A. Macaya1 L. Brunso2,3 N. Fernández-Castillo3 J. A. Arranz1 H. B. Ginjaar4 E. Cuenca-León1 Molybdenum Cofactor Deficiency Presenting as R. Corominas1 M. Roig1 Neonatal Hyperekplexia: A Clinical, Biochemical B. Cormand3 and Genetic Study hr Communication Short

Abstract Introduction

We report a newborn with exaggerated startle reactions and Molybdenum cofactor (MoCo) deficiency (MIM# 252150) is a stiffness of neonatal onset, the prototypical signs of hyperekplex- neonatal-onset neurological disorder with autosomal recessive ia. Startle and flexor spasms, leading to apnoea, did not respond inheritance and rapid, severe neurological deterioration. The to treatment with clonazepam but did partially to sodium val- usual phenotype consists of untreatable neonatal seizures and proate. Molecular analysis of GLRA1 revealed no mutations. The profound retardation in association with the biochemical find- incidental finding of hypouricemia led to a work-up for molybde- ings of hypouricemia, elevated xanthine in plasma and urine num cofactor (MoCo) deficiency; the diagnosis was confirmed by and elevated urine sulphites, particularly S-sulphocysteine. Most the altered urine chemistries, including elevated urine S-sulpho- patients do not survive the neonatal period. The deficiency of cysteine. Despite persistence of the spasms, clinical or electro- MoCo results in loss of activity of the molybdoenzymes sulphite graphic seizures were never detected before the infant died at oxidase, xanthine dehydrogenase and aldehyde oxidase, the neu- age 1 month. In this patient, the concurrence of hyperekplexia rological damage being attributed primarily to sulphite oxidase and MoCo deficiency was suggestive of impaired gephyrin func- deficiency. At least four different proteins are involved in the bio- tion. GPH mutational analysis, however, showed no abnormal- synthetic pathway of MoCo. Mutations in three of them, MOCS1, ities. The patient was eventually found to harbour a novel MOCS2 and GPH, have been identified in patients with MoCo de- c.1064T > C mutation in exon 8 of the MOCS1 gene. Despite exten- ficiency [29,30]. MOCS1, which encodes two peptides (MOCS1A sive sequence analysis of the gene, the second causative muta- and MOCS1B) that convert a guanine derivative into protein Z, 389 tion of this recessive trait still awaits identification. MoCo defi- and MOCS2, encoding the two subunits of molybdopterin syn- ciency should be considered in the differential diagnosis of neo- thase (MOCS2A and MOCS2B), are bicistronic genes. Each of natal hyperekplexia, particularly in the instances of refractori- them can produce two proteins either from different mRNAs ness to clonazepam, an early demise in infancy or the evidence generated by alternative splicing or by independent translation of no mutations in the GLRA1 gene. of a bicistronic mRNA [30]. GPH encodes gephyrin, a postsynaptic scaffolding protein that is also required for the insertion of mo- Key words lybdenum during cofactor assembly. Gephyrin is involved in

Startle · newborn · molybdenum · gephyrin clustering the inhibitory glycine and GABAA receptors at the postsynaptic membrane [6,13].

Affiliation 1 Grup de Recerca en Malalties Neurometabòliques, Hospital Universitari Vall d’Hebron, Barcelona, Spain 2 Servei de Psiquiatria, Hospital Universitari Vall d’Hebron, Barcelona, Spain 3 Departament de Genètica, Universitat de Barcelona, Barcelona, Spain 4 Center of Human and Clinical Genetics, Leiden University Medical Center, Leiden, The Netherlands

Correspondence Alfons Macaya M.D. · Secció Neurologia Infantil · Hospital Materno-infantil Vall d’Hebron · Passeig Vall d’Hebron 119 –129 · 08035 Barcelona · Spain · E-mail: [email protected]

Received: May4,2005·Accepted after Revision: September 7, 2005

Bibliography Neuropediatrics © Georg Thieme Verlag KG Stuttgart · New York · DOI 10.1055/s-2005-872877 · Published online November 24, 2005 · ISSN 0174-304X Abnormal, excessive startle to unexpected stimuli is the key fea- During the following days the patient remained alert but se- ture of hyperekplexia (MIM# 149 400, startle disease, STHE, Kok verely hypoactive and hypertonic, with flexed forearms and legs disease) [14,16, 36]. The neonatal – or major – variant of the dis- and generalised hyperreflexia. Slight stimuli or handling trig- order is characterised by accompanying episodes of acute gener- gered generalised tonic spasms with apnoea. Tapping the nasal alised flexion hypertonia, sometimes leading into apnoea, and a bridge or tip produced a generalised startle with prominent head strong head-retraction reflex upon nose tapping [1,32]. In addi- retraction that showed no habituation. Several EEG recordings, tion, many affected infants display continuous muscle rigidity, both ictal and interictal, were normal. A cranial ultrasonogram referred to in the past as the stiff baby syndrome [18,31]. Several was normal. A CSF analysis revealed normal glucose, proteins reports have alerted to the potentially fatal outcome of hyperek- and cell counts. Microbiological investigations were negative. plexia with neonatal onset [17,20,21,37]. Hyperekplexia is often EKG monitoring did not reveal a heart block. Initial metabolic a hereditary condition, more commonly autosomal dominant studies, including blood glucose, ammonia, acid-base status, lac- with complete penetrance and variable expression, although tate and pyruvate, revealed no abnormalities. cases with incomplete penetrance [15] or with autosomal reces- hr Communication Short sive inheritance [24] have been reported. Point mutations in the On day 3, phenobarbital was discontinued and clonazepam was GLRA1 gene, encoding the glycine receptor alpha1 subunit, have titrated up to 0.25 mg/kg/day, with a mild improvement of hy- been found in familial hyperekplexia [33,34]. A transient hyper- pertonia but persistence of startle reactions, both spontaneous ekplexia phenotype has been associated with compound hetero- and stimulus-induced. An occasional, severe attack, which pre- zygote mutations in the gene GLRB, encoding the beta subunit of vented even mechanical ventilation, was aborted by flexing the the glycine receptor [25]. The glycine transporter subtype 2, a patient toward the trunk, as described by Vigevano et al. [37]. presynaptic transporter located in glycinergic interneurons, has On day 8, a further attempt to control the symptoms by adding also been considered a candidate hyperekplexia gene, since sodium valproate, up to 30 mg/kg/day, resulted in a reduction of GlyT2-deficient mice display lethal neuromotor signs that mimic the number and intensity of the tonic spasms and startle reac- human startle disease [8]. In all these instances, as a result of al- tions and the emergence of some spontaneous movements, but tered glycine receptor function, the balance between excitatory the drug was discontinued later on, as the general status of the and inhibitory transmission in the brainstem and spinal cord is patient deteriorated. He developed a left inguinal hernia, that lost toward neuronal hyperexcitability. The molecular basis in a was operated on day 17. No dysmorphic features were ever substantial number of cases of sporadic and hereditary hyperek- noted. The patient’s clinical course was complicated by repeated plexia, however, remains unknown. bouts of atelectasia and pneumonia, which precluded weaning from mechanical ventilation, and by progressive deterioration We report the case of a neonate who presented at birth with the of renal glomerular and tubular function, with generalised oede- association of the classical hyperekplexia phenotype and the ma, proteinuria and hypoalbuminemia. A renal ultrasonogram characteristic biochemical findings of MoCo deficiency. The was normal. Towards the end of the first month he was coma- 390 unique phenotype of this patient hinted at a disturbed gephyrin tose, with profound hypotonia, absent spontaneous movements function; however, while the analysis of GPH coding sequence re- and very occasional episodes of hypertonia. Clinical or electro- vealed no mutations, he was found to harbour a novel mutation graphic seizures were never documented. From day 20 onwards, in exon 8 of the MOCS1 gene. the patient developed multiorgan failure that did not respond to intensive care and the patient died at age 40 days. Necropsy was not available. Patient and Methods Biochemical studies Case report Serum and urine urate were low at 23.8 μmol/L (normal 136.8 – This Caucasian male infant was born at 34 weeks gestation to 279.6) and 0.0095 mmol/day (normal 1.5 ± 0.3), respectively. healthy, non-consanguineous parents. The mother was a 37- Urine sulphite test was positive. Urine amino acid analysis year-old gravida 3 para 2, who had a normal pregnancy until showed increased taurine (676 μmol/mol creatinine; normal 8 – week 32 when she was admitted to the hospital because of pre- 226) and a peak compatible with sulphocysteine. Liquid chroma- mature labour, which was controlled with tocolysis. Foetal tography for urine purine and pyrimidine profile revealed eleva- movements had been felt as normal and amniocentesis had tion of xanthine (429.1 mmol/mol creatinine: normal < 68) and yielded a normal karyotype. Foetal parenchymal maturation normal hypoxanthine (11.5 mmol/mol creatinine; normal < 62). with steroids was started. A foetal ultrasonogram at 33 weeks These findings were consistent with the biochemical profile of detected moderate polyhydramnios and suggested macrosomy. molybdenum cofactor (MoCo) deficiency. Mass spectrometric At 34 weeks, amniorrhexis was followed by an uncomplicated analysis verified and quantitated S-sulphocysteine: 579 μmol/g vaginal delivery. Birth weight was 2700 g (90th percentile), creatinine; normal < 100 μmol/g creatinine (Dr. R. Stevens, Duke length 45 cm (50th percentile) and head circumference 34 cm University, Durham, NC) and thus confirmed the diagnosis of (97th percentile). Apgar scores at 1 and 5 min were 5 and 6, re- MoCo deficiency. Serum amino acids, lactate and pyruvate and spectively. Immediately after birth the infant developed general- urine organic acids were normal. ised jerks, rigidity and apnoeic spells, labelled initially as sei- zures and treated with phenobarbital and midazolam. He was in- Genetic studies tubated and transferred to the neonatal ICU. Family history was Genomic DNA isolation negative for symptoms associated with hyperekplexia or other Genomic DNA from the patient and his parents was isolated from neurological disorders. venous blood using the QIAamp DNA Blood Midi Kit (Qiagen, Hil-

Macaya A et al. Molybdenum Cofactor Deficiency … Neuropediatrics den, Germany). The samples were drawn in accordance with the Helsinki declaration. Table 1 Primers for PCR amplification of the MOCS1 gene exons and flanking intron sequences, product sizes, and PCR reaction Mutation analysis conditions The complete coding region and all the splice sites of the GPH (Gephyrin, MIM 603930), MOCS1 (Molybdenum Cofactor Syn- Exon Primer sequence Product Annealing DMSO thesis 1, MIM 603707) and MOCS2 (Molybdenum Cofactor Syn- (5′→3′) length temperature 5% (bp) (8C) thesis 2, MIM 603708) genes were PCR-amplified from the pa- tient’s genomic DNA. For MOCS1, 1859 bp preceding the MOCS1A 1a F – gactgcgtcctcgcctatt 339 51 yes initiation codon and 843 bp following the MOCS1B stop codon R – agctactgggggaaaaggg were also amplified in four segments. The PCR conditions used were the following: 50 ng genomic DNA, 1 U AmpliTaq Gold pol- 1bcd F – gctgaatacttaaggggt- 401 52 no gggtcc ymerase (Applied Biosystems, Branchburg, NJ, USA), 1 × recom- R – ttcaagggctgcttcagcagatgg mended buffer, 1.5 mM MgCl2, 200 μM dNTPs, 10 pmol of both Communication Short the forward and reverse primers in a final volume of 50 μL. The 2 F – ttggggagtggaggcat- 318 57 no cacggg amplification protocol was 94 8C for 10 min; 94 8C for 30 s, 51 – R – gttaacatcggcatcagtgtccag 608C for 45 s and 72 8C for 30 sec, for 35 cycles; and 72 8C for 2 min. For GLRA1 (Glycine Receptor Alpha 1 subunit, MIM 3 F – gagagcctcttttccatcca 388 55 no 138 491) analysis, genomic DNA was amplified by PCR with the R – cccagacaccaagaggaagt following parameters: 95 8C for 5 min, 35 cycles of 94 8C for 30 s, 4 F – tttgccaatctccagacta- 209 55 no gatgg 55 8C for 30 s, 72 8C for 30 s and a final extension for 5 min at 72 8C. The primer sequences used in the amplification of MOCS1, R – gtgtggagggaagtcgggaatct the PCR products length, and the particular PCR conditions used 5 F – ctgagtggaaggcctca- 303 55 no gtg for some of the fragments are indicated in Table 1. Some of the primer sequences are according to Reiss et al. [28], whereas the R – tgaggtcagccatacccagt rest were designed de novo to include longer intronic sequences. 6 F – aggggatggactcaaag- 254 55 no acc The primers for GPH and MOCS2 are available from the authors upon request. Most of the primer pairs were designed from ge- R – catcctagggtggaggtacg nomic sequences using the Primer3 program (frodo.wi.genome. 7 F – aggagtggaggttctgat- 261 55 no gtcatg mit.edu/cgi-bin/primer3/primer3_www.cgi). The GLRA1 pri- R – gaggagacatgagaacacagaggt mers are according to Shiang et al. [34]. The PCR fragments were column-purified using the GFX™ PCR DNA and Gel Band purifi- 8 F – tagctcctcagaggccagg 292 55 no R – ccctaggtgttccttggtca cation Kit (Amersham Biosciences, Little Chalfont, UK) or the 391 Qiaquick PCR purification kit (Qiagen, Hilden, Germany), se- 9 F – ccctgctttcctctccct 246 60 yes quenced with the BigDye Terminator Cycle Sequencing Kit v3.0 R – atcagcatgaaatgcaggag (Applied Biosystems, Warrington, UK), purified with Sephadex 10a F – gtatgaaagagaactt- 330 58 no G-50 (Amersham Biosciences, Molsheim, France) using Multi- gaggtggg Screen Plates (Millipore, Uppsala, Sweden) and run in an ABI R – ggcatctgagtctgcacggg PRISM 3730 DNA analyzer (Applied Biosystems, Foster City, CA, 10b F – atttttgatgttccccaattc 760 57 no USA). Sequence chromatograms were analysed with the Seq- R – gtgctaagcccgatggaagtc Man™II software (DNASTAR Inc., Madison, WI, USA). 10c F – agatccaggcatcttgc- 342 55 no cgg The sequence variant identified in the MOCS1 gene was num- R – caggcctgtttgttagtagt bered using GenBank NM_005943 as a reference sequence, with Prom-A F – cggccctgatgacactt- 875 55 no nucleotide 136 corresponding to + 1. The mutation c.1064T > C aat (p.Ile355Thr) in the MOCS1 gene was confirmed by restriction R – tcaaaccagcctgttgtatcc analysis of the exon 8 PCR product of the patient using the TspRI Prom-B F – ttccagccggtgttttattc 558 55 no enzyme (New England Biolabs, Ipswich, MA, USA), followed by R – tcacatcactcagtgcacca electrophoresis on a 2% agarose gel and ethidium bromide stain- Prom-C F – gggcacaactggagaag- 577 55 no ing. The mutation creates a restriction site, and the amplified tgt DNA, 292 bp in length, is cut in two fragments of 152 and 140 R – agcctgatacgagcggaac bp when the mutation is present. Control samples for the muta- 3′-UTR F – gcaatgtaggctgaggg- 797 55 no tion and the patient’s parents were screened using the same re- aaa striction protocol. R – tcttgcatctgcaaagttgg

Results

Complete sequencing of the GPH, MOCS1, MOCS2 and GLRA1 cod- 3′-untranslated regions revealed a novel putative disease-caus- ing sequences, all exon-intron boundaries and part of the 5′- and ing mutation in exon 8 of the MOCS1 gene of the patient (Fig. 1).

Macaya A et al. Molybdenum Cofactor Deficiency … Neuropediatrics hr Communication Short

Fig.1aand b Sequence and restriction analysis of a PCR product con- of a healthy control and the patient, which shows a C to T transition taining MOCS1 exon 8 in the patient and his parents. a On top, sche- leading to a isoleucine to threonine amino acid substitution at position matic representation of the MOCS1 gene, with the MOCS1A and 355 of the encoded protein. b Detection of the p.Ile355Thr mutation MOCS1B open reading frames. Exons are indicated by boxes and num- in the patient and his father, but not in the mother, by TspRI restriction bered at the top of the diagram. Introns are not drawn to scale, but analysis. ND = non-digested PCR product; D = digested product. their sizes in kb are indicated underneath. Below, sequence analysis

This exon belongs to the 5′ open reading frame (MOCS1A) of the tonia leading to apnoea and showed stiffness between these epi- gene, which produces a bicistronic mRNA with the potential to sodes. Presumably, as a consequence of the former, he also devel- produce two proteins (MOCS1A and MOCS1B). The mutation, in- oped an inguinal hernia. As in some previous reports, we found herited from the father, is a heterozygous T to C transition at po- the manoeuvre of forcefully flexing head and legs toward the sition 1064 of the cDNA starting from the A of the initiation co- trunk to be life-saving. The preceding clinical findings fit clearly don (c.1064T > C), causing a Ile to Thr amino acid substitution the ones previously described in cases of neonatal hyperekplexia 392 (p.Ile355Thr). The putative promoter region of the MOCS1 gene [22]. At variance with many reports on neonatal hyperekplexia, and the 3′-untranslated region were also sequenced in the pa- the clinical improvement after starting clonazepam was very tient, but no other mutation was identified in this gene or in any limited in our patient. A more notable improvement of the neu- other gene included in this study. rological symptoms was seen when sodium valproate was added, similarly to a single case report with adolescent-onset hyperek- plexia [4]. Both clonazepam and sodium valproate are GABAergic Discussion drugs and the efficacy in ameliorating pathological startle has been taken as indirect evidence of reduced GABA availability The patient we report expands the clinical phenotype of molyb- underlying deficient inhibitory transmission in hyperekplexia. denum cofactor deficiency by including hyperekplexia as a pos- Along this line, low CSF GABA has been found in several patients sible presenting sign. with hyperekplexia [2, 5,35]. However, the only molecular de- fects identified so far in hereditary hyperekplexia are mutations Hyperekplexia, usually a hereditary condition, is an exaggeration in the genes encoding the alpha and beta subunits of the inhibi- of the normal startle reaction, with brief, superimposed attacks tory glycine receptor [25, 33]. The most common of them, muta- of hypertonia. Marked stiffness is a common, additional feature tions in GLRA1 gene, were not found in our patient. It is, in fact, in affected infants with the major form of the disease [1,36]. In estimated that some 60% of the sporadic hyperekplexia cases familial cases, the clinical phenotype is variable and can be lim- are not linked to GLRA1 or GLRB mutations [26]. ited to occasional excessive startle and/or nocturnal myoclonus. Hyperekplexia can also occur in adults as a consequence of ac- The diagnosis of molybdenum cofactor deficiency was unex- quired lesions involving the rhomboencephalic reticular forma- pected in our patient. Although hypertonia, dystonia or myoclo- tion in the lower brainstem, most probably at the level of the nu- nus have been occasionally reported in MoCo deficiency [9], ex- cleus reticularis pontis caudalis [3,19]. Our patient, despite the aggerated startle and stiffness, to the degree seen in hyperek- preterm labour, did not show signs suggestive of intrapartum as- plexia, are not among the previously reported clinical signs in phyxia or neonatal hypoxic-ischemic encephalopathy and neuro- this condition. Moreover, the typical clinical sign of tonic-clonic imaging did not reveal abnormalities. The patient was alert and seizures was not present; neither were other typical signs, such seizures were not present either clinically or on the serial EEG’s. as dysmorphic facies, feeding troubles or lens subluxation [11]. Still, the patient needed immediate ventilation because slight Consequently, the diagnostic suspicion was not raised until low tactile or auditory stimuli elicited episodes of generalised hyper- serum uric acid was found during the second week of life. The

Macaya A et al. Molybdenum Cofactor Deficiency … Neuropediatrics progressive renal failure of our patient has not been noted in pre- pected recessive disease alleles was identified in the patient, vious patients with MoCo deficiency. Why MoCo deficiency merely suggesting MOCS1A deficiency. It is possible that muta- should produce exaggerated startle is not obvious. It is conceiv- tions in introns or distant regulatory regions affecting the tran- able that sulphite oxidase deficiency could mimic primary hy- script levels, or gross heterozygous genomic rearrangements, perekplexia because of a severe neuronal loss at either the corti- have remained undetected. Unfortunately, the limited availabil- cal or brainstem level, causing deranged inhibitory circuitry, ity of genomic DNA and RNA from the patient and his parents similarly to the proposed pathogenesis in the classical, seizure- makes it difficult to perform Southern or Northern blot analysis. prone phenotype. Unfortunately, neurochemical or pathological The mutation identified in our patient adds to the 16 changes data to prove or disprove this hypothesis are lacking and neuro- previously reported by others in the MOCS1 gene in patients with radiological findings were limited to cranial ultrasonograms in MoCo deficiency, the majority in the MOCS1A ORF. Interestingly, our patient, given his critical condition since birth. molecular alterations in MOCS1A account for approximately 50% of all MoCo deficiency cases [30], but had never been associated The combination of hyperekplexia and MoCo deficiency strongly with the hyperekplexia phenotype. suggested a disturbance in gephyrin function. Gephyrin is a key Communication Short protein in the organisation of inhibitory postsynaptic receptors Genetic heterogeneity may account for the diverse clinical in human CNS. Gephyrin knock-out mice display both deficient course in hyperekplexia. While some neonatal cases are de- MoCo biosynthesis and an abnormal motor behaviour reminis- scribed as relatively benign and reversible and show clear im- cent of human hyperekplexia [7]. A patient with MoCo defi- provement when clonazepam treatment is started, other follow ciency, but no clinical signs suggesting hyperekplexia, was found a relentlessly neurological deterioration or die suddenly in in- to harbour a deletion of exons 2 and 3 in the GPH gene [29]. De- fancy. It is possible that other drugs may prove to be effective in spite the negative mutational analysis in our patient, GPH still these cases; propofol has been shown to potentiate glycine re- appears as an adequate candidate gene for hereditary forms of ceptor responses in Xenopus oocytes and transgenic mice carry- hyperekplexia not linked to GLRA1 or GLRB mutations. Recently, ing “hyperekplexic” mutations in GLRA1 receptors [23]. in a series of 32 familial and sporadic cases of hyperekplexia, Rees et al. detected a single case with novel mutation causing Whatever its genetic basis, neonatal hyperekplexia can be a life- an N10Y substitution at the extreme N-terminus of gephyrin. threatening condition. MoCo deficiency should be considered in The patient developed a partially reversible hyperekplexia phe- the differential diagnosis of a neonate presenting with excessive notype with no associated signs of altered molybdenzyme activ- startle and a poor response to standard treatment. ity. However, functional analysis of this mutation showed that it did not disrupt targeting or clustering of glycine receptors [26]. Acknowledgements Mutations in the MOCS1 and MOCS2 genes have been identified in patients with MoCo deficiency [30], whereas mutations in Thanks are due to Jean L. Johnson, Ph.D. and Robert Stevens, 393 the GLRA1 gene are responsible for familial hyperekplexia Ph.D., for reviewing biochemical data and performing mass spec- [33,34]. An extensive mutational analysis of these three genes trometry quantitation of urine S-sulphocysteine. E. C. was sup- in our patient allowed the identification of a previously unde- ported by MCyT (Spain), R.C. and L.B. were supported by Institut scribed mutation in MOCS1, p.Ile355Thr. Several facts strongly Vall d’Hebron (Spain), and J.A.A. was supported by FIS (Rede- suggest that this change is indeed a disease-causing mutation. meth G03/054). First, it was not found in a screening of 150 control chromosomes from healthy Spanish individuals, nor in any public or private SNP database (Applera Genomics – www.celera.com, NCBI – References www.ncbi.nlm.nih.gov, the SNP Consortium – snp.cshl.org and ENSEMBL – www.ensembl.org) indicating that it is not a neutral 1 Andermann F, Keene DL, Andermann E, Quesney LF. Startle disease or polymorphism present in the general population. Second, amino hyperekplexia: further delineation of the syndrome. Brain 1980; 103: 985 – 997 acid Ile355 is a conserved residue in the MOCS1 protein of Homo 2 Berthier M, Bonneau D, Desbordes JM, Chevrel J, Oriot T, Jaeken J et al. sapiens (human), Mus musculus (mouse), Bos taurus (cow), Oryc- Possible involvement of a gamma-hydroxybutyric acid receptor in tolagus cuniculus (rabbit), Gallus gallus (chicken), Drosophila mel- startle disease. Acta Paediatr 1994; 83: 678– 680 3 anogaster (fruit fly), Caenorhabditis elegans (nematode), Mono- Brown P, Rothwell JC, Thompson PD, Britton TC, Day BL, Marsden CD. The hyperekplexias and their relationship to the normal startle reflex. delphis domestica (South American opossum) and many plant Brain 1991; 114: 1903 – 1928 and bacteria species, indicating functional/structural relevance 4 Dooley JM, Andermann F. Startle disease or hyperekplexia: Adoles- [10,27]. And third, this substitution causes a change from a non- cent onset and response to valproate. Pediatr Neurol 1989; 5: 126 – polar to a polar amino acid residue. Furthermore, when the sec- 127 5 Dubowitz LMS, Bouza H, Hird MF, Jaeken J. Low cerebrospinal fluid ondary structures for the normal and mutant proteins are pre- concentration of free gamma-aminobutyric acid in startle disease. dicted using the NNPREDICT software [12], substantial modifica- Lancet 1992; 340: 80– 81 tions are clearly shown, as the mutation disrupts a predicted α 6 Essrich C, Lorez M, Benson JA, Fritschy JM, Luscher B. Postsynaptic helix. However, further functional characterisation of the mutant clustering of major GABA(A) receptor subtypes requires the gamma- 2 subunit and gephyrin. Nature Neurosci 1998; 1: 563– 571 allele will be needed to confirm these assumptions. Although we 7 Feng G, Tintrup H, Kirsch J, Nichol MC, Kuhse J, Betz H et al. Dual re- have sequenced all the coding region of the MOCS1 gene, the quirement for gephyrin in glycine receptor clustering and molyb- splice sites, the putative promoter and the 3′-untranslated re- doenzyme activity. Science 1998; 282: 1321 –1324 gion, including the polyadenylation signal, only one of two ex-

Macaya A et al. Molybdenum Cofactor Deficiency … Neuropediatrics 8 Gomeza J, Ohno K, Hulsmann S, Armsen W, Eulenburg V, Richter DW unit of the inhibitory glycine receptor in hyperekplexia. Hum Genet et al. Deletion of the mouse glycine transporter 2 results in a hyper- 2001; 109: 267– 270 ekplexia phenotype and postnatal lethality. Neuron 2003; 40: 797 – 25 Rees MI, Lewis TM, Kwok JBJ, Mortier GR, Govaert P, Snell RG et al. Hy- 806 perekplexia associated with compound heterozygote mutations in 9 Graf WD, Oleinik OE, Jack RM, Weiss AH, Johnson JL. Ahomocysteine- the beta-subunit of the human inhibitory glycine receptor (GLRB). mia in molybdenum cofactor deficiency. Neurology 1998; 51: 668 – Hum Molec Genet 2002; 11: 853 –860 670 26 Rees MI, Harvey K, Ward H et al. Isoform heterogeneity of the human 10 Gray TA, Nicholls RD. Diverse splicing mechanisms fuse the evolu- gephyrin gene (GPHN), binding domains to the glycine receptor and tionarily conserved bicistronic MOCS1A and MOCS1B open reading mutation analysis in hyperekplexia. J Biol Chem 2003; 278: 24688 – frames. RNA 2000; 6: 928 – 936 24696 11 Johnson JL, Wadman SK. Molybdenum cofactor deficiency. In: Scriver 27 Reiss J, Cohen N, Dorche C, Mandel H, Mendel RR, Stallmeyer B et al. CR, Beaudet AL, Sly WS, Valle D (eds). The metabolic basis of inherited Mutations in a polycistronic nuclear gene associated with molybde- disease. 6th edn. New York: McGraw-Hill, 1989: 1463 num cofactor deficiency. Nat Genet 1998; 20: 51 –53 12 Kneller DG, Cohen FE, Langridge R. Improvements in protein secon- 28 Reiss J, Christensen E, Kurlemann G, Zabot MT, Dorche C. Genomic dary structure prediction by an enhanced neural network. J Mol Biol structure and mutational spectrum of the bicistronic MOCS1 gene de- 1990; 214: 171 – 182 fective in molybdenum cofactor deficiency type A. Hum Genet 1998; 13 hr Communication Short Kirsch J, Wolters I, Triller A, Betz H. Gephyrin antisense oligonucleo- 103: 639 – 644 tides prevent glycine receptor clustering in spinal neurons. Nature 29 Reiss J, Gross-Hardt S, Christensen E, Schmidt P, Mendel RR. Schwarz 1993; 366: 745 – 748 G. A mutation in the gene for the neurotransmitter receptor-cluster- 14 Kirstein L, Silfverskiold BP. A family with emotionally precipitated ing protein gephyrin causes a novel form of molybdenum cofactor de- “drop seizures”. Acta Psychiatr Neurol Scand 1958; 33: 471 – 476 ficiency. Am J Hum Genet 2001; 68: 208 –213 15 Kwok JB, Raskin S, Morgan G, Antoniuk SA, Bruk I, Schofield PR. Muta- 30 Reiss J, Johnson JL. Mutations in the molybdenum cofactor biosyn- tions in the glycine receptor alpha1 subunit (GLRA1) gene in heredi- thetic genes MOCS1, MOCS2 and GEPH. Hum Mutat 2003; 21: 569 – tary hyperekplexia pedigrees: evidence for non-penetrance of muta- 576 tion Y279C. J Med Genet 2001; 38: E17 31 Sander JE, Layzer RB, Goldsobel AB. Congenital stiff-man syndrome. 16 Kok O, Bruyn GW. An unidentified hereditary disease. Lancet 1962; 1: Ann Neurol 1980; 8: 195 – 197 1359 32 Shahar E, Brand N, Uziel Y, Barak Y. Nose tapping test inducing a gen- 17 Kurczinsky T. Hyperekplexia. Arch Neurol 1983; 40: 246 –248 eralized flexor spasm. A hallmark for hyperekplexia. Acta Paediatr 18 Lingam S, Wilson J, Hart EW. Hereditary stiff-baby syndrome. Am J Dis Scand 1991; 80: 1073 –1077 Child 1981; 135: 909 – 911 33 Shiang R, Ryan SG, Zhu Y, Hahn AF, O’Connell P, Wasmuth JJ. Muta- 19 Matsumoto J, Fuhr P, Nigro M, Hallett M. Physiological abnormalities tions in the α1 subunit of the inhibitory glycine receptor cause the in hereditary hyperekplexia. Ann Neurol 1992; 32: 41– 50 dominant neurologic disorder, hyperekplexia. Nat Genet 1993; 5: 20 McAbee GN, Kadakia SK, Sisley KC, Delfiner JS. Complete heart block 351–357 in nonfamilial hyperekplexia. Pediatr Neurol 1995; 12: 149 – 151 34 Shiang R, Ryan SG, Zhu YZ, Fielder TJ, Allen RJ, Fryer A et al. Mutational 21 Nigro MA, Lim HCN. Hyperekplexia and sudden neonatal death. Pe- analysis of familial and sporadic hyperekplexia. Ann Neurol 1995; 38: diatr Neurol 1992; 8: 221 – 225 85 – 91 22 Praveen V, Patole SK, Whitehall JS. Hyperekplexia in neonates. Post- 35 Stephenson JBP. Vigabatrin for startle disease with altered cerebrospi- grad Med J 2001; 77: 570– 572 nal fluid free gamma-aminobutyric acid in startle disease. Lancet 23 O’Shea SM, Becker L, Weiher H, Betz H, Laube B. Propofol restores the 1992; 340: 81 – 82 function of “hyperekplexic” mutant glycine receptors in Xenopus oo- 36 Suhren O, Bruyn GW, Tuyman JA. Hyperekplexia a hereditary startle 394 cytes and mice. J Neurosci 2004; 24: 2322 –2327 syndrome. J Neurol Sci 1966; 3: 577 –605 24 Rees MI, Lewis TM, Vafa B, Ferrie C, Corry P, Muntoni F et al. Com- 37 Vigevano F, Di Capua M, Dalla Bernardina B. Startle disease: an avoid- pound heterozygosity and nonsense mutations in the alpha(1)-sub- able cause of sudden infant death. Lancet 1989; 1: 216

Macaya A et al. Molybdenum Cofactor Deficiency … Neuropediatrics