120409 Thesis

Mechanisms of Specificity in Neuronal Activity-regulated Gene Transcription

Michelle Renée Lyons

Department of Neurobiology Duke University

Date:______Approved:

______Anne West, Supervisor

______Dona Chikaraishi, Chair

______James O. McNamara

______Geoffrey Pitt

______Scott Soderling

Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University

2012

ABSTRACT

Mechanisms of Specificity in Neuronal Activity-regulated Gene Transcription

Michelle Renée Lyons

Department of Neurobiology Duke University

Date:______Approved:

______Anne West, Supervisor

______Dona Chikaraishi, Chair

______James O. McNamara

______Geoffrey Pitt

______Scott Soderling

An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University

2012

Abstract

In the nervous system, activity-regulated gene transcription is one of the fundamental processes responsible for orchestrating proper brain development – a process that in humans takes over 20 years. Moreover, activity-dependent regulation of gene expression continues to be important for normal brain function throughout life; for example, some forms of synaptic plasticity important for learning and memory are known to rely on alterations in gene transcription elicited by sensory input. In the last two decades, increasingly comprehensive studies have described complex patterns of gene transcription induced and/or repressed following different kinds of stimuli that act in concert to effect changes in neuronal and synaptic physiology. A key theme to emerge from these studies is that of specificity, meaning that different kinds of stimuli up- and downregulate distinct sets of genes. The importance of such signaling specificity in synapse-to-nucleus communication becomes readily apparent in studies examining the physiological effects of the loss of one or more forms of transcriptional specificity – often, such genetic manipulations result in aberrant synapse formation, neuronal cell death, and/or cognitive impairment in mutant mice. The two primary loci at which mechanisms of signaling specificity typically act are 1) at the synapse – in the form of calcium channel number, localization, and subunit composition – and 2) in the nucleus – in the form of transcription factor expression, localization, and post-translational modification.

My dissertation research has focused on the mechanisms of specificity that govern the activity-regulated transcription of the gene encoding Brain- derived Neurotrophic Factor (Bdnf). BDNF is a secreted protein that has

numerous important functions in nervous system development and plasticity, including neuronal survival, neurite outgrowth, synapse formation, and long- term potentiation. Due to Bdnf’s complex transcriptional regulation by various forms of neural stimuli, it is well positioned to function as a transducer through which altered neural activity states can lead to changes in neuronal physiology and synaptic function. In this dissertation, I show that different families of transcription factors, and even different isoforms or splice variants within a single family, can specifically regulate Bdnf transcription in an age- and stimulus- dependent manner. Additionally, I characterize another mechanism of synapse- to-nucleus signaling specificity that is dependent upon NMDA-type glutamate receptor subunit composition, and provide evidence that the effect this signaling pathway has on gene transcription is important for normal GABAergic synapse formation.

Taken together, my dissertation research sheds light on several novel signaling mechanisms that could lend specificity to the activity-dependent transcription of Bdnf exon IV. My data indicate that distinct neuronal stimuli can differentially regulate the Calcium-Response Element CaRE1 within Bdnf promoter IV through activation of two distinct transcription factors: Calcium-

Response Factor (CaRF) and Myocyte Enhancer Factor 2 (MEF2). Furthermore, individual members of the MEF2 family of transcription factors differentially regulate the expression of Bdnf, and different MEF2C splice variants are unequally responsive to L-type voltage-gated calcium channel activation.

Additionally, I show here for the first time that the NMDA-type glutamate receptor subunit NR3A (also known as GluN3A) is capable of exerting an effect on NMDA receptor-dependent Bdnf exon IV transcription, and that changes in

the expression levels of NR3A may function to regulate the threshold for activation of synaptic plasticity-inducing transcriptional programs during brain development. Finally, I provide evidence that the transcription factor CaRF might function in the regulation of homeostatic programs of gene transcription in an age- and stimulus-specific manner. Together, these data describe multiple novel mechanisms of specificity in neuronal activity-regulated gene transcription, some of which function at the synapse, others of which function in the nucleus.

Dedication

This dissertation is dedicated to the memory of Violet Elaine Holman.

She was my grandmother and a nurse; she inspired in me from a very early age a love of human anatomy and physiology and an interest in better understanding the world around me.

vii

Contents

Abstract...... iv

List of Tables ...... xiii

List of Figures ...... xiv

Abbreviations and Acronyms ...... xxii

Acknowledgements ...... xxvii

1. Introduction ...... 1

1.1 Activity-regulated gene transcription is critical for normal brain development and function ...... 1

1.2 Brain-Derived Neurotrophic Factor (BDNF) regulates neuronal physiology and synaptic function...... 2

1.3 Fos: the archetypal member of a second class of activity-regulated genes. 7

1.3.1 Mechanisms of Fos transcriptional regulation: Association of transcription factors with stimulus-response elements in the proximal promoter ...... 9

1.3.2 Mechanisms of Fos transcriptional regulation: Stimulus-dependent recruitment of transcriptional co-activators and co-repressors that post- translationally modify histones...... 11

1.3.3 Mechanisms of Fos transcriptional regulation: Modulation of promoter function by distant enhancer elements...... 12

1.3.4 Mechanisms of Fos transcriptional regulation: Regulation of transcriptional elongation ...... 14

1.4 Transcription factors regulated by neuronal activity...... 14

1.4.1 Activation of prebound transcription factors...... 15

1.4.1.1 Calcium/cAMP-Response Element binding protein (CREB)...... 17

1.4.1.2 Serum-Response Factor (SRF) ...... 18

1.4.1.3 Myocyte Enhancer Factor 2 (MEF2) ...... 20

1.4.2 Transcription factors that undergo regulated nucleocytoplasmic shuttling ...... 23

viii

1.4.2.1 Activity-dependent nuclear translocation...... 24

1.4.2.2 Synaptic activity-dependent nuclear export ...... 27

1.4.3 Transcription factors that show regulated binding...... 28

1.4.4 Neuronal activity-regulated transcription factor expression...... 30

1.5 Calcium channel-dependent regulation of transcription ...... 31

1.5.1 NMDA Receptors (NMDARs)...... 33

1.5.1.1 NMDARs regulate transcription in vitro and in vivo ...... 34

1.5.1.2 Molecular biology and patterns of expression of the NMDARs.... 35

1.5.1.3 Different pools of NMDARs differentially regulate transcription 39

1.5.1.4 Protein interactions that underlie NMDAR signaling specificity.. 44

1.5.2 L-type Voltage-Gated Calcium Channels (L-VGCCs) ...... 51

1.5.2.1 Molecular biology of the L-VGCCs ...... 51

1.5.2.2 Physiological relevance of L-VGCCs for transcription ...... 52

1.5.2.3 Signaling pathways and protein interactions that regulate L- VGCCs ...... 54

1.5.3 Other sources of calcium ...... 58

1.6 Research objectives...... 61

1.6.1 Identification and characterization of MEF2 as a second binding protein of the CaRE1 element within Bdnf promoter IV...... 62

1.6.2 Identification Grin3a as a potential CaRF target and demonstration that NR3A can modulate both NMDAR-dependent Bdnf exon IV transcription and GABAergic synapse development ...... 65

2. Members of the MEF2 transcription factor family differentially regulate Bdnf transcription in response to neuronal depolarization ...... 70

2.1 Summary...... 70

2.2 Introduction...... 71

2.3 Materials and Methods...... 72

2.3.1 Plasmids...... 72

2.3.2 Cell culture, transfection, and luciferase assays ...... 73

2.3.3 Electrophoretic mobility shift assay (EMSA) ...... 73

2.3.4 RNAi plasmids and quantitative RT-PCR ...... 74

2.3.5 Statistical analyses...... 75

2.4 Results ...... 75

2.4.1 CaRE1 is required for membrane depolarization-enhanced Bdnf promoter IV activity in Carf knockout neurons ...... 75

2.4.2 MEF2 drives CaRE1-dependent Bdnf transcription...... 77

2.4.2.1 MEF2 and CaRF are both capable of binding to the CaRE1 element within Bdnf promoter IV ...... 77

2.4.2.2 MEF2 and CaRF neither compete nor cooperate in their binding to the CaRE1 element within Bdnf promoter IV...... 79

2.4.2.3 MEF2 is capable of driving transcription of Bdnf exon IV in a CaRE1-dependent manner...... 82

2.4.3 MEF2C splice variants are differentially responsive to membrane depolarization ...... 84

2.4.4 Regulation of Bdnf transcription by different MEF2 family members in cortical neurons...... 86

2.5 Discussion...... 88

3. The NMDA receptor subunit NR3A inhibits synaptic activity-induced transcription of Bdnf and limits GABAergic synapse development...... 92

3.1 Summary...... 92

3.2 Introduction...... 93

3.3 Materials and Methods...... 96

3.3.1 Plasmids...... 96

3.3.2 Neuron culture...... 97

3.3.3 RNA interference (RNAi) and quantitative RT-PCR ...... 97

3.3.4 Western blotting ...... 98

3.3.5 Microarrays ...... 99

3.3.5 Calcium phosphate transfection and luciferase assays...... 102

3.3.6 Immunoctyochemistry...... 102

3.3.7 Pilocarpine-induced seizure ...... 103

3.3.8 Statistical analyses...... 104

3.4 Results ...... 105

3.4.1 NMDAR-dependent Bdnf exon IV transcription is potentiated in CaRF- deficient neurons ...... 105

3.4.1.1 Generation of two Carf shRNA-containing lentiviruses ...... 105

3.4.1.2 Tetrodotoxin withdrawal is an NMDAR-dependent stimulus that leads to CREB phosphorylation and increased transcription of Bdnf exon IV ...... 107

3.4.1.3 Bdnf exon IV induction following tetrodotoxin withdrawal is potentiated in CaRF knockdown neurons...... 109

3.4.2 The gene Grin3a, which encodes the NMDAR subunit NR3A, is a potential target of CaRF...... 110

3.4.3 NMDAR-dependent Bdnf exon IV transcription is potentiated in NR3A-deficient neurons...... 114

3.4.3.1 Generation of two Grin3a shRNA-containing lentiviruses...... 114

3.4.3.2 Bdnf exon IV induction following tetrodotoxin withdrawal is potentiated in NR3A knockdown neurons ...... 115

3.4.3.3 Bdnf exon IV induction is not altered following L-VGCC activation in NR3A knockdown neurons ...... 116

3.4.3.4 Potentiation of Bdnf exon IV induction in NR3A-deficient neurons is both NMDAR- and transcription-dependent ...... 117

3.4.4 MEF2 transcriptional activity is potentiated in NR3A knockdown neurons...... 119

3.4.5 NR3A knockdown neurons exhibit an exuberance of GABAergic synapses...... 121

3.4.6 Expression of Carf and Grin3a is inversely regulated by changes in neuronal activity...... 122

3.4.6.1 Carf and Grin3a are inversely regulated by alterations in neuronal activity in vitro ...... 122

3.4.6.1 Carf and Grin3a are both downregulated by seizure in vivo...... 125

3.5 Discussion...... 127

4. Discussion ...... 133

4.1 Specificity: the “next frontier” in the field of activity-regulated gene transcription ...... 133

4.2 Musical chairs: CaRF and MEF2 can both regulate the Bdnf gene, but in response to different stimuli ...... 133

4.3 My big, fat MEF family: MEF2 isoforms and splice variants and their roles in activity-regulated gene transcription...... 136

4.4 It’s a balancing act: CaRF as a homeostatic regulator of calcium signaling in neurons ...... 139

4.5 Minority report: NR3A has a big effect on NMDAR-dependent gene transcription ...... 145

4.6 Concluding remarks...... 149

Appendix A...... 150

Appendix B ...... 153

References...... 160

Biography ...... 194

xii

List of Tables

Table 1: Neuronal activity-regulated genes that modulate synaptic function...... 3

Table 2: 100 most significantly altered genes in Carf KD neurons as compared with scrambled controls, as determined by the t-statistic...... 150

Table 3: Top 250 genes most altered by Carf KD, as determined by signal:noise analysis of gene array results...... 153

xiii

List of Figures

Figure 1: Multiple activity-regulated transcription factors contribute to inducibility of Bdnf promoter IV. The box shows spliced mRNAs (blue) encoding Bdnf transcripts driven by the eight alternative Bdnf promoters mapped onto chromosome 2 of Mus musculus (black). Boxes represent the nine exons that comprise the Bdnf gene and the thicker region of exon IX indicates the coding sequence. The gray line shows an expansion of the region just upstream of exon IV. Three calcium-response elements (CaREs) and two transcription start sites (TSSs) are indicated by the gray boxes. Transcription factors demonstrated to regulate Bdnf promoter IV are shown at their binding sites. Npas4 binding has been localized to a PAS response element just 5’ to CaRE1 in human BDNF promoter IV (Pruunsild et al., 2011) and to a region near the CaRE2 element by ChIP-Seq in mouse neurons (Kim et al., 2010). Although MEF2 has been localized to Bdnf promoter IV by chromatin immunoprecipitation, its binding elements have not yet been reported. Like the Fos promoter, Bdnf promoter IV is thought to already have the RNA polymerase II (Pol II) complex pre-bound prior to neuronal stimulation...... 5

Figure 2: Mechanisms of neuronal activity-induced transcription. The diagrams represent four steps in the process of Fos transcription that are regulated by neural activity. (A) Prior to neuronal activity, the Fos promoter is primed for response by the association of sequence-specific DNA binding transcription factors with stimulus-response elements (gray boxes) in the proximal promoter. RNA polymerase II (Pol II) is also pre-associated with the Fos promoter prior to activation. Numbers show base pair distances of each element from the transcription start site (TSS). The promoter is kept off in part by the local recruitment of HDACs. Key sites of calcium-regulated phosphorylation are represented by the circled letter P. (B) Calcium induces a switch in cofactors present at the Fos promoter, with recruitment of the co-activator and histone acetyltransferase CBP and loss of the repressive HDACs. (C) Distal enhancer elements (E.E.) contribute to activity-dependent transcription. These elements are bound by transcription factors including SRF and CREB, and show calcium- dependent recruitment of CBP and Pol II binding. Chromatin looping may bring the enhancer into physical proximity of the proximal promoter and Fos TSS. (D) Transcription elongation is regulated by stimulus-dependent phosphorylation of two sites in the C-terminal domain of the large subunit of RNA polymerase II. The pre-initiation form of RNA Pol II is bound to the Fos promoter but is not competent to drive RNA synthesis. Phosphorylation of serine 5 (pSer5) is sufficient to promote engagement but results in polymerase stalling within the transcribed region of many genes. Productive elongation requires additional phosphorylation of RNA Pol II at serine 2 (pSer2)...... 10

xiv

coactivators and corepressors is an important mechanism to regulate the function of pre-bound transcription factors such as CREB, MEF2, and SRF. (B) Nuclear translocation of the transcription factors NFAT and NF-kB is induced by a wide variety of stimuli including neuronal activity, allowing these factors to bind to their target gene promoters. By contrast, neuronal activity drives the nuclear export of the forkhead box transcription factor FOXO3 and prevents nuclear translocation of CCAT. (C) Regulated binding of transcription factors is controlled through different mechanisms. In the case of CREB, signal-dependent regulation of histone modifying enzymes may lead to a change chromatin structure that alters the accessibility of CREB binding sites. For DREAM, direct binding of calcium to the EF-hands in this repressor protein changes its affinity for DNA, releasing it from its binding site. (D) In addition to the classic IEGs transcription factors, such as Fos, Jun, and Egr family members, additional transcription factors are subject to activity-dependent regulation of expression. These transcription factors include ICER, a repressor form of the CREB family member CREM, and the bHLH-PAS domain transcription factor NPAS4. Expression of other transcription factors is likely to be repressed by neuronal activity, however these remain to be identified...... 16

Figure 4: Schematic depicting splice variants of MEF2A, MEF2C, and MEF2D. MEF2A, C, and D all have a great degree of structural homology. The MADS and MEF2 domains of each protein constitute the DNA binding domain (Molkentin et al., 1996). MEF2A and D each contain 2 alternatively spliced domains. Each has either an α 1 or an α 2 domain, as well as an optional β domain. These alternative splice sites yield a total number of four distinct splice variants. MEF2C contains an additional alternatively spliced region, the γ domain, which allows for up to eight distinct MEF2C splice variants. By contrast, all MEF2A and MEF2D variants contain the γ domain. TAD; transcriptional activation domain. Red arrows indicate alternatively spliced regions...... 23

the subsequent phosphorylation of SynGAP. While NR2B-containing NMDARs have also been shown to interact with Ras-GRF1 (not shown), how that signal is integrated with SynGAP activation remains to be determined. The EphB2 receptor has been shown to interact with the NR1 subunit and potentiate NMDAR-mediated calcium influx and downstream signaling cascades by phosphorylating the NR2B subunit. Lastly, the scaffolding protein Yotiao can bind to NR1 splice variants containing the C1 cassette and tether PKA and PP1 to the channel complex. While it is not known if this tethering is important for PKA-mediated NMDAR signaling (not shown), this interaction could mediate PP1-dependent signaling to the nucleus and dephosphorylation of CREB...... 43

Figure 7: CaRF is a novel transcription factor that exhibits complex regulation by neuronal activity. (A) Post-translational modifications of CaRF. The numbers represent amino acid positions from human CaRF. P, phosphorylation; Ac, acetylation; S, serine; K, lysine; DBD, DNA binding domain; TAD, transcriptional activation domain. (B) Model for the bimodal calcium-dependent regulation of CaRF-mediated transcription. Membrane depolarization induced by the elevation of extracellular potassium leads to the opening of voltage-gated calcium channels. This stimulus is associated with an increase in the transcriptional activity of the CaRF activation domain tethered via UAS-Gal4 to a luciferase reporter plasmid, whereas the same stimulus results in a decrease in Carf mRNA expression 6 hours after membrane depolarization...... 67

Figure 9: CaRE1 is required for membrane depolarization-induced activation of Bdnf promoter IV in CaRF knockout neurons. (A) Schematic of the Bdnf pIV- luciferase reporter plasmids used. The numbers indicate the position of the promoter 5’ end relative to the initiation site of transcription. pIV-Luc (Tao et al., 2002) contains the proximal 170bp of Bdnf pIV; pIV(mCaRE1)-Luc has the CaRE1 site mutated to a sequence (CTTCCGCCAGGC) that does not bind CaRF. (B) Mutation of the CaRE1 element leads to a reduction in membrane depolarization-induced Bdnf pIV activity in both Carf+/+ and Carf-/- cortical neurons. n = 2-3. *p<0.05, pIV(mCaRE1) compared with pIV...... 76

xvi

1000-fold molar excess of unlabeled MRE, CaRE1, or cCaRE. The right triangles indicate increasing concentrations of unlabeled competitor (“Comp.”), and the arrow indicates the transcription factor-radiolabeled probe complexes. (C) CaRF binds CaRE1. The binding of CaRF to a radiolabeled cCaRE probe was either not competed (-) or competed with the addition of a 10-, 100-, or 1000-fold molar excess of unlabeled cCaRE, CaRE1, or MRE. The right triangles indicate increasing concentrations of unlabeled competitor (“Comp.”), and the arrow indicates the transcription factor-radiolabeled probe complexes...... 79

Figure 11: MEF2 and CaRF both bind to CaRE1. (A) The intensity of the transcription factor-radiolabeled probe complexes (MEF2-MRE) in the competition assays shown in Figure 10B above were quantified relative to probe intensity in the same lane. (B) The intensity of the transcription factor- radiolabeled probe complexes (CaRF-cCaRE) in the competition assays shown in Figure 10C above were quantified relative to probe intensity in the same lane. Bars display average relative intensity measurements from three independent experiments, and the error bars represent S.E.M...... 80

Figure 12: CaRF and MEF2 bind independently to CaRE1. The ability of CaRF and MEF2 to bind to CaRE1 cooperatively (or competitively) was assessed using competition EMSAs. (A) The intensity of the CaRF-cCaRE complex was quantified relative to probe intensity in the same lane in a competition assay similar to those described in Figure 10 above (black bars) or when CaRF was cotranscribed and translated with MEF2 (gray bars). (B) The intensity of the MEF2-MRE complex was quantified relative to probe intensity in the same lane in a competition assay similar to those described in Figure 10 above (black bars) or when MEF2 was cotranscribed and translated with CaRF (gray bars). Bars display average relative intensity measurements from three independent experiments, and the error bars represent S.E.M...... 81

Figure 13: MEF2 can drive CaRE1-dependent gene transcription. (A) MEF2 activates Bdnf exon IV transcription in a CaRE1-dependent manner. A wildtype Bdnf pIV reporter plasmid (pIV-Luc) or a version bearing mutations at CaRE1 (pIV(mCaRE1)-Luc) were transfected into HEK 293T cells with mammalian expression vectors containing either CaRF, MEF2A and MEF2D, CREB, or an empty vector control. The bars show the mean values from three independent experiments scaled to the vector control. *p<0.05, pIV(mCaRE1)-Luc vs. pIV- Luc. (B) Endogenous MEF2 contributes to CaRE1-dependent transcription in neurons. Luciferase reporter plasmids enhanced by the MRE, CaRE1, or cCaRE elements were transfected into cultured mouse cortical neurons along with shRNA vectors that knockdown (KD) MEF2A and MEF2D. An empty shRNA vector was used as a control (Ctrl). The bars show the mean values from three independent experiments scaled to the vector control from each day. *p<0.05 KD vs. Ctrl...... 83

xvii

responsive to membrane depolarization. Cultured embryonic rat cortical neurons were cotransfected with a pUAS-Luc reporter vector along with plasmids expressing Gal4 fusions of the indicated MEF2C splice variants. “Δγ” indicates a γ-containing MEF2C variant with a S396A point mutation. The bars show the mean values from four independent experiments scaled to the untreated empty vector control from each day. In all graphs, error bars represent S.E.M. *p<0.05 6 hr KCl vs. none...... 85

Figure 15: Differential regulation of endogenous Bdnf transcription by MEF2 family members in cortical neurons. (A) Cultured embryonic rat cortical neurons were infected with lentiviruses containing shRNAs targeting individual MEF2 family members. Knockdown (KD) of endogenous mRNA levels was validated by quantitative PCR. Levels of MEF2 expression are shown normalized to levels in cells infected with the empty vector control viruses. n = 4. (B, C, and D) Cultured embryonic rat cortical neurons were infected with the indicated shRNA-delivering lentiviruses or empty vector controls. 6 days after infection, neurons were either left untreated or stimulated with 55 mM KCl for 3 hrs. Endogenous Fos (B), Bdnf exon IV (C), or Bdnf exon I (D) mRNA levels were determined by quantitative PCR. n = 3-4. *p<0.05 MEF2 KD vs. Ctrl...... 87

Figure 16: Validation of Carf knockdown by lentiviral infection. (A) Fluorescence microscope image of neurons infected with lentiviruses containing either the scrambled control shRNA (Scr) or Carf KD shRNA. GFP – pLLx3.8-infected cells; red – MEFD antibody staining (neuronal marker). (B) Cultured embryonic mouse cortical neurons were infected with lentiviruses containing shRNAs targeting two independent sites within the Carf gene. Knockdown (KD) of endogenous mRNA levels was validated by quantitative RT-PCR. Levels of Carf expression are shown normalized to levels in cells infected with the control viruses. n = 3. (C) Nuclear extracts from cultured neurons infected with the indicated lentiviruses were analyzed by Western blot using an antibody that detects the CaRF protein (Tao et al., 2002). Histone H3 is shown as a loading control. Error bars represent S.E.M. *p<0.05 KD vs. control...... 106

Figure 17: TTX withdrawal is an NMDAR-dependent stimulus that induces CREB phosphorylation. (A) Cultured embryonic mouse cortical neurons were either treated on DIV4 with 1 µM tetrodotoxin (TTX) and then withdrawn from TTX (TTX w/d) for 6 hrs on DIV6 or treated with 55 mM KCl for 6 hrs on DIV6 prior to RNA harvesting analysis by quantitative RT-PCR. Both sets of treatments were done in combination with the indicated channel blockers. “Basal” – prior to 6 hr treatments; “Stim” – 6 hr stimulus; “Stim+APV” – 6 hrs of stimulus in the presence of the NMDAR blocker APV (100 µM); “Stim+Nim” – 6 hrs of stimulus in the presence of the L-VGCC blocker nimodipine (5 µM); “Stim+A+N” – 6 hrs of stimulus in the presence of both APV and nimodipine. n = 1-3. (B) Whole cell lysates from cultured neurons treated with 1 µM TTX on DIV4 ± 30 min TTX withdrawal on DIV6 were analyzed by Western blot for Ser133 CREB phosphorylation. Total CREB was blotted for as a control. Error bars represent S.E.M. *p<0.05 TTX w/d vs. indicated blockers. #p<0.05 KCl vs. indicated blockers...... 108

xviii

Figure 19: The transcription factor CaRF regulates numerous genes that are important for calcium signaling in neurons. (A) Decrease of genes in response to Carf KD. The rows represent the 100 transcripts most changed by a decrease of CaRF (p < 0.0015, adjusted p < 0.475), sorted according to the t-statistic, which takes direction of regulation into account. Each column is an experiment labeled as control conditions or KCl-stimulated conditions and SCR (scrambled virus) or KD (Carf KD virus). The cells of the heat map...... 112

Figure 20: Validation of Grin3a knockdown by lentiviral infection. (A) Cultured embryonic rat hippocampal neurons were infected with lentiviruses containing shRNAs targeting two independent sites within the Grin3a gene. Knockdown (KD) of endogenous mRNA levels was validated by quantitative RT-PCR. Levels of Grin3a expression are shown normalized to levels in cells infected with the control viruses. n = 4-20. (B) Membrane fractions from cultured neurons infected with the indicated lentiviruses were analyzed by Western blot using an antibody that detects the NR3A protein. The NR1 NMDAR subunit was blotted for as a control. Error bars represent S.E.M. *p<0.05 KD vs. control (Ctrl)...... 115

Figure 21: TTX withdrawal-dependent Bdnf exon IV induction is potentiated in Grin3a KD neurons. (A) Cultured embryonic rat hippocampal neurons were infected with either Grin3a shRNA 4-containing or control (Ctrl) lentiviruses. Cells were treated with 1 µM TTX on DIV7 ± 6 hrs TTX withdrawal (TTX w/d) on DIV9. Samples were analyzed for Bdnf exon IV induction by quantitative RT- PCR. n = 9-18. (B) Cultured neurons were infected with either Grin3a shRNA 5- containing or control (Ctrl) lentiviruses. Cells were treated as described in part A and samples were analyzed for Bdnf exon IV induction. n = 3. Error bars represent S.E.M. *p<0.05 shRNA TTX w/d vs. Ctrl TTX w/d...... 116

Figure 22: Membrane depolarization-dependent Bdnf exon IV induction is normal in Grin3a knockdown (KD) neurons. Cultured embryonic rat hippocampal neurons were infected with either Grin3a shRNA 4-containing or control (Ctrl) lentiviruses. Cells were treated with 55 mM KCl for 6 hrs on DIV9. Samples were analyzed for Bdnf exon IV induction by quantitative RT-PCR. Error bars represent S.E.M. n = 6-9...... 117

xix

withdrawal was done in the presence of 100 µM APV, 10 µM nifedipine, or both, as indicated. n =3. (B) Cells were treated with the transcriptional inhibitor actinomycin D (ActD; 30 nM), as indicated. n =3. Error bars represent S.E.M. *p<0.05 TTX w/d in Ctrl vs. in the presence of indicated blockers. #p<0.05 TTX w/d in Grin3a KD vs. in the presence of indicated blockers...... 118

Figure 24: MEF2-, but not CREB-, dependent transcription is potentiated in Grin3a knockdown (KD) neurons. (A) A luciferase reporter plasmid enhanced by the Calcium/cAMP Response Element (CRE) was transfected into cultured embryonic rat hippocampal neurons that had been infected with either Grin3a shRNA 4-containing or control (Ctrl) lentiviruses. Cells were treated with 1 µM TTX on DIV7 and then withdrawn from TTX (TTX w/d) on DIV9 for the indicated lengths of time. n =3-6. (B) The experiment described in part A was performed using a luciferase reporter plasmid enhanced by the MEF2 Response Element (MRE). n =6-9. Error bars represent S.E.M. *p<0.05 Ctrl vs. Grin3a KD, as determined by two-way analysis of variance (ANOVA)...... 120

Figure 25: Grin3a knockdown (KD) neurons exhibit an exuberance of GABAergic synapses. (A) Confocal microscope images of cultured embryonic rat hippocampal neurons transfected with either the Grin3a KD shRNA-containing plasmid or control vector, as well as a GFP-expressing vector for the purpose of identification. Cells were maintained for 21 DIV prior to fixation. The white box in the first panel is enlarged to show synapses. Grayscale – cell fill in transfected cells; red – GABAAγ2 subunit (GABAergic postsynaptic marker); green – GAD65 (GABAergic presynaptic marker). (B) Quantification of GABAergic synapse density in 21 DIV hippocampal neurons transfected, fixed, and stained as described in part A. n =29. Error bars represent S.E.M. *p<0.05 Ctrl vs. Grin3a KD...... 122

Figure 26: Carf and Grin3a are inversely regulated by neuronal activity in vitro. RNA was harvested from cultured hippocampal neurons after the following treatments: Ctrl – no treatment; EGTA – 6 hrs 2.5 mM EGTA; TTX – 24-48 hrs 1 µM TTX; KCl – 6 hrs 55 mM KCl; Bicuc – 3 hrs 50 µM bicuculline + 2.5 mM 4-AP. EGTA, TTX, and KCl treatments were done in embryonic rat hippocampal neurons at DIV 7-9; bicuculline/4-AP treatments were done in P0 mouse hippocampal neurons at DIV 16. Samples were analyzed by quantitative RT- PCR for either Carf or Grin3a induction. n = 3-27. Error bars represent S.E.M. *p<0.05 indicated treatment vs. Ctrl for Carf. #p<0.05 indicated treatment vs. Ctrl for Grin3a...... 124

Figure 27: Carf and Grin3a are both downregulated in vivo in response to pilocarpine-induced seizure. Adult C57/B6 mice were injected with saline or with pilocarpine (375 mg/kg) to induce seizure, and the hippocampus was dissected out at the indicated time points. Quantitative RT- PCR was run on cDNA made from harvested total RNA...... 126

development. Green arrows indicate activating interactions or effects. Red arrows indicate limiting or repressive interactions or effects...... 129

xxi

Abbreviations and Acronyms

ADAR2 RNA-dependent adenosine deaminase 2

AKAP A kinase-anchoring protein

Akt protein kinase B (also known as PKB)

AMPA α-amino-3-hydroxyl-5-methyl-4-isoxazole-proprionate

AMPAR AMPA receptor

ANOVA analysis of variance

Arc Activity-Regulated Cytoskeletal Protein

ATF activating transcription factor

BDNF Brain-derived Neurotrophic Factor bHLH basic helix-loop-helix

CaM Ca2+/calmodulin

CaMK Ca2+/CaM-dependent protein kinase

CaMKI Ca2+/CaM-dependent protein kinase I

CaMKII Ca2+/CaM-dependent protein kinase II

CaMKIV Ca2+/CaM-dependent protein kinase IV

CaMKK CaMK kinase

CaRE Calcium Response Element

CaRF Calcium Response Factor

CBP CREB-binding protein

CCAT calcium channel associated transcription regulator

ChIP chromatin immunoprecipitation

ChIP-Seq ChIP-sequencing

CNS central nervous system

xxii

CRAC calcium release-activated calcium

CRE Calcium/cAMP Response Element

CREB Calcium/cAMP Response Element-binding protein

CREM cAMP Response Element Modulatory Protein

CREST Calcium-Responsive Transactivator

Crtc CREB-regulated transcription coactivator

DAPK1 death-associated protein kinase 1

DIV day in vitro

DREAM Downstream Repressor Element Antagonist Modulator

DYRK dual specificity tyrosine phosphorylation-regulated kinase

Egr early growth response eIF3E eukaryotic initiation factor 3 subunit E

Elk-1 Ets-like gene 1

EMSA electrophoretic mobility shift assay

ER endoplasmic reticulum

Erk extracellular signal-regulated kinase eRNA enhancer RNA

Ets E-twenty six

FIRE Fos intragenic regulatory element

FOXO forkhead box O

IEG immediate early gene

GABA γ-aminobutyric acid

GAD65 glutamic acid decarboxylase 65

GAP GTPase activating protein

Gapdh Glyceraldehyde-3-phosphate dehydrogenase

xxiii

GEF GTP exchange factors

GFP green fluorescent protein

GSEA Gene Set Enrichment Analysis

GSK3 glycogen synthase kinase 3

HAT histone acetyltransferase

HDACs histone deacetylases

IκB Inhibitor of NF-κB

IKK IκB kinase i.p. intraperitoneally

IP3 inositol trisphosphate

KD knockdown

KO knockout

LTD long-term depression

LTP long-term potentiation

L-VGCC L-type voltage-gated calcium channel

MAGUK membrane-associated guanylate kinase

MAPK mitogen-activated protein kinase

MEF2 Myocyte Enhancer Factor 2

MKL myocardin-related transcription factor

MRE MEF2 Response Element nAChR nicotinic acetylcholine receptors

NCS Neuronal Calcium Sensor

NEMO NF-κB essential modulator

NFAT Nuclear Factor of Activated T Cells

NF-κB Nuclear Factor κB

xxiv

NLS nuclear localization signal

NMDA N-methyl-D-aspartate

NMDAR NMDA receptor

Npas4 Neuronal PAS Domain Protein 4

Nr nuclear receptor

PAS Per-Arnt-Sim

Pdyn prodynorphin

PI3K phosphatidylinositol 3-kinase

PIKfyve phosphatidylinositol 3-phosphate 5-kinase

PKA protein kinase A

PKC protein kinase C

PLC phospholipase C

PP1 protein phosphatase 1

PP2A protein phosphatase 2A

PSD postsynaptic density

Ras-GRF Ras-specific guanine nucleotide-releasing factor

Rb retinoblastoma tumor suppressor

RCE Retinoblastoma Control Element

Rheb Ras homologue enriched in brain

RNAi RNA interference

SAP synapse-associated protein

Sap-1 SRF accessory protein 1 shRNA short hairpin RNA

SRE Serum Response Element

SRF Serum Response Factor

xxv

Stim stromal interaction molecule

SUMO small ubiquitin-like modifier

SynGAP synaptic Ras GTPase activating protein

TCF Ternary Complex Factors

TM transmembrane domain

TSS transcriptional start site

TTX tetrodotoxin

UAS upstream activating sequence

VGCC voltage-gated calcium channel

WT wildtype

xxvi

Acknowledgements

I am very grateful to my advisor, Anne West, for her constant support, guidance, and enthusiasm. She not only taught me how to carry out question- driven science, but she was also an incredibly warm, caring, and delightful person with whom to work for all of the years I have spent in her lab. She set an excellent example of what it means to come to lab every day excited to be there. I am also indebted to my thesis committee, Dona Chikaraishi, Jim McNamara,

Geoff Pitt, and Scott Soderling, for their helpful insights and constructive criticisms throughout the duration of my dissertation work.

I would like to thank all of the members of the West lab – both past and present – for their assistance in my experiments, for their suggestions in lab meetings, and for making my daily life in the lab very enjoyable and occasionally hilarious. In particular, Ashley, Ranjula, and Young May – the other Ph.D. students in the lab – have become very close friends of mine. I enjoy spending time with them both doing science and at our other non-science excursions. I am very appreciative of Jay Deng, the post-doc in the lab, for his knowledge and expertise, perpetual skepticism that always helped me refine my ideas, and assistance with the Carf knockout mouse experiments I have recently started on.

I would like to thank Charlotte Schwarz, a rock-star undergraduate student who has been working with me for the last two years and who made a significant contribution to the MEF2 project. I would also like to recognize Kelli McDowell and Andreas Pfenning for having laid some of the groundwork for what became my thesis project, and for continuing to be great friends of mine even after they left the lab. Finally, Bill Rinehart was the lab manager for my first 3+ years in the

xxvii

lab. I would like to thank him for always magically knowing where everything was, being able to fix anything at a moment’s notice, and for always having some amazing recipe from Bon Appetit to tell me about in between experiments.

I would like to thank Wolfgang Liedtke for allowing me to use the microplate luminometer in his lab for my luciferase experiments, and Michele

Yeo and Suki Lee for teaching me how to use it and providing technical assistance. I would also like to thank many of the members of the former Ehlers lab for their technical expertise with various cellular and molecular methods. In particular, Ming-Chia Lee was invaluable in her suggestions with synaptic immunostaining for NMDA receptor subunits. I am also very grateful to

Marguerita Klein for her guidance with difficult cloning projects.

I was very lucky in my time in graduate school to have made a number of close friends in the Neurobiology Ph.D. program. I spent many evenings with

Monica Coelho Favre, Katie Tschida, Amrita Nair, and Molly Heyer when I was not doing science. They were my first group of friends here in Durham, and I sincerely hope to always stay in touch with them, even as our paths diverge.

I am indebted to Ann Sink, Jessica Herbst, and Beth Peloquin, all of whom have served as Administrative Coordinator of the Neurobiology Program at one time or another during my time at Duke. They were all incredibly helpful in their tireless dedication to all of the Neurobiology graduate students.

I would also like to recognize my undergraduate research advisor, Nael

A. McCarty, who inspired me to pursue a post-graduate degree in the biomedical sciences in the first place.

I am deeply grateful to my family and my friends outside of science, for their undying support through this lengthy degree program. My parents, Dennis

xxviii

Tougas and Sue Hatton, have always encouraged me to do my best and follow my dreams, wherever they might take me. My brother, Jeff Tougas, has always been supportive and, I am happy to say, in recent years has become one of my very best friends. I’d like to thank Naz Majdi and Kelly Schoenecker, two friends

I’ve had from earlier life stages, to whom I have remained close and who have even come to visit me in Durham on occasion. I’d also like to thank Hannah

Terry for being an amazing friend and gym buddy, as well as for her continual efforts to bring a sense of sanity to my sometimes-crazy lab life.

Last, but definitely not least, I am profoundly appreciative of my wonderful husband, Gray. I met and married him while in graduate school, and even if nothing else good had come of my time here, I would still say it had been worth it for having found him. He has acted as a sounding board, a dear friend, and even on rare occasion a second pair of hands in lab. He has loved me, supported me, and encouraged me throughout my graduate studies, both in my scientific research and in all of my other pursuits and passions.

xxix

1. Introduction

1.1 Activity-regulated gene transcription is critical for normal brain development and function

Neuronal activity-regulated gene transcription has been shown to contribute to many biological processes in the brain including neurite outgrowth

(Spitzer, 2006; Wayman et al., 2006), cell fate determination (Borodinsky et al.,

2004), synapse development (Greer and Greenberg, 2008), critical period plasticity (Sugiyama et al., 2008), long-lasting changes in synaptic strength

(Alberini, 2009), and neural adaptations to drugs of abuse (Nestler, 2001). In the last two decades, increasingly comprehensive studies have described complex patterns of gene transcription induced and/or repressed following different kinds of stimuli that act in concert to effect adaptations upon neuronal and synaptic physiology (Flavell et al., 2008; Guan et al., 2005; Kim et al., 2010; Xiang et al., 2007; Zhang et al., 2007). A key theme to emerge from these studies is that of specificity, meaning that different kinds of stimuli up- and downregulate distinct sets of genes (Bading et al., 1993; Bartel et al., 1989; Hardingham et al., 2002).

In some cases such as cortical development, the activity-dependent processes appear to be inductive. For example, in the visual cortex, the onset of patterned visual input from the two eyes and the subsequent activity-regulated transcription-dependent maturation of inhibition induces the closure of the critical period for experience-dependent rewiring of inputs from the two eyes

(Fagiolini et al., 2004). At other times, the actions of activity-regulated transcription appear to be largely homeostatic. The term homeostasis refers to phenomena by which a single cell, an organ system, or an entire organism

maintains a stable internal environment in the face of changing external stimuli

(Cannon, 1932). One example of this type of regulation is the cellular homeostatic plasticity mechanisms that are known to be able to mediate the scaling of excitatory synaptic strength following changes in synaptic activity of the same cell (Burrone and Murthy, 2003; Turrigiano, 2007).

How can neuronal activity-induced changes in gene transcription lead to long-lasting alterations in neuronal physiology and synaptic function? Many genes whose expression is regulated by changes in neural activity states actually have specific functions in synapse development or physiology (Flavell et al., 2008;

Guan et al., 2005; Hevroni et al., 1998; Kim et al., 2010; Lanahan and Worley, 1998;

Nedivi et al., 1993; Qian et al., 1993; Xiang et al., 2007; Zhang et al., 2007) (Table 1).

The evidence that neural activity can change the expression of synaptic gene products suggests that study of these genes may reveal neural-selective mechanisms of transcription that are of particular importance for synaptic plasticity (Leslie and Nedivi, 2011). In the next section, I will discuss one particularly important activity-regulated gene known to shape changes in neural physiology and development, as well as the signaling mechanisms that control its activity-dependent induction.

1.2 Brain-Derived Neurotrophic Factor (BDNF) regulates neuronal physiology and synaptic function

BDNF is a secreted protein of the neurotrophin family that has numerous functions in the nervous system including the promotion of neuronal survival and the modulation of synaptic function (Lewin, 1996; Poo, 2001). Exposure to a wide range of environmental stimuli leads to induced expression of Bdnf mRNA

Table 1: Neuronal activity-regulated genes that modulate synaptic function. Gene Product Function References Arc Activity-Regulated AMPA-type (Link et al., 1995; Cytoskeletal protein glutamate receptor Lyford et al., 1995) (Arc/Arg 3.1) recycling Arcadlin Arcadlin Cell adhesion (Yamagata et al., 1999; Yasuda et al., 2007) Bdnf Brain-Derived Activation of receptor (Zafra et al., 1990) Neurotrophic tyrosine kinase (TrkB) Factor signaling Cox2 Cyclooxygenase 2 Prostaglandin (Yamagata et al., signaling 1993) Cpg15 Cpg15/Neuritin Dendrite outgrowth (Nedivi et al., 1998) Cpg2 Cpg2 Endocytosis (Cottrell et al., 2004) Dusp6 Map Kinase Phosphatase (Hevroni et al., 1998; phosphatase 3 Nedivi et al., 1993) (MKP3) Homer1 Homer 1a Scaffolding of (Brakeman et al., synaptic signaling 1997) proteins H2-D1, Major Cell adhesion (Corriveau et al., H2-K1, Histocompatability 1998) H2-T22, Complex Group I H2-T23 Antigens Narp Narp AMPA-type (Chang et al., 2010; glutamate receptor O'Brien et al., 1999; clustering Tsui et al., 1996) Pdyn Prodynorphin Secreted (Nedivi et al., 1993) neuropeptide Pim1 Pim1 Serine/Threonine (Konietzko et al., kinase 1999)

Plat Tissue Plasminogen Endopeptidase (Qian et al., 1993) activator (TPA) Plk2 Serum-Inducible Ser/Thr kinase (Kauselmann et al., Kinase (SIK) 1999) Rgs2 Regulator of G- Inhibits G-protein (Ingi et al., 1998) protein Signaling 2 signaling Rheb Rheb Ras-superfamily (Yamagata et al., small GTPase 1994) Sema3d Semaphorin 3d Axon guidance (Flavell et al., 2008) Syt4 Synaptotagmin 4 Vesicle exocytosis (Vician et al., 1995) Ube3a Ube3a Ubiquitin ligase (Greer et al., 2010)

in corresponding activated brain regions, suggesting that the induction of Bdnf transcription may be a common mechanism for environmental modulation of neural function (Lu, 2003). Neural activity also regulates both the local secretion of BDNF protein and the trafficking of the BDNF receptor TrkB to the plasma membrane, allowing BDNF-TrkB signaling to be tightly linked to activity

(Balkowiec and Katz, 2000; Meyer-Franke et al., 1998). Mutations that partially reduce either overall levels of BDNF or BDNF secretion have substantial effects on brain development and plasticity (Chen et al., 2006; Egan et al., 2003; Genoud et al., 2004). Taken together, these data suggest that precise temporal and spatial control of BDNF expression is essential to its function.

The mammalian Bdnf gene is comprised of nine exons with at least eight alternative promoters that are differentially used during development, across brain regions, and in different cell types (Aid et al., 2007; Liu et al., 2006). All of the Bdnf promoters are active to at least some degree in the CNS, and transcription from each of these promoters can be induced by neuronal activity

(Aid et al., 2007). Promoter IV (formerly referred to as “promoter III” in the five- exon nomenclature of the Bdnf gene, see (Timmusk et al., 1993)) is strongly activity-responsive in cultured embryonic neurons and has been the most extensively studied at the molecular level (Shieh et al., 1998; Tao et al., 1998; West et al., 2001).

One of the key insights to be derived from studies of Bdnf promoter IV is that the tight temporal-, spatial-, and stimulus-specific regulation of this single promoter is achieved by a complex interplay between multiple activity-regulated transcriptional pathways (Figure 1). Three calcium-response elements (CaREs) within the proximal 170bp of the major embryonic promoter IV transcriptional

NPAS4! P! P! P! MEF2! CBP! P! P! P! Pol II! CaRF! USF1/2! CREB! NF-κB! bHLHB2! NFAT! CaRE1! CaRE2! CaRE3! TSS! TSS!

IV (Chen et al., 2003; Shieh et al., 1998; Tao et al., 1998). Starting at the element most distal to the TSS, these CaREs are selectively bound and regulated by the unique transcription factor Calcium-Response Factor (CaRF) (Tao et al., 2002), the upstream stimulatory factors USF1/2 (Chen et al., 2003), and members of the

CREB family (Shieh et al., 1998; Tao et al., 1998). In addition, the activity- inducible transcription factor Neuronal Per-Arnt-Sim (PAS) Domain Protein 4

(Npas4) has been shown to interact with another activity-response element 5’ to

CaRE1 (Pruunsild et al., 2011). An alternative TSS about 100bp downstream of the 5’-most end of Bdnf exon IV is regulated by the association of the Nuclear

Factor κB (NF-κB) (Lipsky et al., 2001) and the basic helix-loop-helix (bHLH) protein bHLHB2 (Jiang et al., 2008) with elements that fall between the two TSSs.

The Nuclear Factor of Activated T Cells (NFAT) is reported to regulate Bdnf exon

IV expression in response to N-methyl-D-aspartate (NMDA) receptor (NMDAR) activation via its association with an intragenic element located 140-156bp 3’ to the alternative TSS (Vashishta et al., 2009). Finally, ChIP studies have shown that

Bdnf promoter IV is bound by myocyte enhancer factor 2 (MEF2) (Hong et al.,

2008), however up until the work described in this dissertation, the specific binding site for this factor within Bdnf promoter IV had not been identified.

Distinct functions of these transcription factors in the regulation of Bdnf promoter IV have been revealed through the generation of transgenic mice that either lack expression of one of these transcription factors or that block the ability of specific factors to regulate Bdnf. For example, studies in mice lacking the

CaRE1-binding protein CaRF show that this factor appears to play a brain region-specific role in regulation of Bdnf transcription (McDowell et al., 2010).

Carf knockout mice show reduced levels of Bdnf exon IV-containing mRNA transcripts and reduced BDNF protein in the frontal cortex compared with their wildtype littermates, however Bdnf expression is unchanged in the hippocampus and striatum of the knockout mice (McDowell et al., 2010). Furthermore, although CaRE1 is required for activity-dependent transcription of Bdnf exon IV,

CaRF is selectively required for the activity-independent regulation of Bdnf promoter IV activity (McDowell et al., 2010). The failure of the Carf knockout to fully phenocopy the loss of the CaRE1 site implies that there likely exist

additional CaRE1 binding proteins that are yet to be identified. By contrast, the binding of CREB to CaRE3 is selectively required for the activity-dependent regulation of Bdnf exon IV transcription. The functional importance of this interaction was elegantly demonstrated by generation of a mouse strain bearing a mutation knocked into Bdnf promoter IV that changes the CaRE3 sequence

(TCACGTCA) to a sequence that does not support CREB family protein binding

(CAGCTGCA) (Hong et al., 2008). Neurons from CaRE3 mutant mice have normal basal levels of BDNF but lack activity-inducible transcription from promoter IV, validating the requirement for this CaRE in activity-dependent Bdnf gene regulation in vivo. Interestingly, disruption of CaRE3 is associated with impaired Bdnf promoter IV recruitment of other transcriptional regulators including MEF2, which binds to a DNA sequence distinct from CaRE3. These data provide experimental support for the role of a multifactor transcriptional complex at Bdnf promoter IV, and suggest a function for CREB in nucleating the assembly of this complex.

1.3 Fos: the archetypal member of a second class of activity-regulated genes

There exists a second class of activity-regulated genes that are capable of exerting an effect on neuronal physiology and synaptic function. Classic immediate-early gene transcription factors, which are general response factors in a broad range of cell types, are capable of initiating the transcription of a myriad of other genes once they themselves are expressed. In fibroblasts, Fos is only one of a set of genes whose transcription is rapidly induced by growth factors. Since induction of this transcriptional program proceeds without the need for prior protein synthesis, these genes were termed “immediate early genes” (IEGs) in

analogy to the protein synthesis-independent gene expression program that underlies viral oncogenesis (Lau and Nathans, 1987). IEGs include members of the Fos, Jun, early growth response (Egr), and nuclear receptor (Nr) families of transcription factors. In addition to Fos, many of the classic growth factor regulated IEGs are part of the neural activity-dependent transcriptional program including Fosb, Fosl1, Fosl2, Jun, Junb, Egr1 (also termed zif/268; Ngfi-a; Krox-24),

Egr3, and Nr4a1 (also termed nur77, Ngfi-b) (Herdegen and Leah, 1998). These genes encode transcription factors that are induced in many cells types in response to a broad range of stimuli. Thus, rather than having a specific cellular function, the IEG program appears to play a more general role in coupling extracellular stimuli with intracellular adaptations. The different functional consequences of IEG induction arise through cell type- and stimulus-specific recruitment of complexes of these transcription factors to distinct sets of late response genes promoters (Hill and Treisman, 1999). In the CNS, IEG transcription factors have been shown to contribute to diverse processes, including neurite outgrowth, neurotransmitter fate, and synapse plasticity

(Dragunow et al., 2000; Li et al., 2007; Marek et al., 2010; Maze et al., 2010).

Because Fos was the first of the activity-regulated genes to be identified, and because it is so widely and strongly induced, considerable effort has been devoted to understanding the molecular mechanisms that regulate its transcription. The details of Fos transcription exemplify many of the general principles of activity-dependent transcription, and thus will be described in detail here. Specifically, Fos induction has been shown to be dependent upon 1) the association of sequence-specific DNA binding transcription factors with stimulus-response elements in the proximal promoter, 2) the stimulus-dependent

recruitment to these transcription factors of transcriptional co-activators and co- repressors that post-translationally modify promoter-associated histones, 3) the modulation of promoter function by distant enhancer elements, and 4) the regulation of transcriptional elongation (Figure 2).

1.3.1 Mechanisms of Fos transcriptional regulation: Association of transcription factors with stimulus-response elements in the proximal promoter

Mutagenesis of the Fos promoter revealed two elements that are differentially required for promoter activity in response to a variety of stimuli

(Sheng et al., 1990). One element about 300bp upstream of the Fos transcription start site (TSS) is required for serum- and growth factor-dependent induction of

Fos and was therefore named the Serum Response Element (SRE) (Sheng et al.,

1988; Treisman, 1986). A second element, about 60bp upstream of the TSS is required for calcium- and cAMP-dependent regulation of Fos and was named the

Calcium/cAMP-Response Element (CRE) (Hyman et al., 1988; Sheng et al., 1988).

Finally, a distinct element just 5’ to the CRE is required for regulation of Fos transcription by the retinoblastoma tumor suppressor (Rb) and was named the

Retinoblastoma Control Element (RCE) (Udvadia et al., 1992). DNA elements control transcription because they are binding sites for transcription factors, thus once identified the elements are powerful tools for purifying or cloning the binding proteins. In the case of the SRE, the binding protein was called the

Serum Response Factor (SRF) (Norman et al., 1988). Subsequent studies showed that SRF binds the SRE in cooperation with additional proteins called the

Ternary Complex Factors (TCF), which are a subfamily of E-twenty six (Ets) domain-containing transcription factors exemplified by Ets-like gene 1 (Elk-1)

+Ca2+! A)! B)! P! HDAC! HDAC! P! CREST CREST Rb! P! Rb! ! P! ! CBP! HDAC! BRG1! CBP! BRG1! Pol II! P! P! P! Pol II! Elk1! SRF! Sp1! CREB! Elk1! SRF! Sp1! CREB! SRE! RCE! CRE! TSS! SRE! RCE! CRE! TSS!

-300 bp -60 bp 0 bp! -300 bp -60 bp 0 bp!

C)! D)!

Preinitiation! Paused (pSer5)! Elongating (pSer2, pSer5)!

P! P! P! SRF! E.E.! Pol II! Pol II! Pol II! CREB! P! Pol II! P! CBP! P! P! P! P! P!PCBP! ! P! Pol II! TSS! SRF! CREB!

Figure 2: Mechanisms of neuronal activity-induced transcription. The diagrams represent four steps in the process of Fos transcription that are regulated by neural activity. (A) Prior to neuronal activity, the Fos promoter is primed for response by the association of sequence-specific DNA binding transcription factors with stimulus- response elements (gray boxes) in the proximal promoter. RNA polymerase II (Pol II) is also pre-associated with the Fos promoter prior to activation. Numbers show base pair distances of each element from the transcription start site (TSS). The promoter is kept off in part by the local recruitment of HDACs. Key sites of calcium-regulated phosphorylation are represented by the circled letter P. (B) Calcium induces a switch in cofactors present at the Fos promoter, with recruitment of the co-activator and histone acetyltransferase CBP and loss of the repressive HDACs. (C) Distal enhancer elements (E.E.) contribute to activity-dependent transcription. These elements are bound by transcription factors including SRF and CREB, and show calcium-dependent recruitment of CBP and Pol II binding. Chromatin looping may bring the enhancer into physical proximity of the proximal promoter and Fos TSS. (D) Transcription elongation is regulated by stimulus-dependent phosphorylation of two sites in the C-terminal domain of the large subunit of RNA polymerase II. The pre-initiation form of RNA Pol II is bound to the Fos promoter but is not competent to drive RNA synthesis. Phosphorylation of serine 5 (pSer5) is sufficient to promote engagement but results in polymerase stalling within the transcribed region of many genes. Productive elongation requires additional phosphorylation of RNA Pol II at serine 2 (pSer2).

(Buchwalter et al., 2004; Dalton and Treisman, 1992). CRE binding proteins were named the Calcium/cAMP-Response Element Binding protein (CREB) family

(Montminy and Bilezikjian, 1987). The RCE is bound by the zinc-finger transcription factor Sp1 (Udvadia et al., 1993).

Even prior to neural activity, all of these transcription factors as well as the pre-initiation form of the RNA polymerase II complex are bound to the Fos promoter (Kim et al., 2010; Sheng et al., 1988). The primed state of this promoter is likely to be important for the very rapid induction of Fos transcription by stimuli. However, this state also implies that active repression of the promoter may be required in the absence of a stimulus to prevent Fos from being constitutively transcribed.

1.3.2 Mechanisms of Fos transcriptional regulation: Stimulus- dependent recruitment of transcriptional co-activators and co- repressors that post-translationally modify histones

Genomic DNA is wound into a complex secondary and tertiary structure called chromatin via its interactions with structural proteins. The basic repeating unit of chromatin in the nucleosome, which consists of 147bp of DNA wound around an octamer of histone proteins: 2 each of histones H2A, H2B, H3, and H4

(Horn and Peterson, 2002). These histones are subject to extensive post- translational modifications (e.g. acetylation, methylation, phosphorylation, ubiquitination) at specific amino acid residues in their flexible N-terminal tails.

The observed correlation between specific modifications and transcriptional activity has given rise to the hypothesis of a “histone code” that determines the transcriptional state of a gene (Strahl and Allis, 2000). Although the details of this relationship between histone modifications and transcription remains an

active area of investigation (Lee et al., 2010), substantial evidence suggests that stimulus-dependent regulation of histone H3 and H4 acetylation is a major mechanism of promoter activation and repression (Bernstein et al., 2007; Clayton et al., 2006; Roh et al., 2005). In the case of Fos, one mechanism of promoter repression is via the RCE, which recruits a protein complex consisting of Sp1, the transcriptional co-repressor Rb, and the scaffolding protein Calcium-Responsive

Transactivator (CREST). In the absence of synaptic activity, Rb is bound to histone deacetylases (HDACs), which enzymatically remove acetyl groups from the histones surrounding the Fos TSS, repressing transcription (Qiu and Ghosh,

2008). HDACs can also be recruited to the SRF-binding protein Elk-1, although the functional requirement for this interaction at the Fos gene is not known (Yang et al., 2002). Following neuronal activity, calcium-dependent signaling events drive the dissociation of the HDACs from both Rb and Elk, and also induce the active export of class II HDACs (HDAC4 and HDAC5) from the nucleus (Chawla et al., 2003; Qiu and Ghosh, 2008; Yang and Sharrocks, 2006). Simultaneously, signaling cascades lead to the recruitment of the histone acetyltransferase (HAT)

CREB-binding protein (CBP) to both CREB and CREST, acetylating promoter histones and promoting transcription (Chrivia et al., 1993; Impey et al., 2002; Qiu and Ghosh, 2008).

1.3.3 Mechanisms of Fos transcriptional regulation: Modulation of promoter function by distant enhancer elements

In addition to these local events at the Fos promoter, membrane depolarization of neurons is associated with widespread, activity-induced recruitment of both CBP and RNA polymerase II to enhancer elements that neighbor Fos and other activity-regulated genes (Kim et al., 2010). Biochemically,

enhancers have been defined across the genome as regions that show a characteristic chromatin signature that is enriched for histone H3 lysine 4 monomethylation and that shows hypersensitivity to cleavage with enzyme

DNAseI (Heintzman et al., 2007). Functionally, enhancers are defined as any

DNA element that promotes transcription of a given gene regardless of its location in the genome or its orientation with respect to the regulated gene.

Enhancers can be found at great distances from the TSS, as is well documented for regulation of the β-globin locus and the Hoxd gene cluster (Hérault et al., 1999;

Tuan et al., 1985). How distant enhancers regulate promoter activity remains an active area of investigation, however these mechanisms may involve looping of chromatin to bring the enhancers in close proximity to the gene promoter (Li et al., 2006a), and/or large scale chromosome reorganization that brings multiple actively transcribed regions of chromatin to pre-formed transcriptional

“factories” near the nuclear periphery (Sutherland and Bickmore, 2009). Similar to promoter regulatory elements, many enhancer elements are pre-bound by activity-regulated transcription factors including SRF, CREB, and MEF2, which may act to recruit CBP (Flavell et al., 2008; Kim et al., 2010). Interestingly, activity-dependent RNA polymerase II recruitment to enhancers is associated with the induced expression of short, non-coding enhancer RNA transcripts

(eRNAs) that initiate at these non-coding elements (Kim et al., 2010). Although the functions of eRNAs are not known, they may play a role in recruiting chromatin modifying enzymes to maintain the chromatin landscape in a transcriptionally permissive state.

1.3.4 Mechanisms of Fos transcriptional regulation: Regulation of transcriptional elongation

Finally, in addition to the regulation of transcriptional initiation, evidence suggests that Fos transcription may also be regulated at the level of transcriptional elongation. Productive transcriptional elongation is an active process that requires dynamic CDK9/pTEFb-dependent phosphorylation of amino acids in the C-terminal domain of the large subunit of RNA polymerase II

(Buratowski, 2009). For at least a subset of genes, regulation of RNA polymerase

II phosphorylation causes the polymerase complex to undergo promoter proximal stalling following initiation until signal-dependent elongation is cued

(Nechaev et al., 2010). Consistent with the possibility that Fos transcription may be subject to regulation of elongation, nuclear run-on assays of Fos transcription in quiescent fibroblasts show that these cells have constitutive transcription of short 5’ transcripts that fail to extend past a Fos intragenic regulatory element

(FIRE) near the end of exon I prior to serum stimulation (Lamb et al., 1990).

Genome-level chromatin immunoprecipitation (ChIP) studies have begun to address the localization and phosphorylation state of the polymerase subunits at large sets of activity-regulated genes (Kim et al., 2010), and further studies of this kind are likely to enhance understanding of the relative importance of the regulation of transcriptional elongation for neuronal activity-dependent changes in mRNA expression.

1.4 Transcription factors regulated by neuronal activity

There are two primary locations in a neuron at which mechanisms of signaling specificity typically act: 1) at the synapse – in the form of calcium

channel number, localization, and subunit composition – and 2) in the nucleus – in the form of transcription factor expression, localization, and post-translational modification. In the next two sections, I will discuss these in turn, starting first with mechanisms of specificity that function in the nucleus, and then in Section

1.5 discussing mechanisms of specificity that occur at the point of calcium entry in the neuron. In particular, I will focus on transcription factors that have been shown to regulate the activity-dependent transcription of the Bdnf gene (see

Section 1.2).

Stimulus-regulated transcription factors play an essential role in cell biology by coupling extracellular stimuli to coordinated intracellular responses.

Activity-regulated signaling pathways modulate gene transcription by altering the function, localization, or expression of transcriptional factors in the nucleus

(West et al., 2002). A growing number of transcriptional regulators have been shown to be targets of activity-dependent signaling cascades in neurons (Figure

3). Here I will discuss some of the most well-studied activity-regulated transcription factors in neurons, and review the mechanisms of their regulation.

1.4.1 Activation of prebound transcription factors

One of the most striking features of neuronal activity-regulated transcription is its very rapid initiation. Newly synthesized nuclear RNA transcripts can be detected within one minute of stimuli that induce calcium influx suggesting that some gene promoters are primed for rapid response

(Greenberg et al., 1986). At these promoters, such as Fos, transcriptional activators are prebound before stimulation arrives (Kim et al., 2010). Activity-

A) Cofactor recruitment! B) Nucleocytoplasmic shuttling!

NFAT! P! MAL! NF-κB! HDAC! CCAT!

P! Crtc1! CBP! P! P! P! P! P! P! P! P! P! FOXO3! MEF2! CREB! Elk-1! SRF!

C) Binding! D) Expression!

CREB! DREAM!

Fos, Crem, Npas4! ?!

Figure 3: Mechanisms of transcription factor regulation by neuronal activity. Transcription factor function can be regulated by neuronal activity through at least four different mechanisms. Green arrows represent genes that show activity-induced transcriptional activation, red bars represent genes that undergo activity-induced transcriptional repression. (A) Recruitment of transcriptional coactivators and corepressors is an important mechanism to regulate the function of pre-bound transcription factors such as CREB, MEF2, and SRF. (B) Nuclear translocation of the transcription factors NFAT and NF-kB is induced by a wide variety of stimuli including neuronal activity, allowing these factors to bind to their target gene promoters. By contrast, neuronal activity drives the nuclear export of the forkhead box transcription factor FOXO3 and prevents nuclear translocation of CCAT. (C) Regulated binding of transcription factors is controlled through different mechanisms. In the case of CREB, signal-dependent regulation of histone modifying enzymes may lead to a change chromatin structure that alters the accessibility of CREB binding sites. For DREAM, direct binding of calcium to the EF-hands in this repressor protein changes its affinity for DNA, releasing it from its binding site. (D) In addition to the classic IEGs transcription factors, such as Fos, Jun, and Egr family members, additional transcription factors are subject to activity-dependent regulation of expression. These transcription factors include ICER, a repressor form of the CREB family member CREM, and the bHLH-PAS domain transcription factor NPAS4. Expression of other transcription factors is likely to be repressed by neuronal activity, however these remain to be identified.

dependent signaling pathways are required to post-translationally modify these factors and/or their associated proteins to change their activity state.

1.4.1.1 Calcium/cAMP-Response Element binding protein (CREB)

The CREB family of transcription factors is comprised of Creb, cAMP

Response Element Modulatory Protein (Crem), and activating transcription factor

1 (Atf1). In the CNS, CREB family members have been shown to be essential for neuronal survival and are thought to modulate both synaptic and intrinsic plasticity in response to neuronal activity (Benito and Barco, 2010; Lonze and

Ginty, 2002). Loss-of-function genetic studies show that CREB and CREM have overlapping functions in the developing and mature CNS, whereas ATF1 plays particularly important roles early in development (Bleckmann et al., 2002;

Mantamadiotis et al., 2002). All stimuli that activate neuronal CREB-dependent transcription (e.g., receptor tyrosine kinases, calcium signaling pathways, cAMP) do so by inducing phosphorylation of CREB at serine 133 (Ser133) (Shaywitz and

Greenberg, 1999). Distinct Ser133 kinases including protein kinase A (PKA),

Ca2+/calmodulin (CaM)-dependent protein kinases (CaMKs), mitogen-activated protein kinase (MAPK), and Akt (also known as protein kinase B, PKB) mediate phosphorylation of CREB in response to different stimuli in different cell types

(Gonzalez and Montminy, 1989; Lonze and Ginty, 2002; Mayr and Montminy,

2001; Sheng et al., 1991). In neurons, CaMKs mediate rapid but transient phosphorylation of CREB following membrane depolarization, whereas MAPKs make a major contribution to later, sustained CREB phosphorylation (Dolmetsch et al., 2001; Wu et al., 2001a). Phosphorylation of CREB at Ser133 activates transcription by inducing the association of CREB with the transcriptional coactivators CBP and p300, which promote transcription by acetylating promoter

histones (Chrivia et al., 1993; Goodman and Smolik, 2000). Alternate CREB coactivators include the CREB-regulated transcription coactivators (Crtc1-3, previously known as TORCs) (Conkright et al., 2003; Kovács et al., 2007; Sasaki et al., 2011; Screaton et al., 2004).

In addition to phosphorylation of Ser133, activation of neuronal calcium signaling pathways induces phosphorylation of CREB at Ser142 and Ser143

(Kornhauser et al., 2002). These phosphorylation events occur concurrently with activation of CREB-dependent transcription, and mutation of these serines to non-phosphorylatable alanine residues selectively inhibits calcium-regulated

CREB activity in a reporter gene assay, while leaving cAMP-dependent transcription unaffected (Kornhauser et al., 2002). Consistent with a role for these phosphorylation sites in regulation of CREB-dependent transcription in vivo, phosphorylation of CREB Ser142 is induced in neurons of the suprachiasmatic nucleus by light exposure, and mice bearing a mutation that changes Ser142 to alanine knocked into the Creb1 gene show altered circadian rhythms (Gau et al.,

2002).

1.4.1.2 Serum-Response Factor (SRF)

SRF is a versatile transcription factor expressed in many cell types that plays an important role in coupling actin signaling to changes in gene expression that control cell motility (Arsenian et al., 1998; Knöll et al., 2006; Olson and

Nordheim, 2010). In the CNS, disruption of SRF function is associated with impaired axon pathfinding during development and impaired synaptic plasticity in the adult hippocampus (Etkin et al., 2006; Knöll et al., 2006; Ramanan et al.,

2005). Furthermore the inducibility of many of the IEG transcription factors is abolished in the absence of SRF expression, implying an essential role for this

factor in activating the general cellular response to changes in extracellular stimuli (Parkitna et al., 2010; Ramanan et al., 2005). Unlike the CREB family of transcription factors, SRF acts as a homodimer and is encoded by a single gene

(Norman et al., 1988). SRF interacts with a diverse set of transcriptional co- regulators, many of which are highly modulated by activity-regulated signaling cascades (Knöll and Nordheim, 2009). Evidence suggests that it is the differential regulation and use of these cofactors that confers functional versatility upon SRF- dependent programs of gene transcription.

SRF-dependent transcription is activated by two sets of cofactors: 1) the

TCFs (Buchwalter et al., 2004), and 2) the myocardin family of transcriptional cofactors, which includes myocardin, myocardin-related transcription factor A

(MKL1, also known as MAL or MRTF-A) and MKL2 (also known as MRTF-B)

(Pipes et al., 2006). The TCFs Elk-1, Net, and SRF accessory protein 1 (Sap-1) comprise a subfamily of the Ets domain transcription factors, and were first shown to complex with SRF on the SRE of the Fos gene (Shaw et al., 1989). The

N-terminal domain of the TCF factors recruits co-repressors to keep target genes off in the absence of stimuli (Yang et al., 2001). Following neuronal activity- and calcium-dependent activation of MAPK signaling pathways, the TCFs are extensively phosphorylated (Marais et al., 1993; Miranti et al., 1995).

Phosphorylation of TCFs regulates their activity by inducing a conformational change that both enhances DNA binding and also activates the TCF-bound HAT

CBP (Gille et al., 1992).

In contrast to the dominant role of the MAPKs in regulation of the TCFs, the myocardin family of SRF coactivators is regulated by actin signaling (Miralles et al., 2003; Sotiropoulos et al., 1999). In resting cells, myocardin family members

such as MKL1 are bound to monomeric G-actin, which keeps them sequestered in the cytoplasm. Extracellular signals that activate intracellular Rho-GTPases stimulate the assembly of filamentous F-actin, freeing MKL1 to translocate into the nucleus where it can bind to SRF and activate SRF-dependent transcription

(Vartiainen et al., 2007). Although the relative importance of these two sets of cofactors in neurons for SRF-dependent transcription is not fully known, evidence suggests that the myocardins may be particularly important during neuronal development. For example, whereas Elk1 knockout mice show grossly normal brain development (Cesari et al., 2004), mice lacking both Mkl1 and Mkl2 in the brain have abnormal neuronal migration, neurite outgrowth, and SRF- dependent gene expression (Mokalled et al., 2010), phenocopying many of the early neurodevelopmental defects observed in Srf knockout mice (Knöll et al.,

2006).

1.4.1.3 Myocyte Enhancer Factor 2 (MEF2)

The MEF2 family was first identified for its role in muscle differentiation

(Molkentin et al., 1995), however the four members of the MEF2 family (MEF2A-

D) are also found in distinct but overlapping patterns in neurons throughout the developing and adult CNS (Leifer et al., 1993; Lyons et al., 1995). Various members of the MEF2 family have been implicated in the regulation of neuronal survival during development (Mao et al., 1999), in the activity-dependent elimination of excitatory synapses (Flavell et al., 2006), and in behavioral adaptations to drugs of abuse (Pulipparacharuvil et al., 2008).

The transcriptional activity of MEF2 is highly sensitive to regulation by a complex array of stimulus-dependent post-translational modifications that modulate MEF2’s interactions with multiple transcriptional cofactors (McKinsey

et al., 2002; Shalizi et al., 2006). The intricate details of these regulatory mechanisms suggest that post-translational modification of MEF2 by various signaling enzymes may provide a way for distinct stimuli to differentially regulate MEF2-dependent transcriptional programs. MEF2 can be either an activator or a repressor of transcription, and stimulus-induced signaling pathways switch it between these states. In its repressor state, class IIa HDACs

(HDAC 4,5, 7 and 9) bind to the N-terminal domain of the MEF2s (Lemercier et al., 2000). This interaction contributes to repression of MEF2-dependent transcription both by reducing the acetylation of histones at MEF2 target gene promoters and by deacetylating a key residue on MEF2, Lys403 (note: all amino acid numbers presented in this section refer to sequence positions in human

MEF2A) (Shalizi et al., 2006). Deacetylation of Lys403 is correlated with modification of this residue by the small ubiquitin-like modifier (SUMO) moiety, which appears to stabilize MEF2 in the repressor state (Shalizi et al., 2006; Zhao et al., 2005).

Neuronal activity-induced calcium signaling pathways activate MEF2- dependent transcription by at least three mechanisms. First, CaMK-dependent phosphorylation of the HDACs leads to their release from MEF2 and their export from the nucleus (Chawla et al., 2003; Lu et al., 2000). Since the HDACs compete for binding to the same region on MEF2 as the HATs p300 and CBP, HDAC unbinding promotes the ability of MEF2 to recruit co-activators (McKinsey et al.,

2001). Second, calcium-dependent activation of the p38-MAPK leads to phosphorylation of MEF2s at multiple sites (Han et al., 1997; Yang et al., 1999;

Zhao et al., 1999). At least three sites of p38-induced phosphorylation contribute to the transcriptional activity of the MEF2s (Thr312, Thr319, and Ser453). These

sites are conserved in MEF2A, C, and D, and these isoforms of MEF2 are targets of p38-MAPK regulation (Yang et al., 1999). In addition, the extracellular signal- regulated kinase 5 (Erk5) MAPK is capable of phosphorylating MEF2A, C, and D and has been implicated in neuronal MEF2 regulation downstream of BDNF signaling (Kato et al., 1997; Shalizi et al., 2003). Third, calcium-dependent activation of the phosphatase calcineurin leads to dephosphorylation of Ser and

Thr residues on MEF2 (Mao and Wiedmann, 1999; Wu et al., 2001b).

Dephosphorylation at Ser408 is particularly important for the ability to switch

MEF2 from repressor to activator and is required for activity to induce the switch at Lys403 from SUMOylation to acetylation (Grégoire et al., 2006; Shalizi et al.,

2006). Interestingly, these sites of regulation are conserved in MEF2A and D, however they are contained within an alternatively spliced region of MEF2C (the

γ domain; Figure 4) that is only present in a fraction of the MEF2C protein expressed in brain (Zhu et al., 2005). Finally, whereas calcium and cAMP cooperate to activate the transcription factor CREB, cAMP can either prevent or inhibit MEF2 activation by blocking HDAC export from the nucleus and by inhibiting import of the MEF2 co-activator NFATc3/c4 (Belfield et al., 2006).

Taken together, these data raise the possibility that differential activation of signaling cascades, combined with differential expression of MEF2 isoforms, is a mechanism of transcriptional specificity for MEF2-dependent gene expression.

Whether the different splice variants of a particular MEF2 isoform might differentially contribute to activity-regulated MEF2-dependent gene expression remains unknown.

!,-."%

!"#$% !,-.% / / % 2% 3"#% 4% &'()*+% &'()*+% 0%'1 .

!,-.5%

!"#$% !,-.% / / % 2% 3"#% 4% &'()*+% &'()*+% 0%'1 .

!,-.#%

!"#$% !,-.% / / % 2% 3"#% 4% &'()*+% &'()*+% 0%'1 .

6%)7891+):;97<%=>7*?9&%9@'+=!

Figure 4: Schematic depicting splice variants of MEF2A, MEF2C, and MEF2D. MEF2A, C, and D all have a great degree of structural homology. The MADS and MEF2 domains of each protein constitute the DNA binding domain (Molkentin et al., 1996). MEF2A and D each contain 2 alternatively spliced domains. Each has either an α1 or an α2 domain, as well as an optional β domain. These alternative splice sites yield a total number of four distinct splice variants. MEF2C contains an additional alternatively spliced region, the γ domain, which allows for up to eight distinct MEF2C splice variants. By contrast, all MEF2A and MEF2D variants contain the γ domain. TAD; transcriptional activation domain. Red arrows indicate alternatively spliced regions.

1.4.2 Transcription factors that undergo regulated nucleocytoplasmic shuttling

An alternative mechanism by which activity can induce transcription factor activity is via the regulation of nuclear import. Cytoplasmic sequestration of transcription factors provides a robust means to keep transcription off in the absence of stimuli, and local tethering of transcription factors near channels may also allow them to be directly regulated by signaling events that occur near the cell membrane. In the nervous system it has been suggested that transcription factors may be capable of being locally activated at dendritic synapses or in the distal growing axon and then translocating to the nucleus (Cox et al., 2008;

Meffert et al., 2003). Even for transcription factors that are retained in the nucleus, key transcriptional coactivator and corepressor proteins may be shuttled in and out of the nucleus to regulate transcriptional activity (Parkitna et al., 2010;

Soriano et al., 2011). Compared with transcription induced by prebound transcription factors, the transcriptional response to shuttling factors is slower and constitutes a late wave of activity-regulated transcription. Termination of transcription through these pathways is primarily mediated by signaling pathways that induce nuclear export.

1.4.2.1 Activity-dependent nuclear translocation

The two most widely studied transcription factors that translocate into the nucleus following stimulation are NF-κB and NFAT. The calcium-dependent regulation of these factors was first studied in immune cells, where these pathways play crucial roles is gene expression activated by T and B cell receptors. Although the sources of calcium and the biological context of the signaling pathways are different in neurons, these factors appear to still play an important role in regulating intracellular neuronal responses to extracellular signaling most likely including synaptic activity.

NF-κB refers to the activity of a set of five mammalian Rel-domain DNA binding subunits: NF-κB1 (p50/p105), NF-κB2 (p52/p100), RelA (p65), RelB, and c-Rel (Liou and Baltimore, 1993). In some cell types, most notably activated immune cells, NF-κB activity is constitutive. However, in many cells, NF-κB is held in the cytosol in an inactive form through its association with one of the

Inhibitor of NF-κB (IκB) proteins (Meffert and Baltimore, 2005). The ankyrin repeat domains of IκB mask the nuclear localization signal (NLS) of NF-κB, and

thus keep this transcription factor in an inactive form in the cytoplasm. Nuclear translocation of NF-κB is induced by stimuli that lead to phosphorylation and subsequent degradation of IκB (Mercurio et al., 1997). Phosphorylation of IκB is mediated primarily by the IκB kinase (IKK), which is composed of the IKKα and

IKKβ subunits along with the regulatory protein NF-κB essential modulator

(NEMO).

Some of the same stimuli that activate NF-κB in the immune system also regulate this transcription factor in the CNS. These stimuli include cytokines such as TNFα, viral infections, and oxidative stress. However, in the CNS NF-κB activity can also be induced by glutamate activation of synaptic NMDARs or the opening of L-VGCCs (Guerrini et al., 1995; Meffert et al., 2003). Both Ca2+/CaM- dependent protein kinase II (CaMKII) and MAPKs have been implicated in CNS regulation of NF-κB activity (Lilienbaum and Israël, 2003; Meffert et al., 2003;

Takeuchi and Fukunaga, 2004). However, some controversy exists over whether glutamate induces NF-κB activity in neurons as opposed to other CNS cell types such as glia or microglia (Massa et al., 2006). The need to identify the cell types in which transcription is activated is not unique to NF-κB, but rather is a concern for any of the transcription factors that are expressed in both neurons and glia

(this conundrum applies to CREB, for example). Future development of cell type-specific genetic tools for manipulating NF-κB activity in the CNS will be important for addressing the different biological functions of this transcription factor in neurons, glia, and microglia.

Although evolutionarily related to the Rel/NF-κB family, the NFAT transcription factors (NFAT1-4) are distinguished by their sensitivity to

intracellular Ca2+ and their regulation by the Ca2+-dependent serine/threonine phosphatase calcineurin (Hogan et al., 2003). A fifth NFAT family member

(NFAT5/TonEBP) shares homology to the NFAT DNA binding domain but lacks calcium sensitivity and instead plays important roles in cellular responses to changes in extracellular tonicity (Miyakawa et al., 1999). NFAT family members have been most highly studied for their role in regulation of cytokine gene expression in T cells, however these proteins are widely expressed in numerous tissues including the nervous system (Vihma et al., 2008). Genetic studies have revealed that NFAT is required for neurotrophin- and netrin-dependent axon outgrowth during embryonic development (Graef et al., 2003) and for serum- and activity-dependent survival of cerebellar granule neurons (Benedito et al., 2005).

However, the substantial redundancy in function among the four calcium- regulated members of this family and the requirement for these factors in development of other organ systems have limited genetic analysis of adult brain functions in constitutive knockout mice.

In response to stimuli that elevate intracellular calcium and/or induce the release of calcium from intracellular stores, the phosphatase calcineurin dephosphorylates multiple Ser and Thr residues on NFAT, which facilitates nuclear translocation (Okamura et al., 2000). Although NFAT can bind DNA as a dimer at regulatory elements that resemble NF-kB binding sites, NFAT also binds and cooperates with a number of other nuclear transcription factors including Fos/Jun family members and MEF2 (collectively known as “NFATn” for the NFAT “nuclear” component) to synergistically promote gene transcription (Hogan et al., 2003). NFAT-dependent transcription is terminated by nuclear export following rephosphorylation of the protein by a number of

constitutively active kinases including dual specificity tyrosine phosphorylation- regulated kinase 1A (DYRK1A) and glycogen synthase kinase 3 (GSK3) (Graef et al., 1999; Gwack et al., 2006).

1.4.2.2 Synaptic activity-dependent nuclear export

In addition to driving transcription factors into the nucleus, increased activity can also lead to nuclear export. The transcription factor forkhead box O3

(FOXO3) is best known for its regulation of cell death and stress responses

(Brunet et al., 1999; Brunet et al., 2004; Tran et al., 2002). FOXO3 is phosphorylated at three sites by the growth factor-regulated Akt signaling pathway, promoting 14-3-3 association and nuclear export (Brunet et al., 1999).

By contrast, growth factor withdrawal and oxidative stress are associated with

FOXO3A dephosphorylation and nuclear entry, and the activation of FOXO3A target genes that promote cell death. In neurons the NMDAR-dependent activation of calcium signaling pathways can also lead to regulated shuttling of

FOXO1 and FOXO3A (Al-Mubarak et al., 2009; Dick and Bading, 2010; Papadia et al., 2008; Soriano et al., 2006). For example, stimulation of extrasynaptic

NMDARs, which can induce cell death, drives nuclear translocation of FOXO3A

(Dick and Bading, 2010). By contrast, prolonged synaptic activation prior to growth factor withdrawal reduces nuclear translocation of FOXO3A and protects against cell death through a signaling pathway that requires the activation of synaptic NMDARs, the elevation of nuclear calcium, and Ca2+/CaM-dependent protein kinase IV (CaMKIV). This bidirectional regulation of the FOXO1 and

FOXO3A pathways demonstrates one of the many downstream pathways through which synaptic and extrasynaptic NMDARs can have opposing effects on neuronal biology. Importantly, this example highlights the fact that calcium

signaling pathways can drive the nuclear export as well as the nuclear import of transcription factors.

A relative newcomer to the field of stimulus-regulated neuronal transcription factors is the calcium channel associated transcription regulator

(CCAT). Experiments in both neurons and cardiac myocytes had suggested that the C-terminal domain of the L-VGCC α subunit Cav1.2 could be cleaved from the membrane-associated channel (De Jongh et al., 1994; Gerhardstein et al., 2000).

When Gomez-Ospina and colleagues raised an antibody against this C-terminal domain of the protein, they were surprised to find that it strongly localized to the nucleus, especially in glutamic acid decarboxylase 65 (GAD65)-expressing γ- aminobutyric acid (GABA)-ergic interneurons (Gomez-Ospina et al., 2006). In the nucleus, CCAT binds to the transcriptional regulator p54(nrb)/NonO, and acts as a transcriptional activator of a number of genes including that encoding the connexin Cx31.1 (Gjb5). Most interestingly, CCAT localization is regulated by intracellular calcium, and it accumulates in the nucleus under conditions of low intracellular calcium. These data raise the intriguing possibility that CCAT could contribute to transcriptional regulation induced under periods of low rather than high synaptic activity, providing an important counterbalance to the programs of transcription driven by activity-induced factors such as CREB, SRF, and MEF2.

1.4.3 Transcription factors that show regulated binding

The specificity of transcription factor function is determined in large part by the factor’s sites of DNA binding, which in turn determine which genes that transcription factor can regulate. For this reason, inducible binding of a transcription factor to different sites in the genome would have an obvious

impact on its function. Perhaps the most clear example of calcium-dependent regulation of transcription factor binding has been that described for the

Downstream Repressor Element Antagonist Modulator (DREAM) (Carrión et al.,

1999). DREAM (also known as KChIP3 and calsenillin (An et al., 2000; Buxbaum et al., 1998)) belongs to the Neuronal Calcium Sensor (NCS) family of EF-hand proteins (Burgoyne, 2007). This protein family is related to the ubiquitous calcium effector protein CaM, but NCS family members also have domains distinct from those found in CaM. The 14 members of the NCS family have functions ranging from vesicle trafficking to ion channel regulation to transcriptional control (Burgoyne, 2007). DREAM was first characterized as a transcription factor when it was shown to bind to a repressor element in the first intron of the gene encoding prodynorphin (Pdyn) (Carrión et al., 1999). In the absence of calcium signaling, DREAM acts as a repressor of Pdyn by sterically hindering progression of the polymerase. Upon a rise in nuclear calcium,

DREAM binds calcium through its EF-hands and its affinity for DNA is subsequently reduced (Lusin et al., 2008; Osawa et al., 2005; Osawa et al., 2001).

Mice lacking DREAM (Kcnip3-/- mice) have elevated Pdyn mRNA in the spinal cord and reduced behavioral responses to painful stimuli, indicating a physiological requirement for DREAM in this pathway (Cheng et al., 2002).

Although a few other factors including some bHLH proteins

(Corneliussen et al., 1994) and members of the MEF2 family (Mao and

Wiedmann, 1999) have been shown to exhibit regulated DNA binding in vitro, direct regulation of DNA binding capacity has not emerged as a major mechanism of transcriptional regulation for most activity-regulated factors.

Instead, it seems likely that inducible binding may be more likely to occur as a

consequence of multiple coordinated cellular signaling events that either shift the subcellular localization of transcription factors and cofactors or that change the structure of genomic DNA.

1.4.4 Neuronal activity-regulated transcription factor expression

As initially described for Fos and the other IEGs, an important class of transcription factors are regulated by neuronal activity at the level of their expression. The promoters of these genes are targets of the transcription factors in the categories above. Robust induction of the IEG transcription factors is a cardinal feature of the transcriptional response to a wide variety of stimuli in many cell types (Herdegen and Leah, 1998; Morgan and Curran, 1991). Notably these transcription factors are also subject to additional forms of activity- dependent regulation. For example, after synthesis, Fos and Jun family transcription factors are subject to phosphorylation, which can change their nuclear localization or protein-protein interactions (Chen et al., 1993).

A recent addition to the set of activity-induced transcription factors is the bHLH-PAS domain family member Npas4 (Lin et al., 2008). Like other IEGs,

Npas4 is very rapidly and robustly induced by membrane depolarization of cultured neurons (Lin et al., 2008). However, unlike the Fos and Jun families of transcription factors, expression of Npas4 is largely restricted to neurons and its transcription is selectively induced by stimuli that activate intracellular calcium signaling pathways (Coba et al., 2008; Lin et al., 2008; Ooe et al., 2004; Zhang et al.,

2009). Interestingly, acute RNAi-mediated knockdown of Npas4 during synaptogenesis in cultured hippocampal neurons reduces GABAergic synapse numbers while overexpression of Npas4 selectively increases GABAergic

synapses (Lin et al., 2008). By contrast these manipulations have no effect on the number of glutamatergic synapses, indicating a selective role for Npas4 in regulating GABAergic synapse development. Npas4 forms functional heterodimers with other members of the bHLH-PAS domain protein family including Arnt1 and Arnt 2 (Ooe et al., 2009). Genome-wide ChIP-sequencing

(ChIP-Seq) for Npas4 shows that this protein is widely found not only at promoters but also at activity-regulated distant enhancers (Kim et al., 2010). The function of Npas4 recruitment to enhancers remains to be determined, however one speculative idea is that late recruitment of Npas4 may be required to prolong the transcription of activity-regulated genes such that they reach critical expression levels for regulation of downstream processes (Greer and Greenberg,

2008). RNA interference (RNAi)-mediated knockdown of Npas4 affects the expression of a large number of gene products, many of which are activity- regulated, consistent with the possibility that this transcription factor contributes to stimulus-dependent regulation of gene expression (Lin et al., 2008).

1.5 Calcium channel-dependent regulation of transcription

Transcription occurs in the cell nucleus, and up to this point, I have focused on cellular mechanisms of specificity that act on the nuclear proteins that regulate transcription in response to neuronal activity. However, the signals that set these nuclear events in motion begin at the synaptic plasma membrane, where neurotransmission occurs. In this section, I will describe the synaptic and cytoplasmic mechanisms by which calcium signaling pathways encode specificity toward the transcriptional pathways they activate.

Presynaptic action potentials release glutamate into the synaptic cleft, activating glutamate receptors of NMDA-, α-amino-3-hydroxyl-5-methyl-4- isoxazole-proprionate (AMPA)-, and kainate-types. This postsynaptic glutamate receptor activation then sets into motion a series of intracellular signaling events that culminate in the regulation of the transcription factors and stimulus- regulated genes described above. One of the most salient second messengers in cell biology is the calcium ion (Clapham, 2007). The importance of calcium signaling pathways for activity-regulated gene transcription was first demonstrated by experiments that showed removing calcium from the extracellular solution ablates neurotransmitter-induced gene induction in cultured cells (Greenberg et al., 1986; Morgan and Curran, 1986). Over the course of the following decade, it became apparent that this single signal – the calcium ion – is capable of exerting diverse effects on neuronal physiology and metabolism depending upon the mode of calcium entry and the cellular context in which the calcium signal acts (Ghosh and Greenberg, 1995). The two most physiologically relevant modes of calcium entry into neurons in terms of regulating changes in gene transcription are entry through L-VGCCs and

NMDARs (Bading et al., 1993; Ghosh et al., 1994b; Ghosh and Greenberg, 1995;

Lerea et al., 1992). Additional sources of calcium include other voltage- and ligand-gated plasma membrane calcium channels as well as the release of calcium from intracellular stores.

Calcium can activate a number of different signaling cascades, and the differential activation of these pathways by distinct pools of intracellular calcium contributes to the specificity of transcriptional responses. Calcium acts on cell physiology by virtue of its ability to bind to proteins, which then changes their

conformations and functions. One of the most important calcium adaptors in the cell is the protein CaM, which can coordinate up to four calcium ions with its four EF hand domains (Clapham, 2007). The Ca2+/CaM complex is then capable of activating several different types of effector molecules, including the family of

CaMKs and the Ca2+/CaM-dependent protein phosphatase calcineurin (Wayman et al., 2008). Other Ca2+/CaM binding proteins including Ras-specific guanine nucleotide-releasing factor (Ras-GRF), along with CaMKIV, lead to activation of

MAPK signaling pathways. Additionally, Ca2+/CaM-dependent adenylate cyclases elevate cellular cAMP levels to activate PKA. Activation of these kinase cascades drives the changes in transcription factor activation discussed above that regulate gene transcription. Factors such as calcium channel location, channel subunit composition, calcium microdomain dynamics, and protein- protein interactions can all play a role in determining which signaling cascades – and therefore which genes – are differentially regulated following neuronal stimulation (Bading et al., 1993; Ginty, 1997). In this section, I will discuss the different sources of calcium that, upon activation, can lead to alterations in gene transcription in neurons, as well as the mechanisms by which these various routes of calcium influx convey specificity to the nucleus.

1.5.1 NMDA Receptors (NMDARs)

NMDARs are glutamate-gated non-selective cation channels that play a key role in the activation of intracellular calcium signaling cascades following synaptic activity (Dingledine et al., 1999; McBain and Mayer, 1994). Because

NMDARs require both presynaptic depolarization (for neurotransmitter release into the synaptic cleft) and postsynaptic depolarization (for the removal of the

Mg2+ ion that usually blocks the channel pore) for activation, they play an essential role as coincidence detectors in long-term potentiation (LTP), a Hebbian form of synaptic plasticity that is a cellular mechanism for learning and memory

(Collingridge and Singer, 1990; McBain and Mayer, 1994). The ability of

NMDARs to allow calcium to enter the cell has been shown to be important for many neurobiological processes including neuronal survival, migration, neurite outgrowth, synapse formation, and other forms of plasticity such as homeostatic plasticity and metaplasticity (Choi, 1988a, b). Importantly, it has been demonstrated by a myriad of studies that one critical way in which NMDARs are capable of exerting their effects on a neuron’s life and metabolism is via regulation of gene transcription (Hardingham and Bading, 2003; Wayman et al.,

2006; West et al., 2002).

1.5.1.1 NMDARs regulate transcription in vitro and in vivo

There is a substantial body of evidence in support of the idea that calcium influx through NMDARs contributes to induction of gene transcription. The first evidence for NMDARs being critical for the induction of IEGs following electrical stimulation came from a study published by Cole and colleagues (Cole et al.,

1989). Briefly, the authors showed that high frequency stimulation of the perforant path-granule cell synapse in vivo leads to robust induction of Egr1 mRNA in an NMDAR-dependent manner. A later study showed that in cultured hippocampal neurons, glutamate-induced increases in mRNA transcript levels of the IEGs Fos, FosB, Jun, JunB, Egr1 and Nr4a1 were almost entirely due to

NMDAR activation (Bading et al., 1995). Interestingly, while high frequency stimulation – which is known to induce LTP – is capable of triggering Egr1 mRNA induction, low frequency stimulation – which does not induce LTP – is

not sufficient to induce Egr1 transcription (Cole et al., 1989). These correlational findings were also among the first to suggest that IEG transcription might play a role in synaptic plasticity.

NMDAR-regulated gene transcription has been implicated in numerous cellular processes. NMDARs are the critical source of calcium influx for the initiation of LTP (Collingridge et al., 1983a, b; Kauer et al., 1988; Malenka et al.,

1988; Muller et al., 1988), and subsequent work has suggested that the late phase of LTP relies on NMDAR-induced, transcription-dependent cellular events (Frey and Morris, 1997; Nguyen et al., 1994). NMDARs also contribute to transcription that promotes neural development. For example, NMDAR activation regulates

Wnt-2 transcription in a manner dependent upon CaMK kinase (CaMKK), the

Ca2+/CaM-dependent protein kinase I (CaMKI) α and γ isoforms, MAPK, and

CREB activation (Wayman et al., 2006). This increase in Wnt2 transcription following synaptic NMDAR stimulation results in increased Wnt-2 protein secretion and a subsequent increase in dendrite outgrowth and branching in hippocampal neurons. Finally, NMDAR activation has been shown to be essential for the regulation of neuronal survival during development

(Hardingham and Bading, 2002, 2003; Hardingham et al., 2002; Sala et al., 2000).

Interestingly, cell survival can be bidirectionally regulated by NMDARs, and this process appears to rely largely on which specific NMDARs are activated on a given neuron. We will discuss this phenomenon in greater detail below.

1.5.1.2 Molecular biology and patterns of expression of the NMDARs

NMDAR channels are heterotetramers that can be made up of different subunit compositions. There are seven known NMDAR subunits: NR1, which

can be alternatively spliced to yield eight different variants; NR2A-D, which are encoded by four different genes; and NR3A-B, which are also encoded by distinct genes (Ciabarra et al., 1995; Dingledine et al., 1999; Matsuda et al., 2002;

McBain and Mayer, 1994; Nishi et al., 2001; Sucher et al., 1995). Each subunit has three transmembrane domains (TM1, TM3, and TM4) plus a cytoplasm-facing re- entrant membrane loop (TM2), meaning that the N terminus is located extracellularly and the C terminus intracellularly (Dingledine et al., 1999).

Functional glutamate-sensing NMDARs require at least one NR1 and one NR2 subunit (Cull-Candy et al., 2001; Köhr, 2006; Rosenmund et al., 1998), however the exact subunit composition of individual receptors varies. The NR1 and

NR3A/B subunits contain glycine-binding sites, while the four NR2 subunits all contain glutamate-binding sites. In order to achieve full opening of the ion channel pore, co-activation by both glutamate and glycine is required (Clements and Westbrook, 1991; McGurk et al., 1990). Most CNS NMDARs are thought to contain two NR1 subunits and two NR2 subunits (Dingledine et al., 1999).

NMDARs that contain NR3 subunits probably contain NR1, NR2, and NR3

(Sasaki et al., 2002).

NR1 is expressed throughout the nervous system and is an obligate

NMDAR subunit; without it, functional NMDARs cannot form (Ishii et al., 1993;

Kutsuwada et al., 1992; Meguro et al., 1992; Monyer et al., 1992). Several important, functional differences have been identified that distinguish the four

NR2 subunits (NR2A-D) from each other. NR2A and NR2B are most highly expressed in brain structures in the forebrain, while NR2C and NR2D are more highly expressed in the hindbrain and the cerebellum (Monyer et al., 1994;

Monyer et al., 1992). The subunits NR2B and NR2D are both expressed in

embryonic CNS structures, while there is no notable expression of either NR2A or NR2C until some time after birth (Monyer et al., 1994; Monyer et al., 1992).

After birth, expression of NR2A and NR2C slowly increases until their levels plateau shortly before adulthood, while NR2B and NR2D levels either remain unchanged or decrease. The developmental “switch” that occurs between NR2B and NR2A over the course of development is thought to be critical for a number of neurological developmental milestones (Shi et al., 1997). Furthermore, there is evidence that this switch is not only regulated by developmental progression, but also by neuronal activity, as visual deprivation retards this switch in the visual cortex (Nase et al., 1999; Quinlan et al., 1999; Roberts and Ramoa, 1999).

Functionally, this switch is important because NR2B-containing NMDARs exhibit longer-lasting currents and carry more calcium per unit of current

(Monyer et al., 1994; Sobczyk et al., 2005). This means that for each episode of presynaptic glutamate release, NR2B-containing NMDARs allow more calcium to enter the cell than do NR2A-containing NMDARs.

Finally, like NR2A and NR2B, NR3A is most highly expressed in regions of the forebrain, while NR3B is more highly expressing in the midbrain, hindbrain, and in peripheral motor neurons (Al-Hallaq et al., 2002; Matsuda et al.,

2002; Nishi et al., 2001; Sasaki et al., 2002; Wong et al., 2002). Both NR3 subunits are highly developmentally regulated, with expression increasing in the early postnatal period and peaking ~P8-10 in the rodent brain before decreasing down to low levels that persist through adulthood (Al-Hallaq et al., 2002; Sasaki et al.,

2002; Wong et al., 2002). Numerous studies agree that inclusion of NR3A into

NR1/NR2-containing receptors reduces single channel conductance, Ca2+

Figure 5: NR3A alters NMDAR channel properties. Incorporation of NR3A into a pool of NMDARs decreases single channel conductance, calcium (Ca2+) permeability, and sensitivity to magnesium (Mg2+) block. permeability, and sensitivity to Mg2+ block (Figure 5) (Das et al., 1998; Sasaki et al., 2002; Tong et al., 2008). These properties make NR3A extremely interesting, and it has been proposed that the lower Ca2+ permeability of NR3A-containing

NMDARs may offer some protection from excitotoxic injury during development, while the relative insensitivity to Mg2+ block might enhance the

NMDAR-mediated component of synaptic activity (Nakanishi et al., 2009; Sasaki et al., 2002).

Given that NR3A’s expression begins to decline at approximately the same developmental time period that activity-dependent synapse formation is known to occur, the hypothesis has been raised that NR3A might play an important role in brain development. Consistent with this idea, NR3A-/- mice have increased spine density in cortical layer IV/V neurons (Das et al., 1998).

Moreover, Roberts and colleagues (Roberts et al., 2009) recently showed that

removal of NR3A from the cell surface is required for development of strong

NMDAR currents, full LTP expression, and a mature synaptic organization characterized by more synapses and larger postsynaptic densities. Excitingly, transgenic mice with reversibly prolonged NR3A expression in the forebrain are impaired in their ability to form long-term memories (Roberts et al., 2009).

Deficits associated with prolonged NR3A expression are reversible, as late-onset suppression of NR3A transgene expression can rescue both synaptic and memory impairments (Roberts et al., 2009).

1.5.1.3 Different pools of NMDARs differentially regulate transcription

The subunit composition of NMDARs has a strong effect on their function

(Hardingham and Bading, 2010). While all NMDARs must contain an NR1 subunit, one key distinction between different receptors is which NR2 subunit they contain, as well as whether they contain an NR3 subunit. The combinations of NMDAR subunit assemblages allows for NMDARs with distinct pharmacological, physiological, and signaling properties (Monyer et al., 1994;

Monyer et al., 1992). Subunit composition can significantly affect subcellular localization as well as which signaling cascades are activated downstream of

NMDAR stimulation, and subsequently which transcriptional programs are induced in response to that stimulation (Cheng et al., 1999; Hardingham and

Bading, 2002, 2003; Hardingham et al., 2002; Martel et al., 2009; Yashiro and

Philpot, 2008).

One transcription factor that is particularly important for NMDAR- regulated transcription is CREB (Hardingham and Bading, 2002, 2003;

Hardingham et al., 2002; Sala et al., 2000). Interestingly, CREB is not only activated by NMDAR signaling, its transcriptional activity can also be turned off

by NMDARs (Hardingham et al., 2002). Specifically, synaptic NMDAR stimulation induces CREB Ser133 phosphorylation, which is required for transcriptional activation. By contrast, extrasynaptic NMDAR stimulation results in CREB Ser133 dephosphorylation, which leads to transcriptional deactivation

(Hardingham and Bading, 2002; Hardingham et al., 2002). One possible mechanism by which extrasynaptic NMDARs might induce CREB dephosphorylation is via the nuclear translocation of the recently-identified protein Jacob (Dieterich et al., 2008). Jacob has been shown to be alternately bound by either the NCS Caldendrin – during periods then dendritic calcium levels are very high, such as would occur during synaptic NMDAR stimulation – or by α-importin, which following extrasynaptic NMDAR stimulation localizes

Jacob to the nucleus (Dieterich et al., 2008; Thompson et al., 2004). Nuclear localization of Jacob has been shown to be both necessary and sufficient for extrasynaptic NMDAR-dependent CREB dephosphorylation and subsequent cell death pathway initiation (Dieterich et al., 2008).

Importantly, even though they inactivate CREB under some conditions, extrasynaptic NMDARs are capable of inducing other programs of gene transcription (Hardingham and Bading, 2002; Hardingham et al., 2002; Wahl et al., 2009). However, unlike synaptic NMDAR activity, which promotes cell survival, transcription regulated by extrasynaptic glutamate receptors is able to trigger activation of cell death pathways in neurons. For example, as described in section 3.2.2, stimulation of extrasynaptic NMDARs has been shown to drive nuclear translocation of the FOXO family of transcription factors, which functions as a trigger for apoptosis through upregulation of cell-death promoting genes (Brunet et al., 1999; Dick and Bading, 2010), whereas synaptic NMDAR

activation induces FOXO export (Papadia et al., 2008; Soriano et al., 2006).

Among the extrasynaptically-regulated genes that might damage neurons are

Clca1, which encodes a putative calcium-activated chloride channel that has been implicated in other forms of cellular injury (Wahl et al., 2009), and Txnip, a thioredoxin inhibitor that leaves cells more vulnerable to oxidative stress

(Papadia et al., 2008).

An important point of uncertainty lies in the identity of the subunits that comprise synaptic versus extrasynaptic NMDARs, and furthermore to what degree the identity of the subunits matters for downstream transcriptional regulation. In the studies done on synaptic versus extrasynaptic regulation of

CREB phosphorylation and CREB-dependent gene transcription, the authors demonstrated that blockade of NR2B-containing NMDARs by ifenprodil greatly impairs the ability of extrasynaptic NMDARs to effect CREB Ser133 dephosphorylation (Hardingham et al., 2002). This raises the intriguing possibility that NMDAR NR2 subunit composition might dictate the specificity of signaling cascades activated downstream of NMDAR stimulation (Cheng et al., 1999; Hardingham et al., 2002; Martel et al., 2009), and specifically suggests that NR2B is critical in mediating extrasynaptic NMDAR-dependent gene transcription programs. It has been suggested that synaptic NMDARs might be predominantly NR2A-containing, while extrasynaptic NMDARs are predominantly NR2B-containing. This is interesting given that at birth,

NMDARs are almost exclusively NR1/NR2B heteromers, and NR2A subunit expression in the rodent CNS doesn’t begin until 6-10 days after birth, a particularly dynamic period in synapse development (Flint et al., 1997; Kew et al.,

1998; Kirson and Yaari, 1996; Li et al., 1998; Monyer et al., 1994; Sheng et al., 1994;

Tovar and Westbrook, 1999). However, more recent evidence suggests that this model may be overly simplistic. In dissociated hippocampal neuron cultures

NMDARs have been found to be mobile and to traffic in and out of synapses via lateral diffusion (Groc et al., 2006; Tovar and Westbrook, 2002), although a similar study in acutely dissected hippocampal slices reported contrary results (Harris and Pettit, 2007). One possible explanation for this apparent discrepancy could be that the extracellular matrix plays a role in NMDAR stabilization at the plasma membrane, which would only be left intact in whole tissue preps. In addition, a study done in 2006 suggested that there are roughly equal proportions of NR2A and NR2B localized both synaptically and extrasynaptically (Thomas et al., 2006). More work is required to determine where NR2A and NR2B are localized, how their localization is regulated developmentally, and to what degree subunit composition versus localization is the deciding factor in what kind of signal is transmitted from NMDARs to the nucleus.

There have never been any studies published examining the role of

NR3A- or NR3B-containing NMDARs in activity-regulated gene transcription.

Given NR3A’s unique spatial and developmental expression patterns, its physiological properties, and its effects on synapse development – a process known to be reliant upon activity-dependent changes in gene transcription – it stands to reason that NR3A might well have some modulatory role in activity- regulated gene transcription. In particular, NR3A is well positioned to regulate a shift in the activity-inducibility of some genes over developmental time.

Synaptic NMDARs! NR1!

EphB2! NR2A! Yotiao!

2+ ! Ca /CaM 2+! PP1! Ca2+! Ca Ca2+/CaM! 2+! CaMKII! Ca NR2B! CaMKK! SynGAP! Ras-GRF2! Ras-GDP! CaMKI!

Ras-GTP! Extrasynaptic!

Raf! NMDARs!

P! DAPK1! MEK! Ca2+! Ca2+! Ca2+! Ca2+! Erk1/2! FOXO3!

Rsk2!

CaMKIV! P! Pro-survival genes Cell death-promoting CREB! Akt! (e.g., Fos, Bdnf)! FOXO3! genes (e.g., Clca1)!

Figure 6: Different pools of NMDARs are capable of effecting distinct changes in gene transcription. Synaptic NMDARs are capable of signaling through the CaMKs and the Ras/Raf/MEK/Erk/Rsk2 pathway to phosphorylate CREB and initiate transcription of a variety of pro-survival genes. Additionally, synaptic NMDAR activation of CaMKK and CaMKIV leads to the activation of Akt and subsequently the phosphorylation and nuclear export of the transcription factor FOXO3, thereby inhibiting transcription of various cell death-inducing genes. In contrast, activation of extrasynaptic NMDARs opposes the effects of synaptic NMDAR activation. Activation of extrasynaptic NMDARs inhibits the activation of Erk1/2, thereby reducing CREB phosphorylation. Additionally, extrasynaptic NMDARs induce the nuclear import of FOXO3 and the subsequent transcription of pro-death genes; this is potentiated by DAPK1. Subunit composition can also lend specificity to synapse-to-nucleus signaling by NMDARs. NR2A-containing NMDARs are capable of interacting with and selectively activating Ras-GRF2; activation of NR2B-containing NMDARs leads to the activation of CaMKII and the subsequent phosphorylation of SynGAP. While NR2B-containing NMDARs have also been shown to interact with Ras-GRF1 (not shown), how that signal is integrated with SynGAP activation remains to be determined. The EphB2 receptor has been shown to interact with the NR1 subunit and potentiate NMDAR-mediated calcium influx and downstream signaling cascades by phosphorylating the NR2B subunit. Lastly, the scaffolding protein Yotiao can bind to NR1 splice variants containing the C1 cassette and tether PKA and PP1 to the channel complex. While it is not known if this tethering is important for PKA-mediated NMDAR signaling (not shown), this interaction could mediate PP1-dependent signaling to the nucleus and dephosphorylation of CREB.

1.5.1.4 Protein interactions that underlie NMDAR signaling specificity

The large intracellular C-termini of the NMDAR subunits are variable and have been shown to confer differential protein-protein interactions with

NMDARs of distinct subunit composition (Figure 6). These interactions have important functional implications for NMDAR localization as well as interaction with signaling molecules and may be responsible for the specificity upon receptor activation of downstream events including transcription. Given the differential effects of NR2A- and NR2B-containing receptors on many biological processes, including the regulation of CREB Ser133 phosphorylation, considerable effort has been devoted to determining whether these two NR2 subunits may differentially interact with signaling proteins.

Some signaling proteins bind to both NR2A and NR2B, however they may show differential regulation at these subunits. NR2A and NR2B both have

PDZ-binding domains at the C-terminal tails, allowing them to interact with the membrane-associated guanylate kinase (MAGUK) family of synaptic scaffoldingproteins (Kennedy, 2000). These scaffolds in turn associate with important synaptic signaling molecules and tether NMDARs to intracellular signaling pathways. The mammalian MAGUK family is comprised of four members: postsynaptic density-95 (PSD-95), synapse-associated protein-97 (SAP-

97), postsynaptic density-93 (PSD-93), and synapse-associated protein-102 (SAP-

102) (Sheng and Sala, 2001). Although some studies suggested that NR2A- containing NMDARs might be more likely to bind PSD-95, while NR2B- containing NMDARs could preferentially bind SAP102 (Sans et al., 2000;

Townsend et al., 2003), others found that PSD-95 and SAP-102 interact with diheteromeric NR1/NR2A and NR1/NR2B receptors in the adult brain in vivo at

roughly comparable levels (Al-Hallaq et al., 2007). However, NR2A-containing receptors co-immunoprecipitate with a greater fraction of the synaptic proteins neuronal nitric oxide synthase, Homer, and β-catenin (Al-Hallaq et al., 2007).

None of these proteins bind directly to NMDARs; instead they are thought to interact indirectly via their association with the MAGUKs or other scaffolding molecules such as the Shank family (Sheng, 2001). These data are consistent with the possibility that the MAGUKs may be key for differential formation of signaling complexes at distinct NMDARs, although the mechanism of specificity remains to be determined. Additionally, whether these differential interactions with scaffolding molecules influences specificity of signals transmitted to the nucleus remains another unanswered question.

Another signaling molecule that binds to both NR2A and NR2B but exhibits distinct properties at these subunits is CaMKII. NR2A and NR2B have both been shown to bind CaMKIIα and both subunits can be substrates for

CaMKII phosphorylation (Bayer et al., 2001; Gardoni et al., 1999; Strack and

Colbran, 1998; Strack et al., 2000). However, the affinity of CaMKIIα binding to

NR2B is greatly enhanced upon CaMKIIα autophosphorylation, suggesting a mechanism that may explain the stimulus-dependent trafficking of CaMKII to synapses (Bayer and Schulman, 2001; Shen and Meyer, 1999). Furthermore, the sites of CaMKIIα binding to the subunits differ – in NR2A the CaMKII binding site is near the C-terminus and competes with the PDZ domain interactions of the C-terminal tail (Gardoni et al., 2001), whereas in NR2B the binding site is farther away from the C-terminus (Bayer et al., 2001), potentially allowing NR2B to simultaneously interact with both CaMKII and PSD-95. Thus, while NR2A and NR2B can both bind to CaMKII, their specific modes of interaction with this

important signaling molecule are fundamentally different, and this may differentially affect CaMKII-dependent gene transcription.

The ability of NMDARs to regulate CREB is known to require activation of the MAPK signaling pathway; thus, several studies have examined the differential recruitment to NR2 subunits of the upstream regulators of MAPK activation. The classic calcium-regulated MAPK cascade in neurons begins with signaling events that change the ratio of GTP:GDP-bound Ras (Rosen et al., 1994).

Ras then activates the MAP kinase kinase Raf, which in turn activates the MAP kinase MEK, which then activates the MAP kinases Erk1 and Erk2. Erk1/2 activate various kinases including Rsk2, which then translocate to the nucleus to phosphorylate CREB at Ser133. The ratio of GTP:GDP-bound Ras is determined by the balance in the activation of the GTPase activating proteins (GAPs) that enhance the ability of Ras to hydrolyze bound GTP, and the GTP exchange factors (GEFs) that catalyze the release of GDP from Ras in exchange for binding

GTP.

Two of the most important calcium-regulated Ras modulators in neurons are the synaptic Ras GTPase activating protein (SynGAP) and the GEF Ras-

GRF1/2 (Cullen and Lockyer, 2002). SynGAP is highly concentrated in the postsynaptic density (PSD) of excitatory glutamatergic synapses in the CNS and the GAP activity of this protein is enhanced upon phosphorylation by CaMKII

(Chen et al., 1998; Oh et al., 2004). Ras-GRF1 contains a CaM-binding IQ domain that is required for the regulation of its ability to active MAPK signaling, suggesting that calcium-dependent regulation is conferred on Ras-GRF1 indirectly through calcium binding to CaM (Farnsworth et al., 1995). Ras-GRF2 also contains an IQ domain, but has a somewhat more complex mechanism of

activation by calcium that involves additional protein-protein and protein-lipid interactions (Cullen and Lockyer, 2002). SynGAP is selectively found in synaptic complexes with NR2B-containing NMDARs where it may contribute to the ability of these receptors to suppress activation of MAPK signaling (Kim et al.,

2005). Intriguingly, Ras-GRF1 is also enriched at NR2B-containing receptors

(Krapivinsky et al., 2003), whereas Ras-GRF2 has been shown to selectively mediate signaling to MAPKs downstream of NR2A-containing receptors (Li et al., 2006b). How the effects of Ras-GRF1 and SynGAP signaling toward MAPK pathways are integrated at NR2B-containing receptors is not entirely clear, but combinatorial signaling through these Ras regulators appears to largely have a net effect of inhibiting Erk1/2 activation (Kim et al., 2005). By contrast, the Ras-

GRF2 is required for NMDAR-dependent LTP (Li et al., 2006b), a cellular phenomenon largely ascribed as a downstream action of NR2A-containing

NMDARs (Liu et al., 2004).

Finally, there are a few classes of proteins that do appear to be specifically bound to one or the other of the two NR2 subunits NR2A and NR2B. One protein that may be involved in the pro-death-associated signaling capabilities of extrasynaptic NMDARs (as apposed to the pro-survival signaling of synaptic

NMDARs) is death-associated protein kinase 1 (DAPK1). DAPK1 has been shown to directly bind to the NMDAR subunit NR2B and to phosphorylate

NR2B at Ser1303, thereby enhancing NR2B-containing NMDAR channel conductance (Tu et al., 2010). Importantly, genetic deletion of DAPK1 appears to uncouple NR2B-containing, extrasynaptic NMDARs from cell death-associated signaling pathways, while leaving NMDAR-mediated synaptic transmission unaffected. In mice deficient for DAPK1, activation of extrasynaptic NMDARs

does not activate cell death, thus protecting them from ischemic insults (Tu et al.,

2010).

In addition to proteins that associate with the different NR2 subunits, it is also possible to generate diversity amongst NMDAR-associated signaling complexes via proteins that differentially associate with alternatively spliced regions of the C-terminus of the NR1 subunit. The Grin1 gene encoding NR1 contains three alternatively spliced exons: exon 5 in the N terminus (also called the N1 cassette) and exons 21 and 22 in the C terminus (also known as the C1 and

C2 cassettes) (Dingledine et al., 1999). There is evidence that the different C- terminal NR1 splice variants may couple differentially to downstream signaling cascades and subsequent changes in gene transcription. In conventional nomenclature, NR1-1 is the full-length NR1 variant containing both C-terminal exons, NR1-2 lacks exon 21 (the C1 cassette), NR1-3 lacks exon 22 (the C2 cassette), and NR1-4 lacks both (Dingledine et al., 1999; Hollmann et al., 1993).

Exclusion of exon 22 by splicing removes the stop codon present in exon 22 and introduces a new coding region that encodes an unrelated domain termed C2'

(Zukin and Bennett, 1995). Bradley and colleagues have found that NMDARs lacking the C1 cassette (aka exon 21; NR1-2 and NR1-4 splice variants) are much less efficacious in their ability to activate gene transcription than are NMDARs that contain the C1 cassette (NR1-1 and NR1-3) (Bradley et al., 2006).

Additionally, it has been shown that the splicing of the C2 cassette is activity- dependent, with increased activity leading to more C2-containing NR1 subunits and activity blockade yielding more C2'-containing NR1 subunits (Mu et al.,

2003). This activity-dependent splicing could provide a mechanism of

homeostatic control, as the C2' domain is much more efficiently trafficked out of the ER and to the cell surface than the C2 domain.

A yeast two-hybrid screen for proteins that bind to NR1 identified a protein called Yotiao that interacts with the alternatively spliced C-terminal C1 exon cassette of the ion channel (Lin et al., 1998). Yotiao binds to both the cAMP- dependent protein kinase PKA and the protein phosphatase 1 (PP1) and is thought to be important for anchoring these proteins to NR1-1 and 1-3 containing

NMDARs (Westphal et al., 1999). It has been suggested that activation of PP1, which can dephosphorylate CREB, is important for limiting the duration of

NMDAR-mediated transcription (Bito et al., 1996). However, what effect the interaction of Yotiao with alternatively spliced NR1 subunits might have on

NMDAR dependent transcription remains to be determined. Finally, two other

NR1-interacting proteins that may contribute to the regulation of transcriptional pathways are the EF-hand-containing transcriptional repressor DREAM and the

Eph family receptor tyrosine kinase EphB2. DREAM has been shown to bind to the membrane proximal region of the NR1 C-terminal domain (the “C0” domain)

(Zhang et al., 2010). The interaction of DREAM with NR1 significantly impairs

NMDAR surface expression in neurons and is neuroprotective against NMDA- induced excitotoxic neuronal injury, however the functional consequence of this interaction for NMDAR-mediated transcription, and the regulation of DREAM- mediated transcription, is not known. Unlike the other interactions discussed so far, EphB2 binds to the extracellular domain of NR1 (Dalva et al., 2000).

EphrinB2-mediated activation of EphB2 receptors in primary cortical neurons potentiates NMDAR-dependent influx of calcium and subsequent CREB- dependent gene transcription (Takasu et al., 2002). The effects of EphB2 on

NMDAR function are mediated by phosphorylation of the NR2B subunit at Tyr

1252, 1336, and 1472 through the activity Src tyrosine kinase family members.

The cooperative regulation of transcription by Eph receptors and NMDARs may be a mechanism to couple activity-independent and activity-dependent signaling pathways in early neuronal development (Takasu et al., 2002).

Finally, NR3A has been shown to engage in numerous protein-protein interactions that could have important implications for the function of NMDARs that contain this subunit. The C-terminus of NR3A has been shown to interact with several intracellular proteins, including PACSIN1/syndapin-1 (Pérez-Otaño et al., 2006), protein phosphatase 2A (PP2A) (Chan and Sucher, 2001), and the small GTPase Ras homologue enriched in brain (Rheb) (Sucher et al., 2010). The interaction with PACSIN1/syndapin-1 has been the most extensively studied, and has been shown to mediate activity-dependent endocytosis of NR3A- containing NMDARs, which may be important for the downregulation of NR3A surface expression during development (Pérez-Otaño et al., 2006). Association of

PP2A with the C-terminal tail of NR3A increases the phosphatase activity of

PP2A and leads to dephosphorylation of the NR1 subunit at the PKA-regulated site at Ser897 (Chan and Sucher, 2001). The association of NR3A and PP2A is inhibited by NMDAR stimulation, suggesting a mechanism by which control of this signaling event could be regulated by synaptic activity. The C-terminal tail of NR3B differs substantially from that of NR3A, suggesting that the protein- protein interactions of these two related subunits may be distinct. The role of either of the NR3 subunits in influencing NMDAR-dependent gene transcription remains unknown. Furthermore, it is unknown whether any of the protein- protein interactions described in this paragraph are capable of modulating any

signal transduction cascades that function downstream of NR3A-containing

NMDAR activation.

1.5.2 L-type Voltage-Gated Calcium Channels (L-VGCCs)

AMPA-type glutamate receptors (AMPARs) comprise the other major class of glutamate receptors at synapses, and activation of these receptors by glutamate results in a large current influx that drives postsynaptic membrane depolarization. This depolarization then induces the opening of voltage-gated ion channels, including voltage-gated calcium channels (VGCCs). The VGCCs are commonly referred to by names that arose from aspects of the physiological properties of their currents – for example there are L-type (long-lasting activation), N-type (neurotransmitter release), T-type (transient activation), P/Q- type (found in Purkinje cells), and R-type (drug-resistant) channels. Molecular cloning of VGCC subunits has shown that a set of distinct α1 subunits confers the specific physiological properties upon each of these calcium channel types.

Among the classes of VGCCs expressed in neurons, L-VGCCs have been shown to be a particularly salient mode of calcium entry in terms of their ability to bring about alterations in gene transcription (Bading et al., 1993).

1.5.2.1 Molecular biology of the L-VGCCs

All VGCCs are made up of a single, central α1 subunit, which both forms the ion-conducting pore and defines the channel type, along with a variable

number of auxiliary α2-δ, β, and γ subunits (Dai et al., 2009). L-VGCCs are categorized as being high voltage-activated channels (calcium channels that require strong membrane depolarization for activation) and are pharmacologically defined by their sensitivity to dihydropyridine agonists or

antagonists (Dai et al., 2009; Dolphin, 2009; Lipscombe et al., 2004). The best- characterized L-VGCC α1 subunit in terms of ability to regulate gene transcription in neurons is CaV1.2 (Dolmetsch et al., 2001; Weick et al., 2003).

Additionally, several biochemical and functional studies indicate that CaV1.2- containing channels account for at least 75–80% of all L-VGCCs in the brain (Hell et al., 1993a; Hell et al., 1993b; Koschak et al., 2007). The Cav1.3 α1 subunit is also highly expressed in the brain where it has been shown to contribute to activity- dependent induction of nuclear CREB Ser133 phosphorylation (Zhang et al.,

2006). The α2-δ, β, and γ auxiliary subunits function to modulate channel surface expression, localization, biophysical properties, and intracellular protein-protein interactions (Chen et al., 2004; Dai et al., 2009; Lipscombe et al., 2004; Opatowsky et al., 2004; Van Petegem et al., 2004).

1.5.2.2 Physiological relevance of L-VGCCs for transcription

L-VGCCs are present along the dendrites and the somata of neurons.

They have been shown to couple membrane depolarization in neurons to numerous cellular processes, and are thought to exert many of these actions through their effects on activity- and calcium-regulated gene transcription.

Significant data implicate L-VGCCs in the activity-dependent regulation of neuronal survival. For example, Ghosh and colleagues demonstrated that activation of L-VGCCs promotes cell survival in cultured cortical neurons in a manner that requires BDNF, which can be transcriptionally induced by L-VGCC signaling (Ghosh et al., 1994a). L-VGCCs have also been shown to regulate dendritic growth in cultured cortical neurons in a calcium-, CREB-, and transcription-dependent manner (Redmond and Ghosh, 2005; Redmond et al.,

2002). Interestingly, evidence suggests that the unique biophysical properties of

L-VGCCs – namely their ability to activate at relatively negative potentials, and their slow activation kinetics as compared with other VGCCs – may allow them to act as a kinetic filter to support spike–EPSP discrimination in the activation of

CREB-dependent gene transcription (Mermelstein et al., 2000).

Genetic evidence for a critical role of L-VGCCs in neuronal and other cellular physiology came when the CaV1.2 gene was shown to be mutated in

Timothy Syndrome. This syndrome is characterized by multiorgan dysfunction including lethal arrhythmias, webbing of fingers and toes, congenital heart disease, immune deficiency, intermittent hypoglycemia, cognitive abnormalities, and autism (Splawski et al., 2005; Splawski et al., 2004). Patients with Timothy syndrome have a critical mutation in an alternatively spliced exon of the Cacna1c gene encoding CaV1.2, which results in the coding sequence mutation G406R.

The G406R mutation produces maintained inward Ca2+ currents by causing nearly complete loss of voltage-dependent channel inactivation, a key property of normal L-VGCCs (Splawski et al., 2004). This could hypothetically lead to calcium overload in many excitable cell types, including neurons. Intriguingly, while cardiac arrhythmia due to delayed cardiomyocyte repolarization is the primary cause of death in Timothy syndrome (Splawski et al., 2005; Splawski et al., 2004), it remains to be determined what effect the prolonged inward Ca2+ currents might have on calcium-dependent gene transcription – particularly in the nervous system – and what role that could then play in the manifestation of plasticity-related neurological deficits such as autism.

1.5.2.3 Signaling pathways and protein interactions that regulate L-VGCCs

Like NMDARs, L-VGCCs have long been known to play an important role in activity-regulated gene transcription (Greenberg et al., 1986). However, several early studies demonstrated important differences in the ability of calcium influx through L-VGCCs versus NMDARs to activate specific transcriptional pathways (Bading et al., 1993; Ghosh et al., 1994b). For example, whereas the activation of transcription through the SRF-binding SRE element can be driven by calcium influx through NMDARs, the calcium rises that activate transcription through the CREB-binding CRE-element are more selectively coupled to L-

VGCCs (Bading et al., 1993; Hardingham et al., 1997). Like other plasma membrane receptors, the specificity of L-VGCC signaling is thought to arise in part through the nature of the specific protein-protein interactions between these channels and components of intracellular signaling pathways. Strong evidence for this idea of local calcium signaling at the L-type channel came from an elegant study that examined the ability of calcium chelators with different calcium binding affinities and KON rates to block membrane depolarization induced Ser133 phosphorylation of CREB (Deisseroth et al., 1996). These studies showed that only the very rapid chelation of calcium, which inhibits the elevation of calcium with the microdomain at the mouth of the channel, is sufficient to block CREB Ser133 phosphorylation following L-VGCC activation.

These data suggested that a local submembranous calcium sensor bound at or near the channel was required for transmission of the calcium signal to CREB.

One way in which L-VGCCs may be capable of coupling to downstream transcriptional signaling pathways is via their direct interaction with the calcium sensor CaM. An isoleucine-glutamine ("IQ") motif in the C-terminus of the L-

VGCC α1 subunit CaV1.2 allows the channel to bind CaM and this interaction is critical for conveying the Ca2+ signal through the channel to the nucleus

(Dolmetsch et al., 2001). Specifically, cultured neurons transfected with a construct encoding a CaV1.2 in which the IQ domain has been mutated are deficient for activation of the Ras/MAPK pathway, which is normally activated following L-VGCC activation. Additionally, these neurons fail to exhibit CREB- or MEF2-dependent gene transcription following a stimulus that normally leads to L-VGCC activation (Dolmetsch et al., 2001). How the local activation of CaM might selectively couple L-VGCCs to CREB-dependent transcription is not entirely clear. CaM is involved in gating the calcium-dependent inactivation of

L-VGCCs (Peterson et al., 1999), which could influence the amplitude or kinetics of downstream signaling pathway activation. In addition, some studies have suggested that CaM locally activated at calcium channels may translocate to the nucleus (Deisseroth et al., 1998). Nuclear CaM levels are elevated within 15 seconds of calcium channel activation, and this elevation precedes the phosphorylation of CREB (Mermelstein et al., 2001). However, in isolated preparations of hippocampal nuclei, elevation of calcium levels is sufficient to induce CREB phosphorylation in a CaMK-dependent manner indicating that

CaM translocation from the synapse is not required to activate this signaling pathway (Hardingham et al., 2001). Furthermore, nuclear expression of a CaM- binding peptide that inhibits nuclear CaM blocks 43% of all genes induced by action potential firing in cultured hippocampal neurons, indicating that elevation of nuclear calcium is essential for controlling the expression of a large subset of activity-regulated genes (Zhang et al., 2009).

Protein-protein interactions that affect L-VGCC channel function may serve to regulate gene transcription programs by regulating the location or function of L-VGCCs themselves. For example, the tumor suppressor eukaryotic initiation factor 3 subunit E (eIF3E, also known as Int6) binds to the II-III loop of

CaV1.2 in a calcium-dependent manner following electrical stimulation. This interaction facilitates the activity-dependent internalization of L-VGCCs into endosomes following neuronal activity (Green et al., 2007), and thus has the potential to function in the homeostatic regulation of L-VGCCs and their downstream signaling effects on the neuron. Interestingly, the lipid kinase phosphatidylinositol 3-phosphate 5-kinase (PIKfyve) has also been shown to bind to CaV1.2 in an activity-dependent manner (Tsuruta et al., 2009). Following

NMDAR-induced binding of PIKfyve to CaV1.2, CaV1.2 is endocytosed and targeted to lysosomes for degradation. Tsuruta and colleagues suggest that this phenomenon could be a novel mechanism by which neurons guard against excitotoxicity, as knockdown of PIKfyve prevents CaV1.2 degradation and increases neuronal susceptibility to excitotoxicity (Tsuruta et al., 2009). It is important to note that the stimulus used in this study to activate NMDARs was the bath application of high concentrations of glutamate to cortical neurons in culture. It has been shown previously that this stimulus not only activates synaptic NMDARs (which induce pro-survival signaling pathways and gene transcription paradigms) but also activates extrasynaptic NMDARs, which have been shown to induce cell death in a manner that is dominant over the synaptic

NMDAR-mediated signals (Hardingham and Bading, 2002, 2003; Hardingham et al., 2002). It would be interesting to determine whether the binding of PIKfyve to

CaV1.2 and the subsequent internalization and degradation of CaV1.2 is

specifically induced by activation of extrasynaptic NMDARs (which would indicate a possible compensatory role for this interaction) or by synaptic

NMDARs (which would indicate that it functions as part of a larger pro-survival signaling paradigm induced by synaptic activation).

Finally, the activity of L-VGCCs is also subject to modulation downstream of other signaling cascades in addition to changes in cellular calcium. Thus, modulation of L-VGCC function may be a pathway through which other signaling cascades can alter gene transcription. For example, it has long been known that activity of L-VGCCs in neurons was subject to modulation by cAMP signaling (Gray and Johnston, 1987). Phosphorylation of the L-VGCC

2+ α1 subunit CaV1.2 by PKA enhances L-type Ca currents by increasing the open probability (PO) of the individual channels in cardiac myocytes (Bean et al., 1984;

Yue et al., 1990), and PKA modulates L-VGCCs in the dendrites of hippocampal neurons as well (Hoogland and Saggau, 2004; Kavalali et al., 1997). A substantial body of evidence indicates that the PKA-mediated enhancement of L-VGCC current specifically relies on the phosphorylation of Ser1928 in the C-terminal tail of the pore-forming CaV1.2 subunit (Catterall, 2000). The A kinase-anchoring protein 15 (AKAP15) is capable of directly interacting with the distal C terminus of the L-VGCC α1 subunit CaV1.2 via a leucine zipper-like motif, and this interaction is important for the β-adrenergic regulation of CaV1.2 channels via the PKA pathway (Hulme et al., 2003). However, while AKAP15 can direct PKA to its protein substrates, other AKAPs can function as signaling integrators by binding additional regulators other than PKA to target proteins. Recently,

Oliveria and colleagues have shown that AKAP79/150 is capable of anchoring both PKA and calcineurin to CaV1.2 via a direct interaction between modified

leucine zipper motifs in both proteins, and that this association is capable of modulating neuronal L-VGCC-mediated calcium currents (Oliveria et al., 2007).

Interestingly, AKAP79/150 targeting of calcineurin also appears to be necessary to couple Ca2+ influx via L-VGCCs to activation of the transcription factor

NFATc4, thus providing a novel mechanism by which L-VGCCs might be capable of signaling to the nucleus.

1.5.3 Other sources of calcium

Although NMDARs and L-VGCCs appear to play the major roles in the regulation of calcium-dependent transcription in neurons, other sources of calcium may be important under select conditions. For example, although N- type voltage-gated calcium channels (N-VGCCs), are generally inactivated during persistent neuronal depolarization, transient activation of these channels has been shown to contribute to the induction of tyrosine hydroxylase expression that occurs following 5 Hz electrical stimulation of primary sensory neurons

(Brosenitsch and Katz, 2001).

In addition, subsets of AMPARs can provide a source of calcium entry at the synapse. AMPARs are tetramers comprised of various combinations of the

GluA1-4 subunits (formerly called GluR1-4 (Collingridge et al., 2009). In the mature brain, the majority of AMPARs contain the GluA2 subunit and are impermeable to calcium due to the presence of a positively-charged arginine (R) residue in a key position in the GluA2 pore domain that blocks calcium influx.

Notably, however, some GluA2-containing AMPARs are calcium permeable.

This is because the calcium permeability of GluA2 is regulated post- transcriptionally by RNA editing. In the genome, the DNA sequence of the Gria2

gene encodes a negatively charged glutamine (Q) residue at the key selectivity residue in the GluA2 pore, rather than the R found in edited Gria2 mRNA

(Lomeli et al., 1994). The Q/R switch occurs by editing of the Gria2 mRNA that is mediated by the enzyme RNA-dependent adenosine deaminase 2 (ADAR2)

(Melcher et al., 1996). In addition to AMPARs with unedited GluA2, some

AMPARs pass calcium because they lack GluA2. For example, early in development a significant fraction of AMPARs lack GluA2 (Kumar et al., 2002), and GluA2-lacking, calcium-permeable AMPARs are also expressed in interneurons of the adult cortex (Geiger et al., 1995). Furthermore, following the induction of LTP, the selective insertion of GluA1-only AMPA receptors has been reported, leading to the transient appearance of GluA2-lacking, calcium permeable AMPARs at potentiated synapses (Liu and Cull-Candy, 2000; Plant et al., 2006). This calcium could contribute to transcriptional regulation. It has been shown that pharmacological activation of AMPARs in striatal and cortical neurons leads to a MAPK- and calcium-dependent phosphorylation of the transcription factor CREB, raising the possibility that AMPARs could function in some cases to activate changes in gene transcription (Perkinton et al., 1999; Tian and Feig, 2006). However, whether calcium influx through AMPARs contributes to the regulation of specific transcriptional programs has not been well established.

Finally, neuronal transcription can also be regulated by calcium release from intracellular calcium stores (Hardingham et al., 2001). In order to utilize the highly abundant ion calcium as a second messenger, all cells tightly regulate intracellular calcium levels by binding or sequestering the vast majority of free calcium (Clapham, 2007). The endoplasmic reticulum (ER) serves as a

particularly large and important reservoir of stored calcium. In response to extracellular signals that activate receptors coupled to Gq-type G proteins or phospholipase C (PLC), calcium is released from the ER into the cytoplasm through inositol trisphosphate (IP3)- and ryanodine receptors (Berridge, 2002). In non-excitable cells such as lymphocytes, this depletion of intracellular calcium stores is coupled to the opening of calcium release-activated calcium (CRAC) channels in the plasma membrane. Lymphocytes lack the VGCCs that are so important for activity-dependent transcription in neurons, and in non-excitable cells it is the CRAC channels that serve as the major source of calcium for stimulus-dependent transcriptional regulation (Hogan et al., 2010). Store- operated calcium entry depends on the proteins known as stromal interaction molecules 1 and 2 (Stim1 and Stim2), which sense the depletion of calcium in the

ER. The Stim proteins then form a complex with the plasma membrane protein

Orai, which forms the pore subunit of the CRAC channel.

Stim1 is expressed in the brain, where it has been shown to interact directly with the C-terminal tail of the L-VGCC subunit Cav1.2 (Park et al., 2010).

Interestingly, the association of Stim1 with Cav1.2 suppresses depolarization- induced opening of the L-VGCC channel and causes long-term depletion of L- type channels from the plasma membrane by promoting their internalization.

These data suggest that the actions of Stim1 and L-VGCCs are reciprocally regulated in neurons, raising the possibility that they could signal the activation of distinct downstream events. One stimulus that may utilize this interplay between these calcium sources to differentially regulate transcription is the activation of nicotinic acetylcholine receptors (nAChRs). Activated nAChRs are capable of inducing CREB Ser133 phosphorylation and activating Fos expression

(Chang and Berg, 2001; Hu et al., 2002). This transcriptional response requires calcium influx across the plasma membrane as well as subsequent release of calcium from internal stores, and is thought to signal to the nucleus through

CaMK and MAPK pathways. Interestingly, however, sustained CREB phosphorylation is only driven by nAChRs if L-VGCCs are silent (Chang and

Berg, 2001). As described above, Stim1 is one potential mechanism that could couple intracellular calcium release and silencing of L-VGCCs (Park et al., 2010).

Future studies that address the requirements for Stim1/2 in stimulus-regulated transcription in the nervous system may reveal selective functions for intracellular calcium stores in response to different kinds of extracellular stimuli.

1.6 Research objectives

Substantial progress has been made in the identification of molecular mechanisms that mediate neuronal activity-dependent changes in gene transcription. In total, these data demonstrate that neurons use a complex array of signaling pathways and transcriptional mechanisms to orchestrate the expression of diverse gene expression programs in response to a wide range of extracellular stimuli. Transcription factors can be regulated at the level of expression, protein-DNA binding, nuclear versus non-nuclear localization, or via post-translational modifications that either activate or repress transcription.

Furthermore, different neurotransmitter receptors and ion channels in the plasma membrane – both at the synapse and outside the synapse – all activate specific signaling molecules that differentially regulation the transcriptional machinery in the nucleus. Without a doubt, the most critical second messenger in the regulation of neuronal gene transcription is the calcium ion, and the two

most salient modes of calcium entry for neurons are NMDARs and L-VGCCs.

The body of work presented in this dissertation will elucidate a few more mechanisms of specificity through which neurons can fine-tune their transcriptional responses to a diverse array of stimuli. My research focuses on the activity-dependent transcription of Bdnf exon IV early in development, the transcription factors and upstream signaling cascades that are capable of regulating its expression, and the physiological relevance of such signaling specificity.

1.6.1 Identification and characterization of MEF2 as a second binding protein of the CaRE1 element within Bdnf promoter IV

One transcription factor of particular interest in the stimulus-specific regulation of Bdnf exon IV transcription is CaRF. CaRF was originally identified as a binding protein of the CaRE1 element within Bdnf promoter IV (see Figure 1)

(Tao et al., 2002). CaRF is a nuclear protein that is widely expressed in many tissues and cell types. Within the CNS, CaRF is preferentially expressed in neurons compared with glial cells, and expression levels peak during early postnatal development before falling back in adulthood (McDowell et al., 2010).

The domain of CaRF that is required for DNA binding is highly similar between

CaRF orthologs from Cnidarians to mammals, suggesting an evolutionarily conserved function for CaRF as a DNA binding protein (Pfenning et al., 2010).

Surprisingly, unlike most transcription factors, which belong to large families defined by similarity of their DNA binding domains (Vaquerizas et al., 2009), the

DNA binding domain of CaRF is unique and shares no homology with any other protein. However, CaRF binds DNA directly and acts as a CaRE1-dependent transcriptional activator in heterologous cells (Pfenning et al., 2010; Tao et al.,

2002). Importantly, CaRF’s ability to bind variant CaRE1 sequences in vitro strongly correlates with the ability of those sequences to promote activity- dependent transcription of the Bdnf (pIV-170) reporter plasmid (Tao et al., 2002).

Taken together, these data indicate that CaRF can bind to and regulate the transcription of Bdnf and presumably other neural genes.

Evidence that CaRF is required for transcriptional regulation of Bdnf exon

IV in neurons in vivo comes from analysis of Bdnf expression in the brains of Carf knockout (KO) mice. These mice lack exon VIII of the Carf gene and are functional nulls (McDowell et al., 2010). Carf KO mice are viable and fertile, and they show no overt behavioral or neurological deficits. Although Bdnf mRNA and protein levels are unchanged in the hippocampus and striatum of adult Carf

KO mice compared with their wildtype (WT) littermates, there is a significant reduction in the expression of both Bdnf mRNA and BDNF protein in the frontal cortex of the KO mice. This reduction is specific for exon IV-containing Bdnf transcripts, whereas expression of transcripts generated by the three other most transcriptionally active Bdnf promoters in the adult brain (exon I-, II-, and VI- containing isoforms) are unchanged. Although these data do not prove that

CaRF regulates Bdnf transcription directly via CaRE1 binding, the restriction of the deficit to exon IV-containing forms of Bdnf is consistent with a role for CaRF at this particular promoter.

What is surprising about these data is the regional selectivity of the requirement for CaRF, especially given the widespread and largely similar expression of CaRF across most brain regions (McDowell et al., 2010).

Historically there exists some precedence for regional differences in the regulation of Bdnf transcription, though the mechanisms have not been fully

understood (Alboni et al., 2010; Dennis and Levitt, 2005; Poulsen et al., 2004). In addition, since CaRE1 is required for activity-dependent transcription of the Bdnf

(pIV-170) reporter plasmid, it might have been anticipated that Carf KO mice would show impaired activity-inducible Bdnf exon IV expression. By contrast, although cultured cortical Carf KO neurons show reduced Bdnf exon IV expression prior to membrane depolarization, the activation of L-VGCCs robustly induces Bdnf exon IV expression in Carf KO neurons in a manner that is not discernibly different from that seen in WT neurons (McDowell et al., 2010).

The fact that the loss of CaRF fails to phenocopy loss of CaRE1 in this assay indicates that there must exist additional CaRE1 binding proteins in addition to

CaRF that contribute to the actions of this element.

Chapter 2 of this dissertation will demonstrate that the transcription factor MEF2 is also capable of binding to the CaRE1 element within Bdnf promoter IV. MEF2 has been previously shown by ChIP to bind to Bdnf promoter IV (Hong et al., 2008), however the specific binding site for MEF2 within Bdnf promoter IV has been unidentified up until now. I also further characterize the different roles specific MEF2 isoforms have in mediating the membrane depolarization-dependent regulation of Bdnf exon IV. Lastly, I examine the possibility that specific MEF2C splice variants might be differentially responsive to neuronal membrane depolarization. This chapter of my dissertation characterizes three distinct mechanisms of specificity in the regulation of Bdnf transcription: 1) the binding of different transcription factors to a single site within the promoter in response to different types of neuronal stimuli, 2) alternative regulation of different promoters by specific isoforms within the MEF2 family of transcription factors, and 3) differential

responsiveness to the same stimulus by distinct splice variants of a single MEF2 isoform (MEF2C).

1.6.2 Identification Grin3a as a potential CaRF target and demonstration that NR3A can modulate both NMDAR- dependent Bdnf exon IV transcription and GABAergic synapse development

The line of investigation that led to the discovery of CaRF began with the goal of understanding how neuronal activity leads to changes in Bdnf transcription. Since the CaREs mediate calcium-regulated transcription of Bdnf promoter IV, it was presumed that the transcription factors bound to the CaREs could be targets of calcium-regulated signaling pathways. Neuronal activity can impinge on the regulation of transcription factors by modulating their nuclear localization, their protein–protein or protein–DNA interactions, or their expression (Lyons and West, 2011; West et al., 2002). CaRF is a constitutively nuclear protein, and in vitro DNA binding assays revealed no evidence for activity-dependent changes in CaRF’s affinity for CaRE1 binding (Tao et al.,

2002).

Stimulus-dependent regulation of transcription factor activity is commonly studied by tethering the activation domain of the transcription factor of interest down onto a reporter gene as a fusion protein with the DNA binding domain of the yeast transcription factor Gal4, which binds with high affinity and selectivity to the upstream activating sequence (UAS). When the transcriptional activation domain of CaRF is tethered to a UAS-Luciferase reporter in neurons, membrane depolarization drives a significant increase in CaRF-dependent luciferase expression that is blocked by the L-VGCC inhibitor nimodipine, suggesting that activation of calcium-dependent signaling pathways is required

for this increase in CaRF-dependent transcription (Tao et al., 2002). Intriguingly, like the activation of Bdnf transcription, the enhancement of CaRF’s transcriptional activity in this assay is both calcium- and neuron-selective, although the mechanism of this selectivity remains unknown. While tandem mass spectrometry has led to the identification of several sites on the CaRF protein that can be post-translationally modified, whether these sites are functionally important for CaRF-dependent transcription or regulated by calcium-signaling pathways remains to be determined (Figure 7A).

Although the studies described above indicate that CaRF-dependent transcription can be enhanced by L-VGCC-activated signaling cascades, demonstration of the importance of this regulatory mechanism for CaRF- dependent gene transcription in vivo has proved elusive. As described in the previous section, Carf KO neurons show normal membrane depolarization- induced expression of Bdnf exon IV. However, this does not rule out the possibility that CaRF may also be subject to other forms of stimulus-dependent regulation. For example, a recent study reported that repeated serotonin transporter blockade for 7 or 21 days in vivo with the drug escitalopram enhanced expression of CaRF in the prefrontal cortex of rats and depressed expression in the hippocampus (Alboni et al., 2010). Furthermore, the magnitude, regional distribution, and time course of these changes parallel changes in Bdnf expression. Unlike some other activity-regulated transcription factors such as CREB, which have little ability to promote transcription until phosphorylated by stimulus-induced signaling cascades, CaRF shows significant basal transcriptional activity in unstimulated neurons (Tao et al., 2002). Thus, changing expression levels of this transcription factor may be sufficient to have a

!" !"#$%&'()*+,-.+*(/"$0-12( 34567(89:("'%.-("$%;+( BIJK( LJ:M( B:JI( B:43( H >$( H H < !

+,#%$*(="1%".0+( $C="C-.(6-'"%.( 6<>(?%.;%.@(( "#0*1."C=*( ;-'"%.( ,-#D>(+%@."#E+F(

#" N*'?1".*(6*,-#"1%O"C-.( P(!"#$%&'(Q.R&S(

!")/( T"#J( !"#$%&'()&* VV( +('%* U>B(

)",%;#D(%.$1*"+*(!")/("$C=%0D( B#-W#D(;*$1*"+*(!")/(*S,1*++%-.(

Figure 7: CaRF is a novel transcription factor that exhibits complex regulation by neuronal activity. (A) Post-translational modifications of CaRF. The numbers represent amino acid positions from human CaRF. P, phosphorylation; Ac, acetylation; S, serine; K, lysine; DBD, DNA binding domain; TAD, transcriptional activation domain. (B) Model for the bimodal calcium-dependent regulation of CaRF-mediated transcription. Membrane depolarization induced by the elevation of extracellular potassium leads to the opening of voltage-gated calcium channels. This stimulus is associated with an increase in the transcriptional activity of the CaRF activation domain tethered via UAS- Gal4 to a luciferase reporter plasmid, whereas the same stimulus results in a decrease in Carf mRNA expression 6 hours after membrane depolarization. significant impact on expression of its target genes. How escitalopram regulates

CaRF expression is not known, however in a recent genome-wide RNA-Seq study, Carf was among a set of genes whose RNA levels were significantly reduced in cultured hippocampal neurons 6 hours following membrane depolarization (Kim et al., 2010). This finding raises the interesting possibility

that calcium signaling pathways could upregulate the activity but downregulate the expression of CaRF on different time scales, allowing for differential temporal regulation of the transcription of CaRF target genes (Figure 7B).

One possible confounding factor when analyzing any constitutive KO mouse strain for deficiencies is the possibility for compensation. In order to acutely examine the role of CaRF in activity-regulated gene transcription, shRNAs were designed to knockdown (KD) Carf in cultured neurons.

Surprisingly, our lab has found that NMDAR-dependent Bdnf exon IV transcription is potentiated in Carf KD neurons. This is in stark contrast to both what has been observed with basal Bdnf exon IV expression levels in Carf KO brains (Bdnf levels are decreased) and what has been observed in Carf KO neurons in vitro following neuronal membrane depolarization and L-VGCC activation (Bdnf levels are unchanged) (McDowell et al., 2010). Chapter 3 of this dissertation will show, based on a gene array run on cultured Carf WT versus KD neurons, that Grin3a is a potential target of CaRF. Grin3a encodes the NMDAR subunit NR3A, providing a potential mechanism by which Carf KD might lead to enhanced NMDAR-dependent gene transcription. I will go on to demonstrate that NR3A does in fact play a modulatory role in NMDAR-dependent gene transcription, a completely novel finding. Given that the brains of Carf KO mice have increased numbers of GABAergic synapses (McDowell et al., 2010), I will examine the possibility that NR3A could play a role in this developmental process. Lastly, the activity-dependent regulation of Carf and Grin3a expression levels will be further examined. This chapter of my dissertation characterizes four distinct mechanisms of specificity in the regulation of Bdnf transcription: 1)

CDE8%2F%G0H>)>(% &'(')% *+,-..%'/01'023% 4!567%'/01'023%%

.'7#% &'(#)*<%

!"#$%.'7#% !"#$%8923%:,% !"#$%.'7#% !"#$%8923%:,% !"#$% !"#$%8923%:,% .'7";% .'7";% .'7";% 78=>/8=% ?3/@'3A8=% ")81'B8=% "I8/B%2F%+*'$%JKLJ5%23%!"#$%8923%:,%

Figure 8: CaRF selectively regulates different modes of Bdnf transcription through direct and indirect mechanisms. Above: mode of Bdnf regulation. Below: change in Bdnf exon IV levels in the absence of Carf expression. Following L-VGCC activation, Bdnf exon IV levels are unchanged in both Carf KO and KD neurons. In contrast, basal Bdnf exon IV mRNA levels and BDNF proteins levels are reduced in the brains of Carf KO mice (McDowell et al., 2010). Finally, in this dissertation I will provide evidence that in Carf KD neurons, a loss of CaRF-dependent expression of Grin3a, the gene encoding the NMDAR subunit NR3A, results in enhanced Bdnf exon IV levels. differential regulation of Bdnf exon IV by CaRF in response to distinct stimuli, 2) subunit-dependent specificity in the regulation of NMDAR-dependent signaling cascades and associated gene transcription, 3) stimulus-dependent specificity in the regulation of the expression of CaRF, and 4) stimulus-dependent specificity in the regulation of the expression levels of the NMDAR subunit Grin3a.

Taken together, the data presented in this dissertation will provide a complex model of stimulus-specific regulation of Bdnf exon IV transcription by the transcription factor CaRF (Figure 8). Many of the discrete cellular mechanisms described here that lend specificity to neuronal transcriptional responses will doubtless be applicable to other neuronal genes as well as other cell types.

2. Members of the MEF2 transcription factor family differentially regulate Bdnf transcription in response to neuronal depolarization

2.1 Summary

Transcription of Brain-Derived Neurotrophic Factor (Bdnf) is induced in response to a wide variety of extracellular stimuli via the activation of a complex array of transcription factors. However, whether individual transcription factors confer specificity upon the regulation of Bdnf is poorly understood. Previous studies have shown that members of the Myocyte Enhancer Factor 2 (MEF2) transcription factor family bind a regulatory element upstream of Bdnf promoter

I and associate with an unknown binding site in Bdnf promoter IV. Here we identify the calcium-response element CaRE1 as the MEF2 binding site in promoter IV of the Bdnf gene and determine the requirements for individual members of the MEF2 family in Bdnf regulation. MEF2A, C, and D are all highly expressed in embryonic rat cortical neurons, however only the Mef2c gene encodes a MEF2 splice variant that lacks the γ repressor domain. We find that

MEF2C variants lacking the γ-domain are particularly sensitive to activation by membrane depolarization, raising the possibility that the MEF2s may differentially contribute to activity-regulated gene expression. We find that only knockdown of MEF2C significantly impairs membrane depolarization-induced expression of Bdnf exon IV. By contrast, only knockdown of MEF2D affects depolarization-induced expression of Bdnf exon I, and induction of exon I is significantly enhanced in the absence of MEF2D expression. Taken together, these data show that individual members of the MEF2 family of transcription

factors differentially regulate the expression of Bdnf, revealing a new mechanism that may confer specificity on the induction of this biologically important gene.

2.2 Introduction

Neuronal activity-regulated gene transcription plays an important role in converting sensory information into long-lasting changes in brain function

(Lyons and West, 2011). The gene encoding the secreted neurotrophin BDNF is a key player in this process, as it performs essential roles in neural development and plasticity by modulating synaptic development and function (Lewin and

Barde, 1996; Loebrich and Nedivi, 2009; Lu, 2003). The Bdnf gene contains nine distinct alternative promoters, however all Bdnf transcripts encode the same protein (Aid et al., 2007). Alternative promoter usage is thought to facilitate cell type-, region-, and stimulus-specific regulation of Bdnf transcription (Loebrich and Nedivi, 2009; Timmusk et al., 1993). Promoters I and IV are both highly responsive to neuronal activity, however transcripts initiated from promoter IV

(pIV) are the most abundant in developing neurons (Lyons and West, 2011;

Timmusk et al., 1993).

Studies examining transcription factor binding sites within promoter I and promoter IV of the Bdnf gene have identified multiple calcium response elements (CaREs) that are required for the L-type voltage-gated calcium channel

(L-VGCC)-dependent induction of Bdnf expression driven by membrane depolarization (Chen et al., 2003; Lyons and West, 2011; Pruunsild et al., 2011;

Shieh et al., 1998; Tao et al., 2002). Calcium-Response Factor (CaRF) was identified as a binding protein for the CaRE1 element within Bdnf promoter IV

(Tao et al., 2002), and levels of Bdnf exon IV mRNA are significantly reduced in

the cerebral cortex of Carf knockout (KO) mice (McDowell et al., 2010). However, cultured Carf KO neurons show normal upregulation of Bdnf exon IV in response to membrane depolarization. Thus, these data raised the possibility that additional CaRE1 binding proteins may exist that mediate the activity of this element following membrane depolarization.

In this study, we identify the MEF2 family of transcription factors as mediators of membrane depolarization-inducible, CaRE1-dependent transcription from Bdnf promoter IV. The MEF2 family is comprised of four separate gene products (MEF2A-D) that are differentially expressed spatially and temporally in the brain (Leifer et al., 1993; Lyons et al., 1995; Martin et al., 1993).

MEF2A, C, and D are coexpressed in embryonic cortical neurons, and the Mef2c gene encodes multiple MEF2C splice variants that we show are differentially responsive to membrane depolarization. We further demonstrate that knockdown of MEF2C selectively reduces membrane depolarization-induced expression of Bdnf exon IV, whereas induction of Bdnf exon I expression is strongly potentiated by knockdown of MEF2D. Taken together, our data suggest a novel mechanism of specificity in the transcriptional regulation of Bdnf promoter IV via the actions of distinct transcription factors within a single family. We propose that this transcriptional diversity may enable neurons to finely tune their cellular responses to environmental stimuli.

2.3 Materials and Methods

2.3.1 Plasmids

Wildtype or CaRE1 mutant Bdnf pIV firefly luciferase reporter plasmids were previously called p3-170Luc and p3-170Luc3-4 respectively (Tao et al.,

2002). The following plasmids were previously described: cCaRE, mCaRE,

CaRE1 (McDowell et al., 2010) and MRE (Flavell et al., 2006) luciferase reporter plasmids; Gal4 fusions with human MEF2Cα1, MEF2Cα1β, MEF2Cα1γ,

MEF2Cα1βγ, or MEF2Cα1βΔγ (Zhu and Gulick, 2004); the UAS-luciferase plasmid

(Tao et al., 2002); mammalian expression vectors for CaRF (Tao et al., 2002),

MEF2A and MEF2D (Flavell et al., 2006), and CREB (Kornhauser et al., 2002); and the shRNA plasmids targeting mouse MEF2A and D used in neuronal transfection experiments (Flavell et al., 2006).

2.3.2 Cell culture, transfection, and luciferase assays

Neuron-enriched cultures were generated from cortices of male and female postnatal day 0 (P0) Carf+/+ or Carf-/- littermates (McDowell et al., 2010),

E16 CD1 mouse embryos (Charles River Laboratories, Raleigh, NC), or E18/19

CD1 rat embryos (Charles River) as described (McDowell et al., 2010; Tao et al.,

2002). For luciferase assays, neurons or HEK 293T cells (ATCC, Manassas, VA) were transfected with calcium phosphate (Tao et al., 2002). Cotransfection of TK- renilla luciferase (Promega, Madison, WI) was used to control for transfection efficiency and sample handling. For neurons, lysates were harvested on day in vitro (DIV) 5-6 after overnight treatment with 1µM of the sodium channel inhibitor TTX (Sigma) ± 6 hrs exposure to 55 mM extracellular KCl, which activates L-VGCC-dependent transcription of Bdnf (Tao et al., 2002).

2.3.3 Electrophoretic mobility shift assay (EMSA)

In vitro transcribed and translated MEF2A and D were incubated with a radiolabeled double-stranded MEF response element (CTCTAAAAATAACCCA) for EMSA as described (Pfenning et al., 2010). Unlabeled double-stranded

competition probes (CaRE1: GTGTCTATTTCGAGGCAGAGGA, cCaRE:

GTGTYCARAACGAGGCAGAGG) were added in 10,100, or 1000-fold molar excess. Gels were dried and visualized by PhosphorImager, and shifts intensities were quantified relative to probe intensity in the same lane using ImageQuant

(GE Healthcare, Piscataway, NJ).

2.3.4 RNAi plasmids and quantitative RT-PCR

For viral infection of neurons, MEF2 knockdown constructs targeting rat

MEF2A, C or D in the vector pLKO.1 (TRCN0000095959, TRCN0000012068, and

TRCN0000085268) were obtained from Thermo Scientific (Lafayette, CO) and packaged as lentiviral particles in 293T cells. Cultured rat cortical neurons were infected on DIV1. RNA was harvested on DIV7 for cDNA synthesis and quantitative SYBR green PCR (ABI, Foster City, CA). Intron spanning primers were used for all genes tested. Gapdh mRNA levels were used as a normalizing control. The PCR primers used were: Gapdh F-CATGGCCTTCCGTGTTCCT, R-

TGATGTCATCATACTTGGCAGGTT; Mef2a F-TCAAGCCACACAACCTCTTG,

R-CAGCATTCCAGGGGAAGTAA; Mef2b F-AGAGGGTCCTGGAGAGAAGC,

R-AGGTGGCTCGGAGAGAAGAT; Mef2c F-CCAAATCTCCTCCCCCTATG;

Mef2cγ F-TCAAATCTCTCCCTGCCTTC, R-CTCCCATCGTAGGAACTGCT;

Mef2d F-CAGCAGCCAGCACTACAGAG, R-GGCAGGGATGACCTTGTTTA;

Fos F-TTTATCCCCACGGTGACAGC, R-CTGCTCTACTTTGCCCCTTCT; Bdnf exon IV F-CGCCATGCAATTTCCACTATCAATAA, R-

GCCTTCATGCAACCGAAGTATG; Bdnf exon I F-

GCATCTGTTGGGGAGACAAG, R-GCCTTCATGCAACCGAAGTA.

2.3.5 Statistical analyses

All data presented are the average of at least three measurements from each of at least two independent experiments. Data were analyzed by a

Student’s unpaired t-test, and p<0.05 was considered significant. Bar graphs show mean values and all error bars show S.E.M.

2.4 Results

2.4.1 CaRE1 is required for membrane depolarization-enhanced Bdnf promoter IV activity in Carf knockout neurons

Membrane depolarization drives transcription of Bdnf exon IV in a manner that requires CaRE1 (Tao et al., 2002). Although CaRF binds to CaRE1

(Pfenning et al., 2010; Tao et al., 2002) and CaRF knockout mice have reduced

Bdnf exon IV mRNA levels in the cortex under conditions of basal synaptic activity, loss of CaRF does not impair membrane depolarization-induced Bdnf exon IV transcription (McDowell et al., 2010). To test whether the CaRE1 element is required for membrane depolarization-induced transcription of Bdnf exon IV, we transfected cultured Carf+/+ or Carf-/- cortical neurons with Bdnf promoter IV reporter plasmids (Figure 9A). In both Carf+/+ and Carf-/- neurons, membrane depolarization robustly induced transcription from the wildtype promoter IV plasmid (Figure 9B). Mutation of the CaRE1 binding site significantly inhibited depolarization-induced luciferase expression in both Carf+/+ and Carf-/- neurons demonstrating the CaRE1-dependence of this induction in neurons of both genotypes. Interestingly, however, the membrane depolarization-dependent inducibility of both reporter plasmids was not significantly different between

Carf+/+ and Carf-/- neurons. These data strongly suggest that CaRE1-binding

!" 3456A89K"

6#)!"L3" =IJ:"45" A89FG=<.H="

-73 CTATTTCGAGGC -61! B+,"-./D#E"

345B?-./D#E6A89K"

6#)!"L3" =IJ:"45" A89FG=<.H="

-73 CTtccgCcAGGC -61! B?-./D#E" 7" M" *" 3456789"8:;<=.;=>" M" 3456789"''"?@"1-A" )" 345B?-C/D#E6789"8:;<=.;=>" (" 345B?-C/D#E6789"''"?@"1-A" '" &" %"

#$%&'()*+,"-./)0+%'1+" $" #" !" NON" 6O6" !"#$+,"% -./0"12"!"#$% 2+3$456+"

Figure 9: CaRE1 is required for membrane depolarization-induced activation of Bdnf promoter IV in CaRF knockout neurons. (A) Schematic of the Bdnf pIV-luciferase reporter plasmids used. The numbers indicate the position of the promoter 5’ end relative to the initiation site of transcription. pIV-Luc (Tao et al., 2002) contains the proximal 170bp of Bdnf pIV; pIV(mCaRE1)-Luc has the CaRE1 site mutated to a sequence (CTTCCGCCAGGC) that does not bind CaRF. (B) Mutation of the CaRE1 element leads to a reduction in membrane depolarization-induced Bdnf pIV activity in both Carf+/+ and Carf-/- cortical neurons. n = 2-3. *p<0.05, pIV(mCaRE1) compared with pIV.

proteins other than CaRF mediate the activity of this element in response to membrane depolarization.

2.4.2 MEF2 drives CaRE1-dependent Bdnf transcription

2.4.2.1 MEF2 and CaRF are both capable of binding to the CaRE1 element within Bdnf promoter IV

Previously we conducted a binding site selection screen to identify high affinity CaRF DNA binding sites (Pfenning et al., 2010). Alignment of this consensus CaRF binding site (cCaRE) with the Bdnf CaRE1 sequence revealed that the cCaRE closely matches only the 3’ half of CaRE1 (Figure 10A). By contrast, the 5’ side of CaRE1 aligns well with the consensus binding motif for the MEF2 family of transcription factors (Gossett et al., 1989). MEF2A-D are highly expressed in the nervous system where they play important roles in neuronal activity-dependent transcription and synaptic development (Greer and

Greenberg, 2008; Shalizi and Bonni, 2005). MEF2 has been shown by chromatin immunoprecipitation to associate with Bdnf promoter IV in vivo, however the site of binding was not identified (Hong et al., 2008). Thus, we considered the possibility that MEF2 may bind to CaRE1. Recombinant MEF2A/D heterodimers were tested by competition EMSA for their ability to bind CaRE1.

Addition of oligonucleotides containing the CaRE1 site were able to compete binding of MEF2 to a consensus MEF2 response element (MRE) (Gossett et al.,

1989) indicating that MEF2 can bind CaRE1 (Figure 10B). Quantification of the competition revealed that a 100-fold excess of unlabeled MRE competed 47.7±5% of the binding to the radiolabeled MRE probe whereas it took a 1000-fold excess of unlabeled CaRE1 to reach a similar level of competition (48.2±5%). Thus

MEF2A/D has an approximately 10-fold higher affinity for the MRE relative to

!" 1+/-.*! CCATAACGAGGC!

!"#$!"#$%$&'#!()*% CTATTTCGAGGC! ,-.*! CTATTTAAAG!

#" +$%"*! ,-.! +/-.0! 1+/-.! !!!!!!!$!!!!!!!!

,-.!

%" +$%"*! 1+/-.!!!!!!!! +/-.0! ,-.! !!!!!!!$!!!!!!!!

1+/-.!!!!!!!!

Figure 10: MEF2 and CaRF both bind to CaRE1. (legend on next page)

Figure 10: MEF2 and CaRF both bind to CaRE1. (A) Alignment of the consensus CaRF binding site (Pfenning et al., 2010), the Bdnf promoter IV CaRE1 element (Tao et al., 2002), and a canonical MEF2 response element (MRE) (Gossett et al., 1989). Vertical lines indicate nucleotide sequences shared with CaRE1. (B) MEF2 binds CaRE1. The binding of MEF2A/D heterodimers to a radiolabeled MRE probe was either not competed (-) or competed with the addition of a 10-, 100-, or 1000-fold molar excess of unlabeled MRE, CaRE1, or cCaRE. The right triangles indicate increasing concentrations of unlabeled competitor (“Comp.”), and the arrow indicates the transcription factor-radiolabeled probe complexes. (C) CaRF binds CaRE1. The binding of CaRF to a radiolabeled cCaRE probe was either not competed (-) or competed with the addition of a 10-, 100-, or 1000- fold molar excess of unlabeled cCaRE, CaRE1, or MRE. The right triangles indicate increasing concentrations of unlabeled competitor (“Comp.”), and the arrow indicates the transcription factor-radiolabeled probe complexes.

CaRE1. Importantly, we found that oligonucleotides containing the consensus

CaRF binding site (cCaRE), which has no homology to the MEF2 binding site, were unable to compete for MEF2 binding. As a control, we ran the same experiment using recombinant CaRF protein (Figure 10C). We found that, as expected, addition of oligonucleotides containing the CaRE1 site were able to compete binding of CaRF to its consensus cCaRE site (Pfenning et al., 2010), as were unlabeled cCaRE oligos. Importantly, MRE oligos were not able to compete for CaRF binding. Taken together, these data indicate that the CaRE1 sequence within the Bdnf exon IV promoter is capable of being bound by both CaRF and

MEF2. Quantified data from three independent EMSAs for both MEF2 (Figure

11A) and CaRF (Figure 11B) are included.

2.4.2.2 MEF2 and CaRF neither compete nor cooperate in their binding to the CaRE1 element within Bdnf promoter IV

The apparent binding sites for CaRF and MEF2 appear to overlap in the

CaRE1 element (Figure 10A), suggesting that binding of one factor might influence the binding of the other. Specifically, we considered the possibility that the binding of CaRF and MEF2 to CaRE1 could be 1) cooperative, 2) competitive, or 3) independent. To address this question, we used competition EMSAs to

!" ,.2& ,.1& ,.0& ,./& ,& -.2& -.1& -.0&

$%&'()%"*+,-",./%.*,/0" -./& -& !"#$%&&&&&&&&#&&&&&&&& +)*& !()*,& '!()*& 1" ,.0& ,./& ,& -.2& -.1& -.0&

$%&'()%"*+,-",./%.*,/0" -./& -& !"#$%&&&&&&&&#&&&&&&&& '!()*&&&&&&&& !()*,& +)*&

Figure 11: MEF2 and CaRF both bind to CaRE1. (A) The intensity of the transcription factor-radiolabeled probe complexes (MEF2-MRE) in the competition assays shown in Figure 10B above were quantified relative to probe intensity in the same lane. (B) The intensity of the transcription factor-radiolabeled probe complexes (CaRF-cCaRE) in the competition assays shown in Figure 10C above were quantified relative to probe intensity in the same lane. Bars display average relative intensity measurements from three independent experiments, and the error bars represent S.E.M. determine whether the apparent affinity of CaRF for CaRE1 would change when

MEF2 was added to the binding reaction, and conversely if the affinity of MEF2 for CaRE1 would change in the presence of CaRF. We reasoned that if, for example, CaRF and MEF2 bind cooperatively to CaRE1, then adding MEF2 to the

EMSA reaction should enhance the ability of CaRE1 to compete the CaRF-cCaRE interaction, making it more closely resemble the competition with cCaRE.

+.1& !()3&(4"56& +.0& !()3&(57&,*3/& +./& +& -.2& -.1& -.0& %&'()*&#+,-.#-/0&/+-01# -./& -& !"#$%&&&&&&&&&&!&&&&&&&& '!()*&&&&&&&& !()*+& ,)*& $# +.2& ,*3/&(4"56& +.1& ,*3/&(57&!()3& +.0& +./& +& -.2& -.1& -.0& %&'()*&#-/0&/+-01#*('2&# -./& -& !"#$%&&&&&&&&&&!&&&&&&&& ,)*& !()*+& '!()*&

Similarly, adding CaRF to the MEF2-MRE EMSA reaction would also enhance the ability of CaRE1 to compete that interaction. Conversely, if these factors bind competitively, then the presence of either transcription factor should inhibit the ability of CaRE1 to compete for binding of the other factor in this assay.

However, we find that addition of MEF2 has no significant effect on the ability of

CaRE1 to compete the CaRF-cCaRE interaction (Figure 12A). Furthermore, we also find that addition of CaRF has no significant effect on the ability of CaRE1 to compete the MEF2-MRE interaction (Figure 12B). On the basis of these data we conclude that the Bdnf exon IV CaRE1 element contains independent, closely spaced binding sites for CaRF and MEF2.

2.4.2.3 MEF2 is capable of driving transcription of Bdnf exon IV in a CaRE1- dependent manner

We next asked whether MEF2 can drive CaRE1-dependent Bdnf exon IV transcription. Overexpression of either MEF2A/D or CaRF in HEK 293T cells was sufficient to drive expression of luciferase from a wildtype Bdnf promoter IV reporter plasmid. By contrast, neither MEF2 nor CaRF drove luciferase expression from a Bdnf promoter IV reporter in which the CaRE1 site was mutated, demonstrating the CaRE1-dependence of the activity of both factors at this promoter (Figure 13A). Importantly, transcription from both the wildtype and CaRE1 mutant plasmids were promoted equally by overexpressed CREB, which binds Bdnf promoter IV at a site (CaRE3/CRE) distinct from CaRE1 (Tao et al., 1998).

Finally, to determine whether endogenous MEF2 contributes to CaRE1- dependent transcription in neurons, we assessed the effect of RNAi-mediated knockdown of neuronal MEF2 on luciferase expression from cotransfected MRE,

!" =" *6.789" =" :4;&" '" 123;" &#$" 134<" &" %#$" %" !#$"

$%&'()*+,-")./*0,&(1," !" ()*+,-." ()*/01234%5+,-." 2,3%&4,&"4&(510,/4,-" #" =" =" %#&" %" !#@" 179A" !#?" :4;&"BC" !#>" !#&" $%&'()*+,-")./*0,&(1," !" :34" 1234%" .1234" 2,3%&4,&"

Figure 13: MEF2 can drive CaRE1-dependent gene transcription. (A) MEF2 activates Bdnf exon IV transcription in a CaRE1-dependent manner. A wildtype Bdnf pIV reporter plasmid (pIV-Luc) or a version bearing mutations at CaRE1 (pIV(mCaRE1)-Luc) were transfected into HEK 293T cells with mammalian expression vectors containing either CaRF, MEF2A and MEF2D, CREB, or an empty vector control. The bars show the mean values from three independent experiments scaled to the vector control. *p<0.05, pIV(mCaRE1)-Luc vs. pIV-Luc. (B) Endogenous MEF2 contributes to CaRE1-dependent transcription in neurons. Luciferase reporter plasmids enhanced by the MRE, CaRE1, or cCaRE elements were transfected into cultured mouse cortical neurons along with shRNA vectors that knockdown (KD) MEF2A and MEF2D. An empty shRNA vector was used as a control (Ctrl). The bars show the mean values from three independent experiments scaled to the vector control from each day. *p<0.05 KD vs. Ctrl.

CaRE1, or cCaRE reporter plasmids. Neurons were transfected with either a control shRNA plasmid, or shRNA-expressing plasmids that knockdown expression of MEF2A and MEF2D (Flavell et al., 2006). Compared with control neurons, knockdown of MEF2 significantly reduced luciferase expression from a reporter enhanced by three copies of the MRE demonstrating the efficacy of the

RNAi (Figure 13B). Knockdown of MEF2A/D also significantly reduced luciferase expression from the reporter enhanced by three copies of the wildtype

CaRE1 site. By contrast, MEF2 knockdown had no effect on luciferase expression from a reporter enhanced by the consensus CaRF-binding site cCaRE (Figure

13B). Taken together, these data implicate MEF2 along with CaRF as a CaRE1- dependent transcriptional regulator of Bdnf promoter IV in neurons.

2.4.3 MEF2C splice variants are differentially responsive to membrane depolarization

A previous study showed that knockdown of MEF2A and D in cultured hippocampal neurons reduced L-VGCC dependent induction of Bdnf, and identified a MEF2D binding site in a putative Bdnf enhancer 4.5kB upstream of

Bdnf exon I (Flavell et al., 2008). However, whereas Mef2a and Mef2d are the primary MEF2 family members expressed in the hippocampus, Mef2c transcripts are by far the most highly expressed of the MEF2s in cortical neurons (Figure

14A,B). Mef2b expression is negligible by comparison to the other MEF2 family members.

Whereas MEF2A, C, and D all undergo alternative splicing of two domains called α and β, only MEF2C shows alternative splicing of the γ domain.

This is important because the γ domain is a major site of regulation of the activity of the MEF2 transcription factors by neuronal signaling cascades (Shalizi et al.,

2006). In cultured rat cortical neurons only 48.4±4.3% of Mef2c transcripts contain the γ domain, as determined by RT-PCR. To determine how differential splicing affects the membrane depolarization-dependent regulation of MEF2C activity, we overexpressed a series of Gal4-MEF2C splice variant fusion constructs in cultured cortical neurons along with a plasmid containing a

!" #"

<;!" $%&&'()*&+," &!" ('.517" $;<" B!" !"#$%&

!"#$%& $;!" %!" =;<" =;!"

8"97&.1,,%':"41/);<1"5'" !;!" !" ,6>#*" ,6>#?" ,6>#@" ,6>#A" ,6>#*" ,6>#?" ,6>#@" ,6>#A" 6" C" '%" '$" 4546" %"789":/+" '#" C" '!" C" &" %" C" $"

-'.*)/%012"/+(%31.),1" #" !" ()*+$" ,-.#/0'" ,-.#/0'1" ,-.#/0'2" ,-.#/0'12" ,-.#/0'132" 41&'.51."

Figure 14: Region-specific expression and calcium-dependent regulation of MEF2s. (A and B) Relative expression of MEF2 family members were determined by quantitative PCR from cultured embryonic rat hippocampal (A) or cortical (B) neurons. n = 4. (C) MEF2C splice variants are differentially responsive to membrane depolarization. Cultured embryonic rat cortical neurons were cotransfected with a pUAS-Luc reporter vector along with plasmids expressing Gal4 fusions of the indicated MEF2C splice variants. “Δγ” indicates a γ-containing MEF2C variant with a S396A point mutation. The bars show the mean values from four independent experiments scaled to the untreated empty vector control from each day. In all graphs, error bars represent S.E.M. *p<0.05 6 hr KCl vs. none.

luciferase gene under the control of a GAL4-binding UAS element. Whereas the presence of the β domain led to higher levels of membrane depolarization- induced transcription, the presence of the γ domain led to significantly less activation of MEF2C compared with γ-lacking forms (Figure 14C). Consistent with evidence that phosphorylation of MEF2C at serine 396 within the γ domain is a mechanism of the repressive activity of this domain (Shalizi et al., 2006; Zhu and Gulick, 2004), we found that mutation of this residue to alanine increased membrane depolarization-induced transcriptional activation (Figure 14C). These data are important because they suggest that MEF2C splice variants lacking the γ domain, which are highly expressed in the developing cortex, are likely to be the most sensitive of the MEF2 transcription factors to membrane depolarization.

2.4.4 Regulation of Bdnf transcription by different MEF2 family members in cortical neurons

To determine whether individual members of the MEF2 family differentially regulate Bdnf transcription, we generated lentiviruses carrying shRNAs to selectively knockdown MEF2A, MEF2C, or MEF2D (Figure 15A).

Importantly, knocking down MEF2 family members does not impair activity- regulated gene transcription in general, as membrane-depolarization induced Fos expression was unaffected by any of the knockdowns (Figure 15B). We found that knockdown of MEF2C but not MEF2A or MEF2D significantly reduced the membrane depolarization-dependent induction of Bdnf exon IV-containing transcripts (Figure 15C). These data are consistent with our evidence that MEF2 family members can activate CaRE1-dependent transcription of Bdnf promoter IV reporter plasmids, and identify MEF2C as an important contributor to activity- dependent regulation of Bdnf transcription in the developing cortex.

!"" '#!" :" :" :" 3" $!!" 32!" '!!" 3!!" &!" #2!"

%!" ,./0" 62571*-2" #!!" ,./0"

1-" !"#$ 1,0" 1-2,&-(" '2!" $!" '!!" 4-(5" #!" 2!" !"

#"$%"&'()*+'",-"'./,0"+'1,-&" !" ()*#+" ()*#," ()*#-" ,45./40" ()*#+" ()*#," ()*#-" $2-185-92":6&7;" :" :" <" 32!" %" %!!" 3!!" 2!!" #2!" $!!" #!!" ,./0" 3!!" ,./0"

'2!" '=-2">"62571*-2" '=-2">:"62571*-2" 1,0" 1,0" '!!" #!!" %&'($ %&'($ 2!" '!!" 4-(5" 4-(5" !" !" ,45./40" ()*#+" ()*#," ()*#-" ,45./40" ()*#+" ()*#," ()*#-" $2-185-92":6&7;" $2-185-92":6&7;"

Although exon IV-containing forms of Bdnf are the most abundant Bdnf transcripts in the developing cortex, Bdnf promoter I is also highly activity- responsive in neurons and MEF2D has been found bound to a putative enhancer element upstream of promoter I that can regulate promoter I activity (Flavell et al., 2008). Knockdown of MEF2C or MEF2A had no effect on membrane- depolarization induced Bdnf exon I expression (Figure 15D). However, knockdown of MEF2D significantly enhanced*678/9"$" Bdnf exon I induction (Figure

15D). Collectively, these data reveal that specific MEF2 family members have distinct effects on the regulation of different Bdnf gene promoters in response to membrane depolarization.

2.5 Discussion

MEF2 family members are highly expressed in the nervous system where they regulate calcium-dependent transcriptional programs that are important for synapse development (Flavell et al., 2006; Shalizi et al., 2006). Bdnf is among the transcriptional targets of MEF2 in hippocampal neurons (Flavell et al., 2008) and by chromatin immunoprecipitation endogenous MEF2 proteins have been found to associate both with an unidentified element in promoter IV and with a putative long-distance Bdnf enhancer element 4.5kb upstream of promoter I

(Flavell et al., 2008; Hong et al., 2008). However, the functional importance of the interactions of specific MEF2 family members with each of these binding sites was not known.

Our evidence that two different CaRE1-associated proteins, CaRF and

MEF2C, are each required for Bdnf promoter IV activity in cortical neurons under different environmental conditions suggests that the differential expression or recruitment of specific transcription factors at single Bdnf regulatory elements may provide a mechanism of specificity for the regulation of this important gene.

Indeed, multiplex regulation appears to be an important principle of Bdnf transcription in general. Not only are there as many as nine alternative Bdnf promoters, promoter IV alone is regulated by at least eight families of transcription factors (MeCP2, Npas4/Arnt, MEF2, CaRF, USF1/2, CREB, bHLHB4, and NF-κB) several of which have calcium-selective modes of

regulation (Jiang et al., 2008; Lyons and West, 2011; Pruunsild et al., 2011;

Vashishta et al., 2009; West, 2008). Whereas studies that have deleted any single transcription factor have shown only a moderate impact on Bdnf transcription

(Chen et al., 2003; Flavell et al., 2008; McDowell et al., 2010; Vashishta et al., 2009), deletion of just one of the calcium-response elements in Bdnf promoter IV (the

CaRE3/CRE site bound by CREB family members) significantly impairs activity- dependent Bdnf gene induction (Hong et al., 2008). Thus, diversity of transcription factor binding at each CaRE may confer distinct modes of regulation on the Bdnf gene and/or ensure a high safety factor for Bdnf induction following increases in intracellular calcium.

Like most transcription factors, the MEF2s are members of a family of proteins that share a highly conserved DNA binding domain and have many overlapping functions. Outside of the DNA binding domain, however, individual members of the MEF2 family show significant sequence divergence, which may allow for diversity in protein-protein interactions and post- translational regulation (Shalizi and Bonni, 2008). The MEF2 genes show variant expression patterns across different cell types and tissues, which is likely to contribute to their differential biological functions (Lyons et al., 1995). However in some places, such as neurons of the cerebral cortex, multiple MEF2 family members as well as multiple splice variants from the same MEF2 gene are coexpressed in the same neurons (Lyons et al., 1995). By using RNAi to selectively knockdown expression of individual MEF2 family members, we have now shown in developing cerebral cortical neurons, which coexpress MEF2A, C, and

D, that only MEF2C is required for membrane depolarization-dependent transcriptional activation of Bdnf promoter IV. This selective requirement is not

likely to be due to differential binding of the MEF2s to promoter IV, because we have found that MEF2A, C, and D show a similar affinity for CaRE1 by EMSA

(data not shown), and because in vivo chromatin immunoprecipitation experiments have demonstrated the association of endogenous MEF2D with Bdnf promoter IV in cortex (Hong et al., 2008). Furthermore, the relative importance of

MEF2C may be specific to cortical neurons because dual knockdown of MEF2A and MEF2D in hippocampal neurons was shown in a previous study to impair membrane depolarization-induced expression of Bdnf (Flavell et al., 2008).

Although Flavell and colleagues (2008) did not report whether the effects of their knockdown were selective for exon IV-containing Bdnf transcripts, their data raise the possibility that the functional contributions of the MEF2s to the regulation of Bdnf may be context or cell-type specific. We suggest that one way that selective functions of the MEF2s may arise is as a consequence of their differential sensitivity to activation by membrane depolarization. Although the

MEF2s have similar gene structures, only the Mef2c gene encodes variants that lack the γ domain (Shalizi and Bonni, 2008; Zhu and Gulick, 2004). This difference is relevant to the regulation of activity-regulated genes in neurons because we find that γ-lacking MEF2C variants are the most highly activated of the MEF2Cs upon membrane depolarization. In the developing cortex, Mef2c is by far the predominant Mef2 gene expressed (Figure 14B) and nearly half of the

Mef2c transcripts lack the γ domain. Thus, the heightened sensitivity of γ-lacking

MEF2C variants to L-VGCC activation may be particularly important for coupling the induction of activity-regulated genes like Bdnf to environmental stimuli during cortical development.

Interestingly, although knockdown of MEF2D in cortical neurons had no effect on Bdnf promoter IV regulation, membrane depolarization-dependent induction of Bdnf exon I-containing transcripts was strongly upregulated in neurons that lack this but not other MEF2 family members. It is possible that reducing MEF2D expression enhances the likelihood that γ-lacking forms of

MEF2C get recruited to Bdnf promoter I regulatory elements, thus enhancing membrane depolarization-dependent transcriptional activation. Alternatively, because the MEF2s are known to bind co-repressors as well as co-activators

(Shalizi and Bonni, 2008), it is possible that selective interactions between MEF2D and a transcriptional co-repressor could be important for dampening the transcriptional activity of Bdnf promoter I in developing cortical neurons. This would be particularly interesting because unlike Bdnf promoter IV, which is highly active and inducible in young neurons, Bdnf promoter I is relatively inactive until adulthood, when its inducibility is markedly elevated via unknown mechanisms (Timmusk et al., 1994). Taken together, our data are important because they suggest that variations in the expression of different MEF2 variants, which occurs both during development and in response to certain kinds of stimuli, could change the transcriptional inducibility of important activity- regulated targets such as Bdnf, providing a mechanism for the fine-tuning of neuronal transcription-dependent plasticity.

3. The NMDA receptor subunit NR3A inhibits synaptic activity-induced transcription of Bdnf and limits GABAergic synapse development

3.1 Summary

During brain development, activation of NMDA-type glutamate receptors (NMDARs) plays an essential role in the calcium-dependent induction of gene transcription programs that sculpt synapse development. Changes in

NMDAR subunit composition are known to affect the ability of NMDARs to activate gene expression. Expression of the NMDA receptor subunit NR3A (also known as GluN3A) is highly developmentally regulated with peak levels occurring in the early postnatal period, and incorporation of NR3A into

NMDARs reduces their calcium permeability. Here we identified Grin3a as a potential gene target of the transcription factor Calcium Response Factor (CaRF) and tested the importance of NR3A for NMDAR-dependent activation of gene transcription by knocking down Grin3a expression in cultured rat hippocampal neurons. We find that neurons lacking NR3A show enhanced NMDAR- dependent induction of Brain-Derived Neurotrophic Factor (Bdnf) exon IV, a phenomenon also observed in neurons lacking CaRF. This increase in NMDAR- dependent transcription is accompanied by prolonged activation of the transcription factor Myocyte Enhancer Factor 2 (MEF2), whereas activity- dependent activation of the Calcium/cAMP Response Element binding protein

(CREB) is unaffected. To investigate the cellular consequences of changing

NR3A expression, we examined synapse development in Grin3a knockdown neurons. We find that loss of NR3A leads to a significant increase in the number of GABAergic synapses. Interestingly, we also show that neural activity can

change the expression levels of NR3A such that NR3A expression is highest when synaptic activity is quiescent. Taken together, these data raise the possibility that changes in the expression of NR3A may mediate a form of metaplasticity to alter the threshold for activation of synaptic plasticity-inducing transcriptional programs during brain development.

3.2 Introduction

Mammalian brain development relies on a very complicated genetic program. However, environmental cues – frequently represented in the brain by altered levels of neuronal activity – are also critically important for proper synaptic wiring. In order to understand this complex process, it is important to identify the molecular mechanisms that allow sensory input to be specifically transduced into the appropriate cellular response in neurons. One way in which transient sensory stimuli can result in long-lasting changes in brain function is via activity-regulated gene transcription, which is typically induced by increased calcium levels within the cell. The two most salient modes of calcium entry for signal transduction to the nucleus are L-type voltage-gated calcium channels (L-

VGCCs) and NMDARs (Bading et al., 1993; Ghosh et al., 1994b; Ghosh and

Greenberg, 1995; Lerea et al., 1992). One gene that has been shown to be regulated by both types of stimuli and is of particular interest in studying how sensory experience can shape brain development is Bdnf (Lyons and West, 2011;

West et al., 2002). BDNF has been shown to be critical for numerous neurodevelopmental processes, including learning and memory and synapse development (Loebrich and Nedivi, 2009). Furthermore, the gene Bdnf is itself regulated by neuronal activity, thus placing it in a prime position to regulate

sensory experience- and activity-dependent synapse development (Lyons and

West, 2011; Timmusk et al., 1993).

The Bdnf gene contains nine distinct alternative promoters, however all

Bdnf transcripts encode the same protein (Aid et al., 2007). Alternative promoter usage is thought to facilitate cell type-, region-, and stimulus-specific regulation of Bdnf transcription (Loebrich and Nedivi, 2009; Timmusk et al., 1993). Bdnf exon IV is unique in that it is both the most abundant transcript found in developing neurons and it is also highly responsive to neuronal activity (Lyons and West, 2011; Timmusk et al., 1993). Studies examining transcription factor binding sites within Bdnf promoter IV have identified multiple calcium response elements (CaREs) that are required for the L-type voltage-gated calcium channel

(L-VGCC)-dependent induction of Bdnf expression driven by membrane depolarization (Chen et al., 2003; Lyons and West, 2011; Pruunsild et al., 2011;

Shieh et al., 1998; Tao et al., 2002). CaRF was identified as a binding protein for the CaRE1 element within Bdnf promoter IV (Tao et al., 2002), and levels of Bdnf exon IV mRNA are significantly reduced in the cerebral cortex of Carf knockout

(KO) mice (McDowell et al., 2010). However, cultured Carf KO neurons show normal upregulation of Bdnf exon IV in response to membrane depolarization.

In this study, we show that NMDAR-dependent Bdnf transcription is potentiated by loss of CaRF, indicating that CaRF-dependent regulation of Bdnf is complex and could serve as a mechanism of stimulus-dependent specificity in the Bdnf transcriptional response to neuronal activity. Furthermore, we identify a number of genes important for calcium signaling in neurons as potential targets of CaRF. Among these is Grin3a, the gene encoding the NMDAR subunit NR3A

(also known as GluN3A). NR3A is a particularly interesting NMDAR subunit

because it has been shown to limit calcium influx through NMDARs and decrease sensitivity to magnesium blockade (Das et al., 1998; Sasaki et al., 2002;

Tong et al., 2008). NR3A has been shown to be important in NMDAR trafficking

(Pérez-Otaño et al., 2006) – and therefore also possibility NMDAR localization.

Finally, expression of NR3A is highly regulated by development, with NR3A protein levels peaking in the early postnatal period (Al-Hallaq et al., 2002;

McDowell et al., 2010; Sasaki et al., 2002; Wong et al., 2002). While it has been established for some time that factors such as NMDAR subunit composition or receptor localization can influence which signaling cascades are activated downstream of NMDAR stimulation (Cheng et al., 1999; Hardingham and

Bading, 2003; Martel et al., 2009), whether NR3A might modulate transcriptional events that occur downstream of NMDAR-mediated calcium entry has remained an open question.

Excitingly, we find that loss of NR3A leads to a potentiation in MEF2- dependent transcriptional activation and Bdnf exon IV transcription following

NMDAR stimulation. NR3A is known to be important for normal excitatory synapse development (Das et al., 1998; Roberts et al., 2009), and here we show that NR3A appears to be important for normal inhibitory, GABAergic synapse development as well. Finally, given evidence that Carf and Grin3a are both inversely regulated by altered neuronal activity states, we propose that regulation of NR3A may mediate a form of metaplasticity to alter the threshold for activation of synaptic plasticity-inducing transcriptional programs during brain development. Furthermore, our findings suggest that CaRF is capable of lending a great degree of specificity to stimulus-induced programs of gene

transcription and that, via its gene targets, it might be capable of regulating activity and calcium signaling levels on a global scale within the cell.

3.3 Materials and Methods

3.3.1 Plasmids

Two independent shRNAs were used to knockdown mouse Carf.

“shRNA1” was cloned into vector pLLx3.8 (vector reference PMID: 17610817). shRNA1’s sequence is 5’-GAAGACAGCACCAGCAATTAC-3’. The “Scr” control sequence for the shRNA1 construct is 5′-

AAACAAGCCCATTCGCGGATT-3′. The second shRNA (“shRNA2”) was purchased from Thermo Scientific (Lafayette, CO) and is packaged in the pLKO.1 vector (TRCN0000086260). The empty pLKO.1 vector is used as the contol for shRNA2.

Two independent shRNAs were used to knockdown Grin3a. “shRNA4” was purchased from Thermo Scientific (Lafayette, CO) and is packaged in the pLKO.1 vector (TRCN0000100220). The empty pLKO.1 vector is used as the contol for shRNA4. “shRNA5” was cloned into the pLLx3.8 vector. The sequence of shRNA5 is 5’-GTATCCGGCAGATATTTGAAA-3’. The “Scr” control sequence for the shRNA5 construct is 5′-

GCCTGCAGTATGACTCAGTAA-3′.

The CRE luciferase reporter plasmid was purchased from Stratagene

(Cedar Creek, TX). The MRE luciferase reporter plasmid was previously described (Flavell et al., 2006).

3.3.2 Neuron culture

Neuron-enriched cultures were generated from cortices of male and female E16 CD1 mouse embryos (Charles River Laboratories, Raleigh, NC), from hippocampii of male and female postnatal day 0 (P0) CD1 mice (Charles River), or from hippocampii of male and female E18/19 CD1 rat embryos (Charles

River) as described (McDowell et al., 2010; Tao et al., 2002).

Activity-dependent gene transcription was induced using a variety of stimuli. Withdrawal from tetrodotoxin (TTX; Sigma) was done by treating neurons for a period of 48 hrs with 1 µM TTX prior to either harvesting RNA (for the control condition) or washing out the TTX with plain Neurobasal (NB) medium. Cells were washed twice with plain NB prior to addition of TTX- lacking conditioned media obtained from other wells of untreated neurons. For experiments with channel blockers, blockers were added either to plain NB and conditioned media for TTX withdrawal, or to the KCl solution for depolarization with 55 mM KCl. APV (Tocris; Minneapolis, MN) was used at a concentration of

100 µM. Nimodipine (Sigma) and nifedipine (Sigma) were both used at a concentration of 5 µM. EGTA (Sigma) was used at 2.5 mM EGTA. Bicuculline

(Sigma) was used at 50 µM along with 2.5 mM 4-AP (Tocris) as previously described (Hardingham et al., 2002). Actinomycin D was used at 30 nM (Sigma).

3.3.3 RNA interference (RNAi) and quantitative RT-PCR

For viral infection of neurons, Carf or Grin3a shRNA constructs were packaged as lentiviral particles in HEK 293T cells (ATCC, Manassas, VA).

Cultured mouse cortical neurons or rat hippocampal neurons were infected on

DIV1. For neurons infected with a Grin3a KD virus or corresponding control

virus, 100 µM APV was added to the media at the time of infection to keep cells alive, as loss of NR3A can lead to excitotoxicity (Nakanishi et al., 2009). RNA was harvested on DIV7-10 after 48 hrs treatment with 1µM of the sodium channel inhibitor TTX (Sigma) ± 6 hrs TTX withdrawal in plain Neurobasal media OR exposure to 55 mM extracellular KCl, which activates L-VGCC- dependent transcription of Bdnf (Tao et al., 2002). RNA was used for cDNA synthesis and quantitative SYBR green PCR (ABI, Foster City, CA). Intron spanning primers were used for all genes tested. Gapdh mRNA levels were used as a normalizing control. The PCR primers used were: Gapdh F-

CATGGCCTTCCGTGTTCCT, R-TGATGTCATCATACTTGGCAGGTT; Carf F-

CCGCAAGTAGCGCATAAGAT, R-TCCAGTCCTCAAGGATTTCTG; Bdnf exon

IV F-CGCCATGCAATTTCCACTATCAATAA, R-

GCCTTCATGCAACCGAAGTATG; Grin3a F-TTGGTCTCTCCATCCTGACC, R-

GAACGTGGCTGCTTTTCTTC; Grin1 F-GCTCAGAAACCCCTCAGACA, R-

GGCATCCTTGTGTCGCTTGTAG; Grin2a F-TACTCCAGCGCTGAACATTG, R-

TCAGCTGGACCTGTGTCTTG; Grin2b F-GAGCATAATCACCCGCATCT, R-

AAGGCACCGTGTCCGTATCC; Fos F-TTTATCCCCACGGTGACAGC, R-

CTGCTCTACTTTGCCCCTTCT.

3.3.4 Western blotting

10 µg of nuclear extracts (McDowell et al., 2010), 30 µg of whole cell lysates, or 7 µg of crude membrane fractions (Sasaki et al., 2002) were loaded on

8–10% SDS-PAGE gels for separation and transferred to polyvinylidene fluoride

(PVDF) membrane. After blocking, primary antibodies were incubated for 60 min at room temperature, and secondary antibodies conjugated to HRP (Jackson

ImmunoResearch) were used at 1:10,000. Bands were visualized by reacting blots with ECL (Pierce) and exposing to film. For quantitation, multiple exposures were taken to establish the linear range. Primary antibodies used in this study include rabbit anti-CaRF, 1:500 (#4510, present study); rabbit anti-

Histone H3, 1:5000 (Millipore; catalog #070-690); mouse anti-phospho-S133 cAMP response element binding protein (anti-pCREB), 1:1000 (Millipore, catalog

#05-667); rabbit anti-cAMP response element-binding protein (anti-CREB), 1:1000

(Millipore; catalog #06-863); rabbit anti-NR3A, 1:1000 (Millipore; catalog #07-

356); mouse anti-NR1, 1:1000 (Affinity Bioreagents; catalog #OMA1-04010).

3.3.5 Microarrays

Cortical neurons were dissociated from brains of male and female E16

CD1 mouse embryos (Charles River Laboratories, Raleigh, NC) and cultured in

Neurobasal medium plus B27 supplements. Neurons were infected with either

Carf shRNA-containing lentiviruses or scrambled control viruses on day in vitro

(DIV) 1. Also on DIV1, 5µm AraC was added to block glial proliferation. On

DIV6 neurons were treated overnight with 1µm TTX. The next day neurons were left untreated or they were membrane depolarized for 6 hours with 55 mM extracellular KCl. For microarray experiments, total RNA was purified using

RNeasy mini kits (Qiagen) and biotin-labeled cRNA was generated following

Affymetrix standard protocols. Ten micrograms of the labeled cRNA was hybridized to Affymetrix mouse MOE430 arrays.

All raw CEL files obtained from the Affymetrix Mouse Genome 430 2.0 array were processed and normalized on a log scale using RMA Express

(Bolstad, 2003; Bolstad et al., 2003; Irizarry et al., 2003a; Irizarry et al., 2003b).

They were then altered by hand to conform to the .gct matrix format with 18 different experiments as columns and 45,101 probes as rows. The microarray data was split into two groups. The control group contained depolarized (3 samples) and non-depolarized (3 samples) scrambled control-infected cortical neurons. Another group, representing a decrease in CaRF, contained depolarized (3 samples) and non-depolarized (3 samples) Carf shRNA-infected cortical neurons. Although there are significant differences between the depolarized and non-depolarized system, we believe a high quality subset of the gene sets strongly affected by CaRF could be found by pooling these different types of data. A heat map was produced showing the 100 most significantly altered genes in Carf KD neurons as compared with scrambled controls, as determined by the t-statistic (see Table 2 in Appendix A).

Gene Set Enrichment Analysis (GSEA) was used to analyze the microarray data with respect to entire annotated sets of genes that represent biologically relevant clusters (Subramanian et al., 2005). One group of gene sets represents known biological pathways compiled by various online databases. A second group of gene sets was compiled based on having a particular sequence motif, most likely representing a transcription factor binding site, in the promoter. The default, a signal to noise metric defined as the difference of the means divided by the sum of the standard deviations of the two different groups

(scrambled control vs. Carf shRNA) (Subramanian et al., 2005), was used by

GSEA to rank the genes based on differing expression values between the control and Carf knockdown group (see Table 3 in Appendix B). Using other metrics, including t-statistics, available in the program yielded similar results. Interesting individual genes were selected out of the top 250 in terms of signal to noise

100

metric. To calculate the significance of a gene set, such as a pathway or motif,

GSEA uses random walk statistics on the ranked list of genes (Subramanian et al.,

2005).

In addition to the GSEA analysis, we used gene ontology analysis to look for overrepresented functions in potential CaRF targets. This analysis was performed using GOstat (Beissbarth and Speed, 2004) on the top 250 and then the bottom 250 genes in this ranking versus the set of entire genes that were ranked in the program. This set is limited to genes that have a corresponding probe on the MOE430_2 microarray chip and also excludes probes in the microarray dataset that do not have a corresponding gene. In total 14,723 genes were available for this search.

To analyze the microarray data for the creation of the heat map, produce a ranked list of Carf KD versus scrambled control, and produce a ranked list of stimulated versus unstimulated cultured neurons, a linear model was created, where the gene expression Y was explained by:

Y = AKCLIKCL + AN IN + ASCRISCR + AKDIKD

where I represents indicator variables where IKCL = 1 when the neurons were stimulated, IN = 1 when the neurons were unstimulaed, ISCR = 1 when the neurons were infected with a scrambed control virus, and IKD = 1 in the Carf KD samples.

ACONDITION are the estimated coefficients of these variables. To create the heat map, the contrast is performed on the ASCR - AKD. The ranked set of stimulus- dependent gene expression is created by subsetting the data to include only SCR or KD samples and then performing the contrast AKCL - AN. After the ranked lists

101

were generated, a Wilcox rank sum test was used to compare the ranks of transcripts that belong to certain group of genes versus transcripts that do not.

The PCR primers used to validate some of the genes identified in the gene array were: Efcbp1 F-CAGAAGCTCTCAAACGAATCTC, R-

CATGGTAGATGTGAGCTCTGGA; Kcnip2 F-TCAGTGATTCTTCGGGGAAC,

R-GGCAGGGTAGGTGTACTTGC; Trpc1 F-ATGGATTTGCTCGCATACCT, R-

GTGCTCTGCATCTTCTGTCG; Htr2c F-GTTCAATTCGCGGACTAAGG, R-

AAGTTCGGGTCATTGAGCAC; Gabra1 F-CCCAATGCACTTGGAAGACT, R-

AAACGTGACCCATCTTCTGC.

3.3.5 Calcium phosphate transfection and luciferase assays

For luciferase assays, neurons were transfected with calcium phosphate

(Tao et al., 2002). Cotransfection of TK-renilla luciferase (Promega, Madison, WI) was used to control for transfection efficiency and sample handling. Lysates were harvested on DIV9-10 after 48 hrs treatment with 1µM of the sodium channel inhibitor TTX (Sigma) ± 0, 4, 6, 8, 14, or 22 hrs TTX withdrawal in plain

Neurobasal media. Luciferase activity was determined using the Dual-

Luciferase® Reporter Assay System (Promega; Madison, WI) and a Veritas microplate luminometer (Turner BioSystems).

3.3.6 Immunoctyochemistry

To verify viral infection efficiency in embryonic mouse cortical neurons, cells were cultured at normal density on glass coverslips (Bellco; catalog #1943-

10015) and fixed in a 4% paraformaldehyde solution at DIV5. A mouse anti-

MEF2D antibody (1:1000; BD Biosciences; catalog #610774) was used to identify neurons in the cultures. Infection efficiency was estimated based on percentage

102

of MEF2D-positive cells that were also GFP-positive (indicating infection with a pLLx3.8 lentivirus).

For GABAergic synapse quantification, embryonic rat hippocampal neurons were cultured at low density on glass coverslips. To study the effects of single-cell NR3A KD on GABAergic synapses, we used Lipofectamine 2000

(Invitrogen; catalog #11668-027) transfection to deliver the Grin3a shRNA into a small subset (about 1-3%) of cultured neurons. We cotransfected a GFP construct to label transfected cells and counted synapses on single transfected cells in a background of nontransfected cells. Neurons were fixed in a 4% paraformaldehyde/4% sucrose solution, and then immunostained with antibodies raised against GAD65 (1:500; Millipore; catalog #MAB351) and the

GABAA receptor subunit γ2 (1:500; Millipore Bioscience Research Reagents; catalog #AB5954). Samples were imaged on a confocal microscope, and the number of GABAergic synapses (defined as colocalized punctae of pre- and postsynaptic markers) were counted and compared to control transfected neurons. An investigator blind to the genetic manipulation of each coverslip of neurons took the pictures, and quantification was done in ImageJ using the same preset parameters across all treatments within one experiment.

3.3.7 Pilocarpine-induced seizure

Seizure was induced by pilocarpine injection as previously described

(Okazaki et al., 1995). Briefly, adult (8-12 week old) wildtype C57BL6/J mice were weighed, then injected with 1 mg/kg methyl scopolamine nitrate intraperitoneally (i.p.). 30 minutes later mice were injected with either 337 mg/kg pilocarpine HCl or saline (control mice) i.p. (both scopolamine and

103

pilocarpine were diluted in 0.9% injectable NaCl). Stock solutions were prepared such that each animal received 0.1 cc of drug. Scopolamine was administered to reduce the peripheral side effects of pilocarpine and the risk of death upon pilocarpine injection. Following pilocarpine injection, animals were monitored for status epilepticus (defined as a continuous limbic motor seizure of stage 2 or higher). Status epilepticus was allowed to proceed for 3 hours and then was terminated by administration of diazepam (10mg/kg, i.p.). Pilocarpine-treated animals that failed to develop or did not survive status epilepticus were excluded from the study. At various times after pilocarpine-induced status epilepticus (1 hours – 6 hours after the initiation of the seizure by pilocarpine injection), animals were anesthetized with isofluorane and sacrificed by decapitation prior to tissue harvesting. Control mice were never given diazepam and were sacrificed 3 hours after receiving scopalamine. Following decapitation, hippocampii were dissected out as previously described (McDowell et al., 2010) and RNA was isolated and analyzed by quantitative RT-PCR as described above.

3.3.8 Statistical analyses

Unless otherwise indicated, all data presented are the average of at least three measurements from each of at least two independent experiments. Also unless otherwise indicated, data were analyzed by a Student’s unpaired t-test, and p<0.05 was considered significant. Time courses were analyzed by one- or two-way analysis of variance (ANOVA), as indicated, using SPSS v11.0 statistical software (SPSS, Chicago, IL). Bar and line graphs show mean values and all error bars show S.E.M.

104

3.4 Results

3.4.1 NMDAR-dependent Bdnf exon IV transcription is potentiated in CaRF-deficient neurons

3.4.1.1 Generation of two Carf shRNA-containing lentiviruses

We have previously found that, while basal levels of Bdnf exon IV mRNA are significantly reduced in the cerebral cortex of Carf KO mice, cultured Carf KO neurons show normal upregulation of Bdnf exon IV in response to membrane depolarization (McDowell et al., 2010). Based on these findings, we decided to acutely ablate CaRF, in order to rule out or eliminate any compensatory processes that could be occurring in the constitutive Carf KO neurons.

In order to be able to study the effects of acute CaRF loss, we generated two different shRNA-containing lentiviruses to knockdown Carf in neurons in vitro. The two shRNAs target independent sites within the Carf mRNA sequence, and are packaged in two different viral vectors – pLLx3.8 (shRNA1) and pLKO

(shRNA2). For shRNA1, we used a randomly scrambled shRNA-containing pLLx3.8 construct as a control. For shRNA2, we used the empty pLKO vector as a control. To test infection efficiency, neurons infected with either the scrambled control-containing pLLx3.8 virus or the Carf shRNA1-containing pLLx3.8 virus were co-stained with a MEF2D-specific antibody to label all neurons (Figure

16A). Because the pLLx3.8 vector contains a GFP construct, we are able to determine infection efficiency visually. We typically see roughly 90 to 95% infection efficiency (Figure 16A). Furthermore, we see robust knockdown of Carf mRNA (Figure 16B) and CaRF protein (Figure 16C) with both shRNAs. One thing to note is that there are actually four bands that are labeled with the anti-

CaRF antibody on a Western blot. We suspect that these might be different

105

!" %&'"&()*'(+"""" " """"""""""""""""""$,'-"./01!"

#" $" :" (#$" :" ./0"/123014" (" 5607"89" 201!" % !#'"

!"#$ !#&" !#%" !#$"

1('2,+3456" !" )*+,-(" )*+,-$" ./01!"3)-5&*56"

106

splice variants of the CaRF protein, although we do not know for certain. The important thing, however, is that all four bands are nearly completely eliminated by infection with a virus containing either Carf-specific shRNA.

3.4.1.2 Tetrodotoxin withdrawal is an NMDAR-dependent stimulus that leads to CREB phosphorylation and increased transcription of Bdnf exon IV

We found that membrane depolarization-induced Bdnf exon IV transcription was not statistically different in Carf KD neurons as compared with controls (data not shown), consistent with what we observed in Carf KO neuron cultures (McDowell et al., 2010). Given that Carf-deficient neurons have reduced basal Bdnf exon IV levels, but exhibit normal L-VGCC-induced Bdnf exon IV transcription, we asked whether NMDAR-dependent Bdnf induction might be altered in Carf-deficient neurons.

In order to study NMDAR-dependent gene transcription in Carf-deficient neuron cultures, we used withdrawal from the sodium channel blocker tetrodotoxin (TTX) to stimulate NMDAR activity. It has previously been shown that washout of TTX from neuron cultures that have been pre-treated with the channel blocker for 48 hrs leads to robust Activity-regulated cytoskeletal protein

(Arc) induction in an NMDAR-dependent manner (Rao et al., 2006). We first tested whether TTX withdrawal is also capable of inducing Bdnf exon IV transcription (Figure 17A). Next, in order to determine what mode of calcium entry is important for Bdnf exon IV induction following TTX withdrawal, we also performed TTX withdrawal in the presence of the NMDAR blocker APV, the L-

VGCC blocker nimodipine, or both blockers combined (Figure 17A). Both TTX withdrawal and treatment with 55 mM KCl lead to robust induction of Bdnf exon

IV transcription. However, only TTX withdrawal is significantly reduced by the

107

!" 0"

'#!" 667"89:" 667"89:" 1" 2" ;<+" '!!"

.&-("'/" """"=<>?(" &!"

!"#$% @" %!"

$!" A" """"""<>?(" @" #!" A" #"$%&"'()*+,-(" @" !" ()*)+" ,-." /,-.0123" /,-.045."/,-.0104"

Importantly, Bdnf exon IV induction in response to both stimuli is completely blocked by treatment with a combination of APV and nimodipine (Figure 17A).

These results indicate that, while TTX withdrawal relies primarily on NMDAR activation, there is a small but significant component that depends on L-type channel activation. Nonetheless, these data indicate that withdrawal from TTX is a suitable stimulus to study NMDAR-dependent gene transcription.

108

Numerous studies have shown that activation of the transcription factor

CREB is both induced by various forms of neuronal activity, as well as required in many cases for induction of Bdnf exon IV transcription. In order to determine whether withdrawal from TTX leads to phosphorylation of CREB at serine 133

(Ser133), we performed Western blots on lysates from cultured rat hippocampal neurons that had been withdrawn from TTX. We see that TTX withdrawal leads to an increase in CREB phosphorylation at Ser133, while total levels of CREB protein remained unchanged (Figure 17B). These data indicate that, following stimulation of NMDARs by TTX withdrawal, the transcription factor CREB can be turned “on” by phosphorylation at Ser133.

3.4.1.3 Bdnf exon IV induction following tetrodotoxin withdrawal is potentiated in CaRF knockdown neurons

We next tested whether NMDAR-dependent Bdnf exon IV transcription is altered in neurons deficient for CaRF. We cultured embryonic mouse cortical neurons for 6 or 7 DIV. TTX was added to culture media on DIV4 or 5, and neurons were withdrawn from TTX for 6 hours prior to harvesting on DIV6 or 7.

Samples were analyzed by RT-PCR for Bdnf exon IV induction. To our surprise, we found that Bdnf exon IV induction in response to TTX withdrawal was significantly potentiated in Carf KD neurons (Figure 18). This effect was evident with both shRNAs against Carf. This result is surprising, given that CaRF was originally identified as an activity-dependent activator of Bdnf promoter IV.

Furthermore, we have already shown that basal Bdnf exon IV levels are reduced in the brains of Carf KO mice as compared littermate controls (McDowell et al.,

2010). Additionally, it has also been shown that L-VGCC-dependent Bdnf exon

IV induction is not affected by loss of CaRF (McDowell et al., 2010). Taken

109

.**" 889" !" -+*" 889"):(" #"

-**"

,+*"

,**"

+*" !"#$"%&'$"()#'"*+",'&-./#'",'"0123"4" *" /012"," /012"-" 34567"," 34567"-" !"#$%$%&'$(&)%"

Figure 18: TTX withdrawal-dependent Bdnf exon IV induction is potentiated in Carf KD neurons. Cultured embryonic mouse cortical neurons were infected with the indicated lentiviruses and treated with 1 µM TTX on DIV4 ± 6 hrs TTX withdrawal (TTX w/d) on DIV6. Samples were analyzed for Bdnf exon IV induction by quantitative RT-PCR. n = 3. Error bars represent S.E.M. *p<0.05 shRNA 1 TTX w/d vs. Ctrl 1 TTX w/d. #p<0.05 shRNA 2 TTX w/d vs. Ctrl 2 TTX w/d. together, these findings indicate that CaRF-dependent regulation of Bdnf exon IV expression is complex and that CaRF could serve as a molecular mechanism of stimulus-dependent specificity in the regulation of this important gene.

3.4.2 The gene Grin3a, which encodes the NMDAR subunit NR3A, is a potential target of CaRF

We have shown that NMDAR-dependent Bdnf exon IV transcription is potentiated in Carf KD neurons. Given that CaRF is a transcription factor that can potentially regulate the expression of a large number of genes, we hypothesized there might be gene targets of CaRF whose protein products are important for NMDAR-dependent gene transcription. To examine this, we performed Affymetrix gene arrays on Carf KD neurons and compared the results to arrays run on scrambled control virus-infected neuron cultures (Figure 19A).

110

To analyze the arrays, a linear model was constructed comparing neurons infected with the scrambled control virus to the Carf KD virus under both the control and depolarized conditions (see Materials and Methods). Using an adjusted p-value of 0.05 as a threshold to rule out false discoveries, no transcripts were determined to be significant. We believe this was due to the low number of replicates and differences in the Carf KD efficiency across samples. However, if we use a non-adjusted p-value, we are able to detect many genes whose expression is significantly altered by Carf KD in our neuron cultures. Looking at the top 100 genes most altered in either direction in their expression level by loss of CaRF, we observed a clear bias towards a decrease in gene expression (69 transcripts versus 31 transcripts; see Table 2 in Appendix A for a list of these genes), suggesting that while CaRF is capable of acting as both a transcriptional activator and a transcriptional repressor, it functions as an activator more frequently than it acts as a repressor.

To determine whether there are any pathways or cellular functions particularly affected by loss of CaRF function, we performed Gene Set

Enrichment Analysis (GSEA) to look for gene sets that are significantly altered in

Carf KD neurons. We found that a Wnt/calcium signaling pathway and a GABA signaling pathway both had a number of gene members altered in the Carf KD neurons as compared with controls. We next used a second statistical method of analysis to attempt to validate our results obtained by GSEA. To do this, we created a list of the top 250 genes most reduced in expression in Carf KD neurons as determined by the signal:noise ratio of the differences between Carf KD neurons and the scrambled control group (see Table 3 in Appendix B for a list of these genes). Upon analysis of this list of genes by gene ontology, we identified a

111

/" 69 Decreasing Decreasing 69 31 Increasing Increasing 31

!" #"

Grin3a (" Efcbp1

'.$/" !#'" Kcnip2 4 CamkIId !#&"

Trpc1 !"#$%&' 4 CamkIIa !#%" Htr2c !#$" Gabra2 Gabra1 $%&'()*+,-" !" )*+,-*." /0123(" /0123$" !#$" !#%" !#&" !#'" (" 012&,33*%4"*4"(&")'56"&,)(78,"9%":;&";%49&%)"

112

are labeled as blue for a decrease in the Carf KD and red for an increase with the "Color Key" giving the log fold change of the color intensities. Each transcript is normalized to the control conditions and scrambled control virus. The light blue line in the color tree shows a histogram of various expression changes. (B) Validation of a selected number of genes from the CaRF array. Cultured embryonic mouse cortical neurons were infected with either a Carf shRNA-containing (KD) or a scrambled control (WT) lentivirus. Expression of the indicated endogenous mRNA levels were validated by quantitative RT- PCR. Genes important for calcium signaling include Kcnip2, Trpc1, Efcbp1, Camk2a, Camk2d. Genes encoding neurotransmitter receptors include Gabra1, Gabra2, Htr2c, Grin3a. n = 6. (C) Validation of Grin3a mRNA reduction in CaRF KD neurons. RNA from cultured neurons infected with the indicated lentiviruses were analyzed for Grin3a expression by quantitative RT-PCR. n = 4-6. Error bars represent S.E.M. *p<0.05 shRNA vs. control. number of genes whose protein products are annotated as being important for calcium signaling pathways in neurons. These results agree with and lend further credence to our earlier findings from GSEA.

Taken together, our results indicate that CaRF can regulate a set of gene targets important for neuronal excitability and calcium signaling in neurons, including proteins that are capable of directly binding calcium ions, ligand-gated ion channel subunits, and members of the Ca2+/calmodulin-dependent protein kinase II (CaMKII) family. These results suggest that CaRF could potentially function in a homeostatic feedback loop, whereby activity can regulate the transcriptional activation of CaRF, which then affects the transcription and subsequent expression of various calcium signaling molecules, thus regulating the overall activity levels of the cell. To validate that some of the top candidates of the array were changing in response to Carf KD, we performed RT-PCR to test for the expression levels of several genes identified in the array in Carf KD neurons. We found that the expression levels of several genes in CaRF-deficient neurons were statistically significantly different from controls (Figure 19B).

Among these genes, we identified Grin3a, which encodes the NMDAR subunit NR3A (also known as GluN3A). We validated that expression of the

113

gene Grin3a was significantly decreased in Carf KD neurons with both Carf shRNAs (Figure 19C). The possibility that the transcription factor CaRF could regulate the expression of the gene Grin3a is very intriguing, given that we have already shown that NMDAR-dependent gene transcription is altered in CaRF deficient neurons, thus providing a potential mechanism for this phenomenon.

Taken together, these results suggest that NR3A itself could have an important modulatory role in NMDAR-dependent programs of gene transcription.

3.4.3 NMDAR-dependent Bdnf exon IV transcription is potentiated in NR3A-deficient neurons

3.4.3.1 Generation of two Grin3a shRNA-containing lentiviruses

In order to determine whether NR3A plays a role in NMDAR-dependent gene transcription, we first generated lentiviruses to deliver shRNAs against

Grin3a. We used two different shRNAs, which target independent sites in the gene, to knock down Grin3a. We found that both shRNAs were highly efficacious in knocking down Grin3a mRNA levels (Figure 20A). Additionally, we ran Western blots on membrane fractions from neurons infected with the shRNA4-containing lentivirus to verify protein knockdown. We found that, as compared with controls, NR3A protein is nearly completely absent in Grin3a KD neurons (Figure 20B). Importantly, we do not see a change in the protein expression levels of the NR1 subunit, indicating that the shRNA against NR3A is both specific and that there is no compensation. These data indicate that we can effectively eliminate the vast majority of NR3A protein with our shRNAs against

Grin3a.

114

!" #" A% A% ,.-% !"#$% !"#$% &'()%*+% ,--% &'()%*+% 1-% %%%%%&'()% 0-% /-% .-%

&5#67$89:;%<#8=(7%>?@% -% %%%%%%%&',% 23'&)%/% 23'&)%4%

3.4.3.2 Bdnf exon IV induction following tetrodotoxin withdrawal is potentiated in NR3A knockdown neurons

NMDAR-dependent Bdnf exon IV transcription is potentiated in CaRF- deficient neurons, and our earlier results indicate that Grin3a might be a target of

CaRF. Furthermore, it is known that NR3A is capable of reducing calcium influx through NMDARs (Das et al., 1998; Sasaki et al., 2002; Tong et al., 2008). These findings suggest that neurons deficient for NR3A might also show potentiated

NMDAR-dependent gene transcription. We found that following knockdown of

NR3A with two independent shRNAs, Bdnf exon IV transcription following TTX withdrawal is indeed significantly potentiated (Figure 21A,B). These data suggest that, in Carf KD neurons, the concomitant reduction in NR3A expression levels could be responsible for the potentiation of NMDAR-dependent Bdnf exon

IV induction. Furthermore, these data are exciting and novel because this is the first evidence that the NMDAR subunit NR3A is capable of exerting a unique

115

/% 0% 6" '!" 6" $'" &#" $%" &!" $!" 112" 112" %#" 8" 112"345" 112"345" %!"

&'"(%)*%+($,-."(% 7" &'"(%)*%+($,-."(% $#" '" !"#$% !"#$% $!" %" #" !"#$% !"#$% !" !" ()*+"'" ,-./0"'" ()*+"#" ,-./0"#"

Figure 21: TTX withdrawal-dependent Bdnf exon IV induction is potentiated in Grin3a KD neurons. (A) Cultured embryonic rat hippocampal neurons were infected with either Grin3a shRNA 4-containing or control (Ctrl) lentiviruses. Cells were treated with 1 µM TTX on DIV7 ± 6 hrs TTX withdrawal (TTX w/d) on DIV9. Samples were analyzed for Bdnf exon IV induction by quantitative RT-PCR. n = 9-18. (B) Cultured neurons were infected with either Grin3a shRNA 5-containing or control (Ctrl) lentiviruses. Cells were treated as described in part A and samples were analyzed for Bdnf exon IV induction. n = 3. Error bars represent S.E.M. *p<0.05 shRNA TTX w/d vs. Ctrl TTX w/d. effect on activity-dependent gene transcription. Specifically, our data suggest that NR3A might actually function to limit activity-induced gene transcription following NMDAR activation.

3.4.3.3 Bdnf exon IV induction is not altered following L-VGCC activation in NR3A knockdown neurons

In order to verify that the effects of Grin3a KD on NMDAR-dependent

Bdnf exon IV induction are specific to NMDAR-dependent stimuli, and not a result of a more general, global effect on gene transcription, we stimulated neurons with 55 mM KCl, a stimulus known to activate gene transcription in anL-VGCC-dependent manner (Figure 17A). We found that Bdnf exon IV induction following 6 hours of KCl treatment was not statistically different in neurons that had been infected with the NR3A shRNA-containing virus as

116

&!" ./,0" %#" 12&3"45" %!" $#" &'"(%)*%+($,-."(% $!"

!"#$% #"

!"#$% !" ##"'6"4.0" !"'()"%%7% %%%%%%8%%%%%*"+,-" /,01."(%"2%34#%50&156&(5% Figure 22: Membrane depolarization-dependent Bdnf exon IV induction is normal in Grin3a knockdown (KD) neurons. Cultured embryonic rat hippocampal neurons were infected with either Grin3a shRNA 4-containing or control (Ctrl) lentiviruses. Cells were treated with 55 mM KCl for 6 hrs on DIV9. Samples were analyzed for Bdnf exon IV induction by quantitative RT-PCR. Error bars represent S.E.M. n = 6-9. compared to control neurons (Figure 22). These data indicate that Grin3a KD selectively affects NMDAR-dependent signaling to the nucleus, rather than altering the inducibility of gene transcription on a more global scale.

3.4.3.4 Potentiation of Bdnf exon IV induction in NR3A-deficient neurons is both NMDAR- and transcription-dependent

To further establish that the effects of Grin3a KD on Bdnf exon IV induction rely specifically on NMDAR activation, we withdrew control or Grin3a

KD neurons from TTX in the presence of various channel blockers. We found that APV is capable of completely blocking the relative increase in Bdnf exon

IVtranscription following TTX withdrawal in Grin3a KD neurons as compared with controls (Figure 23A). We found that the L-VGCC blocker nifedipine is also capable of reducing TTX withdrawal-induced levels of Bdnf exon IV, although this effect is not statistically significant. Importantly, in the presence of both blockers combined all detectible increases in Bdnf exon IV following TTX withdrawal were abolished (Figure 23A).

117

'($)"*+",)&-./$)" :!" %!" E" !"#$% $!" #$%&" D" E" !" &&'"234" &&'"0" &&'"234"1" &&'"234"-".=>"1" &&'"234"-"?@A"1" &&'"234"-"BC0*"1" """"""".=>" 0" 0" 1" 0" 1" """"8@AF4G" 0" 0" 0" 1" 1" !" %!" 60+7" $#" 89:.";1"

$!" '($)"*+",)&-./$)" %

!"#$ #"

#$%&" D" E" !" &&'"234&&'"()"*+,"" 0" &&'"()"*+,"0" &&'"234"5"1" &&'"234"5"1" """"""./01" 0" -./01"1" *+,"0" *+,"-"./01"1"

Figure 23: Potentiation of TTX withdrawal-mediated Bdnf exon IV induction in Grin3a knockdown (KD) neurons is NMDAR- and transcription-dependent. Cultured embryonic rat hippocampal neurons were infected with either Grin3a shRNA 4- containing or control (Ctrl) lentiviruses. Cells were treated with 1 µM TTX on DIV7 ± 6 hrs TTX withdrawal (TTX w/d) on DIV9. Samples were analyzed for Bdnf exon IV induction by quantitative RT-PCR. (A) TTX withdrawal was done in the presence of 100 µM APV, 10 µM nifedipine, or both, as indicated. n =3. (B) Cells were treated with the transcriptional inhibitor actinomycin D (ActD; 30 nM), as indicated. n =3. Error bars represent S.E.M. *p<0.05 TTX w/d in Ctrl vs. in the presence of indicated blockers. #p<0.05 TTX w/d in Grin3a KD vs. in the presence of indicated blockers.

118

To determine whether the potentiated Bdnf exon IV induction we observe in Grin3a KD neurons following TTX withdrawal is dependent upon an increase in active gene transcription, we withdrew control or Grin3a KD neurons from

TTX in the presence or absence of the transcriptional inhibitor actinomycin D

(Figure 23B). We found that actinomycin D completely blocked TTX withdrawal-dependent Bdnf exon IV induction in both Grin3a KD neurons and control neurons. Taken together, these data indicate that in neurons deficient for

NR3A, Bdnf exon IV induction is potentiated following TTX withdrawal in an

NMDAR- and transcription-dependent manner.

3.4.4 MEF2 transcriptional activity is potentiated in NR3A knockdown neurons

Clearly, there is some signaling cascade capable of transmitting information from the synapse to the nucleus that is differentially activated in

Grin3a KD neurons as compared with controls. One way to begin to elucidate what signaling mechanisms might be mediating the potentiation in Bdnf transcription that we see in neurons deficient for NR3A is to study the relative activation levels of different transcription factors known to regulate Bdnf promoter IV.

To begin to address this, we transfected control or Grin3a KD neurons with luciferase reporter plasmids containing either the CREB binding site (CRE) or MEF2 binding site (MRE). Interestingly, we found that while CREB activation is not significantly different in Grin3a KD neurons as compared with controls

(Figure 24A), MEF2 activation is significantly potentiated (Figure 24B). These data further substantiate the idea that only select signaling cascades are potentiated in neurons deficient for NR3A, and suggest that MEF2 could be at

119

<+ =0>+ &"$# -.(/# &"!# 0123#45#

%"$#

%"!#

!"$#

!"#$%&'()*+,'#)-./0)1'&&%+ !"!# !#'()# *#'()# +#'()# ,#'()# %*#'()# &!#'()# 23#%4"1+"5+6'78*#%6%&+5#"$+99:+ ;+ ?0>+ %!# 6# -.(/# 6# ,# 0123#45#

!"#$%&'()*+,'#)-./0)1'&&%+ !# !#'()# *#'()# +#'()# ,#'()# &&#'()# 23#%4"1+"5+6'78*#%6%&+5#"$+99:+

120

least one of the transcription factors responsible for the increase in Bdnf exon IV mRNA that we see following TTX withdrawal in Grin3a KD neurons.

3.4.5 NR3A knockdown neurons exhibit an exuberance of GABAergic synapses

It has been shown that activity-dependent Bdnf exon IV transcription is important for GABAergic synapse formation (Hong et al., 2008). Additionally,

NR3A has been shown to be important for glutamatergic synapse development

(Das et al., 1998; Roberts et al., 2009). Given these two pieces of information, we hypothesized that the increased levels of Bdnf exon IV mRNA that we see in

Grin3a KD neurons following NMDAR stimulation might lead to increased

GABAergic synapse formation. To address this, we cultured embryonic rat hippocampal neurons at low density on glass cover slips, transfected them with either shRNA-containing or control plasmids at DIV5, and fixed and stained

them after 21 DIV. We used antibodies against the GABAAγ2 subunit (a postsynaptic marker) and GAD65 (a presynaptic GABAergic marker) to identify

GABAergic synapses (Figure 25A). Additionally, neurons were co-transfected with a GFP-encoding plasmid in order to identify transfected neurons. Synapses were defined as points of colocalization of pre-and postsynaptic markers, and the number of synapses touching a GFP-labeled dendrite were quantified as a function of units of dendrite length. Following quantification, we found that

Grin3a KD neurons have a significantly higher number of GABAergic synapses per unit of dendrite length as compared to controls (Figure 25B). These data suggest that NR3A's effects on gene transcription could be a regulatory mechanism in the activity-dependent control of GABAergic synaptogenesis.

121

!" #"

!1&&'2&&'34567' 4+8++9:' 4+;<=' >?1%&@A' 5" +" *" )"

!"#$%"&' (" '" &" %" $"

$!#!%&'()"*+,-.*%*/01"23" #" !" ,-./" 01%2"34" ()*+',#"-./"0#'

3.4.6 Expression of Carf and Grin3a is inversely regulated by changes in neuronal activity

3.4.6.1 Carf and Grin3a are inversely regulated by alterations in neuronal activity in vitro

It has previously been shown that CaRF and NR3A are regulated at the level of expression over developmental time, with expression of both peaking in the early postnatal period (Al-Hallaq et al., 2002; McDowell et al., 2010; Sasaki et al., 2002; Wong et al., 2002). Additionally, our data and other previously published studies indicate that CaRF and NR3A are both important for normal synapse development (Das et al., 1998; McDowell et al., 2010; Roberts et al., 2009).

However, it is well known that synapse formation is not only developmentally-

122

regulated, but can also be influenced by changes in neural activity. These findings raise the question of whether CaRF and NR3A might be regulated by changes in neuronal activity. While there is evidence that the transcriptional activity of CaRF can be regulated in a neuron- and calcium-selective manner (Tao et al., 2002), and that the localization and surface expression of NR3A can be altered in response to neuronal activity (Pérez-Otaño et al., 2006), it has never been shown whether the expression of either CaRF or NR3A is sensitive to changes in activity.

To determine whether the expression of these two genes might be regulated in response to changes in neuronal activity, we treated cultured rat or mouse hippocampal neurons with either EGTA or TTX to silence either calcium signaling or evoked synaptic activity in neurons, respectively. We then used KCl or bicuculline and 4-AP treatment to increase either depolarization-dependent calcium signaling to the nucleus or evoked synaptic activity, respectively.

Interestingly, we find that expression of both Carf and Grin3a mRNA is inversely regulated by changes in neuronal activity (Figure 26). In response to both EGTA and TTX treatment, we find that Carf mRNA levels are significantly upregulated.

While both EGTA and TTX lead to upregulation of Grin3a mRNA, only EGTA treatment leads to a statistically significant increase. One possible explanation for this is that the moderate levels of calcium signaling that are still present during TTX treatment (as a result of spontaneous neurotransmitter release and subsequent calcium influx) are sufficient to keep Grin3a levels slightly lower.

Conversely, we find that treatment with either 55 mM KCl or a combination of bicuculline and 4-AP lead to significant downregulation of both

Carf and Grin3a mRNA. Taken together, these data indicate that in vitro stimuli

123

'" !"#$% >" &#$" &#'()"% =" &" ="

%#$"

%" >"

!"#$%&'()%*+$,-."+% >" =" !#$" ="

!" ()*+" ,-./" ..0" 1(+" 23454" !"#$"%&"'% ()#$"%&"'% 675*869+"94:;3)<" 675*869+"94:;3)<"

Figure 26: Carf and Grin3a are inversely regulated by neuronal activity in vitro. RNA was harvested from cultured hippocampal neurons after the following treatments: Ctrl – no treatment; EGTA – 6 hrs 2.5 mM EGTA; TTX – 24-48 hrs 1 µM TTX; KCl – 6 hrs 55 mM KCl; Bicuc – 3 hrs 50 µM bicuculline + 2.5 mM 4-AP. EGTA, TTX, and KCl treatments were done in embryonic rat hippocampal neurons at DIV 7-9; bicuculline/4-AP treatments were done in P0 mouse hippocampal neurons at DIV 16. Samples were analyzed by quantitative RT-PCR for either Carf or Grin3a induction. n = 3-27. Error bars represent S.E.M. *p<0.05 indicated treatment vs. Ctrl for Carf. #p<0.05 indicated treatment vs. Ctrl for Grin3a. are capable of regulating the expression levels of Carf and Grin3a in a manner that is inversely related to neuronal calcium signaling. These results lend further credence to the idea that Grin3a could be a potential target of CaRF, given that

Grin3a levels are highest when Carf levels are highest and vice versa.

Additionally, these data indicate that CaRF and NR3A might be important homeostatic regulators of neuronal calcium signaling and developmental synaptic metaplasticity.

124

3.4.6.1 Carf and Grin3a are both downregulated by seizure in vivo

We next asked whether our findings that Carf and Grin3a are inversely regulated by neuronal activity would be substantiated in response to neuronal stimuli in vivo. To test this, we induced seizure by pilocarpine injection in mice, harvested RNA from brain tissue, and analyzed samples by RT-PCR. We found that, similar to our findings in vitro, Carf and Grin3a are both downregulated over the course of several hours in response to seizure induction (Figure 27A). To verify that this downregulation is specific to these genes, we examined the expression levels of other NMDAR subunit-encoding genes. We found that neither Grin1, Grin2a, nor Grin2b are significantly altered in their expression levels in response to seizure over the time course that we examined (Figure 27B).

Finally, as a control, we examined Bdnf exon IV and Fos induction in our samples

(Figure 27C). It is well established that both of these genes are significantly upregulated in response to seizure in the brain (Morgan et al., 1987; Poulsen et al.,

2004; Timmusk et al., 1993), and, as expected we found that they are both significantly upregulated in our samples as well (Figure 27C).

Taken together, these data indicate that Carf and Grin3a are inversely regulated by neuronal activity, both in vitro and in vivo. Given that CaRF is a transcription factor that can be regulated in several ways by disparate neuronal stimuli, and the fact that our gene array results suggest that it can regulate the expression of a set of gene targets important for numerous calcium signal- dependent processes, this suggests that CaRF could play an important role in mediating activity-induced homeostatic processes in the brain. Additionally, the fact that NR3A is also inversely regulated by neuronal activity suggests that its effects on NMDAR-dependent changes in gene expression could have important

125

(#$" !"#$% &#'()"% (" !#'" 4" !#&" !#%" 3" !#$" 3" !" !"#$%&'()*+$,!-./%0*1+ )*+," ("-." /"-." &"-." 2'$)+%3)#+"45)6+"7+58$9&95+

(#'" &#'(*% (#&" &#'(+"% &#'(+,% (#%" (#$" (" !#'" !#&" !#%"

!"#$%&'()*+$,!-./%0*1+ !#$" !" )*+," ("-." /"-." &"-."

;+ -.($%/01(%23%,0*+"12" 4" 4" 415% 4" (!!"

(!" 3" 3" 3" !"#$%&'()*+$,!-./%0*1+ (" )*+," ("-." /"-." &"-."

Figure 27: Carf and Grin3a are both downregulated in vivo in response to pilocarpine- induced seizure. Adult C57/B6 mice were injected with saline or with pilocarpine (375 mg/kg) to induce seizure, and the hippocampus was dissected out at the indicated time points. Quantitative RT- PCR was run on cDNA made from harvested total RNA.

126

“None” condition represents tissue harvested three hours after mice were injected with saline. (A) Carf and Grin3a were normalized to Gapdh mRNA values. *p<0.05 Carf time point vs. Carf “None,” as determined by one-way ANOVA. #p<0.05 Grin3a time point vs. Grin3a “None,” as determined by one-way ANOVA. (B) Grin1, Grin2a, and Grin2b were normalized to Gapdh mRNA values. (C) Bdnf exon IV and Fos were run as positive controls and also normalized to Gapdh values. *p<0.05 Bdnf exon IV time point vs. Bdnf exon IV “None,” as determined by one-way ANOVA. #p<0.05 Fos time point vs. Fos “None,” as determined by one-way ANOVA. All data points are represented as a fold induction above or below the “None” control value for that gene. n = 3-7. Error bars represent S.E.M. physiological implications in the developing brain. Specifically, given our findings that NR3A is important for GABAergic synapse development, developmental- and activity-dependent regulation of NR3A expression could be an important form of metaplasticity, enabling the temporal window of synapse formation and maturation to be shifted in response to environmental cues.

3.5 Discussion

In this study we have identified a transcriptional signaling pathway that selectively couples induction of Bdnf transcription to activation of NMDARs.

This selectivity suggests that this pathway may be particularly important for

NMDAR-dependent processes during brain development, such as the sensory experience-guided formation of synapses. In light of our previously published findings, these results indicate that CaRF is capable of regulating gene transcription in different ways in response to disparate stimuli. While loss of

CaRF results in decreased levels of basal Bdnf exon IV mRNA and BDNF protein in mouse cortex, loss of CaRF has no effect on L-VGCC-mediated gene transcription (McDowell et al., 2010). By contrast, our most recent results show that CaRF actually appears to limit, rather than induce, NMDAR-dependent gene transcription. Given that CaRF was originally identified as an activator of the

CaRE1 site in Bdnf promoter IV, we hypothesize that the effects of Carf KD on

127

transcription of Bdnf promoter IV following NMDAR stimulation is due to an indirect interaction. While it is possible that CaRF is functioning as a repressor at this site in response to NMDAR activation, our data suggest that it is actually the reduction in Grin3a expression in CaRF-deficient neurons that is responsible for the altered levels of Bdnf exon IV mRNA following TTX withdrawal. Thus, CaRF exerts different effects on the transcriptional activation of Bdnf promoter IV in a stimulus-specific manner: 1) CaRF is an activator of basal Bdnf exon IV transcription (McDowell et al., 2010), 2) CaRF has no effect on L-VGCC- dependent Bdnf exon IV transcription (McDowell et al., 2010), and 3) CaRF limits or reduces NMDAR-dependent Bdnf exon IV transcription in an indirect manner, which has important implications for synapse development (Figure 28).

Our identification of a number of genes important for calcium signaling as putative targets of CaRF suggests that CaRF could be an important mediator of homeostatic programs of gene transcription in neurons. Homeostatic plasticity describes the process used by cells to maintain a preferred and constant intracellular state in the face of changing extracellular stimuli. In neurons, homeostatic mechanisms are crucial for regulating both cell excitability and the strength of activity-dependent signal pathways under conditions of altered synaptic activity (Turrigiano, 2007; Turrigiano and Nelson, 2004). Homeostatic processes have in some cases been proposed to function globally in neurons

(Burrone and Murthy, 2003), implicating activity-regulated transcription as a plausible mechanism to mediate subsequent cellular responses. In particular, the fact that CaRF expression is highest when neuronal activity levels are low indicates that CaRF could have a role in homeostatic programs that enable neuronal responses to low levels of calcium signaling. Our results from the gene

128

Normal! CaRF/NR3A KD!

CaRF! CaRF!

NR3A! NR3A!

MEF2! MEF2!

Bdnf exon IV! Bdnf exon IV!

GABAergic synapses! GABAergic synapses!

Figure 28: An NMDAR-selective pathway for regulation of Bdnf. A model depicting our working hypothesis for how Carf or Grin3a knockdown (KD) might affect NMDAR- dependent signaling and subsequent gene induction and synapse development. Green arrows indicate activating interactions or effects. Red arrows indicate limiting or repressive interactions or effects. array suggesting that CaRF can regulate a set of genes important for calcium signaling are consistent with our previously published ChIP-Seq results

(Pfenning et al., 2010). Both when testing for genes whose expression is affected by loss of CaRF function, and when testing for genes that actually have CaRF bound to their promoters (Pfenning et al., 2010), we identify complements of genes known to be important for calcium signaling, neuronal excitability, and synaptic transmission. Additionally, both studies suggest that CaRF can function either as an activator or a repressor, depending on the site it is regulating. Taken together, our data indicate that the transcription factor CaRF integrates

129

information about the overall level of activity a neuron is experiencing and plays a crucial role in regulating the expression of genes that capable of scaling the

“gain” of cell excitability accordingly.

Based on our gene array data and validation by real-time PCR in Carf KD neurons, we suggest that Grin3a could be a potential target of CaRF. We further hypothesize that it is the reduction in Grin3a expression that is responsible for the potentiation in NMDAR-dependent Bdnf exon IV transcription that we see in

Carf KD neurons. These data are exciting and novel because this is the first evidence that the NMDAR subunit NR3A is capable of exerting an effect on

NMDAR-dependent gene transcription. While there are numerous studies establishing the electrophysiological properties of NR3A-containing NMDARs

(Das et al., 1998; Sasaki et al., 2002; Tong et al., 2008), and there is a significant body of evidence detailing the biological effects and signaling mechanisms of

NMDAR-dependent changes in gene transcription (Hardingham and Bading,

2003; Lyons and West, 2011; Wayman et al., 2006; West et al., 2002), this is the first study to demonstrate that NR3A is capable of having an effect on gene induction following NMDAR stimulation. Further experiments will be necessary, however, to establish Grin3a as a true, direct target of CaRF. While in silico analysis suggests that there may be a CaRF binding site within the Grin3a promoter (data not shown), there is a possibility that the reduction in Grin3a expression in Carf KD neurons is actually an indirect effect itself. Additional work will need to be done to tease apart this issue; if Grin3a is not actually a direct target of CaRF then we propose that, at the very least, the two genes must have some key regulatory mechanism in common.

130

We have shown, using in vitro and in vivo stimuli, that Carf and Grin3a are both regulated at the level of expression by changes in neuronal activity.

Specifically, both genes are inversely regulated by activity, meaning that expression is highest when neuronal signaling is quiescent. Additionally, previous studies indicate that CaRF and NR3A are also regulated in a similar fashion over developmental time; the expression levels of both genes are highest in the brain of rodents within the first 10 to 14 days after birth (Al-Hallaq et al.,

2002; McDowell et al., 2010; Sasaki et al., 2002; Wong et al., 2002). Given NR3A's interesting developmental expression patterns (Al-Hallaq et al., 2002; Sasaki et al.,

2002; Wong et al., 2002) and the fact that our data indicates that NR3A actually functions to limit NMDAR-dependent gene induction, this suggests that NR3A could be capable of regulating gene transcription in a temporally-specific manner during development. Given that NR3A’s expression peaks in the early postnatal period and begins to drop off around the time when synaptogenesis is most robust (Al-Hallaq et al., 2002; Sasaki et al., 2002; Wong et al., 2002), our data demonstrating that Grin3a KD leads to an exuberance of GABAergic synapses raises the exciting possibility the modulation of activity-dependent cellular processes by NR3A could play a role in several neurodevelopmental processes that take place around this time, such the closure of the critical period in the visual cortex. The idea that NR3A is important for the normal development of neural connections is further supported by previously published work demonstrating that mutant mice that are either deficient for NR3A or overexpress NR3A have altered numbers of glutamatergic synapses (Das et al.,

1998; Roberts et al., 2009). Further work will need to be done to determine whether the apparent effects of NR3A on glutamatergic synapse development vs.

131

GABAergic synapse development have a causal relationship, and if so, which one precipitates the other. In the case of CaRF, its developmentally-regulated expression profile, combined with the complement of genes we have identified by gene array as being potential CaRF targets, suggest that CaRF could have a role in regulating activity-dependent changes in gene expression in a stimulus- and temporally-specific manner. Our previously published finding that CaRF

KO mice have altered GABAergic synapse development in the striatum

(McDowell et al., 2010) suggests that CaRF-dependent gene transcription is physiologically important for normal brain development. Taken together, our data presented here characterize a number of novel mechanisms of signaling specificity in the activity-regulated transcription of Bdnf exon IV.

132

4. Discussion

4.1 Specificity: the “next frontier” in the field of activity- regulated gene transcription

One of the conundrums that has arisen in the last two decades in the field of activity-regulated gene transcription is: how can the influx of a single ion – calcium – transmit so many different types of signals from the synapse to the nucleus of a neuron? How, based on the type of channel, duration, and context of a particular influx of calcium ions, can a neuron distinguish between signals that induce synaptic proliferation versus synaptic pruning, or cell survival versus apoptotic cell death? The answer lies in cellular mechanisms of signal specificity.

Such mechanisms can lie at the synapse – in channel subunit composition, for example – or at the nucleus – in the complement of transcription factors expressed in that particular neuron.

In my dissertation research, I have identified and characterized several novel mechanisms of specificity in the activity-regulated transcription of the gene encoding Brain-Derived Neurotrophic Factor (BDNF), a member of the neurotrophin family that is critical for many aspects of neural development. In this chapter, I will provide some further discourse and analysis regarding the significance and implications of my work, as well as some suggestions for future directions that could be pursued.

4.2 Musical chairs: CaRF and MEF2 can both regulate the Bdnf gene, but in response to different stimuli

In Chapter 2, I provided evidence that the transcription factor MEF2 is capable of binding to the CaRE1 element within Bdnf promoter IV. This is the

133

same site that the transcription factor CaRF has previously been shown to be capable of binding to and regulating (Tao et al., 2002). Interestingly, we have also found that CaRF and MEF2 appear to regulate Bdnf in response to disparate stimuli. CaRF appears to be more important for basal regulation of Bdnf transcription, while MEF2 seems to be important for L-VGCC-mediated induction of Bdnf transcription. Additionally, it appears that CaRF has a role in limiting NMDAR-dependent gene transcription, although this interaction appears to be indirect (Chapter 3). The fact that we have found that CaRF and

MEF2 associate with CaRE1 independently – that is, they neither cooperate nor compete in their binding to the site – further substantiates the idea that these two factors function autonomously from one another and regulate CaRE1 under largely disparate conditions. Moreover, we have also never seen evidence in our

EMSA experiments that CaRF and MEF2 are capable of binding to the CaRE1 element simultaneously.

Given that CaRF and the MEF2 family of transcription factors both show distinct spatial and temporal patterns of expression in the developing brain, this could have important implications for regulation of Bdnf expression over the course of development. While CaRF has only been found to bind to the CaRE1 element within promoter IV of the Bdnf gene, a second putative binding site for

MEF2 has been identified in an enhancer element upstream of Bdnf promoter I

(Flavell et al., 2008). Based on my experiments and previously published studies,

I predict that regulation of the expression levels of CaRF and the various MEF2s in a given neuron over time could control to what degree Bdnf is expressed basally and also how activity-responsive Bdnf transcription is. In my experiments, I see significantly greater expression levels of Bdnf exon IV than of

134

Bdnf exon I – both basally and in response to membrane depolarization.

Consequently, genetic manipulations that affect Bdnf exon IV transcription (such as knocking down MEF2C) also have a significant impact on total Bdnf transcript levels. Conversely, genetic manipulations that only affect Bdnf exon I (such as knocking down MEF2D) do not also necessarily exert a significant effect on total

Bdnf transcript levels. One could imagine however, that in older neurons, when exon I is the dominantly-expressed Bdnf transcript, transcriptional mechanisms that regulate this promoter would be much more important in regulating total

Bdnf levels.

Taken together, the work I have presented in Chapter 2 of this dissertation describes a novel mechanism by which multiple transcription factors can regulate the age- and stimulus-dependent transcription of a single gene. But what does this mean, functionally, for the developing brain and for various forms of plasticity that occur throughout life? It would be interesting in future studies to examine processes known to be dependent upon activity-regulated

Bdnf transcription in the brains of mice deficient for CaRF and/or one of the

MEF2 isoforms. For example, given evidence that activity-dependent Bdnf exon

IV induction is critical for normal GABAergic synapse development (Hong et al.,

2008), I hypothesize that in mice deficient for MEF2C, one might observe a reduction in GABAergic synapse number. Carf KO mice have already been shown to have altered GABAergic synapse development in the striatum

(McDowell et al., 2010). Additionally, while Bdnf exon I is not very highly expressed early in development, it is one of the more dominant activity-inducible

Bdnf transcripts later on in life (Timmusk et al., 1994). Would mice deficient for

MEF2D perhaps perform better than wildtype mice in learning and memory

135

tasks, given that Mef2d KD leads to potentiated Bdnf exon I transcription?

Further work will need to be done to elucidate which neural processes rely upon the differential stimulus-specific regulation of the Bdnf gene by CaRF and MEF2.

4.3 My big, fat MEF family: MEF2 isoforms and splice variants and their roles in activity-regulated gene transcription

I have reported evidence in Chapter 2 that the different MEF2 isoforms are differentially capable of regulating transcription of endogenous genes.

Additionally, it appears that different MEF2 splice variants of a single isoform can also be differentially activity-responsive. Specifically, I showed that MEF2C splice variants containing the γ domain are less activity-responsive than γ-lacking

MEF2C splice variants. Furthermore, it appears that the β domain actually has a positive effect on activity responsiveness; that is, the presence of the β domain enhances transcriptional activation following membrane depolarization. One possible caveat to the experiment shown in Figure 14C is that the different splice variants could exhibit varied time courses of transcriptional activation, which might not have been detected by only examining luciferase activity 6 hours after

KCl treatment. To fully address this, one would need to do the experiment with the Gal4-MEF2 fusion constructs over the course of a variety of depolarization times. In any case, these data indicate that regulation of Mef2c transcript splicing could have important effects on the activity-inducibility of genes regulated by this transcription factor.

I also show that KD of MEF2A, MEF2C, or MEF2D has disparate effects on the membrane depolarization-dependent induction of Bdnf exon IV and exon I transcription. Specifically, Mef2c KD results in a decrease in depolarization-

136

induced Bdnf exon IV transcription, while KD of Mef2a or Mef2d has no statistically significant effect. This is in contrast to Bdnf exon I, the depolarization-induced transcription of which is potentiated by Mef2d KD and unaffected by either Mef2a or Mef2c KD. This suggests, at the most simplistic level, that MEF2C is a transcriptional activator Bdnf exon IV and MEF2D is a transcriptional repressor of Bdnf exon I.

That Mef2c KD reduces Bdnf exon IV inducibility is not surprising, given that MEF2C is also the dominant isoform expressed in our cortical neuron culture system. The most parsimonious explanation for this is that we are eliminating the majority of the MEF2 factors present in the cell, thus reducing the inducibility of all MEF2 target genes. However, it may not be that simple. In every diploid neuronal cell, there are only two Bdnf exon IV promoters.

Theoretically, there could still be enough MEF2A and D protein left in the nucleus of Mef2c KD neurons to bind and activate the CaRE1 site in response to membrane depolarization. One alternative explanation for why only Mef2c KD leads to impaired Bdnf exon IV induction following membrane depolarization is that in our neuron cultures, MEF2C may be more sensitive to activation by membrane depolarization. Only the Mef2c gene encodes variants that lack the γ domain (Shalizi and Bonni, 2008; Zhu and Gulick, 2004), and we find that γ- lacking MEF2C variants are the most highly activated of the MEF2Cs upon membrane depolarization. Additionally, Mef2c is by far the predominant Mef2 gene expressed in the developing cortex, and in our cultures nearly half of the

Mef2c transcripts lack the γ domain. Thus, loss of γ-lacking MEF2C variants could be what is leading to a decrease in depolarization-dependent inducibility of Bdnf exon IV in Mef2c KD neurons. To test this hypothesis, one could

137

selectively knockdown only γ-lacking MEF2C variants and then examine depolarization-induced Bdnf exon IV transcript levels. This could then be compared to knockdown of only γ-containing MEF2C variants, which I would predict would not have a significant effect on Bdnf exon IV induction following membrane depolarization. If this hypothesis is correct, the heightened sensitivity of γ-lacking MEF2C variants to L-VGCC activation may be particularly important for coupling the induction of activity-regulated genes like Bdnf to environmental stimuli during cortical development.

In contrast to what we observe with Bdnf exon IV, we have found that

Bdnf exon I induction following membrane depolarization is potentiated by

Mef2d KD. It has previously been shown that MEF2D is capable of binding to an enhancer element upstream of Bdnf exon I, and this has been indicated to be important for depolarization-dependent induction of Bdnf exon I (Flavell et al.,

2008). Why then, do we see MEF2D acting as a functional repressor of Bdnf exon

I? One possible explanation is the difference in cell types between our study and the study published by Flavell and colleagues (2008); while their experiments were done in cultured hippocampal neurons, our work was done in cultured cortical neurons. It could be that in some cell types, MEF2D acts as a transcriptional activator, while in others it acts as a transcriptional repressor.

This could be mediated by interactions between MEF2D and specific complements of co-factors present only in a given population of neurons, or by differences in post-translational modifications, which could also be regulated in a cell type-specific manner. An alternative explanation for the potentiation of Bdnf exon I in Mef2d KD neurons is that MEF2D is not actively repressing Bdnf exon I, but rather occupying – and thereby blocking – a site either within the enhancer

138

or promoter I itself from being occupied by another, activating transcription factor, possibly a different MEF2 variant. The interesting finding that KD of

Mef2d leads to derepression of Bdnf exon I could suggest a possible mechanism by which the activity-inducibility of this particular exon could be increased with age.

One other point of interest is that the MEF2 family of transcription factors is known to function as dimers. It would be interesting in future studies to do double- or even triple-knockdowns of different MEF2 isoforms to see if particular heterodimer combinations are important for differential regulation of Bdnf promoter I and IV. Additionally, another interesting experiment would be to attempt to rescue the effects of Mef2c KD with various MEF2C splice variants, to see if a particular splice variant is particularly important for activity-dependent gene induction early in development. Finally, future studies could create mice that are deficient for only particular MEF2C splice variants – rather than the entire Mef2c gene – to ask if one or more splice variants are particularly physiologically important for normal brain development.

4.4 It’s a balancing act: CaRF as a homeostatic regulator of calcium signaling in neurons

In Chapter 3, I characterize an NMDAR-selective signaling pathway that could be important for stimulus-specific synapse development. The transcription factor CaRF was originally identified as an activator of Bdnf promoter IV (Tao et al., 2002). Interestingly however, Carf KD leads to a potentiation – rather than a reduction – in Bdnf exon IV transcription following

TTX withdrawal, an NMDAR-selective stimulus. While our results from the gene array indicate that for a small fraction of potential CaRF target genes, CaRF

139

could function as a repressor, it is more likely that the effects of Carf KD on Bdnf exon IV transcription following TTX withdrawal are a result of an indirect interaction. Specifically, my working hypothesis is that regulation of the expression levels of the NMDAR subunit NR3A is a critical mechanistic link between CaRF and NMDAR-selective gene transcription.

More generally, looking across the complement of putative CaRF targets from the gene array yields some interesting observations. First of all, out of the

100 genes whose expression is most significantly altered by Carf KD, 69 of them exhibit decreased expression levels while 31 of them are increased in expression.

While it remains to be determined how many of these are actually direct targets of CaRF, this generally indicates that CaRF is capable of functioning both as a transcriptional activator and as a transcriptional repressor. These findings are generally in agreement with the findings from our lab’s previously published

CaRF ChIP-Seq study (Pfenning et al., 2010). Additionally, the identification of a number of groups of genes that are broadly important for calcium signaling and synaptic transmission in neurons (specifically, ionotropic neurotransmitter receptor subunits, calcium ion binding proteins, and CaMKII subunits) suggests that CaRF could have a role in regulating the overall excitability of a neuron.

Even more exciting, we have also found that CaRF's transcriptional activity is regulated bidirectionally over two different time courses. In the short term, increased calcium signaling in neurons appears to activate CaRF (Tao et al., 2002).

In the long term however, increased calcium signaling actually leads to a decrease in CaRF expression. Since CaRF is inversely regulated at the level of expression by neuronal activity, CaRF could potentially serve as a transcription factor important for homeostatic changes in the “gain” of calcium signaling

140

pathways in response to decreases in overall activity levels. This idea is further substantiated by evidence that newly expressed CaRF protein is transcriptionally active (data not shown). Finally, our previously published finding that CaRF appears to be able to bind to and repress its own promoter (Pfenning et al., 2010) makes this picture of CaRF as a homeostatic feedback mediator in neurons even more intriguing.

Our gene array run on Carf KD neurons indicates that Grin3a could be a potential target of CaRF. While there does appear to be a very small CaRF ChIP peak in the Grin3a promoter based on our previously published ChIP-Seq data

(Pfenning et al., 2010), this peak is not statistically significant. Also, we have not been able to find evidence that Grin3a mRNA or NR3A protein levels are altered in the brains of Carf KO mice. While it is possible that Grin3a is a true target of

CaRF and there is simply some compensatory mechanism being engaged in the constituent Carf KO mice that prevents Grin3a expression from being altered, this could also indicate that Grin3a is in fact not a direct target of CaRF. If so, then the reduction in Grin3a expression in Carf KD neurons would be due to an indirect effect of loss of CaRF function. One way to test for this is to perform EMSAs with CaRF protein and radiolabeled oligonucleotide sequences matching the putative CaRF binding site within the Grin3a promoter. While we have preliminarily tried this experiment and not found any convincing evidence that

CaRF does bind to the sequence within the Grin3a promoter, it is possible there is an alternative CaRF binding site within the Grin3a promoter that was not detected by the ChIP-Seq experiment. Further work will need to be done to establish whether the effects of Carf KD on Grin3a expression are direct or indirect.

141

Another question remaining to be addressed is how CaRF-deficient neurons differ physiologically from wildtype neurons. Do Carf KD or KO neurons have altered mEPSC (or mIPSC) frequency or amplitude? Do they have altered rates of calcium ion diffusion? CaRF-deficient neurons might actually have altered levels of activity, given that numerous other genes were identified in the gene array that have important functions in calcium signaling, neuronal excitability, and synaptic transmission. We have already found that Carf KD neurons have decreased CaMKII activity (data not shown), a result that is not surprising given that several CaMKII subunits were identified on the gene array.

Given the effects of Carf KD on Grin3a expression, and the fact that it does not appear as if Grin3a is a direct target of CaRF, I hypothesize that Carf KD neurons have increased levels of calcium signaling under basal conditions. This makes sense given my data showing that Grin3a is inversely regulated by neuronal activity. If Grin3a is not a direct target of CaRF, but Grin3a expression is decreased by increasing neuronal activity, then increased levels of activity in Carf

KD neurons could explain the decrease in Grin3a expression that we observe.

Given that all stimuli that I tested that ultimately result in an increase in calcium signaling to the nucleus lead to decreased expression of Grin3a, there are a number of hypotheses that could be made regarding in what way specifically

Carf KD neurons have increased levels of activity. This could be due to any number of changes in neuronal physiology, including increased frequency or amplitude of excitatory synaptic signaling events, a potentiation of the “gain” in signaling cascades downstream of synaptic events, or a reduction in either local or global calcium buffering within the cell. Any of these would lead to increased calcium-dependent signals being transmitted to the nucleus, which based on our

142

data, we suggest could lead to decreased expression of Grin3a. Any of these mechanisms may be in place in Carf KD neurons; future electrophysiological and calcium imaging experiments should further address these issues.

One potential discrepancy between the results described in this dissertation and our lab’s previously published findings is the effect of loss of

CaRF function on expression of genes encoding GABAA receptor subunits. We have previously found that the brains of Carf KO mice have increased expression levels of the GABAAβ2/3 subunit, the GABAAγ2 subunit, and GAD65 (McDowell et al., 2010). Additionally, our previously published study demonstrated that the brains of Carf KO mice have increased numbers of GABAergic synapses in the striatum. By contrast, we have identified two other GABA receptor subunits as being decreased in expression at the mRNA level in Carf KD neurons based on our data from the gene array. However, the genes identified in the array are the

GABAAα1 and GABAAα2 subunits, neither one of which was shown to have increased expression of the protein level in the brains of Carf KO mice (McDowell et al., 2010). The most obvious explanation for these two findings is simply that there are other GABAAα subunits that could potentially be incorporated to form functional GABAA receptors in CaRF-deficient neurons. In fact, there are six different GABAAα subunits, all of which have distinct spatial and temporal patterns of expression. Interestingly, the functional relevance of such spatial and temporal regulation of GABAA subunit expression largely remains to be determined (Hevers and Lüddens, 1998). Thus, it is possible that loss of CaRF results not only in an increase in total numbers of GABAergic synapses, but also in a shift in the relative subunit composition of the GABAA receptors at those synapses. A different hypothesis that must be considered, however, is that Carf

143

KO and Carf KD could simply have disparate effects on GABAergic synapse formation in general. Still another alternative hypothesis is that loss of CaRF function somehow has disparate effects on the transcription of GABAA subunit genes than it does on the translation of those gene products. An easy way to test whether the last two hypotheses could be true is to examine GABAergic synapse numbers in Carf KD neurons in culture, and to perform immunoblotting experiments to test for the relative expression levels of the GABAAα subunits in the striata of Carf KD mice. Given my evidence that Grin3a KD also results in increased numbers of GABAergic synapses, which is consistent with the effects observed in the brains of Carf KO mice, I currently favor the first hypothesis as being most likely.

Taken together, the results detailed in Chapters 2 and 3 of this dissertation indicate that CaRF is capable of regulating transcription of Bdnf in a complex, stimulus-dependent manner. Additionally, I have shown that CaRF is capable of regulating the expression of other genes important for calcium signaling in neurons. This, coupled with the fact that CaRF is itself regulated in an inverse fashion by changes in neuronal calcium signaling, suggest that CaRF could play an important role in the initiation of homeostatic programs of gene expression and that this could have important functional consequences for synapse formation and other neurodevelopmental processes. Future studies will hopefully further elucidate the upstream regulatory processes and downstream gene targets of this interesting transcription factor.

144

4.5 Minority report: NR3A has a big effect on NMDAR- dependent gene transcription

In this dissertation, I have provided the first evidence that the NMDAR subunit NR3A is capable of having a modulatory effect on NMDAR-dependent programs of gene transcription (Chapter 3). These data are especially exciting and surprising given that, even at the peak of its expression, NR3A is only estimated to be incorporated into roughly 10-15% of total surface NMDARs (Al-

Hallaq et al., 2002). How is it possible that knockdown of a subunit only present in 10-15% of all NMDARs is capable of exerting such a drastic effect on NMDAR- dependent Bdnf exon IV transcription? Specifically, I observed almost a threefold increase in Bdnf exon IV transcription following TTX withdrawal in Grin3a KD neurons as compared with controls. These data indicate that either NR3A must be strategically localized to have a disproportionately large effect on NMDAR- dependent gene transcription, or NR3A is capable of interacting with some sort of signaling cascade that enables amplification of an NR3A-specific signal. While it has been shown that NR3A is capable of significantly reducing single channel conductance and calcium permeability of NMDARs (Das et al., 1998; Sasaki et al.,

2002; Tong et al., 2008), rough calculations that I have performed suggest that this would have only a very marginal effect on global calcium signals within the neuron. It is possible that NR3A’s effects on NMDAR calcium permeability could have more significant implications if one considers the phenomenon of calcium microdomains around the opening of a channel pore. It is possible that the differential calcium influx in Grin3a KD neurons could be sufficient to activate a signaling molecule tethered close to the opening of the NMDAR ion channel pore that, in WT neurons, might not necessarily be activated.

145

An alternative explanation to the calcium signaling hypothesis described above is that NR3A could be uniquely capable of interacting with a signaling molecule via its C-terminal domain. For example, NR3A has been shown to physically associate with the protein phosphatase PP2A (Chan and Sucher, 2001;

Ma and Sucher, 2004). Additionally, in Grin3a KD neurons, I observe a robust potentiation of TTX withdrawal-induced Npas4 transcription. Npas4 is a transcription factor that is known to be regulated at the level of expression by neuronal activity and to activate transcription of Bdnf exons I and IV in an activity-dependent manner (Lin et al., 2008; Pruunsild et al., 2011). It is possible that enhanced induction of Npas4 expression is responsible for the increase in

NMDAR-dependent Bdnf exon IV transcription observed in Grin3a KD neurons.

This is especially enticing given that I have evidence suggesting that it is actually the time course, rather than the total amplitude, of Bdnf induction that is altered by Grin3a KD (data not shown). That is, Bdnf exon IV transcription is prolonged in Grin3a KD neurons by several hours (data not shown). A similar mechanism has been described for long-term induction of the Arc gene by expression of Egr1 and Egr3 (Li et al., 2005). Specifically, Arc induction has two phases: a short-term, translation-independent phase (hence its original identification as an “immediate early gene”) and a longer-term, translation-dependent phase that Li and colleagues have demonstrated relies on transcription and translation of the Egr1 and Egr3 transcription factors (2005). One could test whether induction of Npas4 expression is mediating the extended time course of Bdnf exon IV induction by treating neurons with a translational inhibitor prior to TTX withdrawal. Finally, the fact that MEF2-, but not CREB-, dependent signaling is potentiated in Grin3a

KD neurons could give us some clue as to what signaling cascades might be

146

differentially activated between the synapse and the nucleus in Grin3a KD neurons. For example, p38/MAPK is known to phosphorylate and activate

MEF2 but not CREB (Mao et al., 1999). Further studies addressing the mechanism by which NR3A can limit NMDAR-dependent gene transcription will doubtlessly prove interesting.

I have already shown that GABAergic synapse development is altered in

Grin3a KD neurons, but might there be other functional ramifications of NR3A- dependent signaling to the nucleus? The fact that NR3A is both regulated over developmental time and inversely regulated by changes in neuronal activity is certainly intriguing, and suggests that NR3A could be of an important regulator of other activity-dependent developmental processes and/or homeostatic mechanisms in neurons. Of particular interest, a study by Nakanishi and colleagues have shown that NR3A is neuroprotective, and that genetic ablation of NR3A results in increased susceptibility to excitotoxicity, while overexpression of NR3A reduces ischemic lesion size (Nakanishi et al., 2009).

These findings are exactly in line with my own unpublished results; unless the

NMDAR blocker APV is added to the media at the time of lentiviral infection,

Grin3a KD neurons consistently die, while their control counterparts continue to live happily and extend neurites for days or weeks in culture. Previous studies have shown that distinct NMDAR subpopulations are capable of exerting opposite effects on activity-dependent gene transcription and neuronal survival

(Hardingham and Bading, 2002; Hardingham et al., 2002; Sala et al., 2000). Is it possible that an alteration in NMDAR-dependent gene transcription in Grin3a

KD neurons is responsible for the apparent “tipping of the balance” in favor of cell death over survival? If so, I would hypothesize that the observed reduction

147

in Grin3a expression in the brains of mice that have undergone pilocarpine- induced seizure is pathological, rather than compensatory.

As already mentioned in Chapter 3, I hypothesize that the developmental regulation of NR3A in vivo could be important for regulating the timing of various critical periods in the brain. It has been shown that NR3A KO mice have increased numbers of glutamatergic synapses (Das et al., 1998) while transgenic mice that overexpress NR3A have fewer and less mature glutamatergic synapses

(Roberts et al., 2009). However, it remains to be determined whether these effects on glutamatergic synapses and the effects that I observed of Grin3a KD on

GABAergic synapse formation occur in series or in parallel. Specifically, is the effect on one type of synapse causal to the effect on the other type of synapse, and if so which one is responsible for which? It has been shown that BDNF expression is important for GABAergic synapse formation, which has been implicated in the closure of the visual critical period (Huang et al., 1999). Based on this, I hypothesize that the effect of Grin3a KD on Bdnf transcription results in increased – or possibly expedited – GABAergic synapse formation, and that this is responsible for the effects on glutamatergic synapse development reported by others (Das et al., 1998; Roberts et al., 2009). Thus, in this scenario, NR3A could function to regulate the metaplasticity of critical period timing. Specifically, activity-dependent modulation of the developmental time course of NR3A expression could function to either shorten or prolong the critical period in an experience-dependent manner. Finally, one other point that is still unclear in the broader field of BDNF-dependent synapse development is to what degree basal versus stimulus-induced Bdnf expression is required for normal development.

Given that I also see enhanced baseline expression of Bdnf exon IV in Grin3a KD

148

cultures, the degree to which stimulus-evoked Bdnf expression specifically contributes to the ability of NR3A to modulate experience-dependent brain development remains to be determined. Hopefully, future in vivo studies will tease apart this complicated issue and shed further light on the physiological functions of NR3A the developing brain.

4.6 Concluding remarks

My dissertation research has elucidated several novel mechanisms of specificity in activity-regulated gene transcription in the nervous system. These include the binding of multiple transcription factors to a single response element within a promoter following disparate types of stimuli, the specific spatial and temporal expression of different isoforms or splice variants of a single family of transcription factors, alterations in the expression levels of a transcription factor in response to altered activity states, and the regulation of expression of a neurotransmitter receptor subunit that can modulate gene transcription downstream of that receptor’s activation. Taken together, the work described here represents a significant and novel contribution to my field that I hope others will find useful and continue to build on for years to come.

149

Appendix A

Table 2: 100 most significantly altered genes in Carf KD neurons as compared with scrambled controls, as determined by the t-statistic.

Name Log Fold Change t Statistic p Value Adj. p Value Nras -0.89 -7.92 3.56E-06 0.1091681 Stk24 -0.87 -7.17 9.83E-06 0.1091681 BC010981 -1.22 -6.85 1.54E-05 0.1091681 Wrnip1 -0.84 -6.78 1.71E-05 0.1091681 Nras -0.93 -6.67 2.01E-05 0.1091681 Calm3 -0.90 -6.59 2.26E-05 0.1091681 Mib1 -0.84 -6.26 3.75E-05 0.1536465 Rab6b -0.92 -6.02 5.39E-05 0.1984771 Rab21 -0.83 -5.84 7.15E-05 0.2295043 E030003F13Rik -1.14 -5.81 7.52E-05 0.2295043 Aldoc -0.44 -5.67 9.49E-05 0.2496894 Rps20 /// LOC245676 /// LOC623568 -1.47 -5.60 1.05E-04 0.2582404 Rab21 -0.84 -5.32 1.66E-04 0.3122721 Sdc2 -0.98 -5.29 1.76E-04 0.3122721 Lrrc16 -0.90 -5.28 1.78E-04 0.3122721 Peci -0.50 -5.26 1.85E-04 0.3122721 Tnrc9 -0.30 -5.23 1.95E-04 0.3122721 Ptgfrn -0.48 -5.20 2.05E-04 0.3135735 Ranbp5 -0.25 -5.18 2.13E-04 0.3135735 Fgf12 -1.14 -5.14 2.26E-04 0.3186328 Tmtc4 -1.27 -5.09 2.46E-04 0.3230816 39513 -0.60 -5.05 2.63E-04 0.3230816 Narg1 -0.51 -5.03 2.70E-04 0.3230816 AI956758 -0.70 -5.03 2.72E-04 0.3230816 BB332873gs -0.59 -4.99 2.90E-04 0.3341906 Wnk1 -0.47 -4.93 3.22E-04 0.3440913 Pitrm1 -0.47 -4.93 3.23E-04 0.3440913 Impa1 -0.74 -4.92 3.27E-04 0.3440913 Rab6b -1.28 -4.79 4.09E-04 0.3969603 Armc1 /// LOC634390 -0.77 -4.75 4.39E-04 0.4091632 BB395066gs -0.92 -4.74 4.44E-04 0.4091632 4933425L03Rik -0.52 -4.71 4.68E-04 0.4112755

150

Name Log Fold Change t Statistic p Value Adj. p Value Acsbg1 -0.52 -4.70 4.80E-04 0.4112755 Lnp -0.41 -4.68 5.00E-04 0.4187374 Pdzd8 -0.54 -4.63 5.39E-04 0.4412917 Abcb7 -0.59 -4.61 5.66E-04 0.4513683 2900019E01Rik -0.43 -4.56 6.08E-04 0.4513683 AV238942gs -0.44 -4.56 6.18E-04 0.4513683 4930431H11Rik -0.38 -4.55 6.28E-04 0.4513683 9330121K16Rik -0.30 -4.50 6.80E-04 0.4513683 Camk2g -0.48 -4.50 6.88E-04 0.4513683 Ttll7 -0.98 -4.48 7.03E-04 0.4513683 Nt5dc2 -0.48 -4.46 7.29E-04 0.4513683 Gdap1 -0.36 -4.45 7.44E-04 0.4513683 Lxn -0.39 -4.45 7.48E-04 0.4513683 Ntrk2 -0.58 -4.44 7.59E-04 0.4513683 Cpd -0.94 -4.38 8.51E-04 0.4562823 Mtfr1 -0.64 -4.37 8.54E-04 0.4562823 Nebl -0.32 -4.37 8.58E-04 0.4562823 Gls -0.93 -4.37 8.62E-04 0.4562823 BE200144gs -0.74 -4.37 8.67E-04 0.4562823 2210010L05Rik -0.88 -4.35 8.88E-04 0.4610779 Pex11a -0.57 -4.34 9.14E-04 0.4651824 Rap2c -0.57 -4.33 9.22E-04 0.4651824 C85320gs -0.51 -4.28 1.01E-03 0.4749934 BB750118gs -0.42 -4.28 1.01E-03 0.4749934 C130030K03Rik -0.58 -4.27 1.03E-03 0.4749934 Gopc -0.51 -4.26 1.06E-03 0.4749934 Nrxn1 -0.61 -4.21 1.14E-03 0.4749934 5430431D22Rik -0.61 -4.20 1.17E-03 0.4749934 A2bp1 -0.66 -4.19 1.18E-03 0.4749934 Dip2c -0.35 -4.19 1.19E-03 0.4749934 D6Ertd90e -0.20 -4.18 1.22E-03 0.4749934 Phgdh /// LOC673015 -0.33 -4.15 1.28E-03 0.4749934 Sycp3 -0.64 -4.14 1.29E-03 0.4749934 Zrsr2 -0.46 -4.14 1.30E-03 0.4749934 B3galtl -0.38 -4.13 1.32E-03 0.4749934 Hipk3 -1.07 -4.13 1.32E-03 0.4749934 BB128963 -0.34 -4.13 1.32E-03 0.4749934 Slco5a1 0.75 7.26 8.64E-06 0.1091681 1110033J19Rik 0.94 6.56 2.37E-05 0.1091681

151

Name Log Fold Change t Statistic p Value Adj. p Value Usp20 0.42 5.76 8.10E-05 0.2295043 5730405I09Rik 0.92 5.41 1.43E-04 0.3122721 BC029214 0.40 5.33 1.65E-04 0.3122721 5033417F24Rik 0.34 5.23 1.93E-04 0.3122721 Smug1 0.72 5.12 2.33E-04 0.3186328 Rasip1 0.50 4.88 3.52E-04 0.3604237 Inha 0.54 4.86 3.65E-04 0.3632989 6330403K07Rik 0.44 4.71 4.69E-04 0.4112755 AI847427gs 0.38 4.59 5.83E-04 0.4513683 5730407M17Rik 0.20 4.58 5.94E-04 0.4513683 1110014J01Rik 0.45 4.53 6.47E-04 0.4513683 Pnpo 0.58 4.51 6.68E-04 0.4513683 1700019N19Rik 0.24 4.47 7.26E-04 0.4513683 Stxbp5 0.59 4.46 7.33E-04 0.4513683 Nfatc2ip 0.40 4.43 7.72E-04 0.4514067 Pcdhb3 0.47 4.41 7.97E-04 0.4540151 St6galnac4 0.29 4.41 8.01E-04 0.4540151 Ubap2 0.25 4.31 9.50E-04 0.4728744 Dnalc1 0.44 4.29 9.84E-04 0.4749934 D7Wsu128e 0.25 4.23 1.10E-03 0.4749934 Wdr70 0.33 4.22 1.13E-03 0.4749934 BB325333gs 0.27 4.21 1.14E-03 0.4749934 Ophn1 0.37 4.20 1.16E-03 0.4749934 4432405B04Rik 0.34 4.19 1.18E-03 0.4749934 Golga3 0.46 4.17 1.22E-03 0.4749934 BE851919gs 1.05 4.17 1.24E-03 0.4749934 Pxdn 0.57 4.16 1.24E-03 0.4749934 Lum 0.28 4.16 1.26E-03 0.4749934 AW489535gs 0.29 4.14 1.29E-03 0.4749934

152

Appendix B

Table 3: Top 250 genes most altered by Carf KD, as determined by signal:noise analysis of gene array results.

Name Score Rps20 /// LOC245676 /// LOC623568 -0.2825215 E030003F13Rik -0.28060117 D430047L21Rik -0.23011786 1458273_at -0.21128891 BC010981 -0.2027103 Ttr -0.2021612 1450105_at -0.20025764 1436182_at -0.19933924 1460588_at -0.19703409 1444025_at -0.19501264 9330121K16Rik -0.19337286 LOC665081 -0.19230613 Ddx3y -0.19108956 1441305_at -0.18909322 1439779_at -0.18422458 C230004L04 -0.18309343 AI956758 -0.18256724 2610305J24Rik /// BC005512 /// LOC215866 /// LOC629242 /// LOC630153 /// LOC630525 /// LOC631386 /// LOC637482 /// LOC641366 /// LOC668904 /// LOC669019 /// LOC669231 /// LOC669436 /// LOC670270 /// LOC670719 /// LOC672061 /// LOC672196 /// LOC672939 /// LOC673876 /// LOC674912 /// LOC674927 /// LOC675168 /// LOC675410 /// LOC675706 /// LOC676247 /// LOC676718 /// LOC677506 -0.18142499 Ass1 -0.18111022 Hipk3 -0.18014309 Aqp4 -0.18003294 Sycp3 -0.1773934 1437400_at -0.17624933 2610528B01Rik -0.1758265 AI649393 -0.1733874 2210010L05Rik -0.17055087 1436400_at -0.16979 1430995_at -0.16887155

153

Name Score Lpl /// LOC669888 -0.16880794 1441716_at -0.16721894 1441974_at -0.16663879 Jarid1d -0.16637936 Tmtc4 -0.16569519 4921517B04Rik -0.16087969 2900009J20Rik -0.15989335 1457805_at -0.15926613 1459325_at -0.15893063 Lrrc16 -0.15874523 1439990_at -0.15861319 Efcbp1 -0.15860036 Pdlim5 /// LOC669660 -0.15851548 1437987_at -0.1576822 Htr2c -0.15638976 Armc1 -0.15409419 1440516_at -0.15400913 BC014699 -0.15327406 4631408O11Rik -0.15136336 Mib1 -0.15045214 D930002L09Rik -0.14992993 AW493563 -0.14901145 1455150_at -0.14841506 Nts -0.14833179 1440015_at -0.14807887 2810453I06Rik -0.14613539 Kcnip2 -0.14513983 Nov -0.1450502 Slc41a2 -0.141799 Hist1h2bc -0.14100033 Eda2r -0.14057834 Pex11a -0.14034148 1438310_at -0.14005046 5430431D22Rik -0.139517 Wrnip1 -0.13874286 1422687_at -0.1386503 1439170_at -0.13832016 LOC677213 -0.13822457 1442073_at -0.13607338 C130030K03Rik -0.135969

154

Name Score Kif2a -0.13595751 Nell1 -0.1355765 Arl10 -0.13456309 4921509J17Rik -0.13434154 1456953_at -0.13416412 Pdk1 -0.13373436 Kcnt2 -0.13347845 Lactb2 -0.13330984 1110018F16Rik -0.13326876 1443960_at -0.13298818 37688 -0.1329563 1435120_at -0.13213077 2610201A13Rik -0.13123113 Adamts1 -0.13085169 5530402H23Rik -0.13078289 AI591476 -0.13057259 5430405N12Rik -0.13042091 2810455D13Rik -0.13005346 Thy1 -0.12933767 1440363_at -0.12827721 2900078E11Rik -0.12822807 A530017D24Rik -0.12799379 Camk2d -0.12790267 Sdc2 -0.12789321 2900064F13Rik -0.12728642 Edg1 -0.12726152 Id3 -0.12700671 Hist1h1c -0.12638772 Cpeb1 -0.12625554 E130309B19Rik -0.12600464 1460043_at -0.12571205 C030014L02 -0.12570724 Eif2s3y -0.12567759 Nras -0.12548214 Adam10 -0.12532562 1457832_at -0.12527294 Thrsp -0.12503795 Neurod6 -0.124976315 2900041A09Rik -0.1249699 Hdgfrp3 /// Tm6sf1 -0.124694645

155

Name Score 1443196_at -0.12461962 Ttpa -0.12452247 Kcne2 -0.12445941 1455406_at -0.12410688 Ap3m1 /// LOC671800 -0.12350894 Cav2 -0.12339597 1450693_at -0.1231813 2900086B20Rik -0.123049766 Zfy2 -0.12304054 1436412_at -0.12279823 Pla2g7 -0.12031193 Hist1h2bc /// Hist1h2be /// Hist1h2bl /// Hist1h2bm /// Hist1h2bp /// LOC665596 /// LOC665622 /// LOC671645 -0.12027094 Armc1 /// LOC634390 -0.12002038 Parvb -0.11999683 Ankrd29 -0.119841605 1455074_at -0.11951268 1700066M21Rik -0.11926441 Dok4 -0.1186251 Itpka -0.11824521 LOC669787 -0.11769759 D10627 -0.11716637 1455374_at -0.1171052 Rdh9 -0.116936006 1434861_at -0.11672797 LOC666801 /// LOC669012 /// LOC672036 -0.11618908 Pnoc -0.11589195 Slc25a16 -0.11578711 Slc39a12 -0.11564604 Hapln1 -0.11563554 C030009O12Rik -0.11559686 Lrp4 -0.11532145 D7Ertd715e -0.115137845 AI503301 -0.11448379 AFFX-18SRNAMur/X00686_5_at -0.11423634 Gabra2 -0.11412726 Pdk4 -0.11353026 Gm879 -0.11335074 BC049806 -0.112569995 1439300_at -0.11253192

156

Name Score BB182297 -0.11220863 LOC433230 -0.112040386 5730499H23Rik -0.11170812 Mobkl1a -0.11163051 Mtap2 /// A730034C02 -0.111579075 Ptprg -0.1113335 Prkcc -0.111270785 AI448984 -0.11106875 Hectd2 -0.1110441 Gem -0.11095785 1452886_at -0.11075944 4933406J04Rik -0.11043119 Pcdha4 /// Pcdha6 /// Pcdha7 /// Pcdha5 /// Pcdha11 /// Pcdha10 /// Pcdha1 /// Pcdha9 /// Pcdha@ /// Pcdha3 /// Pcdha12 /// Pcdha2 /// Pcdha8 /// Pcdhac1 /// Pcdhac2 -0.1097385 Efemp1 -0.10955043 Gabra1 -0.10937475 1445421_at -0.10936063 Trpc1 -0.10925758 1441905_x_at -0.108643666 1440305_at -0.10850036 Pthlh -0.1082409 AI851453 -0.10820619 Calm3 -0.10803136 Tshz2 -0.1077434 Hmox1 -0.107658476 Rfx4 -0.10753904 3110035E14Rik -0.10737101 Stk24 -0.10729288 Sp3 -0.10726867 Setd7 -0.10717848 Rab21 -0.10695588 Itgb8 -0.10670135 Nkd1 /// LOC634379 /// LOC671838 -0.10648793 Fxyd7 -0.106318675 Rock2 -0.105685994 2610209A20Rik -0.10561517 9330118A15Rik -0.10546716 1700047I17Rik /// LOC665155 -0.105380155 Ankib1 -0.10530036

157

Name Score 1440759_at -0.105208576 Cutc -0.10498504 Dfna5h -0.10485709 Zbtb41 -0.104703836 Amy2 -0.10452834 Abhd3 -0.10450386 Rmnd5a -0.10439554 B230343J05Rik -0.10425444 BC023892 -0.10417433 Myl9 -0.1038725 2900019E01Rik -0.10381727 Stk32a -0.103583135 Acsbg1 -0.10350252 Dnajb14 -0.10332526 Tax1bp1 -0.10313047 Cntn4 -0.10289702 1442867_at -0.10280334 Lpl -0.102587014 1110020G09Rik -0.1025681 9330184L24Rik -0.10249032 2900084O13Rik -0.10247687 Cmtm6 -0.102445714 1444602_at -0.102335356 Cldn10 -0.10200441 Cth -0.10199171 Tnrc15 -0.10190366 Fut9 -0.101445146 Cacng3 -0.10143349 AI608492 -0.101005144 Crim1 -0.10091354 Axl -0.10087706 Lats1 -0.100807026 LOC674888 -0.10061945 Satb1 -0.1003515 Ak5 -0.10030998 Garnl3 -0.10002143 2410078J06Rik -0.09984514 6330407I18Rik -0.09976694 Zfp81 -0.09959218 Nav3 -0.09946574

158

Name Score F3 -0.099333115 Asph -0.09914524 9930028C20Rik -0.0991053 1417769_at -0.098864965 Tnpo1 -0.098812066 H1foo -0.098730296 Timp3 -0.09870146 Grin3a -0.0986072 Ankrd43 -0.098544195 2810019C22Rik -0.09827948 1700020I14Rik -0.098234616 Syt13 -0.09788909 Tacc1 -0.09782982 AU023006 -0.097667135 Usp25 -0.097452596 Cpt1a -0.09743322 AI504432 -0.09743308 1445686_at -0.09742651 Trove2 -0.09731496 1458046_at -0.09703266 BC023179 -0.096960805 Acadl -0.096942864 37871 -0.09689227 Rpl5 /// LOC382740 /// LOC665407 /// LOC668032 /// LOC672748 /// LOC675821 -0.09672272 1431274_a_at -0.09660724 6430502M16Rik -0.09644795

159

References

Aid, T., Kazantseva, A., Piirsoo, M., Palm, K. and Timmusk, T. (2007) Mouse and rat BDNF gene structure and expression revisited. J Neurosci Res 85, 525- 535.

Al-Hallaq, R. A., Conrads, T. P., Veenstra, T. D. and Wenthold, R. J. (2007) NMDA di-heteromeric receptor populations and associated proteins in rat hippocampus. J Neurosci 27, 8334-8343.

Al-Hallaq, R. A., Jarabek, B. R., Fu, Z., Vicini, S., Wolfe, B. B. and Yasuda, R. P. (2002) Association of NR3A with the N-methyl-D-aspartate receptor NR1 and NR2 subunits. Mol Pharmacol 62, 1119-1127.

Al-Mubarak, B., Soriano, F. X. and Hardingham, G. E. (2009) Synaptic NMDAR activity suppresses FOXO1 expression via a cis-acting FOXO binding site: FOXO1 is a FOXO target gene. Channels (Austin) 3, 233-238.

Alberini, C. M. (2009) Transcription factors in long-term memory and synaptic plasticity. Physiol Rev 89, 121-145.

Alboni, S., Benatti, C., Capone, G., Corsini, D., Caggia, F., Tascedda, F., Mendlewicz, J. and Brunello, N. (2010) Time-dependent effects of escitalopram on brain derived neurotrophic factor (BDNF) and neuroplasticity related targets in the central nervous system of rats. European Journal of Pharmacology 643, 180-187.

An, W. F., Bowlby, M. R., Betty, M., Cao, J., Ling, H. P., Mendoza, G., Hinson, J. W., Mattsson, K. I., Strassle, B. W., Trimmer, J. S. and Rhodes, K. J. (2000) Modulation of A-type potassium channels by a family of calcium sensors. Nature 403, 553-556.

Arsenian, S., Weinhold, B., Oelgeschläger, M., Rüther, U. and Nordheim, A. (1998) Serum response factor is essential for mesoderm formation during mouse embryogenesis. The EMBO Journal 17, 6289-6299.

Bading, H., Ginty, D. D. and Greenberg, M. E. (1993) Regulation of gene expression in hippocampal neurons by distinct calcium signaling pathways. Science 260, 181-186.

Bading, H., Segal, M. M., Sucher, N. J., Dudek, H., Lipton, S. A. and Greenberg, M. E. (1995) N-methyl-D-aspartate receptors are critical for mediating the effects of glutamate on intracellular calcium concentration and immediate early gene expression in cultured hippocampal neurons. Neuroscience 64, 653-664.

160

Balkowiec, A. and Katz, D. M. (2000) Activity-dependent release of endogenous brain-derived neurotrophic factor from primary sensory neurons detected by ELISA in situ. J Neurosci 20, 7417-7423.

Bartel, D. P., Sheng, M., Lau, L. F. and Greenberg, M. E. (1989) Growth factors and membrane depolarization activate distinct programs of early response gene expression: dissociation of fos and jun induction. Genes Dev 3, 304-313.

Bayer, K. U., De Koninck, P., Leonard, A. S., Hell, J. W. and Schulman, H. (2001) Interaction with the NMDA receptor locks CaMKII in an active conformation. Nature 411, 801-805.

Bayer, K. U. and Schulman, H. (2001) Regulation of signal transduction by protein targeting: the case for CaMKII. Biochem Biophys Res Commun 289, 917-923.

Bean, B. P., Nowycky, M. C. and Tsien, R. W. (1984) Beta-adrenergic modulation of calcium channels in frog ventricular heart cells. Nature 307, 371-375.

Beissbarth, T. and Speed, T. P. (2004) GOstat: find statistically overrepresented Gene Ontologies within a group of genes. Bioinformatics (Oxford, England) 20, 1464-1465.

Belfield, J. L., Whittaker, C., Cader, M. Z. and Chawla, S. (2006) Differential effects of Ca2+ and cAMP on transcription mediated by MEF2D and cAMP-response element-binding protein in hippocampal neurons. J Biol Chem 281, 27724-27732.

Benedito, A. B., Lehtinen, M., Massol, R., Lopes, U. G., Kirchhausen, T., Rao, A. and Bonni, A. (2005) The transcription factor NFAT3 mediates neuronal survival. J Biol Chem 280, 2818-2825.

Benito, E. and Barco, A. (2010) CREB's control of intrinsic and synaptic plasticity: implications for CREB-dependent memory models. Trends Neurosci 33, 230-240.

Bernstein, B. E., Meissner, A. and Lander, E. S. (2007) The mammalian epigenome. Cell 128, 669-681.

Berridge, M. J. (2002) The endoplasmic reticulum: a multifunctional signaling organelle. Cell Calcium 32, 235-249.

Bito, H., Deisseroth, K. and Tsien, R. W. (1996) CREB phosphorylation and dephosphorylation: a Ca(2+)- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87, 1203-1214.

Bleckmann, S. C., Blendy, J. A., Rudolph, D., Monaghan, A. P., Schmid, W. and Schütz, G. (2002) Activating transcription factor 1 and CREB are

161

important for cell survival during early mouse development. Mol Cell Biol 22, 1919-1925.

Bolstad, B. M. (2003) RMA Express. In: http://rmaexpress.bmbolstad.com/.

Bolstad, B. M., Irizarry, R. A., Astrand, M. and Speed, T. P. (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics (Oxford, England) 19, 185-193.

Borodinsky, L. N., Root, C. M., Cronin, J. A., Sann, S. B., Gu, X. and Spitzer, N. C. (2004) Activity-dependent homeostatic specification of transmitter expression in embryonic neurons. Nature 429, 523-530.

Bradley, J., Carter, S. R., Rao, V. R., Wang, J. and Finkbeiner, S. (2006) Splice variants of the NR1 subunit differentially induce NMDA receptor- dependent gene expression. J Neurosci 26, 1065-1076.

Brakeman, P. R., Lanahan, A. A., O'Brien, R., Roche, K., Barnes, C. A., Huganir, R. L. and Worley, P. F. (1997) Homer: a protein that selectively binds metabotropic glutamate receptors. Nature 386, 284-288.

Brosenitsch, T. A. and Katz, D. M. (2001) Physiological patterns of electrical stimulation can induce neuronal gene expression by activating N-type calcium channels. J Neurosci 21, 2571-2579.

Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J. and Greenberg, M. E. (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857-868.

Brunet, A., Sweeney, L. B., Sturgill, J. F., Chua, K. F., Greer, P. L., Lin, Y., Tran, H., Ross, S. E., Mostoslavsky, R., Cohen, H. Y., Hu, L. S., Cheng, H.-L., Jedrychowski, M. P., Gygi, S. P., Sinclair, D. A., Alt, F. W. and Greenberg, M. E. (2004) Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303, 2011-2015.

Buchwalter, G., Gross, C. and Wasylyk, B. (2004) Ets ternary complex transcription factors. Gene 324, 1-14.

Buratowski, S. (2009) Progression through the RNA polymerase II CTD cycle. Molecular Cell 36, 541-546.

Burgoyne, R. D. (2007) Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat Rev Neurosci 8, 182-193.

Burrone, J. and Murthy, V. N. (2003) Synaptic gain control and homeostasis. Curr Opin Neurobiol 13, 560-567.

162

Buxbaum, J. D., Choi, E. K., Luo, Y., Lilliehook, C., Crowley, A. C., Merriam, D. E. and Wasco, W. (1998) Calsenilin: a calcium-binding protein that interacts with the presenilins and regulates the levels of a presenilin fragment. Nat Med 4, 1177-1181.

Cannon, W. (1932) The wisdom of the body. The American Journal of the Medical Sciences.

Carrión, A. M., Link, W. A., Ledo, F., Mellström, B. and Naranjo, J. R. (1999) DREAM is a Ca2+-regulated transcriptional repressor. Nature 398, 80-84.

Catterall, W. A. (2000) Structure and regulation of voltage-gated Ca2+ channels. Annu Rev Cell Dev Biol 16, 521-555.

Cesari, F., Brecht, S., Vintersten, K., Vuong, L. G., Hofmann, M., Klingel, K., Schnorr, J.-J., Arsenian, S., Schild, H., Herdegen, T., Wiebel, F. F. and Nordheim, A. (2004) Mice deficient for the ets transcription factor elk-1 show normal immune responses and mildly impaired neuronal gene activation. Mol Cell Biol 24, 294-305.

Chan, S. F. and Sucher, N. J. (2001) An NMDA receptor signaling complex with protein phosphatase 2A. J Neurosci 21, 7985-7992.

Chang, K. T. and Berg, D. K. (2001) Voltage-gated channels block nicotinic regulation of CREB phosphorylation and gene expression in neurons. Neuron 32, 855-865.

Chang, M. C., Park, J. M., Pelkey, K. A., Grabenstatter, H. L., Xu, D., Linden, D. J., Sutula, T. P., McBain, C. J. and Worley, P. F. (2010) Narp regulates homeostatic scaling of excitatory synapses on parvalbumin-expressing interneurons. Nat Neurosci.

Chawla, S., Vanhoutte, P., Arnold, F. J. L., Huang, C. L.-H. and Bading, H. (2003) Neuronal activity-dependent nucleocytoplasmic shuttling of HDAC4 and HDAC5. J Neurochem 85, 151-159.

Chen, H. J., Rojas-Soto, M., Oguni, A. and Kennedy, M. B. (1998) A synaptic Ras- GTPase activating protein (p135 SynGAP) inhibited by CaM kinase II. Neuron 20, 895-904.

Chen, R. H., Abate, C. and Blenis, J. (1993) Phosphorylation of the c-Fos transrepression domain by mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase. Proc Natl Acad Sci USA 90, 10952-10956.

Chen, W. G., West, A. E., Tao, X., Corfas, G., Szentirmay, M. N., Sawadogo, M., Vinson, C. and Greenberg, M. E. (2003) Upstream stimulatory factors are mediators of Ca2+-responsive transcription in neurons. J Neurosci 23, 2572-2581.

163

Chen, Y.-H., Li, M.-H., Zhang, Y., He, L.-L., Yamada, Y., Fitzmaurice, A., Shen, Y., Zhang, H., Tong, L. and Yang, J. (2004) Structural basis of the alpha1- beta subunit interaction of voltage-gated Ca2+ channels. Nature 429, 675- 680.

Chen, Z.-Y., Jing, D., Bath, K. G., Ieraci, A., Khan, T., Siao, C.-J., Herrera, D. G., Toth, M., Yang, C., McEwen, B. S., Hempstead, B. L. and Lee, F. S. (2006) Genetic variant BDNF (Val66Met) polymorphism alters anxiety-related behavior. Science 314, 140-143.

Cheng, C., Fass, D. M. and Reynolds, I. J. (1999) Emergence of excitotoxicity in cultured forebrain neurons coincides with larger glutamate-stimulated [Ca(2+)](i) increases and NMDA receptor mRNA levels. Brain Res 849, 97- 108.

Cheng, H.-Y. M., Pitcher, G. M., Laviolette, S. R., Whishaw, I. Q., Tong, K. I., Kockeritz, L. K., Wada, T., Joza, N. A., Crackower, M., Goncalves, J., Sarosi, I., Woodgett, J. R., Oliveira-dos-Santos, A. J., Ikura, M., van der Kooy, D., Salter, M. W. and Penninger, J. M. (2002) DREAM is a critical transcriptional repressor for pain modulation. Cell 108, 31-43.

Choi, D. W. (1988a) Calcium-mediated neurotoxicity: relationship to specific channel types and role in ischemic damage. Trends Neurosci 11, 465-469.

Choi, D. W. (1988b) Glutamate neurotoxicity and diseases of the nervous system. Neuron 1, 623-634.

Chrivia, J. C., Kwok, R. P., Lamb, N., Hagiwara, M., Montminy, M. R. and Goodman, R. H. (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365, 855-859.

Ciabarra, A. M., Sullivan, J. M., Gahn, L. G., Pecht, G., Heinemann, S. and Sevarino, K. A. (1995) Cloning and characterization of chi-1: a developmentally regulated member of a novel class of the ionotropic glutamate receptor family. J Neurosci 15, 6498-6508.

Clapham, D. E. (2007) Calcium signaling. Cell 131, 1047-1058.

Clayton, A. L., Hazzalin, C. A. and Mahadevan, L. C. (2006) Enhanced histone acetylation and transcription: a dynamic perspective. Molecular Cell 23, 289-296.

Clements, J. D. and Westbrook, G. L. (1991) Activation kinetics reveal the number of glutamate and glycine binding sites on the N-methyl-D-aspartate receptor. Neuron 7, 605-613.

Coba, M. P., Valor, L. M., Kopanitsa, M. V., Afinowi, N. O. and Grant, S. G. N. (2008) Kinase networks integrate profiles of N-methyl-D-aspartate

164

receptor-mediated gene expression in hippocampus. J Biol Chem 283, 34101-34107.

Cole, A. J., Saffen, D. W., Baraban, J. M. and Worley, P. F. (1989) Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature 340, 474-476.

Collingridge, G. L., Kehl, S. J. and McLennan, H. (1983a) Excitatory amino acids in synaptic transmission in the Schaffer collateral-commissural pathway of the rat hippocampus. The Journal of Physiology 334, 33-46.

Collingridge, G. L., Kehl, S. J. and McLennan, H. (1983b) The antagonism of amino acid-induced excitations of rat hippocampal CA1 neurones in vitro. The Journal of Physiology 334, 19-31.

Collingridge, G. L., Olsen, R. W., Peters, J. and Spedding, M. (2009) A nomenclature for ligand-gated ion channels. Neuropharmacology 56, 2-5.

Collingridge, G. L. and Singer, W. (1990) Excitatory amino acid receptors and synaptic plasticity. Trends Pharmacol Sci 11, 290-296.

Conkright, M. D., Canettieri, G., Screaton, R., Guzman, E., Miraglia, L., Hogenesch, J. B. and Montminy, M. (2003) TORCs: transducers of regulated CREB activity. Molecular Cell 12, 413-423.

Corneliussen, B., Holm, M., Waltersson, Y., Onions, J., Hallberg, B., Thornell, A. and Grundström, T. (1994) Calcium/calmodulin inhibition of basic-helix- loop-helix transcription factor domains. Nature 368, 760-764.

Corriveau, R. A., Huh, G. S. and Shatz, C. J. (1998) Regulation of class I MHC gene expression in the developing and mature CNS by neural activity. Neuron 21, 505-520.

Cottrell, J. R., Borok, E., Horvath, T. L. and Nedivi, E. (2004) CPG2: a brain- and synapse-specific protein that regulates the endocytosis of glutamate receptors. Neuron 44, 677-690.

Cox, L. J., Hengst, U., Gurskaya, N. G., Lukyanov, K. A. and Jaffrey, S. R. (2008) Intra-axonal translation and retrograde trafficking of CREB promotes neuronal survival. Nat Cell Biol 10, 149-159.

Cull-Candy, S., Brickley, S. and Farrant, M. (2001) NMDA receptor subunits: diversity, development and disease. Curr Opin Neurobiol 11, 327-335.

Cullen, P. J. and Lockyer, P. J. (2002) Integration of calcium and Ras signalling. Nat Rev Mol Cell Biol 3, 339-348.

Dai, S., Hall, D. D. and Hell, J. W. (2009) Supramolecular assemblies and localized regulation of voltage-gated ion channels. Physiol Rev 89, 411-452.

165

Dalton, S. and Treisman, R. (1992) Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell 68, 597-612.

Dalva, M. B., Takasu, M. A., Lin, M. Z., Shamah, S. M., Hu, L., Gale, N. W. and Greenberg, M. E. (2000) EphB receptors interact with NMDA receptors and regulate excitatory synapse formation. Cell 103, 945-956.

Das, S., Sasaki, Y. F., Rothe, T., Premkumar, L. S., Takasu, M., Crandall, J. E., Dikkes, P., Conner, D. A., Rayudu, P. V., Cheung, W., Chen, H. S., Lipton, S. A. and Nakanishi, N. (1998) Increased NMDA current and spine density in mice lacking the NMDA receptor subunit NR3A. Nature 393, 377-381.

De Jongh, K. S., Colvin, A. A., Wang, K. K. and Catterall, W. A. (1994) Differential proteolysis of the full-length form of the L-type calcium channel alpha 1 subunit by calpain. J Neurochem 63, 1558-1564.

Deisseroth, K., Bito, H. and Tsien, R. W. (1996) Signaling from synapse to nucleus: postsynaptic CREB phosphorylation during multiple forms of hippocampal synaptic plasticity. Neuron 16, 89-101.

Deisseroth, K., Heist, E. K. and Tsien, R. W. (1998) Translocation of calmodulin to the nucleus supports CREB phosphorylation in hippocampal neurons. Nature 392, 198-202.

Dennis, K. E. and Levitt, P. (2005) Regional expression of brain derived neurotrophic factor (BDNF) is correlated with dynamic patterns of promoter methylation in the developing mouse forebrain. Brain research Molecular brain research 140, 1-9.

Dick, O. and Bading, H. (2010) Synaptic activity and nuclear calcium signaling protect hippocampal neurons from death signal-associated nuclear translocation of FoxO3a induced by extrasynaptic N-methyl-D-aspartate receptors. J Biol Chem 285, 19354-19361.

Dieterich, D. C., Karpova, A., Mikhaylova, M., Zdobnova, I., König, I., Landwehr, M., Kreutz, M., Smalla, K.-H., Richter, K., Landgraf, P., Reissner, C., Boeckers, T. M., Zuschratter, W., Spilker, C., Seidenbecher, C. I., Garner, C. C., Gundelfinger, E. D. and Kreutz, M. R. (2008) Caldendrin-Jacob: a protein liaison that couples NMDA receptor signalling to the nucleus. PLoS Biol 6, e34.

Dingledine, R., Borges, K., Bowie, D. and Traynelis, S. F. (1999) The glutamate receptor ion channels. Pharmacol Rev 51, 7-61.

Dolmetsch, R. E., Pajvani, U., Fife, K., Spotts, J. M. and Greenberg, M. E. (2001) Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway. Science 294, 333-339.

166

Dolphin, A. C. (2009) Calcium channel diversity: multiple roles of calcium channel subunits. Curr Opin Neurobiol 19, 237-244.

Dragunow, M., Xu, R., Walton, M., Woodgate, A., Lawlor, P., MacGibbon, G. A., Young, D., Gibbons, H., Lipski, J., Muravlev, A., Pearson, A. and During, M. (2000) c-Jun promotes neurite outgrowth and survival in PC12 cells. Brain Res Mol Brain Res 83, 20-33.

Egan, M. F., Kojima, M., Callicott, J. H., Goldberg, T. E., Kolachana, B. S., Bertolino, A., Zaitsev, E., Gold, B., Goldman, D., Dean, M., Lu, B. and Weinberger, D. R. (2003) The BDNF val66met polymorphism affects activity-dependent secretion of BDNF and human memory and hippocampal function. Cell 112, 257-269.

Etkin, A., Alarcón, J. M., Weisberg, S. P., Touzani, K., Huang, Y. Y., Nordheim, A. and Kandel, E. R. (2006) A role in learning for SRF: deletion in the adult forebrain disrupts LTD and the formation of an immediate memory of a novel context. Neuron 50, 127-143.

Fagiolini, M., Fritschy, J.-M., Löw, K., Möhler, H., Rudolph, U. and Hensch, T. K. (2004) Specific GABAA circuits for visual cortical plasticity. Science 303, 1681-1683.

Farnsworth, C. L., Freshney, N. W., Rosen, L. B., Ghosh, A., Greenberg, M. E. and Feig, L. A. (1995) Calcium activation of Ras mediated by neuronal exchange factor Ras-GRF. Nature 376, 524-527.

Flavell, S. W., Cowan, C. W., Kim, T.-K., Greer, P. L., Lin, Y., Paradis, S., Griffith, E. C., Hu, L. S., Chen, C. and Greenberg, M. E. (2006) Activity-dependent regulation of MEF2 transcription factors suppresses excitatory synapse number. Science 311, 1008-1012.

Flavell, S. W., Kim, T.-K., Gray, J. M., Harmin, D. A., Hemberg, M., Hong, E. J., Markenscoff-Papadimitriou, E., Bear, D. M. and Greenberg, M. E. (2008) Genome-wide analysis of MEF2 transcriptional program reveals synaptic target genes and neuronal activity-dependent polyadenylation site selection. Neuron 60, 1022-1038.

Flint, A. C., Maisch, U. S., Weishaupt, J. H., Kriegstein, A. R. and Monyer, H. (1997) NR2A subunit expression shortens NMDA receptor synaptic currents in developing neocortex. J Neurosci 17, 2469-2476.

Frey, U. and Morris, R. G. (1997) Synaptic tagging and long-term potentiation. Nature 385, 533-536.

Gardoni, F., Schrama, L. H., Kamal, A., Gispen, W. H., Cattabeni, F. and Di Luca, M. (2001) Hippocampal synaptic plasticity involves competition between Ca2+/calmodulin-dependent protein kinase II and postsynaptic density

167

95 for binding to the NR2A subunit of the NMDA receptor. J Neurosci 21, 1501-1509.

Gardoni, F., Schrama, L. H., van Dalen, J. J., Gispen, W. H., Cattabeni, F. and Di Luca, M. (1999) AlphaCaMKII binding to the C-terminal tail of NMDA receptor subunit NR2A and its modulation by autophosphorylation. FEBS Lett 456, 394-398.

Gau, D., Lemberger, T., von Gall, C., Kretz, O., Le Minh, N., Gass, P., Schmid, W., Schibler, U., Korf, H. W. and Schütz, G. (2002) Phosphorylation of CREB Ser142 regulates light-induced phase shifts of the circadian clock. Neuron 34, 245-253.

Geiger, J. R., Melcher, T., Koh, D. S., Sakmann, B., Seeburg, P. H., Jonas, P. and Monyer, H. (1995) Relative abundance of subunit mRNAs determines gating and Ca2+ permeability of AMPA receptors in principal neurons and interneurons in rat CNS. Neuron 15, 193-204.

Genoud, C., Knott, G. W., Sakata, K., Lu, B. and Welker, E. (2004) Altered synapse formation in the adult somatosensory cortex of brain-derived neurotrophic factor heterozygote mice. J Neurosci 24, 2394-2400.

Gerhardstein, B. L., Gao, T., Bünemann, M., Puri, T. S., Adair, A., Ma, H. and Hosey, M. M. (2000) Proteolytic processing of the C terminus of the alpha(1C) subunit of L-type calcium channels and the role of a proline- rich domain in membrane tethering of proteolytic fragments. J Biol Chem 275, 8556-8563.

Ghosh, A., Carnahan, J. and Greenberg, M. E. (1994a) Requirement for BDNF in activity-dependent survival of cortical neurons. Science 263, 1618-1623.

Ghosh, A., Ginty, D. D., Bading, H. and Greenberg, M. E. (1994b) Calcium regulation of gene expression in neuronal cells. J Neurobiol 25, 294-303.

Ghosh, A. and Greenberg, M. E. (1995) Calcium signaling in neurons: molecular mechanisms and cellular consequences. Science 268, 239-247.

Gille, H., Sharrocks, A. D. and Shaw, P. E. (1992) Phosphorylation of transcription factor p62TCF by MAP kinase stimulates ternary complex formation at c-fos promoter. Nature 358, 414-417.

Ginty, D. D. (1997) Calcium regulation of gene expression: isn't that spatial? Neuron 18, 183-186.

Gomez-Ospina, N., Tsuruta, F., Barreto-Chang, O., Hu, L. and Dolmetsch, R. (2006) The C terminus of the L-type voltage-gated calcium channel Ca(V)1.2 encodes a transcription factor. Cell 127, 591-606.

168

Gonzalez, G. A. and Montminy, M. R. (1989) Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59, 675- 680.

Goodman, R. H. and Smolik, S. (2000) CBP/p300 in cell growth, transformation, and development. Genes Dev 14, 1553-1577.

Gossett, L. A., Kelvin, D. J., Sternberg, E. A. and Olson, E. N. (1989) A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes. Mol Cell Biol 9, 5022-5033.

Graef, I. A., Mermelstein, P. G., Stankunas, K., Neilson, J. R., Deisseroth, K., Tsien, R. W. and Crabtree, G. R. (1999) L-type calcium channels and GSK- 3 regulate the activity of NF-ATc4 in hippocampal neurons. Nature 401, 703-708.

Graef, I. A., Wang, F., Charron, F., Chen, L., Neilson, J., Tessier-Lavigne, M. and Crabtree, G. R. (2003) Neurotrophins and netrins require calcineurin/NFAT signaling to stimulate outgrowth of embryonic axons. Cell 113, 657-670.

Gray, R. and Johnston, D. (1987) Noradrenaline and beta-adrenoceptor agonists increase activity of voltage-dependent calcium channels in hippocampal neurons. Nature 327, 620-622.

Green, E. M., Barrett, C. F., Bultynck, G., Shamah, S. M. and Dolmetsch, R. E. (2007) The tumor suppressor eIF3e mediates calcium-dependent internalization of the L-type calcium channel CaV1.2. Neuron 55, 615-632.

Greenberg, M. E., Ziff, E. B. and Greene, L. A. (1986) Stimulation of neuronal acetylcholine receptors induces rapid gene transcription. Science 234, 80- 83.

Greer, P. L. and Greenberg, M. E. (2008) From synapse to nucleus: calcium- dependent gene transcription in the control of synapse development and function. Neuron 59, 846-860.

Greer, P. L., Hanayama, R., Bloodgood, B. L., Mardinly, A. R., Lipton, D. M., Flavell, S. W., Kim, T.-K., Griffith, E. C., Waldon, Z., Maehr, R., Ploegh, H. L., Chowdhury, S., Worley, P. F., Steen, J. and Greenberg, M. E. (2010) The Angelman Syndrome protein Ube3A regulates synapse development by ubiquitinating arc. Cell 140, 704-716.

Grégoire, S., Tremblay, A. M., Xiao, L., Yang, Q., Ma, K., Nie, J., Mao, Z., Wu, Z., Giguère, V. and Yang, X.-J. (2006) Control of MEF2 transcriptional activity by coordinated phosphorylation and sumoylation. J Biol Chem 281, 4423- 4433.

169

Groc, L., Heine, M., Cousins, S. L., Stephenson, F. A., Lounis, B., Cognet, L. and Choquet, D. (2006) NMDA receptor surface mobility depends on NR2A- 2B subunits. Proc Natl Acad Sci USA 103, 18769-18774.

Guan, Z., Saraswati, S., Adolfsen, B. and Littleton, J. T. (2005) Genome-wide transcriptional changes associated with enhanced activity in the Drosophila nervous system. Neuron 48, 91-107.

Guerrini, L., Blasi, F. and Denis-Donini, S. (1995) Synaptic activation of NF-kappa B by glutamate in cerebellar granule neurons in vitro. Proc Natl Acad Sci USA 92, 9077-9081.

Gwack, Y., Sharma, S., Nardone, J., Tanasa, B., Iuga, A., Srikanth, S., Okamura, H., Bolton, D., Feske, S., Hogan, P. G. and Rao, A. (2006) A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulators of NFAT. Nature 441, 646-650.

Han, J., Jiang, Y., Li, Z., Kravchenko, V. V. and Ulevitch, R. J. (1997) Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature 386, 296-299.

Hardingham, G. E., Arnold, F. J. and Bading, H. (2001) Nuclear calcium signaling controls CREB-mediated gene expression triggered by synaptic activity. Nat Neurosci 4, 261-267.

Hardingham, G. E. and Bading, H. (2002) Coupling of extrasynaptic NMDA receptors to a CREB shut-off pathway is developmentally regulated. Biochim Biophys Acta 1600, 148-153.

Hardingham, G. E. and Bading, H. (2003) The Yin and Yang of NMDA receptor signalling. Trends Neurosci 26, 81-89.

Hardingham, G. E. and Bading, H. (2010) Synaptic versus extrasynaptic NMDA receptor signalling: implications for neurodegenerative disorders. Nat Rev Neurosci 11, 682-696.

Hardingham, G. E., Chawla, S., Johnson, C. M. and Bading, H. (1997) Distinct functions of nuclear and cytoplasmic calcium in the control of gene expression. Nature 385, 260-265.

Hardingham, G. E., Fukunaga, Y. and Bading, H. (2002) Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-off and cell death pathways. Nat Neurosci 5, 405-414.

Harris, A. Z. and Pettit, D. L. (2007) Extrasynaptic and synaptic NMDA receptors form stable and uniform pools in rat hippocampal slices. J Physiol (Lond) 584, 509-519.

170

Heintzman, N. D., Stuart, R. K., Hon, G., Fu, Y., Ching, C. W., Hawkins, R. D., Barrera, L. O., Van Calcar, S., Qu, C., Ching, K. A., Wang, W., Weng, Z., Green, R. D., Crawford, G. E. and Ren, B. (2007) Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet 39, 311-318.

Hell, J. W., Westenbroek, R. E., Warner, C., Ahlijanian, M. K., Prystay, W., Gilbert, M. M., Snutch, T. P. and Catterall, W. A. (1993a) Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel alpha 1 subunits. J Cell Biol 123, 949-962.

Hell, J. W., Yokoyama, C. T., Wong, S. T., Warner, C., Snutch, T. P. and Catterall, W. A. (1993b) Differential phosphorylation of two size forms of the neuronal class C L-type calcium channel alpha 1 subunit. J Biol Chem 268, 19451-19457.

Hérault, Y., Beckers, J., Gérard, M. and Duboule, D. (1999) Hox gene expression in limbs: colinearity by opposite regulatory controls. Dev Biol 208, 157- 165.

Herdegen, T. and Leah, J. D. (1998) Inducible and constitutive transcription factors in the mammalian nervous system: control of gene expression by Jun, Fos and Krox, and CREB/ATF proteins. Brain Res Brain Res Rev 28, 370-490.

Hevers, W. and Lüddens, H. (1998) The diversity of GABAA receptors. Pharmacological and electrophysiological properties of GABAA channel subtypes. Molecular Neurobiology 18, 35-86.

Hevroni, D., Rattner, A., Bundman, M., Lederfein, D., Gabarah, A., Mangelus, M., Silverman, M. A., Kedar, H., Naor, C., Kornuc, M., Hanoch, T., Seger, R., Theill, L. E., Nedivi, E., Richter-Levin, G. and Citri, Y. (1998) Hippocampal plasticity involves extensive gene induction and multiple cellular mechanisms. J Mol Neurosci 10, 75-98.

Hill, C. S. and Treisman, R. (1999) Growth factors and gene expression: fresh insights from arrays. Sci STKE 1999, PE1.

Hogan, P. G., Chen, L., Nardone, J. and Rao, A. (2003) Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev 17, 2205-2232.

Hogan, P. G., Lewis, R. S. and Rao, A. (2010) Molecular basis of calcium signaling in lymphocytes: STIM and ORAI. Annu Rev Immunol 28, 491-533.

Hollmann, M., Boulter, J., Maron, C., Beasley, L., Sullivan, J., Pecht, G. and Heinemann, S. (1993) Zinc potentiates agonist-induced currents at certain splice variants of the NMDA receptor. Neuron 10, 943-954.

171

Hong, E. J., Mccord, A. E. and Greenberg, M. E. (2008) A biological function for the neuronal activity-dependent component of Bdnf transcription in the development of cortical inhibition. Neuron 60, 610-624.

Hoogland, T. M. and Saggau, P. (2004) Facilitation of L-type Ca2+ channels in dendritic spines by activation of beta2 adrenergic receptors. Journal of Neuroscience 24, 8416-8427.

Horn, P. J. and Peterson, C. L. (2002) Molecular biology. Chromatin higher order folding--wrapping up transcription. Science 297, 1824-1827.

Hu, M., Liu, Q.-s., Chang, K. T. and Berg, D. K. (2002) Nicotinic regulation of CREB activation in hippocampal neurons by glutamatergic and nonglutamatergic pathways. Mol Cell Neurosci 21, 616-625.

Huang, Z. J., Kirkwood, A., Pizzorusso, T., Porciatti, V., Morales, B., Bear, M. F., Maffei, L. and Tonegawa, S. (1999) BDNF regulates the maturation of inhibition and the critical period of plasticity in mouse visual cortex. Cell 98, 739-755.

Hulme, J. T., Lin, T. W.-C., Westenbroek, R. E., Scheuer, T. and Catterall, W. A. (2003) Beta-adrenergic regulation requires direct anchoring of PKA to cardiac CaV1.2 channels via a leucine zipper interaction with A kinase- anchoring protein 15. Proc Natl Acad Sci USA 100, 13093-13098.

Hyman, S. E., Comb, M., Lin, Y. S., Pearlberg, J., Green, M. R. and Goodman, H. M. (1988) A common trans-acting factor is involved in transcriptional regulation of neurotransmitter genes by cyclic AMP. Mol Cell Biol 8, 4225- 4233.

Impey, S., Fong, A. L., Wang, Y., Cardinaux, J. R., Fass, D. M., Obrietan, K., Wayman, G. A., Storm, D. R., Soderling, T. R. and Goodman, R. H. (2002) Phosphorylation of CBP mediates transcriptional activation by neural activity and CaM kinase IV. Neuron 34, 235-244.

Ingi, T., Krumins, A. M., Chidiac, P., Brothers, G. M., Chung, S., Snow, B. E., Barnes, C. A., Lanahan, A. A., Siderovski, D. P., Ross, E. M., Gilman, A. G. and Worley, P. F. (1998) Dynamic regulation of RGS2 suggests a novel mechanism in G-protein signaling and neuronal plasticity. J Neurosci 18, 7178-7188.

Irizarry, R. A., Bolstad, B. M., Collin, F., Cope, L. M., Hobbs, B. and Speed, T. P. (2003a) Summaries of Affymetrix GeneChip probe level data. Nucleic acids research 31, e15.

Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U. and Speed, T. P. (2003b) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics (Oxford, England) 4, 249-264.

172

Ishii, T., Moriyoshi, K., Sugihara, H., Sakurada, K., Kadotani, H., Yokoi, M., Akazawa, C., Shigemoto, R., Mizuno, N. and Masu, M. (1993) Molecular characterization of the family of the N-methyl-D-aspartate receptor subunits. J Biol Chem 268, 2836-2843.

Jiang, X., Tian, F., Du, Y., Copeland, N. G., Jenkins, N. A., Tessarollo, L., Wu, X., Pan, H., Hu, X.-Z., Xu, K., Kenney, H., Egan, S. E., Turley, H., Harris, A. L., Marini, A. M. and Lipsky, R. H. (2008) BHLHB2 controls Bdnf promoter 4 activity and neuronal excitability. J Neurosci 28, 1118-1130.

Kato, Y., Kravchenko, V. V., Tapping, R. I., Han, J., Ulevitch, R. J. and Lee, J. D. (1997) BMK1/ERK5 regulates serum-induced early gene expression through transcription factor MEF2C. EMBO J 16, 7054-7066.

Kauer, J. A., Malenka, R. C. and Nicoll, R. A. (1988) NMDA application potentiates synaptic transmission in the hippocampus. Nature 334, 250- 252.

Kauselmann, G., Weiler, M., Wulff, P., Jessberger, S., Konietzko, U., Scafidi, J., Staubli, U., Bereiter-Hahn, J., Strebhardt, K. and Kuhl, D. (1999) The polo- like protein kinases Fnk and Snk associate with a Ca(2+)- and integrin- binding protein and are regulated dynamically with synaptic plasticity. EMBO J 18, 5528-5539.

Kavalali, E. T., Hwang, K. S. and Plummer, M. R. (1997) cAMP-dependent enhancement of dihydropyridine-sensitive calcium channel availability in hippocampal neurons. J Neurosci 17, 5334-5348.

Kennedy, M. B. (2000) Signal-processing machines at the postsynaptic density. Science 290, 750-754.

Kew, J. N., Richards, J. G., Mutel, V. and Kemp, J. A. (1998) Developmental changes in NMDA receptor glycine affinity and ifenprodil sensitivity reveal three distinct populations of NMDA receptors in individual rat cortical neurons. J Neurosci 18, 1935-1943.

Kim, M. J., Dunah, A. W., Wang, Y. T. and Sheng, M. (2005) Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking. Neuron 46, 745-760.

Kim, T.-K., Hemberg, M., Gray, J. M., Costa, A. M., Bear, D. M., Wu, J., Harmin, D. A., Laptewicz, M., Barbara-Haley, K., Kuersten, S., Markenscoff- Papadimitriou, E., Kuhl, D., Bito, H., Worley, P. F., Kreiman, G. and Greenberg, M. E. (2010) Widespread transcription at neuronal activity- regulated enhancers. Nature.

Kirson, E. D. and Yaari, Y. (1996) Synaptic NMDA receptors in developing mouse hippocampal neurones: functional properties and sensitivity to ifenprodil. J Physiol (Lond) 497 ( Pt 2), 437-455.

173

Knöll, B., Kretz, O., Fiedler, C., Alberti, S., Schütz, G., Frotscher, M. and Nordheim, A. (2006) Serum response factor controls neuronal circuit assembly in the hippocampus. Nat Neurosci 9, 195-204.

Knöll, B. and Nordheim, A. (2009) Functional versatility of transcription factors in the nervous system: the SRF paradigm. Trends Neurosci 32, 432-442.

Köhr, G. (2006) NMDA receptor function: subunit composition versus spatial distribution. Cell Tissue Res 326, 439-446.

Konietzko, U., Kauselmann, G., Scafidi, J., Staubli, U., Mikkers, H., Berns, A., Schweizer, M., Waltereit, R. and Kuhl, D. (1999) Pim kinase expression is induced by LTP stimulation and required for the consolidation of enduring LTP. EMBO J 18, 3359-3369.

Kornhauser, J. M., Cowan, C. W., Shaywitz, A. J., Dolmetsch, R. E., Griffith, E. C., Hu, L. S., Haddad, C., Xia, Z. and Greenberg, M. E. (2002) CREB transcriptional activity in neurons is regulated by multiple, calcium- specific phosphorylation events. Neuron 34, 221-233.

Koschak, A., Obermair, G. J., Pivotto, F., Sinnegger-Brauns, M. J., Striessnig, J. and Pietrobon, D. (2007) Molecular nature of anomalous L-type calcium channels in mouse cerebellar granule cells. J Neurosci 27, 3855-3863.

Kovács, K. A., Steullet, P., Steinmann, M., Do, K. Q., Magistretti, P. J., Halfon, O. and Cardinaux, J.-R. (2007) TORC1 is a calcium- and cAMP-sensitive coincidence detector involved in hippocampal long-term synaptic plasticity. Proc Natl Acad Sci USA 104, 4700-4705.

Krapivinsky, G., Krapivinsky, L., Manasian, Y., Ivanov, A., Tyzio, R., Pellegrino, C., Ben-Ari, Y., Clapham, D. E. and Medina, I. (2003) The NMDA receptor is coupled to the ERK pathway by a direct interaction between NR2B and RasGRF1. Neuron 40, 775-784.

Kumar, S. S., Bacci, A., Kharazia, V. and Huguenard, J. R. (2002) A developmental switch of AMPA receptor subunits in neocortical pyramidal neurons. J Neurosci 22, 3005-3015.

Kutsuwada, T., Kashiwabuchi, N., Mori, H., Sakimura, K., Kushiya, E., Araki, K., Meguro, H., Masaki, H., Kumanishi, T. and Arakawa, M. (1992) Molecular diversity of the NMDA receptor channel. Nature 358, 36-41.

Lamb, N. J., Fernandez, A., Tourkine, N., Jeanteur, P. and Blanchard, J. M. (1990) Demonstration in living cells of an intragenic negative regulatory element within the rodent c-fos gene. Cell 61, 485-496.

Lanahan, A. and Worley, P. (1998) Immediate-early genes and synaptic function. Neurobiol Learn Mem 70, 37-43.

174

Lau, L. F. and Nathans, D. (1987) Expression of a set of growth-related immediate early genes in BALB/c 3T3 cells: coordinate regulation with c- fos or c-myc. Proc Natl Acad Sci USA 84, 1182-1186.

Lee, J.-S., Smith, E. and Shilatifard, A. (2010) The language of histone crosstalk. Cell 142, 682-685.

Leifer, D., Krainc, D., Yu, Y. T., McDermott, J., Breitbart, R. E., Heng, J., Neve, R. L., Kosofsky, B., Nadal-Ginard, B. and Lipton, S. A. (1993) MEF2C, a MADS/MEF2-family transcription factor expressed in a laminar distribution in cerebral cortex. Proc Natl Acad Sci USA 90, 1546-1550.

Lemercier, C., Verdel, A., Galloo, B., Curtet, S., Brocard, M. P. and Khochbin, S. (2000) mHDA1/HDAC5 histone deacetylase interacts with and represses MEF2A transcriptional activity. J Biol Chem 275, 15594-15599.

Lerea, L. S., Butler, L. S. and McNamara, J. O. (1992) NMDA and non-NMDA receptor-mediated increase of c-fos mRNA in dentate gyrus neurons involves calcium influx via different routes. J Neurosci 12, 2973-2981.

Leslie, J. H. and Nedivi, E. (2011) Activity-regulated genes as mediators of neural circuit plasticity. Progress in Neurobiology 94, 223-237.

Lewin, G. R. (1996) Neurotrophins and the specification of neuronal phenotype. Philos Trans R Soc Lond, B, Biol Sci 351, 405-411.

Lewin, G. R. and Barde, Y. A. (1996) Physiology of the neurotrophins. Annual Review of Neuroscience 19, 289-317.

Li, J. H., Wang, Y. H., Wolfe, B. B., Krueger, K. E., Corsi, L., Stocca, G. and Vicini, S. (1998) Developmental changes in localization of NMDA receptor subunits in primary cultures of cortical neurons. Eur J Neurosci 10, 1704- 1715.

Li, L., Carter, J., Gao, X., Whitehead, J. and Tourtellotte, W. G. (2005) The neuroplasticity-associated arc gene is a direct transcriptional target of early growth response (Egr) transcription factors. Mol Cell Biol 25, 10286- 10300.

Li, L., Yun, S. H., Keblesh, J., Trommer, B. L., Xiong, H., Radulovic, J. and Tourtellotte, W. G. (2007) Egr3, a synaptic activity regulated transcription factor that is essential for learning and memory. Mol Cell Neurosci 35, 76- 88.

Li, Q., Barkess, G. and Qian, H. (2006a) Chromatin looping and the probability of transcription. Trends Genet 22, 197-202.

Li, S., Tian, X., Hartley, D. M. and Feig, L. A. (2006b) Distinct roles for Ras- guanine nucleotide-releasing factor 1 (Ras-GRF1) and Ras-GRF2 in the

175

induction of long-term potentiation and long-term depression. J Neurosci 26, 1721-1729.

Lilienbaum, A. and Israël, A. (2003) From calcium to NF-kappa B signaling pathways in neurons. Mol Cell Biol 23, 2680-2698.

Lin, J. W., Wyszynski, M., Madhavan, R., Sealock, R., Kim, J. U. and Sheng, M. (1998) Yotiao, a novel protein of neuromuscular junction and brain that interacts with specific splice variants of NMDA receptor subunit NR1. J Neurosci 18, 2017-2027.

Lin, Y., Bloodgood, B. L., Hauser, J. L., Lapan, A. D., Koon, A. C., Kim, T.-K., Hu, L. S., Malik, A. N. and Greenberg, M. E. (2008) Activity-dependent regulation of inhibitory synapse development by Npas4. Nature 455, 1198- 1204.

Link, W., Konietzko, U., Kauselmann, G., Krug, M., Schwanke, B., Frey, U. and Kuhl, D. (1995) Somatodendritic expression of an immediate early gene is regulated by synaptic activity. Proc Natl Acad Sci USA 92, 5734-5738.

Liou, H. C. and Baltimore, D. (1993) Regulation of the NF-kappa B/rel transcription factor and I kappa B inhibitor system. Curr Opin Cell Biol 5, 477-487.

Lipscombe, D., Helton, T. D. and Xu, W. (2004) L-type calcium channels: the low down. J Neurophysiol 92, 2633-2641.

Lipsky, R. H., Xu, K., Zhu, D., Kelly, C., Terhakopian, A., Novelli, A. and Marini, A. M. (2001) Nuclear factor kappaB is a critical determinant in N-methyl- D-aspartate receptor-mediated neuroprotection. J Neurochem 78, 254-264.

Liu, L., Wong, T. P., Pozza, M. F., Lingenhoehl, K., Wang, Y., Sheng, M., Auberson, Y. P. and Wang, Y. T. (2004) Role of NMDA receptor subtypes in governing the direction of hippocampal synaptic plasticity. Science 304, 1021-1024.

Liu, Q.-R., Lu, L., Zhu, X.-G., Gong, J.-P., Shaham, Y. and Uhl, G. R. (2006) Rodent BDNF genes, novel promoters, novel splice variants, and regulation by cocaine. Brain Res 1067, 1-12.

Liu, S. Q. and Cull-Candy, S. G. (2000) Synaptic activity at calcium-permeable AMPA receptors induces a switch in receptor subtype. Nature 405, 454- 458.

Loebrich, S. and Nedivi, E. (2009) The function of activity-regulated genes in the nervous system. Physiological reviews 89, 1079-1103.

Lomeli, H., Mosbacher, J., Melcher, T., Höger, T., Geiger, J. R., Kuner, T., Monyer, H., Higuchi, M., Bach, A. and Seeburg, P. H. (1994) Control of kinetic

176

properties of AMPA receptor channels by nuclear RNA editing. Science 266, 1709-1713.

Lonze, B. E. and Ginty, D. D. (2002) Function and regulation of CREB family transcription factors in the nervous system. Neuron 35, 605-623.

Lu, B. (2003) BDNF and activity-dependent synaptic modulation. Learn Mem 10, 86-98.

Lu, J., McKinsey, T. A., Nicol, R. L. and Olson, E. N. (2000) Signal-dependent activation of the MEF2 transcription factor by dissociation from histone deacetylases. Proc Natl Acad Sci USA 97, 4070-4075.

Lusin, J. D., Vanarotti, M., Li, C., Valiveti, A. and Ames, J. B. (2008) NMR structure of DREAM: Implications for Ca(2+)-dependent DNA binding and protein dimerization. Biochemistry 47, 2252-2264.

Lyford, G. L., Yamagata, K., Kaufmann, W. E., Barnes, C. A., Sanders, L. K., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Lanahan, A. A. and Worley, P. F. (1995) Arc, a growth factor and activity-regulated gene, encodes a novel cytoskeleton-associated protein that is enriched in neuronal dendrites. Neuron 14, 433-445.

Lyons, G. E., Micales, B. K., Schwarz, J., Martin, J. F. and Olson, E. N. (1995) Expression of mef2 genes in the mouse central nervous system suggests a role in neuronal maturation. J Neurosci 15, 5727-5738.

Lyons, M. R. and West, A. E. (2011) Mechanisms of specificity in neuronal activity-regulated gene transcription. Progress in Neurobiology.

Ma, O. K. and Sucher, N. J. (2004) Molecular interaction of NMDA receptor subunit NR3A with protein phosphatase 2A. Neuroreport 15, 1447-1450.

Malenka, R. C., Kauer, J. A., Zucker, R. S. and Nicoll, R. A. (1988) Postsynaptic calcium is sufficient for potentiation of hippocampal synaptic transmission. Science 242, 81-84.

Mantamadiotis, T., Lemberger, T., Bleckmann, S. C., Kern, H., Kretz, O., Martin Villalba, A., Tronche, F., Kellendonk, C., Gau, D., Kapfhammer, J., Otto, C., Schmid, W. and Schütz, G. (2002) Disruption of CREB function in brain leads to neurodegeneration. Nat Genet 31, 47-54.

Mao, Z., Bonni, A., Xia, F., Nadal-Vicens, M. and Greenberg, M. E. (1999) Neuronal activity-dependent cell survival mediated by transcription factor MEF2. Science 286, 785-790.

Mao, Z. and Wiedmann, M. (1999) Calcineurin enhances MEF2 DNA binding activity in calcium-dependent survival of cerebellar granule neurons. J Biol Chem 274, 31102-31107.

177

Marais, R., Wynne, J. and Treisman, R. (1993) The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73, 381-393.

Marek, K. W., Kurtz, L. M. and Spitzer, N. C. (2010) cJun integrates calcium activity and tlx3 expression to regulate neurotransmitter specification. Nature neuroscience.

Martel, M.-A., Wyllie, D. J. A. and Hardingham, G. E. (2009) In developing hippocampal neurons, NR2B-containing N-methyl-D-aspartate receptors (NMDARs) can mediate signaling to neuronal survival and synaptic potentiation, as well as neuronal death. Neuroscience 158, 334-343.

Martin, J. F., Schwarz, J. J. and Olson, E. N. (1993) Myocyte enhancer factor (MEF) 2C: a tissue-restricted member of the MEF-2 family of transcription factors. Proceedings of the National Academy of Sciences of the United States of America 90, 5282-5286.

Massa, P. T., Aleyasin, H., Park, D. S., Mao, X. and Barger, S. W. (2006) NFkappaB in neurons? The uncertainty principle in neurobiology. J Neurochem 97, 607-618.

Matsuda, K., Kamiya, Y., Matsuda, S. and Yuzaki, M. (2002) Cloning and characterization of a novel NMDA receptor subunit NR3B: a dominant subunit that reduces calcium permeability. Brain Res Mol Brain Res 100, 43-52.

Mayr, B. and Montminy, M. (2001) Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2, 599-609.

Maze, I., Covington, H. E., Dietz, D. M., LaPlant, Q., Renthal, W., Russo, S. J., Mechanic, M., Mouzon, E., Neve, R. L., Haggarty, S. J., Ren, Y., Sampath, S. C., Hurd, Y. L., Greengard, P., Tarakhovsky, A., Schaefer, A. and Nestler, E. J. (2010) Essential role of the histone methyltransferase G9a in cocaine-induced plasticity. Science 327, 213-216.

McBain, C. J. and Mayer, M. L. (1994) N-methyl-D-aspartic acid receptor structure and function. Physiol Rev 74, 723-760.

McDowell, K. A., Hutchinson, A. N., Wong-Goodrich, S. J. E., Presby, M. M., Su, D., Rodriguiz, R. M., Law, K. C., Williams, C. L., Wetsel, W. C. and West, A. E. (2010) Reduced cortical BDNF expression and aberrant memory in carf knock-out mice. J Neurosci 30, 7453-7465.

McGurk, J. F., Bennett, M. V. and Zukin, R. S. (1990) Polyamines potentiate responses of N-methyl-D-aspartate receptors expressed in xenopus oocytes. Proc Natl Acad Sci USA 87, 9971-9974.

178

McKinsey, T. A., Zhang, C. L. and Olson, E. N. (2001) Control of muscle development by dueling HATs and HDACs. Curr Opin Genet Dev 11, 497- 504.

McKinsey, T. A., Zhang, C. L. and Olson, E. N. (2002) MEF2: a calcium- dependent regulator of cell division, differentiation and death. Trends Biochem Sci 27, 40-47.

Meffert, M. K. and Baltimore, D. (2005) Physiological functions for brain NF- kappaB. Trends Neurosci 28, 37-43.

Meffert, M. K., Chang, J. M., Wiltgen, B. J., Fanselow, M. S. and Baltimore, D. (2003) NF-kappa B functions in synaptic signaling and behavior. Nat Neurosci 6, 1072-1078.

Meguro, H., Mori, H., Araki, K., Kushiya, E., Kutsuwada, T., Yamazaki, M., Kumanishi, T., Arakawa, M., Sakimura, K. and Mishina, M. (1992) Functional characterization of a heteromeric NMDA receptor channel expressed from cloned cDNAs. Nature 357, 70-74.

Melcher, T., Maas, S., Herb, A., Sprengel, R., Seeburg, P. H. and Higuchi, M. (1996) A mammalian RNA editing enzyme. Nature 379, 460-464.

Mercurio, F., Zhu, H., Murray, B. W., Shevchenko, A., Bennett, B. L., Li, J., Young, D. B., Barbosa, M., Mann, M., Manning, A. and Rao, A. (1997) IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF- kappaB activation. Science 278, 860-866.

Mermelstein, P. G., Bito, H., Deisseroth, K. and Tsien, R. W. (2000) Critical dependence of cAMP response element-binding protein phosphorylation on L-type calcium channels supports a selective response to EPSPs in preference to action potentials. Journal of Neuroscience 20, 266-273.

Mermelstein, P. G., Deisseroth, K., Dasgupta, N., Isaksen, A. L. and Tsien, R. W. (2001) Calmodulin priming: nuclear translocation of a calmodulin complex and the memory of prior neuronal activity. Proc Natl Acad Sci USA 98, 15342-15347.

Meyer-Franke, A., Wilkinson, G. A., Kruttgen, A., Hu, M., Munro, E., Hanson, M. G., Reichardt, L. F. and Barres, B. A. (1998) Depolarization and cAMP elevation rapidly recruit TrkB to the plasma membrane of CNS neurons. Neuron 21, 681-693.

Miralles, F., Posern, G., Zaromytidou, A.-I. and Treisman, R. (2003) Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113, 329-342.

Miranti, C. K., Ginty, D. D., Huang, G., Chatila, T. and Greenberg, M. E. (1995) Calcium activates serum response factor-dependent transcription by a

179

Ras- and Elk-1-independent mechanism that involves a Ca2+/calmodulin-dependent kinase. Mol Cell Biol 15, 3672-3684.

Miyakawa, H., Woo, S. K., Dahl, S. C., Handler, J. S. and Kwon, H. M. (1999) Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proc Natl Acad Sci USA 96, 2538-2542.

Mokalled, M. H., Johnson, A., Kim, Y., Oh, J. and Olson, E. N. (2010) Myocardin- related transcription factors regulate the Cdk5/Pctaire1 kinase cascade to control neurite outgrowth, neuronal migration and brain development. Development 137, 2365-2374.

Molkentin, J. D., Black, B. L., Martin, J. F. and Olson, E. N. (1995) Cooperative activation of muscle gene expression by MEF2 and myogenic bHLH proteins. Cell 83, 1125-1136.

Molkentin, J. D., Firulli, A. B., Black, B. L., Martin, J. F., Hustad, C. M., Copeland, N., Jenkins, N., Lyons, G. and Olson, E. N. (1996) MEF2B is a potent transactivator expressed in early myogenic lineages. Mol Cell Biol 16, 3814-3824.

Montminy, M. R. and Bilezikjian, L. M. (1987) Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature 328, 175- 178.

Monyer, H., Burnashev, N., Laurie, D. J., Sakmann, B. and Seeburg, P. H. (1994) Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron 12, 529-540.

Monyer, H., Sprengel, R., Schoepfer, R., Herb, A., Higuchi, M., Lomeli, H., Burnashev, N., Sakmann, B. and Seeburg, P. H. (1992) Heteromeric NMDA receptors: molecular and functional distinction of subtypes. Science 256, 1217-1221.

Morgan, J. I., Cohen, D. R., Hempstead, J. L. and Curran, T. (1987) Mapping patterns of c-fos expression in the central nervous system after seizure. Science 237, 192-197.

Morgan, J. I. and Curran, T. (1986) Role of ion flux in the control of c-fos expression. Nature 322, 552-555.

Morgan, J. I. and Curran, T. (1991) Stimulus-transcription coupling in the nervous system: involvement of the inducible proto-oncogenes fos and jun. Annu. Rev. Neurosci. 14, 421-451.

Mu, Y., Otsuka, T., Horton, A. C., Scott, D. B. and Ehlers, M. D. (2003) Activity- dependent mRNA splicing controls ER export and synaptic delivery of NMDA receptors. Neuron 40, 581-594.

180

Muller, D., Joly, M. and Lynch, G. (1988) Contributions of quisqualate and NMDA receptors to the induction and expression of LTP. Science 242, 1694-1697.

Nakanishi, N., Tu, S., Shin, Y., Cui, J., Kurokawa, T., Zhang, D., Chen, H.-S. V., Tong, G. and Lipton, S. A. (2009) Neuroprotection by the NR3A subunit of the NMDA receptor. Journal of Neuroscience 29, 5260-5265.

Nase, G., Weishaupt, J., Stern, P., Singer, W. and Monyer, H. (1999) Genetic and epigenetic regulation of NMDA receptor expression in the rat visual cortex. Eur J Neurosci 11, 4320-4326.

Nechaev, S., Fargo, D. C., dos Santos, G., Liu, L., Gao, Y. and Adelman, K. (2010) Global analysis of short RNAs reveals widespread promoter-proximal stalling and arrest of Pol II in Drosophila. Science 327, 335-338.

Nedivi, E., Hevroni, D., Naot, D., Israeli, D. and Citri, Y. (1993) Numerous candidate plasticity-related genes revealed by differential cDNA cloning. Nature 363, 718-722.

Nedivi, E., Wu, G. Y. and Cline, H. T. (1998) Promotion of dendritic growth by CPG15, an activity-induced signaling molecule. Science 281, 1863-1866.

Nestler, E. J. (2001) Molecular basis of long-term plasticity underlying addiction. Nat Rev Neurosci 2, 119-128.

Nguyen, P. V., Abel, T. and Kandel, E. R. (1994) Requirement of a critical period of transcription for induction of a late phase of LTP. Science 265, 1104- 1107.

Nishi, M., Hinds, H., Lu, H. P., Kawata, M. and Hayashi, Y. (2001) Motoneuron- specific expression of NR3B, a novel NMDA-type glutamate receptor subunit that works in a dominant-negative manner. J Neurosci 21, RC185.

Norman, C., Runswick, M., Pollock, R. and Treisman, R. (1988) Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element. Cell 55, 989-1003.

O'Brien, R. J., Xu, D., Petralia, R. S., Steward, O., Huganir, R. L. and Worley, P. (1999) Synaptic clustering of AMPA receptors by the extracellular immediate-early gene product Narp. Neuron 23, 309-323.

Oh, J. S., Manzerra, P. and Kennedy, M. B. (2004) Regulation of the neuron- specific Ras GTPase-activating protein, synGAP, by Ca2+/calmodulin- dependent protein kinase II. J Biol Chem 279, 17980-17988.

Okamura, H., Aramburu, J., García-Rodríguez, C., Viola, J. P., Raghavan, A., Tahiliani, M., Zhang, X., Qin, J., Hogan, P. G. and Rao, A. (2000) Concerted dephosphorylation of the transcription factor NFAT1 induces

181

a conformational switch that regulates transcriptional activity. Mol Cell 6, 539-550.

Okazaki, M. M., Evenson, D. A. and Nadler, J. V. (1995) Hippocampal mossy fiber sprouting and synapse formation after status epilepticus in rats: visualization after retrograde transport of biocytin. The Journal of comparative neurology 352, 515-534.

Oliveria, S. F., Dell'Acqua, M. L. and Sather, W. A. (2007) AKAP79/150 anchoring of calcineurin controls neuronal L-type Ca2+ channel activity and nuclear signaling. Neuron 55, 261-275.

Olson, E. N. and Nordheim, A. (2010) Linking actin dynamics and gene transcription to drive cellular motile functions. Nat Rev Mol Cell Biol 11, 353-365.

Ooe, N., Saito, K. and Kaneko, H. (2009) Characterization of functional heterodimer partners in brain for a bHLH-PAS factor NXF. Biochim Biophys Acta 1789, 192-197.

Ooe, N., Saito, K., Mikami, N., Nakatuka, I. and Kaneko, H. (2004) Identification of a novel basic helix-loop-helix-PAS factor, NXF, reveals a Sim2 competitive, positive regulatory role in dendritic-cytoskeleton modulator drebrin gene expression. Mol Cell Biol 24, 608-616.

Opatowsky, Y., Chen, C.-C., Campbell, K. P. and Hirsch, J. A. (2004) Structural analysis of the voltage-dependent calcium channel beta subunit functional core and its complex with the alpha 1 interaction domain. Neuron 42, 387-399.

Osawa, M., Dace, A., Tong, K. I., Valiveti, A., Ikura, M. and Ames, J. B. (2005) Mg2+ and Ca2+ differentially regulate DNA binding and dimerization of DREAM. J Biol Chem 280, 18008-18014.

Osawa, M., Tong, K. I., Lilliehook, C., Wasco, W., Buxbaum, J. D., Cheng, H. Y., Penninger, J. M., Ikura, M. and Ames, J. B. (2001) Calcium-regulated DNA binding and oligomerization of the neuronal calcium-sensing protein, calsenilin/DREAM/KChIP3. J Biol Chem 276, 41005-41013.

Papadia, S., Soriano, F. X., Léveillé, F., Martel, M.-A., Dakin, K. A., Hansen, H. H., Kaindl, A., Sifringer, M., Fowler, J., Stefovska, V., McKenzie, G., Craigon, M., Corriveau, R., Ghazal, P., Horsburgh, K., Yankner, B. A., Wyllie, D. J. A., Ikonomidou, C. and Hardingham, G. E. (2008) Synaptic NMDA receptor activity boosts intrinsic antioxidant defenses. Nat Neurosci 11, 476-487.

Park, C. Y., Shcheglovitov, A. and Dolmetsch, R. (2010) The CRAC channel activator STIM1 binds and inhibits L-type voltage-gated calcium channels. Science 330, 101-105.

182

Parkitna, J. R., Bilbao, A., Rieker, C., Engblom, D., Piechota, M., Nordheim, A., Spanagel, R. and Schütz, G. (2010) Loss of the serum response factor in the dopamine system leads to hyperactivity. FASEB J 24, 2427-2435.

Pérez-Otaño, I., Luján, R., Tavalin, S. J., Plomann, M., Modregger, J., Liu, X.-B., Jones, E. G., Heinemann, S. F., Lo, D. C. and Ehlers, M. D. (2006) Endocytosis and synaptic removal of NR3A-containing NMDA receptors by PACSIN1/syndapin1. Nat Neurosci 9, 611-621.

Perkinton, M. S., Sihra, T. S. and Williams, R. J. (1999) Ca(2+)-permeable AMPA receptors induce phosphorylation of cAMP response element-binding protein through a phosphatidylinositol 3-kinase-dependent stimulation of the mitogen-activated protein kinase signaling cascade in neurons. J Neurosci 19, 5861-5874.

Peterson, B. Z., DeMaria, C. D., Adelman, J. P. and Yue, D. T. (1999) Calmodulin is the Ca2+ sensor for Ca2+ -dependent inactivation of L-type calcium channels. Neuron 22, 549-558.

Pfenning, A. R., Kim, T.-K., Spotts, J. M., Hemberg, M., Su, D. and West, A. E. (2010) Genome-Wide Identification of Calcium-Response Factor (CaRF) Binding Sites Predicts a Role in Regulation of Neuronal Signaling Pathways. PLoS ONE 5, e10870.

Pipes, G. C. T., Creemers, E. E. and Olson, E. N. (2006) The myocardin family of transcriptional coactivators: versatile regulators of cell growth, migration, and myogenesis. Genes Dev 20, 1545-1556.

Plant, K., Pelkey, K. A., Bortolotto, Z. A., Morita, D., Terashima, A., McBain, C. J., Collingridge, G. L. and Isaac, J. T. R. (2006) Transient incorporation of native GluR2-lacking AMPA receptors during hippocampal long-term potentiation. Nat Neurosci 9, 602-604.

Poo, M. M. (2001) Neurotrophins as synaptic modulators. Nat Rev Neurosci 2, 24- 32.

Poulsen, F. R., Lauterborn, J., Zimmer, J. and Gall, C. M. (2004) Differential expression of brain-derived neurotrophic factor transcripts after pilocarpine-induced seizure-like activity is related to mode of Ca2+ entry. Neuroscience 126, 665-676.

Pruunsild, P., Sepp, M., Orav, E., Koppel, I. and Timmusk, T. (2011) Identification of cis-Elements and Transcription Factors Regulating Neuronal Activity-Dependent Transcription of Human BDNF Gene. J Neurosci 31, 3295-3308.

Pulipparacharuvil, S., Renthal, W., Hale, C. F., Taniguchi, M., Xiao, G., Kumar, A., Russo, S. J., Sikder, D., Dewey, C. M., Davis, M. M., Greengard, P.,

183

Nairn, A. C., Nestler, E. J. and Cowan, C. W. (2008) Cocaine regulates MEF2 to control synaptic and behavioral plasticity. Neuron 59, 621-633.

Qian, Z., Gilbert, M. E., Colicos, M. A., Kandel, E. R. and Kuhl, D. (1993) Tissue- plasminogen activator is induced as an immediate-early gene during seizure, kindling and long-term potentiation. Nature 361, 453-457.

Qiu, Z. and Ghosh, A. (2008) A calcium-dependent switch in a CREST-BRG1 complex regulates activity-dependent gene expression. Neuron 60, 775- 787.

Quinlan, E. M., Olstein, D. H. and Bear, M. F. (1999) Bidirectional, experience- dependent regulation of N-methyl-D-aspartate receptor subunit composition in the rat visual cortex during postnatal development. Proc Natl Acad Sci USA 96, 12876-12880.

Ramanan, N., Shen, Y., Sarsfield, S., Lemberger, T., Schütz, G., Linden, D. J. and Ginty, D. D. (2005) SRF mediates activity-induced gene expression and synaptic plasticity but not neuronal viability. Nat Neurosci 8, 759-767.

Rao, V. R., Pintchovski, S. A., Chin, J., Peebles, C. L., Mitra, S. and Finkbeiner, S. (2006) AMPA receptors regulate transcription of the plasticity-related immediate-early gene Arc. Nat Neurosci 9, 887-895.

Redmond, L. and Ghosh, A. (2005) Regulation of dendritic development by calcium signaling. Cell Calcium 37, 411-416.

Redmond, L., Kashani, A. H. and Ghosh, A. (2002) Calcium regulation of dendritic growth via CaM kinase IV and CREB-mediated transcription. Neuron 34, 999-1010.

Roberts, A. C., Díez-García, J., Rodriguiz, R. M., López, I. P., Luján, R., Martínez- Turrillas, R., Picó, E., Henson, M. A., Bernardo, D. R., Jarrett, T. M., Clendeninn, D. J., López-Mascaraque, L., Feng, G., Lo, D. C., Wesseling, J. F., Wetsel, W. C., Philpot, B. D. and Pérez-Otaño, I. (2009) Downregulation of NR3A-containing NMDARs is required for synapse maturation and memory consolidation. Neuron 63, 342-356.

Roberts, E. B. and Ramoa, A. S. (1999) Enhanced NR2A subunit expression and decreased NMDA receptor decay time at the onset of ocular dominance plasticity in the ferret. J Neurophysiol 81, 2587-2591.

Roh, T.-Y., Cuddapah, S. and Zhao, K. (2005) Active chromatin domains are defined by acetylation islands revealed by genome-wide mapping. Genes Dev 19, 542-552.

Rosen, L. B., Ginty, D. D., Weber, M. J. and Greenberg, M. E. (1994) Membrane depolarization and calcium influx stimulate MEK and MAP kinase via activation of Ras. Neuron 12, 1207-1221.

184

Rosenmund, C., Stern-Bach, Y. and Stevens, C. F. (1998) The tetrameric structure of a glutamate receptor channel. Science 280, 1596-1599.

Sala, C., Rudolph-Correia, S. and Sheng, M. (2000) Developmentally regulated NMDA receptor-dependent dephosphorylation of cAMP response element-binding protein (CREB) in hippocampal neurons. J Neurosci 20, 3529-3536.

Sans, N., Petralia, R. S., Wang, Y. X., Blahos, J., Hell, J. W. and Wenthold, R. J. (2000) A developmental change in NMDA receptor-associated proteins at hippocampal synapses. J Neurosci 20, 1260-1271.

Sasaki, T., Takemori, H., Yagita, Y., Terasaki, Y., Uebi, T., Horike, N., Takagi, H., Susumu, T., Teraoka, H., Kusano, K.-i., Hatano, O., Oyama, N., Sugiyama, Y., Sakoda, S. and Kitagawa, K. (2011) SIK2 Is a Key Regulator for Neuronal Survival after Ischemia via TORC1-CREB. Neuron 69, 106-119.

Sasaki, Y. F., Rothe, T., Premkumar, L. S., Das, S., Cui, J., Talantova, M. V., Wong, H.-K., Gong, X., Chan, S. F., Zhang, D., Nakanishi, N., Sucher, N. J. and Lipton, S. A. (2002) Characterization and comparison of the NR3A subunit of the NMDA receptor in recombinant systems and primary cortical neurons. J Neurophysiol 87, 2052-2063.

Screaton, R. A., Conkright, M. D., Katoh, Y., Best, J. L., Canettieri, G., Jeffries, S., Guzman, E., Niessen, S., Yates, J. R., Takemori, H., Okamoto, M. and Montminy, M. (2004) The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 119, 61-74.

Shalizi, A. and Bonni, A. (2008) Chapter 12: Not Just for Muscle Anymore: Activity and Calcium Regulation of MEF2-Dependent Transcription in Neuronal Survival and Differentiation. In: Transcriptional Regulation by Neuronal Activity. pp. 229-250. Ed. S. M. Dudek. Springer: New York, NY.

Shalizi, A., Gaudillière, B., Yuan, Z., Stegmüller, J., Shirogane, T., Ge, Q., Tan, Y., Schulman, B., Harper, J. W. and Bonni, A. (2006) A calcium-regulated MEF2 sumoylation switch controls postsynaptic differentiation. Science 311, 1012-1017.

Shalizi, A., Lehtinen, M., Gaudilliere, B., Donovan, N., Han, J., Konishi, Y. and Bonni, A. (2003) Characterization of a neurotrophin signaling mechanism that mediates neuron survival in a temporally specific pattern. J Neurosci 23, 7326-7336.

Shalizi, A. K. and Bonni, A. (2005) brawn for brains: the role of MEF2 proteins in the developing nervous system. Curr Top Dev Biol 69, 239-266.

Shaw, P. E., Schröter, H. and Nordheim, A. (1989) The ability of a ternary complex to form over the serum response element correlates with serum inducibility of the human c-fos promoter. Cell 56, 563-572.

185

Shaywitz, A. J. and Greenberg, M. E. (1999) CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68, 821-861.

Shen, K. and Meyer, T. (1999) Dynamic control of CaMKII translocation and localization in hippocampal neurons by NMDA receptor stimulation. Science 284, 162-166.

Sheng, M. (2001) Molecular organization of the postsynaptic specialization. Proc Natl Acad Sci USA 98, 7058-7061.

Sheng, M., Cummings, J., Roldan, L. A., Jan, Y. N. and Jan, L. Y. (1994) Changing subunit composition of heteromeric NMDA receptors during development of rat cortex. Nature 368, 144-147.

Sheng, M., Dougan, S. T., McFadden, G. and Greenberg, M. E. (1988) Calcium and growth factor pathways of c-fos transcriptional activation require distinct upstream regulatory sequences. Mol Cell Biol 8, 2787-2796.

Sheng, M., McFadden, G. and Greenberg, M. E. (1990) Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4, 571-582.

Sheng, M. and Sala, C. (2001) PDZ domains and the organization of supramolecular complexes. Annu Rev Neurosci 24, 1-29.

Sheng, M., Thompson, M. A. and Greenberg, M. E. (1991) CREB: a Ca(2+)- regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252, 1427-1430.

Shi, J., Aamodt, S. M. and Constantine-Paton, M. (1997) Temporal correlations between functional and molecular changes in NMDA receptors and GABA neurotransmission in the superior colliculus. J Neurosci 17, 6264- 6276.

Shieh, P. B., Hu, S. C., Bobb, K., Timmusk, T. and Ghosh, A. (1998) Identification of a signaling pathway involved in calcium regulation of BDNF expression. Neuron 20, 727-740.

Sobczyk, A., Scheuss, V. and Svoboda, K. (2005) NMDA receptor subunit- dependent [Ca2+] signaling in individual hippocampal dendritic spines. J Neurosci 25, 6037-6046.

Soriano, F. X., Léveillé, F., Papadia, S., Bell, K. F. S., Puddifoot, C. and Hardingham, G. E. (2011) Neuronal activity controls the antagonistic balance between peroxisome proliferator-activated receptor-γ coactivator- 1α and silencing mediator of retinoic acid and thyroid hormone receptors in regulating antioxidant defenses. Antioxid Redox Signal 14, 1425-1436.

186

Soriano, F. X., Papadia, S., Hofmann, F., Hardingham, N. R., Bading, H. and Hardingham, G. E. (2006) Preconditioning doses of NMDA promote neuroprotection by enhancing neuronal excitability. J Neurosci 26, 4509- 4518.

Sotiropoulos, A., Gineitis, D., Copeland, J. and Treisman, R. (1999) Signal- regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98, 159-169.

Spitzer, N. C. (2006) Electrical activity in early neuronal development. Nature 444, 707-712.

Splawski, I., Timothy, K. W., Decher, N., Kumar, P., Sachse, F. B., Beggs, A. H., Sanguinetti, M. C. and Keating, M. T. (2005) Severe arrhythmia disorder caused by cardiac L-type calcium channel mutations. Proc Natl Acad Sci USA 102, 8089-8096; discussion 8086-8088.

Splawski, I., Timothy, K. W., Sharpe, L. M., Decher, N., Kumar, P., Bloise, R., Napolitano, C., Schwartz, P. J., Joseph, R. M., Condouris, K., Tager- Flusberg, H., Priori, S. G., Sanguinetti, M. C. and Keating, M. T. (2004) Ca(V)1.2 calcium channel dysfunction causes a multisystem disorder including arrhythmia and autism. Cell 119, 19-31.

Strack, S. and Colbran, R. J. (1998) Autophosphorylation-dependent targeting of calcium/ calmodulin-dependent protein kinase II by the NR2B subunit of the N-methyl- D-aspartate receptor. J Biol Chem 273, 20689-20692.

Strack, S., McNeill, R. B. and Colbran, R. J. (2000) Mechanism and regulation of calcium/calmodulin-dependent protein kinase II targeting to the NR2B subunit of the N-methyl-D-aspartate receptor. J Biol Chem 275, 23798- 23806.

Strahl, B. D. and Allis, C. D. (2000) The language of covalent histone modifications. Nature 403, 41-45.

Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S. and Mesirov, J. P. (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102, 15545- 15550.

Sucher, N. J., Akbarian, S., Chi, C. L., Leclerc, C. L., Awobuluyi, M., Deitcher, D. L., Wu, M. K., Yuan, J. P., Jones, E. G. and Lipton, S. A. (1995) Developmental and regional expression pattern of a novel NMDA receptor-like subunit (NMDAR-L) in the rodent brain. J Neurosci 15, 6509- 6520.

187

Sucher, N. J., Yu, E., Chan, S. F., Miri, M., Lee, B. J., Xiao, B., Worley, P. F. and Jensen, F. E. (2010) Association of the Small GTPase Rheb with the NMDA Receptor Subunit NR3A. Neurosignals.

Sugiyama, S., Di Nardo, A. A., Aizawa, S., Matsuo, I., Volovitch, M., Prochiantz, A. and Hensch, T. K. (2008) Experience-dependent transfer of Otx2 homeoprotein into the visual cortex activates postnatal plasticity. Cell 134, 508-520.

Sutherland, H. and Bickmore, W. A. (2009) Transcription factories: gene expression in unions? Nat Rev Genet 10, 457-466.

Takasu, M. A., Dalva, M. B., Zigmond, R. E. and Greenberg, M. E. (2002) Modulation of NMDA receptor-dependent calcium influx and gene expression through EphB receptors. Science 295, 491-495.

Takeuchi, Y. and Fukunaga, K. (2004) Different effects of five dopamine receptor subtypes on nuclear factor-kappaB activity in NG108-15 cells and mouse brain. J Neurochem 88, 41-50.

Tao, X., Finkbeiner, S., Arnold, D. B., Shaywitz, A. J. and Greenberg, M. E. (1998) Ca2+ influx regulates BDNF transcription by a CREB family transcription factor-dependent mechanism. Neuron 20, 709-726.

Tao, X., West, A. E., Chen, W. G., Corfas, G. and Greenberg, M. E. (2002) A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF. Neuron 33, 383-395.

Thomas, C. G., Miller, A. J. and Westbrook, G. L. (2006) Synaptic and extrasynaptic NMDA receptor NR2 subunits in cultured hippocampal neurons. J Neurophysiol 95, 1727-1734.

Thompson, K. R., Otis, K. O., Chen, D. Y., Zhao, Y., O'Dell, T. J. and Martin, K. C. (2004) Synapse to nucleus signaling during long-term synaptic plasticity; a role for the classical active nuclear import pathway. Neuron 44, 997- 1009.

Tian, X. and Feig, L. A. (2006) Age-dependent participation of Ras-GRF proteins in coupling calcium-permeable AMPA glutamate receptors to Ras/Erk signaling in cortical neurons. J Biol Chem 281, 7578-7582.

Timmusk, T., Belluardo, N., Persson, H. and Metsis, M. (1994) Developmental regulation of brain-derived neurotrophic factor messenger RNAs transcribed from different promoters in the rat brain. Neuroscience 60, 287- 291.

Timmusk, T., Palm, K., Metsis, M., Reintam, T., Paalme, V., Saarma, M. and Persson, H. (1993) Multiple promoters direct tissue-specific expression of the rat BDNF gene. Neuron 10, 475-489.

188

Tong, G., Takahashi, H., Tu, S., Shin, Y., Talantova, M., Zago, W., Xia, P., Nie, Z., Goetz, T., Zhang, D., Lipton, S. A. and Nakanishi, N. (2008) Modulation of NMDA receptor properties and synaptic transmission by the NR3A subunit in mouse hippocampal and cerebrocortical neurons. J Neurophysiol 99, 122-132.

Tovar, K. R. and Westbrook, G. L. (1999) The incorporation of NMDA receptors with a distinct subunit composition at nascent hippocampal synapses in vitro. Journal of Neuroscience 19, 4180-4188.

Tovar, K. R. and Westbrook, G. L. (2002) Mobile NMDA receptors at hippocampal synapses. Neuron 34, 255-264.

Townsend, M., Yoshii, A., Mishina, M. and Constantine-Paton, M. (2003) Developmental loss of miniature N-methyl-D-aspartate receptor currents in NR2A knockout mice. Proc Natl Acad Sci USA 100, 1340-1345.

Tran, H., Brunet, A., Grenier, J. M., Datta, S. R., Fornace, A. J., DiStefano, P. S., Chiang, L. W. and Greenberg, M. E. (2002) DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein. Science 296, 530-534.

Treisman, R. (1986) Identification of a protein-binding site that mediates transcriptional response of the c-fos gene to serum factors. Cell 46, 567- 574.

Tsui, C. C., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Barnes, C. and Worley, P. F. (1996) Narp, a novel member of the pentraxin family, promotes neurite outgrowth and is dynamically regulated by neuronal activity. J Neurosci 16, 2463-2478.

Tsuruta, F., Green, E. M., Rousset, M. and Dolmetsch, R. E. (2009) PIKfyve regulates CaV1.2 degradation and prevents excitotoxic cell death. J Cell Biol 187, 279-294.

Tu, W., Xu, X., Peng, L., Zhong, X., Zhang, W., Soundarapandian, M. M., Balel, C., Wang, M., Jia, N., Zhang, W., Lew, F., Chan, S. L., Chen, Y. and Lu, Y. (2010) DAPK1 interaction with NMDA receptor NR2B subunits mediates brain damage in stroke. Cell 140, 222-234.

Tuan, D., Solomon, W., Li, Q. and London, I. M. (1985) The "beta-like-globin" gene domain in human erythroid cells. Proc Natl Acad Sci USA 82, 6384- 6388.

Turrigiano, G. (2007) Homeostatic signaling: the positive side of negative feedback. Curr Opin Neurobiol 17, 318-324.

Turrigiano, G. G. and Nelson, S. B. (2004) Homeostatic plasticity in the developing nervous system. Nat Rev Neurosci 5, 97-107.

189

Udvadia, A. J., Rogers, K. T., Higgins, P. D., Murata, Y., Martin, K. H., Humphrey, P. A. and Horowitz, J. M. (1993) Sp-1 binds promoter elements regulated by the RB protein and Sp-1-mediated transcription is stimulated by RB coexpression. Proc Natl Acad Sci USA 90, 3265-3269.

Udvadia, A. J., Rogers, K. T. and Horowitz, J. M. (1992) A common set of nuclear factors bind to promoter elements regulated by the retinoblastoma protein. Cell Growth Differ 3, 597-608.

Van Petegem, F., Clark, K. A., Chatelain, F. C. and Minor, D. L. (2004) Structure of a complex between a voltage-gated calcium channel beta-subunit and an alpha-subunit domain. Nature 429, 671-675.

Vaquerizas, J. M., Kummerfeld, S. K., Teichmann, S. A. and Luscombe, N. M. (2009) A census of human transcription factors: function, expression and evolution. Nature reviews Genetics 10, 252-263.

Vartiainen, M. K., Guettler, S., Larijani, B. and Treisman, R. (2007) Nuclear actin regulates dynamic subcellular localization and activity of the SRF cofactor MAL. Science 316, 1749-1752.

Vashishta, A., Habas, A., Pruunsild, P., Zheng, J.-J., Timmusk, T. and Hetman, M. (2009) Nuclear factor of activated T-cells isoform c4 (NFATc4/NFAT3) as a mediator of antiapoptotic transcription in NMDA receptor-stimulated cortical neurons. Journal of Neuroscience 29, 15331-15340.

Vician, L., Lim, I. K., Ferguson, G., Tocco, G., Baudry, M. and Herschman, H. R. (1995) Synaptotagmin IV is an immediate early gene induced by depolarization in PC12 cells and in brain. Proc Natl Acad Sci USA 92, 2164- 2168.

Vihma, H., Pruunsild, P. and Timmusk, T. (2008) Alternative splicing and expression of human and mouse NFAT genes. Genomics 92, 279-291.

Wahl, A.-S., Buchthal, B., Rode, F., Bomholt, S. F., Freitag, H. E., Hardingham, G. E., Rønn, L. C. B. and Bading, H. (2009) Hypoxic/ischemic conditions induce expression of the putative pro-death gene Clca1 via activation of extrasynaptic N-methyl-D-aspartate receptors. Neuroscience 158, 344-352.

Wayman, G. A., Impey, S., Marks, D., Saneyoshi, T., Grant, W. F., Derkach, V. and Soderling, T. R. (2006) Activity-dependent dendritic arborization mediated by CaM-kinase I activation and enhanced CREB-dependent transcription of Wnt-2. Neuron 50, 897-909.

Wayman, G. A., Lee, Y.-S., Tokumitsu, H., Silva, A. J., Silva, A. and Soderling, T. R. (2008) Calmodulin-kinases: modulators of neuronal development and plasticity. Neuron 59, 914-931.

190

Weick, J. P., Groth, R. D., Isaksen, A. L. and Mermelstein, P. G. (2003) Interactions with PDZ proteins are required for L-type calcium channels to activate cAMP response element-binding protein-dependent gene expression. J Neurosci 23, 3446-3456.

West, A. E. (2008) Biological functions of activity-dependent transcription revealed. Neuron 60, 523-525.

West, A. E., Chen, W. G., Dalva, M. B., Dolmetsch, R. E., Kornhauser, J. M., Shaywitz, A. J., Takasu, M. A., Tao, X. and Greenberg, M. E. (2001) Calcium regulation of neuronal gene expression. Proc Natl Acad Sci USA 98, 11024-11031.

West, A. E., Griffith, E. C. and Greenberg, M. E. (2002) Regulation of transcription factors by neuronal activity. Nat Rev Neurosci 3, 921-931.

Westphal, R. S., Tavalin, S. J., Lin, J. W., Alto, N. M., Fraser, I. D., Langeberg, L. K., Sheng, M. and Scott, J. D. (1999) Regulation of NMDA receptors by an associated phosphatase-kinase signaling complex. Science 285, 93-96.

Wong, H.-K., Liu, X.-B., Matos, M. F., Chan, S. F., Pérez-Otaño, I., Boysen, M., Cui, J., Nakanishi, N., Trimmer, J. S., Jones, E. G., Lipton, S. A. and Sucher, N. J. (2002) Temporal and regional expression of NMDA receptor subunit NR3A in the mammalian brain. J Comp Neurol 450, 303-317.

Wu, G. Y., Deisseroth, K. and Tsien, R. W. (2001a) Activity-dependent CREB phosphorylation: convergence of a fast, sensitive calmodulin kinase pathway and a slow, less sensitive mitogen-activated protein kinase pathway. Proc Natl Acad Sci USA 98, 2808-2813.

Wu, H., Rothermel, B., Kanatous, S., Rosenberg, P., Naya, F. J., Shelton, J. M., Hutcheson, K. A., DiMaio, J. M., Olson, E. N., Bassel-Duby, R. and Williams, R. S. (2001b) Activation of MEF2 by muscle activity is mediated through a calcineurin-dependent pathway. EMBO J 20, 6414-6423.

Xiang, G., Pan, L., Xing, W., Zhang, L., Huang, L., Yu, J., Zhang, R., Wu, J., Cheng, J. and Zhou, Y. (2007) Identification of activity-dependent gene expression profiles reveals specific subsets of genes induced by different routes of Ca(2+) entry in cultured rat cortical neurons. J Cell Physiol 212, 126-136.

Yamagata, K., Andreasson, K. I., Kaufmann, W. E., Barnes, C. A. and Worley, P. F. (1993) Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron 11, 371-386.

Yamagata, K., Andreasson, K. I., Sugiura, H., Maru, E., Dominique, M., Irie, Y., Miki, N., Hayashi, Y., Yoshioka, M., Kaneko, K., Kato, H. and Worley, P.

191

F. (1999) Arcadlin is a neural activity-regulated cadherin involved in long term potentiation. J Biol Chem 274, 19473-11979.

Yamagata, K., Sanders, L. K., Kaufmann, W. E., Yee, W., Barnes, C. A., Nathans, D. and Worley, P. F. (1994) rheb, a growth factor- and synaptic activity- regulated gene, encodes a novel Ras-related protein. J Biol Chem 269, 16333-16339.

Yang, S.-H., Bumpass, D. C., Perkins, N. D. and Sharrocks, A. D. (2002) The ETS domain transcription factor Elk-1 contains a novel class of repression domain. Mol Cell Biol 22, 5036-5046.

Yang, S.-H. and Sharrocks, A. D. (2006) PIASxalpha differentially regulates the amplitudes of transcriptional responses following activation of the ERK and p38 MAPK pathways. Molecular Cell 22, 477-487.

Yang, S. H., Galanis, A. and Sharrocks, A. D. (1999) Targeting of p38 mitogen- activated protein kinases to MEF2 transcription factors. Mol Cell Biol 19, 4028-4038.

Yang, S. H., Vickers, E., Brehm, A., Kouzarides, T. and Sharrocks, A. D. (2001) Temporal recruitment of the mSin3A-histone deacetylase corepressor complex to the ETS domain transcription factor Elk-1. Mol Cell Biol 21, 2802-2814.

Yashiro, K. and Philpot, B. D. (2008) Regulation of NMDA receptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology 55, 1081-1094.

Yasuda, S., Tanaka, H., Sugiura, H., Okamura, K., Sakaguchi, T., Tran, U., Takemiya, T., Mizoguchi, A., Yagita, Y., Sakurai, T., De Robertis, E. M. and Yamagata, K. (2007) Activity-induced protocadherin arcadlin regulates dendritic spine number by triggering N-cadherin endocytosis via TAO2beta and p38 MAP kinases. Neuron 56, 456-471.

Yue, D. T., Herzig, S. and Marban, E. (1990) Beta-adrenergic stimulation of calcium channels occurs by potentiation of high-activity gating modes. Proc Natl Acad Sci USA 87, 753-757.

Zafra, F., Hengerer, B., Leibrock, J., Thoenen, H. and Lindholm, D. (1990) Activity dependent regulation of BDNF and NGF mRNAs in the rat hippocampus is mediated by non-NMDA glutamate receptors. EMBO J 9, 3545-3550.

Zhang, H., Fu, Y., Altier, C., Platzer, J., Surmeier, D. J. and Bezprozvanny, I. (2006) Ca1.2 and CaV1.3 neuronal L-type calcium channels: differential targeting and signaling to pCREB. Eur J Neurosci 23, 2297-2310.

192

Zhang, S.-J., Steijaert, M. N., Lau, D., Schütz, G., Delucinge-Vivier, C., Descombes, P. and Bading, H. (2007) Decoding NMDA receptor signaling: identification of genomic programs specifying neuronal survival and death. Neuron 53, 549-562.

Zhang, S.-J., Zou, M., Lu, L., Lau, D., Ditzel, D. A. W., Delucinge-Vivier, C., Aso, Y., Descombes, P. and Bading, H. (2009) Nuclear calcium signaling controls expression of a large gene pool: identification of a gene program for acquired neuroprotection induced by synaptic activity. PLoS Genet 5, e1000604.

Zhang, Y., Su, P., Liang, P., Liu, T., Liu, X., Liu, X.-Y., Zhang, B., Han, T., Zhu, Y.- B., Yin, D.-M., Li, J., Zhou, Z., Wang, K.-W. and Wang, Y. (2010) The DREAM protein negatively regulates the NMDA receptor through interaction with the NR1 subunit. J Neurosci 30, 7575-7586.

Zhao, M., New, L., Kravchenko, V. V., Kato, Y., Gram, H., di Padova, F., Olson, E. N., Ulevitch, R. J. and Han, J. (1999) Regulation of the MEF2 family of transcription factors by p38. Mol Cell Biol 19, 21-30.

Zhao, X., Sternsdorf, T., Bolger, T. A., Evans, R. M. and Yao, T.-P. (2005) Regulation of MEF2 by histone deacetylase 4- and SIRT1 deacetylase- mediated lysine modifications. Mol Cell Biol 25, 8456-8464.

Zhu, B. and Gulick, T. (2004) Phosphorylation and alternative pre-mRNA splicing converge to regulate myocyte enhancer factor 2C activity. Mol Cell Biol 24, 8264-8275.

Zhu, B., Ramachandran, B. and Gulick, T. (2005) Alternative pre-mRNA splicing governs expression of a conserved acidic transactivation domain in myocyte enhancer factor 2 factors of striated muscle and brain. J Biol Chem 280, 28749-28760.

Zukin, R. S. and Bennett, M. V. (1995) Alternatively spliced isoforms of the NMDARI receptor subunit. Trends Neurosci 18, 306-313.

193

Biography

Michelle Renée Lyons (née Tougas)

Date of Birth: April 20, 1984

Place of Birth: Atlanta, Georgia, U.S.A.

Education:

08/2006-03/2012 Ph.D. Candidate, Department of Neurobiology,

Duke University, Durham, NC, U.S.A.

08/2002-05/2006 B.S. in Biology (Highest Honors) w/Honors Thesis,

Co-operative Education Distinction,

Georgia Institute of Technology, Atlanta, GA, U.S.A.

Publications:

Lyons, M.R. and A.E. West (2011) Mechanisms of specificity in neuronal activity- regulated gene transcription. Prog Neurobiol, 94:259-295.

Haack, K.K.V., M.R. Tougas*, K.T. Jones, S.S. El-Dahr, H. Radhakrishna, and N.A. McCarty (2010) A Novel Bioassay for Detecting GPCR Heterodimerization: Transactivation of Beta 2 Adrenergic Receptor by Bradykinin Receptor. J. Biomol. Screen., 15:251-260.

*Published under my maiden name.

Awards & Fellowships:

2008-2009 Ruth K. Broad Foundation Research Award

194