DOCSLIB.ORG

Golden Rice: a Product-Development Partnership in Agricultural Biotechnology and Humanitarian Licensing

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Golden Rice: a Product-Development Partnership in Agricultural Biotechnology and Humanitarian Licensing CASE STUDY 3 Golden Rice: A Product-Development Partnership in Agricultural Biotechnology and Humanitarian Licensing IP (intellectual property) constraints are often per- only two genes, phytoene synthase (psy) and phytoene ceived as barriers to market entry, especially when it desaturase (crt I), the pathway is reconstituted and comes to developing countries. This case study exam- beta-carotene accumulates in the endosperm (the en- ines the IP management component in the develop- dosperm being the edible part of the grain).3 ment of Golden Rice1 (or beta-carotene-containing rice) and the transfer and introduction of Golden Rice IntellEctual PRoperty to developing countries. Features oF the case Rice, one of the most widely grown food crops, The development of Golden Rice led to a significant contains neither vitamin A nor beta-carotene, yet it change in the relationship between the public sec- is a staple food crop for billions of people, especially tor and intellectual property. A freedom to operate in Asia. Here, and in other developing countries, vita- (FTO) review of pro-Vitamin A-containing Golden min A deficiency (VAD) is a major problem affecting Rice was commissioned by the International Rice primarily children under age five and pregnant and Research Institute, a center of the Consultative Group lactating women. Thousands of impoverished people on International Agricultural Research (CGIAR), lose their eyesight because of VAD. Severe VAD (xe- with funding from the Rockefeller Foundation (led rophthalmia, or night blindness) leads to permanent by one of us [AK]). The review showed that about 70 blindness: 500,000 people, 250,000 of them children, patents and patent applications were applicable to the lose their sight every year due to VAD.2 The deficiency improved rice when all patents issued in or applied also leads to a depressed immune system that increases for in all countries, including patents on commer- the incidence and severity of infectious diseases and cially accessed research tools, were considered.4 The infant mortality rates. published analysis also showed, in accordance with There are several avenues for mitigating VAD, in- analysis by Zeneca (which later merged with Novartis cluding programs to fortify food with vitamin A and to form Syngenta) that, in practice, only a few, if any, beta-carotene and to distribute vitamin A supplements patents pertaining to Golden Rice were applicable in to affected populations. For the supplement distribu- developing countries, together with a few material tion, more than US$100 million are spent every year. transfer agreements. An alternative, and complementary, approach is to in- sert relevant genes in rice. This allows farmers to grow Obtaining Freedom to Operate beta-carotene-rich rice. By enhancing those varieties Fortunately, these potential—and arguably perceived— primarily grown or consumed by poor people, beta- constraints were resolved in a few months in the year carotene can be delivered at essentially no cost once 2000 by a straightforward IP management strategy the Golden Rice has been developed and bred into lo- comprising four goals: cal varieties. • identification of major IP components (the Interestingly, rice plants synthesize beta-caro- above-mentioned FTO review) tene in foliage and other parts of the plant, but not • interpretation, with Zeneca, of the relevance of in the grain, and all but two steps of the biosynthetic the FTO review to the proposed humanitarian pathway are present in the grain. By the addition of use in developing countries Krattiger A and I Potrykus. 2007. Golden Rice: A Product-Development Partnership in Agricultural Biotechnology and Hu- manitarian Licensing. In Executive Guide to Intellectual Property Management in Health and Agricultural Innovation: A Handbook of Best Practices (eds. A Krattiger, RT Mahoney, L Nelsen, et al.). MIHR: Oxford, U.K., and PIPRA: Davis, U.S.A. Avail- able online at www.ipHandbook.org. © 2007. A Krattiger and I Potrykus. Sharing the Art of IP Management: Photocopying and distribution through the Internet for noncommercial purposes is permitted and encouraged. HANDBOOK OF BEST PRACTICES: EXECUTIVE GUIDE | CS 11 CASE STUDY 3 • in licensing for humanitarian use, led by Zeneca, • The technology must be introduced into public of IP components it did not already own seed varieties, as a way to optimize public sector • licensing by Zeneca, as Syngenta, via the inven- benefit and use. tors of the assembled (or bundled) intellectual • No technology fee (or surcharge) may be property to public sector institutions in devel- charged for Golden Rice, as a way to optimize oping countries that could use the rights for the public sector benefits. benefit of resource-poor farmers, and others, • Sale of Golden Rice is authorized by farmers, as deficient in vitamin A a way to reach urban poor. • Farmers are allowed to reuse harvested seeds. The patented key technologies for Golden Rice • Golden Rice may not be released in a country production include core patents related to the specific that lacks biosafety regulations and where of- biosynthetic pathway. These patents were filed by the ficial government review has not been made to inventors, Potrykus and Beyer. Their work built on ensure health and environmental safety. myriad other technologies that were published in is- • Export of Golden Rice is not permitted, except sued patent documents and scientific literature. These to other licensees for humanitarian research and core patents were licensed to Zeneca, which already subsequent use. (Export of crops is a commer- owned its own plant-biotechnology-related patents. cial activity. The purpose of the humanitarian Zeneca then negotiated access to all possibly necessary project is to assist resource-poor people in over- patents, including intellectual property from Bayer coming VAD). AG, MonsantoCompany, Novartis AG, Orynova BV, • With regard to improvements to the Golden and Zeneca Mogen BV. Rice technology: All of these companies, including Zeneca (which, o Humanitarian use of any improvements to coincidentally, almost immediately merged with Golden Rice is guaranteed under the same Novartis Agribusiness to form Syngenta), provided terms of the original agreement (and thus access to their technologies, free of charge, for de- any improvements to the technology will fined humanitarian research and use of Golden Rice serve the humanitarian purpose). Syngenta in developing countries. It is important to note that, has acted on this—donating to the humani- contrary to what many commentators state, the licens- tarian project new transformations, includ- ing process was relatively uncomplicated, with the in- ing the intellectual property and results re- volvement of commercially experienced people. ported in Paine and colleagues.5 o Commercial rights to improvements of the Licensing technology are granted back to Syngenta. Within a short time, 16 further licenses, including li- • No warranties are given by the licensor or licen- censes with the right to further sublicense (for example, sors (as is common for licenses), and each party the license issued to IRRI), were issued to public sec- is responsible for what it controls. tor licensees. Thus national programs in Bangladesh, China, India, Indonesia, the Philippines, South Africa, and Vietnam obtained licenses for use of the technol- KEy lESSonS lEARnED ogy in local rice varieties important in VAD areas. The rapid resolution of the IP constraints surrounding Golden Rice demonstrated, first of all, how effective IP Terms of the humanitarian license agreement management, coupled with strong collaborations be- The Golden Rice Humanitarian Board, although not tween the public and private sectors, can help achieve a legal entity, provides a forum for discussion of stra- global access to new technologies and products for tegic and tactical issues relating to the humanitarian humanitarian goals. The IP constraints identified by project. Both Potrykus and Beyer have the right to is- Kryder and colleagues6 did not delay the development sue licenses. Two licensees also have that right, as does of the product, and their clarification and resolution Syngenta, which has not exercised its right. All the li- required only managerial and influencing skills and censes are in the same form, as proposed by Syngenta the resulting goodwill of IP owners. and agreed to by the inventors. More specifically, three specific lessons have been The essential elements of the licenses include the learned: following points: 1. Intellectual property and patents did not delay • Syngenta retains commercial rights, although it the development and introduction of Golden has no current plans to commercialize Golden Rice by a single day. Notwithstanding this, the Rice. Humanitarian use, and research leading resolution of the potential IP constraints could to it, is allowed. not be ignored. • Humanitarian use is defined as use in develop- 2. Other constraints are much more critical to the ing countries by resource-poor farmers (earning introduction of Golden Rice, in particular, and less than US$10,000 per year from farming). to potentially life-saving food biotechnology CS 12 | HANDBOOK OF BEST PRACTICES: EXECUTIVE GUIDE CASE study 3 applications, in general. These constraints are, relationships with the private sector, and between the in decreasing order of importance: public sector institutions, are critical components of • the necessity of governments to establish the utilization of intellectual property
Load more

Recommended publications
  • Controlling Pregnancy: Fred Lyman Adair and the Influence of Eugenics on the Development of Prenatal Care
    Yale University EliScholar – A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2019 Controlling Pregnancy: Fred Lyman Adair And The nflueI nce Of Eugenics On The evelopmeD nt Of Prenatal Care Florence Hsiao Follow this and additional works at: https://elischolar.library.yale.edu/ymtdl Recommended Citation Hsiao, Florence, "Controlling Pregnancy: Fred Lyman Adair And The nflueI nce Of Eugenics On The eD velopment Of Prenatal Care" (2019). Yale Medicine Thesis Digital Library. 3504. https://elischolar.library.yale.edu/ymtdl/3504 This Open Access Thesis is brought to you for free and open access by the School of Medicine at EliScholar – A Digital Platform for Scholarly Publishing at Yale. It has been accepted for inclusion in Yale Medicine Thesis Digital Library by an authorized administrator of EliScholar – A Digital Platform for Scholarly Publishing at Yale. For more information, please contact [email protected]. Controlling Pregnancy: Fred Lyman Adair and the Influence of Eugenics on the Development of Prenatal Care A Thesis Submitted to the Yale University School of Medicine In Partial Fulfillment of the Requirements for the Degree of Doctor of Medicine By Florence Hsiao Class of 2019 Abstract This thesis examines the development of prenatal care in the United States in the early 1900s by focusing on the life and career of Fred Lyman Adair who, as an obstetrician and eugenicist, played a significant role in shaping prenatal care into what it is today. Although prenatal care was a product of infant welfare activists and public health officials, obstetricians like Adair who struggled to establish obstetrics as a legitimate specialty, saw an opportunity in prenatal care to pathologize pregnancy and elevate their specialty.
    [Show full text]
  • An Overview: Innovation in Plant Breeding
    An Overview: Innovation in Plant Breeding Modern plant breeding blends traditional ways of developing crops with the latest in science and technology to achieve improved crops – enabling more choices for both farmers and consumers, and producing crops that can better cope with evolving pests, diseases and a changing climate. The Basics What: The simplest definition of plant breeding is crossing two plants Most of the fruits, vegetables, and to produce offspring that share the best characteristics of the two grains that we eat today are the parent plants. Breeders make crosses then select which offspring to advance in the pipeline based on their desired characteristics. result of generations of plant breeding. About 5,000 years ago, Why: Even the earliest farmers understood that, in order to survive, watermelons were only they needed plant varieties specifically adapted to their environmental conditions and cultivated to produce the best foods to nourish their 2 inches in diameter livestock and communities. and had a bitter taste, vastly How: Through generations of research and discovery, plant breeding has advanced beyond selecting a parent plant simply based on its different from appearance. It now includes an in-depth understanding of plants’ the large, genetic makeup, enabling breeders to better predict which plants will sweet-tasting have the highest probability of success in the field and the grocery fruit we enjoy store before making a cross. today. The Background The earliest farmers were plant breeders who understood the value of identifying crops that showed beneficial characteristics to plant in future seasons. Later, they learned they could cross two plants to develop an even better plant.
    [Show full text]
  • The Debate on the Golden Rice and Its Background
    The Debate on the Golden Rice and its Background A Literature Review Klaus Ammann, [email protected] Dedicated to the inventor and relentless promoter of Golden Rice, Ingo Potrykus Judge GM crops on their properties, not the technique used to make them – and we can start saving lives Editorial help: Vivian Moses, Patrick and Michael Moore 20140615 references numbered with full text links Millions of children die worldwide every year, an untenable situation that is still worsening which needs immediate correction. According to the World Health Organization (1), an estimated 250 million preschool children are vitamin A deficient (= VAD) and it is likely that in VAD areas a substantial proportion of pregnant women are also affected in 2013. Earlier reports (2) make evident that the problems are still growing: (in 2004: 140 million preschool children and more than 7 million pregnant women were suffering from VAD) 2 Preface It is not the intention of the author for this literature compilation on Golden Rice to replace the two websites www.goldenrice.org and www.allowgoldenricenow.org, they contain major information pieces, are well organized and specific information is easy to access. Rather it is the aim here to pull together a set of publications related to the background of the Golden Rice debate. We often are confronted with all kinds of determined opinions about the Golden Rice, Bio-Fortification, Transgenic Plants, Traditional and Organic Agriculture etc. and it is the purpose of this summary to shed light to the background of opinions pro and contra the Golden Rice – on how and why those opinions grow and how they are unfortunately melting down into simplistic slogans.
    [Show full text]
  • View Presentation
    Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva1 Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda Sanofi Novartis AstraZeneca Roche Otsuka Johnson & Johnson Otsuka Abbott Teva Amgen Daiichi Sankyo Bayer Boehringer Ingelheim Merck & Co Eli Lilly Bristol-Myers Squibb Novo Nordisk Pfizer GlaxoSmithKline Takeda
    [Show full text]
  • Bayer Cropscience Contaminates Our Rice
    Bayer e CropScience contaminates our rice greenpeace.org Campaigning for Sustainable Agricultur Greenpeace is an independent global campaigning organisation that acts to change attitudes and behaviour, to protect and conserve the environment and to promote peace. Contents A Contamination Nightmare 3 US Export markets impacted by GE contamination 4 Key dates in the LL rice scandals 5 The situation now 6 LL601 and other Bayer GE rice varieties 7 Should consumers be worried about eating LL rice? 7 Contamination threats 8 Bayer CropScience 9 Rice facts 9 Securing a Healthy Industry - Conclusion and Demands 10 End Notes 11 For more information contact: [email protected] JN 085 Published in October 2007 by Greenpeace International Ottho Heldringstraat 5 1066 AZ Amsterdam The Netherlands Tel: +31 20 7182000 Fax: +31 20 5148151 greenpeace.org Cover image: ©Greenpeace/Novis Bayer CropScience contaminates our rice The following is a summary of events Japan and Korea imposed equally strict testing requirements, surrounding one of the worst cases of genetic followed some months later by the Philippines when engineering contamination of food in history Greenpeace revealed contamination there. Russia and Bulgaria imposed bans on US rice and Mexico, Iraq and and one of the most damaging events in the Canada imposed test and certification requirements on history of the US rice industry. imports. The United Arab Emirates required a GE free guarantee. (5) The devastation has been caused by the multinational company Bayer CropScience - which maintains that the contamination As of July 2007, Greenpeace has identified 30 countries wasn't their fault - it was an 'act of God'.
    [Show full text]
  • (Genetically Modified Organisms (Plants) Genetically Engineered Plants)) Why Create Transgenic Plants?
    Transgenic Plants (Genetically modified organisms (plants) Genetically engineered plants)) Why create transgenic plants? When there is no naturally occurring genetic variation for the target trait. Examples: 1. Glyphosate herbicide resistance in soybean, corn 2.Vitamin A in rice 3.Blue roses What genes to transfer? 1. One gene to a few genes - the CP4 ESPS example 2. Multiple genes - Golden Rice and Applause rose 3. In principle, any gene (or genes) ORIGIN 1 cctttcctac tcactctgga caggaacagc tgtctgcagc cacgccgcgc ctgagtgagg 61 agaggcgtag gcaccagccg aggccaccca gcaaacatct atgctgactc tgaatgggcc 121 cagtcctccg gaacagctcc ggtagaagca gccaaagcct gtctgtccat ggcgggatgc 181 cgggagctgg agttgaccaa cggctccaat ggcggcttgg agttcaaccc tatgaaggag 241 tacatgatct tgagtgatgc gcagcagatc gctgtggcgg tgctgtgtac cctgatgggg 301 ctgctgagtg ccctggagaa cgtggctgtg ctctatctca tcctgtcctc gcagcggctc CP4 EPSPS: The gene conferring resistance to the herbicide Roundup The gene was found in Agrobacterium tumefaciens and transferred to various plants Coincidentally, this organism is also used for creating transgenic plants TGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAG ATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGA CGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAG CTGACTCTAGCAGATCTTTCAAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACC CCAAGTTCCTAAATCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTCAATT
    [Show full text]
  • Agribusiness and Antitrust: the Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union
    The Global Business Law Review Volume 7 Issue 1 Article 9 7-1-2018 Agribusiness and Antitrust: The Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union Aleah Douglas Cleveland-Marshall College of Law Follow this and additional works at: https://engagedscholarship.csuohio.edu/gblr Part of the Antitrust and Trade Regulation Commons, and the Business Organizations Law Commons How does access to this work benefit ou?y Let us know! Recommended Citation Aleah Douglas, Agribusiness and Antitrust: The Bayer-Monsanto Merger, Its Legality, and Its Effect on the United States and European Union, 7 Global Bus. L. Rev. 156 (2018) available at https://engagedscholarship.csuohio.edu/gblr/vol7/iss1/9 This Note is brought to you for free and open access by the Journals at EngagedScholarship@CSU. It has been accepted for inclusion in The Global Business Law Review by an authorized editor of EngagedScholarship@CSU. For more information, please contact [email protected]. AGRIBUSINESS AND ANTITRUST: THE BAYER-MONSANTO MERGER, ITS LEGALITY, AND ITS EFFECT ON THE UNITED STATES AND EUROPEAN UNION ALEAH DOUGLAS I. INTRODUCTION……………………………………………………………………... 157 II. BACKGROUND…………………………………………………………………….....158 A. A Review of the Bayer-Monsanto Merger………………………….…………... 158 B. United States Antitrust Laws…………………………………………………… 161 1. The Applicable Laws……………………………………………………. 161 2. Problems and Antitrust Violations……………………………………… 166 3. American Agribusiness…………………………………………………. 167 C. European Union Antitrust Laws……………………………………………….. 172 1. The European Union……………………………………………………. 172 2. The Applicable Laws………………………………….………………… 172 3. Problems and Antitrust Violations……………………….………....…... 174 4. European Union Agribusiness…………….…………………………….. 176 D. Illegality and Detriment …………………………………….…………………. 178 III. CONCLUSION……………………………………………………………………....... 180 ABSTRACT This note examines the current and historical antitrust laws of the United States and the European Union as they relate to the currently pending merger between Bayer and Monsanto.
    [Show full text]
  • Feeding the World a Look at Biotechnology and World Hunger
    Feeding the World A LOOK AT BIOTECHNOLOGY & WORLD HUNGER A brief prepared by the Pew Initiative on Food and Biotechnology MARCH 2004 Pew Initiative on Food and Biotechnology 1331 H Street, NW, Suite 900 Washington, DC 20005 phone 202-347-9044 fax 202-347-9047 www.pewagbiotech.org © 2004 Pew Initiative on Food and Biotechnology. All rights reserved. No portion of this paper may be reproduced by any means, electronic or mechanical, without permission in writing from the publisher. This report was support- ed by a grant from the Pew Charitable Trusts to the University of Richmond. The opinions expressed in this report are those of the authors and do not necessarily reflect the views of the Pew Charitable Trusts or the University of Richmond. 3 Preface One of the most controversial issues surrounding geneti- cally modified foods is whether biotechnology can help address the urgent problems of global hunger. According to the Food and Agriculture Organization of the United Nations, the number of chronically undernourished peo- ple in developing nations has risen in recent years to 798 million. Proponents of biotechnology argue that it offers the best prospect for helping less developed nations feed their hungry citizens by improving plant genetics to increase crop yields, in the same way that improved rice and wheat varieties led to the Green Revolution beginning in the 1960s. Critics respond that genetically modified foods pose risks to human health and the environment. Both sets of arguments are embedded in the context of broader and deeper conflicts over development, global- ization, and the role of technology in agriculture.
    [Show full text]
  • Which of the 'Following Is True for Golden Rice' ? (A) It Has Yellow Grains, Because of a Gene Introduced from a Primitive Varie
    NEET REVISION SERIES BIOTECHNOLOGY AND ITS APPLICATIONS Revise Most Important Questions to Crack NEET 2020 Download Doubtnut Now Q-1 - 10761395 Which of the 'following is true for Golden rice' ? (A) It has yellow grains, because of a gene introduced from a primitive variety of rice (B) It is Vitamin A enriched, with a gene from daffodil (C) It is pest resistant, with a gene from Bacillus thuringiensis (D) It is drought tolerant, developed using Agrobacterium vector CORRECT ANSWER: B SOLUTION: Gene for β carotene is taken from daffodil plant and inserted in normal rice plant to make golden rice Watch Video Solution On Doubtnut App Q-2 - 26089157 The first clinical gene therapy was done for the treatment of (A) AIDS (B) Cancer (C) Cystic fibrosis (D) SCID (Severe Combined lmmuno Deficiency) resulting from the deficiency of ADA. SOLUTION: The first clinical gene therapy was done for the treatment of SCID (Severe Combined) immuno Deficiency resulting from the deficiency of ADA. The SCID patient has a defectiv e gene for the enzyme Adenosine Deaminase (ADA). Due to which he/she lacks functional T-lymphocytes and therefore fails to fight the infecting pathogen. Watch Video Solution On Doubtnut App Q-3 - 10761356 What triggers activation of protoxin to active toxin of Bacillus thuringiensis in boll worm (A) Acidic pH of stomach (B) Body temperature (C) Moist surface of midgut (D) Alkaline pH of gut CORRECT ANSWER: D Watch Video Solution On Doubtnut App Q-4 - 18928062 Which of the flowing has the ability to transform normal cell into cancerous cell in animal (A) Arbovirus (B) Rotavirus (C) Enterovirus (D) Retrovirus CORRECT ANSWER: C Watch Video Solution On Doubtnut App Q-5 - 40481518 In nematode resistance by RNA interference, some specific genes were introduced which form dsRNA.
    [Show full text]
  • Case M.8851 – BASF / BAYER DIVESTMENT BUSINESS
    EUROPEAN COMMISSION DG Competition Case M.8851 – BASF / BAYER DIVESTMENT BUSINESS Only the English text is available and authentic. REGULATION (EC) No 139/2004 MERGER PROCEDURE Decision on the implementation of the commitments - Purchaser approval Date: 07/11/2018 EUROPEAN COMMISSION Brussels, 07.11.2018 C(2018) 7488 final PUBLIC VERSION In the published version of this decision, some information has been omitted pursuant to Article 17(2) of Council Regulation (EC) No 139/2004 concerning non-disclosure of business secrets and other confidential information. The omissions are shown thus […]. Where possible the information omitted has been replaced by ranges of figures or a general description. To the notifying party Dear Sir/Madam, Subject: Case M.8851 – BASF / Bayer Divestment Business Approval of Syngenta Crop Protection AG as purchaser of the [NSH line of research 1 remedy package], following your letter of 13 September 2018 and the Trustee’s opinion of 18 October 2018 FACTS AND PROCEDURE 1. By decision of 30 April 2018 (the "Decision") pursuant to Article 6(1)(b) in conjunction with Article 6(2) of Council Regulation (EC) No 139/2004 of 20 January 2004 on the control of concentrations between undertakings1 (the "Merger Regulation"), the Commission declared the acquisition of assets of Bayer Aktiengesellschaft (the "Bayer Divestment Business") by BASF SE ("BASF") compatible with the internal market subject to full compliance with the commitments submitted by BASF, which were annexed to the Decision (the "Commitments"). 2. In particular, pursuant to the Decision, the Commitments provide that in order to address the serious doubts raised by the combination of BASF's and the Bayer Divestment Business' activities in certain nematicide markets as well as in weed management innovation, BASF would divest (i) its Trunemco nematicide (the "Trunemco Assets") as well as, separately, (ii) a package of data and intellectual 1 OJ L 24, 29.01.2004, p.
    [Show full text]
  • The Bio Revolution: Innovations Transforming and Our Societies, Economies, Lives
    The Bio Revolution: Innovations transforming economies, societies, and our lives economies, societies, our and transforming Innovations Revolution: Bio The The Bio Revolution Innovations transforming economies, societies, and our lives May 2020 McKinsey Global Institute Since its founding in 1990, the McKinsey Global Institute (MGI) has sought to develop a deeper understanding of the evolving global economy. As the business and economics research arm of McKinsey & Company, MGI aims to help leaders in the commercial, public, and social sectors understand trends and forces shaping the global economy. MGI research combines the disciplines of economics and management, employing the analytical tools of economics with the insights of business leaders. Our “micro-to-macro” methodology examines microeconomic industry trends to better understand the broad macroeconomic forces affecting business strategy and public policy. MGI’s in-depth reports have covered more than 20 countries and 30 industries. Current research focuses on six themes: productivity and growth, natural resources, labor markets, the evolution of global financial markets, the economic impact of technology and innovation, and urbanization. Recent reports have assessed the digital economy, the impact of AI and automation on employment, physical climate risk, income inequal ity, the productivity puzzle, the economic benefits of tackling gender inequality, a new era of global competition, Chinese innovation, and digital and financial globalization. MGI is led by three McKinsey & Company senior partners: co-chairs James Manyika and Sven Smit, and director Jonathan Woetzel. Michael Chui, Susan Lund, Anu Madgavkar, Jan Mischke, Sree Ramaswamy, Jaana Remes, Jeongmin Seong, and Tilman Tacke are MGI partners, and Mekala Krishnan is an MGI senior fellow.
    [Show full text]
  • From Disagreements to Dialogue: Unpacking the Golden Rice Debate
    Sustainability Science https://doi.org/10.1007/s11625-018-0577-y REVIEW ARTICLE From disagreements to dialogue: unpacking the Golden Rice debate Annika J. Kettenburg1,2 · Jan Hanspach1 · David J. Abson1 · Joern Fischer1 Received: 20 May 2017 / Accepted: 4 May 2018 © The Author(s) 2018 Abstract Transgenic Golden Rice has been hailed as a practical solution to vitamin A deficiency, but has also been heavily criticized. To facilitate a balanced view on this polarized debate, we investigated existing arguments for and against Golden Rice from a sustainability science perspective. In a structured literature review of peer-reviewed publications on Golden Rice, we assessed to what extent 64 articles addressed 70 questions covering different aspects of sustainability. Using cluster analysis, we grouped the literature into two major branches, containing two clusters each. These clusters differed in the range and nature of the sustainability aspects addressed, disciplinary affiliation and overall evaluation of Golden Rice. The ‘biotechnological’ branch (clusters: ‘technical effectiveness’ and ‘advocacy’) was dominated by the natural sciences, focused on biophysi- cal plant-consumer interactions, and evaluated Golden Rice positively. In contrast, the ‘socio-systemic’ branch (clusters: ‘economic efficiency’ and ‘equity and holism’) was primarily comprised of social sciences, addressed a wider variety of sustainability aspects including participation, equity, ethics and biodiversity, and more often pointed to the shortcomings of Golden Rice. There were little to no integration efforts between the two branches, and highly polarized positions arose in the clusters on ‘advocacy’ and ‘equity and holism’. To explore this divide, we investigated the influences of disciplinary affiliations and personal values on the respective problem framings.
    [Show full text]