Transport Mechanisms for the Nutritional Supplement Β-Hydroxy-Β-Methylbutyrate (HMB) in Mammalian Cells

Pharm Res (2019) 36: 84 https://doi.org/10.1007/s11095-019-2626-3

RESEARCH PAPER

Transport Mechanisms for the Nutritional Supplement β-Hydroxy-β-Methylbutyrate (HMB) in Mammalian Cells

Jiro Ogura1 & Toshihiro Sato 1 & Kei Higuchi 1 & Yangzom D. Bhutia1 & Ellappan Babu 1 & Masayuki Masuda2 & Seiji Miyauchi2 & Ricardo Rueda3 & Suzette L. Pereira4 & Vadivel Ganapathy1

Received: 12 February 2019 /Accepted: 8 April 2019 /Published online: 17 April 2019 # Springer Science+Business Media, LLC, part of Springer Nature 2019

ABSTRACT transports HMB, but in a Na+-coupled manner. Other, yet Purpose β-Hydroxy-β-methylbutyrate (HMB), a nutritional unidentified, transporters mediate the major portion of HMB supplement, elicits anabolic activity in muscle. Here we inves- uptake in C2C12 and MCF7 cells. tigated the mechanism of HMB uptake in muscle cells. Methods Murine muscle cells (C2C12) and human mamma- KEY WORDS H+-coupled transport . MCT1 (SLC16A1) . ry epithelial cells (MCF7) were used for uptake. As HMB is a MCT4(SLC16A3) .Na+-coupledtransport .Skeletalmusclecell . monocarboxylate, focus was on monocarboxylate trans- SMCT1 (SLC5A8) porters, monitoring interaction of HMB with H+-coupled lactate uptake, and influence of H+ directly on HMB uptake. Involvement of MCT1–4 was studied using selective inhibi- ABBREVIATIONS tors and gene silencing. Involvement of human Na+/mono- AIDS Acquired immune deficiency syndrome carboxylate transporter SMCT1 was also assessed using HMB β-Hydroxy-β-methylbutyrate Xenopus oocytes. HPRT Hypoxanthine/guanine phosphoribosyl transferase + Results H -coupled lactate uptake was inhibited by HMB in KIC α-ketoisocaproate + both mammalian cells. HMB uptake was H -coupled and MCTs H+-Coupled monocarboxylate transporters inhibited by lactate. C2C12 cells expressed MCT1 and OATPs Organic anion transporting polypeptides MCT4; MCF7 cells expressed MCT1–4; undifferentiated OATs Organic anion transporters + C2C12 cells expressed SMCT1. SMCT1 mediated Na - PAH Para-aminohippurate coupled HMB transport. Inhibitors of MCT1/4, siRNA- SLC Solute carrier family mediated gene silencing, and expression pattern showed that SMCTs Na+-coupled monocarboxylate transporters MCT1–4 were responsible only for a small portion of HMB uptake in these cells. Conclusion HMB uptake in C2C12 and MCF7 cells is pri- INTRODUCTION marily H+-coupled and inhibited by lactate, but MCT1–4are − only partly responsible for HMB uptake. SMCT1 also β-Hydroxy-β-methylbutyrate [CH3C(OH)(CH3)CH2COO ]; HMB] is a natural metabolite of the branched chain amino * Vadivel Ganapathy acid leucine (1), produced in small amounts in the body by a [email protected] two-step process starting with the transamination of leucine to α-ketoisocaproate (KIC), followed by conversion of a fraction of 1 Department of Cell Biology and Biochemistry, Texas Tech University the produced KIC to HMB catalyzed by a KIC-dioxygenase Health Sciences Center, 3601 4th Street, Lubbock, TX 79430-6540, (2,3). Studies in animals and humans have demonstrated ben- USA efits of HMB in promoting skeletal muscle anabolism and at- 2 Department of Pharmaceutics, Toho University, Funabashi, tenuating muscle catabolism [Reviewed in Ref. 4–6]. Studies in Chiba 274-8510, Japan young exercising athletes have shown benefits of supplementing 3 Abbott Nutrition, Research & Development, 18004 Granada, Spain HMB with exercise to enhance muscle mass and strength 4 Abbott Nutrition, Research & Development, Columbus, OH 43219, [Reviewed in Ref. 7]. Several animal studies have reported USA on the beneficial effects of HMB in preserving muscle during 84 Page 2 of 14 Pharm Res (2019) 36: 84 catabolic conditions, including cancer cachexia (8), sepsis (9), Aldrich. The MCT1-specific inhibitor SR13800 (2,6-dihydro- immobilization (10), and response to steroids (11). These results 7-[(3-hydroxypropyl)thio]-2-methyl-4-(2-methylpropyl)-6-(1- have been supported by human studies that have demonstrated naphthalenylmethyl)-1H-pyrrolo[3,4-d]pyridazin-1-one) was ob- the benefit of HMB in preserving muscle mass during cancer tained from EMD Millipore Calbiochem (Billerica, MA, USA). cachexia (12), AIDS-related cachexia (13), extended immobili- Cell culture media were from Corning Cellgro (Manassas, VA, zation (14,15), and aging-related muscle loss, even in the ab- USA) and fetal bovine serum was from Atlanta Biologicals senceofexercise(16–18). (Norcross, GA, USA). L-[14C(U)]-Lactate (sodium salt) (specific HMB has a direct effect on muscle cells and modulates vari- radioactivity, 150 mCi/mmol) was purchased from Perkin Elmer ous metabolic pathways in the muscle. This has been demon- (Waltham, MA, USA). [1-14C]- β-Hydroxy-β-methylbutyrate strated in vitro using C2C12 myotubules, as well as in in vivo feed- (sodium salt) (American Radiolabeled Company, St. Louis, ing studies followed by analysis of muscle tissue. HMB has been MO, USA). MCT1 rabbit monoclonal antibody (ab179832) shown to downregulate pathways involved in muscle catabolism was obtained from Abcam (Cambridge, MA, USA). MCT1 rab- such as the ubiquitin-proteasomal degradation pathway (19)and bit polyclonal antibody (PA5–76687) was obtained from the autophagy pathway (20), and to upregulate pathways in- Thermo Fisher Scientific (Waltham, MA, USA). MCT4 rabbit volved in muscle anabolism via activation of mTOR (21,22) polyclonal antibody (LS-C406788) was obtained from LifeSpan and pathways involved in muscle regeneration and repair (23). BioSciences, Inc. (Seattle, WA, USA). β-Actin mouse antibody Upon intake of HMB as a supplement, plasma concentrations (C4) (sc-47,778) was obtained from Santa Cruz Biotechnology, have been shown to reach high micromolar levels in humans (7). Inc. (Dallas, TX, USA). Even though the exact site of action of HMB in muscle cells has not been identified, the plethora of biologic effects of HMB Analysis of SMCT1-Mediated HMB Transport in X. laevis coupled with its chemical nature as a monocarboxylate suggest at Oocytes least some involvement of intracellular actions of HMB in muscle cells. Despite all the existingdataontheeffectsofHMBon We expressed human SMCT1 (SLC5A8) heterologously in muscle, a big gap in our understanding of this molecule is the X. laevis oocytes by cRNA injection and used the oocytes for mechanism by which HMB enters the muscle cell to mediate its electrophysiology 4–5 days following the injection. For this, we effects. HMB, a monocarboxylate with a pKa value of 4.4, is used the oocyte expression plasmid pGH19 with human expected to exist almost entirely in deprotonated form. SLC5A8 cDNA as the insert. The structural features of the Therefore, facilitated transport rather than simple diffusion is cDNA insert are described in our previous publication (27). likely responsible for cellular entry of HMB. The goal of our The transport activity of SMCT1 was monitored in these oo- current study was to identify the transporters responsible for cytes using a two-microelectrode voltage-clamp technique (27). cellular uptake of HMB in muscle tissue. The membrane potential was clamped at −50 mV. Water- Because HMB is a monocarboxylate, we speculated involve- injected oocytes were used as negative controls. In SMCT1- ment of monocarboxylate transporters in the uptake of HMB expressing oocytes, the short-chain fatty acid butyrate was used into muscle cells. There are two well-known classes of trans- the positive control (27). The substrate-induced inward currents porters involved in the cellular uptake of various were used as a measure of SMCT1 transport activity. The monocarboxylates. These include H+-coupled monocarboxyl- ability of SMCT1 to transport HMB was monitored by exam- ate transporters (MCTs) and Na+-coupled monocarboxylate iningifexposureofSMCT1-expressingoocytestoHMBresult- transporters (SMCTs) (24–26). Here we examined the ability ed in an inward current. The relative affinities of SMCT1 for of the Na+-coupled, electrogenic, monocarboxylate transporter butyrate and HMB were determined using the substrate con- SMCT1 (SLC5A8) and the H+-coupled, electroneutral mono- centration versus the substrate-induced current relationship. carboxylate transporters MCT1 and MCT4 to transport HMB Michaelis-Menten equation describing a single saturable trans- in skeletal muscle cells. As MCT1 and MCT4 are known to be port system was used to calculate the kinetic constants for the expressed and play a critical role in tumor cells (24), we used the transport process. As the expression levels for SMCT1 varied human breast cancer cell line MCF7 as a control to evaluate the from oocyte to oocyte, the substrate-induced currents were nor- involvement of these two transporters in HMB uptake. malized by taking the maximum current induced by the substrate as 1 in each oocyte. The experiments were repeated at least with 5 different oocytes from at least two different animals. MATERIALS AND METHODS The composition of the oocyte-perfusion buffer for the analysis of substrate-induced currents was: 3 mM HEPES/3 mM Materials MES/3 mM Tris (pH 7.5), 100 mM NaCl, 2 mM KCl, + 1mMMgCl2,and1mMCaCl2.ForNa -free buffer, NaCl L-Lactate (sodium salt), butyrate (sodium salt), β-hydroxy-β- in the buffer was substituted iso-osmotically with N-methyl-D- methylbutyric acid (free acid), were purchased from Sigma glucamine chloride. Pharm Res (2019) 36: 84 Page 3 of 14 84

Cell Lines and Culture Conditions kit (Thermo Fisher Scientific) with bovine serum albumin as a standard. Fifteen micrograms of protein were subjected to Uptake studies were performed with two cell lines, the human sodium dodecyl sulphate polyacrylamide gel electrophoresis breast cancer cell line MCF7 and the mouse skeletal muscle (SDS-PAGE) and then transferred to polyvinylidene fluoride cell line C2C12. Both cell lines were purchased from the (PVDF) membranes (Bio-Rad Laboratories, Hercules, CA, American Type Culture Collection (ATCC, Manassas, VA, USA). Blots were blocked by 5% skim milk in tris-buffered USA). MCF7 cells (Cat. No. ATCC HTB-22) are epithelial- saline (20 mM Tris, 137 mM NaCl, pH 7.6) containing like and grow as adherent monolayers in plastic culture dishes. 0.1% Tween 20 (TBS-T) at room temperature for 3 h, and The cells were cultured in Dulbecco’s Minimum Essential then probed with anti-MCT1 antibody (1:1000 dilution) Medium (DMEM), supplemented with fetal bovine serum at (ab179832 and PA5–76687), anti-MCT4 antibody (1:200 di- a final concentration of 10%, and antibiotics (penicillin, lution) (LS-C406788) or anti-beta-Actin antibody (1:2000 di- 100 mU/ml; streptomycin, 100 μg/ml). This cell line is used lution) (sc-47,778) at 4°C for 3 h. The blots were washed and widely as a model for estrogen receptor-positive breast cancer. then incubated with goat anti-rabbit or anti-mouse immuno- C2C12 cells (Cat. No. ATCC CRL-1772) are used widely as a globulin G (IgG) conjugated with horseradish peroxidase model for skeletal muscle cells; these cells also grow as adher- (1:2000 dilution, Bio-Rad Laboratories). Pierce™ ECL ent monolayers. The cells were cultured in DMEM supple- Western Blotting Substrate (Thermo Fisher Scientific) was mented with fetal bovine serum at a final concentration of used for detection. 10% and 100 mU/ml penicillin and 100 μg/ml streptomycin. If undifferentiated, the cells exhibit the phenotype of myo- siRNA Transfection blasts. To induce differentiation of these myoblasts into myotubes, the cells were seeded in 24-well culture plates in MCF7 cells were seeded in 24-well cell culture plates at Dulbecco’s Minimum Essential Medium containing 10% fetal a density of 1.5 × 105 cells/well with antibiotics-free bovine serum and antibiotics. Approximately 24 h post DMEM. Transfection of siRNAs was performed using seeding (80–85% confluence), the culture medium was re- Lipofectamine 2000 (Thermo Fisher Scientific) 24 h af- placed with DMEM containing horse serum at a final concen- ter seeding. MCT1 siRNAs (Silencer select siRNA, tration of 2% and antibiotics. This medium was replaced fresh s579), MCT4 siRNAs (Silencer select siRNA, s17417) every 2 days for a week. Within 6–7 days, the differentiation and negative control (Silencer select Negative control was complete. siRNA) were obtained from Thermo Fisher Scientific. Each siRNA diluted in Opti-MEM I Reduced Serum RT-PCR medium and Lipofectamine 2000 were mixed gently and incubated at room temperature for 20 min. These Total RNA was isolated from the cultured cells using TRIzol mixtures were added to each well. The cells were incu-

Reagent (Thermo Fisher Scientific, Waltham, MA), and bated for 48 h at 37°C under 5% CO2 andthenused cDNA was prepared from total RNA using High-capacity for experiments. cDNA reverse transcription kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. PCR was performed Uptake Measurements with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) using 60 ng of cDNA. Quantitative-PCR was Measurements of L-lactate uptake and HMB uptake were performedwithPowerSYBRGreenPCRmastermix made using monolayers of cultured cells in 24-well culture (Thermo Fisher Scientific) using 20 ng of cDNA. Primer se- plates. In the case of the muscle cell line C2C12, the undiffer- quences are shown in the supporting information (Table I). entiated as well as differentiated cells were used. On the day of Amplification and detection for Quantitative-PCR were car- uptake measurement, the culture plates were kept in a water ried out on an Applied Biosystems 7500 Real-Time PCR bath at 37°C. The medium was aspirated and the uptake System (Thermo Fisher Scientific). The relative mRNA ex- medium (250 μL) containing radiolabeled L-lactate or ΔΔ pression was determined by the 2- Ct method. HPRT was radiolabeled HMB was added to the cells. Following incuba- used as a housekeeping gene to normalize the relative expres- tion for indicated time periods, the medium was removed by sion level in samples. aspiration and the cells washed three times with ice-cold uptake buffer. The cells were then lysed in 1% sodium dodecyl Western Blotting sulfate/0.2 N NaOH and used for measurement of radioactivity. Three different uptake buffers were used depending on Cells were lysed in radioimmunoprecipitation assay (RIPA) the experiments. The involvement of SMCT1 was evaluated buffer (Cell Signaling, Danvers, MA). The protein content of by the impact of Na+ on the uptake and the determination of the solubilized cells was determined by the BCA protein assay Na+-coupled uptake activity. This was done by measuring 84 Page 4 of 14 Pharm Res (2019) 36: 84

Ta b l e I Primer Sequences used for RT-PCR Species Protein Name Gene Name Orientation Sequence

Human MCT1 SLC16A1 Forward GGTGGAGGTCCTATCAGCAG Reverse TCAAGTTGAAGGCAAGCCCA MCT2 SLC16A7 Forward GCCCAAAGAAAATCAAAACG Reverse AATCCACCAATTTACCTGCAA MCT3 SLC16A8 Forward CTGCTGCCTGCGTTGTGCTAA Reverse AGACCAGCCTCCCAGCGTACC MCT4 SLC16A3 Forward ATCCTGGGCTTCATTGACAT Reverse CTTCAGGAAATGCTCCACCT SMCT1 SLC5A8 Forward CGTCTCTGTGGAACAGTCCT Reverse TAAGACCACCCAGTGTGCAG Mouse Mct1 Slc16a1 Forward ATTCAGTGCAACGACCAGTG Reverse CCAAGACCTCCAATAACACCA Mct2 Slc16a7 Forward ATGTATGCGGGAGGTCCCAT Reverse GGCTGGTTGCAGGTTGAATG Mct3 Slc16a8 Forward TTCTTCCGAGAGCTCAAGCG Reverse GGAAGTTGAGAGCTAGGCCC Mct4 Slc16a3 Forward CGGTCAGCGTCTTTTTCAAGG Reverse CAGAGCGGTCCTGTGCCATA Smct1 Slc5a8 Forward CGTCTCTGTGGCACAATCCT Reverse TGCTTTAAGACCGCCCAGTG Human/Mouse HPRT Forward GCGTCGTGATTAGCGATGATGAAC Reverse CCTCCCATCTCCTTCATGACATCT

uptake in two different buffers, both at pH 7.5. The Na+- In contrast, the concentration of OATP inhibitors containing buffer consisted of 25 mM Hepes/Tris (pH 7.5), (taurocholate, estrone-3-sulfate) was set to 0.1 mM because

140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2,0.8mM these compounds show relatively higher affinity for OATPs. + MgSO4, and 5 mM D-glucose; the Na -free buffer consisted of the same components except for the equimolar replacement of NaCl with N-methyl-D-glucamine chloride. The difference Statistics in uptake between the two buffers yielded Na+-dependent uptake, which was taken as a measure of SMCT1-mediated For electrophysiological studies, each experiment was uptake activity. The involvement of MCTs was evaluated by repeated at least with five oocytes from two different the impact of a transmembrane H+ gradient on the uptake. frogs. For kinetic analyses of the data from electrophys- This was done by measuring uptake in two different buffers, iological experiments, the inward current induced in in- pH 7.5 or pH 6.0, both without NaCl. The buffers contained dividual oocyte in the presence of maximal concentra- 140 mM N-methyl-D-glucamine chloride, 5.4 mM KCl, tion of the substrate (butyrate or HMB) was taken as 1

1.8 mM CaCl2, 0.8 mM MgSO4, and 5 mM D-glucose; the and the currents induced at lower concentrations was pH was kept at 7.5 using 25 mM HEPES/Tris or at 6.0 using taken as a fraction of this normalized maximal current. 25 mM MES/Tris. The kinetic parameters of the uptake pro- This was necessary because the levels of the cRNA- cess were determined using the substrate concentration versus induced expression of human SMCT1 varied from oo- the uptake rate relationship according to the Michaelis- cyte to oocyte. For experiments with cultured cells, up- Menten equation describing a single saturable transport sys- take measurements were made always in triplicate and tem. In inhibition studies, HMB and lactate were used as the experiments were repeated twice with separate cul- positive control at 10 mM based on their known affinities for tures. In all cases, data are expressed as means ± S. D. MCTs described in the present study and in other published Statistical differences between control groups and exper- reports. The concentration of MCT and/or OAT inhibitors imental groups were analyzed by unpaired Student’st (probenecid, PAH, benzoic acid, 2,5-dihydroxybenzoic acid, test or by one-way analysis of variance (ANOVA) 2,3-dihydroxybenzoic acid) were set to 2.5 mM because these followed by Dunnett’s test for single and multiple com- compounds interact with MCTs and OATs with low affinity. parisons; a p < 0.05 was considered significant. Pharm Res (2019) 36: 84 Page 5 of 14 84

RESULTS we expressed human SMCT1 in X. laevis oocytes and then used the oocytes for electrophysiological studies. Butyrate Expression of Monocarboxylate Transporters in MCF7 was used as a prototypical transportable substrate for Cells and C2C12 Cells SMCT1 (positive control). As SMCT1 operates at neutral pH and its transport function is coupled to the co-transport Using RNA isolated from MCF7 cells and C2C12 cells (un- of Na+, the experiments were done at pH 7.5 (Hepes/Tris differentiated and differentiated), RT-PCR was carried out to buffer) in the presence of NaCl. Using this experimental ap- monitor the expression of the monocarboxylate transporters proach, we first compared the abilities of an equal concentra- for which there is unequivocal evidence for the transport of tion (2 mM) of butyrate and HMB to induce currents in the monocarboxylate lactate. Thus far, six transporters have SMCT1-expressing oocytes with the membrane potential been shown to transport lactate: four in the SLC16 gene fam- clamped at −50 mV (Fig. 2a). Butyrate as a positive control ily (MCT1, MCT2, MCT3, MCT4) and two in the SLC5 induced inward currents. HMB also induced significant cur- gene family (SMCT1 and SMCT2) (24–26). Among these, rents just like butyrate except that the magnitude of the cur- MCT2 is predominantly expressed in the brain while rents induced by 2 mM HMB was approximately one-third of MCT3 is restricted solely to the retinal pigment epithelial cells that seen with 2 mM butyrate. We then compared the kinetics in the retina (24). SMCT2 exhibits extremely low affinity for of transport between butyrate and HMB by analyzing the lactate and hence its physiological role as a monocarboxylate relationship between the concentration of the substrate and transporter remains questionable (28,29). Therefore, we ex- the magnitude of the induced currents with membrane poten- amined the expression of MCT1, MCT2, MCT3, MCT4, tial clamped at −50 mV. Both compounds showed saturable and SMCT1 in MCF7 cells and C2C12 cells. In MCF7 cells, kinetics (Fig. 2b for HMB and Fig. 2c for butyrate). With these the expression of MCT1–4 was evident at the mRNA level data, we determined the affinities of the two compounds for (Fig. 1a) and MCT1 at the protein level (Fig. 1d). The muscle the transporter using the Michaelis-Menten equation. The cell line C2C12 expressed only MCT1 and MCT4, evident Michaelis constant (Kt) values, a measure of the affinity, for both at the mRNA level (Fig. 1c) and the protein level (Fig. HMB and butyrate were 2.6 ± 0.2 mM and 0.09 ± 0.01 mM, 1d). C2C12 cells were used both before (myoblast stage) and respectively. after differentiation (myotubule stage) (Fig. 1b); the expression We then compared the influence of membrane potential pattern of MCTs remained almost unaltered upon differenti- on substrate-induced currents between butyrate and HMB. ation of these cells (Fig. 1c and d). SMCT1 was not expressed The data for the experiment are given in Fig. 3. (A, HMB; in MCF7 cells. It was expressed in C2C12 cells, and the ex- B, butyrate). For both compounds, the induced currents pression seemed to decrease upon differentiation. HepG2 cell showed dependence on the membrane potential; when the line was used as another positive control for human cancer membrane potential was varied from a positive value to more cells (Fig. 1d). Among the two antibodies used for MCT1, the negative values, the substrate-induced currents increased in monoclonal antibody (MCT1 mAb) is human-specific; hence magnitude. This was evident at every concentration of the it detected MCT1 protein in MCF7 and HepG2 cells. In substrate used in the experiment. We also assessed the role contrast, the polyclonal antibody (MCT1 pAb) is not species of Na+ in the transport of HMB via SMCT1 by monitoring selective; hence it detected MCT1 protein in the human cell the HMB-induced currents in SMCT1-expressing oocytes lines MCF7 and HepG2 as well as in the murine cell line both in the presence and absence of Na+ (data not shown). C2C12 (Fig. 1d). First, the oocytes were perfused with ND96 buffer, which was the oocyte-maintenance buffer that contained NaCl, and then Characterization of HMB Transport Via with a normal uptake buffer that also contained NaCl. Then, the Na+-Coupled Monocarboxylate Transporter the oocytes were exposed to 2 mM HMB in the same NaCl- SMCT1 containing buffer. HMB induced currents as we saw in previous experiments. Upon removal of HMB and change of the SMCT1 is a Na+-coupled transporter for several buffer to a Na+-free buffer), the currents come back to the monocarboxylates such as lactate, butyrate, etc. The transport baseline. We then exposed the same oocytes to 2 mM HMB process is electrogenic, meaning that the transport is associat- in the same Na+-free buffer, and found HMB did not induce ed with membrane depolarization that can be detected elec- any detectable currents. trophysiologically using a two-microelectrode voltage-clamp technique in frog oocytes following heterologous expression Interaction of HMB with Lactate Transport System of the transporter. This methodallowsdirectanalysisof in MCF7 Cells SMCT1-mediated transport using unlabeled substrates. Therefore, we should be able to determine if HMB, a mono- To assess the involvement of MCTs, we used MCF7 cells, carboxylate, is a transportable substrate for SMCT1. For this, which express MCT1 and MCT4 (Fig. 1). The transport 84 Page 6 of 14 Pharm Res (2019) 36: 84

Fig. 1 Expression of monocarboxylate transporters in MCF7 cells and in C2C12 cells before and after differentiation. a RT-PCR analysis of mRNAs for various monocarboxylate transporters in MCF7 cells using human-specific primers. b Morphology of C2C12 cells before and after differentiation. c RT-PCR analysis of mRNAs for various monocarboxylate transporters in C2C12 using mouse-specific primers. d Immunoblotting of MCF7 and C2C12 cell lysates before and after differentiation against anti-MCT1 and MCT4 antibodies. HepG2 cell lysate was used as positive control. The band at 54 kDa for MCT1, 45 kDa for MCT4 and 42 kDa for beta-Actin are shown.

activity of MCTs was monitored by the uptake of radiolabeled parameters, the Michaelis constant (Kt) and the maximal ve- + lactate. As these transporters function in a H -coupled manner, locity (Vmax), were determined from the data using the the uptake measurements were made in the absence of Na+ but Michaelis-Menten equation, and the results were confirmed in the presence of an acidic pH (pH 6.0). First, we compared the by the transformation of the data to the Eadie-Hofstee plot. In potencies of unlabeled lactate and HMB to inhibit the uptake of the absence of HMB, the values for Kt and Vmax were 1.7 ± [14C]-lactate. The concentration of radiolabeled lactate was 0.1 mM and 182 ± 3 nmol/106 cells/15 min, respectively. 2.5 μM, and the concentrations of HMB and unlabeled lactate The corresponding values in the presence of HMB were 2.5 were varied over the range 0.01–10 mM. The data are present- ± 0.1 mM and 104 ± 2 nmol/106 cells/15 min. We analyzed ed in Fig. 4a.TheIC50 values (concentration of the unlabeled the kinetics of HMB inhibition by fitting the data to three compound necessary to inhibit the uptake of radiolabeled lac- different inhibition models (noncompetitive, uncompetitive tate by 50%) were calculated from the data. The values for and competitive). The noncompetitive model showed the best unlabeled lactate and HMB were 1.6 ± 0.4 mM and 7.8 ± fit (R2 = 0.98) with a Ki value of 10.3 mM for inhibition of 2.9 mM, respectively. lactate uptake by HMB. We then studied the saturation kinetics of lactate uptake in the absence and presence of HMB. The concentration of Measurement of HMB Uptake in MCF7 Cells IC HMB was set at 10 mM, a value close to its 50. The concentration range for lactate was 0.1–10 mM. The data are The data from the above-described experiments demonstrate shown in Fig. 4b (lactate concentration versus uptake) and that HMB interacted with the lactate transport system be- Fig. 4c (Eadie-Hofstee plot). Lactate uptake was saturable cause HMB suppressed the uptake of lactate. This however both in the absence and presence of HMB. The kinetic does not mean that HMB was actually transported via Pharm Res (2019) 36: 84 Page 7 of 14 84

MCT1–4 that have been shown to be involved in H+-coupled lactate uptake. Therefore, we used radiolabeled HMB to measure its uptake directly. We monitored the uptake of HMB under Na+-free conditions, but in the presence and absence of a transmembrane H+ gradient, which was established by using an uptake buffer with a pH of 6.0. HMB uptake was detectable in MCF7 cells at an extracellular pH of 7.5, but the uptake increased several-fold when the pH of the uptake buffer was 6.0 (Fig. 5a). We then compared the potencies of unlabeled lactate and HMB to inhibit the uptake of radiolabeled HMB (Fig. 5b). Both inhibited [14C]HMB uptake; the inhibition by unlabeled HMB was much greater than that by lac-

tate. The IC50 values for unlabeled HMB and lactate were 9.2 ± 1.6 mM and 21.1 ± 2.3 mM, respectively. We then performed saturation kinetic analysis by measuring HMB uptake at varying concentrations of HMB (Fig. 6). The uptake was saturable. The Michaelis constant (Kt)fortheuptakeprocess was 6.3 ± 0.8 mM and the maximal velocity (Vmax)were74.8 ± 3.2 nmol/mg protein/min).

Differential Involvement of MCT1 and MCT4 in the Uptake of Lactate and HMB in MCF7 Cells

To evaluate the differential involvement of MCT1 and MCT4 in lactate uptake versus HMB uptake, we assessed the effects of a selective high-affinity inhibitor of MCT1 and a dual inhibitor of MCT1 and MCT4. This MCT1-selective

inhibitor SR13800 inhibits MCT1 with an IC50 value of ~0.5 nM (30). We monitored the ability of this selective MCT1 inhibitor to interfere with the uptake of HMB and lactate in MCF7 cells (Fig. 7a, b). HMB uptake was almost completely unaffected by the inhibitor; however, lactate uptake was sensitive to inhibition by SR13800. Next we used the MCT1/MCT4-dual inhibitor Bindarit, which has higher affinity for MCT4 than for MCT1 (31). HMB uptake was inhibited 25% by Bindarit at 500 μM whereas lactate uptake was inhibited 75%.

Features of HMB Uptake in C2C12 Cells

The mouse skeletal muscle cell line C2C12 cells express MCT1 and MCT4 independent of the differentiated state of Fig. 2 Transport of HMB via SMCT1 as assessed by electrophysiological the cell. SMCT1 is expressed only in undifferentiated state; technique in X. laevis oocytes that express human SMCT1 heterologously. upon differentiation, the expression of SMCT1 is reduced. Oocytes were injected with human SMCT1 cRNA and then used for exper- We first assessed the involvement of SMCT1 in HMB uptake iments 4–6 days after injection. Substrate-induced currents were monitored by the two-microelectrode voltage-clamp technique with the membrane in these cells. For this, the uptake of HMB was monitored at + potential clamped at −50 mV. a Comparison of the inward currents induced pH 7.5, but in the presence or absence of Na (Fig. 8). In the by 2 mM butyrate (a prototypical substrate for SMCT1) and 2 mM HMB. b undifferentiated state, the uptake of HMB was detectable in Saturation kinetics of HMB-induced currents. c Saturation kinetics of butyrate- these cells, and the Na+-dependent component was ~25% of induced currents. In these kinetic analysis experiments (b and c), the maximal current induced in each oocyte was taken as 1 to normalize for inter-oocyte total uptake (Fig. 8a). The same was true for lactate. When the variations in the levels of SMCT1 expression. same experiment was done with differentiated cells, almost 100 % of HMB uptake and lactate uptake constituted Na+- independent component (Fig. 8b). This corroborates the 84 Page 8 of 14 Pharm Res (2019) 36: 84

Fig. 3 Current-voltage relationship for the inward currents induced by HMB (a)andbutyrate (b). SMCT1-expressing oocytes were clamped at different membrane potentials and substrate- induced currents were monitored at increasing concentrations of the substrates.

expression data for SMCT1. We then changed the experi- aminohippurate (PAH), taurocholate, and estrone-3-sulfate. mental conditions for HMB uptake to assess the involvement Lactate uptake was also decreased by substrates and/or inhib- of MCT1 and MCT4 in the uptake process. Now the uptake itors for MCTs. The uptake of HMB and that of lactate was was monitored at pH 6.0 but in the absence of Na+,andalso many-fold higher at pH 6.0 (HMB: 0.73 nmol/mg protein/ in the presence or absence of various anions (Table II)and 15 min, lactate: 0.40 nmol/mg protein/15 min) than at inhibitors (Fig. 9). In parallel, we also monitored lactate up- pH 7.5 (HMB: 0.12 nmol/mg protein/15 min, lactate: take. HMB uptake was decreased by substrates and/or inhib- 0.07 nmol/mg protein/15 min), indicating H+-coupled up- itors for MCTs such as lactate, probenecid, and benzoic acid, take with both substrates. This was evident independent of but not by typical substrates and/or inhibitors for organic the differentiation-state of the C2C12 cells. In undifferentiat- anion transporters (OATs and OATPs) such as p- ed as well as differentiated cells, the uptake of HMB was

Fig. 4 Interaction of HMB with H+-coupled monocarboxylate transporters in MCF7 cells as assessed by the ability of HMB to inhibit the uptake of lactate at pH 6 in the absence of Na+. a Uptake of [14C]-lactate (2.5 μM) was measured in the presence of increasing concentrations of HMB and unlabeled lactate. b Saturation kinetics of lactate uptake in the absence and presence of HMB (10 mM). The data are presented as the lactate concentration (S) versus lactate uptake (V). (C) Eadie- Hofstee transformation of the same data (V versus V/S). Pharm Res (2019) 36: 84 Page 9 of 14 84

inhibited only minimally (~20%) by SR13800 at a concentration (1 μM) expected to inhibit MCT1 completely (Fig. 9a, b). In contrast, the uptake of lactate was inhibited ~70% by the MCT1-selective inhibitor (Fig. 9a, b). HMB uptake was not decreased by Bindarit, whereas lactate uptake was slightly decreased. Interestingly, HMB uptake in the presence of SR13800 was almost same as that in the presence of SR13800 and Bindarit, whereas lactate uptake in the presence of SR13800 was further decreased by adding Bindarit (Fig. 9a).

Influence of siRNA-Mediated Silencing of MCT1 and MCT4 on HMB Uptake and Lactate Uptake

The above-described studies used pharmacological inhibitors of MCT1 and MCT4. To corroborate the data from these studies, we silenced MCT1 and MCT4 in MCF7 cells using MCT1-specific and MCT4-specific siRNAs and then monitored the uptake of HMB and lactate at pH 6.0. The uptake of HMB was hardly affected by the siRNA-mediated silencing of MCT1 or MCT4 individually or in combination (Fig. 10a). In contrast, lactate uptake showed significant inhibition upon silencing of MCT1 but not upon silencing of MCT4 (Fig. 10a). The efficacy of siRNA was validated by monitoring the levels of the corresponding mRNAs by qRT-PCR (Fig. 10b). MCT1-specific siRNA reduced MCT1 mRNA levels by 75%; MCT4-specific siRNA reduced MCT4 mRNA levels by 80%.

Fig. 5 Uptake of [14C]-HMB in MCF7 cells. a Uptake of [14C]-HMB (15 μM) was measured for varying time periods with an extracellular pH of DISCUSSION 7.5 or 6.0 using a Na+-free buffer. b Uptake of [14C]-HMB (30 μM) was measured in the presence of increasing concentrations of lactate and unla- The experiments described in this paper address for the first beled HMB. time the transport processes that are responsible for the uptake of HMB, an important and widely used nutritional supplement in the sports and therapeutic arena, in mammalian cells. As the principal use of this supplement is to enhance protein synthesis in skeletal muscle, we focused much of the present study on C2C12 cells, a mouse cell line model for skeletal muscle. HMB being a monocarboxylate, we investigated the potential participation of the monocarboxylate transporters belonging to the SLC16 and SLC5 gene families in its uptake. C2C12 cells represent myoblasts in undifferentiated state, but upon differentiation with appropriate culture conditions, the cells assume the phenotype of myotubes. We used these cells both in undifferentiated and differentiated state to analyze the characteristics of HMB uptake. As the physiological substrate for these monocarboxylate transporters is lactate, we studied lactate uptake in parallel along with HMB uptake. We also Fig. 6 Saturation kinetics of HMB uptake in MCF7 cells. [14C]-HMB (30 μM) used the human breast cancer cell line MCF7 as a model was used as a tracer to monitor HMB uptake and unlabeled HMB was used to + system in some studies to delineate the role of monocarboxyl- alter HMB concentrations. Uptake measurements were made in a Na -free ate transporters in HMB uptake. MCT1 and MCT4 are buffer, pH 6. The data are presented as the HMB concentration (S) versus HMB uptake (V). Inset: Eadie-Hofstee transformation of the same data (V expressed in both these cell lines; MCT2 and MCT3 are versus V/S). expressed in MCF7 cells but not in C2C12 cells. However, 84 Page 10 of 14 Pharm Res (2019) 36: 84

Fig. 7 Differential inhibitory effect of the MCT1-selective inhibitor SR13800 and MCT1/MCT4-dual inhibitor Bindarit on the uptakes of HMB and lactate in MCF7 cells in a Na+ − free buffer, pH 6. a, b Uptake of HMB (30 μM) and lactate (10 μM) was measured using respective radiolabeled compounds in the presence of two different concentrations of SR13800. c, d Uptake of HMB and lactate was measured using respective radiolabeled compounds in the presence of three different concentrations of Bindarit. **, p <0.01 compared to control uptake measured in the absence of the inhibitor (ANOVA, Dunnett’s post-hoc test).

both cell lines exhibit robust H+-coupled uptake activity for do not express MCT2 and MCT3, we focused on MCT1 and HMB. The affinity of the transport process responsible for MCT4 as the likely candidates for HMB uptake in these cells. HMB uptake in both cell lines indicates a low-affinity type MCT1 and MCT4 play a critical function in tumor cells as with Michaelis constant in millimolar range. As C2C12 cells they relate to tumor-cell specific lactate metabolism. Tumor

Fig. 8 Uptake of HMB and lactate in mouse skeletal muscle cell line C2C12 before and after differentiation. Uptake of HMB (30 μM) and lactate (10 μM) was measured using respective radiolabeled compounds in the presence (NaCl) or absence (NMDGCl) of Na+. The pH of the uptake buffer was 7.5. **, p <0.01 compared to the corresponding uptake measured in NaCl- containing buffer (Student’s t test). Pharm Res (2019) 36: 84 Page 11 of 14 84

Table II Inhibition of HMB and Lactate Uptake in C2C12 Cells by Inhibitor HMB uptake (% of control) Lactate uptake (% of control) Various Anions Control 100 ± 8 100 ± 1 + 10 mM Lactate 53.9 ± 2.3* 12.6 ± 1.4* + 10 mM HMB 54.9 ± 5.2* 21.5 ± 1.1* + 2.5 mM Probenecid 69.6 ± 0.9* 45.4 ± 0.6* + 2.5 mM PAH 90.8 ± 2.1 94.4 ± 2.5 + 0.1 mM Taurocholate 112 ± 4 99.5 ± 6.9 + 2.5 mM 2,5-Dihydroxybenzoic acid 105 ± 2 56.6 ± 4.3* + 2.5 mM 2,3-Dihydroxybenzoic acid 104 ± 2 53.9 ± 1.8* Control (0.5% DMSO) 100 ± 2 100 ± 2 + 2.5 mM Benzoic acid 62.3 ± 1.6* 24.5 ± 0.6* + 0.1 mM Estrone-3-sulfate 99.0 ± 1.3 90.7 ± 4.5

Uptake of HMB (30 μM) and lactate (10 μM) in mouse skeletal muscle cell line C2C12 was measured using respective radiolabeled compounds in the presence of various anions at indicated concentrations. The pH of the uptake buffer was 6.0. *, p< 0.05 compared to the corresponding uptake measured in the absence of anions (control) (ANOVA, Dunnett’s post-hoc test) cells generate lactate as the primary end product of glycolysis, tumor cells. This feature makes MCF7 cells ideal to evaluate a prominent feature known as Warburg effect (32). This me- the participation of MCTs in HMB uptake. tabolite has to be removed from the cells lest it will accumulate The findings of the present study can be summarized as inside the cells leading acidification and cell death. MCT1 and follows. HMB is taken up avidly in MCF7 cells as well as in MCT4, being H+-coupled lactate transporters, are ideal for C2C12 cells. The uptake process is coupled to H+. Lactate this purpose and protect the tumor cells from intracellular and many other anions inhibit its uptake. However, the major acidification. As such, both transporters are upregulated in H+-coupled lactate transporters, MCT1 and MCT4,

Fig. 9 Differential effect of the MCT1-selective inhibitor SR13800 and MCT1/MCT4-dual inhibitor Bindarit on the uptakes of HMB and lactate in C2C12 cells before and after differentiation. Uptake of HMB (30 μM) and lactate (10 μM) was measured in a Na+-free buffer, pH 6, using respective radiolabeled compounds in the presence of SR13800 (1 μM) and/or Bindarit (500 μM). *, p<0.05 and **, p < 0.01 compared to the corresponding control uptake measured in the absence of the inhibitor (ANOVA, Dunnett’s post-hoc test or Student’s t test). 84 Page 12 of 14 Pharm Res (2019) 36: 84

Fig. 10 Effect of knockdown of MCT1 and/or MCT4 on HMB uptake and lactate uptake in MCF7 cells. a Uptake of HMB (30 μM) and lactate (10 μM) in MCF7 treated with MCT1- and/or MCT4- siRNA was measured in the absence of Na+ (NMDG chloride buffer) at pH 6.0. b mRNA expression of SLC16A1 (MCT1) and SLC16A3 (MCT4) in MCF7 cells treated with MCT1- and/or MCT4- siRNA was evaluated by quantitative-RT-PCR. *, p<0.05 compared to the corresponding control (ANOVA, Dunnett’s post-hoc test).

contribute HMB uptake only minimally. On the other hand, of anions used in the present study failed to provide any clue as lactate is taken up in both cell lines mostly via MCT1 and, to a to the identity of the transporter involved in HMB uptake smaller extent, via MCT4. Thus, lactate and HMB are han- except that it ruled out the involvement of OATs and dled differentially by MCT1 and MCT4 even though both OATPs. The coupling to H+ and inhibition by lactate suggest compounds are taken up into cells largely by H+-coupled that the HMB transporter is likely to be a member of the mechanisms. This differential involvement of the two mono- SLC16 gene family. This family consists of 14 members (24), carboxylate transporters in lactate uptake versus HMB uptake but only four of them have been shown to transport lactate, all explains most of the findings in the present study. The uptake in a H+-coupled manner; these are MCT1 (SLC16A1), of radiolabeled lactate is inhibited by unlabeled lactate more MCT2 (SLC16A7), MCT3 (SLC16A8), and MCT4 potently than by HMB whereas the uptake of radiolabeled (SLC16A3). C2C12 cells do not express MCT2 and MCT3, HMB is inhibited by unlabeled HMB more potently than by but still show robust HMB uptake activity. Therefore, MCT2 lactate. Even the non-competitive nature of inhibition of lac- and MCT3 are not likely to be responsible for HMB uptake at tate uptake by HMB can be explained by the participation of least in this particular cell line. Studies with inhibitors that are different transporters in the uptake of the two compounds. specific for MCT1 or MCT4 as well as studies with siRNA- The prototypical anion transporters belonging to the families mediated suppression of MCT1 and MCT4 indicate at best of OATs (organic anion transporters) and OATPs (organic only a small contribution to HMB uptake by these two trans- anion transporting polypeptides) do not appear to play any porters. Two other members of the gene family have been role in HMB uptake; this is further supported by the fact that shown to play a role in the transport of thyroid hormones the transporters in these two families are not coupled to H+ (MCT8/SLC16A2) and aromatic amino acids (MCT10/ whereas HMB uptake is definitely is. The present studies show SLC16A10). The remaining members of the family have no for the first time that the HMB uptake in muscle cells and in known transport function. Additional studies are needed to MCF7 cells is coupled to H+ and that this H+-coupled process determine if any of these remaining members is expressed in is responsible for the bulk of HMB uptake in these cells. muscle cells and in MCF7 cells and contribute to HMB uptake. Unfortunately, the exact molecular identity of the trans- The Na+-coupled monocarboxylate transporter SMCT1 is porter(s) mediating this uptake remains unknown. The panel also capable of transporting HMB as evaluated in X. laevis Pharm Res (2019) 36: 84 Page 13 of 14 84 oocytes heterologously expressing the transporter. The trans- present, the H+-coupled transporter that is responsible for port process is electrogenic. It is already known that SMCT1 most of HMB uptake in muscle cells remains unidentified at is a high-affinity transporter for various monocarboxylates molecular level. such as butyrate, pyruvate, and lactate (27); the Michaelis constant for these monocarboxylates for uptake via SMCT1 ACKNOWLEDGMENTS AND DISCLOSURES is in the low micromolar range (50–150 μM). Even though HMB is a transportable substrate for SMCT1, the Michaelis The authors declare no conflict of interest. The funders had constant is in the low millimolar range (~7 mM), indicating no role in the design of the study, in the collection, analyses, or that SMCT1 shows much lower affinity for HMB than for interpretation of data, or in the decision to publish the results. lactate. MCF7 cells are negative for SMCT1 but C2C12 myo- The funders did however help in the writing of the manu- blast but not myotubules express SMCT1 as evident from the script, principally by providing the background information + presence of SMCT1 mRNA and Na -coupled lactate uptake on the nutritional supplement HMB. and Na+-coupled HMB uptake. Interestingly, both the expression and functional activity of SMCT1 decrease in these cells upon differentiation. Normal skeletal muscle expresses AUTHOR CONTRIBUTIONS SMCT1 mRNA but at a much lower levels than found in other tissues such as the kidney, colon, and brain (28,29). J.O., T. S., K. H., Y.D.B., E.B., M.M., and S.M. performed Therefore, it is not clear how much contribution does the the experiments; V.G. designed the experiments and analyzed SMCT1-mediated transport make to the overall uptake of the data; K.H., R.R., S.L.P., and V.G. wrote the manuscript. HMB in skeletal muscle. The H+-coupled monocarboxylate transporters are likely to be the major mode of uptake and Funding accumulation of HMB in skeletal muscle. This raises a ques- tion as to the physiological relevance of H+-coupling to HMB This work was supported in part by a research grant from the uptake in muscle cells. Even though there is no evidence of any Abbott Nutrition, and the Welch Endowed Chair in significant transmembrane H+ gradient across the muscle cell Biochemistry, Grant No. BI-0028, at Texas Tech University plasma membrane, MCTs do function in these cells in the Health Sciences Center. efflux of lactate during anaerobic metabolism. The release of lactate from the cells in a H+-coupled manner is dictated by the concentration gradient of lactic acid, which is higher inside REFERENCES the muscle cells than outside under hypoxic conditions. Trans- stimulation is a general characteristic of solute transporters, 1. Zanchi NE, Gerlinger-Romero F, Guimarães-Ferreira L, de including MCTs; this is a phenomenon in which presence of Siqueira Filho MA, Felitti V, Lira FS, et al. HMB supplementation: clinical and athletic performance-related effects and mechanisms of one substrate on the trans-side stimulates the cellular uptake of action. Amino Acids. 2011;40:1015–25. another substrate of the same transporter from the cis-side. 2. Sabourin PJ, Bieber LL. The mechanism of alpha-ketoisocaproate Therefore, lactic acid generated in muscle cells would serve oxygenase. Formation of beta-hydroxyisovalerate from alpha- – as a substrate on the trans-side to facilitate the entry of HMB ketoisocaproate. J Biol Chem. 1982;257:7468 71. + 3. Sabourin PJ, Bieber LL. Formation of beta-hydroxyisovalerate by from circulation even in the absence of a transmembrane H an alpha-ketoisocaproate oxygenase in human liver. Metab Clin gradient. Under normal physiological conditions, plasma con- Exp. 1983;32:160–4. tains lactate at significant concentrations (~1 mM), which 4. Slater GJ, Jenkins D. Beta-hydroxy-beta-methylbutyrate (HMB) would compete with HMB for entry into muscle cells. But supplementation and the promotion of muscle growth and strength. – when HMB is taken as a supplement, plasma levels of HMB Sports Med. 2000;30:105 16. 5. Molfino A, Gioia G, Rossi Fanelli F, Muscaritoli M. Beta- could reach as high as ~0.5 mM (33), thus making it conceiv- hydroxy-beta-methylbutyrate supplementation in health and able for MCTs to mediate the entry of HMB into muscle cells disease: a systematic review of randomized trials. Amino even in the physiological concentrations of lactate in Acids. 2013;45:1273–92. circulation. 6. Holeček M. Beta-hydroxy-beta-methylbutyrate supplementation In summary, our results demonstrate that HMB is and skeletal muscle in healthy and muscle-wasting conditions. J Cachexia Sarcopenia Muscle. 2017;8:529–41. transported into skeletal muscle cells, and uptake occurs pre- 7. Wilson JM, Fitschen PJ, Campbell B, Wilson GJ, Zanchi N, Taylor + + dominantly via a H -coupled mechanism. The Na -coupled L, et al. International Society of Sports Nutrition Position Stand: transporter SMCT1 does contribute to HMB uptake, but this beta-hydroxy-beta-methylbutyrate (HMB). J Int Soc Sports Nutr. represents quantitatively a minor pathway. Even though lac- 2013;10:6. tate is a substrate for the transporter responsible for HMB 8. Smith HJ, Mukerji P, Tisdale MJ. Attenuation of proteasome- + induced proteolysis in skeletal muscle by {beta}-hydroxy-{beta}- uptake, the known H /lactate transporters MCT1 and methylbutyrate in cancer-induced muscle loss. Cancer Res. MCT4 are not the major contributors for HMB uptake. At 2005;65:277–83. 84 Page 14 of 14 Pharm Res (2019) 36: 84

9. Kovarik M, Muthny T, Sispera L, Holecek M. Effects of β-hydroxy- β-methylbutyrate on human skeletal muscle protein metabolism. J β-methylbutyrate treatment in different types of skeletal muscle of Physiol Lond. 2013;591:2911–23. intact and septic rats. J Physiol Biochem. 2010;66:311–9. 21. Alway SE, Pereira SL, Edens NK, Hao Y, Bennett BT. β-Hydroxy- 10. Hao Y, Jackson JR, Wang Y, Edens N, Pereira SL, Alway SE. β- β-methylbutyrate (HMB) enhances the proliferation of satellite cells Hydroxy-β-methylbutyrate reduces myonuclear apoptosis during in fast muscles of aged rats during recovery from disuse atrophy. recovery from hind limb suspension-induced muscle fiber atrophy Exp Gerontol. 2013;48:973–84. in aged rats. Am J Physiol Regul Integr Comp Physiol. 2011;301: 22. Kimura K, Cheng XW, Inoue A, Hu L, Koike T, Kuzuya M. β- R701–15. Hydroxy-β-methylbutyrate facilitates PI3K/Akt-dependent mam- 11. GirónMD,VílchezJD,ShreeramS,SaltoR,ManzanoM, malian target of rapamycin and FoxO1/3a phosphorylations and Cabrera E, et al. β-Hydroxy-β-methylbutyrate (HMB) normalizes alleviates tumor necrosis factor α/interferon γ-induced MuRF-1 dexamethasone-induced autophagy-lysosomal pathway in skeletal expression in C2C12 cells. Nutr Res. 2014;34:368–74. muscle. PLoS One. 2015;10:e0117520. 23. Szcześniak KA, Ciecierska A, Ostaszewski P, Sadkowski T. 12. May PE, Barber A, D’Olimpio JT, Hourihane A, Abumrad NN. Characterisation of equine satellite cell transcriptomic profile re- Reversal of cancer-related wasting using oral supplementation with sponse to β-hydroxy-β-methylbutyrate (HMB). Br J Nutr. a combination of beta-hydroxy-beta-methylbutyrate, arginine, and 2016;116:1315–25. glutamine. Am J Surg. 2002;183:471–9. 24. Halestrap AP. The SLC16 gene family - structure, role and regu- 13. Clark RH, Feleke G, Din M, Yasmin T, Singh G, Khan FA, et al. lation in health and disease. Mol Asp Med. 2013;34:337–49. Nutritional treatment for acquired immunodeficiency virus- 25. Ganapathy V, Thangaraju M, Gopal E, Martin PM, Itagaki S, associated wasting using beta-hydroxy beta-methylbutyrate, gluta- Miyauchi S, et al. Sodium-coupled monocarboxylate transporters mine, and arginine: a randomized, double-blind, placebo- in normal tissues and in cancer. AAPS J. 2008;10:193–9. – controlled study. JPEN J Parenter Enteral Nutr. 2000;24:133 9. 26. Sivaprakasam S, Bhutia YD, Yang S, Ganapathy V. Short-chain 14. Standley RA, Distefano G, Pereira SL, Tian M, Kelly OJ, Coen fatty acid transporters: role in colonic homeostasis. Compr Physiol. β β PM, et al. Effects of -hydroxy- -methylbutyrate on skeletal muscle 2017;8:299–314. mitochondrial content and dynamics, and lipids after 10 days of bed 27. Miyauchi S, Gopal E, Fei Y-J, Ganapathy V. Functional identifi- – rest in older adults. J Appl Physiol. 2017;123:1092 100. cation of SLC5A8, a tumor suppressor down-regulated in colon 15. Deutz NEP, Pereira SL, Hays NP, Oliver JS, Edens NK, Evans cancer, as a Na(+)-coupled transporter for short-chain fatty acids. β β CM, et al. Effect of -hydroxy- -methylbutyrate (HMB) on lean J Biol Chem. 2004;279:13293–6. body mass during 10 days of bed rest in older adults. Clin Nutr. 28. Srinivas SR, Gopal E, Zhuang L, Itagaki S, Martin PM, Fei Y-J, – 2013;32:704 12. et al. Cloning and functional identification of slc5a12 as a sodium- 16. Flakoll P, Sharp R, Baier S, Levenhagen D, Carr C, Nissen S. coupled low-affinity transporter for monocarboxylates (SMCT2). Effect of beta-hydroxy-beta-methylbutyrate, arginine, and lysine Biochem J. 2005;392:655–64. supplementation on strength, functionality, body composition, 29. Gopal E, Umapathy NS, Martin PM, Ananth S, Gnana-Prakasam and protein metabolism in elderly women. Nutrition. 2004;20: JP, Becker H, et al. Cloning and functional characterization of – 445 51. human SMCT2 (SLC5A12) and expression pattern of the trans- 17. Stout JR, Smith-Ryan AE, Fukuda DH, Kendall KL, Moon JR, porter in kidney. Biochim Biophys Acta. 2007;1768:2690–7. β β Hoffman JR, et al. Effect of calcium -hydroxy- -methylbutyrate 30. Doherty JR, Yang C, Scott KEN, Cameron MD, Fallahi M, Li W, (CaHMB) with and without resistance training in men and women et al. Blocking lactate export by inhibiting the Myc target MCT1 65+yrs: a randomized, double-blind pilot trial. Exp Gerontol. – disables glycolysis and glutathione synthesis. Cancer Res. 2014;74: 2013;48:1303 10. 908–20. 18. Stout JR, Fukuda DH, Kendall KL, Smith-Ryan AE, Moon JR, 31. Futagi Y, Kobayashi M, Narumi K, Furugen A, Iseki K. Hoffman JR. β-Hydroxy-β-methylbutyrate (HMB) supplementa- Identification of a selective inhibitor of human monocarboxylate tion and resistance exercise significantly reduce abdominal adipos- transporter 4. Biochem Biophys Res Commun. 2018;495:427–32. ity in healthy elderly men. Exp Gerontol. 2015;64:33–4. 32. Ristic B, Bhutia YD, Ganapathy V. Cell-surface G-protein-coupled 19. Eley HL, Russell ST, Baxter JH, Mukerji P, Tisdale MJ. Signaling receptors for tumor-associated metabolites: a direct link to mito- pathways initiated by beta-hydroxy-beta-methylbutyrate to attenu- chondrial dysfunction in cancer. Biochim Biophys Acta Rev ate the depression of protein synthesis in skeletal muscle in response Cancer. 2017;1868:246–57. to cachectic stimuli. Am J Physiol Endocrinol Metab. 2007;293: E923–31. 20. Wilkinson DJ, Hossain T, Hill DS, Phillips BE, Crossland H, Publisher’sNoteSpringer Nature remains neutral with regard to jurisdictional Williams J, et al. Effects of leucine and its metabolite β-hydroxy- claims in published maps and institutional affiliations.