Characterization of Microsatellite Loci in the Marine Seaweed Ascophyllum Nodosum (Phaeophyceae; Fucales)

MEN_137.fm Page 33 Wednesday, February 20, 2002 8:53 PM

Molecular Ecology Notes (2002) 2, 33–34

PRIMERBlackwell Science, Ltd NOTE Characterization of microsatellite loci in the marine seaweed Ascophyllum nodosum (Phaeophyceae; Fucales)

J. L. OLSEN,* G. SADOWSKI,† W. T. STAM,* J. H. VELDSINK* and K. JONES† *Department of Marine Biology, Centre for Ecological and Evolutionary Studies, Biological Centre, University of Groningen, PO Box 14, 9750 AA Haren, The Netherlands, †Genetic Identification Services, 9552 Topanga Canyon Blvd., Chatsworth, CA 91311, USA

Abstract Ascophyllum nodosum L. dominates rocky intertidal shores throughout the temperate North Atlantic. Six microsatellite loci were developed for A. nodosum using enriched libraries. The number of alleles ranged from 9 to 24 and heterozygosities from 0.2213 to 0.7785. Ascophyllum is monotypic. There was no cross-reactivity observed with Fucus serratus, F. vesiculosus or F. evanescens. Keywords: algae, Ascophyllum nodosum, Fucales, microsatellites, seaweeds Received 16 July 2001; revision received 10 August 2001; accepted 4 September 2001

Ascophyllum nodosum dominates rocky intertidal shores Perkin Elmer, CA, USA) and an ABI 373 (Applied Bio- throughout the temperate North Atlantic. Its longevity Systems). Library enrichment was assessed as the fraction and sensitivity to temperature fluctuations makes this of sequences containing a microsatellite. The CA library was alga an important model for addressing questions about 85% enriched, averaging 15 repeats per microsatellite. The habitat fragmentation and climate-change in coastal GA library was 75% enriched averaging 11 repeats per marine communities of the North Atlantic. Demographic microsatellite. The AAT and TAGA libraries were only (Åberg 1992) and population genetic studies (Olsen et al. 30% enriched. Repeated (nonmicrosatellite) sequences of unpublished) are highly desirable but have heretofore up to 60 nucleotides in length were present in 120 clones been hampered by the absence of suitable markers. and 80 additional clones were rejected on various technical Genomic DNA was extracted from fresh A. nodosum grounds. Seventy sets of primers were designed from which sperm collected from Roscoff (F) and Tjärnö (S). Sperm only six proved to be polymorphic (Table 1). The AAT and DNA was used because of the potential for genomic con- TAGA libraries contained an additional four polymorphic tamination from Mycosphaerella ascophylli, the alga’s fungal loci but these produced > 20% null alleles. phycobiont. A CTAB extraction method followed by CsCl- Template DNA for the polymerase chain reaction (PCR) purification was performed following the method of Coyer amplifications of the loci was extracted from c. 30 mg silica et al. (1994). Genomic DNA was partially restricted with a dried field material (tips). Tissue was ground in liquid cocktail of seven blunt-end restriction enzymes (RsaI, HaeIII, nitrogen after which 800 µL 2% CTAB extraction buffer and BsrBI, PvuII, StuI, ScaI, EcoRV). A size-selected fraction 2 µL β-mercaptoethanol was added. The lysis mixture was (300–750 bp) was subjected to magnetic bead capture incubated for 2 h at room temperature on a slow turning

(beads coated with biotin-labelled CA15, GA15, AAT12 and rotor followed by two Chloroform Isoamyl Alcohol (24 : 1v/v). TAGA8 motifs) following the manufacturer’s protocols The DNA was further purified using the Sephaglass Band- (CPG Inc., Lincoln Park, New Jersey, USA). Captured prep Kit (Pharmacia) following the manufacturer’s protocol. molecules were amplified and restricted with HindIII, DNA was dissolved in 100 µL 0.1× TE buffer. ligated into pUC19 and transformed into DH5α. Approxim- PCR reactions (10 µL) for locus amplification contained ately 300 recombinant clones were selected at random 2–20 ng DNA; 1× reaction buffer (Promega) consisting of and sequenced using the ABI BigDye Terminator Cycle 10 mm Tris-HCl, 50 mm KCl and 0.1% Triton-X-100; 2 mm µ Sequencing Ready Reaction Kit (PE Applied Biosystems, MgCl2; 0.2 mm dNTP’s; 0.6 m of each primer; 1 mg/mL BSA; and 0.025 U/µL Taq (Promega). Amplication was Correspondence: J. L. Olsen. Fax: + 31-50-363-2261; E-mail: carried out on a Perkin-Elmer Gene-Amp system 9700. An [email protected] initial denaturation step of 3 min at 95 °C was followed by

MEN_137.fm Page 34 Wednesday, February 20, 2002 8:53 PM

34 PRIMER NOTE

Table 1 Primer sequences and characteristics of six polymorphic microsatellite loci in Ascophyllum nodosum. The 5′-end of the forward

primer was labelled with the fluorescent dye indicated. Ta, optimal annealing temperature; n, 1200 diploid individuals. HE and HO are expected, nonbiased and observed heterozygosities; P-values for tests of deviation from Hardy–Weinberg equlibrium

Locus Clone size

(GenBank Core PCR primers Ta No. of bp ′ ′ ° Accession no.) sequence (5 –3 ) ( C) alleles (range) HE HO P-value

An124 (CA)13 HEX-F: ATGCCAATGACTCGTTCT 56 9 89 0.2213 0.0952 0.001 (AF399950) R: ACTCCTTACATGCTCTACAACT (79–95)

An23 (CT)4CA(CT)10 FAM-F: TCCCGTGACAGTAGAGGAC 60 15 125 0.3102 0.3118 0.064 (AF399951) TT(CT)3 R: GTGGAAGAACGGTTCACAT (117–145) An166 (CT)4TC(CT)22 NED-F: GCTCTTTCTCTCTTTCTCTGT 57 15 174 0.6920 0.3308 0.001 (AF399952) R: TTTGCGAGTGTAGCAGTAG (160–190)

An116 (CT)14 FAM-F: TATGGGTAGTGTCGTTTCTTC 58 17 164 0.7717 0.5509 0.015 (AF399953) R: GGCAAATACAAATACAGCG (146–180)

An126 (GA)23 FAM-F: AAAGCTCACACCTGCAAC 60 24 170 0.7785 0.5802 0.011 (AF399954) R: CAGCTCTAGCAATAGTGTCTTC (146–196)

An269 (CT)4ATCTCC(CT)11 HEX-F: CATTTCCGACCCTTTC 60 13 161 0.5959 0.5390 0.448 (AF399955) R: AGTCGCTTCGTGTGAGG (157–179)

30 cycles of 40 s at 94 °C, 40 s at the primer annealing References temperature (Table 1) and 30 s at 72 °C, and concluded by an extension of 10 min at 72 °C. Amplification products Åberg P (1992) Size-based demography of the seaweed Ascophyllum were separated on 4.5% denaturing polyacrylamide gels nodosum in stochastic environments. Ecology, 73, 1488–1501. on an ABI 377 automated sequencer (Applied Biosystems), Belkhir K, Borsa P, Goudet J, Chikhi L, Bonhomme F (2001) GENETIX 4.02, logiciel sous Windows TM pour la génétique des populations. using 5′-fluorescence-labelled (FAM, HEX or NED; Applied Laboratoire Génome et Populations, CNRS UPR 9060, Université Biosystems) primers. Genotypes were determined with de Montpellier II, Montpellier, France. genescan software (Applied Biosystems). Observed and Billot C, Rousvoal S, Estoup A (1998) Isolation and characterisa- expected heterozygosities were calculated and tested for tion of microsatellite markers in the nuclear genome of the departures from Hardy–Weinberg equlibrium (HWE) brown alga Laminaria digitata (Phaeophyceae). Molecular using genetix 4.02 (Belkhir et al. 2001). Deviations from Ecology, 7, 1778–1780. HWE is attributed to an artificial Wahlund effect which Brookfield JFY (1996) A simple new method for estimating null allele frequency from heterozygote deficiency. Molecular Ecology, results from pooling many populations. Inbreeding was 5, 453–455. observed in some populations. Deviations were not due to Coyer JA, Robertson DR, Alberte RS (1994) Genetic variability null alleles as judged by altering amplification conditions within a population and between diploid/haploid tissue of and by estimates based on the method of Brookfield (1996). Macrocystic pyrifera (Phaeophyceae). Journal of Phycology, 30, Microsatellite loci have also been developed for the 545–552. fucoids Fucus serratus and F. evanescens (Coyer et al. 2001), Coyer JA, Veldsink JH, Jones K, Stam WT, Olsen JL (2001) Charac- the kelp Laminaria digitata (Billot et al. 1998), the red alga terization of microsatellite loci in the marine seaweeds Fucus serratus and F. evanescens (Heterokontophyta; Fucaceae). Molecu- Gracilaria gracilis (Wattier et al. 1997) and the green alga lar Ecology Notes, DOI: 10.1046/j.1471-8278 .2001.00138.x. Cladophoropsis membranacea (Van der Strate et al. 2000). In Van der Strate HJ, Olsen JL, Van de Zande L, Edwards KJ, Stam all of the aforementioned seaweed species, microsatellite WT (2000) Isolation and characterization of micorsatellite loci in loci have been found (for unknown reasons) to be less the benthic seaweed, Cladophoropsis membranacea (Cladopho- abundant and/or less polymorphic as compared with rales, Chlorophyta). Molecular Ecology, 9, 1433–1449. higher plants and animals (Wang et al. 1994). We recom- Wang Z, Weber JL, Zhong G, Tanksley SD (1994) Survey of plant mend that enriched libraries be used from the outset when short tandem DNA repeats. Theoretical and Applied Genetics, 88, 1–6. developing markers in new algal species. Wattier R, Dallas JF, Destombe C, Saumitou-Laprade P, Valero M (1997) Single-locus microsatellites in Gracilariales (Rhodo- Acknowledgement phyta): High level of genetic variability within Gracilaria gracilis and conservation in related species. Journal of Phycology, 33, 868– This work was supported by EU project MAS2-CT95-0019 BIOGAP. 880.