560 100% 0.0 100% * Fusarium equiseti KY945342 100% 0.0 100% * Fusarium oxysporum KY798173 100% 0.0 100% Humicola grisea KU705826 100% 0.0 100% Lectera colletotrichoides JQ647428 100% 0.0 100% Mortierella elongata KP772743 100% 0.0 99% Mortierella sarnyensis KU578332 100% 0.0 100% Mucor circinelloides KX620480 100% 0.0 100% Mucor hiemalis MF355385 100% 0.0 100% Penicillium simplicissimum HQ839780 100% 0.0 100% Pleactosphaerella cucumerina MH063755 100% 0.0 100% Trichocladium asperum HQ115689 100% 0.0 100% ** Trichoderma brevicompactum KY750447 100% 0.0 100% F6 Apiotrichum laibachii KY101678 100% 0.0 100% Cladosporium sp. KJ598873 100% 0.0 99% * Fusarium cerealis MG979797 98% 0.0 99% * Fusarium equiseti KU891570 100% 0.0 99% * Fusarium oxysporum KY798173 100% 0.0 100% Mortierella hyalina AY157495 100% 0.0 99% Mucor circinelloides KX620480 100% 0.0 100% Pseudaleuria sp. HG936846 100% 0.0 99% Pseudopithomyces chartarum MF374508 100% 0.0 100% ** Trichoderma hamatum MF120526 100% 0.0 100%

Sixteen isolates belonged to the genus Trichoderma; at least one isolate of each of the following seven species was obtained: T. atroviride, T. brevicompactum, T. gamsii, T. hamatum, T. harzianum, T. viride, and T. viridescens. At least one Trichoderma species was present in soil from each field site. There is some uncertainty in the species assignment of T. viridescens and T. brevicompactum as per current sequences available on Genbank, but I chosen to retain the T. viridescens and T. brevicompactum names here for internal consistency, as these were the most confident species assignments upon initial analyses and there is not sufficient data to warrant new species assignments. There are currently also high accuracy matches to T. koningiopsis on Genbank for the isolate named within as T. viridescens and to T. arundinaceum for T. brevicompactum.

63

There were six isolates identified as F. oxysporum from soil, however no assumption should be made about pathogenicity toward onions or other crop plants for isolates from soil. F. oxysporum was identified in soil from each field site except for F3.

F. commune, F. equiseti, F. tricinctum, and F. solani were identified in soil from site F1,

F. solani was identified from site F2, not Fusarium species were present in soil from site

F3, F. avenaceum and F. equiseti were identified from site F4, and F. cerealis and F. equiseti were identified from site F6.

Dual culture experiments

All species (both FOC and Trichoderma spp.) were observed to conform to one of two culture morphologies: dense hyphae reaching to the edge of growth (e.g. FOC in

Figure 3.3a, T. atroviride in Figure 4.3a); or growth extremities consisting of hyaline, non-aerial hyphae, and eventually less prolific sporulation (e.g. FOC in Figure 3.3b, T. viride in Figure 4.3f). Trichoderma species also displayed more intense green colour at two weeks in plates not showing the ‘hyaline ring’ morphology, suggesting more prolific sporulation. However, due to the relatively small number of plates produced for each condition, and the observation of some macromorphological interaction between FOC and each Trichoderma species in dual culture plates regardless of growth forms for each condition (simultaneous and delayed inoculation of Trichoderma species), growth forms were not considered separately for analyses.

Although ten plates were produced for each dual culture condition, the T. viride delayed inoculation condition had nine plates considered in analyses due to disturbance of fungal growth in a single plate, and the T. atroviride delayed inoculation condition

64

consisted of only five plates due to a planning error. Counts of instances of each interaction among the ten plates are shown in Table 4.2. There were some differences in how specific interactions presented themselves depending on the Trichoderma species; they have been grouped into general categories for the purposes of the table but are described below in further detail.

We suggest that when interpreting the table, that ‘Trichoderma fills plate, including over FOC’ is the result that most obviously demonstrates that the Trichoderma species has outcompeted FOC.

65

TABLE 4.2. Morphological observations of dual culture plates, given in percentage of plates in which each observation was present, on the first day it was noted, and after one and two weeks of dual culture growth. Condition, encompassing the Trichoderma species which was in dual culture with FOC, and timing of inoculation (same time as FOC, or after 48 hours of FOC growth [delayed]) is given. Ten plates were assessed for each combination of Trichoderma species and inoculation timing, excepting ‘T. viride delayed’ (nine plates) and ‘T. atroviride delayed’ (five plates). Trichoderma species Inoculation Observation Day first % of plates Day 7 % of Day 14 % timing observed on first day plates of plates T. atroviride Simultaneous Cultures meet 2 100 100 100 Hyphal barrier (HB) 3 50 100 100 Trichoderma growth on FOC other than HB 4 70 70 70 FOC growth directed away from Trichoderma 4 70 - - FOC abnormal reverse pigmentation 6 10 40 70 Trichoderma fills plate, including over FOC 6 10 30 40 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 7 30 30 30 Trichoderma sporulation on FOC 10 10 - 30 T. atroviride Delayed Cultures meet 2 100 100 100 Hyphal barrier (HB) 3 60 80 100 Trichoderma growth on FOC other than HB 4 40 80 80 FOC growth directed away from Trichoderma 2 80 - - FOC abnormal reverse pigmentation 5 20 40 60 Trichoderma fills plate, including over FOC 8 20 - 20 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 2 80 80 80 Trichoderma sporulation on FOC 7 20 20 80 T. brevicompactum Simultaneous Cultures meet 3 90 100 100 Hyphal barrier (HB) 4 60 60 70 Trichoderma growth on FOC other than HB 5 20 30 60 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation - - - - Trichoderma fills plate, including over FOC 10 10 - 30 Present/effective inhibition zone 4 20/20 70/60 90/30 FOC increased exudation 4 20 60 80 Trichoderma sporulation 4 70 90 90

Trichoderma sporulation on FOC 10 50 - 50 T. brevicompactum Delayed Cultures meet 3 100 100 100 Hyphal barrier (HB) 4 90 90 70 Trichoderma growth on FOC other than HB 8 10 - 50 FOC growth directed away from Trichoderma 3 10 20 30 FOC abnormal reverse pigmentation - - - - Trichoderma fills plate, including over FOC - - - - Present/effective inhibition zone 4 60/60 40/30 40/40 FOC increased exudation 5 10 80 60 Trichoderma sporulation 4 20 60 90 Trichoderma sporulation on FOC 8 10 - 50 T. gamsii Simultaneous Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 90 100 100 Trichoderma growth on FOC other than HB 4 20 70 90 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 6 30 60 60 Trichoderma fills plate, including over FOC 6 10 70 90 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation - - - - Trichoderma sporulation on FOC - - - - T. gamsii Delayed Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 100 100 100 Trichoderma growth on FOC other than HB 4 20 80 90 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 7 80 80 90 Trichoderma fills plate, including over FOC 6 10 20 90 Present/effective inhibition zone - - - - FOC increased exudation 5 80 80 90 Trichoderma sporulation 12 10 - 20 Trichoderma sporulation on FOC - - - - T. hamatum Simultaneous Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 50 100 100 Trichoderma growth on FOC other than HB 6 20 50 100 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 5 10 20 50 Trichoderma fills plate, including over FOC 8 40 - 80

Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 6 10 40 100 Trichoderma sporulation on FOC 10 50 - 80 T. hamatum Delayed Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 100 100 100 Trichoderma growth on FOC other than HB 5 10 10 40 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 6 10 50 70 Trichoderma fills plate, including over FOC 11 10 - 40 Present/effective inhibition zone - - - - FOC increased exudation 70 Trichoderma sporulation 7 10 10 40 Trichoderma sporulation on FOC 9 10 - 30 T. harzianum Simultaneous Cultures meet 3 90 100 100 Hyphal barrier (HB) 4 90 100 100 Trichoderma growth on FOC other than HB 5 50 70 100 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 10 20 - 40 Trichoderma fills plate, including over FOC 8 20 - 50 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 3 20 90 100 Trichoderma sporulation on FOC 5 50 60 80 T. harzianum Delayed Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 70 100 100 Trichoderma growth on FOC other than HB 6 20 50 100 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 6 10 40 40 Trichoderma fills plate, including over FOC 14 20 - 20 Present/effective inhibition zone - - - - FOC increased exudation 5 80 100 100 Trichoderma sporulation 3 30 80 100 Trichoderma sporulation on FOC 6 20 40 80 T. viride Simultaneous Cultures meet 3 100 100 100 Hyphal barrier (HB) 3 70 80 60 Trichoderma growth on FOC other than HB 5 20 30 40

FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 5 40 40 40 Trichoderma fills plate, including over FOC 7 10 10 40 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 14 10 - 10 Trichoderma sporulation on FOC 14 10 - 10 T. viride Delayed Cultures meet 2 60 100 100 Hyphal barrier (HB) 3 80 80 80 Trichoderma growth on FOC other than HB 4 10 60 60 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 4 10 70 80 Trichoderma fills plate, including over FOC 14 20 - 20 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation - - - - Trichoderma sporulation on FOC - - - - T. viridescens Simultaneous Cultures meet 3 100 100 100 Hyphal barrier (HB) 4 100 100 100 Trichoderma growth on FOC other than HB 6 30 40 40 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 6 50 50 60 Trichoderma fills plate, including over FOC 7 20 20 40 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 6 10 20 60 Trichoderma sporulation on FOC 11 10 - 20 T. viridescens Delayed Cultures meet 2 10 100 100 Hyphal barrier (HB) 3 20 30 30 Trichoderma growth on FOC other than HB 6 10 20 20 FOC growth directed away from Trichoderma - - - - FOC abnormal reverse pigmentation 5 10 20 20 Trichoderma fills plate, including over FOC 8 10 - 20 Present/effective inhibition zone - - - - FOC increased exudation - - - - Trichoderma sporulation 12 20 - 30 Trichoderma sporulation on FOC 14 10 - 10

The observation that FOC stopped growth when it came into contact with

Trichoderma was observed in all dual culture conditions and thus was not included in

Table 10. This observation was informed by visual evaluation as well as daily measurements of growth. Stopped growth was most easily observed along the diameter bisecting where the plate was inoculated with the two species, as this was the first point of contact. It was also noted by visual observation that the growth rate of FOC slowed after this time and stopped in all directions when it was surrounded by Trichoderma. This occurred in all plates which experienced simultaneous inoculation, but it was not a reasonable observation to make in many of the delayed inoculation plates as the species produced cultures of similar sizes.

Photographs at fourteen days post inoculation of the Trichoderma species are shown (Figures 4.7-4.8). Note that in all dual culture photographs showing the “top”, or side of the plate with exposed fungal hyphae, FOC is the left-hand culture within the plate; conversely, when the photograph is of the reverse side of the plate, FOC appears on the right-hand side.

Trichoderma growth overlapping onto the FOC culture (beyond a hyphal barrier, if present) was often difficult to assess: both species produce white, floccose, aerial growth, and FOC seemed to produce more dense hyphae in some instance which could be confused for overgrowth by Trichoderma. Nevertheless, efforts were made to be as accurate as possible, although erring on the side of caution. The reverse pigmentation of

FOC was used, if possible, to assist in informing a judgement of overgrowth, as in many cases FOC showed darkened reverse pigmentation in response to overgrowth by

Trichoderma. This was not present in all cases, however. Overgrowth could be

70

confidently identified once Trichoderma produced spore bearing structures, or spores on

FOC, as the macromorphology of both these structures differs from that of FOC (e.g. spores of Trichoderma species are green) (Figures 4.7b, g, j, l, n, p; 4.8a, c, g, i, l, o). The measure of ‘Trichoderma fills plate, including over FOC’ was considered to have occurred if Trichoderma growth was evident surrounding and throughout >50% of the

FOC culture (Figures 4.7b, g, j, n, p; 4.8o).

FOC reverse pigmentation was often affected by dual culture with Trichoderma.

The strain of FOC used has a pale peachy-pink to orange reverse pigmentation when grown alone on PDA, which deepens in colour with age. The pattern of change in FOC reverse pigmentation was dependent on Trichoderma species, timing of inoculation, and growth form of the two species. The most prominent and common changes are considered here.

FOC grown in dual culture with T. atroviride from simultaneous inoculation developed a pink-orange-brown patch within the borders of FOC, on the side opposite from T. atroviride, and a deepened yellow-orange hue where the hyphal barrier formed, as well as at the initial point of inoculation (Figure 4.7c). FOC grown in dual culture with

T. atroviride from delayed inoculation of T. atroviride developed a darkened orange- brown “frontline” within FOC that could be interpreted as the leading edge of T. atroviride growth overlapping into the FOC culture (although faintly visible in Figure

4.8b, this pigmentation was more diffuse on day fourteen, on which all pictures included in Figure 4.8 were taken, than when first developing). This interpretation was supported by later sporulation of T. atroviride within FOC culture that developed this reverse pigmentation (Figure 4.8a).

71

FOC in dual culture plates prepared with T. brevicompactum did not display any altered reverse pigmentation in comparison to FOC grown in isolation. Although some pink-orange colouring was seen, and it did deepen throughout the course of the experiment, it was not visually judged to be significantly different than the colour of control plates.

In plates simultaneously inoculated with T. gamsii, FOC reverse pigmentation was a deep pink-orange to brown (Figure 4.7h); in most cases this pigmentation was concentrated around the initial inoculation point of FOC, but in some cases, it was associated with the hyphal barrier. FOC grown in dual culture with T. gamsii in the delayed inoculation condition developed either a bright to deep yellow reverse pigment within FOC, opposite from T. gamsii and behind the hyphal barrier, or a pink-orange pigment where the hyphal barrier formed (Figure 4.8e).

Dual culture plates containing T. hamatum added in a simultaneous inoculation resulted in FOC developing a yellow-orange or pink-orange reverse pigment between the hyphal barrier and initial inoculation point of FOC, and in some cases an intense darkening of FOC at the inoculation point, to a dark brown to black colour (Figure 4.7k).

Plates which experienced a delayed inoculation of T. hamatum displayed FOC with either a peachy orange colour associated with the hyphal barrier, or an vibrant peachy-red reverse pigment centred around the inoculation point, which spread to encompass most of the FOC culture by the end of the experiment and darkened to a deep orange-brown or red-brown (Figure 4.8j).

FOC grown in dual culture with T. harzianum from simultaneous inoculation developed a slightly deeper yellow reverse pigment than would be expected from FOC

72

not grown in dual culture (Figure 4.7m). Some plates which experienced delayed inoculation of T. harzianum displayed a similar slightly deeper yellow reverse pigment, while some displayed a more extensive darkened area centered around the inoculation point, which grew to encompass approximately half of the culture by the end of the experiment and developed a deep pink-orange to brown colour (Figure 4.8j).

FOC in dual culture plates prepared with T. viride displayed a bright to deep yellow reverse pigment associated with the hyphal barrier, that extended most of the way into FOC by the end of the experiment in some cases, and further darkened to a deep orange hue (Figure 4.7o). T. viride dual culture plates displayed two main changes in

FOC reverse pigment: a peachy pink pigmented hyphal barrier, or a bright to deep yellow hyphal barrier with the colour increasingly extending into FOC with time. In a subsect of plates which displayed the yellow hyphal barrier, the colour darkened to a deep brown in a thin line within the hyphal barrier (Figure 4.8m).

Several patterns of reverse pigmentations were observed in dual culture plates containing T. viridescens added in a simultaneous inoculation resulted in FOC: a deepened peachy pink colour or a darker orange colour associated with the hyphal barrier, a deep yellow to peachy orange colour throughout the FOC culture, and/or a patch of growth pigmented dark orange to brown concentrated in FOC opposite T. viridescens, behind the inoculation point of FOC. Both the deep peachy yellow throughout and patch of dark orange brown within FOC are evident in Figure 4.7q. Plates which experiences a delayed inoculation of T. viridescens displayed FOC with a slightly deeper yellow to peach colour than would be considered normal outside of dual culture,

73

with one plate showing darker orange-brown in a pattern suggesting the extent of growth of T. viridescens (Figure 4.8p).

Hyphal barrier morphology also differed depending on the Trichoderma species used in dual culture, timing of inoculation, and growth forms. The hyphal barrier formed between FOC and T. atroviride grown from either inoculation condition was a bright white barrier at the extremity of FOC growth measuring 1-4 mm, with changes in reverse pigmentation as described above, as the experiment progressed. This barrier was visible from both the top and reverse of the plate before sporulation of T. atroviride (Figures

4.7a,c, 4.8a-b).

Dual culture of FOC and T. brevicompactum from simultaneous inoculation resulted in a thin hyphal barrier (1-2 mm) at the extremity of FOC growth. This was best viewed from the reverse of the plate (Figure 4.7f). Hyphal barrier from a delayed inoculation of T. brevicompactum was similar, sometimes with a thicker, opaquer barrier

(3-5 mm) in which the texture of hyphae was no longer evident. Again, the hyphal barrier was most easily viewed from the reverse of the plate.

The hyphal barrier formed between FOC and T. gamsii from simultaneous inoculation was often very thick (5-6 mm) by the end of the experiment although remained thin in some instances (1-2 mm) (Figure 4.7h-i). In the delayed inoculation condition, there was much variation in morphology of hyphal barrier between T. gamsii and FOC: distinct, dense, bright white barriers in otherwise sparse hyphae (2-3 mm); thick (3-6 mm), opaque barriers among dense hyphae; and thick barriers which retained obvious filiform hyphae (faintly visible in Figure 4.8e).

74

T. hamatum grown in dual culture from simultaneous inoculation as well as from delayed inoculation with FOC resulted in a thin (1-3 mm) bright white hyphal barrier that maintained obvious filiform hyphal morphology (Figures 4.7k, 4.8f,h). Some hyphal barriers in both inoculation conditions with T. harzianum were like those described with

T. hamatum, but some were thicker (3-7 mm), more opaque barriers (Figures 4.7l-m,

4.8j-k).

Dual culture of FOC and T. viride from simultaneous inoculation resulted in a thin

(1-3 mm) hyphal barrier with visible individual hyphae (Figure 4.7o). This type of barrier was also seen in the delayed inoculation conditions although thicker in some instances

(Figure 4.8l-m), and two additional alternate morphologies occurred: a dense, thicker (4-9 mm) barrier with no obvious hyphae texture (Figure 4.8n); and a gradual increase in hyphal density observed later in the assay where hyphae overlapped. This gradual increase was not a hyphal barrier in the same aspect as all other described here; as it may have simply reflected increased growth of both species without any specific interaction between the two.

Between FOC and T. viridescens cultures for both inoculation conditions, hyphal barriers were like those described between FOC and T. viride (Figures 4.7q, 4.8p), excepting the ‘gradual increase in hyphal density’ type barrier, and the thick type barrier being slightly thinner (3-7 mm).

Other observed interactions were: directional growth of FOC away from the growing edge of the Trichoderma species, exclusively observed in dual culture plates of

FOC and T. atroviride (Figure 4.7a) or T. brevicompactum; an inhibition zone, only unmistakably observed between FOC and T. brevicompactum (Figures 4.7d-e, 4.8c); and

75

increased production of exudates by FOC, observed in dual culture plates involving several of the Trichoderma species and shown in detail in Figure 4.7e.

76

a b c

d e f

g h i

j k l

77

m n o

p q

FIG. 4.7. Dual culture plates at fourteen days growth of FOC and Trichoderma species from simultaneous inoculation, on a PDA medium in 8.5 cm Petri dishes. Photographs were selected to show the range of interactions specific to each dual culture species pair. The Trichoderma species are: a-c. T. atroviride; d-f. T. brevicompactum; g-i. T. gamsii; j- k. T. hamatum; l-m. T. harzianum; n-o. T. viride; p-q. T. viridescens.

78

a b c

d e

f g h

i j k

79

l m n

o p

FIG. 4.8. Dual culture plates at sixteen days growth of FOC and fourteen days growth of Trichodermas from delayed inoculation, on PDA. The Trichoderma species are: a-b. T. atroviride; c. T. brevicompactum; d-e. T. gamsii; f-h. T. hamatum; i-k. T. harzianum; l-n. T. viride; o-p. T. viridescens.

80

Radial growth of FOC toward the centre of the plate (R1) after seven days was determined to be 35.4 mm when all observations of FOC grown alone were averaged.

Percent inhibition of growth by Trichoderma species on FOC after seven days of growth when plates were simultaneously inoculated with both species was determined to exist in a range of 57-76% (Figure 4.9, Table 4.3). The greatest percent inhibition of FOC growth was caused by T. gamsii, while the least was caused by T. brevicompactum.

In the delayed inoculation condition, percent inhibition values ranged from 26% to 52%; T. gamsii, T. hamatum, and T. harzianum caused the most percent inhibition of growth of FOC, while T. atroviride caused the least (Figure 4.10, Table 4.3). T. gamsii consistently inhibited a relatively high percent of FOC growth regardless of inoculation timing, while T. brevicompactum inhibited relatively low percentages of FOC growth regardless of inoculation timing.

81

FIG. 4.9. Mean radial growth per hour of FOC along the central plane of ten 8.5 cm Petri dishes when grown alone (Trichoderma present: none) and mean radial growth per hour of FOC cultures grown in ten dual culture plates of each condition, (simultaneous inoculation with each of one of seven Trichoderma species,) measured along the diameter bisecting between the two species. Vertical line is at hour 60, or 2.5 days, approximately when cultures met in dual culture plates. Dual culture measurements involving T. gamsii, T. hamatum and T. harzianum were taken for seven days (~168 h) while remaining measurements were taken for fourteen days (~336 h). Shading shows standard error for each curve.

82

FIG. 4.10. Mean radial growth per hour of FOC along the central plane of ten 8.5 cm Petri dish when grown alone (Trichoderma present: none) and mean radial growth per hour of FOC cultures grown in ten dual culture plates of each condition, (inoculation with each of one of seven Trichoderma species two days after establishment of FOC,) measured along the diameter bisecting between the two species. Vertical line is at hour 60, or 2.5 days, approximately when cultures met in dual culture plates. Dual culture measurements involving T. gamsii, T. hamatum and T. harzianum were taken for seven days (~168 h) while remaining measurements were taken for fourteen days (~336 h). Shading shows standard error for each curve.

83

TABLE 4.3. Percent growth inhibition of FOC by seven Trichoderma species in two inoculation conditions: Trichoderma added simultaneously with FOC, or after 48 h growth of FOC (delayed). Number of plates assessed for each state also shown. Repeats Inoculation condition Trichoderma species Percent growth inhibition 10 Simultaneous T. atroviride 64% 10 Simultaneous T. brevicompactum 57% 10 Simultaneous T. gamsii 76% 10 Simultaneous T. hamatum 71% 10 Simultaneous T. harzianum 68% 10 Simultaneous T. viride 65% 10 Simultaneous T. viridescens 69% 5 Delayed T. atroviride 26% 10 Delayed T. brevicompactum 31% 10 Delayed T. gamsii 52% 10 Delayed T. hamatum 51% 10 Delayed T. harzianum 51% 9 Delayed T. viride 40% 10 Delayed T. viridescens 38%

Greenhouse bioassays to test biocontrol activity of locally isolated Trichoderma species

Because T. harzianum was tested in assay 4, while T. atroviride, T. brevicompactum, and T. viridescens were tested in assay 5, their results are shown separately for accurate comparison to the FOC-only treatment, which varied between these two assays (see chapter 3). Average onion health was higher throughout the four week assay for pots treated with T. harzianum and T.atroviride but was not as high as pots in the control treatment, (no FOC) (Figures 4.11-4.12). Pots which received the T. viride treatment initially had higher health than those in the FOC-only condition, and it appeared that this treatment might be the most effective, but health level fell starting at approximately day fifteen and became comparable to that of pots in the FOC-only condition. Average onion health was lower in pots which received the T. brevicompactum treatment that in pots with only FOC added, throughout the assay.

84

Proportion of asymptomatic seedlings was significantly higher than the FOC-only condition for pots in their respective assays for pots treated with both T. harzianum (P =

1.16 x 10-8) and T. atroviride (P = 0.0001). There was no significant effect of treatment using either T. brevicompactum or T. viridescens.

FIG. 4.11. Mean health of each eighteen pots sown with 25 onions seedlings for control treatment (0 s/g FOC; 0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment (0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment with 100 000 s/g T. harzianum added. Mean health shown per day, from emergence to 28 days post-sowing. Shading shows standard error for each curve.

85

FIG. 4.12. Mean health of each eighteen pots sown with 25 onions seedlings for control treatment (0 s/g FOC; 0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment (0 s/g Trichoderma), vs. 1000 s/g FOC inoculation treatment with 1000 s/g T. atroviride added, vs. 1000 s/g FOC inoculation treatment with 10 000 s/g T. brevicompactum added, vs. 1000 s/g FOC inoculation treatment with 10 000 s/g T. viridescens added. Mean health shown per day, from emergence to 28 days post-sowing. Shading shows standard error for each curve.

86

Discussion

All fungal genera identified in table 4.1 are abundant, widespread soil-dwelling species that were not unexpected finds. Although certain species are not commonly associated with Nova Scotia, or even North America, there is not enough research characterizing fungal soil communities to attach great meaning to an absence of information linking any specific fungal species to certain locations. Further characterization of fungal soil communities, especially in agricultural soils, as well as improvement of fungal identification when publishing DNA sequences in Genbank, would allow for better interpretation of the whether any assemblage of species is

‘normal’ from a certain soil sample.

The species identified were also intrinsically linked to the methods of culture isolation. Fast-growing species in the presence of abundant, easily accessible nutrients would have been highly favoured on the PDA medium plates. While use of DPYA medium was additionally employed to encourage growth of alternate fungal species to

PDA, more rapidly growing species still impeded the isolation of slower growing species, and this was the only other medium type used for isolations. Other media, along with a range of different incubation conditions, would potentially have encouraged the growth of many more fungal species. For these reasons (lack of knowledge of fungal community characteristics in local agricultural soils and limited isolation techniques) we suggest that the species identified do not reflect overall community assemblages in terms of either composition or relative abundance, nor do they accurately reflect differences between sites.

87

The methods used were successful, however, in isolating and identifying

Trichoderma species in soil samples from all sites. All Trichoderma species found have been demonstrated as successful biocontrol agents in at least one crop system or have been linked to biocontrol applications. T. atroviride has been used as a source for creation of transgenic apples resistance to apple scab (note the fungal strain in the cited research has since been re-identified as T. atroviride) (Bolar et al., 2000). T. brevicompactum may inhibit growth of some pathogens of grapevine (Gräfenhan, 2006), T. viridescens is mycoparasitic to cacao plant pathogens (Cuervo-Parra et al., 2014), while T. hamatum and T. gamsii are antagonists of F. graminrearum (Hajighrari et al., 2008; Matarese et al.,

2012). T. harzianum and T. viride have been widely researched as biocontrol agents of many fungal plant pathogens (Cherif and Benhamou, 1990; Dubey et al., 2007; John et al., 2010; Perveen at al., 2012).

All dual culture plates were observed to show some signs of antagonism between the Trichoderma species and FOC. The most common interaction was the formation of a hyphal barrier between species. Research of T. harzianum as a biocontrol agent against

Sclerotinia sclerotiorum showed that T. harzianum formed the hyphal barrier and parasitized S. sclerotiorum when growth began to overlap, with T. harzianum eventually growing beyond the hyphal barrier and overlap and overgrowing S. sclerotiorum

(Abdullah et al., 2008). Other observed interactions have also been previously noted in dual culture assays involving plant pathogenic fungi: inhibition zones, abnormal pigments and/or exudate production have been interpreted as signs of antagonism and support the use Trichoderma species as a biocontrol agent for FOC (Badalyan et al.,

2002; Hajieghrari et al., 2008).

88

Our growth measurement results also agree with those found in other research. T. viride and T. harzianum were found to inhibit growth of F. oxysporum f. sp. ciceris in dual culture experiments, although the results varied dependent on strain of each

Trichoderma species used (Dubey et al., 2007). This suggests that further analysis of the strain of each Trichoderma species may be of use; only one strain was chosen of each species, but multiple isolates of T. gamsii, T. hamatum, and T. harzianum were recovered from local soil samples. It is possible that further analyses would reveal these isolates as different strains with varying biocontrol efficacies, or that additional useful strains of any of the Trichoderma species may be present in local soil that remain undiscovered.

Use of percent inhibition of growth calculations are typical in dual culture experiments, including those specific to Trichoderma and FOC, and other Fusarium species. Coşkuntuna and Özer (2008) found T. harzianum to inhibit growth of FOC by

73% and found T. harizianum to be equally as effective as prochloraz, a wide-spectrum chemical fungicide, in growth chamber and field trials. This supports the conclusion that percent inhibition of growth of at least 73% is correlated to a decrease in FBR symptoms in bulbs grown in a natural system.

Other studies have found comparable results. All strains of T. harizianum and T. viride tested inhibited relative growth of FOC in dual culture trials measuring percent inhibition; the greatest values for each strain were 79% (T. viride) and 83% (T. harzianum), although values were much lower for some other strains tested: as low as

29% and 24% for T. viride and T. harzianum, respectively (Malathi and Mohan, 2011).

Dubey et al., (2007) also found isolates of both T. viride and T. harzianum to result in growth inhibition of F. oxysporum: the greatest percent inhibition at six days were just

89

above 60% for both T. viride and T. harzianum, which correlated to increased seed germination and plant growth, and decreased incidence of wilt symptoms in F. oxysporum infected plants treated with these isolates. Hajieghrari et al., (2008) found T. harzianum and T. hamatum to be most effective at inhibiting growth of F. graminearum, at approximately 68 and 70% inhibition, respectively.

I found the greatest percent inhibition of FOC growth to be caused by T. gamsii at

76%. Using a cut-off of 60%, (considering values presented in other studies,) the dual culture trials with simultaneous inoculation support the conclusion that all Trichoderma species tested, excepting T. brevicompactum, may be effective biocontrol agents of FOC.

Dual culture trials in which the addition of the Trichoderma species was delayed support the results from the simultaneous inoculation test. The delayed inoculation condition aims to simulate a natural environment where FOC is established prior to the addition of a

Trichoderma biocontrol.

I do consider percent inhibition of growth tests limited, however, at least in this case, because the Trichoderma species generally also halted radial growth toward the centre of the plate upon contact with FOC; thus, the reverse calculations (percent inhibition of Trichoderma by FOC) would yield results that would suggest that FOC inhibits Trichoderma. There were no instances, however, in which FOC grew over the

Trichoderma, while the revere did occur, thus the percent inhibition value is still useful.

Additionally, percent inhibition between the Trichoderma species may reflect the relative speed at which each Trichoderma species grew in relation to FOC, since growth was not inhibited before contact was made, or was only slightly inhibited. Although divergence in radial growth is seen in Figures 4.7-4.8 prior to physical contact between

90

the species, the radial growth curve of FOC (and Trichoderma species) displays average growth measurements, which introduces some error when comparing to Trichoderma growth curves, as all dual culture trials did not occur at the same time so there may have been minor differences in growth conditions. Our results would be better supported by additional assays to increase the number of repetitions; conclusions made from ten plates prepared for each condition are made cautiously.

Previous research also illuminates the mode of antagonism by which Trichoderma species act upon Fusarium species, although there is some variation that may depend on species and strain of each Trichoderma and Fusarium. Hyphae of T. harzianum and T. viride have been observed to physically coil around the hyphae of F. oxysporum, but to penetrate infrequently (Dubey et al., 2007; John et al., 2010). Other dual culture studies have determined that T. harzianum and T. viride produce volatile metabolites that inhibit

F. oxysporum growth (Perveen and Bokhari, 2012). Research has also shown that T. harzianum produces chitinases and β-1,3-glucanases that break down cell wall chitin in pathogenic F. oxysporum f. sp. radices-lycopersici (Cherif and Benhamou, 1990).

Inhibition of FOC growth was observed only once cultures of FOC and

Trichoderma physically met, thus my results only correspond with observation of physical interference of F. oxysporum hyphae by Trichoderma. Observation of the interaction zone of dual culture plates under magnification (40X observation of hyphae both in the plate without disturbing the fungi or media, and in slides created from carefully excising hyphae from the interaction zone) did not reveal any obvious physical interactions such as coiling or penetration of hyphae. Thus, I do not speculate on the specific mode of action of the Trichoderma species tested. The use of dual culture slides

91

may facilitate better observation of physical interactions of the hyphae, in which the dual culture methods are replicated at a smaller scale on a microscope slide covered in a thin layer of nutrient agar medium (as implemented by Hajieghrari et al., 2008), or a microscope slide is incorporated into the medium in a Petri dish such as described in Bhat

(2017). These methods have proven effective at observing the mycelial interaction between Trichoderma and Fusarium species (Bhat, 2017; Hajighrari et al., 2008).

The two different growth forms observed in all species warrant further investigation. Although antagonistic interactions were observed in at least some plates regardless of growth form, plates experiencing growth with hyaline extremities (the

“hyaline ring” growth form) had fewer instances of these interactions. It does not appear that this is an induced defense mechanism by FOC, however, as both growth forms were observed in a similar proportion to that observed in dual culture, when both FOC and

Trichoderma were grown separately.

As mentioned in chapter 3 regarding FOC, it is thought that the hyaline ring growth forms reflect degenerate cultural variants, which is likely also the case when observed in Trichoderma species (Burgess et al., 1994). Degenerate cultural variants of pathogenic species are often avirulent, which would explain the fewer instances of interactions between species in plates with this growth form. As in FOC, this growth form is intermediate between the pionnotal and mycelial types described in Burgess et al.,

(1994) when observed in the Trichoderma species.

It is curious that the hyaline ring growth form always occurred in both or neither species when grown in dual culture; this behaviour has not previously been noted for

FOC and Trichoderma in dual culture experiments. Further research correlating growth

92

form observed in cultures grown on media to antagonism in a soil environment, virulence in A. cepa, and method to induce growth form would allow for more accurate assessment of dual culture assays.

Results from the greenhouse bioassays also support previous research. Inoculation using T. harzianum and T. atroviride as treatments against FOC-cause rot both provided improved outcomes of health when compared to the 1000 s/g condition that did not receive a Trichoderma treatment. Coşkuntuna and Özer (2008), also demonstrated that T. harzianum reduced FBR symptoms in onions grown in pots in controlled, indoor conditions. While not yet tested on FBR in onion in other greenhouse research, T. atroviride decreases Fusarium wilt symptoms in chickpeas and increases vegetal growth in greenhouse experiments (Boureghda and Bouznad, 2009). This type of research is important to repeat using additional strains of FOC along with multiple species and/or strains of Trichoderma, however, due to the variable nature of virulence in FOC (Cramer,

2000; Taylor et al., 2013), efficacy of Trichodermas as biocontrol agents, and interactions between the two. It is unknown whether multiple strains of FOC are present in the

Annapolis Valley. Concurrent research at Acadia University is focussed on determining if the additional F. oxysporum isolates mentioned in chapter 3 represent unique FOC strains.

For example, neither T. brevicompactum or T. viridescens isolates from local soils decreased FBR symptoms in the greenhouse assay. There are a few reasons why this might be the case: these species are truly inefficient in the biocontrol of FBR symptoms caused by FOC, or too low a concentration of colony forming units were present in the treatments. Neither T. brevicompactum nor T. viridescens appear as frequently in the

93

literature exploring Trichoderma species as biocontrol options for Fusarium species as often as T. harzianum. Nevertheless, both species have been tested for antagonism against Fusarium species.

T. brevicompactum has been reported to have only low to moderate antifungal activity, growth inhibition, and reductive effect on disease incidence toward F. oxysporum (Ommati and Zaker, 2012a; Shentu et al., 2014). Experiments generally test several Trichoderma species and strains as potential biocontrol antagonists, and T. brevicompactum has not been determined to be the most effective against F. oxysporum in any trial. Application of T. brevicompactum results in reduced disease incidence when tested against F. solani, however, so may be worth further investigation as part of comprehensive control strategy if it were determined that F. solani contributes to the incidence of FBR symptoms in onion in the Annapolis Valley (Ommati and Zaker,

2012b).

T. viridescens, has not been much researched regarding biocontrol of pathogenic

Fusarium species. It is closely related to T. viride, however; various studies have found T. viride to inhibit growth of F. oxysporum in dual culture tests, and to result in larger and more productive plants infected with F. oxysporum (Dubey et al., 2007; John at el., 2010;

Perveen and Bokhari, 2012). These studies have found T. viride to be one of or the most effective Trichoderma isolate of those tested, however, the crop species in question were chickpea, soybean, and date palm, respectively. Results concerning FOC have also been positive: some strains of T. viride resulted in relatively high inhibition of FOC in dual culture, although not as high as T. harzianum (Malathi and Mohan, 2011).

94

Although the research for T. viride is encouraging, it is unclear how transferable, if at all, the results are to T. viridescens. T. viridescens has only been tested for antagonism toward Fusarium species other than F. oxysporum but did inhibit mycelial growth of the four pathogenic Fusarium species tested (Błaszczyk et al., 2017). Based on previous research, it may be that FBR symptoms were not decreased in the greenhouse assay by T. brevicompactum because this species is not an ideal antagonist against FOC, while T. viridescens was not effective due to too low an inoculation concentration.

Additional testing is required to further support these ideas.

Although it was not possible to test T. gamsii, T. hamatum or T. viride in greenhouse bioassays using the methods used to test the other Trichoderma species, the results of dual culture trials were positive regarding antagonism to FOC and so I believe these three species would be effective at decreasing FBR symptoms in greenhouse bioassays with onion. An alternative inoculation method could be employed to complete testing with these species and would provide an opportunity to confirm if results using T. atroviride and T. harzianum are dependent on inoculation method. Mycelia have successfully been used as a treatment inoculation material in other bioassay studies using

Trichoderma species and a fungal pathogen (e.g. Abdullah et al., 2008; Dubey et al.,

2007; Ommati and Zaker, 2012b).

As in virulence assays, experimental design would be improved by labelling pots with random numbers rather than by treatment to reduce observer bias. In these

Trichoderma treatment assays, however, observer bias was lessened (although not eliminated) by little expectation of any Trichoderma species performing better or worse than another: all performed well in dual culture trials.

95

We can conclude that Trichoderma species are present in local onion field soil and are antagonistic to FOC. Isolation of seven Trichoderma species from soil samples and successful observation of antagonism in all dual culture trials support my hypothesis that all Trichoderma species would be antagonistic to FOC. Only four of these

Trichoderma species were tested in greenhouse assays, and of those two have thus far reduced FBR symptoms in greenhouse assays. This prompts the need for further greenhouse testing as well as field trials before any species can be recommended as consistently effective at the field scale.

96

CHAPTER 5: TESTING EFFICACY OF COMMERCIAL BIOCONTROL PRODUCTS AGAINST

FUSARIUM OXYSPORUM F. SP. CEPAE

Objectives

I tested commercially available biological control products marketed for control of Fusarium diseases for reduction of symptoms on onions grown in the field as well as seedlings grown in the greenhouse. This was accomplished using seed treatment and drench application methods. I hypothesized that all products would show reduction of

FBR symptoms

Methods

2016 Field trial design

The onion field site F1 (Annapolis County, NS) was used as a field assay location during the 2016 growing season (Figures 2.2a, 5.1). Two commercial biocontrol products were tested to determine if a difference in disease symptoms could be observed in the onion bulbs at harvest. Trianum-P Biological Fungicide was assessed using both seed treatment and drench applications to site F1, while Myke®Pro WP (Premier Tech

Biotechnologies, Rivière-du-Loup, QC) was tested using only a drench application.

(Myke®Pro WP is no longer produced but is similar to Myke®Pro Turf WP). Trianum contains a minimum 109 colony forming units (cfu)/g of active ingredient Trichoderma harzianum Rifai strain T-22. Myke®Pro contained a minimum 500 cfu/g of active

97

ingredient Glomus intraradices, an arbuscular mycorrhizal fungus. Neither product is marketed for treatment of FBR in onion, but Trianum provides instruction for use as a drench to reduce symptoms of Fusarium rots and wilts in other crop plants, while the arbuscular mycorrhizal fungus (AMF) present in Myke®Pro encourages plant growth when applied to A. cepa (Linderman and Davis, 2004). Neither company suggests seed treatment using their product, but Trichoderma species have been applied in this manner in other research testing biocontrol of F. oxysporum (Coşkuntuna and Özer, 2008).

The seed treatment was applied to a sub-sample of the commercially available

‘Mountaineer’ onion seeds planted in the rest of the field. This is a commonly planted onion variety in the Annapolis Valley, NS. Seeds were treated two days prior to planting.

To treat, 288 g of seeds were combined with 100 g Trianum and 500 mL RO water in a

600 mL container. The mixture was agitated by shaking vigorously by hand for 60 s, then seeds were immediately strained and laid to dry on paper towel, in a single layer. The seeds dried for 12 h at room temperature (21°C), then were stored at 10°C. Weight of

Trianum to use was determined based on product instructions and estimation of the number of seeds planted/unit area, although it should be noted that due to the volume of water used, some amount of the Trianum product was lost during the straining process.

Prior to sowing, any large clumps of seeds were broken up by hand, then smaller clumps were broken by shaking approximately 144 g seeds in a 600 mL container by hand for 5-

6 m.

Eight treatment conditions were applied, each to six treatment plots (Table 5.1).

All plots were within plowed beds of soil approximately 132 cm in width that spanned the length of the field. Each bed had four equidistant, lengthwise rows of onions. Each

98

plot measured approximately 137x132 cm and was separated from the adjacent plot by approximately 20 cm. All plots containing the Trianum seed treatments (1-4) were in one bed, while the remaining treatments (5-8) were in the neighbouring bed, approximately

30 cm away. Seeds were tractor-planted as is typical of commercial onion fields in the area – to plant the treated seeds, the experimental section of the bed was left bare during the first pass of sowing, seeds were removed from the tractor’s seeding device, treated seeds were added, and the experimental section was sown (Figure 5.1a). Seeds were sown

April 28, 2016.

TABLE 5.1. Field experiment treatment conditions, 2016. Six plots were prepared for each condition. Condition Myke®Pro Drench Trianum Drench Trianum Seed Treatment 1 (control) 2 ✓ 3 ✓ 4 ✓ ✓ 5 ✓ 6 ✓ ✓ 7 ✓ ✓ 8 ✓ ✓ ✓

FIG. 5.1. a. Sowing of treated onion seeds at site F1 (April 2016), b. Site F1 at harvest (September 2016).

99

Both Trianum and Myke®Pro drench treatments were applied twice during the growing season: two and twelve weeks after planting (length of growing season was 22 weeks in 2016 and can vary interannually). 2.61 g of Trianum was added to each appropriate plot and/or 0.52 g of Myke®Pro was added to each appropriate plot, suspended in 4.4 L of tap water. For plots in which both products were applied, the volume of water remained 4.4 L. This volume of water was also added to control plots which received neither commercial biocontrol (treatment 5). Amounts of products used were determined based on product instructions; some best approximations were used as neither product provides instructions specific to field sown onions (large scale application).

Onion bulbs were evaluated for disease symptoms at the end of the growing season (Sept. 14-15, 2016, 21 weeks after sowing). Observations were considered to be blind of treatment: treatments were distributed randomly while plots were numbered sequentially, and two months had passed since the final application of treatments.

Number of bulbs per plot was recorded, then the ten bulbs in each plot with the most evident above-ground symptoms were selected.

Each bulb was scored on a scale of 0-4 for both outer disease symptoms, shown in

Table 5.2, and cut open lengthwise and scored for inner disease symptoms if the outer ranking was a 2 or greater (Figure 5.2). Inner disease symptoms were designated as 0 when outer symptoms were 0 or 1, for all onions in the first three plots evaluated; this was assumed to be the case for all subsequent onions with outer symptoms of 0 or 1.

Disease symptoms were defined as any visible or palpable rot, discolouration, softness,

100

mould, or deformity that could be attributed to FOC. The diameter of each bulb was also measured, and presence of insects or insect damage was noted.

TABLE 5.2. Disease symptom key for ‘Mountaineer’ onion bulbs rated at harvest in 2016 field experiment. Score Symptom Key 0 No signs of disease; healthy, firm bulb 1 <5% of bulb has disease symptoms 2 5-25% of bulb has disease symptoms 3 26-75% of bulb has disease symptoms 4 >75% of bulb has disease symptoms

FIG. 5.2. Onion at harvest from site F1, with a of Fusarium basal rot disease symptoms score of 2 (2016).

Data were analysed with R version 3.3.1 and RStudio version 1.1.414. Internal and external symptoms measures were considered as binomial data (presence/absence of symptoms) and fit to a generalized linear mixed-effect model. Fit was assessed by evaluating residual plots. Number of onions per plot and diameter of onions were fit to a generalized linear mixed-effect model and a linear mixed-effect model, respectively.

Effect estimates were considered, and an ANOVA was conducted to determine overall effect of treatment on symptom presence. Discrimination among means was conducted using a Chi-square (X2) test for symptom data and using an F-test for onion number and diameter data; results with P < 0.05 were considered significant.

101

2017 Field trial design

The field sites F7 and F8 (Annapolis County, NS) were used as field assay locations during the 2017 growing season (Figure 2.3). Four commercial products with biocontrol potential were tested to determine if a difference in disease symptoms could be observed in the onion bulbs at harvest. All products were applied as a drench, for ease of applications and to improve comparisons between treatments. Trianum Biological

Fungicide and Myke®Pro Turf WP again used, as well as Prestop and RootShield.

Prestop contains a minimum 2 x 108 cfu/g of active ingredient Gliocladium catenulatum strain J1446 (current name Clonostachys rosea), while RootShield contains a minimum of 107 cfu/g of active ingredient Trichoderma harzianum Rifai strain KRL-AG2.

Trianum was tested for a second growing season in high, medium, and low concentrations to determine if results of the 2016 field assay could be replicated or improved. Myke®Pro was tested in high and low concentrations in combinations with

Trianum, as the 2016 assay suggested decreased disease symptoms only when Myke®Pro was applied in combination with Trianum, not when Myke®Pro was applied alone.

Prestop and RootShield were selected following consultation with the onion growers and to improve comparisons between treatments, as Trianum, Prestop, and RootShield are all marketed as having biocontrol action against F. oxysporum, while the Myke®Pro product is marketed to more generally improve plant growth and disease resistance.

Tractor seed sowing method and experimental plot dimensions remained the same in 2016 and 2017 but the following changes were made to the experimental design in

2017: 60 cm was left between plots instead of 20 cm to decrease the potential for treatment runoff and contamination between plots; and eleven plots were set up in six

102

adjacent beds, rather than 24 plots in two beds, to use a portion of field with greater overall uniformity, to accommodate a greater total number of plots, and to better isolate treatment effects from possible bed effects in subsequent statistical analyses. Seeds were sown the week of April 24, 2017.

The following product amounts were used to create treatment suspensions: 5.64 g

(high), 2.82 g (medium), or 1.41 g (low) of Trianum; 3.76 g of Prestop; 6.06 g of

RootShield; and/or 0.3 (high) or 0.15 g (low) of Myke®Pro. Ten treatments were applied, all in a final volume of 1 L rain water, decreased from 2016 to reduce runoff and contamination (Table 5.3). There were six plots of each treatment condition per field and twelve control plots (no biocontrol treatment) to provide a more comprehensive baseline and to facilitate more thorough analyses. Sites F7 and F8 were identical in all aspects except location.

TABLE 5.3. Field experiment treatment conditions, 2017. Number of plots per field also shown. Con’d RootShield Prestop Trianum Trianum Trianum MP MP # (high) (med.) (low) (med.) (low) plots/field 1 ✓ 6 2 ✓ 6 3 ✓ 6 4 ✓ 6 5 ✓ 6 6 ✓ ✓ 6 7 ✓ ✓ 6 8 ✓ ✓ 6 9 ✓ ✓ 6 10-C 12

All treatments except Prestop (treatment 2) were applied twice during the growing season, as per application instructions of Trianum: at both two and ten weeks post sowing of seeds. Although the Myke®Pre and RootShield products do not specify reapplication

103

to be necessary, it was decided to reapply to achieve more comparable results between products. Prestop was applied every six weeks, and thus three times, as per label instructions: at two weeks, eight weeks, and fourteen weeks. Again, it should be noted that no product provided instruction specific to field sown onions. Additionally, although an earlier initial application time would have been ideal for the Trianum and Prestop products, logistics and a desire to standardize treatments and accommodate the need for

RootShield to be applied slightly later in the season were deciding factors in the initial two-week initial treatment time. Harvest occurred at nineteen weeks at F8 and 21 weeks at F7; harvest times are dependent on weather, logistics, as well as the maturation timeline of onions within each field (e.g. onions at F8 were mature before those at F7, which is likely due to several factors, some of which may include: different sowing days, differences in microclimate, etc.) (Sawler, personal comm., August 2017).

Onion bulbs were evaluated for disease symptoms at the end of the growing season (Sept. 5th, 2017, nineteen weeks after sowing). Number of bulbs per plot was counted, and number of bulbs showing basal rot symptoms were counted. Each onion showing symptoms was cut open lengthwise through the basal plate and scored on a scale of 0-4 for disease symptoms, using a modified version of the 2016 scale that had been simplified and tailored to FBR symptoms (Table 5.4). “Basal rot” was defined as any visible or palpable rot, discolouration, softness, mould, or deformity that could be attributed to FOC, and was present at the basal plate. Some subjectivity was allowed in judging whether basal rot was minor or moderate, as I did not find measures such as percent rot to provide consistent results. Severe basal rot was defined as the compete rotting of the basal plate, i.e. no solid portion of basal plate remained.

104

TABLE 5.4. Disease symptom key for onion bulbs rated at harvest in 2017 field experiment. Rank Symptom Key 0 No signs of disease; healthy, firm bulb 1 Minor basal rot; <11% rotted roots; <11% rot of internal scales 2 Moderate basal rot; ≤100% rotted roots; <11% rot of internal scales 3 Moderate-severe basal rot; ≤100% rotted roots; <31% rot of internal scales 4 Severe basal rot; ≤100% rotted roots; >30% spread to internal scales

No diameter measurements of onion bulbs were taken as this was not found to be a predictive variable for effect of treatment in the 2016 field experiment, and the increased scale of the 2017 field experiments compared to 2016 created logistical challenges for this measure. Again, observations were considered blind.

Data were analysed with R version 3.3.1 and RStudio version 1.1.414. Symptoms were considered as binomial data (presence/absence of symptoms) as in 2016 analyses for comparison, although for 2017 all diseased onions were considered rather than the ten most visibility symptomatic from each plot, made possible by lower disease levels in

2017. Effect of treatment on number of onions was also assessed; models were fit as for

2016 data. Results with P < 0.05 were considered significant.

Evaluation of onions postharvest, in storage

A subset of onions was collected from both sites F7 and F8 to be tracked for disease symptoms in storage. Four random onions from each plot were collected, for a total of 24 onions from each treatment condition, (excepting 48 from control plots,) from each field. A total of 528 onions were collected. Each group of 24 (or 48) was consolidated in one 40 lb-capacity, mesh onion bag. Bags were labelled and then all were

105

placed in a single, labelled storage bin, which experienced the same storage conditions as all other onions processed through the Sawler Gardens farm (Berwick, NS).

Onions were checked for disease symptoms at 4.5 months and 6.5 months post- storage (weeks of Jan. 22nd and Mar. 19th, 2018) with plans to check again at 8.5 months post-storage (week of May 14th).

Greenhouse bioassays to test commercial biocontrol products against FBR

Antagonistic activity of commercial products (Prestop, Trianum, RootShield) was tested against the FOC pathogen on onions planted in soil inoculated with FOC in a greenhouse setting (KCIC) in collaboration with Research Topics student Dominique

Taylor. The same phytotron as was used in virulence and local Trichoderma bioassays was again employed, with all conditions as described in chapter 3: 27°C, 16 h photoperiod, and approximately 60% humidity. Sterilization of onion seeds, soil, and equipment and preparation of FOC spore suspensions were also as previously described

(chapter 3). Sixteen pots were prepared per treatment condition.

Upon consultation with the onion growers, a seed treatment method was chosen, which was later amended to a “simulated seed treatment” due to technical complications.

The concentration of FOC found to produce 50% mortality by the end of the four week period in virulence bioassays (1000 s/g) was used as a pathogen inoculation concentration. In addition to the FOC spore suspension added to the soil, a commercial biocontrol product was applied at the time of planting. Initially, we had planned to apply the powdered, commercial products directly to the seeds by moistening the seeds with water, then shaking in the product to coat. In practice, this resulted in seeds sticking

106

together, which was not conducive to sowing them with any ease. Thus, we created a procedure to simulate a seed treatment: seeds were sowed as in previous assays, untreated, and then the commercial product was uniformly distributed over the seeds prior to a final 1 cm of soil added to cover the seeds.

Our aim was to provide a concentrated dose of product on and near the seeds at time of germination. Each pot received 0.75 g of product, determined according to the product instruction for Trianum (recommended dose of 0.03 g per plant for cultivation at low crop density), because it was the product with the lowest per-plant dosage recommendation. There were four treatment conditions (Table 5.5). No treatment condition which excludes both FOC and treatment inoculation was included here, as previous assays provided consistent results for comparison. Each pot received 200 g of soil.

TABLE 5.5. Treatment conditions for greenhouse antagonism bioassays. Sixteen pots were prepared for each condition. Condition FOC Trianum Prestop RootShield 1 ✓ 2 ✓ ✓ 3 ✓ ✓ 4 ✓ ✓

Seeds were monitored daily for emergence, and seedlings were observed for disease symptoms and survival over a four week period. All observations were recorded by Dominique Taylor. Seedlings and symptoms were observed jointly on two occasions

(once in a previous assay in which observations were recorded by myself, and again in this assay) to reduce observer bias. Observations were not blind, however, as pots were labelled. Symptoms were considered as proportional data (proportion of seedlings with

107

symptoms per pot) on the final day of observations (day 28). Estimates of fixed effects with P < 0.05 were considered significant.

Results

2016 Field trial

The total number of onions per plot ranged from 70 to 107 (Figure 5.3a). This entire range was observed in a single treatment condition, Trianum drench, which also experienced the lowest average number of onions per plot. All conditions overlapped in observed range of number of onions per plot. Only two treatment conditions showed a higher average number of onions per plot than the control condition. These factors prevented me from drawing any definitive conclusions regarding the effect of treatment on number of onions per plot, although it was observed that the treatment in which both

Myke®Pro and Trianum were applied as a drench did produce the most onions per plot.

The diameter of onions at harvest ranged from 18 to 92 mm (Figure 5.3b). All conditions experienced a range in onion size of at least 52 mm difference between the smallest and the largest onion measured, and all conditions overlapped considerably in their range of onion sizes. For this reason, it was difficult to draw conclusions regarding the effect of treatment on bulb diameter. It was observed that all treatment conditions that included the application of Trianum on seeds resulted in an average bulb size larger than the control, while no treatment conditions lacking a Trianum seed treatment exceeded the control in average bulb size. Of the conditions including a Trianum seed treatment, those combined with drenches resulted in the largest average bulb size, with the largest average

108

bulb size being found in treatment 8 (Trianum seed treatment, Trianum drench, and

Myke®Pro drench all applied).

a b

FIG. 5.3. Number (a) and diameter (b) of onions for each of the seven treatment conditions and the control condition used in the 2016 field experiment. There were six plots per treatment; for diameter values, ten onions from each plot were assessed for a total of 60 onions per treatment condition.

When evaluating external symptoms, it was found that most onions in each treatment condition had a FBR symptom level of 1 at harvest (Figure 5.4a). Average external symptom level per condition ranged from 0.97 to 1.68. The only treatment that resulted in a lower average symptom level than the control was treatment 8. When evaluating internal symptoms, most onions in each treatment condition had no symptoms

(Figure 5.4b). Average symptom level ranged from 0.22 to 1.17. Both treatments 7

(Trianum seed treatment and drench both applied) and 8 resulted in lower average disease symptoms than the control.

109

a b

FIG. 5.4. Mean symptoms level of onions for each of the seven treatment conditions and the control condition used in the 2016 field experiment; error bars show standard error. a. External symptom levels, b. internal symptoms levels. Ten onions from each of the six plots per treatment were assessed for a total of 60 onions per treatment condition.

Treatment 5 (Trianum seed treatment) had significantly fewer onions free from external symptoms than the control (P = 0.046), while treatment 2 (AMF drench) had significantly fewer onions free from internal symptoms than the control (P = 0.039). This can be interpreted as these treatments resulting in a greater number of symptomatic onions. Although there was a significant overall effect of treatment (vs. no treatment) on diameter of onions, no one individual treatment differed significantly from the control.

There were no significant effects of treatment on number of onions per plot.

2017 Field trial and evaluation of onions postharvest

Total number of onions per plot ranged from 73 to 159 (Figure 5.5). The low end of the range was lower in field 7 (73-152) than field 8 (101-159) but the high end of the range was comparable between fields. There was no clear pattern between fields in efficacy of any treatment, although the combined ‘medium’ treatments of the Trianum and Myke®Pro, and the RootShield treatment both resulted in more onions per plot than the control at both field sites.

110

a b

FIG. 5.5. Number of onions per plot by treatment, shown separately for each 2017 field site: a. site F7, b. site F8. Each field had six plots per treatment, excepting twelve plots per control (no treatment) in each field.

The mean number of onions with symptoms was less than one for all treatments, in both fields (Figure 5.6). This equates to fewer than 1% of all onions showing any symptoms and reflects the overall low number of diseased onions that were observed.

This makes comparison between treatments more complicated. In site F7, the lowest mean number of onions with symptoms was recorded for the control plots (no commercial biocontrol treatments added). In site F8, there were no diseased onions observed in any of the plots which received the TRI-L. There was no clear pattern of treatment efficacy when comparing between field sites.

111

a b

FIG. 5.6. Mean number of FBR symptomatic onions per treatment, shown separately for each 2017 field site; error bars show standard error. a. Site F7, b. site F8. Each field had six plots per treatment, excepting twelve plots per control (no treatment) in each field.

The greatest number of diseased onions in any plot was three, which affected the confidence with which I could interpret the mean values of the measure of symptom severity. Severity of symptoms in onions with symptoms showed a similar pattern to number of onions with symptoms, per treatment: in site F7, the lowest mean symptom score was recorded for the control plots (no commercial biocontrol treatments added); in site F8, there were no diseased onions observed in any of the plots which received the

TRI-L, resulting in a symptom severity score of 0 (Figure 5.7). There was no clear pattern of treatment efficacy when comparing between field sites.

112

a b

FIG. 5.7. Mean symptoms severity of FBR symptomatic onions per treatment, shown separately for each 2017 field site; error bars show standard error. a. Site F7, b. site F8.

There were no significant effects of treatment on presence of symptoms at either field site in 2017. Considering the TRI-M+AMF-L treatment (medium concentration dose of Trianum combined with a low concentration dose of Myke®Pro), there was a significant effect found in both sites F7 and F8. There were fewer onions per TRI-

M+AMF-L plots than in control plots in site F7 (P = 0.034), while there were more onions per TRI-M+AMF-L plots than in control plots in site F8 (P = 0.011).

Onions in storage were evaluated for FBR symptoms on January 23, 2018. No more than one onion per treatment was symptomatic.

Greenhouse bioassays to test commercial biocontrol products against FBR

In the four week greenhouse bioassay, all three commercial products applied as simulated seed treatments yielded onions with fewer FBR symptoms than the pathogen- only treatment (1000 s/g FOC with no commercial biocontrol treatment) (Figure 5.8).

Until approximately day eleven, the health curve of the Trianum and Prestop treatments, as well as the FOC-only and control (no FOC or commercial biocontrol treatments) were alike. The health of seedlings in the control pots continued to improve until the end of the

113

assay. The mean health of seedlings per pot for the FOC-only, Prestop, and Trianum treatments peaked at scores of 10.1, 12.4 and 13.5 at days twelve, thirteen, and fifteen, respectively, and then declined. The mean health appeared to level off at a score of approximately four for the FOC-only and Prestop treatments by the four week mark. The health of seedlings in the Trianum treatment, while higher at approximately seven at four weeks, appeared to still be in decline.

The mean health of seedlings per pot in the RootShield treatment produced a different health curve when plotted by day than all other treatments. Initially health was lower compared to all treatments, and then increased at a slower rate over time. The mean health score peaked at 10.2 at day 21 and had only declined slightly to 8.9 by the end of the assay.

Both treatments of RootShield and Trianum resulted in significantly lower proportion of symptomatic seedlings than in the FOC-only condition, with the effect being larger for RootShield than for Trianum (Table 5.6). There was no significant effect of the Prestop treatment on proportion of symptomatic seedling at the end of the four week assay, compared to the FOC-only condition.

114

FIG. 5.8. Mean health of each sixteen pots sown with 25 onions seedlings for control treatment (0 s/g FOC; no commercial biocontrol product), vs. 1000 s/g FOC inoculation treatment (no commercial biocontrol product), vs. 1000 s/g FOC inoculation and the addition of one of three commercial biocontrol product: Prestop, RootShield, and Trianum. Mean health shown per day, from emergence to 28 days post-sowing. Shading shows standard error for each curve.

TABLE 5.6. Estimates of effect sizes, standard errors, and P values for three commercial biocontrol treatments in comparison to the 1000 s/g FOC condition (no commercial treatment applied). Treatment Estimate Standard Error P value Prestop -0.038 0.27 0.89 RootShield 1.58 0.22 1.4 x 10-12 Trianum 0.79 0.24 0.0009

115

Discussion

There was a general trend in the 2016 field trial when all dependent variables

(number of onions per plot, diameter of onions, external symptoms, and internal onion bulb symptoms) were considered. Plots that received treatment consisting of multiple products fared better as measured by more onions per pot, larger onions, and lower symptoms scores, with the inclusion of Trianum having a stronger positive effect than inclusion of the AMF product. Treatments consisting of any one product generally produced poorer results than the control condition. The only treatments to differ significantly from the control regarding presence of symptoms, however, had fewer symptomless onions, thus these treatments should be considered to have a negative effect.

It was unclear if the effects observed were related to application method of the

Trianum. While the number of onions per plot was greater when the application method of Trianum was a drench, symptom levels were lower in plots which received Trianum applied as a seed treatment. The interaction between Trianum and the Myke®Pro product was also unclear; although Trianum seemed to be the more effective product, it could not be definitively determined which product had the greater effect in combined treatments.

Similar results were found by Datnoff et al., (1995) in which treatments of T. harzianum and G. intraradices decreased incidence and severity of Fusarium disease in tomato, but individual and combined results were inconsistent.

It is also unclear how the thiram coating present on the onion seeds interacted with treatments. T. harzianum is tolerant of most fungicides, pesticides, and other management practices, including thiram (Bagwan, 2010). G. intraradices is adversely

116

affected by thiram, however, and this may have affected the results (Plenchette and

Perrin, 1992). Additional research should address the effect of thiram and other fungicidal seed coatings common on commercially available onion seed on fungal biocontrol agents: a good candidate agent should tolerate fungicides. Both greenhouse and field experiments similar to those in this thesis could be used for this purpose.

Analysis of the 2016 field trial results prompted several changes to the methods of the 2017 field trials. Two fields were chosen rather than one to determine if results could be replicated in different fields (slight differences in soil type, crop history, microclimate). A single application method (drench) was chosen to facilitate more direct comparison between treatments, and to simplify the experimental design. Different concentrations and combinations of the Trianum and Myke®Pro products were used to determine how differences in response variables were related to these factors. Onion diameters were not measured, as this variable was not found to be related to treatment in

2016, and disease evaluations were altered for simplicity and to better reflect measures of symptom severity used in other onion research (e.g. Galván et al., 2008). Finally, a larger space was left between field plots to reduce runoff of product drenches at time of application, a factor that may have affected 2016 results.

I chose to add the Prestop and RootShield products to the 2017 field trials upon consultation with the onion growers. Prestop decreases seedling mortality caused by F. oxysporum in cucumber, while RootShield effectively reduces Fusarium wilt in tomato

(Larkin and Fravel, 1998; Rose and Parker, 2003).

Analyses of results for the 2017 field trials were impacted by the low level of disease incidence in both field sites. Disease incidence was generally reported to be low

117

in the Annapolis Valley in 2017 (Sawler, personal comm., August 2017). Factors such as weather and field use history impact disease incidence; the growing season was relatively dry and temperate in 2017, which may have mitigated FOC activity (Abawi and Lorbeer,

1972, Cramer, 2000). Field selection was informed by the onion growers, and while it was attempted to select fields with a history of FBR in onion, growers must also temper the researcher’s desire to experiment in an infected field with their crop-rotation requirements.

It is unlikely that significant results found for the TRI-M+AMF-L treatment on number of onions per plot reflect the true efficacy of this treatment, for several reasons, including consideration of the factors explained above. In addition, the results were conflicting between fields, so even if the results are valid, they do not support the use of this treatment because it is not clear what difference between the fields may have caused this difference. As well, although it is possible that this specific combination of concentrations of Trianum and the Myke®Pro products is somehow unique in causing effect on FBR symptoms, it is unlikely that there would be no significant effects of any of the other treatments testing varied concentration combinations of these products if the observed results were truly valid.

Future field trials would benefit from larger plots to increase the number of onions assessed for symptoms per treatment. This would provide greater power to analyses in years when disease incidence is low, as well as in fields with a low pathogen load. Use of fields sites with a known history of severe FOC infection would also test products in the conditions that growers have the most need. Growers are understandably not keen to crop onion in these fields without at least four years of alternate crops, but a

118

portion could be sectioned off for experimental purposes, allowing the rest of the field to be planted with a different crop.

There are some concerns regarding the use of fungal biocontrol agents in the field.

Native microorganisms may be displaced, and/or the natural composition of microflora/fauna may be disturbed, creating different adverse effects to the host plant or affecting the efficacy of the biocontrol treatment itself (Brimner and Boland, 2003). The biocontrol agent may be toxic to non-target plants or animals, or even to humans, which could have extended effects throughout the food chain (Brimner and Boland, 2003).

These concerns can be addressed in assays prior to application, and unforeseen effects can be mitigated by stopping the treatment. Choosing a biocontrol agent that is a common constituent of the local soil microbiota, like a Trichoderma species, also reduces risk.

The greenhouse bioassay testing commercial biocontrol products against FOC showed that seedlings treated with RootShield had the fewest disease symptoms at the end of the four week assay when compared to the other products and the FOC-only condition. Seedlings treated with Trianum also had fewer symptoms than those in the

FOC-only condition. At the four week mark, however, seedling health appeared to be in decline in both the RootShield and Trianum treatment conditions. A longer assay may have revealed that neither product was effective in reducing FBR symptoms over a longer time span. Although previous research has shown that symptoms observed in short seedling assays are correlated to symptoms seen in longer assays in which onions are grown to the bulb stage, four weeks may not be long enough under the conditions tested for this thesis (Taylor et al., 2013).

119

Another consideration in the greenhouse bioassay was the method of a “simulated seed treatment” rather than a true seed treatment. It is not known if the results obtained from our methods are applicable to the results we would see from an application method in which the seeds were coated in the products. Further assays should test alternate methods with which to create true seed treatments applicable to field scale application.

Further assays should also be altered to ensure observations are blind to treatment, although in this case, there were no a priori differences expected between treatments

(although this itself is a bias).

Results of commercial product assays were overall, inconclusive and do not support my hypothesis that all commercial products would reduce FBR symptoms in both greenhouse assays and field trials. Further testing using alternate application methods as described above are recommended, as well as the testing of additional products.

Trichoderma biocontrol products are well established as effective in other crop plants but are lacking in experimental trials for use on onion.

120

CHAPTER 6: CONCLUSIONS

In the Annapolis Valley, NS, FBR of bulb onions has become an increasingly damaging disease in recent years. Incidence and severity of symptoms has risen, as has incidence of infection post-storage. Because FOC strain characteristics are variable and have unique interactions with other biotic and abiotic environmental factors, the lack of research specific to the Annapolis Valley impedes the creation of an effective control strategy for this pathogen.

Characterization efforts specific to the strain of FOC used in all subsequent analyses in this study revealed that FOC in the Annapolis Valley, NS has some features that help to identify and understand it independently from other strains of F. oxysporum or even FOC. The local strain of FOC produced flat, hyaline cultures on MEA in all growth conditions tested, rather than cultures with white, aerial mycelium, which are expected for F. oxysporum cultures grown on MEA (Samson et al., 2010). The colour associated with maturation of local FOC cultures was a pale orange-pink, which deepened in hue with age. This is not atypical, but it is a useful identification feature as there is diversity in colour and/or reverse pigmentation associated with F. oxysporum, in different shades of brown, red, pink, orange, purple, or blue, or no pigmentation (Burgess et al., 1994; Samson et al., 2010).

Morphology of micro- and macroconidia were as expected for F. oxysporum, excepting the sparsity of macroconidia, which are generally abundant but have been reported as scant in some strains (Samson et al., 2010). This may be an unusual feature characteristic to FOC, but more attempts to visualize macroconidia would need to be

121

made before this could be said with confidence. Future research should focus on more comprehensive imaging of micromorphology using alternative slide preparation techniques and imaging technologies (examples in Samson et al., 2010).

Although a comprehensive molecular characterization of the FOC strain using multiple loci was not undertaken for this thesis (but is ongoing in the Walker Lab at

Acadia University), the sequencing of other isolates from infected onion tissue identified

6/31 as F. solani. This raises questions about the use of ITS barcoding to identify the causal agent of Fusarium basal rot of onion, and about the role of F. solani in FBR infections in the Annapolis Valley. Previous research suggests that sequencing additional loci in addition to the ITS gene region is essential in identification of Fusarium species

(O’Donnell et al., 2009; O’Donnell et al., 2015). Other research also suggests that F. solani may be implicated in FBR, so pathogenicity testing of F. solani strains from local fields should be determined (Bayraktar and Dolar, 2011; Boehnke et al., 2015; Klokočar-

Šmit et al., 2008).

Key findings of the pathogenicity and virulence aspects of my study were: 1. The strain of FOC isolated from a local onion and used in all dual culture and greenhouse trials is pathogenic to bulb onion, as axenic cultures produced from plating onion basal plate tissue of onions showing FBR symptoms grown in sterile conditions using FOC as an inoculant, were identified as F. oxysporum. Although a simple confirmation step, this provided an essential basis to test potential biocontrol options. 2. A dosage of approximately 1000 spores FOC per gram of soil resulted in 50% onion seedling mortality after four weeks of growth. Virulence of pathogenic F. oxysporum strains is variable, so virulence assays were also an essential step in creating a baseline for testing

122

of biocontrol products. More research should be undertaken to vary environmental factors such as temperature, humidity, soil type, and onion cultivar to determine the effect of these changes on baseline virulence data, however.

The strain of both the pathogen (FOC) and the biocontrol agent (in this case, a

Trichoderma species) affect the type and strength of interaction that will occur between two isolates. Choosing the most effective biocontrol option requires more precision than simply selecting at the species level. For example, different studies have demonstrated failure of T. harzianum to parasitize F. oxysporum (Sivan and Chet, 1989), as well as success (Dubey et al., 2007; Malathi and Mohan, 2011; Özer et al., 2009; Rahman et al.,

2009). Thus, multiple strains of the fungal biocontrol species must be tested and characterized in more detail.

Taken collectively, the results from dual culture assays and greenhouse assays of

Trichoderma species isolated from local soil as well as in commercially available biocontrol products, support the use of one or more Trichoderma species being used as part of a successful control strategy for FBR caused by FOC in the Annapolis Valley. All seven Trichoderma species isolated from local agricultural soils that have been cropped for onion inhibited the growth of FOC in dual culture trials. The greatest percent growth inhibition was caused by T. gamsii at 76%, and T. atroviride, T. hamatum, T. harzianum,

T. viride, and T. viridescens all inhibited over 60% of FOC growth. Locally isolated T. atroviride and T. harzianum significantly decreased FBR rot symptoms in greenhouse grown onion seedlings, while T. brevicompactum and T. viridescens did not; T. gamsii, T. hamatum, and T. viride were not tested in greenhouse conditions.

123

The collective results of the greenhouse and field trials using commercial biocontrol products do not support the use of Prestop, RootShield, or Trianum to control

FBR symptoms in bulb onions. This could be due to manner of application, or in the field trials, low disease load in experimental fields, thus additional research should work to address these possibilities. For example, product dosage could be increased, products could be combined to examine synergistic effects, and field sites could be chosen with more certain high pathogen loads.

This thesis is the first research project to focus on Fusarium basal rot of onion in the Annapolis Valley, NS. More research is required to address the molecular characteristics of relevant FOC strains, and to provide confidence in the most effective formulation and application method of biocontrol. Nevertheless, this thesis supports the consideration of fungal biocontrol agents as part of a control program for FBR in this region.

124

References

© FAO, 2017. FAOSTAT, Data, Crops. http://www.fao.org/faostat/en/#data/QC.

Accessed 2017-07-06.

Abawi GS, Lorbeer JW. 1972. Several aspects of the ecology and pathology of

Fusarium oxysporum f. sp. cepae. Phytopathology 62: 870-876.

Abdullah MT, Ali NY, Suleman P. 2008. Biological control of Sclerotinia

sclerotiorum (Lib.) de Bary with Trichoderma harzianum and Bacillus

amyloliquefaciens. Crop Protection 27: 1354-1359.

Armitage AD, Taylor A, Sobczyk MK, Baxter L, Greenfield BPJ, Bates HJ, Wilson

F, Jackson AC, Ott S, Harrison R, Clarkson JP. Unpublished. Pangenomic

analysis reveals pathogen-specific regions and novel effector candidates in

Fusarium oxysporum f. sp. cepae. bioRxiv: 182238

Badalyan SM, Garibyan NG, Innocenti G. 2002. Antagonistic activity of xylotrophic

mushrooms against pathogenic fungi of cereals in dual culture. Phytopathologia

Mediterranea 41: 1000-1006.

Bagwan NB. 2010. Evaluation of Trichoderma compatibility with fungicides,

pesticides, organic cakes and botanicals for integrated management of soil borne

125

diseases of soybean [Glycine max (L.) Merril]. International Journal of Plant

Protection 3: 206-209.

Bayraktar H, Dolar FS. 2011. Molecular identification and genetic diversity of

Fusarium species associated with onion fields in Turkey. Journal of

Phytopathology 159: 28-34.

Bayraktar H, Turkkan M, Dolar FS. 2010. Characterization of Fusarium oxysporum f.

sp. cepae from onion in Turkey based on vegetative compatibility and rDNA

RFLP analysis. Journal of Phytopathology 158: 691-697.

Becher R, Hettwer U, Karlovsky P, Deising HB, Wirsel SGR. 2010. Adaptation of

Fusarium graminearum to tebuconazole yielded descendants diverging for levels

of fitness, fungicide resistance, virulence, and mycotoxin production.

Phytopathology 100: 444-453.

Bhat, KA. 2017. A new agar plate assisted slide culture technique to study

mycoparasitism of Trichoderma sp. on Rhizoctonia solani and Fusarium

oxysporum. International Journal of Current Microbiology and Applied Sciences

6: 3176-3180.

126

Błaszczyk L, Basińska-Barczak AN, Ćwiek-Kupczyńska HA, Gromadzka K, Popiel

D, Stępień Ł. 2017. Suppressive effect of Trichoderma spp. on toxigenic

Fusarium species. Polish Journal of Microbiology 66: 85-100.

Boehnke B, Karlovsky P, Pfohl K, Gamliel A, Isack Y, Dehne HW. 2015.

Identification of different Fusarium spp. in Allium spp. in Germany.

Communications in Agricultural and Applied Biological Sciences 80: 453-463.

Bolar JP, Norelli JL, Wong KW, Hayes CK, Harman GE, Aldwinckle HS. 2000.

Expression of endochitinase from Trichoderma harzianum in transgenic apple

increases resistance to apple scab and reduces vigor. Phytopathology 90: 72-77.

Boureghda H, Bouznad Z. 2009. Biological control of Fusarium wilt of chickpea

using isolates of Trichoderma atroviride, T. harzianum, and T. longibrachiatum.

Acta Phytopathologica et Entomologica Hungarica 44: 25-38.

Brimner TA, Boland GJ. 2003. A review of the non-target effects of fungi used to

biologically control plant diseases. Agriculture, Ecosystems & Environment 100:

3-16.

Brown DW, Proctor RH (Eds.). 2013. Fusarium: Genomics, Molecular and Cellular

Biology. Norfolk, UK: Caister Academic Press.

127

Burgess LW, Summerell BA, Bullock S, Gott KP, Blackhouse D. 1994. Laboratory

manual for Fusarium research, 3rd edition. Fusarium Research Laboratory,

Department of Crop Sciences, University of Sydney.

Calistru C, McLean M, Berjak P. 1997. In vitro studies on the potential for biological

control of Aspergillus flavus and Fusarium moniliforme by Trichoderma species.

Mycopathologia 137: 115-124.

Cann DB, MacDougall JI, Hilchey JD. 1965. Soil Survey of Kings County: Report

No. 15, Nova Scotia Soil Survey, Truro, Nova Scotia. Canada Department of

Agriculture and Nova Scotia Department of Agriculture and Marketing.

Cherif M, and Benhamou N. 1990. Cytochemical aspects of chitin breakdown during

the parasitic action of a Trichoderma sp. on Fusarium oxysporum f. sp. radices-

lycopersici. Phytopathology 80: 1406-1414.

Coşkuntuna A, Özer N. 2008. Biological control of onion basal rot disease using

Trichoderma harzianum and induction of antifungal compounds in onion set

following seed treatment. Crop Protection 27: 330-336.

Coûteaux M. 1992. Decomposition of cells and empty shells of testate amoebae

(Rhizopoda, Testacea) in an organic acid soil sterilized by propylene oxide

128

fumigation, autoclaving, and γ-ray irradiation. Biology and Fertility of Soils 12:

290-294.

Cramer CS. 2000. Breeding and genetics of Fusarium basal rot resistance in onion.

Euphytica 115: 159-166.

Cuervo-Parra JA, Sánchez-López V, Romero-Cortes T, Ramírez-Lepe M. 2014.

Hypocrea/Trichoderma viridescens ITV43 with potential for biocontrol of

Moniliophthora roreri Cif & Par, Phytophthora megasperma and Phytophthora

capsici. African Journal of Microbiology Research 8: 1704-1712.

Datnoff LE, Nemec S, Pernezny K. 1995. Biological control of Fusarium crown and

root rot in tomato in Florida using Trichoderma harzianum and Glomus

intraradices. Biological Control 5: 427-431.

Degenkolb T, Nielson KF, Dieckmann R, Branco-Rocha F, Chaverri P, Samuels GJ,

Thrane U, von Dohren H, Vilcinskas A, Bruckner H. 2015. Peptaibol, secondary-

metabolita, and hydrophobin pattern of commercial biocontrol agents formulated

with species of the Trichoderma harzianum complex. Chemistry & Biodiversity

12: 662-684.

129

Dubey SC, Suresh M, Singh B. 2007. Evaluation of Trichoderma species against

Fusarium oxysporum f. sp. ciceris for integrated management of chickpea wilt.

Biological Control 40: 118-127.

Fravel D, Olivain C, Alabouvette C. 2003. Fusarium oxysporum and its biocontrol.

New Phytologist 157: 493-502.

Galván GA, Konig-Boucoiran CFS, Koopman WJM, Burger-Meijer K, González PH,

Waalwijk C, Kik C, Scholten OE. 2008. Genetic variation among Fusarium

isolates from onion, and resistance to Fusarium basal rot in related Allium species.

European Journal of Plant Pathology 121: 499-512.

Gawehns F, Ma L, Bruning O, Houterman PM, Boeren S, Cornelissen BJC, Rep M,

Takken FLW. 2015. The effector repertoire of Fusarium oxysporum determines

the tomato xylem proteome composition following infection. Frontiers in Plant

Science 6: 967.

Geiser DM, del Mar Jiménez-Gasco M, Kang S, Makalowska I, Veeraraghavan N,

Ward TJ, Zhang N, Kuldau GA, O’Donnell K. 2004. FUSARIUM-ID v. 1.0: A

DNA sequence database for identifying Fusarium. European Journal of Plant

Pathology 110: 473-479.

130

Gordon TR, Martyn, RD. 1997. The evolutionary biology of Fusarium oxysporum.

Annual Review of Phytopathology 35: 111-128.

Government of Canada. 2018. Environment and natural resources; Weather,

Climate and Hazard; Past weather and climate.

http://climate.weather.gc.ca/historical_data/search_historic_data_e.html.

Accessed 2018-03-06.

Gräfenhan T. 2006. Epidemiology and biocontrol of latent grapevine trunk diseases.

PhD Thesis, Humboldt University, Berlin, Germany.

Gressel JB, Hartmann KM. 1968. Morphogenesis in Trichoderma: Action spectrum

of photoinduced sporulation. Planta 79: 271-274.

Guadet J, Julien J, Lafay JF, Brygoo Y. 1989. Phylogeny of some Fusarium species,

as determined by large-subunit rRNA sequence comparison. Molecular and

Biological Evolution 6: 227-242.

Hajieghrari B, Torabi-Giglou M, Mohammadi MR, Davari M. 2008. Biological

potential of some Iranian Trichoderma isolates in the control of soil borne plant

pathogenic fungi. African Journal of Biotechnology 7: 967-972.

131

Hillis DM, Davis SK. 1986. Evolution of ribosomal DNA: Fifty million years of

recorded history in the frog genus Rana. Evolution 40: 1275-1288.

Holz G, Knox-Davies PS. 1985. Production of pectic enzymes by Fusarium

oxysporum f. sp. cepae and its involvement in onion bulb rot. Journal of

Phytopathology 112: 69-80.

Howell CR. 2003. Mechanisms employed by Trichoderma species in the biological

control of plant diseases: The history and evolution of current concepts. Plant

Disease 87: 4-10.

Jenkinson DS. 1966. Studies on the decomposition of plant material in soil: II. Partial

sterilization of soil and the soil biomass. European Journal of Soil Science 17:

280-302.

Jiang J, Yun Y, Fu J, Shim W-B, Ma Z. 2011. Involvement of a putative response

regulator FgRrg-1 in osmotic stress response, fungicide resistance and virulence

in Fusarium graminearum. Molecular Plant Pathology 12: 425-436.

John PJ, Tyagi RD, Prévost D, Brar SK, Pouleur S, Surampalli RY. 2010.

Mycoparasitic Trichoderma viride as a biocontrol agent against Fusarium

oxysporum f. sp. adzuki and Pythium arrhenomanes and as a growth promotor in

soybean. Crop Protection 29: 1452-1459.

132

Jones HA, Mann LK. 1963. Onions and their Allies: Botany Cultivation, and

Utilization. London, England: Leonard Hill [Books] Limited.

Kawamoto SO, Lorbeer JW. 1976. Protection of onion seedling from Fusarium

oxysporum f. sp. cepae by seed and soil infestation with Pseudomonas cepacia

[Fungus diseases, biological control]. Plant Disease Reporter (USA).

Kehr AE, O’Brien MJ, Davis EW. 1962. Pathogenicity of Fusarium oxysporum f. sp.

cepae and its interaction with Pyrenochaeta terrestris on onion. Euphytica 11:

197-208.

Klokočar-Šmit ZD, Lević JT, Maširević SN, Grozdanović-Varga JM, Vasić MA,

Aleksić SR. 2008. Fusarium rot of onion and possible use of bioproduct.

Proceedings for Natural Sciences, Matica Srpska Novi Sad 114: 135-148.

Kubicek CP, Komon-Zelazowska M, Druzhinina IS. 2008. Fungal genus

Hypocrea/Trichoderma: from barcodes to biodiversity. Journal of Zhejiang

University Science B 9: 753-763.

Larkin RP, Fravel DR. 1998. Efficacy of various fungal and bacterial biocontrol

organisms for control of Fusarium wilt of tomato. Plant Disease 82: 1022-1028.

133

Leslie JF. 1993. Fungal vegetative compatibility. Annual Review of Phytopathology

31: 127-150.

Linderman RG, Davis EA. 2004. Evaluation of commercial inorganic and organic

fertilizer effects on arbuscular mycorrhizae formed by Glomus intraradices.

HortTechnology 14: 196-202.

Lotrario JB, Stuart BJ, Lam T, Arands RR, O’Connor OA, Kosson DS. 1995. Effects

of sterilization methods on the physical characteristics of soil: Implications for

sorption isotherm analyses. Bulletin of Environmental Contamination and

Toxicology 54: 668-675.

Malathi S, Mohan S. 2011. Evaluation of biocontrol agents and organic amendments

against onion basal rot caused by Fusarium oxysporum f. sp. cepae. Madras

Agricultural Journal 98: 382-385.

Mandeel Q, Baker R. 1990. Mechanisms involved in biological control of Fusarium

wilt of cucumber with strains of nonpathogenic Fusarium oxysporum.

Phytopathology 81: 462-469.

Martin KJ, Rygiewicz PT. 2005. Fungal-specific PCR primers developed for analysis

of the ITS region of environmental DNA extracts. BMC Microbiology 5: doi:

10.1.1186/1471-2180-5-28

134

Martinez-Toledo MV, Salmeron V, Rodelas B, Pozo C, Gonzalez-Lopez J. 1998.

Effects of the fungicide Captan on some functional groups of soil microflora.

Applied Soil Ecology 7: 245-255.

Matarese F, Sarrocco S, Gruber S, Seidl-Seiboth V, Vannacci G. 2012. Biocontrol of

Fusarium head blight: interactions between Trichoderma and mycotoxigenic

Fusarium. Microbiology 158: 98-106.

McNamara NP, Black HIJ, Beresford NA, Parekh NR. 2003. Effects of acute gamma

irradiation on chemical, physical and biological properties of soils. Applied Soil

Ecology 24: 117-132.

Mill JH, Giddens, Foster AA. 1987. Trichoderma virens. Beihefte zur Nova Hedwigia

87: 288.

Minerdi D, Bossi S, Gullino ML, Garibaldi A. 2008. Volatile organic compounds: a

potential direct long-distance mechanism for antagonistic action of Fusarium

oxysporum strain MSA 35. Environmental Microbiology 11: 844-854.

Mokhtar H, Dehimat L. 2015. In vitro and in vivo efficienct of Trichoderma

harzianum against Phoma and Glocladium soft rot occurred on tomato fruits

135

(Lycopersicon esculentum). International Journal of Current Microbiology and

Applied Sciences 4: 141-147.

Mortuza MG, Ilag LL. 1999. Potential for biocontrol of Lasiodiplodia theobromae

(Pat.) Griff. & Maubl. in banana fruits by Trichoderma species. Biological

Control 15: 235-240.

Mukherjee PK, Raghu K. 1997. Effect of temperature on antagonistic and biocontrol

potential of shape Trichoderma sp. on Sclerotium rolfsii. Mycopathologia 139:

151-155.

O’Donnell K, Cigelnik E, Nirenberg HI. 1998. Molecular systematics and

phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465-

493.

O’Donnell K, Gueidan C, Sink S, Johnston PR, Crous PW, Glenn A, Riley R,

Zitomer NC, Colyer P, Waalwijk C, van der Lee T, Moretti A, Kang S, Kim H,

Geiser DM, Juba JH, Baayen RP, Cromey MG, Bithell S, Sutton DA, Skovgaard

K, Ploetz R, Kistler HC, Elliott M, Davis M, Sarver BAJ. 2009. A two-locus

DNA sequence database for typing plant and human pathogens within the

Fusarium oxysporum species complex. 2009. Fungal Genetics and Biology 46:

936-948.

136

O’Donnell K, Ward TJ, Robert VARG, Crous PW, Geiser DM, Kang S. 2015. DNA

sequence-based identification of Fusarium: Current status and future directions.

Phytoparasitica 43: 583-595.

Ommati F, Zaker M. 2012a. Evaluation of some Trichoderma isolates for biological

control of potato wilt disease (Fusarium oxysporum) under laboratory and

greenhouse conditions. Journal of Crop Protection 1: 279-286.

Ommati F, Zaker M. 2012b. In vitro and greenhouse evaluations of Trichoderma

isolates for biological control of potato wilt disease (Fusarium solani). Archives

of Phytopathology and Plant Protection 45: 1715-1723.

Özer N, Koç M, Der B. 2009. The sensitivity of Aspergillus niger and Fusarium

oxysporum f. sp. cepae to fungistasis in onion-growing soils. Journal of Plant

Pathology 91: 401-410.

Plenchette C, Perrin R. 1992. Evaluation in the greenhouse of the effects of

fungicides on the development of mycorrhiza on leek and wheat. Mycorrhiza 1:

59-62.

Puhalla JE. 1985. Classification of strains of Fusarium oxysporum on the basis of

vegetative compatibility. Canadian Journal of Botany 63: 179-183.

137

Rahman MA, Begum MF, Alam MF. 2009. Screening of Trichoderma isolates as a

biological control agent against Ceratocystis paradoxa causing pineapple disease

of sugarcane. Mycobiology 37: 277-285.

Reino JL, Guerrero RF, Hernández-Galán R, Collado IG. 2008. Secondary

metabolites from species of the biocontrol agent Trichoderma. Phytochemistry

Reviews 7: 89-123.

Rose S, Parker M. 2003. Efficacy of biological and chemical treatments for control of

Fusarium root and stem rot on greenhouse cucumber. Plant Disease 87: 1462-

1470.

Samson RA, Houbraken J, Thrane U, Fridvad JC, Anderson B. 2010. Food and

Indoor Fungi. CBS Laboratory Manual Series, vol. 2. CBS-KNAW Fungal

Biodiversity Centre, Utrecht.

Samuels GJ, Nirenberg HI, Seifert KA. Perithecial species of Fusarium. In:

Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW, (eds.,)

Fusarium: Paul E. Nelson Memorial Symposium. APS Press, Saint Paul, MN: 1-

14.

138

Sasaki K, Nakahara K, Tanaka S, Shigyo M, Ito 2. 2015. Genetic and pathogenic

variability of Fusarium oxysporum f. sp. cepae isolated from onion and Welsh

onion in Japan. Phytopathology 105: 525-532.

Saxena A, Cramer CS. 2009. Screening of onion seedlings for resistance against New

Mexico isolates of Fusarium oxysporum f. sp. cepae. Journal of Plant Pathology

91: 199-202.

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque A, Chen W,

Fungal Barcoding Consortium. 2012. PNAS 109: 6241-6246.

Schroers HJ, Samuels GJ, Seifert KA, Gams W. 1999. Classification of the

mycoparasite Gliocladium roseum in Clonostachys as C. rosea, its relationships to

Bionectria ochroleuca and notes on other Gliocladium-like fungi. Mycologia 91:

365-385.

Shentu X, Zhan X, Ma Z, Yu X, Zhang C. 2014. Antifungal activity of metabolites of

the endophytic fungus Trichoderma brevicompactum from garlic. Brazilian

Journal of Microbiology 45: 248-254.

Shishido M, Miwa C, Usami T, Amemiya Y, Johnson KB. 2005. Biological control

efficiency of Fusarium wilt of tomato by nonpathogenic Fusarium oxysporum Fo-

B2 in different environments. Phytopathology 95: 1072-1080.

139

Sivan A, Chet I. 1989. Degradation of fungal cell walls by lytic enzymes of

Trichoderma harzianum. Journal of General Microbiology 135: 675-682.

Skidmore AM, Dickinson CH. 1976. Colony interactions and hyphal interference

between Septoria nodorum and phylloplane fungi. Transactions of the British

Mycological Society 66: 57-64.

Snyder WC, Hansen HN. 1940. The species concept in Fusarium. American Journal

of Botany 27: 64-67.

Taylor A, Vagany V, Jackson AC, Harrison RJ, Rainoni A, Clarkson JP. 2016.

Identification of pathogenicity-related genes in Fusarium oxysporum f. sp. cepae.

Molecular Plant Pathology 17: 1032-1047.

Taylor A, Vagany V, Barbara DJ, Thomas B, Pink DAC, Jones JE, Clarkson JP.

2013. Identification of differential resistance to six Fusarium oxysporum f. sp.

cepae isolates in commercial onion cultivars through the development of a rapid

seedling assay. Plant Pathology 62: 103-111.

Vinale F, Sivasithamparam K, Ghisalberti EL, Marra R, Woo SL, Lorito M. 2008.

Trichoderma-plant-pathogen interactions. Soil Biology & Biochemistry 40: 1-10.

140

Xu J. 2016. Fungal DNA barcoding. Genome 59: 913-932.

Yan K, Dickman MB. 1996. Isolation of a β-tubulin gene from Fusarium moniliforme

that confers cold-sensitive benomyl resistance. Applied and Environmental

Microbiology 62: 3053-3056.

Yoo SJ, Watanabe H, Kobayashi K, Ogoshi A, Kodama F. 1993. Vegetative

compatibility grouping of formae speciales of Fusarium oxysporum pathogenic to

the Liliaceae. Japanese Journal of Phytopathology 59: 3-9.

Zhang L, Khabbaz SE, Wang AM, Li H, Abbasi PA. 2015. Detection and

characterization of broad-spectrum anti-pathogen activity of novel rhizobacterial

isolates and suppression of Fusarium crown and root rot disease of tomato.

Journal of Applied Microbiology 118: 685-703.

141

Appendix A

1 L Media recipes DG18 DPYA MEA SNA

10 g glucose 5 g dextrose 15 g malt extract 1 g KH2PO4 5 g peptone 5 g oxgall *25 mg streptomycin 1 g KNO3 1 g KH2PO4 2 g yeast extract *25 mg penicillin 0.6 g 1 N NaOH 0.5 g MgSO4 1 g peptone 20 g agar 0.5 g MgSO4 · 7H2O 0.002 g dichloran 1 g NH4NO3 0.5 g KCl **220 mL glycerol 1 g K2HPO4 PDA 0.2 g glucose 15 g agar 1 g sodium 39 g potato dextrose 0.2 g sucrose propionate 0.5 g agar mixture 23 g agar MgSO4 *25 mg streptomycin 0.01 g FeCl3 · 6H2O *25 mg penicillin *30 mg streptomycin *30 mg penicillin 20 g agar *Antibiotics added post-autoclaving when used; both antibiotics always used together: streptomycin sulfate (AMRESCO, Solon, OH); penicillin G potassium salt (SIGMA-ALDRICH Co., St. Louis, MO). **Liquid medium gently heated prior to autoclaving to dissolve glycerol

142