2337 A new class of anticancer alkylphospholipids uses lipid rafts as membrane gateways to induce apoptosis in lymphoma cells Arnold H. van der Luit,1 Stefan R. Vink,2 induction and alleviated the inhibition of phosphatidyl- Jeffrey B. Klarenbeek,1 Daniel Perrissoud,4 choline synthesis. Uptake of all alkylphospholipids was Eric Solary,5 Marcel Verheij,1,3 inhibited by small interfering RNA (siRNA)–mediated and Wim J. van Blitterswijk1 blockage of sphingomyelin synthase (SMS1), which was previously shown to block raft-dependent endocytosis. Divisions of 1Cellular Biochemistry and 2Experimental Therapy, Similar to edelfosine, perifosine accumulated in (isolated) 3Department of Radiotherapy, the Netherlands Cancer Institute, lipid rafts independent on raft sphingomyelin content per 4 Plesmanlaan 121, Amsterdam, the Netherlands; Zentaris GmbH, se. However, perifosine was more susceptible than Frankfurt am Main, Germany; and 5Institut National de la Sante et de la Recherche Medicale U866/Universite´de Bourgogne, edelfosine to back-extraction by fatty acid-free serum Laboratoire de Mort Cellulaire et Cancer, UFR de Me´decine, albumin, suggesting a more peripheral location in the cell Dijon, France due to less effective internalization. Overall, our results suggest that lipid rafts are critical membrane portals for cellular entry of alkylphospholipids depending on SMS1 Abstract activity and, therefore, are potential targets for alkyl- Single-chain alkylphospholipids, unlike conventional che- phospholipid anticancer therapy. [Mol Cancer Ther motherapeutic drugs, act on cell membranes to induce 2007;6(8):2337–45] apoptosis in tumor cells. We tested four different alkylphospholipids, i.e., edelfosine, perifosine, erucyl- Introduction phosphocholine, and compound D-21805, as inducers of apoptosis in the mouse lymphoma cell line S49. We Synthetic lipase-resistant analogues of lysophosphatidyl- compared their mechanism of cellular entry and their choline, collectively named alkylphospholipids, exert cyto- potency to induce apoptosis through inhibition of de novo toxic effects against a wide variety of tumors (1–4). The biosynthesis of phosphatidylcholine at the endoplasmic prototype of these compounds, 1-O-octadecyl-2-O-methyl- reticulum. Alkylphospholipid potency closely correlated rac-glycero-3-phosphocholine (Et-18-OCH3,edelfosine), with the degree of phosphatidylcholine synthesis inhibi- structurally resembles lysophosphatidylcholine (Fig. 1) in tion in the order edelfosine > D-21805 > erucylphos- that it has the same polar head group and a single, long phocholine > perifosine. In all cases, exogenous apolar hydrocarbon chain, which allows an easy insertion lysophosphatidylcholine, an alternative source for cellular into the plasma membrane. Whereas membrane-inserted phosphatidylcholine production, could partly rescue cells lysophosphatidylcholine undergoes rapid turnover, edelfo- from alkylphospholipid-induced apoptosis, suggesting sine with its stable ether bonds is not metabolized, leading that phosphatidylcholine biosynthesis is a direct target to accumulation in cell membranes. This interferes with for apoptosis induction. Cellular uptake of each alkyl- lipid-based signal transduction, often resulting in apoptosis phospholipid was dependent on lipid rafts because of tumor cells. In later studies, the glycerol moiety in pretreatment of cells with the raft-disrupting agents, alkylphospholipid was found not essential for the anti- methyl-B-cyclodextrin, filipin, or bacterial sphingomyeli- tumor activity. A second generation of these compounds, nase, reduced alkylphospholipid uptake and/or apoptosis therefore, comprised of phospho-ester–linked (single- chain) alkylphosphocholines and derivatives thereof. The first of these compounds, hexadecylphosphocholine (mil- tefosine), was clinically effective in patients with skin Received 3/22/07; revised 5/16/07; accepted 6/12/07. metastasis of breast cancers (2, 5) and cutaneous lympho- Grant support: Dutch Cancer Society grants NKI 2001-2570 and NKI mas (6). Erucylphosphocholine containing a much longer 2005-3377. (22-carbon) chain with a cis-13,14 double bond (Fig. 1) The costs of publication of this article were defrayed in part by the couldbeappliedi.v.andtherebyshowedimproved payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to antitumor activity with reduced hemolytic and gastroin- indicate this fact. testinal side effects (7, 8). Interestingly, it increased the Note: Current address for A. H. van der Luit: Oncodesign, 20 rue Jean cytotoxicity of ionizing radiation (9, 10). A structural Mazen, B.P. 27627, 21076 Dijon Cedex, France. analogue, octadecyl-(1,1-dimethyl-4-piperidynio-4-yl)- Requests for reprints: Wim J. van Blitterswijk, Division of Cellular phosphate (perifosine; D-21266), in which the choline head Biochemistry, the Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, the Netherlands. Phone: 31-205121976; group has been substituted by a piperidine moiety (Fig. 1) Fax: 31-205121989. E-mail [email protected] has received mounting attention as an anticancer agent, Copyright C 2007 American Association for Cancer Research. especially in combination with other pharmacologic drugs doi:10.1158/1535-7163.MCT-07-0202 (11–16) as well as with radiotherapy (4, 17–19). Mol Cancer Ther 2007;6(8). August 2007 Downloaded from mct.aacrjournals.org on October 1, 2021. © 2007 American Association for Cancer Research. 2338 Uptake of Anticancer Alkylphospholipids via Lipid Rafts In contrast to classic chemotherapeutic drugs that target Silencing of Sphingomyelin Synthase-1 by Small Inter- the DNA, alkylphospholipids act at cell membranes by fering RNA Retroviral Transduction interfering with the turnover and synthesis of natural To suppress the expression of sphingomyelin synthase-1 phospholipids and by disrupting membrane-signaling net- (SMS1), S49 cells were retrovirally transduced by small works at multiple sites, leading to cell death (3, 4, 20). For interfering RNA (siRNA), yielding S49siSMS1 cells, as de- the alkylphospholipids edelfosine and miltefosine, it has scribed previously (25). Briefly, siRNAs directed to SMS1 been shown that they induce apoptosis through the were inserted into the retroviral vector pRETRO-SUPER. inhibition of CTP:phosphocholine cytidylyltransferase Retroviral supernatants were obtained from Phoenix cells and (CT), a key enzyme in phosphatidylcholine biosynthesis used to transduce S49 cells. Stable S49siSMS1 cells were selected (21–24). To inhibit this enzyme at the endoplasmic with puromycin. The following siRNA primers were used: reticulum, alkylphospholipids need to be internalized. We sense GATCCCCGCATGGGAGTTGATTTAGATTCAAGA- have shown that edelfosine, after insertion in the plasma GATCTAAATCAACTCCCATGCTTTTTGGAAA and anti- membrane, accumulates in lipid rafts and is then internal- sense AGCTTTTCCAAAAAGCATGGGAGTTGATTTA ized by an endocytotic pathway that depends on intact rafts GATCTCTTGAATCTAAATCAACTCCCATGCGGG. For and on the activity of sphingomyelin synthase 1 (23–25). mock transfection (S49mock), scrambled RNA was used. How other alkylphospholipids are taken up by cells, their Cellular Uptake of Alkylphospholipids and Apoptosis relative potency and mechanism of apoptosis induction is Assay currently unknown. Cells were grown to a density of 2.5 Â 106/mL and Here, we compared four anticancer alkylphospholipids 14C-perifosine (0.2 ACi, 20 Amol/L) or 3H-edelfosine (0.2 ACi, (molecular structures depicted in Fig. 1) with respect to their 15 Amol/L) was added. At given time points, samples were cellular uptake, cytotoxicity, and mechanism of apoptosis taken, incubated for 2 min on ice, and washed with cold PBS. induction in mouse S49 lymphoma cells. We found that all Samples were lysed in 0.1 N NaOH for scintillation counting. alkylphospholipids use lipid rafts for internalization to For apoptosis, cells were seeded at 1.5 Â 106 cells/mL, inhibit phosphatidylcholine synthesis to varying degrees, cultured overnight, and incubated for indicated time correlating with the efficiency and persistency of cellular periods with various concentrations of alkylphospholipids. uptake and potency to induce apoptosis. Cells were washed with PBS in and lysed overnight at 4jCin 0.1% (w/v) sodium citrate, 0.1% (v/v) Triton X-100, and 50 Ag/mL propidium iodide (27). Fluorescence intensity of Materials and Methods propidium iodide–stained DNA was determined on a Reagents FACScan (Becton Dickinson Advanced Cellular Biology), Edelfosine (1-O-octadecyl-2-O-methyl-rac-glycero-3- and data analyzed using Lysis software. phosphocholine; Et-18-OCH3) was purchased from BioMol. Lipid Biosynthesis 3 3 [ H]Edelfosine ([ H]Et-18-OCH3; 40 Ci/mmol), was syn- To measure phosphatidylcholine and sphingomyelin bio- thesized by Moravek Biochemicals. The other alkylphos- synthesis, cells at 2.5 Â 106 cells/mL were incubated with pholipids (Fig. 1), perifosine (compound D-21266), [14C]choline chloride (1 ACi/mL). At given time points, octadecyl-2-(trimethylarseno)-ethyl-phosphate (compound aliquots of cell suspension were taken, washed, and resus- D-21805), erucylphosphocholine, and [14C]perifosine (30.9 pended in 200 AL PBS. Lipids were extracted with chloro- mCi/mmol), were kindly provided by Zentaris GmbH. form/methanol (1:2, v/v), and phase separation was induced [Methyl-14C]choline chloride (58 mCi/mmol) was from using 1 mol/L NaCl. The organic phase was washed in a 3 Amersham Pharmacia