DOCSLIB.ORG

Characterization of Microsatellite Loci in the Marine Seaweed Ascophyllum Nodosum (Phaeophyceae; Fucales)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Microsatellite Loci in the Marine Seaweed Ascophyllum Nodosum (Phaeophyceae; Fucales) MEN_137.fm Page 33 Wednesday, February 20, 2002 8:53 PM Molecular Ecology Notes (2002) 2, 33–34 PRIMERBlackwell Science, Ltd NOTE Characterization of microsatellite loci in the marine seaweed Ascophyllum nodosum (Phaeophyceae; Fucales) J. L. OLSEN,* G. SADOWSKI,† W. T. STAM,* J. H. VELDSINK* and K. JONES† *Department of Marine Biology, Centre for Ecological and Evolutionary Studies, Biological Centre, University of Groningen, PO Box 14, 9750 AA Haren, The Netherlands, †Genetic Identification Services, 9552 Topanga Canyon Blvd., Chatsworth, CA 91311, USA Abstract Ascophyllum nodosum L. dominates rocky intertidal shores throughout the temperate North Atlantic. Six microsatellite loci were developed for A. nodosum using enriched libraries. The number of alleles ranged from 9 to 24 and heterozygosities from 0.2213 to 0.7785. Ascophyllum is monotypic. There was no cross-reactivity observed with Fucus serratus, F. vesiculosus or F. evanescens. Keywords: algae, Ascophyllum nodosum, Fucales, microsatellites, seaweeds Received 16 July 2001; revision received 10 August 2001; accepted 4 September 2001 Ascophyllum nodosum dominates rocky intertidal shores Perkin Elmer, CA, USA) and an ABI 373 (Applied Bio- throughout the temperate North Atlantic. Its longevity Systems). Library enrichment was assessed as the fraction and sensitivity to temperature fluctuations makes this of sequences containing a microsatellite. The CA library was alga an important model for addressing questions about 85% enriched, averaging 15 repeats per microsatellite. The habitat fragmentation and climate-change in coastal GA library was 75% enriched averaging 11 repeats per marine communities of the North Atlantic. Demographic microsatellite. The AAT and TAGA libraries were only (Åberg 1992) and population genetic studies (Olsen et al. 30% enriched. Repeated (nonmicrosatellite) sequences of unpublished) are highly desirable but have heretofore up to 60 nucleotides in length were present in 120 clones been hampered by the absence of suitable markers. and 80 additional clones were rejected on various technical Genomic DNA was extracted from fresh A. nodosum grounds. Seventy sets of primers were designed from which sperm collected from Roscoff (F) and Tjärnö (S). Sperm only six proved to be polymorphic (Table 1). The AAT and DNA was used because of the potential for genomic con- TAGA libraries contained an additional four polymorphic tamination from Mycosphaerella ascophylli, the alga’s fungal loci but these produced > 20% null alleles. phycobiont. A CTAB extraction method followed by CsCl- Template DNA for the polymerase chain reaction (PCR) purification was performed following the method of Coyer amplifications of the loci was extracted from c. 30 mg silica et al. (1994). Genomic DNA was partially restricted with a dried field material (tips). Tissue was ground in liquid cocktail of seven blunt-end restriction enzymes (RsaI, HaeIII, nitrogen after which 800 µL 2% CTAB extraction buffer and BsrBI, PvuII, StuI, ScaI, EcoRV). A size-selected fraction 2 µL β-mercaptoethanol was added. The lysis mixture was (300–750 bp) was subjected to magnetic bead capture incubated for 2 h at room temperature on a slow turning (beads coated with biotin-labelled CA15, GA15, AAT12 and rotor followed by two Chloroform Isoamyl Alcohol (24 : 1v/v). TAGA8 motifs) following the manufacturer’s protocols The DNA was further purified using the Sephaglass Band- (CPG Inc., Lincoln Park, New Jersey, USA). Captured prep Kit (Pharmacia) following the manufacturer’s protocol. molecules were amplified and restricted with HindIII, DNA was dissolved in 100 µL 0.1× TE buffer. ligated into pUC19 and transformed into DH5α. Approxim- PCR reactions (10 µL) for locus amplification contained ately 300 recombinant clones were selected at random 2–20 ng DNA; 1× reaction buffer (Promega) consisting of and sequenced using the ABI BigDye Terminator Cycle 10 mm Tris-HCl, 50 mm KCl and 0.1% Triton-X-100; 2 mm µ Sequencing Ready Reaction Kit (PE Applied Biosystems, MgCl2; 0.2 mm dNTP’s; 0.6 m of each primer; 1 mg/mL BSA; and 0.025 U/µL Taq (Promega). Amplication was Correspondence: J. L. Olsen. Fax: + 31-50-363-2261; E-mail: carried out on a Perkin-Elmer Gene-Amp system 9700. An [email protected] initial denaturation step of 3 min at 95 °C was followed by © 2002 Blackwell Science Ltd MEN_137.fm Page 34 Wednesday, February 20, 2002 8:53 PM 34 PRIMER NOTE Table 1 Primer sequences and characteristics of six polymorphic microsatellite loci in Ascophyllum nodosum. The 5′-end of the forward primer was labelled with the fluorescent dye indicated. Ta, optimal annealing temperature; n, 1200 diploid individuals. HE and HO are expected, nonbiased and observed heterozygosities; P-values for tests of deviation from Hardy–Weinberg equlibrium Locus Clone size (GenBank Core PCR primers Ta No. of bp ′ ′ ° Accession no.) sequence (5 –3 ) ( C) alleles (range) HE HO P-value An124 (CA)13 HEX-F: ATGCCAATGACTCGTTCT 56 9 89 0.2213 0.0952 0.001 (AF399950) R: ACTCCTTACATGCTCTACAACT (79–95) An23 (CT)4CA(CT)10 FAM-F: TCCCGTGACAGTAGAGGAC 60 15 125 0.3102 0.3118 0.064 (AF399951) TT(CT)3 R: GTGGAAGAACGGTTCACAT (117–145) An166 (CT)4TC(CT)22 NED-F: GCTCTTTCTCTCTTTCTCTGT 57 15 174 0.6920 0.3308 0.001 (AF399952) R: TTTGCGAGTGTAGCAGTAG (160–190) An116 (CT)14 FAM-F: TATGGGTAGTGTCGTTTCTTC 58 17 164 0.7717 0.5509 0.015 (AF399953) R: GGCAAATACAAATACAGCG (146–180) An126 (GA)23 FAM-F: AAAGCTCACACCTGCAAC 60 24 170 0.7785 0.5802 0.011 (AF399954) R: CAGCTCTAGCAATAGTGTCTTC (146–196) An269 (CT)4ATCTCC(CT)11 HEX-F: CATTTCCGACCCTTTC 60 13 161 0.5959 0.5390 0.448 (AF399955) R: AGTCGCTTCGTGTGAGG (157–179) 30 cycles of 40 s at 94 °C, 40 s at the primer annealing References temperature (Table 1) and 30 s at 72 °C, and concluded by an extension of 10 min at 72 °C. Amplification products Åberg P (1992) Size-based demography of the seaweed Ascophyllum were separated on 4.5% denaturing polyacrylamide gels nodosum in stochastic environments. Ecology, 73, 1488–1501. on an ABI 377 automated sequencer (Applied Biosystems), Belkhir K, Borsa P, Goudet J, Chikhi L, Bonhomme F (2001) GENETIX 4.02, logiciel sous Windows TM pour la génétique des populations. using 5′-fluorescence-labelled (FAM, HEX or NED; Applied Laboratoire Génome et Populations, CNRS UPR 9060, Université Biosystems) primers. Genotypes were determined with de Montpellier II, Montpellier, France. genescan software (Applied Biosystems). Observed and Billot C, Rousvoal S, Estoup A (1998) Isolation and characterisa- expected heterozygosities were calculated and tested for tion of microsatellite markers in the nuclear genome of the departures from Hardy–Weinberg equlibrium (HWE) brown alga Laminaria digitata (Phaeophyceae). Molecular using genetix 4.02 (Belkhir et al. 2001). Deviations from Ecology, 7, 1778–1780. HWE is attributed to an artificial Wahlund effect which Brookfield JFY (1996) A simple new method for estimating null allele frequency from heterozygote deficiency. Molecular Ecology, results from pooling many populations. Inbreeding was 5, 453–455. observed in some populations. Deviations were not due to Coyer JA, Robertson DR, Alberte RS (1994) Genetic variability null alleles as judged by altering amplification conditions within a population and between diploid/haploid tissue of and by estimates based on the method of Brookfield (1996). Macrocystic pyrifera (Phaeophyceae). Journal of Phycology, 30, Microsatellite loci have also been developed for the 545–552. fucoids Fucus serratus and F. evanescens (Coyer et al. 2001), Coyer JA, Veldsink JH, Jones K, Stam WT, Olsen JL (2001) Charac- the kelp Laminaria digitata (Billot et al. 1998), the red alga terization of microsatellite loci in the marine seaweeds Fucus serratus and F. evanescens (Heterokontophyta; Fucaceae). Molecu- Gracilaria gracilis (Wattier et al. 1997) and the green alga lar Ecology Notes, DOI: 10.1046/j.1471-8278 .2001.00138.x. Cladophoropsis membranacea (Van der Strate et al. 2000). In Van der Strate HJ, Olsen JL, Van de Zande L, Edwards KJ, Stam all of the aforementioned seaweed species, microsatellite WT (2000) Isolation and characterization of micorsatellite loci in loci have been found (for unknown reasons) to be less the benthic seaweed, Cladophoropsis membranacea (Cladopho- abundant and/or less polymorphic as compared with rales, Chlorophyta). Molecular Ecology, 9, 1433–1449. higher plants and animals (Wang et al. 1994). We recom- Wang Z, Weber JL, Zhong G, Tanksley SD (1994) Survey of plant mend that enriched libraries be used from the outset when short tandem DNA repeats. Theoretical and Applied Genetics, 88, 1–6. developing markers in new algal species. Wattier R, Dallas JF, Destombe C, Saumitou-Laprade P, Valero M (1997) Single-locus microsatellites in Gracilariales (Rhodo- Acknowledgement phyta): High level of genetic variability within Gracilaria gracilis and conservation in related species. Journal of Phycology, 33, 868– This work was supported by EU project MAS2-CT95-0019 BIOGAP. 880. © 2002 Blackwell Science Ltd, Molecular Ecology Notes, 2, 33–34.
Load more

Recommended publications
  • The Valorisation of Sargassum from Beach Inundations
    Journal of Marine Science and Engineering Review Golden Tides: Problem or Golden Opportunity? The Valorisation of Sargassum from Beach Inundations John J. Milledge * and Patricia J. Harvey Algae Biotechnology Research Group, School of Science, University of Greenwich, Central Avenue, Chatham Maritime, Kent ME4 4TB, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-0208-331-8871 Academic Editor: Magnus Wahlberg Received: 12 August 2016; Accepted: 7 September 2016; Published: 13 September 2016 Abstract: In recent years there have been massive inundations of pelagic Sargassum, known as golden tides, on the beaches of the Caribbean, Gulf of Mexico, and West Africa, causing considerable damage to the local economy and environment. Commercial exploration of this biomass for food, fuel, and pharmaceutical products could fund clean-up and offset the economic impact of these golden tides. This paper reviews the potential uses and obstacles for exploitation of pelagic Sargassum. Although Sargassum has considerable potential as a source of biochemicals, feed, food, fertiliser, and fuel, variable and undefined composition together with the possible presence of marine pollutants may make golden tides unsuitable for food, nutraceuticals, and pharmaceuticals and limit their use in feed and fertilisers. Discontinuous and unreliable supply of Sargassum also presents considerable challenges. Low-cost methods of preservation such as solar drying and ensiling may address the problem of discontinuity. The use of processes that can handle a variety of biological and waste feedstocks in addition to Sargassum is a solution to unreliable supply, and anaerobic digestion for the production of biogas is one such process.
    [Show full text]
  • The Interplay of Positive and Negative Influences
    Journal of Experimental Marine Biology and Ecology 448 (2013) 162–170 Contents lists available at SciVerse ScienceDirect Journal of Experimental Marine Biology and Ecology journal homepage: www.elsevier.com/locate/jembe Effects of seaweed canopies and adult barnacles on barnacle recruitment: The interplay of positive and negative influences Arne J. Beermann a, Julius A. Ellrich a, Markus Molis b, Ricardo A. Scrosati a,⁎ a Saint Francis Xavier University, Department of Biology, Antigonish, Nova Scotia B2G 2W5, Canada b Alfred Wegener Institute for Polar and Marine Research (AWI), Am Handelshafen 12, 27570 Bremerhaven, Germany article info abstract Article history: Barnacles are dominant sessile invertebrates on many rocky shores worldwide. Hence, investigating the factors Received 15 February 2013 that affect their recruitment is important. Through field experiments done on the Atlantic coast of Canada, we Received in revised form 30 June 2013 investigated interspecificandintraspecific relationships affecting intertidal barnacle recruitment. Specifically, Accepted 1 July 2013 we evaluated the effects of seaweed canopies (Ascophyllum nodosum) and adult barnacles (Semibalanus Available online xxxx balanoides) on the density of barnacle recruits at the end of the recruitment season. The effects of three canopy treatments on barnacle recruitment and understory environmental conditions allowed us to identify positive Keywords: Ascophyllum and negative effects of canopies. At mid-intertidal elevations subjected to a moderate wave action, we found Barnacle that, during high tides, the flexible algal fronds damage wire sensors established on the substrate (whiplash Intertidal effect) and limit barnacle recruitment. However, at low tide, algal canopies limit water loss and temperature Seaweed extremes and enhance barnacle recruitment in understory habitats.
    [Show full text]
  • Interactive Effects of Increasing Temperature and Nutrient Loading On
    Aquatic Botany 133 (2016) 70–78 Contents lists available at ScienceDirect Aquatic Botany jou rnal homepage: www.elsevier.com/locate/aquabot Interactive effects of increasing temperature and nutrient loading on the habitat-forming rockweed Ascophyllum nodosum ∗ Lauren M. Kay , Allison L. Schmidt, Kristen L. Wilson, Heike K. Lotze Department of Biology, Dalhousie University, 1355 Oxford St., PO Box 15000, Halifax, NS, B3H 4R2, Canada a r t i c l e i n f o a b s t r a c t Article history: Perennial seaweeds are dominant primary producers and foundation species along rocky shores, provid- Received 31 December 2015 ing essential ecosystem functions and services. Although increasingly affected by various anthropogenic Received in revised form 2 June 2016 activities, the cumulative effects of multiple stressors are little known. We tested the interactive effects Accepted 4 June 2016 of nutrient enrichment and increased water temperatures on growth, nitrogen retention and carbon Available online 6 June 2016 ◦ ◦ storage in juvenile Ascophyllum nodosum from Nova Scotia, Canada (44 29.9 N, 63 31.7 W) using a multi-factorial laboratory experiment. Temperature strongly affected growth, significantly reducing Keywords: ◦ ◦ ◦ weight and length gain from 16 C to 20 C and 24 C. Medium nutrient enrichment enhanced while high Ascophyllum nodosum enrichment slowed rockweed growth at lower temperatures, yet these effects disappeared with warming. Juvenile growth Nitrogen retention in rockweed tissue significantly increased with nutrient enrichment and decreased Climate warming Nutrient loading with warming, whereas carbon storage remained unaffected. These individual and interactive effects of Interactive effects nutrient loading and climate warming may alter the structure and function of rockweed habitats with potentially far-reaching ecological and economic consequences.
    [Show full text]
  • Download PDF Version
    MarLIN Marine Information Network Information on the species and habitats around the coasts and sea of the British Isles Ascophyllum nodosum on full salinity mid eulittoral mixed substrata MarLIN – Marine Life Information Network Marine Evidence–based Sensitivity Assessment (MarESA) Review Frances Perry & Jacqueline Hill 2020-04-07 A report from: The Marine Life Information Network, Marine Biological Association of the United Kingdom. Please note. This MarESA report is a dated version of the online review. Please refer to the website for the most up-to-date version [https://www.marlin.ac.uk/habitats/detail/275]. All terms and the MarESA methodology are outlined on the website (https://www.marlin.ac.uk) This review can be cited as: Perry, F. & Hill, J.M., 2020. [Ascophyllum nodosum] on full salinity mid eulittoral mixed substrata. In Tyler-Walters H. and Hiscock K. (eds) Marine Life Information Network: Biology and Sensitivity Key Information Reviews, [on-line]. Plymouth: Marine Biological Association of the United Kingdom. DOI https://dx.doi.org/10.17031/marlinhab.275.2 The information (TEXT ONLY) provided by the Marine Life Information Network (MarLIN) is licensed under a Creative Commons Attribution-Non-Commercial-Share Alike 2.0 UK: England & Wales License. Note that images and other media featured on this page are each governed by their own terms and conditions and they may or may not be available for reuse. Permissions beyond the scope of this license are available here. Based on a work at www.marlin.ac.uk (page left blank) Date: 2020-04-07 Ascophyllum nodosum on full salinity mid eulittoral mixed substrata - Marine Life Information Network Ascophyllum nodosum on full salinity mid eulittoral mixed substrata Photographer: Charlotte Johnston Copyright: Joint Nature Conservation Committee (JNCC) 17-09-2018 Biotope distribution data provided by EMODnet Seabed Habitats (www.emodnet-seabedhabitats.eu) Researched by Frances Perry & Jacqueline Hill Refereed by Prof.
    [Show full text]
  • First Report of the Asian Seaweed Sargassum Filicinum Harvey (Fucales) in California, USA
    First Report of the Asian Seaweed Sargassum filicinum Harvey (Fucales) in California, USA Kathy Ann Miller1, John M. Engle2, Shinya Uwai3, Hiroshi Kawai3 1University Herbarium, University of California, Berkeley, California, USA 2 Marine Science Institute, University of California, Santa Barbara, California, USA 3 Research Center for Inland Seas, Kobe University, Rokkodai, Kobe 657–8501, Japan correspondence: Kathy Ann Miller e-mail: [email protected] fax: 1-510-643-5390 telephone: 510-387-8305 1 ABSTRACT We report the occurrence of the brown seaweed Sargassum filicinum Harvey in southern California. Sargassum filicinum is native to Japan and Korea. It is monoecious, a trait that increases its chance of establishment. In October 2003, Sargassum filicinum was collected in Long Beach Harbor. In April 2006, we discovered three populations of this species on the leeward west end of Santa Catalina Island. Many of the individuals were large, reproductive and senescent; a few were small, young but precociously reproductive. We compared the sequences of the mitochondrial cox3 gene for 6 individuals from the 3 sites at Catalina with 3 samples from 3 sites in the Seto Inland Sea, Japan region. The 9 sequences (469 bp in length) were identical. Sargassum filicinum may have been introduced through shipping to Long Beach; it may have spread to Catalina via pleasure boats from the mainland. Key words: California, cox3, invasive seaweed, Japan, macroalgae, Sargassum filicinum, Sargassum horneri INTRODUCTION The brown seaweed Sargassum muticum (Yendo) Fensholt, originally from northeast Asia, was first reported on the west coast of North America in the early 20th c. (Scagel 1956), reached southern California in 1970 (Setzer & Link 1971) and has become a common component of California intertidal and subtidal communities (Ambrose and Nelson 1982, Deysher and Norton 1982, Wilson 2001, Britton-Simmons 2004).
    [Show full text]
  • COMMISSION RECOMMENDATION (EU) 2018/464 of 19 March 2018 on the Monitoring of Metals and Iodine in Seaweed, Halophytes and Products Based on Seaweed
    L 78/16 EN Official Journal of the European Union 21.3.2018 RECOMMENDATIONS COMMISSION RECOMMENDATION (EU) 2018/464 of 19 March 2018 on the monitoring of metals and iodine in seaweed, halophytes and products based on seaweed (Text with EEA relevance) THE EUROPEAN COMMISSION, Having regard to the Treaty on the Functioning of the European Union, and in particular Article 292 thereof, Whereas: (1) For arsenic, cadmium and lead, maximum levels (MLs) for various foodstuffs are established under Commission Regulation (EC) No 1881/2006 (1). However, currently no MLs are established for these substances in seaweed and halophytes, except for the MLs established under this Regulation for food supplements consisting exclusively or mainly of seaweed or products derived from seaweed. (2) For mercury, currently under Regulation (EC) No 396/2005 of the European Parliament and of the Council (2) a maximum residue level (MRL) for algae and prokaryotic organisms is established at the default level of 0,01 mg/kg. (3) In 2006 the Scientific Committee for food established an upper limit for iodine intake of 600 µg/day for adults and of 200 µg a day for children of 1-3 years (3). It indicated that the ingestion of iodine-rich algal products, particularly dried products, can lead to dangerously excessive iodine intakes, if such products contain more than 20 mg iodine/kg dry matter and the exposed population lives in an area of endemic iodine deficiency. (4) Available occurrence data show that seaweeds contain significant concentrations of arsenic, cadmium, iodine, lead and mercury. As halophytes also grow in a marine environment, it can reasonably be assumed that they will show a similar uptake pattern of these substances and by consequence a similar contamination pattern.
    [Show full text]
  • Plants and Ecology 2013:2
    Fucus radicans – Reproduction, adaptation & distribution patterns by Ellen Schagerström Plants & Ecology The Department of Ecology, 2013/2 Environment and Plant Sciences Stockholm University Fucus radicans - Reproduction, adaptation & distribution patterns by Ellen Schagerström Supervisors: Lena Kautsky & Sofia Wikström Plants & Ecology The Department of Ecology, 2013/2 Environment and Plant Sciences Stockholm University Plants & Ecology The Department of Ecology, Environment and Plant Sciences Stockholm University S-106 91 Stockholm Sweden © The Department of Ecology, Environment and Plant Sciences ISSN 1651-9248 Printed by FMV Printcenter Cover: Fucus radicans and Fucus vesiculosus together in a tank. Photo by Ellen Schagerström Summary The Baltic Sea is considered an ecological marginal environment, where both marine and freshwater species struggle to adapt to its ever changing conditions. Fucus vesiculosus (bladderwrack) is commonly seen as the foundation species in the Baltic Sea, as it is the only large perennial macroalgae, forming vast belts down to a depth of about 10 meters. The salinity gradient results in an increasing salinity stress for all marine organisms. This is commonly seen in many species as a reduction in size. What was previously described as a low salinity induced dwarf morph of F. vesiculosus was recently proved to be a separate species, when genetic tools were used. This new species, Fucus radicans (narrow wrack) might be the first endemic species to the Baltic Sea, having separated from its mother species F. vesiculosus as recent as 400 years ago. Fucus radicans is only found in the Bothnian Sea and around the Estonian island Saaremaa. The Swedish/Finnish populations have a surprisingly high level of clonality.
    [Show full text]
  • Indicator Species Fact Sheet Ascophyllum Nodosum, More
    Indicator Species Fact Sheet Rockweed, Ascophyllum nodosum Other Common Names Include: Knotted Wrack, Knotted Kelp Ascophyllum nodosum, more commonly called Rockweed, is a species of brown algae or seaweed that is found along the New England coast. It grows on available hard surfaces, including rocks, shells, and dock pilings. Rockweed averages in length between 20-30 inches and can grow longer where there is less wave action to cause breakage. Why choose this indicator species? Rockweed. J.Muhlin, MMA As a member of the New England coastal habitat, Ascophyllum nodosum has multiple important roles that impact a variety of other marine species. First, the fronds of the rockweed create a protected canopy for organisms. This sheltered habitat hides smaller organisms from predators and can prevent desiccation of intertidal species when the water recedes at low tide. Less visually obvious is the impact that rockweed has on seawater chemistry. Increasing concentrations of carbon dioxide (CO ) in the atmosphere due to the burning of fossil fuels result in an increase in the uptake 2 of CO by the ocean. When CO dissolves in seawater, carbonic acid is formed and the process is called 2 2 “ocean acidification”. A series of chemical reactions between CO and seawater lower the pH, making the 2 water more acidic. This is problematic for shell producing organisms in particular. Photosynthesizers, such as rockweed, require CO and reduce its levels by using it to produce their own food, thereby also 2 regulating the pH. Additionally, oxygen is a helpful byproduct of photosynthesis that many intertidal animal species utilize for respiration.
    [Show full text]
  • Marlin Marine Information Network Information on the Species and Habitats Around the Coasts and Sea of the British Isles
    MarLIN Marine Information Network Information on the species and habitats around the coasts and sea of the British Isles Spiral wrack (Fucus spiralis) MarLIN – Marine Life Information Network Biology and Sensitivity Key Information Review Nicola White 2008-05-29 A report from: The Marine Life Information Network, Marine Biological Association of the United Kingdom. Please note. This MarESA report is a dated version of the online review. Please refer to the website for the most up-to-date version [https://www.marlin.ac.uk/species/detail/1337]. All terms and the MarESA methodology are outlined on the website (https://www.marlin.ac.uk) This review can be cited as: White, N. 2008. Fucus spiralis Spiral wrack. In Tyler-Walters H. and Hiscock K. (eds) Marine Life Information Network: Biology and Sensitivity Key Information Reviews, [on-line]. Plymouth: Marine Biological Association of the United Kingdom. DOI https://dx.doi.org/10.17031/marlinsp.1337.1 The information (TEXT ONLY) provided by the Marine Life Information Network (MarLIN) is licensed under a Creative Commons Attribution-Non-Commercial-Share Alike 2.0 UK: England & Wales License. Note that images and other media featured on this page are each governed by their own terms and conditions and they may or may not be available for reuse. Permissions beyond the scope of this license are available here. Based on a work at www.marlin.ac.uk (page left blank) Date: 2008-05-29 Spiral wrack (Fucus spiralis) - Marine Life Information Network See online review for distribution map Detail of Fucus spiralis fronds. Distribution data supplied by the Ocean Photographer: Keith Hiscock Biogeographic Information System (OBIS).
    [Show full text]
  • Marlin Marine Information Network Information on the Species and Habitats Around the Coasts and Sea of the British Isles
    MarLIN Marine Information Network Information on the species and habitats around the coasts and sea of the British Isles Channelled wrack (Pelvetia canaliculata) MarLIN – Marine Life Information Network Biology and Sensitivity Key Information Review Nicola White 2008-05-29 A report from: The Marine Life Information Network, Marine Biological Association of the United Kingdom. Please note. This MarESA report is a dated version of the online review. Please refer to the website for the most up-to-date version [https://www.marlin.ac.uk/species/detail/1342]. All terms and the MarESA methodology are outlined on the website (https://www.marlin.ac.uk) This review can be cited as: White, N. 2008. Pelvetia canaliculata Channelled wrack. In Tyler-Walters H. and Hiscock K. (eds) Marine Life Information Network: Biology and Sensitivity Key Information Reviews, [on-line]. Plymouth: Marine Biological Association of the United Kingdom. DOI https://dx.doi.org/10.17031/marlinsp.1342.1 The information (TEXT ONLY) provided by the Marine Life Information Network (MarLIN) is licensed under a Creative Commons Attribution-Non-Commercial-Share Alike 2.0 UK: England & Wales License. Note that images and other media featured on this page are each governed by their own terms and conditions and they may or may not be available for reuse. Permissions beyond the scope of this license are available here. Based on a work at www.marlin.ac.uk (page left blank) Date: 2008-05-29 Channelled wrack (Pelvetia canaliculata) - Marine Life Information Network See online review for distribution map Pelvetia canaliculata at the water's edge. Distribution data supplied by the Ocean Photographer: Judith Oakley Biogeographic Information System (OBIS).
    [Show full text]
  • Ascophyllum Distribution Knotted Wrack Is
    This is easily seen along the shoreline throughout Ascophyllum nodosum the year round. Class: Phaeophyceae common on Order: Fucales the shoreline all year round Family: Fucaceae Genus: Ascophyllum Distribution Knotted Wrack is seaweed It is common on the north-western coast of Europe (from of the northern Atlantic northern Norway to Portugal) as well as the east Greenland and extending as far north as the north-eastern coast of North America. It occurs in the Bay the Arctic Ocean. Its of Fundy, Nova Scotia, Prince Edward Island, Baffin Island, southern distribution Hudson Strait, Labrador and Newfoundland. It has been extends as far south as recorded as an accidental introduction to San Francisco, northern Portugal in the California, and as a potentially invasive species eradicated. east and New Jersey on the As well as Knotted Wrack it is known as Rockweed, Norwegian west side of the Atlantic. Kelp, Knotted Kelp, or Egg Wrack. Habitat The species attaches itself to rocks and stones in the middle of It is most abundant on the tidal region. It is found in a range of coastal habitats from sheltered rocky shores in sheltered estuaries to moderately exposed coasts. Often it the mid-intertidal zone (the dominates the inter-tidal zone. Sub-tidal populations are known area that is fully covered to exist in very clear waters such as those of Rhode Island, USA. and uncovered each day) However, an intertidal habitat is more usual. Reproduction Receptacles begin to develop in response to seasonal variations Knotted Wrack is in late spring and early summer. They are oval pods that are dioecious; each plant is initially flat and become inflated, changing from olive green to either male or female.
    [Show full text]
  • Original Article
    Available online at http://www.journalijdr.com ISSN: 2230-9926 International Journal of Development Research Vol. 09, Issue, 01, pp.25214-25215, January, 2019 ORIGINAL RESEARCH ARTICLEORIGINAL RESEARCH ARTICLE OPEN ACCESS SPECIES COMPOSITION, FREQUENCY AND TOTAL DENSITY OF SEAWEEDS *Christina Litaay, Hairati Arfah Centre for Deep Sea Research, Indonesian Institute of Sciences ARTICLE INFO ABSTRACT Article History: This study was conducted to determine the species composition, frequency and total density of Received 27th October, 2018 seaweeds found on the island of Nusalaut. There were 33 species of seaweed. Of the 33 species, Received in revised form 15 were from the class of Chlorophyceae (45.5%), 10 species from Rhodophyceae (30.3%), and 9 14th November, 2018 species from Phaeophyceae (27.3%).Total frequency showed the highest Gracilaria Accepted 01st December, 2018 (Rhodopyceae) of 29.63% in Akoon and Titawaii is 20.34%, while Halimeda (Chloropyceae) of th Published online 30 January, 2019 19.60% found on the Nalahia. Highest total frequency Phaeophyceae (Padina) is 12.96% found on the Akoon. The highest value of total density is village Ameth that is 1984 gr / m² is from the Key Words: Rhodophyceae group (Acantophora), Nalahia is 486 gr/m² from the Cholorophyceae group Frequency, (Halimeda), and Akoon that is 320 gr/m² from the Phaeophyceae group (Padina). Species composition, Seaweed, Total density. Copyright © 2019, Christina Litaay, Hairati Arfah. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Citation: Christina Litaay, Hairati Arfah.
    [Show full text]