Reelin Signaling in Oligodendrocyte Progenitor Cell Migration

Home , Protein C, Reelin

Item Type Thesis

Authors BHATTI, HARNEET

Rights Attribution-NonCommercial-NoDerivatives 4.0 International

Download date 04/10/2021 01:16:27

Item License http://creativecommons.org/licenses/by-nc-nd/4.0/

Link to Item http://hdl.handle.net/20.500.12648/2052

Reelin Signaling in Oligodendrocyte

Progenitor Cell Migration

HARNEET BHATTI

A Thesis in the Department of Cell and Developmental Biology

Submitted in partial fulfillment of the requirements for the degree of Master of

Science in the College of Graduate Studies of State University of New York, Upstate

Medical University.

Approved______

Date______

Table of Contents

Acknowledgements…………………………………………………………...... iv

List of Tables and Figures…………………………………………………….....v

Abbreviations…………………………………………………………………...vii

Thesis Abstract………………………………………………………………...viii

Chapter 1: General Introduction..………………………………………………...1

Introduction………………………………………………………………..2

The history of Reelin……………………………………………………...3

Structure of Reelin………………………………………………………...4

The function of Reelin in the developing brain…………………………...7

Cellular receptors for Reelin: ApoER2 and VLDLR……………………...9

Downstream effectors of Reelin…………………………………………13

Additional functions of Reelin…………………………………………...21

Reelin and human disease………………………………………………..26

Thesis Research………………………………………………………….35

References………………………………………………………………..37

Figures……………………………………………………………………64

Chapter 2: Reelin signaling in oligodendrocyte progenitor cell migration……..74

Acknowledgements………………………………………………………75

Introduction………………………………………………………………76

Materials and Methods…………………………………………………...78

Results……………………………………………………………………84

Discussion………………………………………………………………..94

Conclusions and Future Directions………………………………………95

References………………………………………………………………..97

Figures…………………………………………………………………..101

iii

Acknowledgements

I would like to acknowledge everyone that has helped me throughout the entire process of obtaining of this thesis.

Firstly, I would like to thank my advisor, Dr. Donna Osterhout, for guiding me throughout the entire length of this journey and for providing me with this great learning opportunity. I would also like to thank Kristen Swieck, who taught me many of the lab techniques that were crucial for the completion of this thesis. In addition, I would like to thank Dr. Eric Olson for providing mice and reagents, as well as for agreeing to be on my committee. I would also like to thank Dr. Huaiyu Hu and Dr. Margaret Maimone for serving on my committee. I am also grateful to the members of Dr. Eric Olson’s lab for teaching me techniques that were critical for this project. I would also like to thank Ivayla

Geneva, MD PhD, for assistance with writing Chapter 1.

I would like to thank the entire Department of Laboratory Animal Resources for helping with animal care.

I would also like to thank Terri Brown for being so patient and understanding and for helping me at every step of the way.

I would also like to thank the Health Science Foundation, the New York State

Spinal Cord Injury Trust and departmental funds for funding this study.

Last by not least, I would like to thank every member of my family, especially my mom and sister as well as my aunt and uncle for being my biggest supporters and for all the guidance they have provided.

List of Tables and Figures

Chapter 1

Figure 1. Inside-out pattern of Reeler brain vs normal cortex

Figure 2. Reelin protein structure and fragments generated upon processing

Figure 3. The structure of Reelin receptors: ApoER2 and VLDLR

Figure 4. Dab1 protein structure

Figure 5. Signaling components downstream of Reelin-Dab1 interactions

Chapter 2

Figure 1. Characterization of primary oligodendrocyte progenitor cells in culture

Figure 2. OPCs express Reelin and components of the Reelin signaling pathway

Figure 3. Reelin has a slight stimulatory effect on oligodendrocyte cell body migration

Figure 4. Reelin stimulates process outgrowth during cell dispersion

Figure 5. After cell bodies disperse, Reelin has no effect on process extension or cell motility

Figure 6. Oligodendrocyte progenitor cell migration appears normal in Reeler -/- mutants

Figure 7. Oligodendrocyte progenitor cells do not readily migrate from the subventricular zone in Scrambler -/- mice

Figure 8. The accumulation of oligodendrocyte progenitor cells is not due to increased proliferation

Figure 9. Common intracellular signaling components may regulate both neuronal and oligodendrocyte migration

Figure 10. Dab1 interacts with Fyn in oligodendrocyte progenitor cells

Figure 11. Fyn deficient mice show a mild migration defect, which may be due to Dab-Src interactions in the absence of Fyn

Figure 12. PDGF stimulation of oligodendrocyte progenitor cells results in phosphorylation of Dab1

Figure 13. Fyn interacts with Cdk5 in oligodendrocyte progenitor cells

Figure 14. Summary: Fyn-Dab1-Cdk5 interactions may be important for oligodendrocyte cell migration and this is stimulated by PDGF

Abbreviations

ApoER2 apolipoprotein E receptor 2 bHLH basic-helix-loop-helix

BSA bovine serum albumin

Cdk5 cyclin-dependent kinase 5

CNPase 2’,3’-Cyclic-nucleotide 3’-phosphodiesterase

CNS central nervous system

Dab1 disabled-1

EDTA ethylenediaminetetraacetic acid

FBS fetal bovine serum

FGF fibroblast growth factor

HBSS Hanks’ balanced salt solutions

MWCO molecular weight cutoff

OPC oligodendrocyte progenitor cell

PBS phosphate buffered saline

PDGF platelet-derived growth factor

PMSF phenylmethane sulfonyl fluoride

PTB phosphotyrosine binding domain

PVDF polyvinylidene difluoride

STK src tyrosine kinase

SVZ subventricular zone

TBS tris-buffered saline

VLDLR very low density lipoprotein receptor

vii

Thesis Abstract

Reelin Signaling in Oligodendrocyte Progenitor Cell Migration

Author: Harneet Bhatti

Sponsor: Dr. Donna Osterhout

Oligodendroglial progenitor cells (OPCs) are the precursors to the myelinating oligodendrocytes in the central nervous system (CNS). These cells are produced in the ventral neuroepithelium at later stages of cortical development, migrating into the cortex where they contact axons and differentiate, ultimately forming a myelin membrane.

During the process of differentiation, OPCs undergo significant morphological changes, extending many processes which will make contact with axons. Once in contact with an axon, the oligodendrocyte process expands and begins to form the myelin membrane which will ensheathe the axon.

Reelin is a highly conserved secretory glycoprotein, which has a critical role in directing neuronal migration. Reelin orchestrates the proper cortical layer formation and neuronal organization during brain development. In the absence of Reelin, the cerebral crotex is disorganized, with inverted cortical layers, generating devastating biological effects. Reelin acts through several cellular receptors, activating numerous downstream effectors and complex signaling cascades. If elements of the Reelin signalling pathway are disrupted, similar defects in migration can occur.

Oligodendroglial cells, from the early progenitor cells to the mature myelinating cells secrete Reelin, but also express a receptor for Reelin and critical elements of the intracellular Reelin signaling pathways. It is not known if these cells can respond to

viii

Reelin. In this thesis, we examined the effects of Reelin on oligodendroglial cells, using both in vitro and in vivo methods. We demostrate a potential role for Reelin in modulating oligodendrocyte migration, but also identify a novel aspect of Reelin signalling in the biology of oligodendroglia.

Chapter 1: General Introduction

I. Introduction

Oligodendrocytes are glial cells that are responsible for myelinating neurons within the central nervous system (CNS). These cells form a myelin sheath around axons, which is essential for rapid saltatory conduction of action potentials along the axon.

During brain development, the source of oligodendroglia are oligodendrocyte progenitor cells (OPCs) that originate in the ventricular zone (Warf et al., 1991; Ono et al., 1995,

1997a). The ventricular zone generates both neurons and glial cells, but it does so at different times during development (Kwan et al., 2012). OPCs are one of the last cell types to be generated (Altman and Bayer, 1984). Closer to the end of the gestational period, oligodendrocyte progenitor cells start to migrate away from the ventricular zone into the brain parenchyma, towards their putative white matter tracts (Bradl and

Lassmann, 2010). In rodents, they continue to migrate postnatally for several weeks, after which the OPCs differentiate and form compact myelin.

Migration of the OPCs is thought to be dependent on many environmental cues, including axonal activity, cell surface components and growth factors, molecules that may act as either a chemoattractant or repellant (de Castro and Bribián, 2005; Wheeler and Fuss, 2015). These molecules can be secreted, on the surface of adjacent cells or in the extracellular matrix network. Platelet-derived growth factor (PDGF) is a well known as a secreted growth factor that can stimulate OPC proliferation and migration

(Armstrong et al., 1991; Frost and Armstrong, 2009). Fibroblast growth factor 2, (FGF2) can stimulate OPC proliferation and is also necessary for proper OPC migration to putative white matter tracts (Osterhout et al., 1997). Netrin can act as both a

chemoattractant and a repellant, depending on the timing of local expression. Laminin is present in the extracellular matrix and may influence process outgrowth and differentiation. The number of molecules that influence OPCs during development is substantial, which is likely due to the dynamic changes occurring in the cellular environment as the brain is formed.

It was recently discovered that OPCs express and secrete Reelin, a neuronal guidance molecule, as well as a receptor for Reelin, VLDLR, as well as Dab1, an intracellular adaptor protein which is important for Reelin signaling (Siebert and

Osterhout, 2011). Reelin is a glycoprotein that plays a crucial role in organizing neuronal migration, a process that occurs prior to myelination (D’Arcangelo, 2014). The observation that oligodendroglia express both Reelin and a receptor for Reelin is novel, and suggests that the cells could respond to Reelin. Characterizing the effects of Reelin on oligodendroglia, the goal of this thesis, could identify a new role for Reelin in brain development.

II. The history of Reelin

In the early 1950s, the British geneticist Douglas Scott Falconer described the phenotypic appearance and abnormal behavior of an unexpected, but naturally occurring mouse variant (Falconer, 1951). The mice were smaller than litter mates and could not keep their hind limbs upright, which caused the animals to sway when standing and to fall to one side when walking, a reeling gait. A decade after the discovery of the Reeler mice, a histopathological study of their brains revealed a smaller-than-normal cerebellum

and disruptions in the laminar organization, explaining some of the behavioral abnormalities (Hamburgh, 1963). Further studies identified the inverted cellular layers of the neocortex of the Reeler mice, giving the brain an ‘inside-out’ organization (Figure 1,

Caviness Jr., 1976).

Proper brain development in mammals is critically dependent on neuronal migration events that are precisely ordered in space and time (Nadarajah and Parnavelas,

2002). The secreted glycoprotein Reelin plays a paramount role in orchestrating neuronal migration during development with deficiencies resulting in major defects in cortical lamination (D’Arcangelo, 2014). Since the description of the Reeler mouse (Falconer,

1951), the underlying mechanisms responsible for the defect have been well characterized. The Reelin gene was mapped (Pearlman et al., 1998) and the primary source of Reelin in the developing brain was identified as the Cajal-Retzius cells, (Ogawa et al., 1995). Two receptors for Reelin have been identified, as well as elements of downstream signaling cascades that are activated after Reelin binding to its receptor

(D’Arcangelo et al., 1999a; Rice and Curran, 2001).

III. Structure of Reelin

The Reelin protein is an approximately 400 kDa glycoprotein (Miao et al., 1994;

D’Arcangelo et al., 1995). It is composed of a N-terminal region (NTR) adjacent to a F- spondin like domain (Figure 2) (de Bergeyck et al., 1998), and 8 Reelin repeats which each contain an EGF-like domain. These EGF-like repeats are commonly present in extracellular proteins and receptors. At the end of the protein sequence is a C-terminal

region that consists of highly charged basic amino acids. It should be noted that much of what is known about Reelin structure is based on numerous studies of neuronal migration.

Reelin is secreted into the extracellular matrix where it is cleaved. In vivo, the cleavage was shown to occur between Reelin-repeat 2 (RR2) and Reelin-repeat 3 (RR3) and between Reelin-repeat 6 (RR6) and Reelin-repeat 7 (RR7), generating 3 different segments (Lambert de Rouvroit et al., 1999; Jossin et al., 2004, 2007): the N-terminal region (N-RR2), the central fragment (RR3-RR6) and the C-terminal region (RR7-C)

(Figure 2). However, the exact mechanisms of Reelin cleavage and the involved proteases are not well described. Recent studies indicate that tissue plasminogen activator

(tPA) and metalloproteinases ADAMTS-4 and ADAMTS-5 may play a role in Reelin cleavage, but despite the use of protease inhibitors or in the tPA knockout mouse, Reelin processing and signaling still occur, implying that there are other proteases at play (Krstic et al., 2012; Trotter et al., 2014).

It was demonstrated that the highly charged C-terminal region is required for

Reelin secretion into the extracellular matrix (D’Arcangelo et al., 1997). Further, the C- terminal region may also be important for maintaining the postnatal marginal zone

(Kohno et al., 2015). The N-RR2 segment contains a region that serves as an epitope recognized by the CR-50 antibody (Ogawa et al., 1995; D’Arcangelo et al., 1997). The

CR-50 antibody blocks Reelin function; evidence suggests that the CR-50 epitope of

Reelin is required for the tertiary structure formation that consists of homopolymers

(Utsunomiya-tate et al., 2000; Kubo et al., 2002), which is a prerequisite for efficient

Reelin signaling. The successful transduction of Reelin binding to its receptor is indicated

by the tyrosine phosphorylation of Dab1, an intracellular adaptor protein (Howell et al.,

1997a, 1997b; Sheldon et al., 1997). The role of this adaptor protein in the Reelin signaling pathway is thoroughly described in a later section. However, mutated Reelin that lacks the CR-50 epitope fails to form homopolymers and is not able to induce efficient Dab1 phosphorylation (Utsunomiya-tate et al., 2000; Kubo et al., 2002). This suggests that the tertiary structure formation of Reelin is dependent on the N-terminal region and is functionally important. The central region (RR3-RR6) was found to be required for receptor binding (Jossin et al., 2004, 2007). This fragment also becomes internalized once it bound to its receptor. Although it was shown that this fragment, on its own, can bind to both Reelin receptors (ApoER2 and VLDR) and induce Dab1 phosphorylation, full-length Reelin was slightly more effective at inducing Dab1 phosphorylation than the central fragment alone (Jossin et al., 2004). Based on these results, it was speculated that the N-terminal region might function to augment Dab1 phosphorylation.

Contradicting results have been published regarding the exact role of cleaved

Reelin. It may be that Reelin cleavage down regulates Reelin activity, as cleavage products generate a diminished Reelin downstream signal when compared to full length

Reelin activity (Utsunomiya-tate et al., 2000; Yasui et al., 2007). On the other hand, secreted Reelin may allow diffuse Reelin signaling. Reelin cleavage products were found at the bottom of the cortical plate, indicating that cleavage may be a way to release Reelin fragments from the extracellular matrix so that they can diffuse and induce long-distance signaling (Jossin and Cooper, 2011).

IV. The function of Reelin in the developing brain

Expression of Reelin in the brain

The RELN gene was mapped to chromosome 7q22, allowing subsequent cloning, and further genetic investigations (Pearlman et al., 1998). Initially, it was discovered that within the embryonic mouse brain, Reelin is produced by a subset of neurons referred to as the Cajal-Retzius cells in the marginal zone of the cerebral cortex and in the stratum lacunosum moleculare of the hippocampus (Ogawa et al., 1995; Nakajima et al., 1997;

Alcántara et al., 1998). By 3 weeks of gestation in the mouse, towards the end of corticogenesis, these Cajal-Retzius cells begin to disappear from the marginal zone and are gradually replaced by subpial granule cells, which are GABAergic neurons that continue to express Reelin in the pre-natal brain. Postnatally and in adult mice, Reelin continues to be expressed in GABAergic interneurons in the cerebral cortex and olfactory bulb (Alcántara et al., 1998). Granule cells in the cerebellum also express Reelin during embryonic development and continue to do so postnatally (Miyata et al., 1996; Alcantara et al., 1998; Jensen et al., 2002).

Neuronal migration during brain development

The Reelin protein has been extensively studied in the developing mammalian brain where it plays a paramount role in cell migration. Neuronal migration in the cerebral cortex begins when early-born neurons, generated at embryonic day 10.5-11.5 in

mice, leave the ventricular zone (VZ), the region where they proliferate, to form the preplate (Pearlman et al., 1998; Gupta et al., 2002). The new neurons split this preplate to generate the superficial marginal zone (MZ) and the deeper subplate as they form the cortical plate (CP) in between. Neurons born next (late born neurons) migrate past the subplate and early born neurons so that the cortex layering is in an “inside-out” pattern, with early born neurons residing in deeper layers (Gupta et al., 2002; Nadarajah et al.,

2003).

To physically migrate, cortical neurons generally use radial glia-independent somal translocation and radial glia-guided locomotion (Nadarajah et al., 2001; Nadarajah and Parnavelas, 2002). In somal translocation, the neuron extends a leading process toward the pial surface until it reaches the MZ at which point the process generates many branches to attach itself to the extracellular matrix of the MZ. The branched end creates traction, which subsequently allows the cell body to translocate. Radial glia-guided locomotion on the other hand relies on the presence of an established radial glial scaffold.

Extension of the leading process and nucleokinesis occur simultaneously in this type of migration. Migrating neurons attach to the radial glial scaffold and migrate toward the pial surface. Once they have reached their destination, neurons detach from the radial glial fiber and stop migrating. Early born neurons mainly use somal translocation to form the subplate and layer VI, whereas late born neurons use radial glia-guided locomotion to migrate larger distances at E13.5 and later in mice (Nadarajah et al., 2001; Nadarajah and

Parnavelas, 2002; Hatanaka et al., 2004; Ayala et al., 2007). These late born neurons seem to switch their migratory mode to somal translocation during their final stages of

migration. The Reelin protein orchestrates the radial glia-guided neuronal migration during pre-natal brain development.

V. Cellular receptors for Reelin: ApoER2 and VLDLR

Genetic and biochemical studies have identified two high-affinity Reelin receptors: apolipoprotein E receptor 2 (ApoER2) and the very-low-density lipoprotein receptor (VLDLR) (Hiesberger et al., 1999; Trommsdorff et al., 1999), both of which are members of the lipoprotein receptor superfamily (Herz, 2001). In terms of cortical development, it is thought that the two receptors ApoER2 and VLDLR play individual roles in the Reelin signaling pathway. ApoER2 seems to play a role in the migration of late born neurons during the cortical layer formation (Hack et al., 2007). It is highly expressed in neurons that generally make up layers II-IV (late born IV neurons). These neurons reach their destination by E16.5-18.5 and ApoER2 expression persists even at

P7. It might be that ApoER2 is important for these neurons to attach to the radial glial scaffold, as these late generated neurons primarily use the radial glial scaffold to migrate to their appropriate locations. In ApoER2 knockout mice, neurons fail to undergo radial migration and are instead packed together in horizontal segments, even though the radial glial scaffold is not affected (Trommsdorff et al., 1999). VLDLR on the other hand, seems to act more of as a stop signal as it was reported that in VLDLR knockout mice, cortical neurons over migrate and invade the marginal zone and they also fail to disperse

(Dulabon et al., 2000; Hack et al., 2007). A double knockout of these receptors in mice induces a reeler-like phenotype (Trommsdorff et al., 1999). However, since ApoER2 or

VLDLR individual knockouts do not demonstrate the full Reeler phenotype, rather just a milder phenotype, the two receptors may have some overlapping functions.

ApoER2 and VLDLR share approximately 50% of their amino acid sequence.

They are type I transmembrane receptors and have five highly conserved structural domains including a cytoplasmic domain that contains a NPxY motif, a single transmembrane sequence, an O-linked sugar domain, an EGF domain, and an extracellular N-terminal ligand-binding domain with cysteine-rich repeats (Reddy et al.,

2011) (Figure 3). A major difference between the two receptors is at their O-linked glycosylation domains. The base pair sequence of this region is the least similar and in

ApoER2 is more than double in size.

Binding of Reelin to either ApoER2 or VLDLR requires Ca2+ and leads to tyrosine phosphorylation of Dab1, an adaptor protein (Hiesberger et al., 1999). Although some studies claim that ApoER2 and VLDLR bind to Reelin with similar affinities

(D’Arcangelo et al., 1999b; Benhayon et al., 2003), others reported that in vitro, ApoER2 has a higher binding affinity than VLDLR and indicated that ApoER2 may play a more critical role in cortical development (Benhayon et al., 2003). Differential splicing of

ApoER2 results in two isoforms with varying binding affinities for Reelin (Hibi et al.,

2009) including a form of ApoER2 that has a different cytoplasmic tail than VLDLR.

ApoER2 has a cytoplasmic tail that consists of a 59-amino acid proline rich insertion

(Stockinger et al., 2000). The proline rich area on ApoER2 interacts with JNK-interacting proteins (JIP-1 and JIP-2) that are involved in the JNK signaling pathway, which is known to play a role in tissue morphogenesis, cell proliferation and apoptosis.

ApoER2 is more highly expressed in cortical and hippocampal neurons while

VLDLR expression is more prominent in the Purkinje cells of the cerebellum

(Trommsdorff et al., 1999). This difference in cellular expression could explain the differences observed in mice lacking ApoER2 vs VLDLR, as ApoER2 knockout mice have more severe defects in forebrain structures whereas VLDLR knockout mice have greater defects in the cerebellum.

With regards to cellular localization, ApoER2 was found to be strictly restricted to lipid rafts (Riddell et al., 2001). VLDLR, on the other hand, is not localized to lipid rafts and it was found that Reelin binding does not translocate VLDLR to lipid rafts

(Mayer et al., 2006). The extracellular domain of mature ApoER2, which contains the O- linked sugar domain, is responsible for ApoER2 localization to lipid rafts/caveolae (Duit et al., 2010). Glycosylation, which forms the O-linked sugar domain, is the signal which directs ApoER2 to lipid rafts. The VLDLR variant that is expressed in the embryonic mouse brain lacks exon 16, which is the region that codes for the O-linked sugar domain

(Mayer et al., 2006). Thus, the extracellular domains of both receptors are responsible for their distinct localization. Both receptors internalize Reelin using clathrin-coated vesicles, but it was found that localization of ApoER2 to lipid rafts negatively affects its Reelin endocytosis rate (Duit et al., 2010). VLDLR internalizes Reelin much more efficiently than ApoER2 but it was found that once ApoER2 loses its association with the rafts, the endocytosis rate increases dramatically.

In the presence of Reelin, ApoER2 levels drop significantly, while there is no major change in VLDLR levels (Mayer et al., 2006). ApoER2 predominantly undergoes degradation upon Reelin stimulation, while most VLDLR is recycled back to the plasma

membrane (Hong et al., 2010). ApoER2, located in lipid rafts, undergoes endocytosis via a clathrin-mediated process (Cuitino et al., 2005), albeit slower than VLDLR.

Subsequently, ApoER2 and VLDLR degradation can occur via lysosomes (Li et al.,

2001; Duit et al., 2010). It was actually found that the intracellular tails of both ApoER2 and VLDLR become ubiquitinated upon induction of E3 ubiquitin-ligase-inducible degrader of the low density lipoprotein receptor (Idol) expression, resulting in the degradation of these receptors (Hong et al., 2010). This was shown in vitro, in glioblastoma cells, as well as in vivo in mice.

It should be noted that Reelin binding to receptors alone is not sufficient for downstream signaling of Reelin (Utsunomiya-tate et al., 2000; Kubo et al., 2002).

Receptor clustering with Reelin binding is required to induce Dab1 phosphorylation and it may be that Reelin binding to its receptors as a homodimer or as a multimeric complex results in receptor clustering (Strasser et al., 2004). However, receptor clustering alone is not sufficient to get the full effect of Reelin, as the Reeler phenotype is not rescued upon induction of receptor clustering in the absence of Reelin binding (Jossin et al., 2004).

This suggests that other unknown molecular events at the receptor level are needed to obtain the full effect of Reelin. Reelin can also act as both an attractant and a repellant for neurons (Frotscher, 1998; Zhao et al., 2004). It is possible that the role of Reelin is determined by which Reelin receptor is activated, since its two receptors seem to have distinct functions and localizations. In cases where both receptors are expressed on the same neurons, differences in receptor binding affinities to Reelin or brain substructure localization may ultimately determine the cellular response.

Both ApoER2 and VLDLR have other ligands that they bind and import, including ApoE lipid complexes, urokinase-type plasminogen activator (uPA)-PAI-1 complex, thrombospondin I, lipoprotein lipase, and serine-protease-protease inhibitor complexes (Cooper and Howell, 1999). Recently, clusterin (Apolipoprotein J) was also reported to be a ligand for both of these receptors (Leeb et al., 2014). It was shown that upon clusterin binding, as a dimer or trimer like Reelin, it leads to receptor clustering and internalization. It induces Dab1 phosphorylation as well and seems to play a role in neurogenesis of these cells at the SVZ. Thrombospondin also binds to these receptors, and causes receptor clustering and Dab1 phosphorylation (Blake et al., 2008)

VI. Downstream effectors of Reelin

DAB-1

When Reelin binds to either ApoEr2 or VLDLR, tyrosine phosphorylation of Dab1, an adaptor protein, occurs. The Dab1 gene was first identified due to similarities between the naturally occuring Scrambler, Yotari, and Reeler mutant mice, and the observation that an engineered Dab1 knockout mouse also exhibited a phenotype similar to the Reeler mouse. Collectively, these findings suggested that Dab1 is involved downstream of

Reelin (Goldowitz et al., 1997; Howell et al., 1997c; Sheldon et al., 1997; Ware et al.,

1997). Further studies demonstrated that molecular signaling downstream of Reelin is critically dependent on phosphorylation of Dab1 (Jossin et al., 2004).

During cortical development, most cortical neurons express Dab1 (Abadesco et al., 2014). In adults, Dab1 expression seems to be limited to pyramidal neurons in cortex layers II, III, and V. It is also expressed in Purkinje cells, sympathetic preganglionic neurons, basal forebrain neurons, spinal cord motor neurons (SMNs), neurogranin- positive Golgi cells in the cerebellum, and in small neurons in the DCN. Oligodendrocyte progenitor cells also express Dab1 (Siebert and Osterhout, 2011).

Dab1 contains a phosphotyrosine binding domain (PTB) and has five potential tyrosine phosphorylation sites: tyrosine residues 185, 198, 200, 220, and 232 (Howell et al., 2000b) (Figure 4). Tyrosine residues 198, 220, and 232 are phosphorylated in response to Reelin (Keshvara et al., 2001; Ballif et al., 2004). It was found that members of the Src family of nonreceptor tyrosine kinases (STKs) mediate Dab1 tyrosine phosphorylation (Howell et al., 1997a; Arnaud et al., 2003a; Jossin et al., 2003a). Fyn seems to be the predominant STK that is responsible for Dab1 phosphorylation downstream of Reelin. When Fyn levels are reduced however, Src, another STK, becomes important, indicating redundancy in their functions. Embryonic mice brains with a double Fyn and Src knockouts exhibit similar phenotypes to Dab1 deficient or

Scrambler mice of the same age (Kuo et al., 2005). It was also found that embryonic brain slices exhibited Reeler-like malformations in the presence of PP2, a Src family kinase inhibitor (Jossin et al., 2003b). Receptor clustering, induced by Reelin binding, leads to the activation of STKs and as a result, tyrosine phosphorylation of Dab1

(Strasser et al., 2004). It should be noted that serine/threonine phosphorylation of Dab1 seems to be necessary for tyrosine phosphorylation to occur (Arnaud et al., 2003b). These

Src family kinases, mainly Fyn, can be further activated via autophosphorylation of a

critical residue (Arnaud et al., 2003a; Bock and Herz, 2003). In addition to phosphorylating Dab1, Fyn has been shown to increase surface levels of ApoER2 and also phosphorylate ApoER2 (Burrell et al., 2014).

When Reelin or both receptors are absent, Dab1 accumulates in a hypophosphorylated form, suggesting that Dab1 phosphorylation is needed for downstream Reelin signaling and that Dab1 is degraded upon Reelin stimulation

(Keshvara et al., 2001). Indeed, STK activation leads to Dab1 tyrosine phosphorlyation and then subsequent degradation of Dab1 through an association with Cbl, a ubiquitin- protein isopeptide ligase (Suetsugu et al., 2004). It was also demonstrated that phosphorylation of Tyrosine 185 and 198 of Dab1 downstream of Reelin signaling leads to polyubiquitination of Dab1 by Cullin 5, an E3 ubiquitin ligase component (Feng et al.,

2007). Cullin 5 forms a complex with the SH2 domain containing SOCS (suppressors of cytokine signaling) proteins, which binds to phosphorylated Dab1 and leads to Dab1 polyubquitination and degradation. Therefore, in the absence of Reelin, Dab1 levels are upregulated. Further, in double knockouts of ApoER2 and VLDLR, Dab1 would be hypophosphorylated, confirming the importance of tyrosine phosphorylation of Dab1 in ubiquitination and degradation (Trommsdorff et al., 1999).

It should be noted that phosphorylation of Dab1 does not occur exclusively downstream of Reelin. Binding of other ligands to Reelin receptors can also lead to Dab1 phosphorylation. For instance, binding of activated Protein C (APC) on monocytic-like

U937 cells to ApoER2 leads to Dab1 phosphorylation on Tyr 220 (Yang et al., 2009).

Clusterin binding to ApoER2 or VLDLR on neurons also leads to Reelin-like signaling

(Leeb et al., 2014). However, even though Dab1 can be phosphorylated via other

molecular pathways, Reelin-induced Dab1 phosphorylation is required for proper neuronal migration (Howell et al., 2000a).

In the absence of Reelin, neuronal Dab1 associates with immature Reelin receptors (Morimura et al., 2005). Immature receptors are those that lack glycosylation and are located in the cytoplasm rather at the cell membrane, whereas mature receptors are those that are found at the cell membrane. When Reelin binds to its receptors, Dab1 is recruited to mature receptors at the plasma membrane, and binds to the intracellular tail of these receptors. The phosphotyrosine binding (PTB) domain on Dab1 interacts with the NPXY motif on the cytoplasmic side of the Reelin receptors (NFDNPXY sequence motif) (Howell et al., 1999). This PTB domain is absolutely required for Reelin signaling. In mice with an altered PTB domain on ApoER2, and in the absence of

VLDLR, a Reeler–type phenotype occurred (Beffert et al., 2006).

Proteins with PTB regions, including Dab1, help regulate intracellular trafficking of the receptors that they associate with after ligand binding (Mishra et al., 2002). Dab1 may be involved in trafficking of Reelin receptors, based on the finding that in COS-7 cells, Dab1 prevents endocytosis of Reelin receptors, making more of these receptors available at the cell surface to bind Reelin (Morimura et al., 2005). In Dab1 deficient mice, the density of Reelin receptors on the cell surface are decreased, further supporting a role for Dab1 in receptor trafficking. By increasing the levels of Dab1 through transfection, Reelin receptors localized to the plasma membrane. Dab1 may increase the surface expression of Reelin receptors by preventing endocytosis and/or by directly translocating the receptors to the plasma membrane. Although in the absence of Reelin,

Dab1 does not strongly interact with mature glycosylated Reelin receptors, it does

interact with the immature Reelin receptors. It may be that Dab1 associates with immature receptors, brings them to the plasma membrane but does not remain bound to them unless Reelin is present.

Internalization of Reelin after binding to a receptor was shown to occur after tyrosine phosphorylation of Dab (Morimura et al., 2005). The internalization of Reelin in neurons was halted in the presence of PP2, an inhibitor of STKs, suggesting that STK activation is required for Dab1-dependent internalization of Reelin. It has also been reported that Dab1 dissociates from the Reelin-containing vesicles after Reelin stimulation and internalization. It was speculated that this might be due tyrosine phosphorylation causing Dab1 degradation or due to a reduction in the affinity between

Dab1 and Reelin receptors caused by Dab1 phosphorylation, or the low pH in endosomes. The exact molecular mechanism is not fully understood at present.

Dab1 phosphorylation has been implicated in the ability of neurons to detach from radial glial fibers in the cerebral cortex, based on the observation that in scrambler mice, neurons tended to stay attached to radial glial fibers whereas normal neurons would detach (Sanada et al., 2004). Phosphorylation of the specific tyrosine residues 220 and

232 of Dab1 seem to be important for neuronal detachment. One model proposed that

Dab1 phosphorylation (Y220 and 232) actually leads to the regulation of alpha3 integrin, which in turn helps control the adhesive properties of migrating neurons. It was shown that Reelin binds to the alpha3beta1 receptor and that this interaction helps neurons detach from radial glial cells (Dulabon et al., 2000). However, binding of Reelin to the alpha3beta1 receptor did not lead to Dab1 phosphorylation, so the exact molecular mechanism remains unknown.

The CRK pathway

Downstream of Reelin binding and Dab-1 phosphorylation is the involvement of

Crk, an adaptor protein, which is linked to an increase in the levels of N-cadherin at the plasma membrane (Jossin and Cooper, 2011) (Figure 5). After Reelin binds to a receptor,

Crk can interact with phosphorylated Y220 and 232 on Dab1 and this in turn leads to tyrosine phosphorylation of C3G, a Ras family guanine nucleotide exchange factor. This ultimately leading to the activation of Rap1 GTPase (Ballif et al., 2004; Chen et al., 2004;

Huang et al., 2004; Park and Curran, 2008; Feng and Cooper, 2009) (Fig. 4). Rap1 can activate other GTPases, including RalA, RalB, Ras1 and Cdc42. In multipolar neurons,

Rap1 was found to increase the level of N-cadherin at the plasma membrane (Jossin and

Cooper, 2011).

When projection neurons first originate at the ventricular zone, they are multipolar, as they extend and retract multiple projections and move in random directions. At this point, they use somal translocation to migrate (Tabata and Nakajima,

2003; Bielas et al., 2004; Noctor et al., 2004). Rap1 GTPase activation via Reelin signaling, specifically in the intermediate zone, resulted in increased levels of N-cadherin at the plasma membrane of multipolar neurons that helped orient the migration of these cells towards the cortical plate (Jossin and Cooper, 2011). This was shown to be important for glia-independent somal translocation (Franco et al., 2011). Further, C3G deficient neurons fail to leave the multipolar state and migrate away from the preplate

(Voss et al., 2008), indicating that the Dab1-Crk-C3G-Rap1-N-cadherin pathway is important for early migration via somal translocation of multipolar neurons.

The P13K-Akt pathway

Another pathway downstream of Reelin is the PI3K-Akt pathway, which leads to changes in microtubules and actin filaments (Figure 5). Dab1 phosphorylation of tyrosine

185 and 198, activates PI3K, phosphatidylinositol 3-kinase, which in turn activates Akt, a serine/threonine kinase (Protein kinase B), via phosphorylation (Beffert et al., 2002) .

Phosphorylated Dab1 interacts with a PI3K regulatory subunit to allow P13K activation

(Bock et al., 2003). Akt activation leads to inhibition of GSK-3Beta, glycogen synthase kinase 3Beta, which along with Cdk5, is responsible for phosphorylation of tau (Beffert et al., 2002) (Figure 5). However, in another study, it was found that the overall effect of

Reelin signaling on GSK-3 was an increase in its activity (González-Billault et al., 2005).

When Reelin activity leads to an increase in GSK-3 activity, it results in phosphorylation of MAP1B, a neuron specific microtubule-associated protein that is involved in regulating the stability between microtubules and actin filaments. Inactivation of GSK-3 via overexpression of Wnt7b leads to a decrease in MAP1B phosphorylation and abnormal positioning of cortical neurons, as they did not migrate out to cortical plate from the SVZ (Viti et al., 2003). It should be noted that GSK-3 has two isoforms: alpha and beta (Cohen and Frame, 2001). It is conceivable that the difference in the results of the two contradicting studies above can be accounted for by the presence of these two isoforms.

Additional evidence supporting a role of the P13K-Akt pathway in neuronal migration is the observation that the absence of P13K activity leads to an impairment in cortical plate formation (Bock et al., 2003). Reelin signaling, via PI3K, may also regulate

n-cofilin activity, an actin-depolarizing protein that promotes the disassembly of F-actin

(Chai et al., 2009). It was found that Reelin induces phosphorylation of serine3 of n- cofilin in a PI3K dependent manner. PI3K activates LIMK1 (LIM kinase 1), a serine/threonine kinase, which then phosphorylates n-cofilin. This phosphorylation event prevents n-cofilin from depolymerizing F-actin and as a result, leads to the stabilization of the cytoskeleton. PI3K, downstream of Reelin and Dab1, also activates Rho GTPase cdc42, which is known to be involved in growth cone motility and filopodia formation in cortical neurons (Leemhuis et al., 2010).

Through the Dab1-PI3K-Akt pathway (Figure 5), Reelin also leads to the activation of the mTor (mammalian target of rapamycin) – S6K1 (S6 Kinase 1) and this is thought to play a role in regulating the growth and branching of dendrites in hippocampal neurons (Jossin and Goffinet, 2007a). mTor phosphorylates Akt, to further increase its activity, but only P13K and Akt seem to be involved in proper cortical plate formation, making it likely that there are other binding partners responsible for this effect.

The Nckbeta and N-WASP pathways

Activation of molecules involved in cytoskeleton remodeling are also downstream of Reelin-Dab1 activation. Nckbeta was shown to bind to phosphorylated

Dab1, on Y220 or Y232, Reelin regulated sites, via its SH2 domain (Pramatarova et al.,

2003) (Figure 5). Dab1 has also been shown to associate with N-WASP (neuronal

Wiskott-Aldrich syndrome protein)(Suetsugu et al., 2004). The PTB domain on Dab1

binds to N-WASP and in doing so, through the Arp 2/3 complex, induces actin polymerization in vitro. LIS1 (PAFAH1B1), a microtubule associated protein, is also thought to be downstream of Dab1 in the Reelin signaling pathway (Assadi et al., 2003)

(Figure 5). Loss of function mutations in the gene PAFAH1B1 leads to lissencephaly, a human neuronal migration disorder which results in a “smooth brain” with less convoluted gyri (Moon and Wynshaw-Boris, 2013). It was found that upon Reelin signaling, phosphorylated Dab1 interacts with LIS1. LIS1 is thought to play a role in cytoplasmic dynein regulation to allow somal translocation (Tsai et al., 2007).

Cytoskeleton rearrangements overall are important for proper neuronal migration and defects in the regulation of microtubule and actin filament remodeling prevents proper cortical lamination of neurons. Reelin may play a role in regulating many of the components involved in cytoskeletal rearrangement.

VII. Additional functions of Reelin

Reelin expression in post-natal and adult brain

Both postnatally and in the adult mouse, the majority of Reelin expression originates from GABAergc interneurons in the cerebral cortex and olfactory bulb

(Alcántara et al., 1998). Granule cells in the cerebellum, which express Reelin during embryonic development, continue to do so postnatally (Miyata et al., 1996; Alcántara et al., 1998; Jensen et al., 2002). It was demonstrated that in the postnatal hippocampus,

Reelin is necessary for the formation of proper layer-specific and topographic

connections as well as for the maturation of single fibers and the synaptogenesis by entorhinal afferents (Borrell et al., 1999). More detailed studies have demonstrated that the lack of Reelin in the Reeler mouse results in delayed apical dendrite growth of the dentate granule neurons in the post-natal forebrain (Niu et al., 2004). Just like during neuronal migration in the pre-natal brain, Reelin binding and Dab1- VLDLR/ApoER2 interactions (Niu et al., 2004) as well as signaling cascades involving the Src kinases,

Crks, PI3K, and Akt (Jossin and Goffinet, 2007b; Matsuki et al., 2008b) may control the rate of dendrite outgrowth in the immature hippocampal neurons. Dendrite growth in hippocampal neurons stems from enhancement of F-actin stability, by elevating immediate-early gene mRNA levels (Stritt and Knoll, 2010). Interestingly, it was demonstrated in vivo that Reelin can orchestrate selective pruning of dendrites in the cortical layer II and III pyramidal neurons, a process in which the participation of the serotonin 5-HT3 receptor is implicated (Chameau et al., 2009).

Further, it was demonstrated using cultured hippocampal neurons that Reelin controls the shift in subunit composition of the NMDA receptors during post-natal brain maturation (Sinagra et al., 2005). During maturation, the contributions of the NR1/NR2B receptors to the whole-cell mediated NMDA currents decrease, as there are fewer of these receptors present at the synapse over time. This depletion at the synapse is accompanied by a concomitant increase in Reelin expression in neuronal somata and Reelin secretion.

Experimental modulation of Reelin levels further demonstrated the important role of the

Reelin protein in post-natal brain maturation (Sinagra et al., 2005). This process is currently referred to as the “NR2B-NR2A developmental switch” and necessitated the presence of the ApoER2 splice variant which contains the region coded by exon 19 and

which is known to be more actively produced during periods of activity (Beffert et al.,

2005). Further, using the same neuronal culture model and single particle tracking (Groc et al., 2007), it was demonstrated that in the presence of Reelin, the NR1/NR2B receptors move faster through the cell membrane, while their mobility is greatly reduced upon

Reelin depletion. In the absence of Reelin, there is a failure to decrease the NR1/NR2B receptor population during the maturation process. Further, there is evidence that, at least in the adult rat hippocampus using the fear conditioning paradigm, memory formation is associated with demethylation and transcriptional activation of the Reelin gene (Miller and Sweatt, 2007).

Oligodendroglia can also serve as a source of Reelin in the postnatal brain.

Reelin, the receptor VLDLR and Dab1 are expressed in oligodendroglial cells, from the progenitor cell to the mature oligodendrocyte (Siebert and Osterhout, 2011). Moreover, both progenitors and mature oligodendrocytes were found to secrete Reelin. Ablation of oligodendrocytes in the brain results in a reduction in Reelin levels, further suggesting that these cells are a source of Reelin in the adult (Collin et al., 2007). However, a specific role for oligodendroglial derived Reelin has yet to be been identified.

At least one post-natal neuronal migration process is Reelin-independent, while still involving the ApoER2/VLDLR-DAB1 intracelluar signaling pathway (Blake et al.,

2008). Namely, the migration of neuronal precursors from the subventricular zone to the olfactory bulb is orchestrated by thrombospondin-1 rather than Reelin, where thrombospondin-1 was shown to serve as a ligand for ApoER2 and VLDLR and induces

Dab1 phosphorylation.

Schwann cells

An increase in Reelin levels is observed after injury, specifically in Schwann cells of peripheral nerves, which was demonstrated in a sciatic nerve crush injury in mice

(Panteri et al., 2006). In the absence of injury, the same study found that Schwann cell- derived Reelin is, just like in the brain, down-regulated with age. Further, they demonstrated that Reelin is associated with a modest decrease in the caliber of myelinated axons and the number of myelinated axons per unit area. The authors proposed that this may be accomplished when Reelin initiates a signaling cascade by binding to the cadherin-related neuronal receptor, protocadherin, which is known to be expressed in developing axons. Similar to other tissues, the signaling cascade is likely mediated by Fyn-tyrosine kinase and results in the stimulation of Cyclin-dependent kinase 5 (Cdk5), which in turn phosphorylates high- and middle-molecular-weight neurofilaments. This last step is paramount for the control of axon diameter.

The eye

Reelin expression has also been detected in the mouse eye at P7, within retinal ganglion cells, amacrine cells, and a subset of bipolar cells (Rice et al., 2001). In the same study, Dab1 has been detected in type AII amacrine cells and at the border between the inner plexiform layer and the ganglion cell layer and possibly in bipolar cells. While the expression of Reelin showed little change until adulthood, Dab1 became restricted to only the type AII amacrine cells. Further, the study found that the expression of Dab1,

which is detectable in type AII amacrine cells of the wild type mouse retina, is 5- to 10- fold higher in the Reeler mouse retina. The fact that a similar 5- to 10-fold increase in

Dab1 expression has been observed in the Reeler mouse forebrain and cerebellum, as compared to wild type (Rice et al., 1998) suggests that the Reelin-Dab1 pathway is likely active in the retina. While there was no significant disruption in the laminated structure of the retina in mice lacking either Reelin or Dab1, there was a significant decrease in rod bipolar cells and an associated attenuation in the electroretinogram (ERG) responses in these mutant retinas (Rice et al., 2001). This functional deficit hinted at the importance of the Reelin-Dab1 pathway for the proper organization of synaptic connections in the retina. Further research supported this idea by demonstrating the expression of Reelin’s receptor, ApoER2, in the post-natal retina, specifically in type AII amacrine cells (Trotter et al., 2011). Mice deficient in ApoER2 featured morphologic disruptions in their rod bipolar cells, disarranged dendritic development in type AII amacrine cells, as well as abnormal rod-driven ERG responses. Although the expression of VLDLR, the other

Reelin receptor, was not studied in this paper, ERGs of VLDLR knockout mice demonstrated reductions in the oscillatory potentials and delayed synaptic response intervals.

Corneal endothelial cells in adult mice have also been shown to produce Reelin

(Pulido et al., 2007). Both the corneal endothelial cells and retinal ganglion cells were capable of upregulating their Reelin expression at the lesion site after an injury consisting of corneal epithelium debridement or full-thickness retinal laceration in mice, respectively. Again, it was speculated that the upregulation is likely associated with an attempt at tissue repair via process akin to the way of how Reelin orchestrates stem cell

migration in adult neural tissues (Kim et al., 2002). A possible Reelin-assisted homing of implanted stem cells was observed in experiments where stems cells are implanted following induced injury in the brain or retina (Qu et al., 2001; Dong et al., 2003).

VIII. Reelin and human disease

Over the last two decades a number of similarities, on the structural, behavioral, and biochemical levels, have been identified between human patients with neurodevelopmental or neurodegenerative disorders and animals lacking the Reelin protein or other proteins from the Reelin-driven signaling cascades. Prominent examples include psychotic conditions, autism, Alzheimer’s disease, lissencephaly, and temporal lobe epilepsy.

Schizophrenia and psychosis

Schizophrenia is a relatively common mental disorder where the affected individual misunderstands reality to the extent that they start behaving erratically and can become harmful to themselves as well as to the people around them. While the origin of this condition has been deemed multifactorial, with many environmental and genetic factors playing a role (Owen et al., 2016), one hypothesis claims that schizophrenia develops as a result of neurodevelopmental errors, such as abnormal cerebral lamination, which occur during the first half of human gestation (Akbarian et al., 1993). Interestingly, it was shown in post-mortem studies that in the brains of patients with schizophrenia, as

well as in those of patients with bipolar disorder with psychosis, the Reelin protein is

50% downregulated, likely due to abnormal DNA methylation of the RELN gene promoter (Impagnatiello et al., 1998; Guidotti et al., 2000; Lakatosova and Ostatnikova,

2012). A similar 50% reduction in Reelin mRNA and protein expression was observed in the brains of heterozygous Reeler mice (Tueting et al., 1999), but initially it was believed that these animals are phenotypically normal as that they do not exhibit ataxia or layer defects in any brain region (D’Arcangelo et al., 1995). Later studies demonstrated that the

Reeler heterozygous mice do exhibit behavioral traits such as neophobia, which are consistent with human psychosis (Tueting et al., 1999; Qiu et al., 2006). The behavioral abnormalities became apparent in the mouse at developmental stage that is equivalent to late adolescence/early adulthood in humans, which coincides with the time when the incidence of psychosis in humans peaks (Lewis, 1997). Further, there was a decrease in pre-pulse inhibition of startle in the heterozygous Reeler mice (Tueting et al., 1999): a finding that had been associated with human psychotic disorders (Karper et al., 1996).

There was an abnormal accumulation of neurons positive for Nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) in the subcortical white matter of heterozygous Reeler mice, which was interpreted as a sign for aberrant cell migration during embryonic development, where the cells fail to reach their cortical plate destination and instead remain in the subplate (Tueting et al., 1999). This finding is similar to the abnormal NADPH-d expression distribution in cortical as compared to subcortical cells in the prefrontal cortex of human patients with schizophrenia (Akbarian et al., 1996). Subtle anatomical abnormalities in the heterozygous mice are hypothesized to account for functional connectivity problems. These include delayed growth of

dendritic processes in hippocampal neurons (Niu et al., 2004), and a reduction in the density of synaptic contacts in the frontal lobe (Liu et al., 2001) and prefrontal cortex

(Iafrati et al., 2014). Defects in dendritic spine density were also found in the hippocampus of heterozygous Reeler and Dab1 knockout mice, accompanied by altered molecular composition of the synaptosomes (Niu et al., 2008). Reelin treatment rescued spine density defects of Reeler organotypic hippocampal slices in a manner that was dependent on all core components of the signaling pathway, namely, the lipoprotein receptors ApoER2 and VLDLR, SFKs and Dab1 (Niu et al., 2008). Taken together, the various similarities between the heterozygous Reeler mouse and human psychosis led to the former being considered as a reasonable animal model for the human conditions and hint at the possibility that Reelin haplo-insufficiency might be a causative factor in the development of psychosis in humans (Costa et al., 2002).

Autism

Autism is another debilitating condition resulting in communication deficits, repetitive behavior, and often mental retardation, where the symptoms become apparent during early childhood. Autism is currently suspected to have underlying neurodevelopmental causes, where abnormal cell migration and apoptosis in the brain play important roles in the pathogenesis (Fatemi et al., 2001). Structural studies of patients with autism have revealed abnormalities similar to the ones described in the

Reeler mouse (Casanova et al., 2002; Fatemi et al., 2012). Further evidence for the possible involvement of Reelin in autism stems from association studies, which

demonstrated linkage between certain RELN gene polymorphisms and the development of the disease in humans (Persico et al., 2001; Zhang et al., 2002). However, this is controversial, because a number of studies failed to find any polymorphism linkages

(Krebs et al., 2002; Bonora et al., 2003; Devlin et al., 2004; Li et al., 2004). This discrepancy may pose the question as to the accurateness and appropriateness of this approach for evaluating the role of a single molecule such as Reelin in autism.

More definitive evidence for the role of Reelin and the components of its signaling cascades came from post-mortem studies of patients with autism and control individuals matched for gender, age, and post-mortem period (Fatemi et al., 2005). This study demonstrated significant decreases in the Reelin protein, Reelin mRNA, and Dab1 mRNA at the frontal and cerebellar areas, while VLDLR mRNA was increased in autistic brains as compared to the controls. In addition, there is a decrease in pre-pulse inhibition of startle in heterozygous Reeler mice (Tueting et al., 1999), a finding which has been associated with neurodevelopmental disorders in humans, including autistic patients diagnosed with Asperger’s syndrome (McAlonan et al., 2002). Clearly much more research would be necessary to fully understand the role of Reelin in the development of autistic traits in humans and the Reeler mouse mutants may prove useful as animal models in this pursuit.

Alzheimer’s disease

Alzheimer’s disease is a debilitating neurodegenerative disorder leading to memory loss, disorientation, mood instability, and eventually loss of the ability to carry

out the basic daily routines of life. It constitutes the most common cause of senile dementia and is a quickly growing economic and social burden world-wide (Ballard et al., 2011). While the pathogenesis of Alzheimer’s disease continues to be a dynamic area of research, it is widely agreed that all the associated genetic, environmental and other putative causative factors eventually lead to the formation of plaques and tangles in the human brain. The most studied hypotheses of pathogenesis are based on specific genetic defects such as the inheritance of the isoform ε4 of the ApoER receptor (Strittmatter et al., 1993), the decrease in production of the neurotransmitter acetylcholine (Francis et al.,

1999), the deposition of the Aβ amyloid protein in the brain (Hardy and Allsop, 1991), and the abnormal hyperphosphorylation of the tau protein. The increased phosphorylation of tau enables it to interact with other proteins in the brain to form neurofibrillary tangles inside nerve cell bodies (Iqbal et al., 2010).

Examination of normal wild type mice and non-human primates revealed that as the animals aged, Reelin ‘plaque-like’ aggregates started to form in the hippocampus and that the process was associated with the loss of the Reelin-expressing neurons (Matsuki et al., 2008a; Doehner et al., 2010). These studies also provided evidence for the co- localization of the Reelin-aggregates with non-fibrillary amyloid plaques, which gave birth to the hypothesis that the Reelin aggregates may be precursors to the senile plaques observed in Alzheimer’s disease.

Targeted genetic analyses carried out in the USA, Italy, and Greece, which including several hundred patients with Alzheimer’s disease and healthy controls, demonstrated that certain polymorphisms of the RELN gene are associated with

Alzheimer’s disease (Seripa et al., 2008; Antoniades et al., 2011; Kramer et al., 2011).

However, the data from human subjects is controversial. For instance, some post-mortem studies demonstrated that the density of the Reelin-producing Cajal-Retzius cells is lower in patients with Alzheimer’s disease and that their arborization is reduced, as compared to healthy controls (Baloyannis, 2005). Similarly, post-mortem studies in human subjects with pre-clinical stage of Alzheimer’s disease showed reduced Reelin expression in the frontal cortex, with unchanged levels of the Reelin receptors VLDLR and ApoER2 or the adaptor protein Dab1 (Herring et al., 2012), with similar depletion of Reelin in the hippocampus prior to the development of Aβ plaques observed in a mouse model of the disease. However, analysis of human subjects with confirmed Alzheimer’s disease claimed to have found an increased expression of the Reelin 180 kDa fragment in the

CSF and in the frontal cortex, as compared to controls, without significant changes in

Reelin levels in the cerebellum or the plasma (Botella-Lopez et al., 2006).

On the molecular level, a few possible mechanisms have been explored that may identify a potential role for Reelin in Alzheimer’s disease pathogenesis. A direct link between Reelin and amyloid precursor protein stems from experiments using cultured primary neurons, where Reelin was shown to enhance the intracellular interaction between Dab1 and amyloid precursor protein, as well as between Dab1 and ApoER2.

This resulted in the enhanced processing of the amyloid precursor protein and a reduction in the production of the toxic Aβ (Hoe et al., 2006). Another proposed mechanism involves the Tau kinase GSK3β, which is a component of signaling cascades downstream of Reelin. Experiments in mice and in neuronal cell culture in vitro showed that Reelin binding to its receptors downregulates the activity of the GSK3β kinase, and that defects in this signaling cascade result in the hyperphosphorylation of Tau, a well-known major

contributor to the pathogenesis of Alzheimer’s disease (Hiesberger et al., 1999; Ohkubo et al., 2003; Beffert et al., 2004).

The influence of the Reelin protein on cholesterol homeostasis is another avenue actively investigated in the Alzheimer’s field because a misbalance can affect both the production and the trafficking of the Aβ proteins (Simons et al., 1998) and is believed to speed up synaptic loss in the brain and increase the chance for the development of dementia (Raber et al., 1998; Weeber et al., 2002). In addition to binding Reelin, the

ApoE receptors can also bind to the various ApoE isoforms, including the ε4 isoform which is a well-documented risk-factor for the development of sporadic Alzheimer’s disease (Corder et al., 1993; Schmechel et al., 1993). And indeed, cell culture experiments demonstrated that the addition of recombinant ApoE ε4 reduced Reelin binding by over 50% (D’Arcangelo et al., 1999b). The ensuing decrease in Reelin- dependent intracellular signaling is expected to disturb the cholesterol homeostasis and thus predispose to the development of Alzheimer’s disease.

Finally, the effect of abnormally high levels of the Aβ protein on Reelin’s expression and post-translational modification was studied in post-mortem patients with

Down syndrome, in whom Alzheimer’s disease commonly develops in the fourth decade of life (Botella-Lopez et al., 2010). In this study, the expression of the 420kDa and the

310kDa Reelin fragments was elevated in the cortices of fetal Down Syndrome patients when compared with normal controls, in addition to an elevated levels of Aβ proteins. An analysis of the post-translational glycosylation pattern of Reelin in Down Syndrome patients, as well as the Tg2576 mouse model for Alzheimer’s disease revealed major differences from the controls. The same aberrant glycosylation of Reelin has also been

reported to occur in adults with Alzheimer’s disease (Botella-Lopez et al., 2006). This has been interpreted by the authors as a reflection of the influence of amyloid proteins on the post-translational modification of Reelin, which in turn may impact the disease progression.

Lissencephaly

Lissencephaly, which literally means “smooth brain”, is a rare but devastating brain disorder where a developmental defect in early-to-mid gestation leads to abnormal neuronal migration, with the end result being the absence of sulci and gyri (Dobyns,

1987). Affected individuals suffer from developmental delay, failure to thrive, muscle tone abnormalities (spasticity or hypotonia), seizures, among other multiple problems.

While lissencephaly can be caused by viral infections and insufficient blood supply to the fetus, there are also a number of genetic defects that can lead to this pathology. The latter include mutations in the RELN gene (Hong et al., 2000). The phenotypic traits of lissencephaly including cerebellar hypoplasia, hypotonia, congenital lymphedema, cerebellar hypoplasia, myopia, nystagmus, and generalized seizures were first described in the children of consanguineous parents in two unrelated families (Hourihane et al.,

1993; Hong et al., 2000). Two distinct mutations in the RELN gene were identified in the affected individuals of the two families (Hong et al., 2000). Based on the genotype of the parents and other siblings where available, an autosomal recessive nature of these mutations was established (Hong et al., 2000). The defect interfered with the proper splicing of the RELN gene, which in turn led to drastic decreases in the Reelin protein

expression. Further, a homozygous carrier of a chromosomal inversion that affected the

RELN gene was reported to have no detectable Reelin protein in their serum and to feature lissencephaly and cerebellar hypoplasia, while the heterozygous family members were neurologically normal (Chang et al., 2007).

Temporal lobe epilepsy

Since many epileptic disorders have been associated with aberrant neuronal migration (Palmini et al., 1991) , the role of Reelin in the pathogenesis of seizures has recently become a focus of interest. It has been noted that in the common seizure disorder, temporal lobe epilepsy, there is a defect in the granule cell migration referred to as granule cell dispersion (GCD) (Houser, 1990). GCD in humans is similar to the aberrant granule cell migration pattern seen in the Reeler mouse (Rakic and Caviness Jr.,

1995). This similarity prompted a study which demonstrated a correlation between the decrease in Reelin mRNA expression by hippocampal Cajal-Retzius cells with the extent of granule cell migration defects in the dentate gyri of human patients suffering from temporal lobe epilepsy (Haas et al., 2002). Additional studies demonstrated that that blocking the function of Reelin in mice can induce GCD even in the absence of neurogenesis via displacement of mature neurons. Moreover GCD can be prevented in a mouse model for mesial temporal lobe epilepsy via infusion with exogenous Reelin (Haas and Frotscher, 2010). The first attempt to define the relative contribution of Reelin mutations to the development of temporal lobe epilepsy as compared to other known genetic risk factors was published only recently (Dazzo et al., 2015). This study consisted

of a genetic analysis of 40 unrelated Italian families which suffered from lateral temporal epilepsy which has been associated with mutations in the LGI1 gene in about 50% of patients. The research revealed that while 12 families (30%) carried a mutation in LGI1, there were also 7 families (17.5%) who did not carry any LGI1 mutations but instead carried mutations in Reelin. While further investigations will be required to better understand the role and scope of Reelin as related to epilepsy, the currently available data suggests a new avenue for the development of anti-epileptic therapies for patients who carry Reelin mutations.

IX. Thesis Research

It is evident that Reelin has an important role in organizing the neurons of the cerebral cortex during development. The Reelin protein is a critical guidance molecule for proper positioning of neurons in cortical layers, and is involved with the maintenance of neuronal connections even into the adult, which has important implication for brain function. In its absence, there are devastating complications in the brain; moreover,

Reelin deficits have been implicated in a number of human conditions with brain dysfunction.

Myelin is essential for rapid nerve impulse conduction in the CNS. The cells that form myelin, oligodendroglial progenitor cells (OPC) are generated in the subventricular zone, and these cells will migrate at later times during brain development, once the neuronal layers are established. Their destination is the white matter tracts, where these

progenitor cells differentiate and form myelin sheaths. The extracellular signals that coordinate their migration and differentiation are not well understood.

Oligodendroglial cells secrete Reelin, the neuronal guidance molecule and also express a receptor for Reelin, VLDLR, as well as critical components of the intracellular signaling cascade including the Dab-1 adaptor protein. This novel discovery suggests that oligodendroglia may actually respond to Reelin; being that Reelin can modulate neuronal migration, it may also influence OPC migration. In this thesis, I examined this hypothesis in a series of in vitro and in vivo experiments. Concomitant with these studies, I also identified elements of the intracellular signaling pathways linked with Reelin in these cells. The results indicate that while Reelin can influence oligodendroglial migration, the activation of the Reelin signaling pathway by other molecules may be more important in the coordinating the migration of OPCs to white matter tracts.

X. References

Abadesco AD, Cilluffo M, Yvone GM, Carpenter EM, Howell BW, Phelps PE (2014)

Novel Disabled-1-expressing neurons identified in adult brain and spinal cord. Eur J

Neurosci 39:579–592.

Akbarian S, Bunney Jr. WE, Potkin SG, Wigal SB, Hagman JO, Sandman CA, Jones EG

(1993) Altered distribution of nicotinamide-adenine dinucleotide phosphate-

diaphorase cells in frontal lobe of schizophrenics implies disturbances of cortical

development. Arch Gen Psychiatry 50:169–177.

Akbarian S, Kim JJ, Potkin SG, Hetrick WP, Bunney Jr. WE, Jones EG (1996)

Maldistribution of interstitial neurons in prefrontal white matter of the brains of

schizophrenic patients. Arch Gen Psychiatry 53:425–436.

Alcantara S, Ruiz M, D’Arcangelo G, Ezan F, de Lecea L, Curran T, Sotelo C, Soriano E

(1998) Regional and Cellular Patterns of reelin mRNA Expression in the Forebrain

of the Developing and Adult Mouse. J Neurosci 18:7779–7799.

Alcántara S, Ruiz M, D’Arcangelo G, Ezan F, de Lecea L, Curran T, Sotelo C, Soriano E

(1998) Regional and cellular patterns of reelin mRNA expression in the forebrain of

the developing and adult mouse. J Neurosci 18:7779–7799.

Altman J, Bayer SA (1984) The development of the rat spinal cord. Adv Anat Embryol

Cell Biol 85:1–164.

Antoniades D, Katopodi T, Pappa S, Lampropoulos A, Konsta V, Frydas E,

Mpalogiannis S, Hatzistilianou M (2011) The role of reelin gene polymorphisms in

the pathogenesis of Alzheimer’s disease in a Greek population. J Biol Regul

Homeost Agents 25:351–358.

Armstrong R, Harvath L, Dubois-Dalcq M (1991) Astrocytes and O-2A progenitors

migrate toward distinct molecules in a microchemotaxis chamber. Ann N Y Acad

Sci 633:520–522.

Armstrong RC, Harvath L, Dubois-Dalcq ME (1990) Type 1 astrocytes and

oligodendrocyte-type 2 astrocyte glial progenitors migrate toward distinct

molecules. J Neurosci Res 27:400–407.

Arnaud L, Ballif B a, Förster E, Cooper J a (2003a) Fyn tyrosine kinase is a critical

regulator of disabled-1 during brain development. Curr Biol 13:9–17.

Arnaud L, Ballif BA, Cooper JA (2003b) Regulation of Protein Tyrosine Kinase

Signaling by Substrate Degradation during Brain Development. 23:9293–9302.

Assadi AH, Zhang G, Beffert U, McNeil RS, Renfro AL, Niu S, Quattrocchi CC,

Antalffy B a, Sheldon M, Armstrong DD, Wynshaw-Boris A, Herz J, D’Arcangelo

G, Clark GD (2003) Interaction of reelin signaling and Lis1 in brain development.

Nat Genet 35:270–276.

Ayala R, Shu T, Tsai L-H (2007) Trekking across the brain: the journey of neuronal

migration. Cell 128:29–43.

Ballard C, Gauthier S, Corbett A, Brayne C, Aarsland D, Jones E (2011) Alzheimer’s

disease. Lancet 377:1019–1031.

Ballif BA, Arnaud L, Arthur WT, Guris D, Imamoto A, Cooper JA (2004) Activation of a

Dab1 / CrkL / C3G / Rap1 Pathway in Reelin-Stimulated Neurons. 14:606–610.

Baloyannis SJ (2005) Morphological and morphometric alterations of Cajal-Retzius cells

in early cases of Alzheimer’s disease: a Golgi and electron microscope study. Int J

Neurosci 115:965–980.

Beffert U, Durudas A, Weeber EJ, Stolt PC, Giehl KM, Sweatt JD, Hammer RE, Herz J

(2006) Functional dissection of Reelin signaling by site-directed disruption of

Disabled-1 adaptor binding to apolipoprotein E receptor 2: distinct roles in

development and synaptic plasticity. J Neurosci 26:2041–2052.

Beffert U, Morfini G, Bock HH, Reyna H, Brady ST, Herz J (2002) Reelin-mediated

signaling locally regulates protein kinase B/Akt and glycogen synthase kinase 3beta.

J Biol Chem 277:49958–49964.

Beffert U, Weeber EJ, Durudas A, Qiu S, Masiulis I, Sweatt JD, Li W-P, Adelmann G,

Frotscher M, Hammer RE, Herz J (2005) Modulation of synaptic plasticity and

memory by Reelin involves differential splicing of the lipoprotein receptor Apoer2.

Neuron 47:567–579.

Beffert U, Weeber EJ, Morfini G, Ko J, Brady ST, Tsai L-H, Sweatt JD, Herz J (2004)

Reelin and cyclin-dependent kinase 5-dependent signals cooperate in regulating

neuronal migration and synaptic transmission. J Neurosci 24:1897–1906.

Benhayon D, Magdaleno S, Curran T (2003) Binding of purified Reelin to ApoER2 and

VLDLR mediates tyrosine phosphorylation of Disabled-1. Mol Brain Res 112:33–

45.

Bielas S, Higginbotham H, Koizumi H, Tanaka T, Gleeson JG (2004) Cortical neuronal

migration mutants suggest separate but intersecting pathways. Annu Rev Cell Dev

Biol 20:593–618.

Blake SM, Strasser V, Andrade N, Duit S, Hofbauer R, Schneider WJ, Nimpf J (2008)

Thrombospondin-1 binds to ApoER2 and VLDL receptor and functions in postnatal

neuronal migration. EMBO J 27:3069–3080.

Bock HH, Herz J (2003) Reelin activates SRC family tyrosine kinases in neurons. Curr

Biol 13:18–26.

Bock HH, Jossin Y, Liu P, Förster E, May P, Goffinet AM, Herz J (2003)

Phosphatidylinositol 3-kinase interacts with the adaptor protein Dab1 in response to

Reelin signaling and is required for normal cortical lamination. J Biol Chem

278:38772–38779.

Bonora E, Beyer KS, Lamb JA, Parr JR, Klauck SM, Benner A, Paolucci M, Abbott A,

Ragoussis I, Poustka A, Bailey AJ, Monaco AP (2003) Analysis of reelin as a

candidate gene for autism. Mol Psychiatry 8:885–892.

Borrell V, Del Rio JA, Alcantara S, Derer M, Martinez A, D’Arcangelo G, Nakajima K,

Mikoshiba K, Derer P, Curran T, Soriano E (1999) Reelin regulates the development

and synaptogenesis of the layer-specific entorhino-hippocampal connections. J

Neurosci 19:1345–1358.

Botella-Lopez A, Burgaya F, Gavin R, Garcia-Ayllon MS, Gomez-Tortosa E, Pena-

Casanova J, Urena JM, Del Rio JA, Blesa R, Soriano E, Saez-Valero J (2006) Reelin

expression and glycosylation patterns are altered in Alzheimer’s disease. Proc Natl

Acad Sci U S A 103:5573–5578.

Botella-Lopez A, Cuchillo-Ibanez I, Cotrufo T, Mok SS, Li QX, Barquero MS, Dierssen

M, Soriano E, Saez-Valero J (2010) Beta-amyloid controls altered Reelin expression

and processing in Alzheimer’s disease. Neurobiol Dis 37:682–691.

Bradl M, Lassmann H (2010) Oligodendrocytes: Biology and pathology. Acta

Neuropathol 119:37–53.

Burrell TC, Divekar SD, Weeber EJ, Rebeck GW (2014) Fyn tyrosine kinase increases

Apolipoprotein E Receptor 2 levels and phosphorylation. PLoS One 9:e110845.

Casanova MF, Buxhoeveden DP, Switala AE, Roy E (2002) Minicolumnar pathology in

autism. Neurology 58:428–432.

Caviness Jr. VS (1976) Patterns of cell and fiber distribution in the neocortex of the

reeler mutant mouse. J Comp Neurol 170:435–447.

Chai X, Förster E, Zhao S, Bock HH, Frotscher M (2009) Reelin stabilizes the actin

cytoskeleton of neuronal processes by inducing n-cofilin phosphorylation at serine3.

J Neurosci 29:288–299.

Chameau P, Inta D, Vitalis T, Monyer H, Wadman WJ, van Hooft JA (2009) The N-

terminal region of reelin regulates postnatal dendritic maturation of cortical

pyramidal neurons. Proc Natl Acad Sci U S A 106:7227–7232.

Chang BS, Duzcan F, Kim S, Cinbis M, Aggarwal A, Apse KA, Ozdel O, Atmaca M,

Zencir S, Bagci H, Walsh CA (2007) The role of RELN in lissencephaly and

neuropsychiatric disease. Am J Med Genet B Neuropsychiatr Genet 144B:58–63.

Chen K, Ochalski PG, Tran TS, Sahir N, Schubert M, Pramatarova A, Howell BW (2004)

Interaction between Dab1 and CrkII is promoted by Reelin signaling. J Cell Sci

117:4527–4536.

Cohen P, Frame S (2001) The renaissance of GSK3. Nat Rev Mol Cell Biol 2:769–776.

Collin L, Doretto S, Malerba M, Ruat M, Borrelli E (2007) Oligodendrocyte ablation

affects the coordinated interaction between granule and Purkinje neurons during

cerebellum development. Exp Cell Res 313:2946–2957.

Cooper JA, Howell BW (1999) Lipoprotein Receptors : Signaling Functions in the

Brain ? Minireview. 97:671–674.

Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW,

Roses AD, Haines JL, Pericak-Vance MA (1993) Gene dose of apolipoprotein E

type 4 allele and the risk of Alzheimer’s disease in late onset families. Science (80- )

261:921–923.

Costa E, Chen Y, Davis J, Dong E, Noh JS, Tremolizzo L, Veldic M, Grayson DR,

Guidotti A (2002) REELIN and schizophrenia: a disease at the interface of the

genome and the epigenome. Mol Interv 2:47–57.

Cuitino L, Matute R, Retamal C, Bu G, Inestrosa NC, Marzolo M-P (2005) ApoER2 is

endocytosed by a clathrin-mediated process involving the adaptor protein Dab2

independent of its Rafts’ association. Traffic 6:820–838.

D’Arcangelo G (2014) Reelin in the Years: Controlling Neuronal Migration and

Maturation in the Mammalian Brain. Adv Neurosci 2014:1–19.

D’Arcangelo G, Homayouni R, Keshvara L, Rice DS, Sheldon M, Curran T (1999a)

Reelin is a ligand for lipoprotein receptors. Neuron 24:471–479.

D’Arcangelo G, Homayouni R, Keshvara L, Rice DS, Sheldon M, Curran T (1999b)

Reelin is a ligand for lipoprotein receptors. Neuron 24:471–479.

D’Arcangelo G, Miao GG, Chen SC, Soares HD, Morgan JI, Curran T (1995) A protein

related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature

374:719–723.

D’Arcangelo G, Nakajima K, Miyata T, Ogawa M, Mikoshiba K, Curran T (1997) Reelin

is a secreted glycoprotein recognized by the CR-50 monoclonal antibody. J Neurosci

17:23–31.

Dazzo E et al. (2015) Heterozygous reelin mutations cause autosomal-dominant lateral

temporal epilepsy. Am J Hum Genet 96:992–1000. de Bergeyck V, Naerhuyzen B, Goffinet AM, Lambert de Rouvroit C (1998) A panel of

monoclonal antibodies against reelin, the extracellular matrix protein defective in

reeler mutant mice. J Neurosci Methods 82:17–24. de Castro F, Bribián A (2005) The molecular orchestra of the migration of

oligodendrocyte precursors during development. Brain Res Brain Res Rev 49:227–

241.

Devlin B, Bennett P, Dawson G, Figlewicz DA, Grigorenko EL, McMahon W, Minshew

N, Pauls D, Smith M, Spence MA, Rodier PM, Stodgell C, Schellenberg GD (2004)

Alleles of a reelin CGG repeat do not convey liability to autism in a sample from the

CPEA network. Am J Med Genet B Neuropsychiatr Genet 126B:46–50.

Dobyns WB (1987) Developmental aspects of lissencephaly and the lissencephaly

syndromes. Birth Defects Orig Artic Ser 23:225–241.

Doehner J, Madhusudan A, Konietzko U, Fritschy JM, Knuesel I (2010) Co-localization

of Reelin and proteolytic AbetaPP fragments in hippocampal plaques in aged wild-

type mice. J Alzheimers Dis 19:1339–1357.

Dong X, Pulido JS, Qu T, Sugaya K (2003) Differentiation of human neural stem cells

into retinal cells. Neuroreport 14:143–146.

Duit S, Mayer H, Blake SM, Schneider WJ, Nimpf J (2010) Differential functions of

ApoER2 and very low density lipoprotein receptor in Reelin signaling depend on

differential sorting of the receptors. J Biol Chem 285:4896–4908.

Dulabon L, Olson EC, Taglienti MG, Eisenhuth S, McGrath B, Walsh C a, Kreidberg J a,

Anton ES (2000) Reelin binds alpha3beta1 integrin and inhibits neuronal migration.

Neuron 27:33–44.

Falconer DS (1951) Two new mutants, “trembler” and “reeler”, with neurological actions

in the house mouse (Mus musculus L.). J Genet 50:192–205.

Fatemi SH et al. (2012) Consensus paper: pathological role of the cerebellum in autism.

Cerebellum 11:777–807.

Fatemi SH, Snow A V, Stary JM, Araghi-Niknam M, Reutiman TJ, Lee S, Brooks AI,

Pearce DA (2005) Reelin signaling is impaired in autism. Biol Psychiatry 57:777–

787.

Fatemi SH, Stary JM, Halt AR, Realmuto GR (2001) Dysregulation of Reelin and Bcl-2

proteins in autistic cerebellum. J Autism Dev Disord 31:529–535.

Feng L, Allen NS, Simo S, Cooper JA (2007) Cullin 5 regulates Dab1 protein levels and

neuron positioning during cortical development. 21:2717–2730.

Feng L, Cooper J a (2009) Dual functions of Dab1 during brain development. Mol Cell

Biol 29:324–332.

Francis PT, Palmer AM, Snape M, Wilcock GK (1999) The cholinergic hypothesis of

Alzheimer’s disease: a review of progress. J Neurol Neurosurg Psychiatry 66:137–

147.

Franco SJ, Martinez-Garay I, Gil-Sanz C, Harkins-Perry SR, Müller U (2011) Reelin

regulates cadherin function via Dab1/Rap1 to control neuronal migration and

lamination in the neocortex. Neuron 69:482–497.

Frost EE, Armstrong RC (2009) Initiation of Oligodendrocyte Progenitor Cell Migration

by a PDGF-A Activated Extracellular Regulated Kinase (ERK) Signaling Pathway.

34:169–181.

Frost EE, Zhou Z, Krasnesky K, Armstrong RC (2009) Initiation of oligodendrocyte

progenitor cell migration by a PDGF-A activated extracellular regulated kinase

(ERK) signaling pathway. Neurochem Res 34:169–181.

Frotscher M (1998) Cajal—Retzius cells, Reelin, and the formation of layers. Curr Opin

Neurobiol 8:570–575.

Garcion E, Faissner A, ffrench-Constant C (2001) Knockout mice reveal a contribution of

the extracellular matrix molecule tenascin-C to neural precursor proliferation and

migration. Development 128:2485–2496.

Goldowitz D, Cushing RC, Laywell E, D’Arcangelo G, Sheldon M, Sweet HO, Davisson

M, Steindler D, Curran T (1997) Cerebellar disorganization characteristic of reeler

in scrambler mutant mice despite presence of reelin. J Neurosci 17:8767–8777.

González-Billault C, Del Río J a, Ureña JM, Jiménez-Mateos EM, Barallobre MJ,

Pascual M, Pujadas L, Simó S, Torre A La, Gavin R, Wandosell F, Soriano E, Avila

J (2005) A role of MAP1B in Reelin-dependent neuronal migration. Cereb Cortex

15:1134–1145.

Groc L, Choquet D, Stephenson FA, Verrier D, Manzoni OJ, Chavis P (2007) NMDA

receptor surface trafficking and synaptic subunit composition are developmentally

regulated by the extracellular matrix protein Reelin. J Neurosci 27:10165–10175.

Guidotti A, Auta J, Davis JM, Di-Giorgi-Gerevini V, Dwivedi Y, Grayson DR,

Impagnatiello F, Pandey G, Pesold C, Sharma R, Uzunov D, Costa E (2000)

Decrease in reelin and glutamic acid decarboxylase67 (GAD67) expression in

schizophrenia and bipolar disorder: a postmortem brain study. Arch Gen Psychiatry

57:1061–1069.

Gupta A, Tsai L-H, Wynshaw-Boris A (2002) Life is a journey: a genetic look at

neocortical development. Nat Rev Genet 3:342–355.

Haas CA, Dudeck O, Kirsch M, Huszka C, Kann G, Pollak S, Zentner J, Frotscher M

(2002) Role for reelin in the development of granule cell dispersion in temporal lobe

epilepsy. J Neurosci 22:5797–5802.

Haas CA, Frotscher M (2010) Reelin deficiency causes granule cell dispersion in

epilepsy. Exp Brain Res 200:141–149.

Hack I, Hellwig S, Junghans D, Brunne B, Bock HH, Zhao S, Frotscher M (2007)

Divergent roles of ApoER2 and Vldlr in the migration of cortical neurons.

Development 134:3883–3891.

Hamburgh M (1963) Analysis of the Postnatal Developmental Effects of “Reeler,” a

Neurological Mutation in Mice. A Study in Developmental Genetics. Dev Biol

8:165–185.

Hardy J, Allsop D (1991) Amyloid deposition as the central event in the aetiology of

Alzheimer’s disease. Trends Pharmacol Sci 12:383–388.

Hatanaka Y, Hisanaga S-I, Heizmann CW, Murakami F (2004) Distinct migratory

behavior of early- and late-born neurons derived from the cortical ventricular zone. J

Comp Neurol 479:1–14.

Herring A, Donath A, Steiner KM, Widera MP, Hamzehian S, Kanakis D, Kolble K,

ElAli A, Hermann DM, Paulus W, Keyvani K (2012) Reelin depletion is an early

phenomenon of Alzheimer’s pathology. J Alzheimers Dis 30:963–979.

Herz J (2001) The LDL Receptor Gene Family : Review ( Un ) Expected Signal

Transducers in the Brain. 29:571–581.

Hibi T, Mizutani M, Baba A, Hattori M (2009) Splicing variations in the ligand-binding

domain of ApoER2 results in functional differences in the binding properties to

Reelin. Neurosci Res 63:251–258.

Hiesberger T, Trommsdorff M, Howell BW, Goffinet a, Mumby MC, Cooper J a, Herz J

(1999) Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces

tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron

24:481–489.

Hoe H-S, Tran TS, Matsuoka Y, Howell BW, Rebeck GW (2006) DAB1 and Reelin

effects on amyloid precursor protein and ApoE receptor 2 trafficking and

processing. J Biol Chem 281:35176–35185.

Hong C, Duit S, Jalonen P, Out R, Scheer L, Sorrentino V, Boyadjian R, Rodenburg KW,

Foley E, Korhonen L, Lindholm D, Nimpf J, van Berkel TJC, Tontonoz P, Zelcer N

(2010) The E3 ubiquitin ligase IDOL induces the degradation of the low density

lipoprotein receptor family members VLDLR and ApoER2. J Biol Chem

285:19720–19726.

Hong SE, Shugart YY, Huang DT, Shahwan SA, Grant PE, Hourihane JO, Martin ND,

Walsh CA (2000) Autosomal recessive lissencephaly with cerebellar hypoplasia is

associated with human RELN mutations. Nat Genet 26:93–96.

Hourihane JO, Bennett CP, Chaudhuri R, Robb SA, Martin ND (1993) A sibship with a

neuronal migration defect, cerebellar hypoplasia and congenital lymphedema.

Neuropediatrics 24:43–46.

Houser CR (1990) Granule cell dispersion in the dentate gyrus of humans with temporal

lobe epilepsy. Brain Res 535:195–204.

Howell BW, Gertler FB, Cooper J a (1997a) Mouse disabled (mDab1): a Src binding

protein implicated in neuronal development. EMBO J 16:121–132.

Howell BW, Hawkes R, Soriano P, Cooper J a (1997b) Neuronal position in the

developing brain is regulated by mouse disabled-1. Nature 389:733–737.

Howell BW, Hawkes R, Soriano P, Cooper J a (1997c) Neuronal position in the

developing brain is regulated by mouse disabled-1. Nature 389:733–737.

Howell BW, Herrick TM, Hildebrand JD, Zhang Y, Cooper J a (2000a) Dab1 tyrosine

phosphorylation sites relay positional signals during mouse brain development. Curr

Biol 10:877–885.

Howell BW, Herrick TM, Hildebrand JD, Zhang Y, Cooper JA (2000b) Dab1 tyrosine

phosphorylation sites relay positional signals during mouse brain development. Curr

Biol 10:877–885.

Howell BW, Lanier LM, Frank R, Gertler FB, Cooper J a (1999) The disabled 1

phosphotyrosine-binding domain binds to the internalization signals of

transmembrane glycoproteins and to phospholipids. Mol Cell Biol 19:5179–5188.

Huang Y, Magdaleno S, Hopkins R, Slaughter C, Curran T, Keshvara L (2004) Tyrosine

phosphorylated Disabled 1 recruits Crk family adapter proteins. Biochem Biophys

Res Commun 318:204–212.

Iafrati J, Orejarena MJ, Lassalle O, Bouamrane L, Gonzalez-Campo C, Chavis P (2014)

Reelin, an extracellular matrix protein linked to early onset psychiatric diseases,

drives postnatal development of the prefrontal cortex via GluN2B-NMDARs and the

mTOR pathway. Mol Psychiatry 19:417–426.

Impagnatiello F, Guidotti AR, Pesold C, Dwivedi Y, Caruncho H, Pisu MG, Uzunov DP,

Smalheiser NR, Davis JM, Pandey GN, Pappas GD, Tueting P, Sharma RP, Costa E

(1998) A decrease of reelin expression as a putative vulnerability factor in

schizophrenia. Proc Natl Acad Sci U S A 95:15718–15723.

Iqbal K, Liu F, Gong CX, Grundke-Iqbal I (2010) Tau in Alzheimer disease and related

tauopathies. Curr Alzheimer Res 7:656–664.

Jensen P, Zoghbi HY, Goldowitz D (2002) Dissection of the cellular and molecular

events that position cerebellar Purkinje cells: a study of the math1 null-mutant

mouse. J Neurosci 22:8110–8116.

Jossin Y, Cooper J a (2011) Reelin, Rap1 and N-cadherin orient the migration of

multipolar neurons in the developing neocortex. Nat Neurosci 14:697–703.

Jossin Y, Goffinet AM (2007a) Reelin signals through phosphatidylinositol 3-kinase and

Akt to control cortical development and through mTor to regulate dendritic growth.

Mol Cell Biol 27:7113–7124.

Jossin Y, Goffinet AM (2007b) Reelin signals through phosphatidylinositol 3-kinase and

Akt to control cortical development and through mTor to regulate dendritic growth.

Mol Cell Biol 27:7113–7124.

Jossin Y, Gui L, Goffinet AM (2007) Processing of Reelin by embryonic neurons is

important for function in tissue but not in dissociated cultured neurons. J Neurosci

27:4243–4252.

Jossin Y, Ignatova N, Hiesberger T, Herz J, Lambert de Rouvroit C, Goffinet AM (2004)

The central fragment of Reelin, generated by proteolytic processing in vivo, is

critical to its function during cortical plate development. J Neurosci 24:514–521.

Jossin Y, Ogawa M, Metin C, Tissir F, Goffinet AM (2003a) Inhibition of SRC family

kinases and non-classical protein kinases C induce a reeler-like malformation of

cortical plate development. J Neurosci 23:9953–9959.

Jossin Y, Ogawa M, Metin C, Tissir F, Goffinet AM (2003b) Inhibition of SRC family

kinases and non-classical protein kinases C induce a reeler-like malformation of

cortical plate development. J Neurosci 23:9953–9959.

Karper LP, Freeman GK, Grillon C, Morgan 3rd CA, Charney DS, Krystal JH (1996)

Preliminary evidence of an association between sensorimotor gating and

distractibility in psychosis. J Neuropsychiatry Clin Neurosci 8:60–66.

Keshvara L et al. (2002) Cyclin-dependent kinase 5 phosphorylates disabled 1

independently of Reelin signaling. J Neurosci 22:4869–4877.

Keshvara L, Benhayon D, Magdaleno S, Curran T (2001) Identification of reelin-induced

sites of tyrosyl phosphorylation on disabled 1. J Biol Chem 276:16008–16014.

Kiernan BW, Götz B, Faissner A, ffrench-Constant C (1996) Tenascin-C inhibits

oligodendrocyte precursor cell migration by both adhesion-dependent and adhesion-

independent mechanisms. Mol Cell Neurosci 7:322–335.

Kim HM, Qu T, Kriho V, Lacor P, Smalheiser N, Pappas GD, Guidotti A, Costa E,

Sugaya K (2002) Reelin function in neural stem cell biology. Proc Natl Acad Sci U

S A 99:4020–4025.

Kohno T, Honda T, Kubo K-I, Nakano Y, Tsuchiya A, Murakami T, Banno H, Nakajima

K, Hattori M (2015) Importance of reelin C-terminal region in the development and

maintenance of the postnatal cerebral cortex and its regulation by specific

proteolysis. J Neurosci 35:4776–4787.

Kramer PL, Xu H, Woltjer RL, Westaway SK, Clark D, Erten-Lyons D, Kaye JA, Welsh-

Bohmer KA, Troncoso JC, Markesbery WR, Petersen RC, Turner RS, Kukull WA,

Bennett DA, Galasko D, Morris JC, Ott J (2011) Alzheimer disease pathology in

cognitively healthy elderly: a genome-wide study. Neurobiol Aging 32:2113–2122.

Krebs MO, Betancur C, Leroy S, Bourdel MC, Gillberg C, Leboyer M (2002) Absence of

association between a polymorphic GGC repeat in the 5’ untranslated region of the

reelin gene and autism. Mol Psychiatry 7:801–804.

Krstic D, Rodriguez M, Knuesel I (2012) Regulated proteolytic processing of Reelin

through interplay of tissue plasminogen activator (tPA), ADAMTS-4, ADAMTS-5,

and their modulators. PLoS One 7:e47793.

Kubo K, Mikoshiba K, Nakajima K (2002) Secreted Reelin molecules form homodimers.

Neurosci Res 43:381–388.

Kuo G, Arnaud L, Kronstad-O’Brien P, Cooper J a (2005) Absence of Fyn and Src

causes a reeler-like phenotype. J Neurosci 25:8578–8586.

Kwan KY, Sestan N, Anton ES (2012) Transcriptional co-regulation of neuronal

migration and laminar identity in the neocortex. Development 139:1535–1546.

Lakatosova S, Ostatnikova D (2012) Reelin and its complex involvement in brain

development and function. Int J Biochem Cell Biol 44:1501–1504.

Lambert de Rouvroit C, de Bergeyck V, Cortvrindt C, Bar I, Eeckhout Y, Goffinet a M

(1999) Reelin, the extracellular matrix protein deficient in reeler mutant mice, is

processed by a metalloproteinase. Exp Neurol 156:214–217.

Leeb C, Eresheim C, Nimpf J (2014) Clusterin is a ligand for apolipoprotein E receptor 2

(ApoER2) and very low density lipoprotein receptor (VLDLR) and signals via the

Reelin-signaling pathway. J Biol Chem 289:4161–4172.

Leemhuis J, Bouché E, Frotscher M, Henle F, Hein L, Herz J, Meyer DK, Pichler M,

Roth G, Schwan C, Bock HH (2010) Reelin signals through apolipoprotein E

receptor 2 and Cdc42 to increase growth cone motility and filopodia formation. J

Neurosci 30:14759–14772.

Lewis DA (1997) Development of the prefrontal cortex during adolescence: insights into

vulnerable neural circuits in schizophrenia. Neuropsychopharmacology 16:385–398.

Li J, Nguyen L, Gleason C, Lotspeich L, Spiker D, Risch N, Myers RM (2004) Lack of

evidence for an association between WNT2 and RELN polymorphisms and autism.

Am J Med Genet B Neuropsychiatr Genet 126B:51–57.

Li Y, Lu W, Marzolo MP, Bu G (2001) Differential functions of members of the low

density lipoprotein receptor family suggested by their distinct endocytosis rates. J

Biol Chem 276:18000–18006.

Liu WS, Pesold C, Rodriguez MA, Carboni G, Auta J, Lacor P, Larson J, Condie BG,

Guidotti A, Costa E (2001) Down-regulation of dendritic spine and glutamic acid

decarboxylase 67 expressions in the reelin haploinsufficient heterozygous reeler

mouse. Proc Natl Acad Sci U S A 98:3477–3482.

Liu X, Lu Y, Zhang Y, Li Y, Zhou J, Yuan Y, Gao X, Su Z, He C (2012) Slit2 regulates

the dispersal of oligodendrocyte precursor cells via Fyn/RhoA signaling. J Biol

Chem 287:17503–17516.

Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH (2002) Common

developmental requirement for Olig function indicates a motor

neuron/oligodendrocyte connection. Cell 109:75–86.

Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles CD,

Rowitch DH (2000) Sonic hedgehog--regulated oligodendrocyte lineage genes

encoding bHLH proteins in the mammalian central nervous system. Neuron 25:317–

329.

Matsuki T, Pramatarova A, Howell B (2008a) Reduction of Crk and CrkL expression

blocks Reelin-induced dendritogenesis. J Cell Sci 121:1869–1875.

Matsuki T, Pramatarova A, Howell BW (2008b) Reduction of Crk and CrkL expression

blocks reelin-induced dendritogenesis. J Cell Sci 121:1869–1875.

Mayer H, Duit S, Hauser C, Wolfgang J, Nimpf J, Schneider WJ (2006) Reconstitution of

the Reelin Signaling Pathway in Fibroblasts Demonstrates that Dab1

Phosphorylation Is Independent of Receptor Localization in Lipid Rafts

Reconstitution of the Reelin Signaling Pathway in Fibroblasts Demonstrates that

Dab1 Phosphorylatio.

McAlonan GM, Daly E, Kumari V, Critchley HD, van Amelsvoort T, Suckling J,

Simmons A, Sigmundsson T, Greenwood K, Russell A, Schmitz N, Happe F,

Howlin P, Murphy DG (2002) Brain anatomy and sensorimotor gating in Asperger’s

syndrome. Brain 125:1594–1606.

Miao GG, Smeyne RJ, D’Arcangelo G, Copeland NG, Jenkins N a, Morgan JI, Curran T

(1994) Isolation of an allele of reeler by insertional mutagenesis. Proc Natl Acad Sci

U S A 91:11050–11054.

Miller CA, Sweatt JD (2007) Covalent modification of DNA regulates memory

formation. Neuron 53:857–869.

Miller RH (2002) Regulation of oligodendrocyte development in the vertebrate CNS.

Prog Neurobiol 67:451–467.

Mishra SK, Keyel P a, Hawryluk MJ, Agostinelli NR, Watkins SC, Traub LM (2002)

Disabled-2 exhibits the properties of a cargo-selective endocytic clathrin adaptor.

EMBO J 21:4915–4926.

Miyamoto Y, Yamauchi J, Tanoue A (2008) Cdk5 phosphorylation of WAVE2 regulates

oligodendrocyte precursor cell migration through nonreceptor tyrosine kinase Fyn. J

Neurosci 28:8326–8337.

Miyata T, Nakajima K, Aruga J, Takahashi S, Ikenaka K, Mikoshiba K, Ogawa M (1996)

Distribution of a reeler gene-related antigen in the developing cerebellum: an

immunohistochemical study with an allogeneic antibody CR-50 on normal and

reeler mice. J Comp Neurol 372:215–228.

Moon HM, Wynshaw-Boris A (2013) Cytoskeleton in action: lissencephaly, a neuronal

migration disorder. Wiley Interdiscip Rev Dev Biol 2:229–245.

Morimura T, Hattori M, Ogawa M, Mikoshiba K (2005) Disabled1 regulates the

intracellular trafficking of reelin receptors. J Biol Chem 280:16901–16908.

Nadarajah B, Alifragis P, Wong ROL, Parnavelas JG (2003) Neuronal migration in the

developing cerebral cortex: observations based on real-time imaging. Cereb Cortex

13:607–611.

Nadarajah B, Brunstrom JE, Grutzendler J, Wong RO, Pearlman AL (2001) Two modes

of radial migration in early development of the cerebral cortex. Nat Neurosci 4:143–

150.

Nadarajah B, Parnavelas JG (2002) Modes of neuronal migration in the developing

cerebral cortex. Nat Rev Neurosci 3:423–432.

Nakajima K, Mikoshiba K, Miyata T, Kudo C, Ogawa M (1997) Disruption of

hippocampal development in vivo by CR-50 mAb against reelin. Proc Natl Acad Sci

U S A 94:8196–8201.

Niu S, Renfro A, Quattrocchi CC, Sheldon M, D’Arcangelo G (2004) Reelin promotes

hippocampal dendrite development through the VLDLR/ApoER2-Dab1 pathway.

Neuron 41:71–84.

Niu S, Yabut O, D’Arcangelo G (2008) The Reelin signaling pathway promotes dendritic

spine development in hippocampal neurons. J Neurosci 28:10339–10348.

Noctor SC, Martínez-Cerdeño V, Ivic L, Kriegstein AR (2004) Cortical neurons arise in

symmetric and asymmetric division zones and migrate through specific phases. Nat

Neurosci 7:136–144.

Ogawa M, Miyata T, Nakajima K, Yagyu K, Seike M, Ikenaka K, Yamamoto H,

Mikoshiba K (1995) The reeler gene-associated antigen on Cajal-Retzius neurons is

a crucial molecule for laminar organization of cortical neurons. Neuron 14:899–912.

Ohkubo N, Lee YD, Morishima A, Terashima T, Kikkawa S, Tohyama M, Sakanaka M,

Tanaka J, Maeda N, Vitek MP, Mitsuda N (2003) Apolipoprotein E and Reelin

ligands modulate tau phosphorylation through an apolipoprotein E

receptor/disabled-1/glycogen synthase kinase-3beta cascade. FASEB J 17:295–297.

Ono K, Bansal R, Payne J, Rutishauser U, Miller RH (1995) Early development and

dispersal of oligodendrocyte precursors in the embryonic chick spinal cord.

Development 121:1743–1754.

Ono K, Fujisawa H, Hirano S, Norita M, Tsumori T, Yasui Y (1997a) Early development

of the oligodendrocyte in the embryonic chick metencephalon. J Neurosci Res

48:212–225.

Ono K, Yasui Y, Rutishauser U, Miller RH (1997b) Focal ventricular origin and

migration of oligodendrocyte precursors into the chick optic nerve. Neuron 19:283–

292.

Osterhout DJ, Ebner S, Xu J, Ornitz DM, Zazanis GA, McKinnon RD (1997)

Transplanted oligodendrocyte progenitor cells expressing a dominant- negative FGF

receptor transgene fail to migrate in vivo. J Neurosci 17:9122–9132.

Osterhout DJ, Wolven A, Wolf RM, Resh MD, Chao M V. (1999) Morphological

differentiation of oligodendrocytes requires activation of Fyn tyrosine kinase. J Cell

Biol 145:1209–1218.

Owen MJ, Sawa A, Mortensen PB (2016) Schizophrenia. Lancet.

Palmini A, Andermann F, Olivier A, Tampieri D, Robitaille Y (1991) Focal neuronal

migration disorders and intractable partial epilepsy: results of surgical treatment.

Ann Neurol 30:750–757.

Panteri R, Mey J, Zhelyaznik N, D’Altocolle A, Del Fà A, Gangitano C, Marino R,

Lorenzetto E, Buffelli M, Keller F (2006) Reelin is transiently expressed in the

peripheral nerve during development and is upregulated following nerve crush. Mol

Cell Neurosci 32:133–142.

Park T-J, Curran T (2008) Crk and Crk-like play essential overlapping roles downstream

of disabled-1 in the Reelin pathway. J Neurosci 28:13551–13562.

Payne HR, Lemmon V (1993) Glial cells of the O-2A lineage bind preferentially to N-

cadherin and develop distinct morphologies. Dev Biol 159:595–607.

Pearlman AL, Faust PL, Hatten ME, Brunstrom JE (1998) New directions for neuronal

migration. Curr Opin Neurobiol 8:45–54.

Persico AM et al. (2001) Reelin gene alleles and haplotypes as a factor predisposing to

autistic disorder. Mol Psychiatry 6:150–159.

Pramatarova A, Ochalski PG, Chen K, Gropman A, Myers S, Min K, Brian W, Howell

BW (2003) Nck β Interacts with Tyrosine-Phosphorylated Disabled 1 and

Redistributes in Reelin-Stimulated Neurons. Mol Cell Biol 23:7210–7221.

Pulido JS, Sugaya I, Comstock J, Sugaya K (2007) Reelin expression is upregulated

following ocular tissue injury. Graefes Arch Clin Exp Ophthalmol 245:889–893.

Qiu S, Korwek KM, Pratt-Davis AR, Peters M, Bergman MY, Weeber EJ (2006)

Cognitive disruption and altered hippocampus synaptic function in Reelin

haploinsufficient mice. Neurobiol Learn Mem 85:228–242.

Qu T, Brannen CL, Kim HM, Sugaya K (2001) Human neural stem cells improve

cognitive function of aged brain. Neuroreport 12:1127–1132.

Raber J, Wong D, Buttini M, Orth M, Bellosta S, Pitas RE, Mahley RW, Mucke L (1998)

Isoform-specific effects of human apolipoprotein E on brain function revealed in

ApoE knockout mice: increased susceptibility of females. Proc Natl Acad Sci U S A

95:10914–10919.

Rakic P, Caviness Jr. VS (1995) Cortical development: view from neurological mutants

two decades later. Neuron 14:1101–1104.

Reddy SS, Connor TE, Weeber EJ, Rebeck W (2011) Similarities and differences in

structure, expression, and functions of VLDLR and ApoER2. Mol Neurodegener

6:30.

Rice DS, Curran T (2001) Role of the reelin signaling pathway in central nervous system

development. Annu Rev Neurosci 24:1005–1039.

Rice DS, Nusinowitz S, Azimi AM, Martinez A, Soriano E, Curran T (2001) The reelin

pathway modulates the structure and function of retinal synaptic circuitry. Neuron

31:929–941.

Rice DS, Sheldon M, D’Arcangelo G, Nakajima K, Goldowitz D, Curran T (1998)

Disabled-1 acts downstream of Reelin in a signaling pathway that controls laminar

organization in the mammalian brain. Development 125:3719–3729.

Riddell DR, Sun X, Stannard AK, Soutar AK, Owen JS (2001) Localization of

apolipoprotein E receptor 2 to caveolae in the plasma membrane. J Lipid Res 42.

Sanada K, Gupta A, Tsai L-H (2004) Disabled-1-regulated adhesion of migrating neurons

to radial glial fiber contributes to neuronal positioning during early corticogenesis.

Neuron 42:197–211.

Schmechel DE, Saunders AM, Strittmatter WJ, Crain BJ, Hulette CM, Joo SH, Pericak-

Vance MA, Goldgaber D, Roses AD (1993) Increased amyloid beta-peptide

deposition in cerebral cortex as a consequence of apolipoprotein E genotype in late-

onset Alzheimer disease. Proc Natl Acad Sci U S A 90:9649–9653.

Seripa D, Matera MG, Franceschi M, Daniele A, Bizzarro A, Rinaldi M, Panza F, Fazio

VM, Gravina C, D’Onofrio G, Solfrizzi V, Masullo C, Pilotto A (2008) The RELN

locus in Alzheimer’s disease. J Alzheimers Dis 14:335–344.

Sheldon M, Rice DS, D’Arcangelo G, Yoneshima H, Nakajima K, Mikoshiba K, Howell

BW, Cooper J a, Goldowitz D, Curran T (1997) Scrambler and yotari disrupt the

disabled gene and produce a reeler-like phenotype in mice. Nature 389:730–733.

Siebert JR, Osterhout DJ (2011) Oligodendroglial cells express and secrete reelin. Anat

Rec (Hoboken) 294:759–763.

Simons M, Keller P, De Strooper B, Beyreuther K, Dotti CG, Simons K (1998)

Cholesterol depletion inhibits the generation of beta-amyloid in hippocampal

neurons. Proc Natl Acad Sci U S A 95:6460–6464.

Sinagra M, Verrier D, Frankova D, Korwek KM, Blahos J, Weeber EJ, Manzoni OJ,

Chavis P (2005) Reelin, very-low-density lipoprotein receptor, and apolipoprotein E

receptor 2 control somatic NMDA receptor composition during hippocampal

maturation in vitro. J Neurosci 25:6127–6136.

Skoff RP, Price DL, Stocks A (1976) Electron microscopic autoradiographic studies of

gliogenesis in rat optic nerve. I. Cell proliferation. J Comp Neurol 169:291–312.

Sperber BR, Boyle-Walsh EA, Engleka MJ, Gadue P, Peterson AC, Stein PL, Scherer SS,

McMorris FA (2001) A unique role for Fyn in CNS myelination. J Neurosci

21:2039–2047.

Stockinger W, Brandes C, Fasching D, Hermann M, Gotthardt M, Herz J, Schneider WJ,

Nimpf J (2000) The reelin receptor ApoER2 recruits JNK-interacting proteins-1 and

-2. J Biol Chem 275:25625–25632.

Strasser V, Fasching D, Hauser C, Bock HH, Hiesberger T, Herz J, Weeber EJ, Sweatt

JD, Pramatarova A, Howell B, Schneider WJ, Nimpf J, Mayer H (2004) Receptor

Clustering Is Involved in Reelin Signaling.

Stritt C, Knoll B (2010) Serum response factor regulates hippocampal lamination and

dendrite development and is connected with reelin signaling. Mol Cell Biol

30:1828–1837.

Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS,

Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and

increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc

Natl Acad Sci U S A 90:1977–1981.

Suetsugu S, Tezuka T, Morimura T, Hattori M, Mikoshiba K, Yamamoto T, Takenawa T

(2004) Regulation of actin cytoskeleton by mDab1 through N-WASP and

ubiquitination of mDab1. Biochem J 384:1–8.

Sugimoto Y, Taniguchi M, Yagi T, Akagi Y, Nojyo Y, Tamamaki N (2001) Guidance of

glial precursor cell migration by secreted cues in the developing optic nerve.

Development 128:3321–3330.

Tabata H, Nakajima K (2003) Multipolar migration: the third mode of radial neuronal

migration in the developing cerebral cortex. J Neurosci 23:9996–10001.

Takenawa T, Miki H (2001) WASP and WAVE family proteins: key molecules for rapid

rearrangement of cortical actin filaments and cell movement. J Cell Sci 114:1801–

1809.

Timsit S, Martinez S, Allinquant B, Peyron F, Puelles L, Zalc B (1995) Oligodendrocytes

originate in a restricted zone of the embryonic ventral neural tube defined by DM-20

mRNA expression. J Neurosci 15:1012–1024.

Trommsdorff M, Gotthardt M, Hiesberger T, Shelton J, Stockinger W, Nimpf J, Hammer

RE, Richardson J a, Herz J (1999) Reeler/Disabled-like disruption of neuronal

migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell

97:689–701.

Trotter JH, Klein M, Jinwal UK, Abisambra JF, Dickey CA, Tharkur J, Masiulis I, Ding

J, Locke KG, Rickman CB, Birch DG, Weeber EJ, Herz J (2011) ApoER2 function

in the establishment and maintenance of retinal synaptic connectivity. J Neurosci

31:14413–14423.

Trotter JH, Lussier AL, Psilos KE, Mahoney HL, Sponaugle AE, Hoe H-S, Rebeck GW,

Weeber EJ (2014) Extracellular proteolysis of reelin by tissue plasminogen activator

following synaptic potentiation. Neuroscience 274:299–307.

Tsai J-W, Bremner KH, Vallee RB (2007) Dual subcellular roles for LIS1 and dynein in

radial neuronal migration in live brain tissue. Nat Neurosci 10:970–979.

Tueting P, Costa E, Dwivedi Y, Guidotti A, Impagnatiello F, Manev R, Pesold C (1999)

The phenotypic characteristics of heterozygous reeler mouse. Neuroreport 10:1329–

1334.

Utsunomiya-tate N, Kubo K, Tate S, Kainosho M, Katayama E (2000) Reelin molecules

assemble together to form a large protein complex , which is inhibited by the

function-blocking CR-50 antibody. PNAS 97:9729–9734.

Viti J, Gulacsi A, Lillien L (2003) Wnt regulation of progenitor maturation in the cortex

depends on Shh or fibroblast growth factor 2. J Neurosci 23:5919–5927.

Voss AK, Britto JM, Dixon MP, Sheikh BN, Collin C, Tan S-S, Thomas T (2008) C3G

regulates cortical neuron migration, preplate splitting and radial glial cell

attachment. Development 135:2139–2149.

Wang C, Rougon G, Kiss JZ (1994) Requirement of polysialic acid for the migration of

the O-2A glial progenitor cell from neurohypophyseal explants. J Neurosci

14:4446–4457.

Ware ML, Fox JW, González JL, Davis NM, Lambert de Rouvroit C, Russo CJ, Chua

SC, Goffinet a M, Walsh C a (1997) Aberrant splicing of a mouse disabled

homolog, mdab1, in the scrambler mouse. Neuron 19:239–249.

Warf B, Fok-Seang J, Miller R (1991) Evidence for the ventral origin of oligodendrocyte

precursors in the rat spinal cord. J Neurosci 11:2477–2488.

Weeber EJ, Beffert U, Jones C, Christian JM, Forster E, Sweatt JD, Herz J (2002) Reelin

and ApoE receptors cooperate to enhance hippocampal synaptic plasticity and

learning. J Biol Chem 277:39944–39952.

Wheeler NA, Fuss B (2015) Extracellular cues influencing oligodendrocyte

differentiation and (re)myelination. Exp Neurol.

Yang X V, Banerjee Y, Fernández JA, Deguchi H, Xu X, Mosnier LO, Urbanus RT, de

Groot PG, White-Adams TC, McCarty OJT, Griffin JH (2009) Activated protein C

ligation of ApoER2 (LRP8) causes Dab1-dependent signaling in U937 cells. Proc

Natl Acad Sci U S A 106:274–279.

Yasui N, Nogi T, Kitao T, Nakano Y, Hattori M, Takagi J (2007) Structure of a receptor-

binding fragment of reelin and mutational analysis reveal a recognition mechanism

similar to endocytic receptors. Proc Natl Acad Sci U S A 104:9988–9993.

Zhang H, Liu X, Zhang C, Mundo E, Macciardi F, Grayson DR, Guidotti AR, Holden JJ

(2002) Reelin gene alleles and susceptibility to autism spectrum disorders. Mol

Psychiatry 7:1012–1017.

Zhao S, Chai X, Förster E, Frotscher M (2004) Reelin is a positional signal for the

lamination of dentate granule cells. Development 131:5117–5125.

Zhou Q, Choi G, Anderson DJ (2001) The bHLH transcription factor Olig2 promotes

oligodendrocyte differentiation in collaboration with Nkx2.2. Neuron 31:791–807.

Zhou Q, Wang S, Anderson DJ (2000) Identification of a novel family of

oligodendrocyte lineage-specific basic helix-loop-helix transcription factors. Neuron

25:331–343.

Figure 1. Inside-out pattern of Reeler brain vs normal cortex.

During the formation of the normal brain, newly generated neurons migrate out from the ventricular zone past older neurons to form the cortical layers. In Reeler brains however, newly generated neurons fail to migrate past the older neurons and rather accumulate underneath, creating an inside-out pattern of neuronal layers at the cortex. Reproduced from Cooper, 2008.

Figure 2. Reelin protein structure and fragments generated upon processing.

The Reelin protein is composed of several function regions, including a N-terminal adjacent to a F-spondin-like region and the CR-50 epitope that is thought to be required for homodimer formation. The structure consists of 8 Reelin repeats and a C-terminal with highly charged amino acids. Upon cleavage, Reelin generates 3 fragment: N-RR2,

RR3-RR6 and RR&-C.

Figure 3. The structure of the Reelin receptors: ApoER2 and VLDLR.

The structures of ApoER2 and VLDLR, transmembrane receptors, are very similar. Both contain an N-terminal ligand binding domain and a cytoplasmic domain with an Npxy motif. The gene sequence at the O-linked sugar domain is the most dissimilar region in the ApoER2 and VLDLR receptors and is it also the region that is responsible for localizing ApoER2 to lipid rafts (Duit et al., 2010; Reddy et al., 2011).

Figure 4. Dab1 protein structure.

Dab1, the adaptor protein downstream of Reelin, contains a phosphotyrosine binding domain (PTB) and has an internal tyrosine rich region adjacent to a serine/threonine rich region. Dab1 has five potential tyrosine phosphorylation sites: Y185, 198, 200, 220 and

232. Y198, Y220 and Y232 have been reported to be phosphorylated in response to

Reelin. Phosphorylation of specific tyrosines is associated with activation of several different signal transduction pathways.

Figure 5. Signaling components downstream of Reelin-Dab1 interactions.

Reelin binding to its receptors induces Dab1 phosphorylation, which activates several downstream pathways. Dab1 phosphorylation at Y220 and Y232 leads to Crk pathway activation, leading to tyrosine phosphorylation of C3G and the activation of Rap1

GTPase, which results in increased levels of N-cadherin at the plasma membrane. Dab1 phosphorylation of Y185 and Y198 activates the P13K pathway, which in turn activates

Akt. Akt regulates GSK-3Beta which phosphorylates tau. P13K also activates LIMK1 which then phosphorylates n-cofilin, preventing depolymerization of F-actin. P13K can also activate Rho GTPase cdc42, which is known to be involved in growth cone motility and filopodia formation. NckB has been shown to interact with Dab1 phosphorylated on

Y220 or Y232. This interaction may lead to actin remodeling. Dab1 also interacts with N-

WASP, possibly contributing to actin polymerization. Downstream of Dab1 is thought to be Lis1, a microtubule associated protein implicated in lissencephaly, involved in somal translocation.

Chapter 2: Reelin signaling in oligodendrocyte

progenitor cell migration

Acknowledgements:

We thank Sana Ahmad Din for helping with the project, specifically with staining mice brain tissue. We are grateful to Ivayla Geneva for helping generate PDGF stimulated cell lysates and for attempting to complete a VLDLR siRNA study. Also, we are thankful to Aimin Naeem for assisting with experimental procedures for this project.

We are indebted to Dr. Olson for providing us with pairs of Reeler +/- and Scrambler +/- mice and to the members of his lab for guiding me through the process of genotyping.

The research conducted for this thesis was supported by funds from the Health Science

Foundation, the New York State Spinal Cord Injury Trust and departmental funds.

I. Introduction

Oligodendrocytes are the myelin forming cells of the central nervous system

(CNS). During the development of the brain, these cells are the last to develop; prenatally neurons are generated first, followed by astrocytes (Altman and Bayer, 1984).

Myelination occurs postnatally and may continue for several years after birth in most vertebrates (Skoff et al., 1976). Oligodendrocyte precursor cells (OPCs) are generated from neuroepithelium cells early in development, but ultimately migrate postnatally to the appropriate areas in the cortex and spinal cord and differentiate into mature oligodendrocytes and myelinate axons.

Oligodendrocyte precursors arise from specific areas of the neural tube (Warf et al., 1991; Ono et al., 1995; Timsit et al., 1995). They are present in ventral regions of the spinal cord during early embryogenesis at certain developmental stages, and also more rostral, in defined areas of the ventricular and subventricular zones (Warf et al., 1991;

Ono et al., 1995, 1997a). The expression of the oligodendrocyte lineage genes, Olig1 and

Olig2, encoding basic-helix-loop-helix (bHLH) transcription factors, is required to generate oligodendroglia (Lu et al., 2000; Zhou et al., 2000). Cells that express both

Olig2 and the transcription factor Nkx2.2 develop into oligodendrocytes (Zhou et al.,

2001). Olig1 is required for later development of oligodendrocytes and remyelination after injury (Lu et al., 2002).

Once these early progenitor cells are committed to the oligodendrocyte lineage, they migrate to their appropriate location in the brain and spinal cord where they begin to differentiate (Figure 1; Miller, 2002). Migration is thought to be regulated partially by

axonal signals, as well as cell surface components such as adhesion molecules and integrins (Payne and Lemmon, 1993; Wang et al., 1994; Kiernan et al., 1996; Ono et al.,

1997b; Garcion et al., 2001). PDGF acts as a chemoattractant for OPCs, stimulating migration, while netrin and semaphorin-3a act as chemorepellants for OPCs (Armstrong et al., 1990, 1991; Sugimoto et al., 2001). FGF signaling is required for normal OPC migration, as cells that do not respond to FGF cannot migrate to putative white matter tracts (Osterhout et al., 1997). Extracellular matrix proteins can also influence migration.

Specifically, laminin, fibronectin, and merosin can promote OPC migration in vitro

(Frost, Kiernan, Faissner, & ffrench-Constant, 1996). However, despite all this work, the precise signals and corresponding signaling pathways that coordinate OPC migration are still not well understood.

Oligodendrocyte progenitor cells (OPCs) were found to secrete Reelin, a well- known extracellular glycoprotein protein involved in neuronal migration. Reelin modulates the migration of neurons during development, which ensures the proper formation of cortical neuronal layers. OPCs also express critical components of the

Reelin signaling pathway, specifically the adaptor protein Dab1 and receptor VLDLR

(Figure 2; (Siebert and Osterhout, 2011)). Expression of these signaling components was seen at all stages of OPC differentiation, ranging from the progenitor cell stage to mature myelinating oligodendrocytes, and Reelin was found to be secreted at all stages of oligodendrocyte differentiation (Siebert and Osterhout, 2011).

Since OPCs produce Reelin and also express a receptor for Reelin and the adaptor protein Dab1, it was hypothesized that OPCs might respond to Reelin, possibly in an autocrine manner. Being that Reelin is a critical regulator of neuronal migration, it was

hypothesized that Reelin might also regulate OPC migration. This thesis examines the effects of Reelin on OPC migration, and characterizes the role of the Reelin signaling pathway components in OPC migration.

II. Materials and Methods

All procedures involving the use of animals were approved by the Upstate

Medical University Committee for the Humane use of Animals, under the direction of the

Department of Laboratory Animal Resources, following the guidelines set for by the

A.A.A.L.A.C

Cell Culture

Primary OPCs were isolated from neonatal Sprague Dawley rats (P1-P2) as previously described (Osterhout et al., 1997). In summary, the cortex was dissociated, and mechanically triturated to generate mixed glial cell cultures. After 7-10 days in culture, OPCs were isolated by a mitotic shake off, followed by differential plating to remove contaminating microglia. OPCs were plated on poly D-lysine coated tissue culture dishes or glass coverslips and maintained in defined media with specific mitogens

(PDGF, 10 ng/ml and FGF 20 ng/ml) to prevent differentiation. OPC differentiation was initiated by culturing OPCs in serum free defined media without mitogens.

Cell Migration assays

OPCs were plated onto polylysine coated dishes in a mix of L15 media with

HEPES, which is an air buffered media to maintain viable cells outside of a tissue culture

incubator. The cells were placed into a temperature controlled chamber set at 37oC on a

Zeiss Axio microscope. Live cells were imaged by time lapse over the course of one hour. The effects of various factors such as PDGF, Reelin (concentrated from B104 conditioned media), blocking antibody CR-50 (MBL International, Woburn, MA), and a control antibody: anti-Tubulin (Promega, Madison, WI) were studied by adding these agents to sister cultures at the start of the one hour monitoring time. The imaging time was limited to one hour to maintain maximum viability of the cells.

B104 conditioned media contains a significant amount of Reelin (Siebert and

Osterhout 2011). Being that B104 cells are neural in origin, it was used as a source of

Reelin for these assays. Growth factors were removed during the concentration process by using Amicon Ultra-4 Centrifugal Filter Unit (100 MWCO) (Millipore, Darmstadt,

Germany).

Cell body movement was measured by obtaining the largest distance between two cell edges at 0 min and at 1 hour. The difference between these two lengths was used as a measure of the degree of cell body migration. Process outgrowth was measured in a similar manner. The largest distance between two processes tips was determined at both 0 min and at 1 hr. The difference between these two lengths was determined and used to measure process outgrowth. OPCs isolated from at least 4 different dissections were analyzed for these cell migration assays.

Statistical analysis

Significant changes in the measurements in the cell body migration and process outgrowth assays were detected using the Student’s t tests, comparing the changes in

measurements after the addition of each factor and the control measurements. The cell assay was replicated 3 times (n=3) using cells collected from at least 4 different dissections.

Western Blotting

Cell Lysate Collection: Cell culture dishes were rinsed twice with ice cold PBS to remove culture media, and lysed with ice cold lysis buffer (10 mM Tris, pH 7.2, 150 mM NaCl, 1 mM EDTA, 1% Triton, 1% Deoxycholate, 0.1%SDS) with protease inhibitors (Leupeptin, Levamisol, NaF, NaVO4, and PMSF) added immediately prior to cell lysis. Oligodendroglial cell cultures were harvested on ice at various time points during differentiation.

OPC conditioned media was collected during regular media changes every two days and concentrated using the Amicon Ultra-4 Centrifugal Filter Unit.

Protein assays: Protein concentrations were quantified using the Micro BCA

Protein Assay Reagent Kit (Pierce, Rockford, IL) per the manufacturer’s instructions.

Immunoprecipitation: Dab1 was immunoprecipitated from cell lysate (100ug starting amount of protein) shaking overnight at 4o C, using 300ug of anti-Dab1 antibody (Rockland, Gilbertsville, PA). Fyn was immunoprecipitated using 300ug of anti-Fyn antibody (FYN 3) (Santa Cruz Biotech, Santa Cruz, CA). Both were incubated with Protein-A agarose beads (Santa Cruz Biotech, Santa Cruz, CA). After incubation,

beads were pelleted by centrifugation, rinsed twice with buffer, and reducing sample buffer was added to beads to release any attached proteins. The amount of antibody and cell lysates were optimized to remove all Dab 1 and Fyn from the cell cytoplasm ( data not shown and Siebert and Osterhout, 2011)

Western blotting: Samples were run on a pre-cast gradient, 3-8%, Tris-Acetate

NuPAGE gel (Invitrogen), then transferred onto a PVDF membrane. Membranes were blocked overnight in 5% nonfat dry milk in TBS containing 0.1% Tween-20 and were then probed for Reelin (clone 142) (1:1000, Millipore, Darmstadt, Germany), Fyn

(1:1000; Santa Cruz Biotech, Santa Cruz, CA), Dab1 (1:1000, Rockland, Gilbertsville,

PA), 4G10 platinum anti-phosphotyrosine antibody (1:1000, Millipore, Darmstadt,

Germany), Cdk5 (1:1000, Santa Cruz Biotech, Santa Cruz, CA), and Src (1:1000, Santa

Cruz Biotech, Santa Cruz, CA). Primary antibodies were diluted in blocking solution and incubated overnight at 4oC. Primary antibodies were detected with an ECF Western

Blotting kit (GE Health Care, UK) or an ECL Plus Western Blotting Detection System

(GE Healthcare, UK) following the manufacturers protocols. Membranes were then scanned on a STORM 840 or Biorad Chemidoc Imaging system.

Animals

Reeler -/- mice and Scrambler -/- mice used in this study were bred from adult

Reeler +/- mice and adult Scrambler +/- mice (a gift from Dr. Eric Olson). Fyn -/- mice brain tissue sections were a generous gift from Yue Feng, Emory University.

Genotyping

Animal Tail Digestion: (Method adapted from Jackson Laboratory’s Protocols)

Incubated 2mm of mice tails in 200ul of PBND buffer (50mM KCl, 10 mM Tris-HCL,

2.5 mM MgCl2, 0.1 mg/ml Gelatin, 0.45% v/v IGEPAL and 0.45% v/v Tween 20) containing 100 ug/ml Proteinase K at 55 degrees C overnight. Samples were heated at 95 degrees C for 5 min to inactivate the Proteinase K.

PCR: Reaction mixture for PCR was created using the ReadyMix Taq PCR reaction mix (Sigma) with the addition of primers provided by the laboratory of Dr. Eric

Olson. For Reeler genotyping, JBXFwd1 (GTCCTCACTCGCCCTTT), JBXRev1 (wt)

(CAGGAATGAAGCAGACTCTC) and JBXRev2 (mut) (TCACGGACAAACTGCTCT) primers were used. For Scrambler genotyping, D4MIT31 fwd

(ACGAGTTGTCCTCTGATCAACA), D4MIT31 REV

(AGCCAGAGCAAACACCAACT), DRMIT331 fwd (CCTAACCCTCCCCACACC)

AND D4MIT331 rev (AAAGATCTGGATTCAAATCCTCC) primers were used.

Immunohistochemical Procedures

Mice older than P7 were perfused with saline solution followed by 4% paraformaldehyde, and the brains were removed. Mice younger than P7 were sacrificed, the brains removed and drop fixed directly into 4% paraformaldehyde. The tissue was postfixed and incubated in sucrose for several days prior to cryosection. Immediately prior to sectioning, they were embedded in OCT compound (Sakura Finetek, Torrance,

CA) and frozen on dry ice. Frozen sagittal sections (18um) were mounted on glass slides

(Superfrost Plus Microscope slides, Fisher Scientific, Pittsburgh, PA).

Olig2 immunohistochemistry: Sections were rehydrated in PBS, and permeabilized by steaming in 0.01M citric acid buffer (pH 6.0) for 20 minutes. They were blocked in antibody media (3% FBS and 3% BSA in HBSS) for 1 hr. Sections were incubated overnight at 4°C in anti-Olig2 primary antibody (1:200; Millipore, Darmstadt,

Germany) diluted in antibody media (3% FBS and 3% BSA in HBSS). Primary antibody binding was detected using a goat anti-rabbit biotinylated secondary antibody (1:1000;

Vector Labs, Burlingame, CA) diluted in 1xPBS, the VECTASTAIN Elite ABC Kit

(Standard) (Vector Labs, Burlingame, CA) and the Dab Peroxidase Substrate kit (Vector

Labs, Burlingame, CA).

H & E stain: After sections were probed for Olig2, they were submerged in hematoxylin for 3 min and then fast dipped in three changes of DI H20 . They were then placed in tap water for 5 min and then fast dipped in acidified EtOH . Then sections were placed in tap water and then in DI H20 for 2 min. Sections were placed into aqueous eosin for 30 sec and then in 95% ethanol, 100% ethanol, and xylene. Slides were mounted in Permount mounting media ( Fisher Scientific).

Ki67 immunohistochemistry: Sections were rehydrated in PBS, and permeabilized by steaming in 0.01M citric acid buffer (pH 6.0) for 20 minutes. They were blocked in antibody media (3% FBS and 3% BSA in HBSS) for 1 hr. Sections were

incubated overnight at 4°C in anti-Ki67 primary antibody ((SP6) (1:200, Thermo

Scientific, Waltham, MA) diluted in antibody media (3% FBS and 3% BSA in HBSS).

Primary antibody binding was detected using a goat anti-rabbit biotinylated secondary antibody (1:1000; Vector Labs, Burlingame, CA) diluted in 1xPBS, the VECTASTAIN

Elite ABC Kit (Standard) (Vector Labs, Burlingame, CA) and the Dab Peroxidase

Substrate kit (Vector Labs, Burlingame, CA).

III. Results

In vitro studies of the effect of Reelin on OPCs

The discovery that OPCs can secrete Reelin and that these cells also express the

Reelin receptor VLDLR and downstream component Dab1 are novel and suggested that

OPCs may actually respond to Reelin. A series of experiments were designed to test this hypothesis. All in vitro experiments were conducted using primary OPCs isolated from neonatal rat brains (Figure 1). OPCs were maintained in serum free defined media with growth factors to prevent differentiation.

To evaluate migration, purified OPC cells were trypsinized, and plated in small concentrated drops on polylysine coated dishes. These cells were maintained in L-15 with

Hepes buffer to maintain proper pH outside of the tissue culture incubator for the duration of the experiments. This plating technique generates many OPCs in cell aggregates. Cells found in clusters tend to rapidly migrate outwards and disperse. Time

lapse imaging was performed over the course of one hour to record this migration while the cells were incubated at 370C in the Zeiss temperature controlled chamber. Individual groups of cells were imaged under several experimental conditions to assess the effect of

Reelin and other factors on cell body migration (Figure 3A). PDGF was utilized as a positive control, as this growth factor has documented effects on oligodendrocyte migration (Frost et al., 2009). Concentrated B104 conditioned media was used as a source of Reelin to evealuate any effects Reelin may have on these cells (Figure 3B). It should be noted that B104 conditioned media also contains growth factors, such as PDGF and

FGF. To minimize any effects due to growth factors, B104 conditioned media was concentrated using the Amicon Ultra-4 Centrifugal Filter Unit, a centrifugal device with a

100 MWCO (molecular weight cut off) to obtain media with minimal levels of growth factors. Western blotting analysis confirmed that growth factor levels in the concentrated

B104 conditioned media were at a minimum (data not shown). Concentrated B104 conditioned media was used to stimulate the cells with Reelin (10 ug), and cell activity was recorded for an hour. The amount of Reelin added to the cells was estimated by comparing to a known quantity of BSA run on Western blots. The Reelin band size was matched to an equivalent band on a western that displayed a gradient of BSA quantities

(data no shown).

Stimulation of OPCs with Reelin resulted in a significant increase in cell body migration from control conditions (L-15 and Hepes with no additions) (Figure 3C). The distance between two cells furthest from each other at 0 min and at 1 hour were determined, and the difference between these two measurements was used to estimate cell body migration. Since OPCs already secrete Reelin (Figure 2C), it was hypothesized

that any additional Reelin added might present with only a slight increase in activity. To further characterize any potential role of Reelin in stimulating OPC migration, 100 ng of

CR-50, a Reelin antibody that interferes with its function (Utsunomiya-tate et al., 2000) was added to newly plated cells. The addition of CR-50 was intended to block any potential Reelin signaling from secreted Reelin during the duration of the experiment. A significant decrease in cell body migration compared to control conditions was noted upon the addition of 100 ng CR-50 and 200 ng of CR-50 (Figure 3C). This suggests that perhaps OPCs do respond to the Reelin they are producing, given the lower cell motility observed with CR50 as compared to control. The assay was repeated with a control antibody, anti-Tubulin. The addition of this control antibody to the cell culture did not result in a decrease in cell motility, suggesting that the effect seen with the addition of

CR-50 is due to the disruption of Reelin signaling (Figure 3C).

A second analysis was performed to evaluate the effect of Reelin on process outgrowth. Typically after plating, OPCs will both migrate away from cell clusters and extend processes at the same time. The cells will ultimately disperse so individual cells with processes can be observed throughout the dish (Figure 5). The early phases of process extension were evaluated to determine whether Reelin influences process outgrowth (Figure 4A). Again, PDGF was utilized as a positive control in this analysis

(Figure 4B). Concentrated B104 conditioned media was used as a source of Reelin and stimulation with 10 ug of Reelin resulted in a significant increase in process outgrowth compared to control conditions. The distances between the processes tips furthest away from each other at 0 min and at 1 hour were determined and the difference between these two measurements was used to determine the extent of process outgrowth. The addition

of 100ng of CR-50 resulted in a very slight decrease in the extent of process outgrowth when comparing to control conditions. An increase in CR-50 dose to 200ng did not further decrease the degree of process outgrowth (Figure 4B).

In an attempt to determine whether OPCs are influenced by Reelin once they have dispersed, purified OPC cells were incubated in L-15 and Hepes Buffer, Reelin-free media, and cells were recorded for a period of 30 minutes. Minimal changes in cell motility and process extension were detected during this time (Figure 5A). Concentrated

B104 conditioned media (approximately 10 ug of Reelin) was then added to the cell culture at 30 minutes and cell activity was recorded for an additional 45 minutes (Figure

5A). After addition of concentrated B104 conditioned media, no changes in cell activity were noted. Process outgrowth and cell body motility remained comparable to control conditions. It is possible that OPCs secrete Reelin during the duration of the experiment, which is at the maximal level that the cells can respond to, and that the addition of exogenous Reelin may not exert any effect.

Since the secretion of Reelin could not be controlled in this experiment, CR-50 was used to interrupt Reelin binding to the cellular receptor. OPC cultures in L-15 and

Hepes were recorded for 30 min at which point CR-50 (1 ug) was added and cell activity was recorded for another 45 min. No significant changes in cell body motility were detected and there were minimal changes in process outgrowth (Figure 5B). To ensure that all Reelin present in the dish was being bound by CR-50, up to 3 ug of CR-50 was added to the cell culture (data not shown) and CR-50 was immunoprecipitated from the cell culture media to test whether it was binding all of the available Reelin. Reelin levels in the culture after CR-50 immunoprecipitation were undetectable (data not shown). Still,

no significant changes were detected, even at longer recording times (up to 5 hours).

OPCs were incubated in CR-50 overnight, but even then, no significant changes in cell motility were detected. Collectively, these findings suggest that after the initial dispersal of cell bodies and initial process outgrowth, Reelin has a minimal effect on cell movement.

In vivo studies of the effect of Reelin on OPCs

The previous in vitro data suggest that Reelin may have a role in oligodendrocyte progenitor cell migration. To determine if there is any effect of diminished Reelin activity on OPCs in vivo, Reeler -/- brain sections were probed for Olig2. Olig2 is a transcription factor in the oligodendroglial cell lineage and is expressed in all stages of oligodendroglia, from the early oligodendrocyte progenitor cells to mature myelinating oligodendrocytes (Zhou et al., 2001; Lu et al., 2002). In Wild-type mice (P7) brain sections, Olig2 positive cells were dispersed throughout the brain parenchyma, with a small band visbile in the subventricular zone (Figure 6A). Olig2 cells in Reeler -/- (P7) brain sections were distributed in a similar pattern, despite abnormal cortical organization

(Figure 6B). To determine whether Reelin exerts any effect on OPCs at a later developmental stage, Olig2 positive cells were examined in P21 mouse brains, with similar findings (Figure 6C, D). Oligodendroglia were dispersed throughout the parenchyma of brains of Reeler +/- and Reeler -/- mice, again indicating no abnormalities in OPC migration. To verify that oligodendrocytes could differentiate in Reeler -/- mice,

CNPase levels were measured in whole brain lysates from both WT and Reeler -/- mice.

The results indicated that oligodendrocytes do express equal levels of CNPase, a protein upregulated early in differentiation, which suggests that OPCs do differentiate even in the absence of Reelin (data not shown).

Dab1 plays a role in OPC migration

Olig2 positive cells were also examined in the Scrambler -/- mouse, which is a mouse strain deficient in the adaptor protein, Dab1. Surprisingly, a significant accumulation of Olig2 positive cells was observed near the SVZ in the Scrambler -/-

(P21) mouse brain when compared to WT (P21) (Figure 7A,B). Such an accumulation suggests these Olig2 positive cells are either proliferating excessively, or are unable to migrate outward to their appropriate locations, suggesting that Dab1 may be important for either OPC migration and/or OPC proliferation. To distinguish between the two biological effects, brain sections were probed for Ki67, a marker for cell proliferation.

Scrambler +/- (P21) mouse brain tissue, used as the control, demonstrated dispersed numbers of Ki67 positive cells around the SVZ, as well as normal levels of Olig2 positive cells dispersed through the brain (Figure 8A,C). Scrambler -/- (P21) also demonstrated a similar number of KI67 positive cells around the SVZ with no accumulation, despite the significant accumulation of Olig2 positive cells in and around the SVZ (Figure 8B, D).

These results strongly suggest that the accumulation of Olig2 positive cells is due to a defect in OPC migration rather than being due to excessive OPC proliferation. These data lead to the conclusion that Dab1, an adaptor protein that is well known for its

involvement in Reelin dependent neuronal migration, plays a role in OPC migration as well.

Dab1 forms complexes with proteins implicated in OPC migration

The observations in the Scrambler -/- mice suggests that Dab1 may be important for OPC migration. Many other proteins have been implicated in OPC migration, including Fyn, a Src family kinase and Cyclin dependent kinase 5 (Cdk5) (Miyamoto et al., 2008; Liu et al., 2012) (Figure 9). Dab1 is known to interact with Fyn downstream of

Reelin in neurons and this interaction is critical for Reelin dependent neuronal migration

(Bock and Herz, 2003). Reelin binding to its receptor, either VLDLR or ApoER2 leads to the phosphorylation of Dab1 by Fyn (Arnaud et al., 2003a). In OPCs, Fyn has been implicated to play a role in cell migration, but the exact molecular mechanisms are still not clear (Miyamoto et al., 2008; Liu et al., 2012). Fyn activation is an important initial step in oligodendroglial differentiation and myelination. The morphological differentiation of OPCs into mature oligodendrocytes is controlled by Fyn activation

(Osterhout et al., 1999), and reduction in myelination is observed in Fyn -/- mice

(Sperber et al., 2001).

To determine whether Dab1 complexes with Fyn in OPCs, immunoprecipitation studies were conducted from primary OPCs harvested the day after plating or at various times after initiating differentiation. OPC lysates were immunoprecipitated with anti-

Dab1, and immunoblotted with an anti-Fyn antibody. An association between Fyn and

Dab1 was clearly demonstrated which is present in both undifferentiated OPCs, as well as

differentiated (Day 7) oligodendrocytes (Figure 10). Thus, Dab1 forms a complex with

Fyn naturally in oligodendrocytes at all stages and it is possible that this interaction may be important for OPC migration.

If the Dab1 and Fyn interaction is important for OPC migration, it was hypothesized that Fyn -/- mice would also show an accumulation of Olig2 positive cells, similar to the Scrambler -/- mice brain tissue. Using Olig2 to identify oligodendroglia, an examination of the SVZ and areas around the ventricles of Fyn -/- (P7) mice brain tissue demonstrated an increase in the number of OPCs (Figure 11A), although clearly not to the same extent as was seen in Scrambler -/- brain. Densities of Olig2 positive cells surrounding in the SVZ and ventricles were measured for various mouse mutants at P21, including the Fyn -/- mice (Figure 11B). This analysis demonstrated that Reeler -/- mice brains demonstrate a slight increase in Olig2 positive cells surrounding the ventricles while the Scrambler -/- mice brains, display a significantly higher number of Olig2 positive cells in the same region. A slight increase in Olig2 positive cells around the ventricular area in Fyn -/- mice supports the hypothesis that Fyn is also important for

OPC migration.

If Fyn/Dab-1 interactions were important for migration, it might be expected that the failure to migrate in Fyn deficient mice would be comparable to Scrambler -/-.

However, the accumulation of OLig2 positive cells near the SVZ was mild comparatively

(Figure 11A and data not shown). However, it may be that Src, another Src family tyrosine kinase family member, partially compensates for the loss of Fyn in Fyn -/- and for this reason, Olig2 positive cells do not fail to migrate as was seen in Scrambler -/- brain. It was found that in the absence of Fyn, Src protein levels are slightly increased in

the brain (Figure 11C). To verify that Src could potentially substitute for Fyn in animals lacking Fyn, we looked for a Src/Dab1 interaction in OPCs. Immunoprecipitation studies revealed an association between Dab1 and Src in both Day 3 OPC lysate as well as Day 7

OPC lysate (Figure 11 D). This finding suggests that Src might be compensating for the lack of Fyn in the Fyn deficient mice, and thus the migratory defect is not as severe.

The observation that there is no obvious migratory defect of OPCs in Reeler -/- mice, and a significant defect in Scrambler -/- mice was seen suggests that when the

Fyn/Dab1 interaction is intact, OPC migration occurs normally. In the absence of Dab-1, migration from the SVZ appears to be significantly reduced. However, there is no Reelin in the Reeler-/- mice; this suggests there could be another signal that stimulates Fyn/Dab1 interaction. PDGF is a well known chemoattractant for OPC and will stimulate OPC migration (Frost et al., 2009) (Figure 9). It is possible that the migration and Fyn/Dab-1 interactions are being stimulated by PDGF. To test the hypothesis that Dab1 could be acting downstream of PDGF signaling, OPCs were stimulated with PDGF in vitro, and the cells were harvested for biochemical analysis. Immunoprecipitation of Dab-1 , followed by probing for tyrosine phosphorylation showed an increase in the levels of

Dab1 phosphorylation after PDGF stimulation (Figure 12A). Dab 1 levels remain constant after PDGF stimulation, as evidenced by examining Dab1 protein levels in the cell lysate . PDGF stimulation significantly increased Dab1 phosphorylation in these cells, demonstrating that PDGF signaling may involve Dab1 activation.

Downstream of PDGF stimulation, both Fyn and Cdk5 are phosphorylated, and implicated in the signaling pathway that regulates PDGF stimulated cell migration. Like

Fyn, Cdk5 has also been implicated in both neuronal and OPC migration (Keshvara et al.,

2002; Miyamoto et al., 2008). Cdk5 was found to phosphorylate neuronal Dab1 independent of Reelin at Serine 491 (Keshvara et al., 2002) and within OPCs, Cdk5 acts downstream of PDGF and Fyn to induce PDGF-dependent migration (Miyamoto et al.,

2008) (Figure 9). Since Cdk5 is known to act downstream of PDGF stimulation

(Miyamoto et al., 2008), we considered the possibility that PDGF stimulation influences potential interactions between Dab1 and Cdk5 in oligodendroglial cells. Specifically,

OPC lysates (Day 0) obtained from control cell culture conditions and OPC lysates from cells stimulated with PDGF for 2 minutes were tested for Dab1/Cdk5 interactions (Figure

12B). Dab1 interacts with Cdk5 under both control conditions and upon stimulation with

PDGF. Dab1 interactions are mildly increased upon stimulation with PDGF, however further quantitative studies would need to be completed to verify this.

Since Dab1 can associate with both Fyn and Cdk5 in OPCs, it was thought that the three proteins may function together as a complex. To help resolve this, immunoprecipitation studies were used to determine whether Fyn associates with Cdk5

(Figure 13A). Indeed, an interaction between Fyn and Cdk5 was found in both OPC lysates and in PDGF stimulated OPC cell lysates. There may even be an increase in Fyn-

Cdk5 interactions upon PDGF stimulation, but further quantitation studies are needed to verify this. However, in differentiating oligodendrocytes, the interaction between Fyn and

Cdk5 is lost (Figure 13B). Day 4 OPCs do not demonstrate a strong association between

Fyn and Cdk5. These cells are non-migratory cells, so this result suggests that Fyn/Dab-

1/Cdk 5 interactions may actually be important for OPC migration. It should be noted however, that Dab1 does still interact with Cdk5 under similar conditions of differentiation (Figure 13C). The function of this interaction is unknown.

IV. Discussion

In vitro studies, specifically the cell migration assays, indicated that Reelin may have a stimulatory role in OPC migration. Cell body migration was significantly increased upon stimulation with Reelin (concentrated B104 conditioned media) and a significant increase in process outgrowth was observed when comparing to control conditions. B104 conditioned media contains growth factors, although the concentration process removed known growth factors, there may be undetectable levels of growth factors or unidentified growth factors remaining in the media and are the reason behind the observed effects. However, the fact that the addition of CR-50 decreases both cell body migration and process outgrowth suggests that Reelin does exert a stimulatory effect on early cell migration, similar to migration from the SVZ in the developing brain.

However, once cells are dispersed, neither the addition of Reelin or CR-50 exert any effect on OPCs, indicating that any role that Reelin plays would be in only early migration events.

Conversely, in vivo data does not clearly support the in vitro results. OPC migration in Reeler -/- brains appears to be normal, despite the irregularities in brain layer formation. Interestingly however, OPC migration is defective in the absence of

Dab1. OPCs accumulate at the SVZ in Scrambler -/- mice, indicating that Dab1 may be a key player in OPC migration. Dab1 was found to interact with Fyn in OPCs as well as

Cdk5. It is interesting that differentiated cells lose the Fyn-Cdk5 association while Dab1 continues to interact with Cdk5. This possibly indicates that the role of Fyn-Cdk5

interaction is specifically related to just OPC migration while Dab1 may interact with

Cdk5 at later stages for other purposes.

Cells stimulated with PDGF demonstrated an increase in tyrosine phosphorylation of Dab1. Both Fyn and Cdk5 have been demonstrated to phosphorylate

Dab1 (Keshvara et al., 2002; Arnaud et al., 2003a). These results hint at the idea that

PDGF may cause the formation of a Dab1-Fyn-Cdk5 complex, which triggers OPC migration (Figure 14). The fact that Reeler -/- brains appear to be normal may be because

PDGF stimulates the activation of Dab-1/Fyn and Cdk5, allowing normal OPC migration.

Reelin could be involved in OPC migration, leading to a similar complex formation, but

PDGF may be more important.

V. Conclusions and Future Directions

Overall it seems that the interaction between Dab1, Fyn, and Cdk5 may be important for proper OPC migration. Serial staining of Scrambler -/-, Fyn -/-, Cdk5 -/-, and Reeler -/- with Olig2 over various developmental stages would be an excellent way to determine if and when defects seen with OPC migration begin. Also, the use of Dab1 siRNAs can help confirm the role of Dab1 in OPC migration. It would be very interesting to conduct a VLDLR siRNA study as well, to help determine a specific role for Reelin in

OPC migration

Further studies are needed to determine whether PDGF leads to an increase in interactions between Fyn and Cdk5 as well as between Dab1 and Cdk5. PDGF does appear to cause an increase in Dab1 tyrosine phosphorylation, but it remains to be

clarified whether Fyn or Cdk5 is actually responsible for this phosphorylation event.

Moreover, events downstream of the proposed complex formation need to be elucidated to help determine the exact mechanism behind oligodendrocyte migration. For instance, downstream of PDGF, Cdk5 has been shown to phosphorylate WAVE-2, a protein that stimulates Arp2/3 to allow actin reorganization (Takenawa and Miki, 2001; Miyamoto et al., 2008). It would be interesting to determine whether Dab1 activity is important upstream of WAVE-2 phosphorylation. Oligodendrocytes from mouse brain are difficult to isolate in sufficient numbers for biochemical studies, thus these studies would have to be done with rat cells.

It would also be very interesting to determine whether Dab1 is involved in the process of myelination at all. Fyn has an important role in myelin formation hence it would be worthwhile to determine whether an interaction between Fyn and Dab1 is important for this event. Another important question to answer is whether oligodendrocytes are a source of Reelin necessary for neuronal migration. Are neurons dependent on oligodendrocytes as a source of Reelin later in development, possibly in adulthood if not early on? Overall, it can be said that much work is needed to identify and characterize the proecise role of Reelin and Dab1 in OPC migration.

VI. References

Altman J, Bayer SA (1984) The development of the rat spinal cord. Adv Anat Embryol

Cell Biol 85:1–164.

Armstrong R, Harvath L, Dubois-Dalcq M (1991) Astrocytes and O-2A progenitors

migrate toward distinct molecules in a microchemotaxis chamber. Ann N Y Acad

Sci 633:520–522.

Armstrong RC, Harvath L, Dubois-Dalcq ME (1990) Type 1 astrocytes and

oligodendrocyte-type 2 astrocyte glial progenitors migrate toward distinct

molecules. J Neurosci Res 27:400–407.

Arnaud L, Ballif B a, Förster E, Cooper J a (2003) Fyn tyrosine kinase is a critical

regulator of disabled-1 during brain development. Curr Biol 13:9–17.

Bock HH, Herz J (2003) Reelin activates SRC family tyrosine kinases in neurons. Curr

Biol 13:18–26.

Frost EE, Zhou Z, Krasnesky K, Armstrong RC (2009) Initiation of oligodendrocyte

progenitor cell migration by a PDGF-A activated extracellular regulated kinase

(ERK) signaling pathway. Neurochem Res 34:169–181.

Garcion E, Faissner A, ffrench-Constant C (2001) Knockout mice reveal a contribution of

the extracellular matrix molecule tenascin-C to neural precursor proliferation and

migration. Development 128:2485–2496.

Keshvara L et al. (2002) Cyclin-dependent kinase 5 phosphorylates disabled 1

independently of Reelin signaling. J Neurosci 22:4869–4877.

Kiernan BW, Götz B, Faissner A, ffrench-Constant C (1996) Tenascin-C inhibits

oligodendrocyte precursor cell migration by both adhesion-dependent and adhesion-

independent mechanisms. Mol Cell Neurosci 7:322–335.

Liu X, Lu Y, Zhang Y, Li Y, Zhou J, Yuan Y, Gao X, Su Z, He C (2012) Slit2 regulates

the dispersal of oligodendrocyte precursor cells via Fyn/RhoA signaling. J Biol

Chem 287:17503–17516.

Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH (2002) Common

developmental requirement for Olig function indicates a motor

neuron/oligodendrocyte connection. Cell 109:75–86.

Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles CD,

Rowitch DH (2000) Sonic hedgehog--regulated oligodendrocyte lineage genes

encoding bHLH proteins in the mammalian central nervous system. Neuron 25:317–

329.

Miller RH (2002) Regulation of oligodendrocyte development in the vertebrate CNS.

Prog Neurobiol 67:451–467.

Miyamoto Y, Yamauchi J, Tanoue A (2008) Cdk5 phosphorylation of WAVE2 regulates

oligodendrocyte precursor cell migration through nonreceptor tyrosine kinase Fyn. J

Neurosci 28:8326–8337.

Ono K, Bansal R, Payne J, Rutishauser U, Miller RH (1995) Early development and

dispersal of oligodendrocyte precursors in the embryonic chick spinal cord.

Development 121:1743–1754.

Ono K, Fujisawa H, Hirano S, Norita M, Tsumori T, Yasui Y (1997a) Early development

of the oligodendrocyte in the embryonic chick metencephalon. J Neurosci Res

48:212–225.

Ono K, Yasui Y, Rutishauser U, Miller RH (1997b) Focal ventricular origin and

migration of oligodendrocyte precursors into the chick optic nerve. Neuron 19:283–

292.

Osterhout DJ, Ebner S, Xu J, Ornitz DM, Zazanis GA, McKinnon RD (1997)

Transplanted oligodendrocyte progenitor cells expressing a dominant- negative FGF

receptor transgene fail to migrate in vivo. J Neurosci 17:9122–9132.

Osterhout DJ, Wolven A, Wolf RM, Resh MD, Chao M V. (1999) Morphological

differentiation of oligodendrocytes requires activation of Fyn tyrosine kinase. J Cell

Biol 145:1209–1218.

Payne HR, Lemmon V (1993) Glial cells of the O-2A lineage bind preferentially to N-

cadherin and develop distinct morphologies. Dev Biol 159:595–607.

Siebert JR, Osterhout DJ (2011) Oligodendroglial cells express and secrete reelin. Anat

Rec (Hoboken) 294:759–763.

Skoff RP, Price DL, Stocks A (1976) Electron microscopic autoradiographic studies of

gliogenesis in rat optic nerve. I. Cell proliferation. J Comp Neurol 169:291–312.

Sperber BR, Boyle-Walsh EA, Engleka MJ, Gadue P, Peterson AC, Stein PL, Scherer SS,

McMorris FA (2001) A unique role for Fyn in CNS myelination. J Neurosci

21:2039–2047.

Sugimoto Y, Taniguchi M, Yagi T, Akagi Y, Nojyo Y, Tamamaki N (2001) Guidance of

glial precursor cell migration by secreted cues in the developing optic nerve.

Development 128:3321–3330.

Takenawa T, Miki H (2001) WASP and WAVE family proteins: key molecules for rapid

rearrangement of cortical actin filaments and cell movement. J Cell Sci 114:1801–

1809.

Timsit S, Martinez S, Allinquant B, Peyron F, Puelles L, Zalc B (1995) Oligodendrocytes

originate in a restricted zone of the embryonic ventral neural tube defined by DM-20

mRNA expression. J Neurosci 15:1012–1024.

Utsunomiya-tate N, Kubo K, Tate S, Kainosho M, Katayama E (2000) Reelin molecules

assemble together to form a large protein complex , which is inhibited by the

function-blocking CR-50 antibody. PNAS 97:9729–9734.

Wang C, Rougon G, Kiss JZ (1994) Requirement of polysialic acid for the migration of

the O-2A glial progenitor cell from neurohypophyseal explants. J Neurosci 14:4446–

4457.

Warf B, Fok-Seang J, Miller R (1991) Evidence for the ventral origin of oligodendrocyte

precursors in the rat spinal cord. J Neurosci 11:2477–2488.

Zhou Q, Choi G, Anderson DJ (2001) The bHLH transcription factor Olig2 promotes

oligodendrocyte differentiation in collaboration with Nkx2.2. Neuron 31:791–807.

Zhou Q, Wang S, Anderson DJ (2000) Identification of a novel family of

oligodendrocyte lineage-specific basic helix-loop-helix transcription factors. Neuron

25:331–343.

100

101

Figure 1. Characterization of primary oligodendrocyte progenitor cells in culture.

Oligodendrocyte progenitor cells are easily isolated from neonatal rat brains and these cells were used for all cell experiments performed in this thesis. (A) Oligodendrocyte progenitor cells can undergo a characteristic program of differentiation in culture under the proper culture conditions. They progress from a simple bipolar cell, which is the migratory phenotype, to a complex cell with multiple processes that eventually mature into the myelinating phenotype. (B) Phase contrast image of oligodendrocyte progenitor cells purified from mixed glial cultures demonstrates simple bipolar cells. (C)

Oligodendrocyte progenitors express the PDGFα receptor (green fluorescence), a known marker for early progenitors. As they differentiate, they extend multiple complex processes (D), and ultimately large membrane sheets over the surface of the culture dish

(E). Both express the ganglioside O1, marker of differentiating oligodendroglia.

102

103

Figure 2. OPCs express Reelin and components of the Reelin signaling pathway.

(A) Western blotting of whole cell lysates demonstrated that OPCs express Reelin, Dab1, and VLDLR at all stages of differentiation. (B) Reelin is secreted by OPCs. Western blotting analysis of conditioned media from OPC cell cultures (24 hour incubation) resulted in higher levels of Reelin when compared to Reelin levels in whole cell lysates.

Conditioned OPC culture media (48 hour incubation) was used for these westerns. These results reproduced from Siebert and Osterhout, 2011.

104

105

Figure 3. Reelin has a slight stimulatory effect on oligodendrocyte cell body migration.

(A) Oligodendrocyte progenitors cells, when plated in a small cluster, will migrate and disperse over the dish. This initial migration was visible and measurable over the course of 1 hour and used to evaluate the effects of various factors including Reelin, on migration. (B) The source of Reelin utilized in this assay was that secreted by B104 cells, a neural cell line. (C) To quantitate migration, the maximum distances between the two furthest cell bodies were measured at 0 min and 1 hour and their difference was used as a measure of cell body migration. PDGF stimulation lead to an increase in cell body migration compared to control conditions (no additions). To evaluate the effects of Reelin in vitro, 15ul of concentrated B104 (10ug of Reelin), was added to the media. After 1 hour of incubation, measurements demonstrated a significant increase in cell body migration as compared to control conditions. Since oligodendrocyte progenitor cells secrete Reelin, the blocking antibody CR-50 (100ng and 200ng) was tested in these cultures. Measurements indicated that the addition of CR-50 causes a decrease in cell body migration, suggesting that the normal secretion of Reelin may have an autocrine effect on oligodendrocyte progenitor cells. Addition of a control antibody, goat–anti- mouse Tubulin, had no effect. Data shown are mean +/- SEM for each group (n=3 for each group).

106

107

Figure 4. Reelin stimulates process outgrowth during cell dispersion.

(A) Oligodendrocyte progenitor cells also extend processes as they migrate and disperse through the culture dish. Process outgrowth was visible over the course of 1 hour and measureable in these assays. (B) To quantitate process outgrowth, the maximum distances between the two cell process tips at 0 min and 1 hour were measured for each of the various conditions. PDGF stimulation lead to an increase in process outgrowth compared to control conditions (no additions). Concentrated B104 (15 ul; 10ug of

Reelin), was utilized as the source of Reelin. Both PDGF and added Reelin stimulated process outgrowth after 1 hour. Since oligodendrocyte progenitor cells can secrete

Reelin, CR-50, a Reelin blocking antibody, was tested in these assays. The addition of

CR50 causes a slight decrease in process outgrowth, as compared to control. Data shown are mean +/- SEM for each group (n=3 for each group).

108

109

Figure 5. After cell bodies disperse, Reelin has no effect on process extension or cell motility.

(A) Once dispersed, oligodendrocyte progenitor cells can migrate along the tissue culture dish, extending lamellopodia and filopodia as they move. Time-lapse movies were taken of dispersed cells, recording movements and process elongation, and branching events live. After the addition of Reelin, from B104 conditioned media, there were no changes in the movement of cells or process outgrowth. (B) Since OPCs secrete Reelin, it was hypothesized that additional Reelin to the media may not have an effect, because the endogenous Reelin secreted may be at maximal levels to produce biological effects. To block any endogenous Reelin signaling, CR-50 was added to the media after recording the cells for 30 min in a control setting. The addition of CR-50, even at high concentrations (1 ug), had no effect. Multiple cells (minimum of 4 cells) were evaluated under time lapse per condition; cells were isolated from at least 3 different dissections.

110

111

Figure 61. Oligodendrocyte progenitor cell migration appears normal in Reeler -/- mutants.

Oligodendrocyte progenitor cells express the transcription factor Olig2, which was used to identify these cells in sections of mouse brain. (A) Olig2 staining of WT P7 mouse brain show numerous Olig2 cells scattered throughout the brain (n=3). (B) Olig2 staining of Reeler -/- P7 mouse brain tissue also shows numerous Olig2 positive cells scattered throughout the brain parenchyma, even though there is no Reelin expression in these mice (n=3). At later stages of development, Olig2 cell dispersion in both Reeler +/- (C) and Reeler -/- mouse brain (D) are similar, showing numerous Olig2 positive cells scattered thoughout the brain. This observation suggests that OPCs seem to migrate normally, although Reelin is absent (n=6).

1 = Data collected by Sana Ahmad Din

112

113

Figure 72. Oligodendrocyte progenitor cells do not readily migrate from the subventricular zone in Scrambler -/- mice.

Scrambler mice do not express the adaptor protein Dab1, which is critical for Reelin signaling. (A) Olig2 positive cells in WT mice at p21 can be observed in a thin layer in the subventricular zone (SVZ), and dispersed through the brain parenchyma, migrating to putative white matter tracts such as the corpus callosum (CC). (B) Olig2 staining of the

Scrambler -/- mouse brain at P21 demonstrated an accumulation of Olig2 positive cells

(*) at the SVZ compared to WT mouse brain tissue. Abbreviations: SVZ subventricular zone, CC corpus callosum, Hi Hippocampus. These sections were subjected to H&E staining to visualize brain structures. (n = 6 for each group).

2 = Data collected by Sana Ahmad Din

114

115

Figure 8. The accumulation of oligodendrocyte progenitor cells is not due to increased proliferation.

Oligodendrocyte progenitor cells disperse normally in the heterozygote (A) but not in the mice lacking Dab1. (B) To determine whether the accumulation of Olig2 positive cells in the SVZ of Scrambler -/- mice was due to a defect in proliferation, brain sections were probed for Ki67, a cell proliferation marker. (C) KI67 staining in Scrambler +/-, which shows normal Olig2 positive cells migration, also shows numerous Ki67 positive cells in and around the SVZ. (D) Ki67 positive cells in the Scrambler -/- brain do not show the same accumulation as was seen for Olig2 positive cells, suggesting that that the accumulation of Olig2 positive cells seen in Scrambler -/- is due to a defect in cell migration. (n=6 for each group)

116

117

Figure 9. Common intracellular signaling components may regulate both neuronal and oligodendrocyte migration.

(A) Downstream of Reelin binding to one of its receptors, VLDLR or ApoER2, Fyn and

Dab1 are critical molecular signals that regulate Reelin dependent neuronal migration

(Arnaud, 2003). Dab1 is phosphorylated downstream of Reelin. Further, Cdk5, which independent of Reelin, also phosphorylates Dab1 (Keshvara, 2002) to influence neuronal migration. (B) In oligodendrocyte progenitor cells, PDGF has a critical role in regulating migration. PDGF binding to its receptor, PDGFRα, leads to Fyn phosphorylation and subsequent Cdk5 phosphorylation (Miyamoto, 2008). Much further downstream of both neuronal and oligodendrocyte signaling pathways are changes to actin polymerization. It should be noted, however, that these figures do not illustrate the complete signaling pathways for neuronal or oligodendrocyte migration, rather just a small aspect that involves Dab1.

118

119

Figure 10. Dab1 interacts with Fyn in oligodendrocyte progenitor cells.

An immunoprecipitation study demonstrates that Dab1 interacts with Fyn in oligodendrocytes at both the progenitor cell state and even once the cells have differentiated (day 7). Equal amount of protein (100 ug) and antibodies were used for each IP; conditions were optimized as described in the methods.

120

121

Figure 11. Fyn deficient mice show a mild migration defect, which may be due to

Dab1-Src interactions in the absence of Fyn.

(A) Fyn -/- brain shows a slight increase in Olig2 positive cells in and around the subventricular zone, even at P7 (n=3). (B) The density of Olig2 positive cells in the subventricular zone was quantitated at P21 in several mouse mutants. There is a slight increase in Olig2 positive cell density in Reelin and Fyn deficient mice, but it is much higher in Scrambler mice, reflecting the accumulation in the SVZ. (C)3 In the absence of

Fyn, Src levels are increased in the brain (20 ug of Fyn-/- mouse brain lysate in each lane). Src can interact with Dab1 (D), albeit not to the same extent as Fyn (Figure 9B).

This may explain why the same accumulation of Olig2 positive cells is not observed in

Fyn deficient mice. Equal amount of protein (100 ug) and antibodies were used for each

IP, and conditions were optimized as described in the methods..

3 = Data from previous work completed by Dr. Donna Osterhout

122

123

Figure 12. PDGF stimulation of oligodendrocyte progenitor cells results in phosphorylation of Dab1.

(A) PDGF stimulation of oligodendrocytes can increase Dab1 tyrosine phosphorylation.

Dab1 was immunoprecipitated and tyrosine phosphorylation was detected using the 4G10 antibody. (B) An association between Dab1 and Cdk5 in OPC lysates was demonstrated both with and without PDGF stimulation, although it may be slightly higher after treatment with PDGF. An equal amount of protein (100 ug) and antibody was used for every IP.

124

125

Figure 13. Fyn interacts with CDK5 in oligodendrocyte progenitor cells.

(A) Immunoprecipitation demonstrates that Fyn interacts with Cdk5 in OPCs in the absence and presence of PDGF stimulation. The interaction appears increased after treatment with PDGF. (B) In differentiating oligodendrocytes, which are not migrating

(day 4 OPCs), Fyn association with CDK5 decreases dramatically. (C) Despite the reduction in Fyn association with Cdk5 in differentiating OPCs, Dab1 continues to interact with Cdk5 in differentiating OPCs (day 4). An equal amount of protein (100 ug) and antibody was used for every IP.

126

127

Figure 14. Summary: Fyn-Dab1-Cdk5 interactions may be important for oligodendrocyte cell migration and this is stimulated by PDGF.

Based on the data collected, it is proposed that downstream of PDGF, Dab1 forms a complex with Fyn and Cdk5 and that this complex is important for OPC migration.

128