DOCSLIB.ORG

A New Class of Anticancer Alkylphospholipids Uses Lipid Rafts As Membrane Gateways to Induce Apoptosis in Lymphoma Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A New Class of Anticancer Alkylphospholipids Uses Lipid Rafts As Membrane Gateways to Induce Apoptosis in Lymphoma Cells 2337 A new class of anticancer alkylphospholipids uses lipid rafts as membrane gateways to induce apoptosis in lymphoma cells Arnold H. van der Luit,1 Stefan R. Vink,2 induction and alleviated the inhibition of phosphatidyl- Jeffrey B. Klarenbeek,1 Daniel Perrissoud,4 choline synthesis. Uptake of all alkylphospholipids was Eric Solary,5 Marcel Verheij,1,3 inhibited by small interfering RNA (siRNA)–mediated and Wim J. van Blitterswijk1 blockage of sphingomyelin synthase (SMS1), which was previously shown to block raft-dependent endocytosis. Divisions of 1Cellular Biochemistry and 2Experimental Therapy, Similar to edelfosine, perifosine accumulated in (isolated) 3Department of Radiotherapy, the Netherlands Cancer Institute, lipid rafts independent on raft sphingomyelin content per 4 Plesmanlaan 121, Amsterdam, the Netherlands; Zentaris GmbH, se. However, perifosine was more susceptible than Frankfurt am Main, Germany; and 5Institut National de la Sante et de la Recherche Medicale U866/Universite´de Bourgogne, edelfosine to back-extraction by fatty acid-free serum Laboratoire de Mort Cellulaire et Cancer, UFR de Me´decine, albumin, suggesting a more peripheral location in the cell Dijon, France due to less effective internalization. Overall, our results suggest that lipid rafts are critical membrane portals for cellular entry of alkylphospholipids depending on SMS1 Abstract activity and, therefore, are potential targets for alkyl- Single-chain alkylphospholipids, unlike conventional che- phospholipid anticancer therapy. [Mol Cancer Ther motherapeutic drugs, act on cell membranes to induce 2007;6(8):2337–45] apoptosis in tumor cells. We tested four different alkylphospholipids, i.e., edelfosine, perifosine, erucyl- Introduction phosphocholine, and compound D-21805, as inducers of apoptosis in the mouse lymphoma cell line S49. We Synthetic lipase-resistant analogues of lysophosphatidyl- compared their mechanism of cellular entry and their choline, collectively named alkylphospholipids, exert cyto- potency to induce apoptosis through inhibition of de novo toxic effects against a wide variety of tumors (1–4). The biosynthesis of phosphatidylcholine at the endoplasmic prototype of these compounds, 1-O-octadecyl-2-O-methyl- reticulum. Alkylphospholipid potency closely correlated rac-glycero-3-phosphocholine (Et-18-OCH3,edelfosine), with the degree of phosphatidylcholine synthesis inhibi- structurally resembles lysophosphatidylcholine (Fig. 1) in tion in the order edelfosine > D-21805 > erucylphos- that it has the same polar head group and a single, long phocholine > perifosine. In all cases, exogenous apolar hydrocarbon chain, which allows an easy insertion lysophosphatidylcholine, an alternative source for cellular into the plasma membrane. Whereas membrane-inserted phosphatidylcholine production, could partly rescue cells lysophosphatidylcholine undergoes rapid turnover, edelfo- from alkylphospholipid-induced apoptosis, suggesting sine with its stable ether bonds is not metabolized, leading that phosphatidylcholine biosynthesis is a direct target to accumulation in cell membranes. This interferes with for apoptosis induction. Cellular uptake of each alkyl- lipid-based signal transduction, often resulting in apoptosis phospholipid was dependent on lipid rafts because of tumor cells. In later studies, the glycerol moiety in pretreatment of cells with the raft-disrupting agents, alkylphospholipid was found not essential for the anti- methyl-B-cyclodextrin, filipin, or bacterial sphingomyeli- tumor activity. A second generation of these compounds, nase, reduced alkylphospholipid uptake and/or apoptosis therefore, comprised of phospho-ester–linked (single- chain) alkylphosphocholines and derivatives thereof. The first of these compounds, hexadecylphosphocholine (mil- tefosine), was clinically effective in patients with skin Received 3/22/07; revised 5/16/07; accepted 6/12/07. metastasis of breast cancers (2, 5) and cutaneous lympho- Grant support: Dutch Cancer Society grants NKI 2001-2570 and NKI mas (6). Erucylphosphocholine containing a much longer 2005-3377. (22-carbon) chain with a cis-13,14 double bond (Fig. 1) The costs of publication of this article were defrayed in part by the couldbeappliedi.v.andtherebyshowedimproved payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to antitumor activity with reduced hemolytic and gastroin- indicate this fact. testinal side effects (7, 8). Interestingly, it increased the Note: Current address for A. H. van der Luit: Oncodesign, 20 rue Jean cytotoxicity of ionizing radiation (9, 10). A structural Mazen, B.P. 27627, 21076 Dijon Cedex, France. analogue, octadecyl-(1,1-dimethyl-4-piperidynio-4-yl)- Requests for reprints: Wim J. van Blitterswijk, Division of Cellular phosphate (perifosine; D-21266), in which the choline head Biochemistry, the Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, the Netherlands. Phone: 31-205121976; group has been substituted by a piperidine moiety (Fig. 1) Fax: 31-205121989. E-mail [email protected] has received mounting attention as an anticancer agent, Copyright C 2007 American Association for Cancer Research. especially in combination with other pharmacologic drugs doi:10.1158/1535-7163.MCT-07-0202 (11–16) as well as with radiotherapy (4, 17–19). Mol Cancer Ther 2007;6(8). August 2007 Downloaded from mct.aacrjournals.org on October 1, 2021. © 2007 American Association for Cancer Research. 2338 Uptake of Anticancer Alkylphospholipids via Lipid Rafts In contrast to classic chemotherapeutic drugs that target Silencing of Sphingomyelin Synthase-1 by Small Inter- the DNA, alkylphospholipids act at cell membranes by fering RNA Retroviral Transduction interfering with the turnover and synthesis of natural To suppress the expression of sphingomyelin synthase-1 phospholipids and by disrupting membrane-signaling net- (SMS1), S49 cells were retrovirally transduced by small works at multiple sites, leading to cell death (3, 4, 20). For interfering RNA (siRNA), yielding S49siSMS1 cells, as de- the alkylphospholipids edelfosine and miltefosine, it has scribed previously (25). Briefly, siRNAs directed to SMS1 been shown that they induce apoptosis through the were inserted into the retroviral vector pRETRO-SUPER. inhibition of CTP:phosphocholine cytidylyltransferase Retroviral supernatants were obtained from Phoenix cells and (CT), a key enzyme in phosphatidylcholine biosynthesis used to transduce S49 cells. Stable S49siSMS1 cells were selected (21–24). To inhibit this enzyme at the endoplasmic with puromycin. The following siRNA primers were used: reticulum, alkylphospholipids need to be internalized. We sense GATCCCCGCATGGGAGTTGATTTAGATTCAAGA- have shown that edelfosine, after insertion in the plasma GATCTAAATCAACTCCCATGCTTTTTGGAAA and anti- membrane, accumulates in lipid rafts and is then internal- sense AGCTTTTCCAAAAAGCATGGGAGTTGATTTA ized by an endocytotic pathway that depends on intact rafts GATCTCTTGAATCTAAATCAACTCCCATGCGGG. For and on the activity of sphingomyelin synthase 1 (23–25). mock transfection (S49mock), scrambled RNA was used. How other alkylphospholipids are taken up by cells, their Cellular Uptake of Alkylphospholipids and Apoptosis relative potency and mechanism of apoptosis induction is Assay currently unknown. Cells were grown to a density of 2.5 Â 106/mL and Here, we compared four anticancer alkylphospholipids 14C-perifosine (0.2 ACi, 20 Amol/L) or 3H-edelfosine (0.2 ACi, (molecular structures depicted in Fig. 1) with respect to their 15 Amol/L) was added. At given time points, samples were cellular uptake, cytotoxicity, and mechanism of apoptosis taken, incubated for 2 min on ice, and washed with cold PBS. induction in mouse S49 lymphoma cells. We found that all Samples were lysed in 0.1 N NaOH for scintillation counting. alkylphospholipids use lipid rafts for internalization to For apoptosis, cells were seeded at 1.5 Â 106 cells/mL, inhibit phosphatidylcholine synthesis to varying degrees, cultured overnight, and incubated for indicated time correlating with the efficiency and persistency of cellular periods with various concentrations of alkylphospholipids. uptake and potency to induce apoptosis. Cells were washed with PBS in and lysed overnight at 4jCin 0.1% (w/v) sodium citrate, 0.1% (v/v) Triton X-100, and 50 Ag/mL propidium iodide (27). Fluorescence intensity of Materials and Methods propidium iodide–stained DNA was determined on a Reagents FACScan (Becton Dickinson Advanced Cellular Biology), Edelfosine (1-O-octadecyl-2-O-methyl-rac-glycero-3- and data analyzed using Lysis software. phosphocholine; Et-18-OCH3) was purchased from BioMol. Lipid Biosynthesis 3 3 [ H]Edelfosine ([ H]Et-18-OCH3; 40 Ci/mmol), was syn- To measure phosphatidylcholine and sphingomyelin bio- thesized by Moravek Biochemicals. The other alkylphos- synthesis, cells at 2.5 Â 106 cells/mL were incubated with pholipids (Fig. 1), perifosine (compound D-21266), [14C]choline chloride (1 ACi/mL). At given time points, octadecyl-2-(trimethylarseno)-ethyl-phosphate (compound aliquots of cell suspension were taken, washed, and resus- D-21805), erucylphosphocholine, and [14C]perifosine (30.9 pended in 200 AL PBS. Lipids were extracted with chloro- mCi/mmol), were kindly provided by Zentaris GmbH. form/methanol (1:2, v/v), and phase separation was induced [Methyl-14C]choline chloride (58 mCi/mmol) was from using 1 mol/L NaCl. The organic phase was washed in a 3 Amersham Pharmacia
Load more

Recommended publications
  • Lipid Raft-Mediated Akt Signaling As a Therapeutic Target in Mantle Cell Lymphoma
    OPEN Citation: Blood Cancer Journal (2013) 3, e118; doi:10.1038/bcj.2013.15 & 2013 Macmillan Publishers Limited All rights reserved 2044-5385/13 www.nature.com/bcj ORIGINAL ARTICLE Lipid raft-mediated Akt signaling as a therapeutic target in mantle cell lymphoma M Reis-Sobreiro1, G Roue´ 2, A Moros2, C Gajate1, J de la Iglesia-Vicente1, D Colomer2 and F Mollinedo1 Recent evidence shows that lipid raft membrane domains modulate both cell survival and death. Here, we have found that the phosphatidylinositol-3-kinase (PI3K)/Akt signaling pathway is present in the lipid rafts of mantle cell lymphoma (MCL) cells, and this location seems to be critical for full activation and MCL cell survival. The antitumor lipids (ATLs) edelfosine and perifosine target rafts, and we found that ATLs exerted in vitro and in vivo antitumor activity against MCL cells by displacing Akt as well as key regulatory kinases p-PDK1 (phosphatidylinositol-dependent protein kinase 1), PI3K and mTOR (mammalian TOR) from lipid rafts. This raft reorganization led to Akt dephosphorylation, while proapoptotic Fas/CD95 death receptor was recruited into rafts. Raft integrity was critical for Ser473 Akt phosphorylation. ATL-induced apoptosis appeared to correlate with the basal Akt phosphorylation status in MCL cell lines and primary cultures, and could be potentiated by the PI3K inhibitor wortmannin, or inhibited by the Akt activator pervanadate. Classical Akt inhibitors induced apoptosis in MCL cells. Microenvironmental stimuli, such as CD40 ligation or stromal cell contact, did not prevent ATL-induced apoptosis in MCL cell lines and patient-derived cells. These results highlight the role of raft-mediated PI3K/Akt signaling in MCL cell survival and chemotherapy, thus becoming a new target for MCL treatment.
    [Show full text]
  • Membrane Lipid Therapy: Modulation of the Cell Membrane Composition and Structure As a Molecular Base for Drug Discovery and New Disease Treatment
    Progress in Lipid Research 59 (2015) 38–53 Contents lists available at ScienceDirect Progress in Lipid Research journal homepage: www.elsevier.com/locate/plipres Review Membrane lipid therapy: Modulation of the cell membrane composition and structure as a molecular base for drug discovery and new disease treatment Pablo V. Escribá a, Xavier Busquets a, Jin-ichi Inokuchi b, Gábor Balogh c, Zsolt Török c, Ibolya Horváth c, ⇑ ⇑ John L. Harwood d, , László Vígh c, a Department of Biology, University of the Balearic Islands, E-07122 Palma de Mallorca, Spain b Division of Glycopathology, Institute of Molecular Biomembrane and Glycobiology, Tohoku Pharmaceutical University, Sendai, Japan c Institute of Biochemistry, Biological Research Center, Hungarian Academy of Sciences, Szeged, Hungary d School of Biosciences, Cardiff University, Cardiff CF10 3AX, Wales, UK article info abstract Article history: Nowadays we understand cell membranes not as a simple double lipid layer but as a collection of Received 28 January 2015 complex and dynamic protein–lipid structures and microdomains that serve as functional platforms Received in revised form 10 April 2015 for interacting signaling lipids and proteins. Membrane lipids and lipid structures participate directly Accepted 29 April 2015 as messengers or regulators of signal transduction. In addition, protein–lipid interactions participate in Available online 9 May 2015 the localization of signaling protein partners to specific membrane microdomains. Thus, lipid alterations Dedicated to the memory of our late change cell signaling that are associated with a variety of diseases including cancer, obesity, neurodegen- colleague and friend, Professor John E. erative disorders, cardiovascular pathologies, etc. This article reviews the newly emerging field of mem- Halver.
    [Show full text]
  • Epirubicin Enhances TRAIL-Induced Apoptosis in Gastric Cancer Cells by Promoting Death Receptor Clustering in Lipid Rafts
    MOLECULAR MEDICINE REPORTS 4: 407-411, 2011 Epirubicin enhances TRAIL-induced apoptosis in gastric cancer cells by promoting death receptor clustering in lipid rafts LING XU, XIUJUAN QU, YING LUO, YE ZHANG, JING LIU, JINGLEI QU, LINGYUN ZHANG and YUNPENG LIU Department of Medical Oncology, the First Hospital of China Medical University, Shenyang 110001, P.R. China Received December 16, 2010; Accepted February 4, 2011 DOI: 10.3892/mmr.2011.439 Abstract. Gastric cancer cells are usually insensitive to tumor induce apoptosis in many cancer cells without causing signifi- necrosis factor-related apoptosis-inducing ligand (TRAIL). cant toxicity to normal cells. TRAIL triggers apoptosis upon In the present study, in MGC803 cells treated with 100 ng/ml engagement of two receptors named death receptor 4 (DR4) TRAIL for 24 h, the inhibition rate of cell proliferation was and death receptor 5 (DR5). In response to TRAIL, death 9.76±2.39% and the rate of cell apoptosis was only 4.37±1.45%. receptors recruit the Fas-associated death domain (FADD) Treatment with epirubicin (1.18 µg/ml, IC50 dose for 24 h) and and procaspase-8 and -10, hence forming the macromolecular TRAIL (100 ng/ml for 24 h) led to a marked increase in the complex, termed the death-inducing signaling complex (DISC). inhibition rate of cell proliferation and apoptosis compared to Within this complex, procaspase-8 and -10 are activated treatment with epirubicin or TRAIL alone (P<0.05). Moreover, and initiate the caspase cascade, leading to apoptosis (3,4). even more notable cleavage of caspase-3 and 8 was detected However, previous studies including our own have reported with the combination of epirubicin and TRAIL.
    [Show full text]
  • Role of Cholesterol in Lipid Raft Formation: Lessons from Lipid Model Systems
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1610 (2003) 174–183 www.bba-direct.com Review Role of cholesterol in lipid raft formation: lessons from lipid model systems John R. Silvius* Department of Biochemistry, McGill University, Montre´al, Que´bec, Canada H3G 1Y6 Received 21 March 2002; accepted 16 October 2002 Abstract Biochemical and cell-biological experiments have identified cholesterol as an important component of lipid ‘rafts’ and related structures (e.g., caveolae) in mammalian cell membranes, and membrane cholesterol levels as a key factor in determining raft stability and organization. Studies using cholesterol-containing bilayers as model systems have provided important insights into the roles that cholesterol plays in determining lipid raft behavior. This review will discuss recent progress in understanding two aspects of lipid–cholesterol interactions that are particularly relevant to understanding the formation and properties of lipid rafts. First, we will consider evidence that cholesterol interacts differentially with different membrane lipids, associating particularly strongly with saturated, high-melting phospho- and sphingolipids and particularly weakly with highly unsaturated lipid species. Second, we will review recent progress in reconstituting and directly observing segregated raft-like (liquid-ordered) domains in model membranes that mimic the lipid compositions of natural membranes incorporating raft domains. D 2003 Elsevier Science B.V. All rights reserved. Keywords: Sterol; Phospholipid; Sphingolipid; Lipid bilayer; Lipid monolayer; Membrane domain 1. Introduction Two major observations suggest that cholesterol–lipid interactions play an important role in the formation of rafts Cholesterol–lipid interactions have long been recognized in animal cell membranes.
    [Show full text]
  • The Adaptive Remodeling of Endothelial Glycocalyx in Response to Fluid Shear Stress
    City University of New York (CUNY) CUNY Academic Works Publications and Research City College of New York 2014 The Adaptive Remodeling of Endothelial Glycocalyx in Response to Fluid Shear Stress Ye Zeng CUNY City College John M. Tarbell CUNY City College How does access to this work benefit ou?y Let us know! More information about this work at: https://academicworks.cuny.edu/cc_pubs/34 Discover additional works at: https://academicworks.cuny.edu This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] The Adaptive Remodeling of Endothelial Glycocalyx in Response to Fluid Shear Stress Ye Zeng1,2, John M. Tarbell1* 1 Department of Biomedical Engineering, The City College of New York, New York, New York, United States of America, 2 Institute of Biomedical Engineering, School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, China Abstract The endothelial glycocalyx is vital for mechanotransduction and endothelial barrier integrity. We previously demonstrated the early changes in glycocalyx organization during the initial 30 min of shear exposure. In the present study, we tested the hypothesis that long-term shear stress induces further remodeling of the glycocalyx resulting in a robust layer, and explored the responses of membrane rafts and the actin cytoskeleton. After exposure to shear stress for 24 h, the glycocalyx components heparan sulfate, chondroitin sulfate, glypican-1 and syndecan-1, were enhanced on the apical surface, with nearly uniform spatial distributions close to baseline levels that differed greatly from the 30 min distributions. Heparan sulfate and glypican-1 still clustered near the cell boundaries after 24 h of shear, but caveolin-1/caveolae and actin were enhanced and concentrated across the apical aspects of the cell.
    [Show full text]
  • Diffusion of Lipids and GPI-Anchored Proteins in Actin-Free Plasma Membrane Vesicles Measured by STED-FCS Falk Schneidera, Mathias P
    bioRxiv preprint doi: https://doi.org/10.1101/076109; this version posted September 19, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Diffusion of lipids and GPI-anchored proteins in actin-free plasma membrane vesicles measured by STED-FCS Falk Schneidera, Mathias P. Clausena,b, Dominic Waithec, Thomas Kollera, Gunes Ozhand,e, Christian Eggelinga,c,*, Erdinc Sezgina,* a MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX39DS, Oxford, United Kingdom b MEMPHYS – Center for Biomembrane Physics, Department of Physics, Chemistry, and Pharmacy, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark c Wolfson Imaging Centre Oxford, Weatherall Institute of Molecular Medicine, University of Oxford, OX39DS, Oxford, United Kingdom d Izmir International Biomedicine and Genome Institute (iBG-izmir), Dokuz Eylul University, Inciralti- Balcova, 35340 Izmir, Turkey; e Department of Medical Biology and Genetics, Dokuz Eylul University Medical School, Inciralti-Balcova, 35340 Izmir, Turkey. Correspondence: [email protected]; [email protected] Running title: Diffusion in actin-free plasma membrane vesicles Keywords: plasma membrane biophysics, fluorescence correlation spectroscopy, lipid raft, GPI anchored proteins, STED microscopy, STED-FCS, giant plasma membrane vesicles, Abbreviations: giant plasma membrane vesicles (GPMVs), giant unilamellar vesicles (GUVs), Glycophosphatidylinositol anchored protein (GPI-AP), phospholipid (PL), Stimulated emission depletion (STED), fluorescence correlation spectroscopy (FCS) Character count: 19,026 1 bioRxiv preprint doi: https://doi.org/10.1101/076109; this version posted September 19, 2016.
    [Show full text]
  • Lipid Rafts Facilitate LPS Responses 2605
    Research Article 2603 Mediators of innate immune recognition of bacteria concentrate in lipid rafts and facilitate lipopolysaccharide-induced cell activation Martha Triantafilou1, Kensuke Miyake2, Douglas T. Golenbock3,* and Kathy Triantafilou1,‡ 1University of Portsmouth, School of Biological Sciences, King Henry Building, King Henry I Street, Portsmouth, PO1 2DY, UK 2Department of Immunology, Saga Medical School, Nabeshima, Japan 3Boston University School of Medicine, Boston Medical Center, The Maxwell Finland Laboratory for Infectious Diseases, Boston, Massachusetts 02118, USA *Present address: Department of Medicine, Division of Infectious Diseases, University of Massachusetts Medical School, Worcester, MA 01665, USA ‡Author for correspondence (e-mail: [email protected]) Accepted 19 March 2002 Journal of Cell Science 115, 2603-2611 (2002) © The Company of Biologists Ltd Summary The plasma membrane of cells is composed of lateral present in microdomains following LPS stimulation. Lipid heterogeneities, patches and microdomains. These raft integrity is essential for LPS-cellular activation, since membrane microdomains or lipid rafts are enriched raft-disrupting drugs, such as nystatin or MCD, inhibit in glycosphingolipids and cholesterol and have been LPS-induced TNF-α secretion. Our results suggest that the implicated in cellular processes such as membrane sorting entire bacterial recognition system is based around the and signal transduction. In this study we investigated the ligation of CD14 by bacterial components and the importance of lipid raft formation in the innate immune recruitment of multiple signalling molecules, such as hsp70, recognition of bacteria using biochemical and fluorescence hsp90, CXCR4, GDF5 and TLR4, at the site of CD14-LPS imaging techniques. We found that receptor molecules ligation, within the lipid rafts.
    [Show full text]
  • Phosphoinositide Phosphatase SHIP-1 Regulates Apoptosis Induced by Edelfosine, Fas Ligation and DNA Damage in Mouse Lymphoma Cells Maaike C
    Phosphoinositide phosphatase SHIP-1 regulates apoptosis induced by edelfosine, Fas ligation and DNA damage in mouse lymphoma cells Maaike C. Alderliesten, Jeffrey B. Klarenbeek, Arnold H. van der Luit, Menno van Lummel, David R Jones, Shuraila Zerp, Nullin Divecha, Marcel Verheij, Wim J van Blitterswijk To cite this version: Maaike C. Alderliesten, Jeffrey B. Klarenbeek, Arnold H. van der Luit, Menno van Lummel, David R Jones, et al.. Phosphoinositide phosphatase SHIP-1 regulates apoptosis induced by edelfosine, Fas ligation and DNA damage in mouse lymphoma cells. Biochemical Journal, Portland Press, 2011, 440 (1), pp.127-135. 10.1042/BJ20110125. hal-00642836 HAL Id: hal-00642836 https://hal.archives-ouvertes.fr/hal-00642836 Submitted on 19 Nov 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 27 Jul 2011 as manuscript BJ20110125 Phosphoinositide phosphatase SHIP-1 regulates apoptosis induced by edelfosine, Fas ligation and DNA damage in mouse lymphoma cells Maaike C. ALDERLIESTEN*, Jeffrey B. KLARENBEEK*, Arnold H. VAN DER ‡ LUIT*2, Menno VAN LUMMEL*3, David R. JONES , Shuraila ZERP*†, Nullin ‡ DIVECHA , Marcel VERHEIJ† and Wim J. VAN BLITTERSWIJK*1 *Division of Cell Biology (B5) and †Department of Radiotherapy, The Netherlands Cancer Institute/ Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, 1066 CX Amsterdam, The ‡ Netherlands, Paterson Institute for Cancer Research, Inositide laboratory, The University of Manchester, Wilmslow Road, M20 4BX Manchester, UK.
    [Show full text]
  • The Importance of Lipid Raft Proteins for Sepsis: Could Raftlin-2 Be a New Biomarker?
    DOI: 10.14744/ejmi.2018.69875 EJMI 2018;2(2):95–100 Research Article The Importance of Lipid Raft Proteins for Sepsis: Could Raftlin-2 be a New Biomarker? Hilmi Erdem Sumbul,1 Emre Karakoc,2 Murat Erdogan,2 Ozlem Ozkan Kuscu,2 Filiz Kibar,3 Salih Cetiner,4 Tugba Korkmaz,2 Merve Yahsi,2 Firat Kocabas2 1Department of Internal Medicine, Health Science University, Adana City Training and Research Hospital, Adana, Turkey 2Department of Internal Medicine, Cukurova University, Adana, Turkey 3Department of Microbiology, Cukurova University, Adana, Turkey 4Department of Biochemistry, Cukurova University, Adana, Turkey Abstract Objectives: Bacterial infections and sepsis are common problems in patients receiving intensive care unit treatment. Raftlin-2 is a protein with an important role in lipid rafts, and the aim of this study was to compare raftlin-2 micro pro- tein blood levels in a healthy control group with a patient group with septicemia. Methods: A prospective, controlled study was conducted in the intensive care unit (ICU) of a university hospital and a control group was selected from healthy individuals. There were 64 ICU patients and 74 individuals in the control group. Blood samples were taken from the study group before the start of antibiotic therapy. The C-reactive protein, procalci- tonin, lactate, biochemistry, and raftlin-2 levels of the patient and control groups were compared. Results: There was a statistically significant difference between the lactate levels in the healthy group and the patient group with septicemia, but not in the raftlin-2 protein level. The p-values were calculated at 0.350 for raftlin-2 and 0.007 for lactate.
    [Show full text]
  • Akt Inhibitors in Cancer Treatment: the Long Journey from Drug Discovery to Clinical Use (Review)
    INTERNATIONAL JOURNAL OF ONCOLOGY 48: 869-885, 2016 Akt inhibitors in cancer treatment: The long journey from drug discovery to clinical use (Review) GeORGe MIHAI NITUleSCU1, DeNISA MARGINA1, PeTRAS JUzeNAS2, QIAN PeNG2, OctavIAN TUDORel OlARU1, eMMANOUIl SAlOUSTROS3, CONCETTINA FENGA4, DeMeTRIOS Α. Spandidos5, MASSIMO lIBRA6 and ARISTIDIS M. Tsatsakis7 1Faculty of Pharmacy, ‘Carol Davila’ University of Medicine and Pharmacy, Bucharest 020956, Romania; 2Department of Pathology, Radiumhospitalet, Oslo University Hospital, 0379 Oslo, Norway; 3Oncology Unit, General Hospital of Heraklion ‘venizelio’, Heraklion 71409, Greece; 4Section of Occupational Medicine, University of Messina, I‑98125 Messina, Italy; 5Department of virology, Faculty of Medicine, University of Crete, Heraklion 71003, Greece; 6Department of Biomedical and Biotechnological Sciences, General and Clinical Pathology and Oncology Section, University of Catania, I‑95124 Catania, Italy; 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, Heraklion 71003, Greece Received November 17, 2015; Accepted December 24, 2015 DOI: 10.3892/ijo.2015.3306 Abstract. Targeted cancer therapies are used to inhibit the importance of each chemical scaffold. We explore the pipeline growth, progression, and metastasis of the tumor by interfering of Akt inhibitors and their preclinical and clinical examina- with specific molecular targets and are currently the focus of tion status, presenting the potential clinical application of these anticancer drug development.
    [Show full text]
  • A Functional Genomic Screen in Saccharomyces Cerevisiae Reveals Divergent Mechanisms of Resistance to Different Alkylphosphochol
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.16.343244; this version posted October 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A functional genomic screen in Saccharomyces cerevisiae reveals divergent mechanisms of resistance to different alkylphosphocholine chemotherapeutic agents. Jacquelin M. Garcia*,3, Michael J. Schwabe*,4, Dennis R. Voelker†, and Wayne R. Riekhof* *School of Biological Sciences, University of Nebraska – Lincoln, Lincoln, NE, USA; †Department of Medicine, National Jewish Health, Denver, CO, USA Current address: 3Division of Biology and Biomedical Sciences, Washington University, St. Louis, MO, USA; 4Department of Surgery, Creighton University School of Medicine, Omaha, NE, USA 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.16.343244; this version posted October 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract The alkylphosphocholine (APC) class of antineoplastic and antiprotozoal drugs, such as edelfosine and miltefosine, are structural mimics of lyso-phosphatidylcholine (lyso-PC), and are inhibitory to the yeast Saccharomyces cerevisiae at low micromolar concentrations. Cytotoxic effects related to inhibition of phospholipid synthesis, induction of an unfolded protein response, inhibition of oxidative phosphorylation, and disruption of lipid rafts have been attributed to members of this drug class, however the molecular mechanisms of action of these drugs remain incompletely understood.
    [Show full text]
  • Antiprotozoal Activities of Phospholipid Analogues Simon L
    Molecular & Biochemical Parasitology 126 (2003) 165–172 Review Antiprotozoal activities of phospholipid analogues Simon L. Croft a,∗, Karin Seifert a, Michael Ducheneˆ b a Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, UK b Division of Specific Prophylaxis and Tropical Medicine, Department of Pathophysiology, AKH, Währinger Gürtel 18-20, A-1090 Vienna, Austria Received 3 June 2002; received in revised form 8 August 2002; accepted 13 August 2002 Abstract The antiprotozoal activity of phospholipid analogues, originally developed as anti-cancer drugs, has been determined in the past decade. The most susceptible parasites are Leishmania spp. and Trypanosoma cruzi with activity also shown against Trypanosoma brucei spp., Entamoeba histolytica and Acanthamoeba spp. Miltefosine, an alkylphosphocholine, was registered for the oral treatment of visceral leishmaniasis (VL) in India in March 2002. This review will focus on the biological activities of phospholipid analogues. Biochemical and molecular targets and mechanism(s) of action have been studied extensively in tumor cells but have not been determined in protozoa. © 2002 Elsevier Science B.V. All rights reserved. Keywords: Phospholipid analogues; Miltefosine; Protozoa 1. Introduction hexadecylphosphocholine (HPC, miltefosine) for the top- ical treatment of skin metastases was approved in Au- Interest in phospholipid analogues as chemotherapeutic gust 1992. The discovery of the ether-lipid structure of agents resulted from the work of Munder and co-workers platelet-activating factor (PAF) also prompted further in- [1] following their investigation of the immunomodula- terest in the synthesis and activity of phospholipids [8,9] tory activity of lysophosphatidylcholine (LPC). As LPC (Fig.
    [Show full text]