The Occurrence of Borrelia Burgdorferi

MASARYKOVA UNIVERZITA

PŘÍRODOVĚDECKÁ FAKULTA

ÚSTAV EXPERIMENTÁLNÍ BIOLOGE

Analýza variability povrchových antigenů patogenní bakterie Borrelia burgdorferi sensu lato

Disertační práce

Adam Norek

ŠKOLITEL: doc. RNDr. Alena Žákovská, Ph.D. BRNO 2016

Bibliografický záznam

Autor: Mgr. Adam Norek

Přírodovědecká fakulta, Masarykova univerzita

Ústav experimentální biologie

Název práce: Analýza variability povrchových antigenů patogenní bakterie Borrelia burgdorferi sensu lato

Studijní program: Biologie

Studijní obor: Fyziologie živočichů

Školitel: Doc. RNDr. Alena Žákovská, Ph.D.

Přírodovědecká fakulta, Masarykova univerzita

Ústav experimentální biologie

Akademický rok: 2016

Počet stran: 123

Klíčová slova: Borrelia burgdorferi, klíště, komár, roztoč, blecha, PCR, flagellin, OspC, monoklonální protilátka, epitop Bibliographic Entry

Author: Mgr. Adam Norek

Faculty of Science, Masaryk University

Department of Experimental Biology

Title of Dissertation: Surface proteins variability analysis of pathogenic bacterium Borrelia burgdorferi sensu lato

Degree Programme: Biology

Field of Study: Animal Physiology

Supervisor: Doc. RNDr. Alena Žákovská, Ph.D.

Faculty of Science, Masaryk University

Department of Experimental Biology

Academic Year: 2016

Number of Pages: 123

Key words: Borrelia burgdorferi, Tick, Mosquito, Mite, Flea, PCR, flagellin, OspC, monoclonal antibody, epitope Abstrakt:

Bakterie řazené do skupiny Borrelia burgdorferi sensu lato, jsou významnými patogeny, známé svojí vysokou variabilitou. Ta se projevuje nejen na úrovni životního cyklu, ale také na úrovni genetické a antigenní výbavy. V této práci jsme se zaměřili na vliv popisované heterogenity na úrovni hematofágních členovců a zastoupení genospecies či jednotlivých kmenů na lokální úrovní. Naše výsledky potvrdily přítomnost borrelií nejen v tkáních klíšťat, ale také larvách komárů (Culex), blech (Siphonaptera) a roztočů (Mesostigmata). Zároveň se nám podařilo identifikovat borrelie izolované z klíšťat sesbíraných na lokalitě Brno- Pisárky (B. afzelii, B. garinii) a tyto kmeny přiřadit k sedmi různým ospC fylogenetickým typům. V závěrečné části jsme se pak zaměřili na zhodnocení vlivu variability OspC proteinu z pohledu protilátkové odpovědi, kdy se nám podařilo identifikovat tři částečně konzervované epitopy ve variabilní oblasti, z nichž jeden (2D1) je zastoupen u více než 59 % porovnávaných OspC sekvencí.

Abstract:

Bacteria belonging to Borrelia burgdorferi sensu lato complex are well known as highly variable. This variability is pronounced not only in the life cycle but at the genetic and antigenic level too. In our work, we try to determine the influence of described diversity in haematophagous invertebrates as well as in genospecies prevalence. Our results confirmed the presence of B. burgdorferi s.l. not only in the tick tissues but mosquito larvae (Culex), flies (Siphonaptera) and mites (Mesostigmata) as well. Moreover, we have genotyped B. burgdorferi s.l. strains previously isolated at Brno-Pisárky locality (B. garinii, B. afzelii) and seven different ospC phylogenetic types were assigned. In the last part of we focus on the evaluation of OspC heterogenicity from the immunologic point of view, when we identified three partially conserved epitopes in the variable part of OspC with the 2D1 epitope present in more than 59 % of compared OspC amino acid sequences.

Seznam tabulek ...... 2 Seznam obrázků ...... 2 Seznam použitých zkratek ...... 3

Předmluva ...... 5

Literární rešerše ...... 6 1. Úvod ...... 6 2. Borrelia burgdorferi sensu lato ...... 8 2.1. Zařazení do systému organismů ...... 8 2.2. Morfologie ...... 10 2.3. Genetická výbava ...... 11 Lineární chromozom ...... 11 Plazmidová DNA ...... 12 2.4. Proteiny vnější membrány ...... 13 Integrální membránové proteiny ...... 15 Lipoproteiny ...... 16 2.5. Životní cyklus Bbsl ...... 19 Přenašeči Bbsl ...... 20 Rezervoároví hostitelé ...... 21 2.6. OspC (Outer surface protein C) ...... 23 Gen pro OspC ...... 23 Exprese a posttranslační modifikace OspC ...... 24 Terciální struktura OspC ...... 25 Funkce OspC ...... 27 2.7. Shrnutí ...... 28

Praktická část ...... 29 3. Výsledky ...... 29 Publikace I...... 30 Publikace II...... 35 Publikace III...... 41 Publikace IV...... 48 Publikace V...... 55

Závěr ...... 98 Seznam použité literatury ...... 99

1 Seznam tabulek

Tabulka 1 str. 9

Seznam obrázků

Obrázek 1 str. 10

Obrázek 2 str. 11

Obrázek 3 str. 14

Obrázek 4 str. 18

Obrázek 5 str. 20

Obrázek 6 str. 25

Obrázek 7 str. 26

2 Seznam použitých zkratek

16S rRNA 16S ribosomal RNA BamA β-barrel assembly machine BBA64 Mammal associated membrane anchored protein BBK32 Vector associated fibronectin binding protein Bbsl Borrelia burgdorferi sensu lato BesC Borrelia Efflux System protein C BptA Borrelia Persistence in Ticks A C1 Complex activated in classical complement pathway C3 Complement component C5b, C6, C7, C8 Membrane attack complex subunits C9 Pore forming subunit cp Circular Plasmid CRASPs Complement Regulator-Acquiring Surface Proteins CspA Complement-acquiring Surface Protein A DbpA a B Decorin Binding Protein A a B DFM Dark Field Microscopy DipA Dicarboxylate-specific Porin A Erp OspEF Related Protein (analogicky ErpG, ErpL, ErpX,...) faktor H complement regulatory factor FHL-2 Factor H Like protein - 2 FlaB, flaB Flagellin B Dsr Small non-coding RNA chaperone LBD1 a LBD2 Ligand Binding Domain 1 a 2 Lgt proLipoprotein diacylGlyceryl Transferase Lnt apoLipoprotein N-acyl Transferase Lol Lipoprotein Outer membrane Localization lp Linear Plasmid Lps Lipoprotein Signal Peptidase Osp, osp Outer Surface Protein (analogicky OspA, OspB...) P13 (BB0034) 13 kDa membrane integrated protein P66 (BB0603) Integrin binding and channel forming protein

3 ResT Resolving Telomerase enzyme Hfq B. burgdorferi specific chaperon RpoN (σ54) Alternative sigma factor RpoS, rpoS Alternative sigma factor Rrp2 Two component Response Regulator Sec General Secrethory pathway TROSPA Tick Receptor for OspA) VlsE Variable major protein-Like Sequence

4 PŘEDMLUVA

Předkládaná disertační práce, která se zaměřuje na původce Lymeské boreliózy, vznikala v úzké spolupráci dvou pracovišť Masarykovi univerzity v Brně.

První, epidemiologická část, zaměřená na detekci Borrelia burgdorferi sensu lato v netradičních hematofágních členovcích a detekci genospecies Borrelia burgdorferi, byla vypracována z větší části na Ústavu experimentální biologie Přírodovědecké fakulty Brno pod vedením mé školitelky Doc. Aleny Žákovské a s nemalým přispěním zaměstnanců firmy GeneProof a.s.

Druhá část, zabývající se identifikací epitopů OspC proteinu, probíhala z větší části v Národním centru strukturní biologie Josefa Dadoka pod dozorem a se značným přínosem Dr. Lubomíra Jandy, který se našeho společného projektu ujal a našel pro něj místo ve své laboratoři.

Oběma zmíněným velmi děkuji za ochotu, trpělivost a cennou pomoc, které se mi od nich dostávalo a dostává každý den.

Mé veliké díky patří i mým rodičům, studentkám Silvii a Nikole a dlouhé řadě kolegyň a kolegů, se kterými jsem se během studia setkal.

Zvláštní místo v tomto seznam pak zaujímá moje nejdražší žena Jitka, u níž jsem vždy našel podporu, pochopení a bez níž by to prostě nešlo.

5 LITERÁRNÍ REŠERŠE

1. Úvod

Bakterie ze skupiny Borrelia burgdorferi sensu lato (Bbsl) jsou obligátní parazité, jejichž někteří zástupci jsou původci onemocnění Lymeská borelióza [1–3]. Toto multisystémové infekční onemocnění je jednou z nejčastějších zoonóz Severní polokoule, které je na člověka přenášena prostřednictvím klíšťat (Ixodidae), infikovaných během svého životního cyklu na široké škále rezervoárových živočichů zahrnujících zástupce z třídy savců, ptáků i plazů [4–8]. Aktivní uplatnění jiných hematofágních členovců (komáři, blechy, roztoči,...) v životním cyklu Bbsl zatím nebylo potvrzeno [9–12].

Bbsl je díky značně redukované metabolické výbavě neschopná přežít mimo hostitelský organismus [13–15]. Z tohoto důvodu je přenos z jednoho typu hostitele na druhý provázen relativně krátkou tranzitní fází charakteristickou změnou expresního profilu, jež umožňuje borreliím kolonizovat novou ekologickou niku [16–19]. Mimo aktivní interakci s komponenty vrozené a získané imunity v krátkodobém horizontu se u perzistentních infekcí uvažuje také o uplatnění změn morfologické stavby spojené s přechodem do reverzibilních klidových forem, cyst, schopných dlouhodobě přežívat v nepříznivých podmínkách [20–23].

Za vysokou míru adaptability umožňující střídání výrazně odlišných hostitelů jsou do velké míry zodpovědné povrchové proteiny, které se podílejí na adhezi ke tkáním hostitelů, potlačení imunitní reakce, vnímavosti k okolnímu prostředí a získávání esenciálních živin a to zejména lipoproteiny, kterým Bbsl dedikuje 8 % své genetické výbavy [13,18,24–31].

Jedním z klíčových povrchových proteinů je lipoprotein OspC, který se uplatňuje při potlačování účinků vrozené imunity savců a diseminaci borrélií z místa primární infekce [32–35]. Tento vysoce variabilní protein je známý svou vysokou imunogenicitou, která je zodpovědná za protilátkovou odpověď [36–38]. Této

6 vlastnosti se využívá v rutinních serologických testech k průkazu onemocnění Lymeská borelióza [39–41] a při vývoji potencionálních vakcín k potlačení infekce Bbsl [42,43].

7 2. Borrelia burgdorferi sensu lato

2.1. Zařazení do systému organismů

Bakterie ze skupiny Borrelia burgdorferi s.l. jsou v systému organismů řazeny do kmene a třídy Spirochaetes, řádu Spirochatetales. Společně s rody Brevinema. Cristispira, Spironema, Spirocheta a Treponema jsou začleněny do čeledi Spirochaetaceae. Rod Borrelia je dále členěn do dvou skupin, a to na borrelie příbuzné s B. hermsii – původce onemocnění návratná horečka a borrelie řadící se ke skupině bakterií asociovaných s Lymeskou boreliózou a souhrnně popisovaných jako B. burdoferi sensu lato [2,3,44].

Na základě genetických a serologických znaků se skupina B. burgdorferi sensu lato dále dělí na jednotlivé genospecies, které se vzájemně liší genotypem nebo popřípadě i fenotypem, avšak s obtížně definovatelným projevem. Celková genetická odlišnost mezi jednotlivými genospecies je přibližně 9 %, u 16S ribosomální RNA je to 1 – 2 % [44,45,45–50].

V současnosti je ve skupině B. Burgdorferi sensu lato 22 genospecies (Tabulka 1). U 13 genospecies byl popsán vztah k lidské formě onemocnění Lymeská borelióza nebo onemocnění s podobnými klinickými příznaky. V Severní Americe jsou nejčastěji detekovány B. burgdorferi sensu stricto, vzácněji B. americana, B. andesonii, B. mayonii, B. kurtebachii a B. bissettii. V Evropě pak převažují B. garinii, B. afzelii, B. bavariensis a B. burgdorferii sensu stricto, méně často jsou detekovány B. valaisiana, B. lusitaniae a B. bissettii.

Genospecies Geografická distribuce Autor Zdroj 1 B. afzelii Evropa Canica et al. [51] 2 B. americana USA Rudenko et al. [52] 3 B. andersonii USA Marconi et al. [53] 4 B. bavariensis Evropa, Asie Margos et al. [54] 5 B. bissettii Evropa, USA Postic et al. [55] 6 B. burgdorferi Evropa, USA Baranton et al. [44] 7 B. californiensis USA Postic et al. [56] 8 B. carolinensis USA Rudenko et al. [57] 9 B. chilensis Jižní Amerika Ivanova et al. [58] 10 B. finlandensis Evropa Casjens et al. [59] 11 B. garinii Evropa, Asie Baranton et al. [44] 12 B. kurtenbachii USA Margos et al. [60] 13 B. lusitaniae Evropa Le Fleche et al. [61] 14 B. japonica Japonsko Kawabata et al. [46] 15 B. sinica Čína Masuzawa et al. [62] 16 B. spielmanii Evropa Richter et al. [63] 17 B. tanukii Japan Fukunaga et al. [64] 18 B. turdi Japan Fukunaga et al. [64] 19 B. valaisiana Evropa, Asie Wang et al. [47] 20 B. yangtzensis Asie Chu et al. [65] 21 B. ruskii sp. nov. Asie Alekseev at al. [66] 22 B. mayonii USA Pritt et al. [67]

Tabulka 1: Seznam identifikovaných genospecies Bbsl a jejich geografická distribuce. Tučně jsou zvýrazněny genospecies s potenciálem infikovat člověka

V Asii a Evropské části Ruské federace se ke klinicky významným kmenům řadí zejména B. burgdorferi sensu stricto, B. garinii, B. afzelii a B. bavariensis; u B. yangtze, (blízce příbuzné k B. valaisiana) nebyl infekční potenciál doposud určen (Obrázek 1) [68,69].

9 G. Margos et al. / Infection, Genetics and Evolution 11 (2011) 1545–1563 1553

B. burgdorferi s.s . B. valaisiana B. garinii B. afzelii B. spielmanii B. kurtenbachii B. bavariensis

B. andersonii

B. tanukii B. californiensis B. turdi B. bissettii B. japonica

B. sinica B. americana B. lusitaniae B. yangtze

B. carolinensis

B. garinii

Fig. 4. Map showing the global distribution of the LB species. The shaded areas show the distribution of tick vectors. Seven species of LB group spirochetes are found in North America, eight species in Europe, and eight species in Asia, two species overlap in the Old and New Worlds, three in Europe and Asia (see text for details).

1994; Norris et al., 1999; Picken et al., 1995; Postic et al., 1998). sidering the varied ecological adaptations of the pathogens, partic- Although it hadObrázek 1 been reported: Genografická distribuce genospecies Bbsl. (Převzato z Margos et al. 2011 that B. bissettii can be transmitted ularly differences in host specificity[48] (Dubska). et al., 2009; by I. scapularis under experimental conditions (Oliver, 1996), B. bis- Hanincova et al., 2003a,b; Hu et al., 1997, 2001; Huegli et al., settii has not been found in questing I. scapularis. Similarly, B. kur- 2002; Kurtenbach et al., 2001; Taragel’ova et al., 2008). The varia- tenbachii has been isolated from host-derived larvae and DNA has tion in host specialization makes the LB group of spirochetes an been isolated from one2.2. questing Morfologie adult I. scapularis (Anderson ideal model to directly contrast the effects of host specialization et al., 1988; Ogden et al., 2011; Picken and Picken, 2000) but the on the geographic distribution of pathogens. As ticks cannot move species has rarely been found in I. scapularis dominated habitats over large distances independently (Falco and Fish, 1991), it has in recent years (Gatewood et al., 2009; Hamer et al., 2007; Hoen been suggested that the spread of LB spirochetes is linked to the et al., 2009; Ogden et al., 2011; Oliver et al., 2006). If generalist vec- movement of their hosts (Kurtenbach et al., 2002c). In addition tors are able toSpirochaetes transmit under experimental a tedy i conditions borrélie LB jsou group charakterizovány to being of public health jako importance, pohyblivé the delineation bakterie and monitor- species that are usually transmitted by endophilic vectors, the ing of the geographic ranges of the different LB species also pro- question arises, whyse specifickou does it not happen šroubovicovitou more frequently in natural stavbou. vides Bakteriální opportunities tělo to examine je výrazně in more general protáhlé terms the role of transmission cycles, why are these species not more widely dis- host ecology in the epidemiology of vector-borne zoonoses. tributed and whats pravidelným závity (4 limits their distribution? - 15). Délka Bbsl se pohybuje v rozmezí 4 – 30 μm a její The species with the widest distribution in North America is B. 6.1. Europe and Asia burgdorferi, rangingprůměr from NE, je to Upper asi Midwest0,2 – (MW)0,3 andμm. Western Na průřezu je patrná gram-negativní stavba States. It also occurs in some Southern States and Southern Canada, MLSA on housekeeping genes has revealed differences in the le- within the distributionse středovým ranges of I. scapularis protoplasmatickým , I. pacificus, and I. aff- válcem vel of obaleným geographic structuring vnitřní of cytoplasmatickou populations of LB species that are inis. Interestingly, in North Carolina, it was found predominantly in consistent with distribution patterns of their different vertebrate I. affinis but not membránou a pružnou peptidoglykanovou vrstvou. Vnější membrána je tvořena I. scapularis and occured sympatrically with B. bis- hosts (Vitorino et al., 2008; Vollmer et al., 2011). settii (Maggi et al., 2010). In the NE B. burgdorferi appears to be the Vitorino et al. (2008) investigated B. lusitaniae, a species that has only LB specieslipidickou transmitted bydvouvrstvou, I. scapularis. Climatic která conditions na rozdíl been od ostatních associated with gram lizards,-negativních from two geographic bakterií regions in Por- impacting tick phenology may favour selection of certain strains tugal (Mafra and Grandola), which are approximately 160 km apart (Diuk-Wasser etpostrádá al., 2006; Gatewood lipopolysacharidy. et al., 2009; Ogden Mezi et al., vnější and located a vnitřní north and membránou south of Lisbon. se A pronounced nachází fine-scale 2007). Both, B. burgdorferi and B. bissettii have been recorded in phylogeographic population structure was observed where most Europe and Northperiplasmatický America (Postic et al., prostor 1998; Gern, andv němž Humair, jsou strains uloženy from Mafra bičíky clustered (7 separately-11), endoflagella. from Grandola strains (Vit- 2002). In Europe, B. bissettii has been mainly described from human orino et al., 2008). The authors suggested that this distribution re- patients (PickenEndofllagela et al., 1996a,b; Rudenko jsou ukotvena et al., 2008) but na has pólech only buněčnflects theého highly těla parapatric a obtáčejí population tělo structure borrélie of lizards on the rarely been found in questing I. ricinus ticks (Hulinska et al., 2007). Iberian peninsula (Paulo et al., 2008). Curiously, humanve infection směru with k opačným B. bissetti in the koncům USA has not bakterie. been Jejich Vollmer rotací and co-authors dochází (Vollmer k prohýbání et al., 2011 vnější ) tested the predic- reported. Continued study of field-collected samples will likely tion that host movement determines spirochete biogeography by continue to increasemembrány the number a of smršťování known Borrelia species těla borrelie (Scott characterising a tím k pohybu. B. garinii, B. Díky valaisiana, uložení and B. bičíků afzelii from various et al., 2010). sites in Europe (Great Britain, France, Germany, Latvia). MLSA of pod vnější membránou a úzkému profilu se borrelie dokáží pohybovat i vethe rodent-associated species, B. afzelii, showed velmi a population struc- 6. Population structure and dispersal patterns of LB species ture that signified restricted movement of strains between geo- viskózním prostředí hostitelských tkání [3,70graphic–75] regions.. This differentiation was pronounced: only two B. Host specialization is an important factor in vector-borne dis- afzelii STs have been found in more than one geographic location eases, and different vector-borne pathogens show varying levels (Fig. 5, Panel C). These data suggested that the English Channel and patterns of host specialization. An accurate understanding of may act as a barrier to the movement of B. afzelii strains between the epidemiology of many zoonoses can only be achieved by con- Great Britain and continental Europe (Vollmer et al., 2011). Chinese

10 2.3. Genetická výbava

Lineární chromozom

Genom Bbsl je v porovnání s jinými bakteriemi organizován velmi netypickým způsobem. Dědičná informace je uložena v jednom lineárním plazmidu (lineární chromozom, cca 1 Mbp) a velkém počtu kruhových (cp – circular plasmid, 5 – 9) a lineárních plazmidů (lp – linear plasmid, 8-12) (Obrázek 2). Celková velikost genetické výbavy je velmi malá a pohybuje se kolem 1,3 Mbp [13]. Přibližně 1250 genů u B. burgdorferi sensu stricto a 1050 – 1300 genů u jiných zástupců skupiny Bbsl představuje jádro genetické výbavy, které je konzervované napříč všemi zástupci, a to včetně zachování poměrů mezi jednotlivými funkčními kategoriemi. 31% z těchto genů kóduje proteiny, které jsou unikátní a doposud nebyli identifikováni ani sekvenční homologové ani příbuzné domény a motivy mimo rod Borrelia [46,47,50,59,68,76].

Obrázek 2: Schématické zobrazení organizace genetického materiálu Bbsl Kruhové (cp) a lineární (lp) plazmidy jsou označené číslem odpovídajícím jejich přibližné molekulové hmotnosti v kilo bázích. Červeně jsou zvýrazněny plazmidy důležité pro udržení Bbsl v hostitelském organismu. (převzato z Stewart et al., 2004 [77]).

11 Referenční analýza genomu B. burgdorferi sensu stricto BR31 prokázala přítomnost 853 otevřených čtecích rámců na lineárním chromozomu (93 % DNA je kódující) [13]. Genetické studie porovnávající rozdíly mezi hlavními genospecies (Bbss, B. afzelii, B. garinii, B. bavariensis, B. valaisiana) ukazují, že lineární chromosom je poměrně stabilní s celkovou identitou 99 – 93 % v závislosti na příbuznosti. Vyšší míra variability (délkové i sekvenční) byla detekována pouze na 3‘-konci lineárního chromozomu a je způsobena rekombinacemi tohoto úseku s DNA z různých plazmidů v průběhu vývoje (až 20 kbp) [25,78]. Tato genetická stabilita naznačuje [79], že geny zodpovědné za preferenci k hostitelskému organismu, infekční potenciál a schopnost úniku před účinky imunitního systému, jsou vázány převážně na plazmidy [29,80–83].

Plazmidová DNA

Plazmidová DNA nese přibližně 30 % veškeré genetické informace Bbsl, což je více než bylo popsáno u kteréhokoliv jiného zástupce bakterií [13,18]. Na rozdíl od lineárního chromozomu, v němž je kódována většina house-keeping genů zodpovědných za replikaci, transkripci, translaci, energetický metabolismus a transport, jsou na plazmidech z větší části uloženy geny zodpovědné za produkci povrchových proteinů, které zprostředkovávají interakce mezi borrelií a jejími savčími a bezobratlými hostiteli [13,81,84–86]. Ačkoliv se počet plazmidů a jejich skladba (lp vs. cp) u jednotlivých genospecies liší, velké množství genů je v těchto uspořádáních zachováno v podobě ortologů. Při porovnání lineárních a kruhových plazmidů lze u dříve zmíněných nalézt značné množství pseudogenů a nekódujících sekvencí [79,87–89].

Cirkulární plazmidy hrají u borrelií v porovnání s jinými bakteriemi menší roli v množství uložené genetické informace [79,90]. Na druhou stranu jsou geneticky mnohem stabilnější a nesou méně pseudogenů, než jejich lineární varianty [79,91]. Mimo cp26 jsou všechny cirkulární plasmidy odvozeny od cp32 (profág) a sdílejí velkou míru podobnosti včetně zkrácených variant cp9 a cp18. Znaky cp32 byly nalezeny i v lineárních plasmidech lp54 a lp56. Mechanismus transdukce Cp32 je také zřejmě zodpovědný za laterální transfer plazmidové DNA. Kromě proteinů bakteriofága (terminaza, holiny) nesou

12 cp32 plazmidy gen pro vysoce variabilní Erp proteiny uplatňující se při vazbě faktoru H, klíčové komponenty savčí vrozené imunity [84,92–94]. Mimo cp32 rodinu se u všech genospecies nalézá cp26, u něhož nedochází k jeho ztrátě ani v průběhu pasážování [28,95,96]. Na tomto plazmidu je uloženo 29 genů, z nichž 15 je pro přežití borrelie nezbytných, zejména pak gen pro ResT enzym, podílející se na rozpuštění telomer lineárních plazmidů a jejich replikaci [13,97]. Dalším důležitým genem uloženým na cp26 je gen pro OspC, jež je jedním z důležitých faktorů virulence u obratlovců [96,98–100].

Organizace DNA do lineárních elementů s telomerami poskytuje možnost rychlé rekombinace. To je velmi výhodné zejména při rekombinacích kazet v exponovaných oblastech antigenů, jako je tomu například u VlsE proteinu kódovaném na lp28-1 [13]. Při jeho expresi dochází k rekombinaci mlčících kazet do lokusu umístěném na 3‘-konci plazmidu a tím změně aminokyselinové sekvence a potažmo vystavených epitopů, což je jeden z nástrojů, jímž se borrelie brání účinkům získané imunity [101–103].

Z pohledu genetické stability jsou nejvýznamnější plazmidy lp54, cp26 a cp32. Jejich celková variabilita je menší než 4% s výjimkou cp26 nesoucím vysoce variabilní gen pro OspC. Ostatní geny na tomto plazmidu jsou konzervované [25,79].

2.4. Proteiny vnější membrány

Výše popsaná genetická variabilita je nevíce patrná na rozhraní mezi borrelií a jejím hostitelem, které je tvořeno vnější povrchovou membránou. Na této membráně sídlí proteiny, které se aktivně uplatňují při interakcích s okolním prostředím a jejichž exprese je ovlivněna typem hostitelského organismu, v němž se borrelie nacházejí (Obrázek 3). Povrchové proteiny jsou zodpovědné za transport esenciálních živin, které si borrelie díky limitované metabolické výbavě nedokáží syntetizovat, adhezi k okolním tkáním, resistenci k antibiotikům, tvorbě pórů a v neposlední řadě za regulaci imunitní odpověď hostitele [104–110].

Kenedy et al. Page 26 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 1. Obrázek 3: Schématické znázornění změny expresního profilu povrchových proteinů Bbsl v prostředí klíštěcí (nahoře) a savčí (dole) tkáně (převzato z Kenedy 2011 [111])

Ke změně expresního profilu povrchových proteinů dochází v důsledku změn v okolním prostředí (pH, teplota), parciálních tlaků rozpuštěných plynů a celkového množství borrelií. Jednou z drah podílejících se na regulaci exprimovaných proteinů je RpoN-RpoS (alternativní sigma faktory RNA polymerázy) signální dráha podílející se například na reciprocitě OspA/OspC proteinů [16,105,112,113]. Jiný princip je využíván například při záměně VlsE variabilních oblastí, kde se uplatňuje kontinuální rekombinace, která umožňuje únik před účinky imunitního systému obratlovců [102,103].

Proteiny vnější povrchové membrány mohou být rozděleny do dvou základních FEMS Immunol Med Microbiol. Author manuscript; available in PMC 2013 October 01. kategorií v závislosti na jejich struktuře: 1) integrální membránové proteiny s β-soudkovou strukturou ukotvenými do membrány pomocí transmembránového helixu a 2) proteiny ukotvené do vnější membrány prostřednictvím N-terminální lipidické komponenty.

14 Integrální membránové proteiny

Integrální membránové proteiny se podílejí na získávání živin, resistenci k antibiotikům, interakcích s hostitelskými organismy a tvorbě pórů. Geny pro jejich expresi se nacházejí na linearním chromozomu a jejich počet se odhaduje na 40-50 [110,114,115]. Z nich bylo identifikováno pouze 10 a podrobněji popsáno 5: BamA (BB0795), BesC (BB0142), DipA (BB0418), P66 (BB0603) a P13 (BB0034).

BamA je ortolog β-barrel assembly machine (BAM), charakteristický pro všechny dvoumembránové bakterie s vysokou mírou konzervovanosti. Příbuzné proteiny byly identifikovány i na eukaryotních organelách (chloroplasty, mitochondrie). Tyto proteiny jsou součástí multiproteinového komplexu podílejícího se na integraci β-soudkových integrálních proteinů do vnější membrány [116,117].

BesC (Borrelia efflux systém protein C) tvoří společně s BesA a BesB RND efluxní systém (bacterial resistence-nodulation-division protein systém) zodpovědný za rezistenci vůči antibiotikům včetně přirozených biocidních látek v hostitelských organismech [13,118].

DipA (dicarboxylate-specific porin) se podílí na přenosu dikarboxylových aniontů a odvozených metabolitů (malát, jantarát, oxalacetáta, ...), které borrelie nedokáže syntetizovat. Jeho analog porin Oms38 byl identifikován i u borrelií způsobujících návratnou horečku [13,107].

P66 je 66 kDa velký povrchový antigen s imunogenními vlastnostmi. Tento protein se podílí na tvorbě nespecifického porinu (póry 2,6 nm), který je navíc schopen interagovat s β1 a β3 řetězcem integrinů při adhezi na tkáně obratlovčích hostitelů. V klíštěti se neexprimuje [24,115].

P13 je 13 kDa velký povrchový antigen, který se řadí mezi poriny a je zodpovědný za transport kationtů. Jeho význam pro Bbsl dokládají četné ortology, které jsou však kódovány na plazmidech. P13 se ze skupiny integrálních membránových proteinů vymyká svou strukturou, neboť

15 je do membrány na rozdíl od ostatních zástupců uchycen prostřednictvím transmembránového α-helixu [119–121].

Lipoproteiny

Lipoproteiny hrají v životním cyklu Bbsl velmi důležitou roli. Jednak jako povrchově vázané hrají významnou úlohu při zprostředkování interakce s tkání hostitele, adhezi ke tkáním, potlačování účinku imunitního systému a také jsou považovány za významné faktory virulence. Navíc, díky své vazbě na chromozomy, mohou být potencionálně přenášeny mezi borreliemi navzájem. Na základě jejich funkce mohou být lipoproteiny rozděleny do čtyř skupin a to na: 1) lipoproteiny zajišťující adhezi ke tkáním klíštěte; 2) lipoproteiny uplatňující se v přenosu Bbsl; 3) lipoproteiny podílející se na adhezi ke tkáním obratlovců; a 4) lipoproteiny potlačující účinky imunitního systému.

Lipoproteiny zprostředkovávající adhezi ke klíštěcí tkáni

OspA/OspB (Outer surface protein A a B) - tyto 31 kDa, respektive 34 kDa strukturně i sekvenčně příbuzné proteiny náležející do společného kontigu na lp54 jsou exprimovány v trávícím traktu klíštěte v době, kdy klíště není nasáté krví. OspA i OspB sdílejí zřejmě společný ligand TROSPA (Tick Receptor for OspA), který váží přes pozitivně nabitou oblast na C-terminálním konci. Studie mutantních kmenů Bbsl prokázaly, že OspA je vůči OspB redundantní a dokáže z větší části nahradit jeho funkci, ale opačně dochází k eliminaci schopnosti borrélie kolonizovat trávící trakt klíštěte. Exprese obou proteinů je ukončena po nasátí čerstvé krve, kdy borrélie začínají migrovat do slinných žláz [27,85,122].

OspD (Outer surface protein D) je kódovaný na lp38 a jeho exprese je indukována změnou teploty prostředí. Její maximum je dosaženo v době, kdy nasáté klíště opouští obratlovčího hostitele. Bylo prokázáno, že tento protein váže extrakt z klíštěcího trávícího traktu, nicméně pro udržení Bbsl v ekosystému není zásadní [123,124].

16 BptA (Borrelia persistence in ticks A) je protein, jehož gen je uložen na lp25. Ačkoliv je tento protein exprimován již v obratlovčím hostiteli (zřejmě v důsledku sání klíštěte), jeho uplatnění bylo prokázáno v klíštěti. Studie s mutantními variantami Bbsl ukázala, že BptA protein je nezbytný pro udržení populace borrelií v tranzitní fázi, kdy klíště přechází z nižšího vývojového stádia do vyššího [82,125].

Lipoproteiny uplatňující se v přenosu Bbsl

BBA64 je 35 kDa protein (P35). Jeho gen, který byl lokalizován na lp54, je aktivní v prostředí savčího hostitele. Jeho indukce je zahájena v době sání klíštěte a udržována v časné fázi infekce. Ačkoliv jeho přesná funkce není známa, bylo prokázáno, že u borrelií postrádajících BBA64 je silně potlačena schopnost kolonizovat myšího hostitele [126–128].

OspC – viz. kapitola 1.2.6

Lipoproteiny podílející se na adhezi k obratlovčím tkáním

DbpA/DbpB (decorin binding protein A a B) kódované na lp54 vykazují afinitu k savčímu decorinu, proteinu, který se váže na kolagen pojivové tkáně. Oba proteiny jsou exprimovány v savčím organismu, kde zřejmě zprostředkovávají vazbu borrelií k epiteliálním buňkám. Experimenty s mutantními kmeny neprokázaly přímou účast DbpA/B na vznik infekce. Spíše se uplatňují během pozdějších fází, tedy během diseminace a persistentní infekce ve tkáních bohatých na decorin [129–132].

BBK32 je 47 kDa velký protein, u něhož byla prokázána schopnost vazby k fibronektinu, dermatant sulfátu a heparin sulfátu. Jeho gen, lokalizovaný na lp36 je aktivní v době sání klíštěte a následné infekci savčího hostitele. Díky své afinitě ke glykoproteinům je považovaný za jeden z adherinů zprostředkovávající interakci Bbsl s cévními elementy v průběhu diseminace a je zodpovědný za kolonizaci kloubních elementů. Navíc bylo prokázáno, že se podílí na utlumení imunitní odezvy hostitele blokováním C1 komplexu

17 komplementu [133–137].

OspF (Outer surface protein F) - tento protein s proměnným místem v genomu Bbsl je považován za jednoho z možných kandidátů zodpovědných za adhezi k srdeční tkáni, močovému měchýři a kloubní tkáni. Uplatňuje se tedy v pozdějších fázích infekce savců [17,18,138,139].

Lipoproteiny potlačující účinky imunitního systému

VlsE (variable major protein-like sequence, 35 kDa) je kódován na lp28 a jeho gen se skládá z expresního místa a 15 mlčících kazet, které se přes své konzervované oblasti rekombinují, čímž dochází k záměně povrchových aminokyselin tohoto proteinu, a to v řádu dnů (Obrázek 4). K rekombinaci dochází během celé doby trvání infekce a její rychlost se zvyšuje. K jejímu spuštění dochází až v imunokompetentním hostiteli a tento mechanismus brání v úspěšném rozpoznání VlsE specifickými protilátkami a tím eradikaci borrelií z hostitelského organismu [102,140–143].

Obrázek 4: Schéma organizace genu vlsE (A), míry variability (B) a mechanismu rekombinace (c) (převzato z Norris et al., 2014 [144]).

CRASPs (complement regulator-acquiring surface proteins) je třída proteinů schopná na svém povrchu imobilizovat faktor-H a faktor-H podobné proteiny (CFHR), které jsou zodpovědné za potlačení aktivity komplementu savců. Tímto způsobem se Bbsl aktivně brání aktivaci alternativní kaskády komplementové

18 reakce. Do této třídy proteinů jsou řazeny proteiny příbuzné k OspE (OspE, CspA, CspZ, ErpA, ErpC and ErpG), kódované na různých variantách cp32. Jejich aktivita je podobná a liší se místem své funkce. OspE se například uplatňuje v těle savčího hostitele, zatímco CspA se podílí na potlačení aktivity komplementu z nasáté krve v těle klíštěte [18,29,145–147]. ErpG, ErpL, ErpX a ErpY jsou popisovány jako regulátory aktivace komplementu jen u domestikovaných zvířat [148].

2.5. Životní cyklus Bbsl

Borrelia burgdorferi sensu lato je obligatorní parazit neschopný přežít mimo hostitelský organismus. V ekosystému je udržována v širokém spektru rezervoárových zvířat, mezi nimiž je přenášena vývojovými stádii klíšťat z rodu Ixodidae. Uplatnění jiných hematofágních členovců jako kompetentních vektorů je doposud neprokázané [9–12,149].

Naivní vývojové stádium klíštěte (larva, nymfa) je infikováno při sání na rezervoárovém hostiteli, tedy organismu (většinou drobní savci), v němž borrelie dlouhodobě přežívají. Borrelie se po nasátí exponenciálně množí a osidlují střevo klíštěte, kde zůstávají dormantní až do okamžiku, kdy dojde ke svlečení a přechodu klíštěte do dalšího vývojového stádia (nymfa, dospělec). Po nasátí čerstvou krví následovanou změnou proteinů exprimovaných na povrchu Bbsl se borrelie uvolňují z trávícího traktu klíštěte a diseminují do tělních orgánů včetně slinných žláz, odkud jsou spolu s jejich výměšky přeneseny do nového obratlovčího hostitele [149–153]. K přenosu borrelií na nového hostitele dochází v časovém horizontu 24 – 48 hodin, v případech vysokého počtu spirochét může přenos probíhat i rychleji [154,155].

V důsledku vazby borrelií na životní cyklus klíštěte je riziko nákazy/přenosu na nového hostitele sezónní a kopíruje aktivitu klíšťat. Tato aktivita opisuje biomodální křivku s prvním výrazným maximem v jarních měsících a nižším maximem na přelomu srpna a září [156]. Aktivita jednotlivých vývojových stádií

19 při hledání hostitelů je přitom závislá na aktuálních povětrnostních podmínkách (teplota, vlhkost vzduchu), a tudíž může bimodální charakter vymizet [156–158].

Přenašeči Bbsl

Za hlavní přenašeče v terestriálním cyklu jsou považovány I. scapulari, I. pacificu (USA), I. ricinus (Evropa), I. persulcatus (Západní Evropa, Severní Asie). Jednotlivé druhy klíšťat pak mohou vykazovat kompetenci k různým genospecies Bbsl. I. sapularis a I. pacificus jsou většinou osídleny B. burgdorferi sensu stricto; I. ricinus je kompetentní vektor pro většinu Evropských genospecies. Jiné druhy klíšťat pak byly prokázány jako kompetentní pro jediný genospecies, například I. dentatus zřejmě přenáší pouze B. andersonii [47,61,159]. Podobně japonský druh klíštěte I. ovatus je asociovaný s B. japonica [46] (Obrázek 5).

Obrázek 5: Vazba Bbsl genospecies na přenašeče rodu Ixodes a jejich geografické rozdělení (převzato z Masuzawa 2004 [160]).

Mimo terestriální cyklus střídání hostitelů byl u B. garinii popsán i cyklus mořský, vázaný na I. uriae, parazitujícího na mořských ptácích, jež jsou ve svých hnízdištích jedinými kompetentními hostiteli. Ačkoliv je díky izolovanosti těchto ptačích kolonií mořský životní cyklus mnohem méně komplexní v porovnání

20 s terestriálním, jeho význam se uplatňuje zejména v přenosu B. garinii v globálním měřítku [5]. Důležitá se zdá být i schopnost I. uriae parazitovat na savcích, a dokonce i člověku (příležitostní hostitelé), což by v případě prokázání kompetence I. uriae vytvářelo rozhraní pro výměnu genetického materiálu Bbsl mezi mořským a terestriálním životním cyklem [6].

K potencionálním, avšak neprokázaným, přenašečům se řadí i jiní krev sající členovci: blechy, komáři, vši a roztoči [10,161]. U všech těchto skupin byla detekována metodami molekulární biologie přítomnost borrelií [10]. Jejich kompetence k přenosu Bbsl a tím k uplatnění v životním cyklu borrelií, a potažmo schopnost infikovat člověka, zatím nebyla prokázána [162,163].

Jako potencionálnímu vektoru byla největší pozornost věnována vývojovým stádiím komára. Původní molekulární studie potvrdily přítomnost specifické DNA Bbsl ve všech vývojových stádiích (B. afzelii, B. garinii a B. bavariensis), a to i po přezimování [9,11,164,165]. Mechanismus infikování či adaptace borrelií na komáry ovšem není znám. Předpokládá se, že se komár infikuje během penetrace kůže, v níž je procento borrelií vyšší než v krvi během spirochetemie [11].

Rezervoároví hostitelé

Rezervoároví hostitelé hrají důležitou úlohu v udržení populace borrelií v ekosystému. Jedná se o obratlovce (savce, plazy, ptáky), kteří mohou být infikovaní kompetentním vektorem a umožňují pomnožení a přenos borrélií na dalšího bezobratlého. Spektrum rezervoárových hostitelů je velmi široké a podobně jako u vektorových živočichů dochází ke geografické a preferenční stratifikaci jednotlivých genospecies a potencionálních rezervoárů. Zároveň musí být splněna podmínka, že se v daném geografickém regionu nachází vhodný vektor schopný parazitovat na tomto druhu.

O kompetentnosti určitého hostitele rozhoduje řada mechanismů. Mezi důležité patří vnímavost konkrétní genospecies k faktorům vrozené imunity, tedy uplatnění CRASP systému a Erp proteinů, nicméně to není pravidlo [166–168]. Navíc bylo zjištěno, že míra kompetence jednotlivých druhů živočichů se snižuje

21 s velikostí jejich těla [169], a proto se jako rezervoároví hostitelé nejvíce uplatňují zřejmě drobní hlodavci a ptáci.

K nejstudovanějším rezervoárovým hostitelům patří drobní savci . V Evropě jsou to zejména hojně rozšíření Apodemus flavicollis, A. sylvaticus, A. agrarius a Clethrionomys glareolus, na nichž parazitují larvy i nymfy infikovaných klíšťat a dochází ke vzniku perzistentní infekce. Podobně i zajícovítí (Lepus europaeus, L. timidus, Oryctolagus cuniculus), kteří jsou častými hostiteli klíšťat, se řadí mezi kompetentní hostitele [159,170–175]. Výzkum drobných synantropních živočichů potvrdil Bbsl například u ježka (Erinaceus europaeus) [176]. Mimo drobné savce se v životním cyklu Bbsl mohou uplatňovat větší živočichové, například mývali a vačice v Severní Americe nebo lišky, jezevci, krysy či ježci v Evropě. K potencionálním přenašečům, jejichž míra zapojení do enzootického cyklu Bbsl musí být ještě definována, patří například Microtus agrestis, Rattus rattus a R. norvegicus [171,177]. Velcí savci jako Capreolus capreolus, Alces alces, Dama dama nebo Cervus elaphus jsou z pohledu udržení borrelií v ekosystému málo významní a uplatňují se spíše jako dočasný hostitel, u něhož může dojít k přenosu borrelií na naivní klíště v průběhu společného sání [178,178,179].

Důležitou úlohu hrají v přenosu borrelií také ptáci, a to nejen jako významní rezervoároví hostitelé (B.valaisiana, B.garinii a B.burgdorferi sensu stricto), ale také díky schopnosti migrovat na velké vzdálenosti a přenášet borrelie nebo přisáté parazity a přispívat tak migraci genofondu borrelií na globální úrovni (Erithacus rubecula, Turdus spp.) [172,174,180,181]. Díky tomu dochází k zanášení Bbsl do oblastí i mimo jejich přirozené lokality (B. lusitanie detekovaná ve Skandinávii; B. carolinensis popsána ve Francii) [154,182]. K jejich uchycení v nové ekologické nice je ovšem zapotřebí, aby se na dané lokalitě vyskytoval i kompetentní rezervoárový hostitel, a umožnil tak udržení v ekosystému.

Z ekologického hlediska jsou významnou skupinou rezervoárových hostitelů také plazi. Mimo B. lusitaniae, byly detekovány B. afzelii, B. andersonii, B. bisseettii, B. valaisiana a B. burgdorferi sensu stricto [8,183].

22 2.6. OspC (Outer surface protein C)

Jedním z klíčových proteinů, který Bbsl exprimují na svém povrchu, je OspC. Tento homodimerický lipoprotein se uplatňuje v přenosu a počátečních fázích infekce savců, kdy Bbsl kolonizuje tkáň v místě přisátí klíštěte a následně migruje hlouběji do organismu [18,100,104,105,184–186]. Mimo svou funkční úlohu hraje OspC protein jako silný imunogen významnou roli i v protilátkové odpovědi obratlovčího hostitele na přítomnost borrelií v tkáních [187–190].

Gen pro OspC

Gen kódující OspC protein je uložen na cp26, anotovaný pod číslem BBB19. Jeho exprese je indukována během sání klíštěte [184], pod vlivem změn v teplotě doprovázenou rozvolněním nadšroubovicovité organizace cp26 [18,19], posunu v pH z pH 7,4 na pH 6,8 [17], snížení množství rozpuštěného kyslíku a oxidu uhličitého [191,192], změnou v koncentraci manganatých a zinečnatých iontů a zvýšení hladiny acetylfosfátu zodpovědného za fosforylaci Rrp2 [113].

Všechny popsané změny vedou k aktivaci Rrp2-RpoN-RpoS kaskády (signální kaskáda σ54 – σS sigma faktorů). Alternativní sigma-faktor RpoS je regulační komponenta zodpovědná za řízení exprese více než 10 % všech genů B. burgdorferi s.l., včetně ospA a ospC. Exprese genu rpoS je řízena RpoN (σ54). Aktivace RpoN(σ54) je závislá na konzervovaném transkripčním aktivátoru Rrp2, který se skládá ze tří funkčních domén, a to N-terminální přijímačové domény, centrální aktivační domény a N-terminální DNA vazebné domény [193]. Centrální doména je aktivována fosforylací N-terminální přijímačové domény (D52) přes acetylfosfát a váže se k E σ54 holoenzymu přes DNA smyčku, hydrolyzuje ATP a umožní tak vytvoření promotorového komplexu, a tím i aktivaci transkripce RpoN(σ54) [113]. RpoN spolu s Rrp2 a transkripčním faktorem BosR aktivuje transkripci rpoS. Protein RpoS pak aktivuje transkripci ospC a dalších genů [17]. Množství syntetizovaného RpoS je navíc postranslačně modifikováno RNA chaperonem Hfq [194] a interferenční RNA Dsr [195]. K regulaci OspC exprese přispívá i sekundární struktura operátoru ospC [196].

23 K ukončení exprese OspC dochází pod tlakem imunitního systému a v imunodeprivovaných tkáních zůstává alespoň částečně zachována [197,198].

Geny pro OspC jsou charakteristické vzájemnou vysokou variabilitou, na základě které byly rozděleny do skupin, fylogenetických typů (sérotypů, genetických skupin, genotypů) . Fylogenetický typ je definován jako skupina alel ospC genu, které mají sekvenční shodu větší než 98 %, ale od ostatních skupin alel ospC se liší více než 8 %, přičemž většina jich vykazuje míru diference větší než 14 % [190]. Ke genetické variabilitě přispívá horizontální transfer, který probíhá na úrovni kmenů i na úrovni genospecies [199,200]. Variabilita OspC proteinů se projevuje nejen lokálně, ale i ve vyšších geografických celcích a také v poměru zastoupení mezi různými hostiteli [37,201–204].

Doposud bylo identifikováno více než 70 ospC fylogenetických typů v Evropě a 31 ospC fylogenetických typů v USA [36,187,190,200,203]. Genetické studie prokázaly existenci vazby mezi ospC typem a preferencí k hostiteli či infekčním potenciálem, tedy schopností Bbsl pronikat tkáněmi hostitele [205–207]. Například u B. burgdorferi sensu stricto bylo mezi 15 OspC typy (A, B, C, D, E, F, G, H, I, J, K, M, N, O, T) izolovaných z klíštěte (I. scapularis) a z erythema migrans identifikovány jako vysoce invazivní kmeny schopné diseminovat do sekundárních míst infekce ty, jež na cp26 nesly ospC alely A, B, I, K [208]. Podobná vazba byla nalezena například u změny zastoupení četnosti alel ospC u B. afzelii v průběhu přenosu z klíštěte na obratlovce a zpět na klíště, kde došlo k výraznému posunu v četnosti alel YU a A1 [209].

Exprese a posttranslační modifikace OspC

Nascentní OspC je exprimován v cytoplazmě Bbsl v blízkosti vnitřní plazmatické membrány. Jeho transport na vnitřní plazmatickou membránu je zajištěn zřejmě Sec (general secretory pathway) nebo Tat (twin-arginine translocase) translokázou, která zprostředkovává transport OspC na vnější stranu vnitřní membrány . Zde je prelipoprotein modifikován diacylglycerol trasferázou (Lgt), která připojuje na sulfhydrylovou skupinu cysteinu v pozici +1 za lipoboxem diacylglycerovou skupinu fosfolipidu. Následně signální peptidáza (Lps) odštěpí

24 signální sekvenci, čímž dochází ke vzniku α-aminoskupiny, na kterou fosfolipid apolipoprotein transacyláza (Lnt) přenáší třetí acylovou skupinu z fosfolipidu, a tím je proces lipidace OspC ukončen [210,211]. Zralý triacylovaný lipoprotein je doposud nepopsaným způsobem transportován v nestrukturované konformaci buď přes Lol kaskádu nebo jiným způsobem na vnitřní stranu vnější membrány, kde je OspC monomer ukotveno přes lipidickou složku a následně přetočen flipázou na vnější stranu vnější membrány a dochází k sbalení do finální terciální struktury a vytvoření dimerní formy [212,213] (Obrázek 6).

W.R. Zückert / Biochimica et Biophysica Acta 1843 (2014) 1509–1516 1511

Fig. 2. Modular model of lipoprotein secretion pathways in monoderm and diderm bacteria. Lipoprotein secretion is mediated by a sequence of pathway modules. (1) The first module exports lipoprotein precursors through the cytoplasmic or inner membrane via the Sec or TAT pathways. (2) The second module processes the N-terminus of the proteins to yield a mature Obrázek lipidated protein; 6 in: monoderm Schématické bacteria, the lastzobrazení modification step is dispensable, postranslačního as indicated by a vertical zpracování dashed line. In diderm lipoproteinů bacteria, IM lipoproteins likeBbsl: E. coli Nlp V are průběhu retained by failure to interact with downstream pathways. (3) In diderm bacteria, OM lipoproteins can subsequently interact with three modules: (a) the Lol periplasmic sorting module uses the en- ergy from ATP hydrolysis to release lipoproteins like E. coli Lpp from the IM, provides a carrier chaperone for transport through the periplasm and an OM membrane receptor for insertion syntézy into the inner je leaflet OspC of the OM. Lpp transportován also assumes an integral membrane Sec proteintranslokázou conformation leading (1) to surface na exposure vnitřní of its C terminus. membránu (b) The T2SS module, kde uses assembl dochází y of a pseudopilus on a periplasmic platform to drive secretion of a specific surface lipoprotein such as K. oxytoca PulA through an OM pore. (c) The T5SS module involves the BAM complex in the OM and the integral membrane protein chaperones Skp, SurA and DegP as well to facilitate OM insertion and pore formation of NalP’s translocator domain (T) and subsequent trans- k lipidizaci (2) a následnému exportu slocation of its N-terminal passenger domain (P) through the OM. N. gonorrhoeae využitím Lol systému nebo jiným způsobem naNalP is released from the cell by autolytic cleavage. (d) A proposed module mediates complete vnitřní surface localization of spirochetal lipoproteins such as B. burgdorferi OspA by interaction with a holding chaperone and an outer membrane lipoprotein flippase complex. Any specific involvement stranu of the Lol pathway vnější remains membrány, to be resolved. See textkde for details. je následně překlopen na vnější stranu vnější membrány (3d) (převzato Zückert 2014 indicates that signal peptide II cleavage[211] occurs). at the interface of the cy- lipoprotein CcfA is further processed by Eep. Eep is a predicted toplasmic membrane with the cell wall or periplasm. Of experimental metalloprotease that cleaves its substrates by regulated intramembrane interest is the function of globomycin as a noncompetitive inhibitor of proteolysis. In concert with a still unknown carboxy exopeptidase, Eep Lsp function [27], which can be exploited to help establish posttransla- trims the CcfA signal peptide to an 8-amino-acid peptide, cCF10, tional modification of a suspected lipoprotein. which serves as a pheromone regulating horizontal gene transfer by Terciální struktura OspC conjugation [35–37]. Additional pheromone peptides are produced 3.3. N-acyl transferase Lnt from other enterococcal signal peptides, and similar processing has been shown in a related streptococcal species [38]. Interestingly, cCF10 A third posttranslational modification step occurs in diderms and is titrated from the system by the cytoplasmic membrane-bound prote- some monoderms (high-GC gram-positive and mycobacteria; [28,29] ase PrgY [37], whose homologs can be found in many bacteria as well Aktivní and is catalyzed OspC by lipoprotein protein NN-acyl se transferase skládá (Lnt). Lnt ze attaches dvou as totožných higher organisms [39,40] monomer. ů a jeho celková an acyl group to the now available amino group of the +1 cysteine molekulová via an amide linkage. hmotnost The studied E. coli je enzyme přibližně is rather promiscuous 44 kDa 4. Rules v závislosti and pathways of lipoproteinna OspC sorting fylogenetickém within the periplasm in its incorporation of phospholipids [30–32], and the amide-linked acyl chain of a lipoprotein may thus reflect availability of a membrane 4.1. Lipoprotein sorting and the evolution of the “+2” rule typu. phospholipid Každý in a particular monomer bacterium andje niche tvořen [33]. A topology čtyřmi α-šroubovicemi (α-1 - α-4) a jednou study using E. coli Lnt fusions to LacZ and PhoA indicated seven TM he- How diderm bacteria localize lipoproteins such as the major E. coli krátkou αlices and a large-šroubovicí (α extracytoplasmic loop that-5), uspořádaných antiparalelně do helikálního vřetene. assumes a CN hydrolase envelope component Lpp to their outer membrane long remained a family fold and contains all conserved residues crucial for enzyme activ- mystery. Insight into the cis sorting determinants was first provided ity: the catalytic site residues (a typical triad of Glu267-Lys335-Cys387), by fusions of N-terminal peptides of E. coli Lpp and cytoplasmic mem- S výjimkouthe hydrophobic pocket helixů (Tyr388α4 a α5, kt, Glu389) and two residueseré jsou paralelní. Šroubovice involved in brane lipoprotein NlpA to a β-lactamase α1 a α2 jsou spojeny reporter. Reporter fusions to binding/release of the apolipoprotein and/or the phospholipid (Trp237, the wild type (w.t.) N-terminal lipopeptides behaved like the w.t. lipo- Glu343) [28,34]. proteins, showing that the lipoproteins’ N-termini were sufficient for dvěma krátkými β-skládanými listy. Jednotlivé sekundární útvary jsou propojeny proper localization, i.e., contained the in cis sorting information [41, 3.4. Additional biological roles of lipoprotein signal peptides 42]. In a more detailed and targeted analysis, swapping the residues im- krátkými smyčkami, dlouhými 4-mediately10 following aminokyselin. the N-terminal cysteine OspC between NlpA dimer (Asp+2) In this context, the fate of the signal peptide that is cleaved from the and Lpp (Ser+2) resulted in mislocalization of the respective mutants maturing lipoprotein by Lsp deserves some attention. Lipoprotein signal to the opposite periplasmic leaflet [42]. These seminal experiments peptides are commonly thought to be discarded and their amino acids gave rise to the formulation of the “+2 rule” for lipoprotein localization,

recycled for the synthesis of new proteins. Yet, some lipoprotein signal where Asp+2 predicts localization to the cytoplasmic membrane, but peptides have a quite intriguing “afterlife”. As one instructive example any other residue stipulates localization to the outer membrane. Subse- in the monoderm pathogen Enterococcus faecalis, the signal peptide of25 quent studies conﬁrmed the +2 rule as a guiding principle, but also je stabilizován kontakty mezi helixy α1 a α1‘ z obou podjednotek a šroubovicemi α1 a α2` a smyčkou spojující helixy α1 a α2, která interaguje s α3` šroubovicí. Ke správnému složení OspC struktury přispívají bivalentní kationty, které se koordinačně váží k povrchovému histidinovému, glutamátovému nebo asparaginovému zbytku [214,215]. C-terminální konec charakterizovaný vysoce konzervovaným motivem PKKP se zřejmě stáčí do prolin bohatého helixu II [216]. Na OspC dimeru byla identifikována dvě potencionální vazebná místa pro ligand. LBD1 se nachází na distálním konci OspC proteinu a u invazivních kmenů je charakteristické negativním nábojem [214]. Druhé předpokládané vazebné místo se nachází v dutině mezi helixy stabilizujícími OspC dimer [217] (Obrázek 7).

Obrázek 7: Terciální struktura OspC proteinu (PDB 1ggq)

26 Funkce OspC

OspC protein je jeden z hlavních antigenů uplatňujících se v enzootickém cyklu Bbsl, a to v okamžiku, kdy dochází k přenosu borrelií z klíštěte na obratlovce. Mutantní kmeny Bbsl postrádající funkční OspC ztrácejí schopnost kolonizovat slinné žlázy klíštěte a diseminovat hlouběji do obratlovčího hostitele [218,219].

Z předchozích studií se zdá jako nejpravděpodobnější, že OspC v součinnosti s dalšími proteiny (CRASP systém a Erp proteiny) reguluje vrozenou imunitní odezvu obratlovců. Jednak potlačením rychlosti fagocytózy profesionálními makrofágy [34] zatím nepopsaným mechanismem a jednak přes své dva identifikované ligandy: klíštěcí protein Salp15 [35,220] a obratlovčí proteázu plasmin nebo jeho prekurzor plasminogen [33,221–224].

Po proniknutí borrelií do místa primární infekce dochází k aktivaci komplementu, opsonizaci spirochet a tvorbě lytického komplexu (klasická nebo alternativní aktivace komplementu). Borrelie s nižší tolerancí k séru způsobené nízkou expresí CRASPs a Erp proteinů vážících faktor H a FHL-2 (inaktivace C3 konvertázy) [18,29,145–147] mohou pro potlačení účinků komplementu využívat klíštěcí Salp 15, který prostřednictvím OspC imobilizují na svém povrchu. Salp15 následně blokuje vytvoření membránu atakujícího komplexu inhibicí C5b, C6, C7, C8 a C9 molekul na povrchu Bbsl [35,220,225,226].

Mezi další klíčové proteiny, které borrelie během diseminace váže ke svému povrchu, patří i obratlovčí serinová proteáza plaminogen/plasmin, uplatňující se při degradaci extracelulární matrix, a tím usnadňující diseminaci. Významným způsobem k imobilizaci plasminu přispívá OspC protein [33,221–224] (plasmin/plasminogen váží mimo jiné i OspA, Erp proteiny [227–229]). Oblast OspC zodpovědná za interakci s plasminem nebyla doposud identifikována, bylo však prokázáno, že u neinvazivních OspC fylogenetických typů F a H je afinita k plasminogenu významně nižší než u invazivních OspC alel A a B [33].

OspC protein je významný i z hlediska získané imunity. Jako silný imunogen indukuje tvorbu specifických protilátek, schopných OspC vázat a vyvolat specifickou imunitní odpověď [18,38,187,188]. Díky této vlastnosti je využíván

27 v diagnostických soupravách pro průkaz onemocnění Lymeská borelióza [40,230–232], a je zvažován jako jeden z potencionálních kandidátů na vakcínu proti lidské formě tohoto onemocnění. Jeho využití je komplikováno vysokou variabilitou. Protilátky proti OspC sice dokáží borrelie eradikovat z organismu, ale rozpoznávají jen takové OspC fylogenetické typy, které jejich tvorbu vyvolaly [42,188,233–236].

2.7. Shrnutí

Bakterie ze skupiny Borrelia burgdorferi sensu lato představují výjimečnou skupinu bakterií, která se díky specifické organizaci genetického materiálu a vysoké variabilitě proteinové výbavy dokáže adaptovat a uchytit ve velmi odlišných podmínkách tkání hostitelů ze skupiny bezobratlých i obratlovců v relativně krátkém čase.

Významnou úlohu v těchto procesech hrají povrchové proteiny, které tvoří rozhraní mezi patogenem a hostitelským organismem.

Cílem předkládané disertační práce bylo tuto variabilitu alespoň částečně popsat, a to jak na úrovni hostitelů, tak také na úrovni lokálního ekosystému a jedné z nejdůležitějších antigenních determinant, proteinu OspC.

28 PRAKTICKÁ ČÁST

3. Výsledky

Předkládaná práce se zaměřuje na klíčové otázky spojené s adaptačními schopnostmi Borrelia burgdorferi sensu stricto, tedy udržení v ekosystému, mírou variability na lokální úrovni a možnou aplikací získaných dat pro vývoj potencionální vakcíny. Získané výsledky se dají rozdělit do dvou celků.

V první, epidemiologické, části se práce zaměřuje na specifickou detekci Bbsl v tkáních haematofágních členovů. Zaměřuje se jednak na tradiční vektor klíště Ixodes ricinus a také na netradiční přenašeče, u nichž zatím není známo uplatnění v životním cyklu borrelií – krev sajících členovců – komárů (Culicidae), blech (Siphonaptera) a parazitických i dravých roztočů (Mesostigmata) obývající hnízda rezervoárových hostitelů.

Ve druhé části se pak práce zabývá identifikací Bbsl izolovaných na území České republiky s důrazem na porovnání variability vysoce konzervovaného genu pro protein Flagellin B a hypervariabilního proteinu OspC. Výsledky genetické studie jsou následně využity pro posouzení příbuznosti epitopů mezi OspC proteinem odvozeným z B. afzelii BRZ31 izolovaného v Brně – Pisárkách a OspC proteiny patogenních kmenů B. burgdorferi, B. afzelii a B. garinii .

Získané výsledky jsou předkládány ve formě reprintů publikací v impaktovaných recenzovaných časopisech. Diskuze k prezentovaným výsledkům zvolených témat jsou součástí předkládaných publikací. U dřívějších publikací jsou výsledky a diskuse k nim zahrnuty i v úvodní kapitole této disertační práce.

29 Publikace I.

What is the percentage of pathogenic borreliae in spirochaetal findings of mosquito larvae?

Shrnutí:

Publikace se zabývá určením pozitivity larev komára rodu Culex (1170 vzorků) získaných na lokalitě Blansko na přítomnost spirochet s důrazem na Borrelia burgdorferi sensu lato. Během studie byly využity metody zástinové mikroskopie a detekce specifické DNA Bbsl pomocí polymerázové řetězové reakce.

Přítomnost motilních spirochet byla potvrzena v 25,4 % případů. Ve 4 případech byla prokázána přítomnost specifické Bbsl DNA (0,3 %)

Příspěvek autora disertační práce:

Úkolem předkladatele disertační práce bylo navrhnout postup pro izolaci kompletní DNA se zvláštním zřetelem na možnost kontaminace vyšetřovaných vzorků, PCR detekce a vyhodnocení výsledků PCR.

Podíl předkladatele disertační práce na výsledku: 25 %

30 ORIGINAL ARTICLES AAEM Ann Agric Environ Med 2009, 16, 273–276

WHAT IS THE PERCENTAGE OF PATHOGENIC BORRELIAE IN SPIROCHAETAL FINDINGS OF MOSQUITO LARVAE?

Petra Nejedlá, Adam Norek, Karel Vostal, Alena Žákovská

Department of Animal Physiology and Immunology, Institute of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic

Nejedlá P, Norek A, Vostal K, Žákovská A: What is the percentage of pathogenic borreliae in spirochaetal fndings of mosquito larvae? Ann Agric Environ Med 2009, 16, 273–276.

Abstract: In this study, larvae (1,179 ex.) of mosquito genera Culex were examined for the presence of spirochaetes by Dark Field Microscopy (DFM) at the locality of Blansko (Czech Republic) in of 2004–2008. DFM spirochaete positive samples (25.4%) were investigated by nested PCR; only 4 samples were positive for the presence of Borrelia burgdorferi sensu lato, which is 0.3% of the total examined samples. We can conclude that only a low percentage of pathogenic borreliae are presented in mosquito larvae, while the spirochaete of undefned genera infect larvae in high amounts.

Address for correspondence: Alena Zakovska, Department of Animal Physiology and Immunology, Institute of Experimental Biology, Faculty of Science, Masaryk University, Kotlarska 2, CZ–61137 Brno, Czech Republic. E-mail: [email protected]

Key words: mosquito larvae, spirochaetal positivity, PCR.

INTRODUCTION development stage – larvae of the third and fourth instar. The aim of this study was to fnd how high is the infection level Lyme borreliosis, caused by Borrelia burgdorferi sensu and the percentage representation of non-defned spirocha- lato, is the most frequent zoonotic multisystem disease of etes in examined mosquito larvae. humans in Europe, with the mean annual incidence of up to 70 cases per 100,000 inhabitants in some of European coun- MATERIAL AND METHODS tries [12]. People and animals become infected with these bacteria by ticks of the genus Ixodes [4]. Except for the The samples were obtained in the locality of Blansko (l.r. presence of pathogenic borreliae in Ixodes ricinus ticks as Blansko) 30 km from Brno city, situated in the Moravian the principal European species transmitting Borrelia burg- Karst, which is rich in small rodents positive for pathogenic dorferi s.l., some information about the persistence of those borreliae (B. garinii). An area on the slope of a hill around spirochaetes in haematophagous insects has been published the small Hluchov brook, covered by mixed wood, cca. [8, 12, 13, 16, 18]. Some articles describe spirochaetes in the 300 m above sea level, used as small allotments among or- midgut of mosquito imagoes [5, 6, 21], and some authors chards with fruit trees was the collecting site. Larvae were mention cases of Lyme borreliosis caused by insect bite [3, collected from rainwater barrels during the summer and 17]. From physicians’ reviews, these insects are introduced autumn of 2004 and 2008. Collection dates were planned as being about 20% of the potential source of infection in rather to late in the summer and autumn because, according the Czech Republic [10]. This data of the presence of patho- to our experience, higher positivity was anticipated. A to- genic borreliae in haematophagous insects opened the dis- tal of 33 collections containing 1,179 larvae Culex (Culex) cussion of further potential vectors of Lyme disease. After pipiens sensu lato were investigated individually. fnding borreliae in the midgut of imago mosquitoes [2, 23, The larvae midgut was extracted and examined by dark- 24], we focused on the presence of Borreliae in the mosquito feld microscopy as described by Žákovská et al. [26].

Received: 25 March 2009 Accepted: 24 September 2009

274 Nejedlá P, Norek A, Vostal K, Žákovská A

Samples with a content of less than 50 spirochaetes CX10 CX17 CX21 CB5 P48 P49 P47 DK P77 P32 P46 were intended only for PCR reaction. When the amount + was higher, two samples, one for PCR and second for the cultivation in BSK-H medium, were prepared. Borrelia-specifc DNA samples were isolated from homogenates using a DNA isolation kit QIAamp DNA Blood Mini Kit (Qiagen, Germany). DNA was eluted from Figure 1. Agarose gel electrophoresis. Results of one-tube nested PCR amplifcation of fagellin gene sequence specifc for Borrelia burgdorferi QIAamp membrane in 40 µl of elution buffer. A volume of sensu lato (276 bp fragment). Negative sample shows only the product of 4 µl of this prepared solution was used for amplifcation. internal control of 420 bp (samples no CX10, CX17, CX21, CB5, P48, PCR assay based on the specifc fagellin sequence P47, DK, P77, P32, P46), positive sample is P49 (276 bp and 420 bp). amplifcation for detection of B. burgdorferi s.l. was performed [20]. The 40 µl of PCR mixture contained: 1x Hot- Spirochaetal positivity was found in 299 samples StarTaq Master Mix (Qiagen, Germany), 0.1 pmol of each (25.4%) (Tab. 1). Some collections (12/33) showed a high FL3 and FL5 primers, and 20 pmol of FL6 and FL7 prim- percentage of positivity (more than 30%), whereas 5/33 ers, 100 µM of dUTP (Sigma, USA), 102 internal com- collections were negative. Among the DFM 299 positive petitive standard (Genex CZ, Czech Republic), and 4 µl of samples, four sample were PCR positive for borreliae de- template DNA received after standard DNA isolation. All tected by PCR as B. burgdorferi s.l. (0.3%) (Tab. 1). All PCR runs were performed on a thermocycler (PTC-200, isolation attempts were negative. MJ Research) with the following profle: an initial activa- The discovery of pathogens in blood feeding mosquito tion step at 96°C for 12 min, 30 cycles consisting of a de- imagoes give rise to the question whether these species of naturation step for 10 sec at 96°C, an annealing step for insects could partially participate in the life cycle of bor- 10 sec at 68°C, an extension step for 40 sec at 72°C, and reliae. The question of formatting in the cycle was made additional 45 cycles consisting of 10 sec at 96°C of dena- more unclear by our previous fnding of pathogenic bor- turation, 10 sec at 54°C of annealing, and of extension step reliae (B. garinii) even in the mosquito larvae [25]. Using at 72°C for 30 sec. the DFM method, we found a high percentage of positive The resulting products of amplifcation were separated on spirochaetes in submitted individual collections, and we 2% agarose gel containing ethidium bromide (5 µg/1 ml) wanted to know what is the representation of pathogenic and visualized using a UV illumination. In the case of a borreliae and how much is represented by other spirocha- positive fnding, the 276 bp – long amplifcation product etes. To date, several studies about the question of trans- was visible. In the case of sample negativity, only the am- mission of B. burgdorferi, the agent of Lyme disease, plifcation product of 420 bp was detected. No amplifca- have been reported. At frst, some studies described the tion product was detectable in the case of inhibition of PCR presence of spirochaetes in haematophagous arthropods, reaction. except Ixodes ricinus ticks [5, 9]. With the development Positive control was used both during isolation of DNA and availability of special molecular genetic techniques, and PCR reaction. pathogenic borreliae as a source of spirochaetes infecting blood-feeding arthropod were revealed [6, 7, 12, 13, RESULTS AND DISCUSSION 21]. Some borreliae were even isolated, and strains as B. afzelii, B. garinii detected [6, 7]. Moreover, medical stud- The results of the present study are shown in Table 1. ies present that insects form about 20% of the possible All mosquitos collected in the locality Blansko, belonged source of infected patients with Lyme disease [10]. These only to complex Culex (Culex) pipiens s.l. A total of 1,179 accumulated pieces of information could lead to the con- larvae were collected in the summer (682 ex.) and in autum clusion that, for example, mosquitoes could be vectors of periods (497 ex.). the agent of Lyme borreliosis disease, B. burgdorferi s.l.

Table 1. Positivity of mosquitoes C. (Culex) pipiens – larvae in locality Blansko 2004–2008.

Year of Locality DFM PCR DFM PCR positive collection examined positive examined positive positive n n % n n % n n % 2004 Blansko 208 48 23.1 208 1 0.5 48 1 2.1

2005 Blansko 459 82 17.9 459 0 0 82 0 0

2007 Blansko 243 73 30 243 0 0 73 0 0

2008 Blansko 269 96 35.7 269 3 1.1 96 3 3.1

Total Blansko 1,179 299 25.4 1179 4 0.3 299 4 1.3

What is the percentage of pathogenic borreliae in spirochaetal fndings of mosquito larvae? 275

On the contrary, in the study by Matuschka and Richter borrelia numbers in ticks, and reported that 34% of posi- [19] the role of the mosquito as a transmitter of Lyme dis- tive ticks contained less than 10 spirochaetes. That is why ease is denied. According to this study, mosquitoes fail to samples from this range are unlikely to have been picked transmit spirochaetes to a second level of host and these up by our method. The tested sensitivity was about 130 authors present proof of this statement, for example, that borreliae in sample per reaction. In spite of all these facts the sucking time of a mosquito is very short compared to there was a decidedly very low positive capture of PCR that of an ixodid tick. This argument can be supported by reaction, and we conclude that larvae midgut contains a the fact that, for example, the role of mosquitoes in the very high number of undefned spirochaetes of genus other transmission has not been studied experimentally. In spite than those of borreliae. of the fact that there exist many negative opinions about From these results we cannot consider mosquito larvae the role of haematophagous arthropods as a vector of LD, to be a suitable milieu for borreliae, but the question of the detection of borreliae in blood sucking arthropods can how do they access them remains unclear. indicate another possible source of high risk to humans. There probably exists the mechanical transmission of these Acknowledgements pathogens. From our results taken until 2001, 3.3% of examined mosquitoe of the genera Aëdes spp., Ochlerotatus This work was supported by MSM: 0021622415 spp., Culex spp. were DFM positive, and of these 0.7% consisted of pathogenic borreliae (in the same mosquitoes REFERENCES genera). Other authors [21] have reported a positivity rate 1. Bašta J, Hulínská D, Plch J, Daniel M: Application of the single–step from 0.7–7.6% in Ochlerotatus (Ochlerotatus) cantans polymerase chain reaction for detection of Borrelia burgdorferi sensu lato formally Aëdes cantans, A. vexans, Culex pipiens and C. and their genome species in Ixodes ricinus ticks. Epidemiol Microbiol pipiens molestus. The similar positivity of Sanogo’s report Imunol 1999, 48, 167-170. 2. Čapková L, Žákovská A, Knoz J, Dendis M, Šerý O: Further spiro- fuctuated from 1.9–5.1% in the same species of mosqui- chaetes fndings in Culex sp., Aedes sp. mosquitoes and in Ixodes ricinus toes. 1.1% of Aëdes spp. and 0.3% of Culex spp. has been ticks. Biologia (Bratisl) 2002, 57, 389-394. reported in north-eastern Poland [22]. According to more 3. Doby JM, Anderson JF, Couatarmanac’h A, Magnarelli LA, Martin recent Polish study, the mosquitoes of genera Aëdes and A: Lyme disease in Canada with possible transmission by an insect. Zen- tralbl Bacteriol Microbiol Hyg 1987, 263, 488-490. Culex were infected in 1.25% [12], while two years later, 4. Gern L, Burgdorfer W, Aeschlimann A, Krampitz HE: The ecology among the collected mosquitoes of the genus Aëdes, the of Lyme borreliosis in Europe. In: Weber K, Burgdorfer W (Eds): Aspect prevalence of B. burgdorferi was 0.8% [13, 14, 15]. This of Lyme Borreliosis, 59-69. Springer, Berlin 1993. low number shows the similarity also with our results. In 5. Halouzka J: Borreliae in Aedes vexans and hibernating Culex pipiens molestus mosquitoes. Biologia (Bratisl) 1993, 48, 123-124 (in Slovak). our paper, the total spirochaetal positivity in larvae was 6. Halouzka J, Postic D, Hubálek Z: Isolation of the spirochaete Bor- 25.4%. Spirochaetes were detected by using DFM method relia afzelii from the mosquito Aedes vexans in the Czech Republic. Med in species Culex (Culex) pipiens s.l., which corresponds to Vet Entomol 1998, 12, 103-105. the positivity fndings of previously cited Czech authors. 7. Halouzka J, Wilske B, Stünzner D, Sanogo YO, Hubálek Z: Isola- tion of Borrelia afzelii from overwintering Culex pipiens biotype moles- While this is a high percentage of spirochaetes by DFM tus mosquitoes. Infection 1999, 27, 275-277. method, this paper revealed a very low prevalence of B. 8. Hubálek Z, Halouzka J: Prevalence rates of Borrelia burgdorferi burgdorferi 0.3% (4 samples) shown by PCR. In our previ- sensu lato in host-seeking Ixodes ricinus ticks in Europe. Parasitol Res ous study, made in the summer of 2001, DFM positivity of 1998, 84, 167-172. 9. Hubálek Z, Halouzka J, Juřicová Z: Investigation of haematopha- 439 Culex (Culex) pipiens pipiens larvae collected in the gous arthropods for borreliae – summarized data 1988–1996. Folia Para- surrounding of Brno was 2.28%, and a total of 5 samples sitol 1998, 45, 67-72. (1.14%) were positive for B. burgdorferi s.l. DNA [26]. 10. Janovská D: Epidemiologická situace lymeské borreliózy v ČR v r. The differences were probably caused by different locality, 2000–2002, Seminář Lymeská borrelióza a ehrlichióza/rozlišeni zdravot- níiho rizika, Praha, in Czech 2002. number of samples and period of collection. 11. Kahl O, Gern L, Gray JS, Guy EC, Jongejan F, Kirstein F, Kur- There remains the question whether more than four sam- tenbach K, Rijpkema SGT, Stanek G: Detection of Borrelia burgdorferi ples could be positive. Of course, there is a possibility of sensu lato in ticks: immunofuorescence assay versus polymerase chain obtaining a lower number of PCR positive samples because reaction. Zentralbl Bacteriol Microbiol Hyg 1998, 287, 205-210. 12. Kosik-Bogacka D, Bukowska K, Kuźna-Grygiel W: Detection of of the small number of spirochaetes by the relatively low Borrelia burgdorferi sensu lato in mosquitoes (Culicidae) in recreation sensitivity of single step PCR method, and by losses dur- areas of the city of Szczecin. Ann Agric Environ Med 2002, 9, 55-57. ing the isolation process. The tendency of PCR detection 13. Kosik-Bogacka D, Kuźna-Grygiel W, Bukowska K: The preva- to miss some of the Borrelia infections in ticks has already lence of spirochaete Borrelia burgdorferi sensu lato in ticks Ixodes ricinus and mosquitoes Aëdes spp. within a selected recreational area in the been reported [11], and this could be consistent with the city of Szczecin. Ann Agric Environ Med 2004, 11, 105-108. fndings of the present study. This observation could be ex- 14. Kosik-Bogacka D, Kuźna-Grygiel W, Górnik K: Borrelia burg- plained by the presence of some inhibitors in the samples, dorferi sensu lato infection in mosquitoes from Szczecin area. Folia Biol which resulted in the lower sensitivity of the reaction [1]. 2006, 54(1-2), 55-59. 15. Kosik-Bogacka D, Kuźna-Grygiel W, Jamborowska M: Ticks and Another reason for lower PCR sensitivity is reported by mosquitoes as a vectors of Borrelia burgdorferi s.l. in the forested areas Hubálek and Halouzka [8] who devoted a long study of of Szczecin. Folia Biol 2007, 55(3-4), 143-146.

276 Nejedlá P, Norek A, Vostal K, Žákovská A

16. Kubica-Biernat B, Stańczak J, Racewicz M, Kruminis-Lozowska 22. Stańczak J, Kubica/Biernat B, Racewicz M, Kruminis-Lozowska W: W: Detection of etiological agent of lyme borreliosis in native mosquitoe Occurrence of Borrelia spirochetes in haematophagous insects (Diptera, (Diptera: Culicidae) population. Wiad Parazytol 1998, 44, 756-757. Siphonaptera, Anoplura). In: Programme and Abstract. IX SOVE Euro- 17. Luger SW: Lyme disease transmitted by a biting fy. N Eng J Med pean Meeting, 49. 4–7 Sept.; Prague, Czech Republic 1995. 1990, 322, 1752. 23. Žákovská A, Čapková L, Šerý O, Halouzka J, Dendis M: Isolation 18. Magnarelli LA, Freier JE, Anderson JF: Experimental infections of Borrelia afzelii from overwintering Culex pipiens biotype molestus of mosquitoes with Borrelia burgdorferi, the etiologic agent of Lyme dis- mosquitoes. Ann Agric Environ Med 2006, 13, 345-348. ease. J Infect Dis 1987, 156, 694-695. 24. Žákovská A, Dendis M, Pejchalová K: Spirochaetes in Aedes spe- 19. Matuschka FR, Richter D: Mosquitoes and soft ticks cannot trans- cies, Culex pipiens pipiens larvae and hibernating Culex pipiens molestus mit lyme disease spirochetes. Parasitol Res 2002, 88, 283-284. mosquitoes detected with darkfeld microscopy (DFM) and polymerase 20. Picken MM, Picken RN, Han D, Cheng Y, Strle F: Single-tube chain reaction (PCR) methods. Biologia (Bratisl) 2000, 55, 667-670. nested polymerase chain reaction assay based on Flagellin gene sequenc- 25. Žákovská A, Jörkova M, Šerý O, Dendis M: Spirochaetes in Culex es for detection of Borrelia burgdorferi sensu lato. Eur J Clin Microbiol (C.) pipiens s.l. larvae. Biologia (Bratisl) 2004, 59, 283-287. Infect Dis 1996, 15, 489-498. 26. Žákovská A, Nejedlá P, Holíková A, Dendis M: Positive fndings 21. Sanogo YO, Halouzka J, Hubálek Z, Němec M: Detection of spiro- of Borrelia burgdorferi in Culex (Culex) pipiens pipiens larvae in the sur- chetes in, and isolation from, Culicine mosquitoes. Folia Parasitol 2000, rounding of Brno city determined by the PCR method. Ann Agric Environ 47, 79-80. Med 2002, 9, 257-259.

34 Publikace II.

The occurrence of Borrelia burgdorferi sensu lato in certain ectoparasites (Mesostigmata, Siphonaptera) of Apodemus flavicollis and Myodes glareolus in chosen localities in the Czech Republic

Shrnutí:

Publikace se zabývá studiem přítomnosti specifické DNA Borrelia burgdorferi sensu lato v tkáních blech a roztočů parazitujících na rezervoárových hostitelích Apodemus flavicoli a Myodes (Clethrionomys) glareolus sesbíraných na třech různých lokalitách. Vzorky parazitů (235 jedinců) byly vyšetřeny s využitím zástinové mikroskopie a polymerázové řetězové reakce, a to buď jednotlivě nebo ve skupinách. V průběhu práce byla přítomnost specifické DNA Bbsl potvrzena ve 13 případech, z toho v 9 případech u roztočů a ve 4 případech u blech.

Příspěvek autora disertační práce:

Úkolem předkladatele disertační práce bylo navrhnout postup pro izolaci kompletní DNA zvláště pak desintegraci chitinového exoskeletu se zvláštním zřetelem na možnost kontaminace vyšetřovaných vzorků, PCR detekce a vyhodnocení výsledků PCR.

Podíl předkladatele disertační práce na výsledku: 20 %

35 DOI: 10.2478/s11686-013-0147-5 © W. Stefan´ski Institute of Parasitology, PAS Acta Parasitologica, 2013, 58(3), 337–341; ISSN 1230-2821 The occurrence of Borrelia burgdorferi sensu lato in certain ectoparasites (Mesostigmata, Siphonaptera) of Apodemus flavicollis and Myodes glareolus in chosen localities in the Czech Republic

Jakub Netušil1, Alena Žákovská1, Karel Vostal1*, Adam Norek1 and Michal Stanko2, 3 1Institute of Experimental Biology, Faculty of Science, Masaryk University, Kotlářská 2, 61137 Brno, Czech Republic 2Institute of Zoology, Slovak Academy of Sciences, Löfflerova 10, 04001 Košice, Slovakia 3 Institute of Parasitology, Slovak Academy of Sciences, Hlinkova 3, 04001 Košice, Slovakia

Abstract Ticks represent the primary vectors of several serious diseases, including the Lyme disease caused by Borrelia burgdorferi sensu lato (Bbsl). In this study two dominant ectoparasitic groups of arthropods (Mesostigmata, Siphonaptera) were investigated for the presence of borrelian DNA in order to determine their potential role of vectors (or carriers) of this bacterium. All individuals (235) were collected from wild-living rodents obtained in three localities in the Czech Republic (Bažantula, Baba and Křižovice). The majority of parasites were members of the families Parasitidae and Dermanyssidae (Mesostigmata) and families Hystrichopsyllidae and Ceratophyllidae (Siphonaptera). The rodent host species was almost exclusively the yellow-necked mouse (Apodemus flavicollis). Bbsl was detected by the PCR method in the following ectoparasite species: Euryparasitus emarginatus (1), Eulaelaps stabularis (1), Haemogamassus nidi (1), Laelaps agilis (5), Myonyssus gigas (1) (Mesostigmata) and Ctenophthalmus agyrtes (1), C. solutus (3) (Siphonaptera).

Keywords Borrelia burgdorferi, Acarina, Siphonaptera, PCR, rodents

Introduction the reservoir for this bacterium (Anderson 1989, Tarageľová et al. 2008). Small rodents seem to be really important in that Ectoparasites generally participate in spreading of various pa- way (Gern 2008, Hanincová et al. 2003). thogens in the nature. These pathogens include Borrelia burg- Ixodes ricinus is characterized as a competent vector of dorferi sensu lato (Bbsl), an etiological agent of the Lyme the Bbsl in Europe (Gern 2008). Besides the places of gene- disease. Ticks (especially those of the genus Ixodes) play a ral occurrence, its presence was also detected in high attitudes very important role in the Bbsl transmission. Ixodes pacificus (Mačička 1955, Danielová et al. 2006). Pre-adult stages of this Cooley et Kohls, 1943 and I. scapularis (formerly I. dam- common tick parasitize rodents and shrews, mainly in the late mini) Say, 1821 transfer borreliae in the United States, I. per- spring and summer (Stanko et al. 2007). Two additional arth- sulcatus Schulze, 1930 in Asia and partially in Europe (Gray ropod parasite groups, fleas and mites (dominant components 1998). I. ricinus is the vector that transmits Bbsl in Europe of the parasite communities), parasitize small mammals dur- and parasitizes over 300 species of animals (148 mammals, ing the whole year (Haitlinger 1997, Stanko and Miklisova 20 reptiles and 149 birds, as reported by Bennett 1995). The 2000, 2002). Fleas (Siphonaptera) are holometabolous insects presence of Bbsl was also confirmed in several other blood- and their adults survive as obligate ectoparasites on the mam- sucking arthropods, such as mosquitoes of the family Culici- malian or avian hosts. Not all flea larvae are parasitic and dae, the sucking lice Anoplura and the fleas Siphonaptera those that are not feed on organic matter found in the nests or (Magnarelli et al. 1986, Halouzka 1993, Žákovská et al. burrows of avian or mammalian hosts. Flea larval and pupal 2002). Various species of reptiles, birds and mammals serve as development is entirely off-host. However, relationships be-

*Corresponding author: [email protected] Unauthenticated Download Date | 4/9/15 9:43 PM

338 Jakub Netušil et al.

tween the mesostigmatid mites (Acarina, Mesostigmata) and and is characteristic of a high diversity of tree species – oaks, rodents are more complicated. Diet of the majority of mite beeches, hornbeams, birches as well as coniferous, such as species consists not only of blood or of other vertebrate pines. host’s body fluids but also of small arthropods, including other mites or larvae and insect eggs. Some mesostigmatid mites Animal material processing (e.g. mites of the genus Laelaps, Hyperlaelaps) are blood-sucking parasitic mites permanently occurring on the body of ro- A two-step procedure was adopted for processing the animal dents. Other mites, the facultative parasites of rodents (e.g. material. Immediately after collection, the collected ectopara- mites of genus Haemogamasus or Eulalelaps), more fre- sites were dissected on a sterile glass slide under a microscope quently occur in the nests of rodents or on rodents them- using sterile preparation needles. The abdomen of each indi- selves. A certain group of these facultative parasites (e.g. fami- vidual was separated and its contents initially examined for lies Parasitidae, Rhodacaridae, Macrochelidae) is present in presence of spirochaetes (spiral shaped cells) using the dark- the rodent nests/on rodents’ bodies rather because these para- field microscopy (DFM). Only the positive specimens were sites are predators that feed on organic mater in the nests; in further tested for presence of the borrelian DNA by the PCR some cases their presence is a result of phoretic relations (Mr- method. The dissected mites were kept in 70% ethanol (Novák ciak et al. 1966, Daniel et al. 1970). and Povolný 1969) and later identified. This DFM process, Fleas have already been tested for presence of pathogenic however, showed rather time consuming, not allowing exa- borreliae. They were found to be rarely infected (Lindsay et al. mination of large number of specimens. Therefore the parasi- 1991). There are very few studies addressing the issue of the tes were classified as the first step and then concentrated into role of mites as vectors of selected groups of bacterial patho- pools containing more than one individual of the same species. gens (Borrelia burgdorferi, Anaplasma phagocytophilum – Contents of each pool were triturated and such-obtained sam- Skoracki et al. 2006, Literák et al. 2008). However, there are ples directly tested for presence of borreliae using the PCR too few informations about relationship between mesostig- method. Fleas (Siphonaptera) were determined by Rosický matid mites and borreliae. The main aim of this study was to (1957), mites (Mesostigmata) by Karg (1993) and Mašán and answer the question whether other parasite groups (fleas, me- Fenďa 2010. sostigmatid mites), which frequently occur on small mammals, can harbour borreliae and thus play any role in circu- Dark-field microscopy lation of Bbsl. Therefore the range of ectoparasite species on small mammals was studied and an attempt to confirm pres- The midgut content of each sample examined by the DFM was ence of borreliae in arthropods was made. individually triturated in 200 µl of BSK – H medium (Sigma- Aldrich) and observed with a magnification of 400X.

Materials and Methods DNA purification

Character of localities Borrelian DNA samples were isolated from homogenates using the DNA isolation kit QIAamp DNA Blood Mini Kit Ectoparasites were collected from the hair of rodents caught (Qiagen, Germany). DNA was eluted from QIAamp mem- by snapping traps. The traps were baited with a piece of lard- brane in 40 l of AE buffer (10 mM Tris-Cl; 0.5 mM EDTA; pH fried wick. 100 pieces of them were laid into scrubs overnight 9.0.). A volume of 4 l of this preparation was used for ampli- and checked in the early morning. The trapping was carried fication. out in three localities in the Czech Republic (Bažantula, Baba and Křižovice). Bažantula (49˚44Ń, 18˚05É) represents a typi- Polymerase chain reaction cal area with deciduous forest where elms and oaks predomi- nate. It is a relatively small area covering about 200 x 300 m, PCR assay based on the specific flagellin sequence amplifi- situated approximately 2 km northeast from the town of Stu- cation for detection of B. burgdorferi sensu lato was perform- dénka. This locality was chosen because of soil moisture, that ed (Picken et al. 1996). 40 µl of PCR master mix contained: creates a very favourable environment for mites. Křižovice 1x HotStarTaq Master Mix (Qiagen, Germany), 0.1 pmol of (49˚26Ń, 16˚21É) is situated in the Bohemian-Moravian each FL3 and FL5 primers, and 20 pmol of FL6 and FL7 prim- Highlands at 500 meters above the sea level. The local woods ers, 100 mM of dUTP (Sigma, USA), 102 internal competitive are mostly mixed, with the predominance of beeches, horn- standard, gene for flagellin of B. afzelii cloned into plasmid beams and spruces predominating in this area. The soil mois- with concentration of 100 copies per 1 ml (Genex CZ, Czech ture in this region is lower in comparison with Bažantula. Republic) and 4 ml of template DNA received after standard As the third locality a mixed wood, near the protected DNA isolation. All PCR runs were performed on a thermo- landscape area Baba (49˚14Ń, 16˚33É) on the edge of Brno cycler (PTC-200, MJ Research) with the following profile: an City, was chosen. This area lies 365 meters above the sea level initial activation step at 96°C for 12 min, 30 cycles consisting Unauthenticated Download Date | 4/9/15 9:43 PM

Bbsl in certain ectoparasites of wild rodents 339

of a denaturation step for 10 sec at 96°C, an annealing step Parasitus (Eugamasus) lunuatus Miller, 1859, Poecilochirus for 10 sec at 68°C, an extension step for 40 sec at 72°C, and sp., and one species of family Rhodacaridae – Euryparasitus additional 45 cycles consisting of 10 sec at 96°C of denatura- emarginatus Koch, 1939. Altogether, five flea species (Sip- tion, 10 sec at 54°C of annealing, and of extension step at honaptera) of two families were confirmed on the hosts: No- 72°C for 30 sec. sopsyllus fasciatus Bosc, 1800, Megabothris turbidus Rothschild, 1909 (family Ceratophyllidae) and three species of Agarose gel electrophoresis family Hystrichopsyllidae: Hystrichopsylla talpae Curtis, 1826, Ctenoph-thalmus agyrtes Heller, 1896, Ctenophthalmus Amplified products were separated on 2% of agarose gel con- solutus Jordan et Rothschild, 1920. All the observed flea spe- taining ethidium bromide (5 g/1 ml) and visualized using the cies were characterised as oligoxenous or euryxenous parasi- UV illumination. In case of a positive finding, both the 276 tes, i.e. they ei-ther infested a narrower or wider host spectrum bp long amplification product and the product of internal stan- (Rosický 1957) or fleas “generalist” (Krasnov 2008). dard amplification (420 bp) were detectable. In case of sam- In 2004, a total of 64 parasitic mites were examined, col- ple negativity, only the internal standard was detected. Internal lected from wild rodents during three collections in the local- standard served as the control of the reaction. It was visible ities Křižovice and Bažantula. From these collections, 6 species when the reaction was not inhibited. No amplification product of ectoparasites and 2 host rodent species were obtained and the was detectable in case of inhibition of the PCR reaction. yellow-necked mouse (Apodemus flavicollis) was their predominant host. Presence of spirochaetes was observed in 13 samples by DFM, while the borrelian DNA confirmed by the PCR Results method was found just in one case (E. stabularis) (Table I). In 2005, the samples were tested directly for the presence All ectoparasites collected from the hair of wild living rodents of Bbsl DNA using PCR, utilised to examine the parasites in were determined as members of the orders Mesostigmata and pools. During two collections in the localities Křižovice and Siphonaptera. The study focused on the most prevalent species Baba, 171 ectoparasites (157 mites and 14 fleas) were obtain- of rodents in the chosen localities: the bank vole Myodes ed; both the mites and fleas belonged to 5 species. The pro- (Clethrionomys) glareolus Schreber, 1780 and the yellow- portional representation of most species was, however, very necked mouse Apodemus flavicollis Melchior, 1834. small. Only 1 host rodent species (Apodemus flavicollis) was Mite communities constituted five species of the Derma- caught. Borreliae were detected in 12 samples (Table I). nyssidae family: Laelaps agilis Koch, 1836, Eulaelaps stabu- During both years of this study, a total of 235 ectopara- laris Koch, 1836, Haemogamasus nidi Michael, 1892, sites of small mammals (221 mites and 14 fleas) were collect- Haemogamasus hirsutus Berlese, 1889, Myonyssus gigas ed and examined, mostly obtained from the yellow-necked (= gigas) Oudemans, 1912; two species of family Parasitidae: mouse A. flavicollis. Altogether, 8 mite species and 5 flea spe-

Table I. DFM and/or PCR positivity of examined mites and fleas species

Number of samples DFM PCR Species Locality number of individuals (individuals in pool) positivity positivity (locality (locality Křižovice Bažantula Baba abbreviation) abbreviation) E. emarginatus 0 0 1 1 0 1(Bab) E. stabularis 10 3 4 13 + 1(4) 6 (Kr) 1 (Kr) H. hirsutus 1 1–2 1 (Kr) 0 H. nidi 9 5 8 14 + 1(3) + 1(5) 4 (Kr) 1 (Bab) L. agilis 104 27 40 28 + 7(10) + 3(11) + 4(10) 2 (Baz) 5 (2 Kr, 3 Bab) M. gigas 0 0 1 1 0 1 (Bab) P. lunulatus 0 2 0 2 0 0 *Poecilochirus sp. 0 5 0 5 0 0 C. agyrtes 0 0 1 1 0 1 (Bab) C. solutus 3 0 4 1 + 1(2) + 4 0 3 (Bab) H. talpae 1 0 0 1 0 0 M. turbidus 2 0 0 1(2) 0 0 N. fasciatus 0 0 3 1(3) 0 0 Total 130 43 62 73 13 13

*The only one parasite species caught from the hair of M. glareolus. Unauthenticated Download Date | 4/9/15 9:43 PM

340 Jakub Netušil et al.

cies were registered. Bbsl was detected in 13 samples out of the positivity detected by the DFM was probably caused by which 9 were the pooled specimens created by a higher num- an unequal amount of DNA in the samples. This was also the ber of individuals (Table I). main reason for the pool analysis in 2005. Bbsl was detected in Laelaps agilis, while 5 pooled samples (each with a content of 10 individuals) were positive. Other PCR positive spe- Discussion cies were Haemogamasus nidi (pool with contents of 5 individuals) and 3 samples coming from single mites – Myo- This study focused on ectoparasites obtained from small ro- nyssus gigas, Eulaelaps stabularis and Euryparasitus emar- dents found in chosen localities throughout Moravia region ginatus. Occurrence of borreliae in mites that are blood- (Czech Republic). The purpose was to determine which arth- sucking parasites (Laelaps agilis, Myonyssus gigas) is not ropod species parasitize on small mammals in these localities surprising. It might be beneficial to artificially infect other spe- and to detect presence of pathogenic spirochaete Bbsl in these cies/genera (Eulaelaps, Haemogamasus, Euryparasitus)of par- parasites. So far, Bbsl has been found in various species of asitic mites by pathogenic borreliae, either by making the arthropods-mites (Acarina), flies (Diptera) and fleas (Sipho- mites suck on infected rodents or by predation. Some mites naptera) (Pokorný 1989, Literák et al. 2008). Ticks are known obtain a host’s blood via predation on other blood feeding ar- as the most significant vectors of borreliae. Other groups of thropods rather than via direct blood sucking (Tagiltsev 1957). bloodsucking arthropods have not yet been much investigat- Some flea species were also tested for presence of Bbsl. ed, even though they occur on small rodents throughout the The bacterium has been already found in Ctenophthalmus year (e.g. Laelaps genus). Trophic niches of the mentioned agyrtes and Hystrichopsylla talpae (Hubálek et al. 1998). Pre- mites are diverse. The most numerous species, L. agilis, is an sented data confirm positive findings in Ctenophthalmus agyr- obligate haematophagous parasite with regular occurrence in tes and Ctenophthalmus solutus. From all these facts, it could the hair of its host. E. stabularis, H. nidi and H. hirsutus are be concluded that mesostigmatid mites and fleas might play a facultative parasites which mainly occur in mammalian nests. role as alternative (non-competent) vectors of borreliae in na- While L. agilis is a host-specialist concentrating on the Apo- ture and might therefore require a more thorough research. demus genus, mites like E. stabularis and the genus Haemo- gamasus, are typical parasites on many rodent species. They, however, occur more frequently in the nests (or hair) of vole Acknowledgements. This work was partially supported by sof the family Microtidae (Karg, 1993). The other determined MSM: 0021622415 and project APVV-0267-10. mites are non-parasitic species and their trophic niches are characterised as predatory (P. lunulatus, E. emarginatus), or free living mites in the soils with nymphal stages with References a frequent phoretic relationships to necrophagous beetles and rodents (Poecilochirus sp.) (Haitlinger 1977). The most pre- Anderson J.F. 1989. Epizootiology of Borrelia in Ixodes tick vectors and reservoir hosts. Reviews of Infectious Diseases,11, 1451– dominant mite species was Laelaps agilis, an obligate parasi- 1459. DOI: 10.1093/clinids/11.Supplement_6.S1451. tic mite infesting a very wide host range (Mrciak et al. 1966, Bennett C.E. 1995. Ticks and Lyme Disease. Advances in Parasit- Haitlinger 1977). In comparison with some other studies car- ology, 36, 343–405. DOI:10.1016/S0065-308X(08)60494-7. ried out for example in Slovakia (Stanko and Miklisova 2000, Daniel M., Mrciak M., Rosický B. 1970. Location and composition 2002) its dominating position in the scale of arthropods para- of nests built by some central European insectivores and rodents in forest biotopes. Acta Facultatis Rerum Naturalium sitizing small mammals in the central Europe was confirmed. Universitatis Comenianae, 16, 1–36. Haemogamasus nidi and Eulaelaps stabularis were the next Danielová V., Rudenko A., Daniel M., Holubová J., Materna J., Go- most frequent species, while other mite species were rare. The lovchenko M., Schwarzová L. 2006. Extension of Ixodes rici- role of some mesostigmatid mites as vectors of various path- nus ticks and agents of tick-borne diseases to mountain areas ogens or parasites has already been investigated and suc- in the Czech Republic. International Journal of Medical Mi- crobiology, 296, 48–53. DOI: 10.1016/j.ijmm.2006.02.007. cessfully confirmed. Pathogenic Francisella tularensis Frank C. 1977. The importance of Laelaps agilis C. L. Koch 1836 causing tularemia was isolated from Haemogamasus nidi and (Mesostigmata: Parasitiformae) as a vector of Hepatozoon syl- Laelaps muris (Lysý et al. 1979; Zuevskij 1976) and rickett- vatici Coles 1914 (Sporozoa: Haemogregarinidae). Zeitschrift siae were observed in a small number of species of nest ecto- für Parasitenkunde, 53, 307–310. DOI: 10.1007/BF00389 parasites (Kocianová 1989). Laelaps agilis was examined in 948. Gern L. 2008. Borrelia burgdorferi sensu lato, the agent of lyme bor- connection with Hepatozoon sylvatici and its potential impor- reliosis: life in the wilds. Parasite, 15, 244–247. tance in transmission of this parasite was also confirmed Gray J.S. 1998. The ecology of ticks transmitting Lyme borreliosis. (Frank 1977). Some mesostigmatid mites contained develop- Experimental and Applied Acarology, 22, 249–258. DOI: mental stages of coccidia (Mohamed et al. 1987). This study 10.1023/A:1006070416135. attempted to enhance the up-to-date knowledge by testing mes- Hanincová K., Schafer S.M., Etti S., Sewell H.S., Tarageľová V., Ziak D., Labuda M., Kurtenbach K. 2003. Association of Borrelia ostigmatid mites for presence of Bbsl using a PCR method. afzelii with rodents in Europe. Parasitology,126, 11–20.DOI: The lower positivity detected in 2004 by the PCR compared to 10.1128/AEM.69.5.2825-2830.2003. Unauthenticated Download Date | 4/9/15 9:43 PM

Bbsl in certain ectoparasites of wild rodents 341

Haitlinger R. 1977. Parasitological investigation of small mammals Mrciak M., Daniel M., Rosický B. 1966. Parasites and inhabitants of of Gory Sowie (Middle Sudetes). VI. Siphonaptera, Anoplura, small mammals in the family Gamasoidea (Parasitiformes). Acarina. Polskie Pismo Entomologiczne, 47, 429–492. Acta Zoologica Universitatis Comenianae, 13, 81–116. Halouzka J. 1993. Borreliae in Aedes vexans and hibernating Culex Novák K., Povolný D. 1969. Metody sběru a preparace hmyzu. pipiens molestus mosquitoes. Biológia, 48, 123–124. Praha: Academia Praha, 244 pp. DOI: SVK01-000313071. Hubálek Z., Halouzka J., Juřicová Z. 1998. Investigation of haema- Picken M.M., Picken R.N., Han D., Cheng Y., Strle F. 1996. Single- tophagous arthropods for borreliae - summarized data, 1988 Tube Nested Polymerase Chain Reaction Assay Based on Fla- – 1996. Folia Parasitologica (Praha), 45, 67–72. gellin Gene Sequences for Detection of Borrelia burgdorferi Karg W. 1993. Acari (Acarina), Milben Parasitiformes (Anactino- sensu lato. European Journal of Clinical Microbiology & In- chaeta), Cohors Gamasina Leach, Raubmilben. Die Tierwelt fectious Diseases, 15, 489–498. DOI: 10.1007/BF01691317. Deutschlands 59, Jena: Gustav Fischer Verlag, 1–523. Pokorný P. 1989. Incidence of the spirochete Borrelia burgdorferi in Kocianová E. 1989. Nest ectoparasites (gamasid mites) as vectors arthropods (Arthropoda) and antibodies in vertebrates (Ver- for rickettsia under experimental conditions. Trudy Instituta tebrata). Československá Epidemiologie, Mikrobiologie, Im- imeni Pasteura, 66, 89–94. munologie, 38, 52–60. Krasnov B.R. 2008. Functional and evolutionary ecology of fleas. Rosický B. 1957. Blechy - Aphaniptera. Praha: Fauna CSR, 442 pp. Cambridge University press, 593 pp. DOI:10.1017/CBO97 Skoracki M., Michalik J., Skotarczak B., Rymaszewska A., Sikora 80511542688 B., Hofman T., Wodecka B., Sawczuk M. 2006. First detection Lindsay L.R., Barker I.K., Surgeoner G.A., Mc Ewen S.A., Elliott of Anaplasma phagocytophilum in quill mites (Acari: Syrin- L.A., Kolar J. 1991. Apparent incompetence of Dermacentor gophilidae) parasitizing passerine birds. Microbes and Infec- variabilis (Acari, Ixodidae) and fleas (Insecta, Siphonaptera) tion, 8, 303–307. DOI: 10.1016/j.micinf.2005.06.029 as vectors of Borrelia burgdorferi in an Ixodes dammini en- Stanko M., Miklisova D. 2000. Host - parasite relationships between demic area of Ontario, Canada. Journal of Medical Entomol- two ectoparasites groups (Ixodida, Mesostigmata) and two ro- ogy, 28, 750–753. dent species in lowland ecosystem of Slovakia. In: Stawonogi Literák I., Stekolnikov A.A., Sychra O., Dubská L., Tarageľová V. Pasożytnicze i Alergogenne, Lublin: KGM, 23–36. 2008. Larvae of chigger mites Neotrombicula spp. (Acari: Stanko M., Miklisova D. 2002. Infestation trends of two rodent species Trombiculidae) exhibited Borrelia but no Anaplasma infec- (Rodentia, Muridae) on the East Slovakian Lowland. In: Sta- tions: a field study including birds from the Czech Carpathi- wonogi Pasożytnicze i Alergogenne, Lublin: KGM, 105–114. ans as hosts of chiggers. Experimental & Applied Acarology, Stanko M., Krasnov B.R., Miklisova D., Morand S. 2007. Simple 44, 307–314. DOI: 10.1007/s10493-008-9150-1. epidemiological model predicts the relationships between Lysý J., Nosek J., Výrosteková V., Kováčik J. 1979. Isolation of prevalence and abundance in ixodid ticks. Parasitology, 134, Francisella tularensis from mites Haemogamasus nidi and 59–68. DOI: 10.1017/S0031182006001296. Laelaps hilaris in western Slovakia. Zentralblatt für Bakteri- Tagiltsev A.A. 1957. On the relationships between parasitic and ni- ologie A, 244, 324–326. dicolous Acari. Meditsinskaya Parazitologiya and Parazi- Mačička O. 1955. O výškovom rozvrstvení kliešťa obyčajného tarnyye Bolezni, 26, 440–447. (Ixodes ricinus L., 1758) vo Vysokých Tatrách. Zoologické a Tarageľová V., Kočí J., Hanincová K., Kurtenbach K., Derdáková Entomologické Listy, 4, 384–388. M., Ogden N.H., Literák I., Kocianová E., Labuda M. 2008. Magnarelli L.A., Anderson J.F., Barbour A.G. 1986. The etiological Blackbirds and Song Thrushes Constitute a Key Reservoir of agent of Lyme disease in deer flies, horse flies and mosqui- Borrelia garinii, the Causative Agent of Borreliosis in Central toes. Journal of Infectious Diseases, 154, 355–358. DOI: Europe. Applied and Environmental Microbiology, 74, 1289– 10.1093/infdis/154.2.355. 1293. DOI: 10.1128/ AEM.01060-07. Mašán P., Fend’a P. 2010. A review of the laelapid mites associated Žákovská A., Nejedlá P., Holíková A., Dendis M. 2002. Positive find- with terrestrial mammals in Slovakia, with key to the Euro- ings of Borrelia burgdorferi in Culex (C) pipiens pipiens larva pean species (Acari: Mesostigmata: Dermanyssoidea). Insti- in the surrounding of Brno City determined using the PCR tute of Zoology, SAS, Bratislava 2010, 978-80-970406-8-0, method. Annals of Agricultural and Environmental Medicine, NOI Press, Bratislava, 187 pp. 9, 257–259. Mohamed H.A., Molyneux D.H., Wallbanks K.R. 1987. A coccidian Zuevskij A.P. 1976. Role of gamasids in the epizootiology of tu- in haemogamasid mites; possible vectors of Elleipsisoma laremia. Parazitologiya, 10, 531–535. thomsoni Franca, 1912. Annales de Parasitologie Humaine et Comparée, 62, 107–116.

(Accepted May 17, 2013)

Unauthenticated Download Date | 4/9/15 9:43 PM

40 Publikace III.

Activity of the tick Ixodes ricinus monitored in a suburban park in Brno, Czech Republic, in association with the evaluation of selected repellents

Shrnutí:

Tato studie si klade za cíl posouzení celoroční aktivity a pozitivity klíšťat na přítomnost Bbsl na lokalitě Pisárky (Brno, Česká Republika). Z 598 vzorků vyšetřených zástinovou mikroskopií bylo 50 jedinců pozitivních na přítomnost spirochet, u 76 % z DFM pozitivních byla potvrzena přítomnost DNA Bbsl pomocí PCR. Zároveň byl hodnocen potenciál komerčních repelentů za účelem testování preventivních vlastností studovaných přípravků proti přenosu Lymeské borreliózy na potencionální návštěvníky studované lokality.

Příspěvek autora disertační práce:

Úkolem předkladatele disertační práce bylo potvrdit přítomnost Bbsl ve vzorcích s mikroskopicky prokázanou přítomností spirochet pomocí specifické PCR detekce DNA Borrelia burgdorferi sensu lato.

Podíl předkladatele disertační práce na výsledku: 5 %

Vol. 38, no. 2 Journal of Vector Ecology 295

Activity of the tick Ixodes ricinus monitored in a suburban park in Brno, Czech Republic, in association with the evaluation of selected repellents

A. Žákovská1, H. Nejezchlebová1, N. Bartoňková1, T. Rašovská1, H. Kučerová, A. Norek1, and P. Ovesná2

1Institute of Experimental Biology, Faculty of Science, Masaryk University, Kotlářská 2, 611 37 Brno, Czech Republic, [email protected] 2 Institute of Biostatistics and Analyses, Masaryk University, Kamenice 3, 625 00 Brno, Czech Republic

Received 18 April 2013; Accepted 8 August 2013

ABSTRACT: Te ever-increasing number of Lyme borreliosis patients led us to consider more efective procedures for disease prevention. Te aim of our study was to monitor the annual activity and infectivity of Ixodes ricinus ticks in the Pisárky region, City of Brno, CR, and to test the responses of the locally-captured ticks to selected repellents. Te result of regular one-hour- per-week monitoring in 2011 was the collection of ticks that directly refected the highest number of Lyme disease patients (4,835) detected throughout the period of recording in the Czech Republic. Te ticks were examined for spirochaetes by dark feld microscopy. Te positive samples were identifed by PCR analysis, confrming that 76% of these were infected with Borrelia burgdorferi sensu lato. Ticks were most abundant in May and June, with August having the highest risk for spirochaetal infection. Tick activity was statistically correlated with temperature. Te moving-object-bioassay was used to study repellent efciency on the Ixodes ricinus nymphs captured in the above-mentioned suburban park. Five selected commercial repellents based on DEET (N, N-diethyl-3-methylbenzamide) showed statistically diferent efects on the non-repellent control group. Journal of Vector Ecology 38 (2): 295-300. 2013.

Keyword Index: Lyme borreliosis, Ixodes ricinus ticks, Borrelia burgdorferi sensu lato, DEET, repellents.

INTRODUCTION chemical repellents. DEET (N, N-diethyl-3-methylbenzamide) is a standard Tick-borne infections rank among the most frequent repellent that, together with citriodiol picaridine and IR3535, arthropod-borne diseases in many parts of the world, is among the four active substances recommended by the including Europe. We focused on Ixodes ricinus ticks, World Health Organization for long-lasting repellency the main vectors of pathogens causing the most frequent against nearly all arthropods (Sorge 2009). Te ‘moving- arthropod-borne infections, including Lyme borreliosis object-bioassay’ (MOB) (Dautel et al. 1999) is one of the (LB), or tick-borne encephalitis, in Europe (Jaenson et al. possible approaches for repellency testing. It consists of a 2012). Te tick-transmitted diseases, especially borreliosis, rotating heated drum that mimics body warmth, movements represent a growing health problem in the Czech Republic. of a potential host or, for example, a specifc host’s smell. Te highest number of patients diagnosed with LB disease Truly efcient tick repellents must be efective despite the over the monitored years was registered in 2011 (EPIDAT - presence of attractants. Tested compounds are applied to database of the National Institute of Public Health). a small exterior area of the drum, and as the drum rotates, Te spread and length of the development cycle of I. an approaching tick can attach to the drum as if it was ricinus, the vector of LB, depends on environmental conditions a passing host. Ticks that approach the drum on a rod and weather. As indicated by changing environmental factors (imitation of vegetation) are expected to be host-seeking. To during recent years, the tick life-cycle has been shortening and a certain extent, MOB eliminates the practical, ethical, and ticks, as well as their pathogens, have migrated to areas where economical disadvantages of testing on live hosts. Numerous they previously did not occur (Hubálek et al. 2002, Materna modifcations of this bioassay have been created, which also et al. 2005, Stünzner et al. 2006). Tis study also emphasized makes the assay suitable for testing of animal repellents. Two regular monitoring of the number and proportion of ticks aims of this study were to show possibilities of prevention in infected with Borrelia burgdorferi sensu lato and their activity the form of efciency of the fve repellents and to defne the related to temperature. Pisárky Park in Brno appears to have critical months for LB infection in the leisure area of a large optimal conditions for ticks, with approximately 65 ticks per city. h that have been captured. Awareness of the critical months for LB infection is among the most important considerations MATERIALS AND METHODS for LB prevention. Te Pisárky location was chosen because it is a leisure area where people go for walks and relaxation. Locality One way to keep nuisance arthropods away from people Te urban park of Brno-Pisárky is located 2 km outside and animals and to avoid tick-borne infections is the use of the center of the Moravian metropolis Brno (Žákovská et

296 Journal of Vector Ecology December 2013

al. 2007). Te altitude is 197-210 m above sea level and the isolation, a reference strain provided by the microbiology location is situated towards the bottom of the Pisárky Valley. laboratory was used. Te predominant local vegetation is formed by a deciduous oak-hornbeam forest and characteristic representatives of Repellents tested herbs. Te biotope also contains a wide range of small and Five commercial products were randomly chosen for middle-sized mammals, including hedgehogs (Erinaceus this study, all of which were based on DEET, while their europaeus) and several species of squirrels (Sciurus vulgaris). additional active ingredients (permethrin, deltamethrin, Te locality was chosen because human visitors come to the pyrethroids) were present only in low percentages and were park for walks with pets and to spend their free time. Under considered rather toxic than repellent. such conditions, infected ticks could represent a real health Experiment 1: DEET 25 % + permethrin < 1 %; additives: problem in this area. buthyl acetate, petrol fraction, propane, butane (producer: Leroy, Czech Rep.) Tick collection Experiment 2: DEET 14 % + permethrin 0.2 %; additives: Ticks were collected at regular intervals (one h/week) propane, butane, ethanol (Lybar, Czech Rep.) by fagging, dragging a white fannel fag (1x1 m) over low Experiment 3: DEET 14 % + deltamethrin 0.01 %; additives: vegetation. Two collectors alternated each week throughout propane, butane, ethanol (Lybar, Czech Rep.) the year. All collected ticks were placed into test tubes and Experiment 4: DEET 10 % + pyrethroids (extract from stored alive at 5° C until they were examined. Air temperature dalmatian chrysanthemum); additives: isobutane, propane, was monitored during the collection. Midgut tissue was butane, ethanol (Aromatica, Czech Rep.) removed from each tick, suspended in a drop of saline, and Experiment 5: DEET 7 %; additives unknown (Hydra examined by dark feld microscopy (DFM) at 400x. Remains farmacosmetici, Poland). of the positive ticks and suspension from microscopic evaluation were transferred to a sterile Eppendorf vial and Repellency testing processed for PCR. To examine the responses of the ticks towards repellents, the modifed moving object bioassay was used (Dautel et al. DNA isolation and PCR reaction 1999). Tis assay was chosen for practical as well as ethical Procedures were followed according to Nejedlá et al. reasons, as it ofers advantages of host-associated stimuli and (2009). Borrelia-specifc DNA samples were isolated from tick contact while avoiding live hosts, since feld-collected 50 homogenates using the DNA isolation kit QIAamp DNA ticks potentially transmit serious pathogens. Blood Mini Kit (Qiagen, Germany). DNA was eluted from During our experiments, tested compounds were applied QIAamp membrane in 40 μl of elution bufer. A volume of onto an exterior area (8x2 cm) of the heated drum (OD 9 cm, 4 μl of this prepared solution was used for amplifcation. height 13 cm, temperature 36.5 ± 0.5º C, sprayed matt white, Te nested PCR assay was based on the specifc fagellin 24 turns min-1). As the drum rotated and the exterior site sequence amplifcation (Picken et al. 1996) for detection of passed by, a tick could approach the drum on a fat iron stick B. burgdorferi s.l. Te 40 μl of PCR mixture contained 1x (imitation of vegetation) and attach to the drum as if it was Hot- StarTaq Master Mix (Qiagen, Germany), 0.1 pmol of a passing host. FL3 and FL5 primers, and 20 pmol of FL6 and FL7 primers, A total of 250 nymphs was processed according to the 100 μM of dUTP (Sigma, U.S.A.), 102 internal competitive experimental procedure, representing the majority of the standard (Genex CZ, Czech Republic), and 4 μl of template developmental stages detected within the monitored area and DNA received afer standard DNA isolation. All PCR runs that visitors to the park are ofen attacked by. Te ticks were were performed on a thermocycler (PTC-200, MJ Research) frst ofered untreated flter paper only (control experiment). with the following profle: an initial activation step at 96° C Ticks that successfully attached to the flter paper were for 12 min, 30 cycles consisting of a denaturation step for 10 considered active and host-seeking and were subsequently s at 96° C, an annealing step for 10 s at 68° C, an extension exposed to the experiments with repellents. Fify active step for 40 s at 72° C, and an additional 45 cycles consisting nymphs were tested per repellent. of 10 s of denaturation at 96° C, 10 s of annealing at 54° C, Te aim of this part of the study was to mimic a practical and an extension step at 72° C for 30 s. Te resulting products usage of the products. Te dosage of repellents followed the of amplifcation were separated on 2% agarose gel containing instructions in the user manuals as if in a real situation and ethidium bromide (5 μg/1 ml) and visualized under UV refected the dispenser performance (heavy/light aerosol, illumination. If the sample contained DNA of B. burgdorferi rapid/slow action). Te products were tested within a 0 - 10 s.l., a 276 bp long amplifcation product was visible. If min time interval afer evaporation of the solvent. the sample did not contain the DNA of B. burgdorferi s.l., In both control experiments and tests with repellents, only an amplifcation of the internal competitive standard each nymph was observed for a maximum of two min. Te (plasmid DNA with sequences corresponding to primers distance between the nymph and the experimenter during FL6 and FL7) product of 420 bp was detected, which served the test was at least 50 cm. Te experiments were performed as a control for a successful run of each single reaction. No at room temperature and relative humidity, which varied amplifcation product was detectable in the case of inhibition according to the weather. of PCR reaction. As a positive control for both PCR and DNA

Vol. 38, no. 2 Journal of Vector Ecology 297 Number

Figure 1. Tick activity and infuence of temperature. Figure 2. Number of ticks and prevalence in each month in 2011. Statistical analyses Data obtained from the individual experiments were dates for individual collections of highest positive ticks were added to a parametric and structured dataset. Te sofware two days in July when the infectivity reached 17.9% (5/28) package STATISTICA 9, 10 (StatSof CR) was used for and 14.3% (3/21). If comparing infectivity to the individual statistical analyses. A χ2 test was used to evaluate results of the months, then May, June, July, and August are statistically repellency testing and activity and infectivity of the individual diferent from the others. No positive ticks were found in stages of the ticks. Linear efciency of the individual products October and November (Figure 2). according to the applied dose was evaluated by Spearman’s Temperature is recorded in Figure 1. According to correlation as well as dependency of the ticks’ activity on statistical testing using Spearman’s rank correlation at the temperature. One–way ANOVA test was used for the study signifcance level of 0.05%, we found a dependence of tick of activity and infectivity in the individual months during the numbers on temperature (Figure 1). DFM-positive samples year. (50, 8.4 %) were identifed by PCR analysis while 76% of these were confrmed to be B. burgdorferi s.l. (38, 6.4 %). RESULTS Repellency testing Tick collection Experiment 1: A formulation with 25% DEET and <1 % I. ricinus ticks were monitored at the same time for one h permethrin. per week from March to November, 2011. Te total number Out of the total of 50 tested nymphs, 49 (98%) were of ticks collected on 29 occasions was 598 individuals, out repelled. of which 50 were positive for the presence of spirochaetes Experiment 2: Experimental set (DEET 14% + (8.4%) by the DFM method. Te DFM-positive samples permethrin 0.2%). were further investigated by PCR. Te average number of Out of the total of 50, 44 (88%) of the nymphs were one-h tick collecting was 23.1. Representation of the various repelled and did not attach to the repellent-treated area and 6 developmental stages is random and signifcantly diferent (12%) were not repelled. statistically. Ticks were present each month of the year, from Experiment 3: A formulation with DEET 14% + March to October, 2011. Te number of collected individuals deltamethrin 0.01%. fuctuated and these changes were also related to temperature Out of the total of 50, three (6%) of the nymphs attached changes at the location (Figure 1). While May and June were to the drum and 47 (94%) were repelled. both statistically diferent from the other months and critical Experiment 4: Mixture of DEET 10% + pyrethroids as for tick occurrence, two typical peaks in tick activity were active substances. recorded, the frst in June and the second in August (Figure Out of the total 50, 39 (78%) of the ticks were repelled 2). Te overall spirochaetal prevalence detected by the DFM and 11 (22%) clung to the flter paper of the drum. method in the Pisárky location of Brno was 8.4% (50/598). Experiment 5: Te product with 7% DEET. Positive ticks appeared in the spring one month afer the Out of the total 50, this product efciently repelled 37 frst collection, and a growing infectivity during the season (74%) of the ticks, but 13 (26%) did attach. was found (Figure 2). Highest numbers of positive ticks from Table 1 summarizes data on the amounts of the applied all collected months were in August (13/98, 13.2%). Critical products and active ingredients. Our data indicate that

Table 1. Amounts and basic statistic parameters of the applied products/active ingredients. 1: DEET 25% + permethrin < 1%, 2: DEET 14% + permethrin 0.2%, 3: DEET 14% + deltamethrin 0.01 %, 4: DEET 10% + pyrethroids, 5: DEET 7%. Product Control(mg/cm2) 1 2 3 4 5 Mean amount of product 0 3.45 5.31 3.72 5.81 3.56 Mean amount of DEET 0 0.86 0.74 0.52 0.58 0.25 Median amount of product 0 3.45 5.38 3.8 5.75 3.5 Min. concentration of product 0 3.0 4.38 3.5 5.06 3.2 Max. concentration of product 0 3.8 6.13 4.0 6.56 4.0

298 Journal of Vector Ecology December 2013

1.2 98% (DEET 25 %+ 94% (DEET 14 % + control deltamethrin 0.01 %) permethrin 1 %) 1 25% DEET + permethrin 0.8 88% (DEET 14 % + 14% DEET + permethrin repelled 74% (DEET 7 %) 78% (DEET 10 % + permethrin 0.2 %) 0.6 not repelled pyrethroids) 14% DEET + deltamethrin

0.4 10% DEET + pyrethroids

0.2 7 % DEET

0% 20% 40% 60% 80% 100% 0 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 Repellent efficiency mg DEET / cm2 Figure 4. Repellency dependence on the amount of the active Figure 3. Repellency of the tested products dosed according DEET ingredient. to the individual instructions on the package as provided by the producers. Another part of our study examined the efect of climate on the abundance of I. ricinus. Dependence of tick all repellents showed signifcant repellency during the occurrence on various climatic conditions had already been experiments compared to the control group (χ2 test, P<0.001; investigated and confrmed (Alekseev and Dubinina 2000, Figure 4). Statistical evaluation showed among the individual Materna et al. 2005). Ticks generally need a high humidity to products are not signifcant (χ2 test, P>0.05). Furthermore, compensate for any defcit in body water (Krober and Guerin efciency of the individual products according to the applied 1999). During our collection intervals in Pisárky, the climate amounts of the active ingredient DEET did not show linear was relatively humid, while the mean value was 53.8%, and

character (Spearman’s correlation, rs=0.7, P=0.188); the tick activity was directly proportional to the temperature. repellent efciency was not directly dependent on the amount Te mean temperature measured in this locality was 18.7° of active ingredient DEET (Figure 3). C. Te temperature was measured on each day of collection, but several parameters could have been infuenced by factors DISCUSSION several days earlier. Weather fuctuation was refected in the number of collected individuals, which ranged from one to We present the results of an annual observation of the 65, with a mean of 23.1). For example, 2011 was characteristic activity of I. ricinus ticks and Borrelia infectivity in a park of a rapid onset of tick numbers in April (82/month) because located in Pisárky, Brno, CR, during the year 2011. Te of the hot days in early spring. Te second consideration was selected number of collected nymphs was further tested a very dry autumn with low numbers of ticks in October. against fve chosen repellents while recording their individual Danielova et al. (2006) stated that climate modifcations, efciency. such as the higher temperature in spring and autumn, cause In a previous study in 1996-2002, there were 162 longer development of ticks and their possible shif to higher B. burgdorferi s.l. positive samples from I. ricinus in this altitudes. Further records on weather dependency come from locality (Žákovská et al. 2008b). From these, a total of ten western Germany, where the presence of B. burgdorferi sensu isolated strains (6.2%) were obtained, seven of which were lato in ticks (14%) has increased in the region of Siebengebirge identifed as B. afzelii and three as B. garinii, using PCR-RFLP over the last 15 years due to unknown changes, some of them (Žákovská et al. 2008a). Te presence of B. garinii suggests perhaps related to climate changes (Kampen et al. 2004). a role for rodents in the circulation of B. burgdorferi s.l. in Out of our 598 samples, only the 50 DFM positive ones this area, but no exact data confrm that. In the year 2011, a were examined by the simple PCR protocol described by total of 598 I. ricinus ticks were collected in Pisárky between Picken et al. (1996), which gave 38 positive results (6.4%). Te March and November, 2011. Te statistical tests divided tick DFM method revealed 50 samples positive for the presence of activity during the year into the following four statistically spirochaetes (8.4%). Te DFM method is commonly used for diferent groups: (1) March and September, (2) April, July, the detection of spirochetes in ticks (Žákovská et al. 2008a, and August, (3) May and June, and (4) October. No ticks were Aleksejev et al. 2001, Stünzner et al. 2006, Hubálek et al. found in November. In our long-term research performed in 2002). A reason for fnding fewer positive samples in PCR the same locality from 1996 to 2002, the annual activity could could be that our PCR sensitivity cannot detect a very low be divided into three statistically diferent periods. In the number of borreliae (from 0-10 per tick). Another reason is six-year study (1996-2002), the curve of seasonal abundance that some of the spirochaetes may not belong in the genus reached two main peaks, one in May and the other in August Borrelia. Similar results can be observed in other studies. (Žákovská et al. 2007). Occurrence of ticks during our one- For example, Aleksejev et al. (2001), reported that 64.8% year study in 2011 also reached two peaks: one maximum in of ticks that yielded a Borrelia PCR product out of 100% of June (151) and the second peak in August (91). Our results DFM-positive ticks, while our experiment result was 76%. were consistent with Černý et al. (1965), who described the Diferences in positive fndings between the DFM and PCR maximum occurrence of ticks in May and June, with another methods are reported by Stünzner et al. (2006) and Stanczak less pronounced peak in autumn. Tese results correspond to et al. (1999) who tested 2,285 I. ricinus ticks by IFA and PCR. the fndings of other authors where two peaks of activity were It is apparent that diferent detection techniques may produce also registered (Peťko et al. 1996, Siuda 1996). divergent epidemiological data.

Vol. 38, no. 2 Journal of Vector Ecology 299

Te average infectivity during a long-term study (1996- movement), can signifcantly contribute to an investigation 2002) in the same location was 5.8% (Žákovská et al. 2008b), of tick-host behavior and safe repellent testing. Another which appears to be lower than the result of the 2011 study contribution of this study is that it analyzes the efciency of (8.4%). However, in the long-term study, the level of infection currently available modern products. changed not only within one year but also over the years, All tested products showed signifcant repellency and starting at 2.1% (2000) and culminating at 13.2% in 1998, as also protection. Te number of Lyme borreliosis patients in the recorded by Petko et al. (1996) in their fve-year observation Czech Republic in 2011 (4,835) is the highest detected in in Forest Park in Košice (Slovakia). Te study of Hubálek et al. the history of monitoring these patients in the CR, and (2002), carried out in an area of the South Moravia and Lower even within a relatively small area such as Pisárky, up to 65 Austria, described much greater DFM infectivity (24.6%) individual ticks can be caught during 1 h of fagging. To defend in 1,517 individual ticks. One of the reasons for the higher ourselves against both the high infectivity and invasion of number of positive ticks compared to our results could be ticks under their optimal environmental conditions, we must better reservoir competence of the locality in the lower Taya have knowledge and awareness of the critical times and make ecosystem. Te prevalence of a Borrelia infection in ticks is the application of appropriate insect repellents an essential one of the most essential components of the Lyme borreliosis part of our visits to these environments. risk assessment. To have meaningful information on when to avoid walking in parks or when to be most wary of ticks is Acknowledgments one way of preventing tick-borne infections. Critical months for the occurrence of ticks in 2011 were May and June, but We thank Dr. Martin Vácha for helpful comments the month of August showed the highest risk of spirochaetal concerning the design of the bioassay and technical support. infection, suggesting that the highest risk of transmission of Tis study was supported by grant MUNI/C 0776/012. the tick-borne borreliae in Pisárky locality is in May, June, and Authors declare that they have no confict of interest regarding August. Similar conclusions were also reported by Piesman et this article. al. (1990). Many in vivo and in vitro assays (Dremova and Smirnova REFERENCES CITED 1970, Ndungu et al. 1999, Jaenson et al. 2006) have been developed to examine the response of ticks to potential Alekseev, A.N. and H.V. Dubinina. 2000. Abiotic parameters repellents. Experiments in our study were carried out with and diel and seasonal activity of Borrelia-infected and the modifed moving-object-bioassay (Dautel et al. 1999), uninfected Ixodes persulcatus (Acarina: Ixodidae). J. which is a test system that provides the advantages of host- Med. Entomol. 37: 9-15. associated stimuli and is cheap, timesaving, and avoids ethical Alekseev, A.N., H.V. Dubinina, I. Van De Pol, and L.M. problems and animal sufering. However, it is possible for the Schouls. 2001. Identifcation of Ehrlichia spp. and results to be infuenced by an investigator exhaling the carbon Borrelia burgdorferi in Ixodes ticks in the Baltic regions dioxide within the closed room. of Russia. J. Clin. Microbiol. 39: 2237-2242. Only the short-time repellency of nymphs was examined Cerný, V., B. Rosický, J. Ašmera, K. Kadlčík, and V. Kobík. in this study. We focused on this developmental stage because 1965. Výsledky sledování fenologie klíštěte obecného it is predominant in the monitored area and therefore of high Ixodes ricinus (L.) v českých zemích v letech 1960–1962. epidemiological importance. All tested products showed Cs. Parasitol. 12: 125–131. signifcant repellency against the feld-collected nymphs, Danielová, V., N. Rudenko, M. Daniel, J. Holubová, J. Materna, but the hypothesis about linear efciency of the individual M. Golovchenko, and L. Schwarzová. 2006. Extension products according to the applied amounts of DEET had to of Ixodes ricinus and agent sof tick-borne diseases to be rejected at the 5% signifcance level. Such outcomes could mountain areas in the Czech Republic. International J. be a result of many factors, such as air temperature, humidity Med. Microbiol. 296: 48-53. and pressure, physiological/pathological state, individual Dautel, H., O. Kahl, K. Siems, M. Oppenrieder, L. Müller- history and age of the ticks and infection by pathogens, and Kuhrt, and M. Hilker. 1999. A novel test system for can be also expected with real usage. detection of tick repellents. Entomol. Exp. Applic. 91: It is essential to note that the feld-collected ticks were 431-441. strongly repelled by all tested products, because as far as Dautel, H. 2004. Test systems for tick repellents. Int. J. Med. the authors know, many studies have been carried out on Microbiol. 293: 182-188. laboratory-reared, pathogen-free ticks, ofen on diferent Dremova, V.P. and S.N. Smirnova. 1970. Efects of repellents tick species (Soares et al. 2010, Zhang et al. 2009). However, on hard (Ixodidae) and sof (Argasidae) ticks. Int. Pest such results can be infuenced by the “laboratory history” Contr. 12: 10-14. of the ticks (light-dark regime, feeding pattern, unnatural Hubálek, Z., D. Stünzner, J. Halouzka, W. Sixl, I. Wendelin, Z. environment). We tested ticks that attacked a live host, as in Juricová, and Y.O. Sanogo. 2002. Prevalence of borreliae real situations, collected shortly before the test directly from in ixodid ticks from a foodplain forest ecosystem. Wien. their natural habitat. Experiments with host-seeking ticks Klin. Wochenschr. (WKWOAO) 115: 121-124. without previous infuence of laboratory breeding, carried out Jaenson, T.G., S. Garboui, and K. Palsson. 2006. Repellency on the apparatus providing host-associated stimuli (warmth, of oils of lemon eucalyptus, geranium, and lavender and

300 Journal of Vector Ecology December 2013

the mosquito repellent MyggA natural to Ixodes ricinus Siuda, K. 1996. Bionomical and ecological characteristic of (Acari: Ixodidae) in the laboratory and feld. J. Med. ticks (Acari: Ixodida) of signifcant medical importance Entomol. 43: 731-736. on the territory of Polland. Roczniki Akad. Med. Bialym. Jaenson, T.G., D.G. Jaenson, L. Eisen, E. Petersson, and E. 41: 11-19. Lindgren. 2012. Changes in the geographical distribution Soares, S.F., R. de Sousa Braga, L.L. Ferreira, C.C. Louly, L.A.D. and abundance of the tick Ixodes ricinus during the past de Sousa, A.C. da Silva, and L.M. Borges. 2010. Repellent 30 years in Sweden. Parasit. Vectors 5: 8. activity of DEET against Amblyomma cajennense (Acari: Kampen, H., D.C. Rötzel, K. Kurtenbach, W.A. Maier, and Ixodidae) nymphs submitted to diferent laboratory H.M. Seitz. 2004. Substantial rise in the prevalence bioassays. Brasil. Parasitol. Vet. (RBPV) 19: 12-16. of lyme borreliosis spirochetes in a region of western Sorge, F. 2009. Prevention with repellent in children. Arch. Germany over a 10-year period. Appl. Environ. Pédiat. 2: 115-122. Microbiol. 70: 1576-1582. Stańczak, J., M. Racewicz, B. Kubica-Biernat, W. Kruminis- Krober, T. and P.M. Guerin. 2002. Ixodid ticks avoid contact Łozowska, J. Dabrowski, A. Adamczyk, and M. with liquid water. J. Exp. Biol. 202: 1877-1883. Markowska. 1999. Prevalence of Borrelia burgdorferi Materna, J., M. Daniel, and V. Danielová. 2005. Altitudinal sensu lato in Ixodes ricinus ticks (Acari, Ixodidae) in distribution limit of the tick Ixodes ricinus shifed diferent Polish woodlands. Ann. Agricult. Environ. considerably towards higher altitudes in central Europe: Med. 6: 127-132. results of three years monitoring in the Krkonose Mts. Stünzner, D., Z. Hubálek, J. Halouzka, I. Wendelin, W. Sixl, and (Czech Republic). Centr. Eur. J. Publ. Hlth. 13: 24-28. E. Marth. 2006. Prevalence of Borrelia burgdorferi sensu Ndungu, M.W., S.C. Chabra, and W. Lwande. 1999. Cleome lato in the tick Ixodes ricinus in the Styrian mountains hirta essentials oil as livestock tick (Rhinicephalus of Austria. Wiener Klin. Wochenschr. (WKWOAO) 118: appendiculatus) and maize weevil (Sitophilus zeamais) 682-685. repellent. Fitoterapia 70: 514-516. Zhang, A., J.A. Klun, S. Wang, J.F. Carroll, and M. Debboun. Nejedlá, P., A. Norek, K. Vostal, and A. Žákovská. 2009. What 2009. Isolongifolenone: a novel sesquiterpene repellent is the percentage of pathogenic borreliae in spirochaetal of ticks and mosquitoes. J. Med. Entomol. 46: 100-106. fndings of mosquito larvae? Ann. Agricult. Environ. Žákovská, A., J. Netušil, and H. Martiníková. 2007. Infuence Med. 16: 273–276. of environmental factors on the occurrence of Ixodes Peťko, B., A. Štefančíková, G. Tresová, J. Peterková, I. ricinus ticks in the urban locality of Brno – Pisárky, Škardová, H. Prokopčáková, and L. Čisláková. 1996. Czech Republic. J. Vector Ecol. 32: 29-33. Kliešť obyčajný (Ixodes ricinus) jako zdroj infekcie ľudí Žákovská, A., E. Janouškovcová, K. Pejchalová, J. Halouzka, a psov pôvodcom lymeskej borreliózy na Slovensku. and M. Dendis. 2008a. Identifcation and characterization Slovenský Vet. Časopis. 21: 313-319. of 31 isolates of Borrelia burgdorferi (Spirochaetales, Picken, M.M., R.N. Picken, D. Han, Y. Cheng, and F. Strle. Spirochaetaceae) obtained from various hosts and 1996. Single-tube nested polymerase chain reaction vectors using PCR-RFLP and SDS-PAGE analysis. Acta assay based on Flagellin gene sequences for detection of Parasitol. 53: 186-192. Borrelia burgdorferi sensu lato. Eur. J. Clin. Microbiol. Žákovská, A., K. Vostal, and H. Martiníková. 2008b. A Infect. Dis. 15: 489-498. longitudinal study of the prevalence of borreliae in ticks Piesman, J., J.R. Oliver, and R.J. Sinsky. 1990. Growth kinetics in the urban locality of Brno / Pisárky, Czech Republic. J. of the Lyme disease spirochete (Borrelia burgdorferi) in Vector Ecol. 33: 385-388. vector ticks (Ixodes dammini). Am. J. Trop. Med. Hyg. 42: 352-357.

47 Publikace IV.

DNA-based identification and OspC serotyping in cultures of Borrelia burgdorferi s.l. isolated from ticks collected in the Moravia (Czech Republic)

Shrnutí:

Cílem studie bylo identifikovat genospecies Borrelia burgdorferi sensu lato izolovaných z klíšťat získaných na lokalitě Brno – Pisárky (Česká Republika). K identifikaci byly využity dva lokusy (flaB a ospC). Pro oba lukusy byla určena sekvence, jež byla využita k identifikaci izolátů Bbsl. Z 12 izolátů bylo 9 identifikováno jako B. garinii a 3 jako B. afzelii. Na základě analýzy ospC sekvence byly izoláty rozděleny do 7 ospC specifických typů.

Příspěvek autora disertační práce:

Úkolem autora předkládané disertační práce byla izolace DNA, amplifikace studovaných lokusů, restrikční analýza flaB lokusu, sekvenční analýza obou lokusů a fylogenetická analýza získaných dat.

Podíl předkladatele disertační práce na výsledku: 70 %

Poznámka: v obrázku č. 2a je tisková chyba. Opravený obrázek je přiložen za diskuzí k článku. Opravená verze bude publikována v dalším čísle Journal of Vector ecology: Volume 42 issue 1.

172 Journal of Vector Ecology June 2016

DNA-based identifcation and OspC serotyping in cultures of Borrelia burgdorferi s.l. isolated from ticks collected in the Moravia (Czech Republic)

Adam Norek1,2*, Lubomír Janda2, and Alena Žákovská1

1Department of Animal Physiology and Immunology, Institute of Experimental Biology, Faculty of Science, Masaryk University, Kamenice 753/5, 62500 Brno, Czech Republic, [email protected] 2CEITEC – Central European Institute of Technology, Masaryk University, Kamenice 753/5, 62500 Brno, Czech Republic

Received 15 February 2016; Accepted 26 March 2016

ABSTRACT: Two diferent genetic loci, faB and ospC, were employed to assign genospecies and OspC phylogenetic type to 18 strains isolated from ticks collected in Pisárky, a suburban park in the city of Brno, Czech Republic. Te RFLP analysis revealed three diferent genospecies (B. afzelii, B. garinii, and B. valaisiana). Tree samples from the collection contained more than one genospecies. In the other 15 strains, nucleotide sequences of faB and ospC were determined. Te following phylogenetic analysis assigned 12 isolates to genospecies B. garinii and three to B. afzelii. Tese isolates were further subdivided into seven distinct ospC groups. Te most related OspC types were G2, G4, and G5 (B. garinii) and A3 and A8 (B. afzelii). Journal of Vector Ecology 41 (1): 172-178. 2016.

Keyword Index: Tick, Borrelia burgdorferi, OspC, Flagellin B, Lyme disease.

INTRODUCTION Barbour and Travinsky 2010) and in combination with other DNA markers, the risk of false genospecies typing is low. Lyme disease (LD), the most common tick-borne disease of According to previous studies, ospC can be divided into the Northern Hemisphere, is a multi-system disorder caused by a several major groups (phylogenetic types/genotypes or serotypes) Lyme disease spirochete belonging to Borrelia burgdorferi sensu that difer not only in an amino acid sequence, but also in physical lato (Bbsl) complex (Burgdorfer et al. 1982, Steere et al. 1983). properties (e.g., surface charge), ability to bind plasminogen, and LD has been described as a three-stage disease. Te frst stage, a seroreactivity (Kaiser and Rauer 1998, Earnhart et al. 2005, Lagal localized form of LD, is characteristic of the presence of Borrelia in et al. 2006). Te OspC major group is defned as a group of alleles the skin close to the tick bite site. Te second and the third stages, that difer in more than 8% of their nucleotide sequence from the disseminated form of the LD, occur when the invasive strain alleles in other OspC groups and difer in less than 2% from alleles of spirochete overcomes the defense mechanisms of humans and in the same group. So far, 69 ospC groups have been identifed invades to sites of secondary infection, reviewed by Stanek et al. in Europe. Twenty-fve of them are associated with the invasive (2012). Both stages are accompanied by various clinical symptoms phenotype of B. garinii, B. afzelii, and B. burgdorferi s.s. (Lagal et loosely associated to genospecies, i.e., Borrelia burgdorferi sensu al. 2002, Bunikis et al. 2004, Tonetti et al. 2015). stricto - Lyme arthritis; B. garinii – neuroborreliosis; B. afzelii – Te aim of this study was to genetically identify Bbsl strains cutaneous form of LD (van Dam et al. 1993). previously isolated from ticks collected in Pisárky, a suburban Nine distinct genospecies responsible for the human form park in the city of Brno, Czech Republic, and to assign each strain of LD have been reported in Europe (B. afzelii, B. bavariensis, B. to the respective ospC serotype. bissettii, B. burgdorferi s.s., B. garinii, B. kurtenbachii, B. lusitaniae, B. spielmanii, and B. valaisiana), with B. afzelii, B. garinii, and MATERIALS AND METHODS B. burgdorferi sensu stricto recognized as the most prevalent in central Europe, including the Czech Republic (Stanek and Reiter Locality and strains used 2011, Rudenko et al. 2011, Bonczek et al. 2015). Eighteen strains obtained from Masaryk University (Brno, Due to their high genetic heterogeneity, Bbsl genospecies are Czech Republic) designated BRZ22 – BRZ24, BRZ26 - BRZ28, further subdivided into specifc genotypes or serotypes, which may BRZ30 –BRZ35, BRZ37 – BRZ40, BRZ42, BRZ43 (Table 1) were correlate with the infectivity or the host preference. Several genetic provided for the genetic analysis (Pejchalová et al. 2007). All loci have been used for this purpose, most commonly ospA, ospC, strains were isolated from ticks (Ixodes ricinus) collected in the vlsE, rrs(5S)-rrl(23S) intergenic spacer, and many others (Picken Pisárky Valley (city of Brno, South Moravia, Czech Republic), in 1992, Rosef et al. 2009, Coipan et al. 2013). Among these loci, the the southeast part of the Czech Republic close to the borders with gene for ospC (Outer surface protein C) plays the pivotal role, Austria and Slovakia. Te Brno-Pisárky urban park is located 2 mostly because of the OspC polymorphic nature (Rudenko et al. km outside the center of the Moravian metropolis of Brno and 2013, Qiu and Martin 2014), as well as the crucial role in borrelia is frequently visited by citizens. Te procedure of spirochete dissemination and the ability to induce production of protective isolation has been previously described (Zákovská et al. 2002). antibodies (Earnhart et al. 2005, Lagal et al. 2006, Carrasco et al. Ticks collected by “fagging” were dissected and those positive for 2015). Although ospC may undergo homologous recombination, spirochetes (by dark-feld microscopy) were used for inoculation such an event is relatively rare (Dykhuizen and Baranton 2001, of BSK-H media with appropriate antibiotics.

49 Vol. 41, no. 1 Journal of Vector Ecology 173

Table 1. Summary of PCR, PCR-RFLP, and sequencing results.

Sample PCR PCR PCR faB faB accession OspC OspC accession Strain No. BBN BBout RFLP genospecies No. genotype No.

1 BRZ 22 + + BG BG JN828677 G4 JN828662 2 BRZ 23 + + BG BG JN828678 G4 JN828663 3 BRZ 24 + + BG BG JN828679 G4 JN828664 4 BRZ 26 + + BG BG JN828685 G4 JN828670 5 BRZ 27 + + BG/BA nd nd nd nd 6 BRZ 28 + + BG BG JN828686 G5 JN828671 7 BRZ 30 + + BA BA JN828691 A3 JN828676 8 BRZ 31 + + BA BA JN828687 A8 JN828672 9 BRZ 32 + + BG BG JN828680 G4 JN828665 10 BRZ 33 + + BA BA JN828690 ND JN828675 11 BRZ 34 + + BG BG JN828681 JN828666 12 BRZ 35 + + BV/BA nd nd nd nd 13 BRZ 37 + + BG BG JN828682 G4 JN828667 14 BRZ 38 + + BG BG JN828688 G5 JN828673 15 BRZ 39 + + BG BG JN828689 G5 JN828674 16 BRZ 40 + + BG/BV nd nd nd nd 17 BRZ 42 + + BG BG JN828683 G4 JN828668 18 BRZ 43 + + BG BG JN828684 G4 JN828669 BA - B. afzelii, BG – B. garinii, BV – B. valaisiana, + - positive, nd – not done.

DNA extraction Master Mix (QIAgen). Te volume of the reaction mixture was Prior to DNA isolation, all spirochete cultures were adjusted with sterile DNAse-free water to the fnal volume of 50 centrifuged for 10 min (8,000 g) at room temperature and the μl. PCR runs were performed with the following profle: an initial cultivation medium was discarded. Te pellet was resuspended in activation step 96° C/10 min, 45 cycles consisting of three steps: 200 μl of sterile PBS bufer and applied to the DNA extraction (i) denaturation step 96° C/10 s, (ii) annealing step 55° C/10 s, (iii) using a GeneProof PathogenFree DNA Isolation Kit (GeneProof) extension step 72° C/60 s, and a fnal extension step of 72° C/10 following the manufacturer’s instructions. min.

PCR assays RFLP Te presence of the DNA specifc to Bbsl in analyzed Te purity of all PCR-BBN positive bacterial cultures was spirochaetal cultures was confrmed by two independent PCR verifed by the Restriction Fragment Length Polymorphism reactions targeting parts of the Bbsl specifc faB gene, designated analysis (RFLP). Products of PCR-BBout (874bp) were digested in this study as PCR-BBN (276 bp) and PCR-BBout (874 bp), for 2 h at 37° C with AluI endonuclease (New England BioLabs), respectively. Both PCR, designed in GenProof (Czech Republic), separated on a 2% (w/v) agarose gel stained with ethidium were based on a previous study by Picken (Picken 1992) and bromide and compared to restriction patterns characteristic for were performed according to manufacturer’s instructions. A set Bbsl genospecies as described by Janouškovcová et al. (2004). of positive (plasmid DNA containing faB gene) and negative When products of digestion shorter than 100 bp are excluded controls (sterile deionized DNA-free water), as well as the DNA from the evaluation process, the specifc restriction patterns isolation control, was incorporated in each PCR run. Moreover, for each genospecies are as follows: B. afzelii 237bp/261bp; B. a PCR-BBN mix contained internal positive control, which is garinii and B. bavariensis 102bp/177bp/261bp; B. valaisiana synthesized whenever the reaction is not inhibited. 106bp/177bp/312bp; B. burgdorferi sensu stricto 237bp/ 261bp; Novel ospC specifc PCR was introduced to determine the and B. spielmanii 177bp/250. ospC ORF sequence. Te set of OspCF primer (5’-CAC CAA AAA GAA TAC ATT AAG TGC GAT ATT AAT GAC-3’) and DNA sequencing OspCR (5’-TTA AGG TTT TTT TGG ACT TTC TGC CAC AAC DNA sequences were obtained by direct sequencing of PCR AGG-3’) in fnal concentration 0.18 pmol and 0.14 pmol was product extracted from agarose gel (Gel Extraction Kit; QIAgen) added, together with 4 μl of template DNA, to 25 μl of HotStarTaq with the same set of primers as used for the initial amplifcation.

174 Journal of Vector Ecology June 2016

Te sequencing was performed at GeneProof (Czech Republic). group containing B. garinii (two positions in 248) and 0% in the Te data were deposited in GeneBank under accession numbers B. afzelii group. JN828662 – JN828691 (Table 1). DNA sequences for ospC ORF were determined using PCR- OspC and direct sequencing of PCR products afer excision from Data analysis the agarose gel and isolation. Obtained DNA sequences were Te partial sequences of the faB and ospC gene (except aligned and phylogenetic analysis was performed (UPGMA, for the signal part) and corresponding predicted proteins were Jukes-Cantor, bootstrap 1,000). In the resulting tree, our isolates aligned using Clustal W 2.1 and compared to reference sequences were divided into seven distinct groups, fve of them comprising downloaded from GeneBank. Only minor manual corrections B. garinii strains and two consisting of B. afzelii strains (Figure 2B, were performed. All phylogenetic analyses were performed by the Table 1). unweighted pair group method with arithmetic means (UPGMA). To confrm the identifcation based on faB gene and Distances of nucleotides and/or amino acids were measured by determination of the OspC genotypes of our spirochaetal cultures, the Jukes-Cantor method. Te bootstrap value was set to 1,000. we performed an additional multiple sequence alignment. In Te phylogenetic tree was drawn using the CLC Sequence this alignment, we used a wide dataset of more than 100 ospC Viewer 7.5 sofware. Variability measurements were calculated sequences. Diferent OspC phylogenetic types for both European from predicted protein sequences. Scorecon server was used to and North American isolates were downloaded from GeneBank determine the diversity of position scores, and the number of and aligned against ospC genes obtained in this study. Te conserved positions (Valdar 2002) and variability plot based selection of previously published sequences was based on three on Wu-Kabat variability measurements was constructed (PVS criteria: i) each sequence covers more than 95% of ospC ORF server). except the signal part of the protein, ii) there is a known source of the host tissue for the Borrelia isolation, and iii) the OspC RESULTS genotype has been previously determined (Lagal et al. 2002, Earnhart et al. 2005, Rudenko et al. 2013). Te most similar All 18 isolates were examined by dark-feld microscopy for sequences were subsequently translated to proteins and aligned the presence of spirochetes. Te viable and motile spirochetes to the predicted OspC proteins of the strains isolated from the were confrmed for each sample (data not shown). To confrm the Pisárky locality. MSA with the most related OspC specifc types presence of Bbsl specifc DNA, we employed two PCRs, PCR-BBN divided our samples into seven distinct OspC groups. Strain and PCR-BBout, amplifying highly conserved and the borrelia- BRZ26 was homological to B. garinii strain, WABSou genotype specifc gene for fagellin B. Te result was verifed with PCR- G2, eight strains (BRZ22–24, –32, –34, –37 –42, and BRZ43) were OspC amplifying the second locus, the gene for OspC protein. classifed as genotype G4 with the highest similarity to B. garinii Te products of all three PCR reactions were detected in all cases. strain KL11, and BRZ 38 together with BRZ 39 were homological Te product of the internal control of PCR-BBN, as well as other to B. garinii strain VSBM, genotype G5. Te BRZ28 sample was positive and/or negative controls for DNA isolation and PCR, also assigned to the G5 genotype, but the most related strain from confrmed the results. our dataset was PBr. BRZ31 was closely related to B. afzelii Shrv To rule out the cultures contamination by other strains of Bbsl, representing genotype A8, and strain BRZ30 was assigned to the the RFLP analysis was performed. Products of the PCR-BBout OspC genotype A3 with the highest similarity to B. afzelii strain reaction (874 bp) were subjected to AluI endonuclease digestion. E61. Strain BRZ 33 was excluded from all used OspC genotypes Te resulting restriction patterns were compared to restriction and formed its own cluster (Figure 2). pattern characteristics for B. garinii, B. afzelii, B. burgdorferi sensu In summary, we have detected three genospecies (B. garinii, stricto, and B. valaisiana. Te RFLP analysis proves the presence B. afzelii, and B. valaisiana) in analyzed collections. Tree cultures of Bbsl DNA from more than one genotype in three instances. contained a mixture of two genospecies BRZ 27 (B. garinii/B. For the BRZ 27, the co-culture of B. garinii and B. afzelii was afzelii), BRZ 35 (B. afzelii/B. valaisiana), and BRZ 40 (B.garinii/B. determined. Te BRZ 35 sample contains the mixture of B. afzelii valaisiana). In remaining isolates, only a single genospecies was and B. valaisiana, and the BRZ 40 strain contains both B. garinii observed, and OspC characterization was conducted. Based on the and B. valaisiana. No further analysis was performed with these OspC DNA sequencing, we conclude that the collection contains three samples. No contamination was detected in the remaining 7 diferent strains. Strains belonging to serotype G4 and G5 (BRZ strains. Te restriction pattern for B. garinii was detected in 12 38, BRZ 39), respectively, are considered as several isolates of two instances. RFLP results correspond to B. afzelii in three instances strains. (Table 1). DNA sequencing of PCR-BBout products confrmed the DISCUSSION RFLP results. Te multiple alignments of peptides predicted from the obtained DNA sequences were compared to FlaB of the Our study focused on the identifcation of Bbsl strains isolated reference strain deposited in GeneBank. Te phylogenetic analysis from tick tissue obtained at Brno-Pisárky. A previous long-term divided our isolates into two distinct groups containing either B. study (Zákovská et al. 2008) reported the average positivity to afzelii or B. garinii (Table 1, Figure 1). An overall diversity among be 5.8% of 2,813 ticks (1996–2002). Moreover, in a similar study predicted FlaB polypeptides derived from strains isolated in from 2011, the positivity appears to rise to an average of 8.3%, Brno was estimated to be 4.4%, with a mere 11 mutations in 248 with a steady increase during the season up to 13.2% recorded in positions. Te global diversity result was estimated to 0.9% in the August (Žákovská et al. 2013). Since it is a frequently visited urban

Vol. 41, no. 1 Journal of Vector Ecology 175

Figure 1. Phylogenetic analysis of predicted FlaB proteins derived from DNA sequences with reference strain downloaded from GeneBank. Sequences obtained in this study were stored in GeneBank under accession Nr. attached to strain designation.

Figure 2. Phylogenetic analysis of predicted OspC proteins derived from DNA sequences with most related OspC genotypes downloaded from GeneBank (A). Sequences obtained in this study were stored in GeneBank under access. Nr. attached to strain designation); Wu- Kabat variability plot of predicted OspC proteins isolated at locality Pisárky (B).

176 Journal of Vector Ecology June 2016

park, the detailed determination of represented genospecies from Seven distinct OspC phylogenetic types represent a relatively previous studies and its phylogenetic type (serotype) can provide high number concerning both the total area of the locality valuable ecological and epidemiological data. (approx. 400 m2) and the number of examined strains. High Our results are in agreement with previously published data level of OspC variability in our isolates might be related to the from the surrounding regions in Austria, the Czech Republic, spirochetes source. Ticks as the vector animals represent the and Slovakia (Smetanová et al. 2007, Bazovska et al., 2011, point where borrelia from all types of reservoir hosts (e.g., small Schmidt et al. 2014, Bonczek et al. 2015), where B. afzelii, B. mammals, birds, and lizards) can be harbored. Unlike in other garinii, and B. valaisiana prevail, followed by B. burgdorferi sensu hosts, selection pressure, which would afect the diversity in stricto and B. bavariensis. B. spielmanii and B. lusitaniae were OspC, has not been described in ticks (Dykhuizen and Baranton detected only rarely. Former studies from Slovakia have revealed 2001, Brisson et al. 2011, Vuong et al. 2013). Te local variability the predominance of B. garinii, B. afzelii and a less frequent in ospC, together with the potential of a horizontal gene transfer, occurrence of B. valaisiana (Smetanová et al. 2007, Bazovska et al. can generate strains with novel OspC phylogenetic types and new 2011). In a similar study investigating the prevalence of zoonotic serotype identities (Barbour and Travinsky 2010). Tis could be pathogens in rodents from a region in Austria close to the Czech benefcial for the Borrelia population, especially in areas where border, B. afzelii was shown to be the most common genospecies reservoir animals are commonly challenged by infected ticks, (Schmidt et al. 2014). Te distribution of Borrelia genospecies and thus immunized, can prevent borrelia from inducing the in the area of South Moravia (including the region of Brno) has infection. On the other hand, such a huge variability has a severe been recently described by Bonczek (2015). His study examined implication for the proposed OspC-based vaccines. Although more than 400 ticks for the presence of Bbsl, and the genospecies chimeric polyvalent OspC vaccine has been successfully tested in were determined by DNA sequencing. According to this long- the animal model (Earnhart and Marconi 2007), the occurrence term study (2008–2012), the most prevalent genospecies were of multiple OspC types even in a small locality can complicate the B. afzelii (70%), followed by B. garinii (10%) and B. valaisiana utilization of such a construct for the prevention of Lyme disease. (8.6%). B. burgdorferi s.s. and B. spielmanii have been detected It would be essential to defne those OspC types that are connected only occasionally. His results correspond to data published by with strains responsible for the human form of LD and in this way Höning et al. (2015) from the southern part of the Czech Republic. select the set of epitopes required for a fully protective LD vaccine Te distribution of genospecies is slightly diferent in the Eastern for each region. Moravia (located close to the borders with Poland and Slovakia). In a recent study by Venclíková et al. (2014), where they examined Acknowledgments 1,279 ticks, B. afzelii and B. valaisiana were identifed as the most abundant. Moreover, they confrmed the presence of B. garinii, B. Tis article was supported by the Specifc Research Program burgdorferi s.s., and even B. spielmanii and B. lusitaniae. at Masaryk University, EurNegVec COST Action TD1303, Except for isolates where only the single genospecies was MSM:0021622415 and Rector´s program to support a MU found, our results confrmed co-cultivation of two genospecies student´s creative work: MUNI/E/0131/2009. in three instances. Te RFLP patterns corresponding to B. afzelii, B. garinii, and/or B. valaisiana were confrmed. Interestingly, all REFERENCES CITED three possible combinations were observed. Co-infection of ticks with multiple genospecies of Borrelia is common (Rauter et al. Andersson, M., K. Scherman, and L. Råberg. 2013. Multiple- 2002, Andersson et al. 2013), but the variation in genospecies strain infections of Borrelia afzelii: a role for within-host distribution in vectors favors combinations of those adapted to the interactions in the maintenance of antigenic diversity? Am. same type of reservoir animal (Rauter and Hartung 2005) because Nat. 181: 545–554. of the diferent resistance to the host complement. B. garinii and Barbour, A.G. and B. Travinsky. 2010. Evolution and distribution B. valaisiana are predominantly bird parasites. B. afzelii is, on the of the ospC Gene, a transferable serotype determinant of other hand, more adapted to rodents (Kurtenbach et al. 1998, Borrelia burgdorferi. mBio 1: e00153–10. 2002). Adaptation to a particular type of host is pronounced in Bazovska, S., J. Durovska, M. Derdakova, V. Taragelova, J. Pancak, strong inhibition of maladapted genospecies afer a tick blood M. Zaborska, and P. Traubner. 2011. Te genospecies B. meal. Tis should increase the probability of coexistence of burgdorferi s.l., isolated from ticks and from neurological genospecies with the same host preference in isolated cultures. patients with suspected Lyme borreliosis. Neuro Endocrinol. Te detected discrepancy in ratio among genospecies in mixed Lett. 32: 491–495. cultures with diferent host adaptation can be explained by only Bonczek, O., A. Žákovská, L. Vargová, and O. Šerý. 2015. the partial elimination of unadapted genospecies, which were Identifcation of Borrelia burgdorferi genospecies isolated recovered during the cultivation (Humair et al. 2007). from Ixodes ricinus ticks in the South Moravian region of the Te ospC-based phylogenetic analysis assigns our isolates to Czech Republic. Ann. Agric. Environ. Med. 22: 637–641. seven diferent OspC major groups. G2, G4, G5 (B. garinii), and A3 Brisson, D., N. Baxamusa, I. Schwartz, and G.P. Wormser. 2011. and A8 (B. afzelii) were among the most related phylogenetic types. Biodiversity of Borrelia burgdorferi strains in tissues of Lyme All the fve genotypes were reported as potentially pathogenic for disease patients. PloS One 6(8): e22926. humans, as the strains carrying these specifc OspC alleles were Bunikis, J., U. Garpmo, J. Tsao, J. Berglund, D. Fish, and A.G. isolated from secondary sites of the LD infection (Lagal et al. 2002, Barbour. 2004. Sequence typing reveals extensive strain 2003). diversity of the Lyme borreliosis agents Borrelia burgdorferi in

178 Journal of Vector Ecology June 2016

Engl. J. Med. 308: 733–740. Zákovská, A., P. Nejedla, A. Holíková, and M. Dendis. 2002. Tonetti, N., M.J. Voordouw, J. Durand, S. Monnier, and L. Gern. Positive fndings of Borrelia burgdorferi in Culex (Culex) 2015. Genetic variation in transmission success of the Lyme pipiens pipiens larvae in the surrounding of Brno city borreliosis pathogen Borrelia afzelii. Ticks Tick-Borne Dis. 6: determined by the PCR method. Ann. Agric. Environ. Med. 334–343. 9: 257–259. Valdar, W.S.J. 2002. Scoring residue conservation. Proteins 48: Žákovská, A., H. Nejezchlebová, N. Bartoňková, T. Rašovská, 227–241. H. Kučerová, A. Norek, and P. Ovesná. 2013. Activity of the Venclíková, K., L. Betášová, S. Sikutová, P. Jedličková, Z. Hubálek, tick Ixodes ricinus monitored in a suburban park in Brno, and I. Rudolf. 2014. Human pathogenic borreliae in Ixodes Czech Republic, in association with the evaluation of selected ricinus ticks in natural and urban ecosystem (Czech Republic). repellents. J. Vector Ecol. 38: 295–300. Acta Parasitol. Witold Stefański Inst. Parasitol. Warszawa Pol. Zákovská, A., K. Vostal, and H. Martiníková. 2008. A longitudinal 59: 717–720. study of the prevalence of borreliae in ticks in the urban Vuong, H.B., C.D. Canham, D.M. Fonseca, D. Brisson, P.J. locality of Brno-Pisárky, Czech Republic. J. Vector Ecol. 33: Morin, P.E. Smouse, and R.S. Ostfeld. 2013. Occurrence and 385–388. transmission efciencies of Borrelia burgdorferi ospC types in avian and mammalian wildlife. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 27: 594–600.

Opravená verze obrázku 2a:

54 Publikace V.

Epitope mapping of Borrelia burgdorferi OspC protein in native fold

Shrnutí:

Cílem studie bylo identifikovat vazebné epitopy monoklonálních protilátek odvozených od OspC proteinu B. afzelii BRZ31 (izolované na lokalitě Brno – Pisárky, Česká Republika) a určit jejich afinitu k čtyřem OspC proteinům patogenních B. garinii, Bafzelii a B. burgdorferi. Pro monoklonální protilátky 3F4 a 2A9 byly identifikovány lineární epitopy v dříve popsaných imunogenních oblastech. U monoklonální protilátky 2A9 byl potvrzen vysoce konzervovaný diskontinuální strukturní epitop nacházející se v blízkosti vazebného místa LBD2.

Příspěvek autora disertační práce:

Úkolem autora předkládané disertační práce byla příprava OspC proteinů v nativní formě, selekce protilátek proti variabilním oblastem, stanovení reaktivity protilátek proti studovaným variantám OspC a definování epitopů na základě bioinformatické analýzy a imunoprecipitace a následné analýzy hmotnostních spekter.

Podíl předkladatele disertační práce na výsledku: 70%

Poznámka: článek je v současné době v oponentském řízení.

Strany 42 – 56 jsou vynechány záměrně. Jsou na nich aminokyselinové sekvence porovnávaných OspC proteinů (125 sekvencí) v uzamčeném formátu .pdf a nelze je vyhodnocovat bez manuálního přepsání.

Protein Science

Epitope mapping of Borrelia burgdorferi OspC protein in native fold

Journal: Protein Science

Manuscript ID PRO-16-0279

Wiley - Manuscript type: Full-Length Papers

Date Submitted by the Author: 23-Nov-2016

Complete List of Authors: Norek, Adam; Stredoevropsky technologicky institut, Protein Structure and Dynamics CF: Josef Dadok National NMR Centre; Masarykova Univerzita, Institute of Experimental Biology Janda, Lubomír ; Masarykova Univerzita, CEITEC

epitope mapping, monoclonal antibody, Outer surface protein C, OspC, Keywords: Borrelia burgdorferi, protein alignment, immunoprecipitation

John Wiley & Sons

Page 1 of 56 Protein Science

Epitope mapping of Borrelia burgdorferi OspC protein in native fold

Adam Norek1,2, Lubomír Janda1

1. CEITEC – Central European Institute of Technology, Masaryk University, Kamenice

753/5, 62500 Brno, Czech Republic

2. Department of Animal Physiology and Immunology, Institute of Experimental Biology,

Faculty of Science, Masaryk University, Kamenice 753/5, 62500 Brno, Czech Republic

Corresponding author:

Adam Norek

Address: CEITEC – Central European Institute of Technology, Masaryk University Kamenice

753/5, 62500 Brno, Czech Republic

Email: [email protected]

Running title

OspC epitope mapping

Total number of manuscript pages: 21

Supplementary material pages: 0

Tables: 1

John Wiley & Sons

Protein Science Page 2 of 56

Figures: 8

Description of supplementary material including filenames:

Supplement_1.tiff – Size exclusion chromatography of OspC under different conditions

Supplement_2.tiff – epitope variability analysis

Supplement_3.doc – OspC dataset amino acid alignment

Supplement_4.doc – 3F4 epitope alignment

Supplement_5.doc – 2A9 epitope alignment

Supplement_6.doc – 2D1 epitope alignment

John Wiley & Sons

Page 3 of 56 Protein Science

Abstract

In current work, we used recombinant OspC protein in native fold derived from B. afzelii

strain BRZ31 and following selection process to produce three mouse monoclonal antibodies

able to bind to variable parts of up to five different OspC proteins. Applying the combination

of mass spectrometry assisted epitope mapping and affinity based theoretical prediction we

have localised regions responsible for antigen-antibody interactions and approximate

epitopes’ amino acid composition. Two mAbs (3F4 and 2A9) binds to linear epitopes located

in previously described immunogenic regions in the exposed part of OspC protein. The third

mAb (2D1) recognises highly conserved discontinuous epitope close to the ligand binding

domain 1.

Keywords: epitope mapping, monoclonal antibody, outer surface protein C, OspC, Borrelia

burgdorferi, protein alignment, immunoprecipitation

Significance: OspC protein is a major antigen of Borrelia burgdorferi sensu lato, the Lyme

disease spirochete, responsible for an early immune response. OspC immunogenicity is

routinely used in diagnostic assays, and it was employed in several OspC based experimental

vaccines. The utilisation of OspC in diagnostic a prophylaxis of Lyme disease is complicated

by highly its polymorphic nature pronounced in more than 70 different ospC phylogenetic

types of which at least 34 were connected to human infection. Immunisation with OspC can

lead to the production of protective antibodies preventing borrelia dissemination but the range

of protection is limited to OspC type used for immunisation.The exact knowledge of

immunogenic regions in OspC protein as well as corresponding epitopes may contribute to

John Wiley & Sons

Protein Science Page 4 of 56

improvements in currently used diagnostic assays. Moreover, the identification of conserved

epitopes may decrease the significance of OspC variability in development of fully protective

Lyme disease vaccine.

John Wiley & Sons

Page 5 of 56 Protein Science

Introduction

Outer surface protein C (OspC) is one of the most dominant antigens on the surface of Lyme

disease (LD) spirochete, Borrelia burgdorferi sensu lato (Bbsl) and it is considered as an

important factor of borrelia infectivity. Although the role of OspC remains somehow elusive,

it has been demonstrated that it is essential in the infection establishment, dissemination 1–3

and can promote spirochetes’ evasion of macrophages 4. Besides the physiological functions,

OspC protein is known for its polymorphic nature and immunogenicity 5. This has been

exploited in the development of serologic assays for laboratory confirmation of LD 6–8 and

proposed vaccines 9–11.

Regardless the means of immunisation and phylogenetic type, the OspC protein can trigger

strong immune response (seroconversion) both in human patients and in animals, leading to

the production of wide range of specific antibodies in high titters 5,9,10. On the other hand, the

quality of antibodies and recognised epitopes may vary depending on the conformation state

of antigen used 12–14. The tertiary and quarternary structure of OspC seems to have an impact

on production of “more relevant” antibodies possibly due to the steric hindrance, especially

when considering discontinuous epitopes.

In the native conformation, OspC consists of two identical monomers (~22 kDa each) folded

in the compact mushroom shape like a four-helical bundle. The dimer is stabilised by

interactions of two α-1 helices, each belonging to one of the subunits 15. Each subunit has a

lipid moiety attached to N-terminal cysteine anchoring the complex into the outer membrane

of B. burgdorferi 16. When displayed on the surface of Bbsl, OspC exposes mainly apical part

of the dimer and most probably C-terminal conserved polyproline II like helix

John Wiley & Sons

Protein Science Page 6 of 56

(PVVAESPKKP) 12.

The tertiary and/or quarternary structure of OspC and related epitopes accessibility seems to

play a crucial part in borrelia dissemination and protectiveness of elicited antibodies. It has

been proposed earlier, that only non-denaturated protein is able to elicit protective antibodies

10,17,18. The importance of preserved tertiary structure also supports the results of experiments

with GST-tag, enhancing the folding, fused to recombinant OspC. GST-tagged rOspC showed

prophylactic capabilities but not the same rOspC after GST tag removal 19. These results were

confirmed in the experiments utilising nucleocapsid of hepatitis B virus displaying OspC

protein in the native fold as confirmed by cryo-electron microscopy 11,13. The opposite

approach based on immunisation with unstructured synthetic peptides was successfully

implemented as well 9,20, but the protective epitope used as a peptides’ template is located in

the highly flexible loop at the top of the OspC dimer.

The exact knowledge of epitopes involved in OspC recognition is essential for our

understanding of mechanisms lying behind the functional differences in the effect of

antibodies targeting OspC exposed on the surface of Bbsl. The antibody screening against the

peptide library, the most common method used for the epitope mapping, seems to be

insufficient in this case, especially with regards to discontinuous epitopes. In this study, we

applied a combination of immunisation and affinity assays with fully structured OspC

combined with analysis of surface exposed amino acids, sequence homology and

immunoprecipitation of digested antigen coupled with MALDI mass spectrometry analysis.

Results

John Wiley & Sons

Page 7 of 56 Protein Science

Production of recombinant OspC

Recombinant OspCEX_BRZ31, OspCEX_BG, OspCEX_BB, OspCEX_BV and

OspCEX_BA were expressed, processed by TEV protease and purified to 99% purity as

verified by SDS-PAGE (Figure 1A). All five antigens migrated approximately to their

calculated molecular weight (Figure 1 C). A monoclonal antibody specific for hexahistidine

tag confirmed the identity of recombinant proteins prior the TEV protease cleavage. The

amino acid composition was verified by mass spectrometry.

Figure 1

Conformation state characterization

The complete folding of OspC after ubiquitin cleavage in phosphate buffer used during

immunisation, hybridoma cell selection and immunoassays was verified by the 1H nuclear

magnetic resonance measurement. The broad dispersion of peaks of amide protons in a region

from 6 to 10 ppm confirmed compact folding of the protein (Figure 2). The ability to form

dimers was confirmed by a combination of SDS-PAGE and native–PAGE (Figure 1 C). OspC

variants were separated under the native condition as dimers or higher state agglomerates with

constant interspaces corresponding to monomer molecular weight with the approx. 24 kDa

regular interspace 21 . In contrast, when the OspC was treated with 10% SDS and 4% -

mercaptoethanol the multimeric state was abolished and only monomeric state was detectable

(Figure 1 B). The stability of dimer was tested using size exclusion chromatography when the

different concentration of urea was used prior to the column load. The elution profile did not

John Wiley & Sons

Protein Science Page 8 of 56

change up to 1.5 M urea concentration when the peak corresponding to monomer appeared

(Supplementary data).

Figure 2

Hybridoma cell selection

For hybridoma cell selection truncated forms of OspC, as well as Bbsl cell lysates, were used

both in western blot and ELISA assays. The selection scheme was designed to target those

supernatants, which contain antibodies able to recognise epitopes in variable regions of OspC

protein. In summary, only the samples showing high affinity to some of the antigens but not

to all of them were propagated and purified. Within the group of over 600 tested hybridoma

cells only 24 showed the ability to bind to OspC protein. Three of them (3F4, 2D1 and 2A9)

exhibited significant differences in the reactivity against proteins included in the test panel

and were further propagated for purification.

4. Affinity assays of purified mAb

Monoclonal antibodies 3F4, 2D1 and 2A9, were purified by affinity chromatography using a

column with immobilised protein G to high purity as confirmed by SDS-PAGE (Figure 3 A).

The binding capacity was verified both in ELISA and western-blot assays (data not shown).

The result confirmed preservation of capacity to bind OspC antigens for all three mAb after

purification. The 3F4 mAb was the most sensitive in western-blot assays as it was able to bind

recombinant as well as native OspC in cell lysates with the exception of recombinant OspC

John Wiley & Sons

Page 9 of 56 Protein Science

BB, where the signal was less visible. On the other hand, only the recombinant OspC proteins

were detected when 2D1 and 2A9 mAb were used (Figure 3 B). This is only in partial

agreement with data obtained in ELISA measurements against a panel of antigens utilised in

the selection process (Figure 4 and 5). 2A9 mAb shows low affinity in both immunoassays,

which could lead to false negative results in cell lysate samples. On the other hand, the overall

affinity of 3F4 and 2D1 mAb in ELISA was similar, which is in contrast to western blot

where the 3F4 antibody shows much higher affinity especially visible when cell lysates are

regarded.

Figure 3

Epitope mapping

The prediction of regions responsible for interactions with each of purified mAb (3F4, 2D1

and 2A9) with OspC antigens was based on the evaluation of the cross-reactivity

measurements with five different OspC variants (OspC_BRZ31, OspC_BG, OspC_BB,

OspC_BV and OspC_BA) in ELISA assay. 3F4 mAb were able to detect OspC_BRZ31 and

OspC_BG. 2D1 mAb was able to bind to all antigens with the similar readouts except for the

OspC_BV where the absorbance was significantly lower. 2A9 antibody was active only

against OspC_BG, OspC_BRZ31 and OspC_BV but very low absorbances were obtained

(Figure 4 and 5). The data are summarised in Table 1.

The cross-reactivity data were extrapolated to multiple sequence alignment of tested antigens

to theoretically predict the possible regions responsible for antibody-antigen interactions. The

3F4 mAb-binding pattern correlates the most with the amino acid composition of C-terminal

John Wiley & Sons

Protein Science Page 10 of 56

part of helix 2 and N-terminal part of helix 3 interconnected by coil 3 of OspC_BRZ31 and

OspC_BG (85TKKLEXLIKNXGEL103). The highest level of similarity with affinity data for

2A9 mAb was determined in the coil 4 and the C-terminal part of helix 6 (132ATDAXAK138).

For 2D1 highly conserved part of the helix 1 (44SSIDELA50) was in agreement with ELISA

assays (Figure 6).

To confirm the theoretical predictions, the trypsin or pepsin digest of OspCEX_BRZ31 used

for immunisation was incubated with each mAb in the pull-down assay. The fragments were

subsequently eluted from the G-protein sepharose beads with immobilised mAb and identified

using MALDI mass spectrometry analysis (Figure 7). When the results were compared to

negative control mAb (anti-AHP protein antibody), there are apparent significant peaks in

each case, which were identified based on the known amino acid composition. For 3F4 mAb

two peaks with m/z 2239.2 (88KLEELIKNPGELKAEISEAK107) and m/z 2367.2

(88KLEELIKNPGELKAEISEAKK108) respectively were detected. In the case of 2A9 two

peaks of m/z 1687.7 (117LKDSNAQLGVQNGAATDAR135) and m/z 1929.0

(119DSNAQLGVQNGAATDAR135) were observed. Both results were in agreement with

previous theoretical prediction (Figure 6). In the case of 2D1 mAb the MS analysis after

trypsin digest showed that the mixture was enriched by fragment

38EVEALLSSIDELAAQAIGQKI58 (m/z 2085.1 and m/z 2107.0) as predicted. Moreover, in

the mixture, after pepsin digest treated with 2D1 mAb the

113FTKKLKDSNAQLGVQNGAATDARAKAAILK143 (m/z 3000.5 and m/z 3071.5)

fragment was detected, although in prediction alignment this position was evaluated by low

expectation. When both 3000.5 and 2085.1 peptides were mapped into the published tertiary

structure, there was apparent co-localization with shared surface area (Figure 8). The close

proximity suggests that the 2D1 binds to both peptides forming a discontinuous epitope. The

John Wiley & Sons

Page 11 of 56 Protein Science

major role in specificity seems to be played by moiety 44SSIDELA50 as predicted and the

interaction is stabilised, at least partially, by completely conserved moiety 140AILK143 in the

C-terminal region of helix 5 and the following coil. The conformation nature of recognised

epitope is also supported by the results of ELISA and western blot. Although very similar

absorbance was measured for 2D1 and 3F4 mAb under native conditions in ELISA, there is a

significant difference in ability to bind tested antigens under denaturating conditions in

western blot.

Figure 4

Figure 5

Table 1

Figure 6

Figure 7

Figure 8

Discussion

In the current work, we identified epitopes of 3 mAbs (3F4, 2A9, 2D1) elicited against OspC

protein variable regions. Two independent approaches (affinity data based theoretical

John Wiley & Sons

Protein Science Page 12 of 56

prediction and MALDI-TOF assisted epitope mapping) were employed for determining the

location as well as the amino acid composition of recognised epitopes.

The theoretical prediction was based on affinity data obtained from five different OspC

proteins. Predicted epitopes were subsequently compared with results from MS assisted

epitope mapping of OspC_BRZ31 used for immunisation. The comparison of determined

epitopes showed that both methods produce comparable results for 2A9 and 3F4 mAbs and

only a partial agreement was found for 2D1 mAb. The 85TKKLEXLIKNXGEL103 located at

C-termianl part of helix 2 and subsequent coil which was predicted for 3F4 antibody covers a

substantial part of peptide 88KLEELIKNPGELKAEISEAK107 detected in solution enriched

by immunoprecipitation. The localisation of the recognised epitope for 2A9 mAb was

predicted mainly in the coil connecting helix-3 and helix-4 with eight amino acids

(132ATDAXXK138), which correspond to MS detected peptide

119DSNAQLGVQNGAATDAR135. Minor differences in predicted and measured peptides

were probably caused by the outcome of enzymatic digest taking place prior to pull-down

assays. The exception, when the epitope was predicted only partially, was the one for 2D1

mAb. Although the affinity data from ELISA assays and Western blots suggested that the

2D1 mAb might recognise discontinuous epitope (Figure 3 and 4), such pattern was not

identified in the predictive alignment (44SSIDELA50). However, the MS analysis confirmed

the presence of two different peptides 38EVEALLSSIDELAAQAIGQKI58 and

113FTKKLKDSNAQLGVQNGAATDARAKAAILK143 with 140AILK143 being the second part

of epitope, thus forming discontinuous epitope consisting of central part of helix-1 and C-

terminal of helix-4 close to ligand binding domain 22. This inaccuracy is inherent in all

prediction procedures based on sequence similarities as it is impossible to know which non-

contiguous residues along a sequence make up discontinuous epitope, especially when the

John Wiley & Sons

Page 13 of 56 Protein Science

particular part of the epitope have no effect on specificity. Moreover, the typical

discontinuous epitope consists of 15 – 22 amino acids, but only 3 – 5 of them are significantly

involved (functional epitope) in interaction with paratope.

The identified linear epitopes obtained for 3F4 and 2A9 mAbs colocalize with previously

identified immunogenic parts of OspC protein. 2A9 mAb recognised region previously

described as immunodominant and later included in the experimental OspC polyvalent

vaccine 9. The topology of epitope corresponding to 3F4 mAb is in a close proximity to the

immunogenic region in OspC protein described by Yang 14. Both published epitopes, as well

as epitopes determined in our experiments, are surface exposed and may be accessible in

solution. The part of discontinuous epitope recognised by 2D1 mAbs has been previously

observed in the study published by Paul Arnaboldi where the screening of peptide library was

employed. The AILK moiety was described in his publication as epitope with diagnostic

potential. On the other hand, the SIDELA moiety did not show any significant affinity to sera

of Lyme disease patients 6. The difference may be explained either by conformation

disruption of 2D1 MAb epitope 10 or can be explained by differences in antibody reactivity in

human patients and rodent hosts 23.

When we compare our results with OspC sequences published previously 24–28 we can

estimate that linear epitopes recognised by 3F4 and 2A9 mAbs can be found only in a small

fraction of OspC proteins. The fragment 85TKKLEXLIKNXGEL103corresponding to 3F4

mAb epitope was found in 8 instances (6.4 %) out of 125 unique OspC amino acid sequences,

132ATDAXXK138 recognised by 2A9 was observed in 16 cases (12.8 %). Discontinuous

epitope 44SSIDELA50~140AILK143 is on the other hand highly conserved with 74 (59.2 %)

John Wiley & Sons

Protein Science Page 14 of 56

instances found among compared OspC sequences. Moreover, the most variable position in

44SSIDELA50~140AILK143 moieties is 50serine at the N-terminal of the first part of the epitope

with other amino acids nearly fully conserved across all OspC sequences taken into account

(Supplementary data 2-6).

7. Conclusions

In conclusion, we can summarise that the approach used during our study enable us to

determine the epitope location for all three mAbs (3F4, 2A9 and 2D1) and to approximate

amino acid composition. Such an approach seems to be well applicable in other variable

proteins as well. These findings confirmed feasibility of chosen combination of methods

using experimental data from immunoassays, analysis of multiple sequence alignments and

MS assisted epitope mapping for rapid epitope determination. Moreover, we were able to

recognised highly conserved discontinuous epitope 44SSIDELA50~140AILK143, which may

have great implications in further development of diagnostic as well as prophylactic tools

concerning Lyme disease.

Material and methods

General

All common chemicals were purchased from Sigma-Aldrich (USA) in at least analytical

grade. Enzymes used in DNA cloning were obtained from New England BioLabs, USA) and

all filtration devices were purchased from Merck-Millipore (Germany).

OspC protein production

John Wiley & Sons

Page 15 of 56 Protein Science

Two types of OspC antigens were used in this study here designated OspCEX

(immunisations) and OspC (hybridoma cells selection and affinity studies). Recombinant

OspC was derived from the gene for ospC, but the signal sequence and the first 10 amino

acids were omitted 29. The amplified coding sequence was fused to ubiquitin with

hexahistidine tag by ligation into the pETM60 plasmid 30 giving the OspCEX protein. The

Ubiquitin with hexahistidine tag was subsequently cleaved by TEV protease and the OspC

with additional four N-terminal amino acids (GAME) was obtained.

The DNA coding OspC was obtained by PCR amplification of genomic DNA isolated from

five strains of Borrelia burgdorferi sensu lato: B. afzelii BRZ31, access. Nr. JN828672

(BRZ31); B garinii, access. Nr. CAH56465 (BG); B. burgdorferi, access. Nr. L42871; B.

valaisiana, access. Nr. WP_012664746 (BV) and B. afzelii, access. Nr. ABA42057 (BA).

Two sets of primers (ospCEX_F: ATACCATGGAGGCATCTACTAATCCTGATG and

OspCEX_R: CATGGATCCTTAAGGTTTTTTTGGACTTTCTG) were employed for

amplification and introduction of NcoI/BamHI cloning sites. Emerald Master Mix (Takara

Bio, USA) was used for PCR according to manufacturer instructions with annealing

temperature 53 °C for 20 sec. The PCR product was treated with corresponding

endonucleases for 2h at 37 °C (NcoI/BamHI), separated by electrophoresis, excised and

isolated (NucleoSpin Gel and PCR Clean-up kit, Macherey-Nagel, Germany) prior the

ligation into the pETM60_Ub3 plasmid containing N-terminal ubiquitin and hexahistidine tag

to promote solubility and purification 30.

John Wiley & Sons

Protein Science Page 16 of 56

All ligation steps have been performed according to the manufacturer’s instructions in the

reaction mixture containing 1U T4 DNA ligase, 2 µl of T4 buffer, 50 ng of linearized vector

and corresponding insert (vector: insert molar ratio 1:9). The total volume of the reaction

mixture was 20 µl. The ligation mixtures were incubated for 16h at 16 °C, 5 µl was used

subsequently for competent cells transformation. For general cloning and plasmid

maintenance the E. coli DH10B strain was used, while E. coli BL21(DE3) RILP have served

as the host strain for protein expression (Agilent Technologies, USA).

Protein expression and cell disruption

Large-scale expressions were performed in 3 L flasks using 500 ml of LB Broth Low Salt

media (Duchefa Biochemie, Netherlands), with corresponding antibiotic at 37 °C/220 rpm.

When the OD600 reached ~0.6, the culture was induced with 0.6 mM IPTG and incubated at

22 °C for 16 h. Cells were cooled down on ice, harvested by centrifugation (8000 g for 20

min at 4°C) and resuspended in 12 ml of loading buffer (100 mM Tri HCl pH 7,2; 300 mM

NaCl; 0,01% Tween 20; 10 mM imidazole; 20% glycerol). Cell suspension was sonicated on

ice (12.7 mm probe, 1 s pulse with amplitude 30, 4 s pause, working time 6 min.) using Q700

sonicator (Qsonica, USA)

Protein purification

The cleared supernatant (centrifugation 20.000g/45min./4 °C) was filtered through 0,22 µm

syringe filter and applied onto the 5 ml HisTrap column (GE Healthcare, USA) equilibrated

with loading buffer. After thorough washing (10 CV) the non-specifically bound proteins

were removed by 59 mM imidazole in loading buffer followed by peaks of HiSalt (100 mM

John Wiley & Sons

Page 17 of 56 Protein Science

Tri HCl pH 7,2; 500 mM NaCl; 0,01% Tween 20; 10 mM imidazole; 20% glycerol) and

LowSalt (100 mM Tri HCl pH 7,2; 0,01% Tween 20; 10 mM imidazole; 20% glycerol)

buffers switching after 5 ml (repeated six-times) and 5 CV of 108 mM imidazole in loading

buffer. The elution was achieved by 3 CV of elution buffer (100 mM Tri HCl pH 7,2; 300

mM NaCl; 0,01% Tween 20; 500 mM imidazole; 20% glycerol). All fractions were examined

by SDS-PAGE for purity and stored either at -80 °C in the same buffer (long term storage) or

at +4 °C up to one month.

Ubiquitin removal

Purified OspCEX was dialysed overnight at 4 °C (4 kDa MWCO) against the TEV buffer (50

mM Tri HCl pH 7,2; 300 mM NaCl; 0,01% Tween 20; 20% glycerol; 1 mM

ethylenediaminetetraacetic acid ) with constant stirring. Subsequently, the TEV protease was

added at a mass ratio of 70:1 (i.e., for 1 mg of purified protein, 14 ng of TEV protease was

added). After 16 h of incubation at 4 °C under mild agitation, the protein sample was loaded

onto nickel column. The column was washed with the loading buffer free of imidazole and

flow-through fractions were collected to obtained protein without ubiquitin.

Production of mAbs

MAbs were raised against OspCEX_BRZ31 (conjugated with Ub3) to promote the production

of specific antibodies (Veterinary Research Institute, Brno, Czech Republic). In summary,

white females of BALB/c mice were injected three times with 100 µg of purified OspCEX

intraperitoneally in the complete Freund’s adjuvans on the day 0 and on the day 14 and 28 in

incomplete Freund’s adjuvans. Spleen cells from a single mouse were used for the hybridoma

John Wiley & Sons

Protein Science Page 18 of 56

fusion with Sp2/0 myeloma cells in ratio 1:10. For the cultivation, a foetal bovine serum

depleted of bovine IgG (Low IgG FBS) was used.

The selection of positive hybridoma cells against three different OspC proteins and

corresponding Bbsl lysates (BRZ_31, BG, BB) was done with indirect ELISA and Western

blot assays. The selection process was configured to detect antibodies capable of binding to

variable parts of OspC protein. Only those hybridoma cells producing mAbs with the high

affinity to some of OspC proteins used (but not binding to all of them) were selected for

propagation.

Selected mAbs were purified using the standard procedure with HiTrap Protein G HP column

(GE Healthcare, USA) according to manufacturer instructions. Pure fractions were dialysed

against PBS buffer with 20% glycerol, diluted to final concentration 1 mg/ml and stored at -

80 °C.

ELISA assays

Indirect ELISA assays were performed for determination of binding activity of purified mAbs

against five OspC proteins (BRZ31, BG, BB, BV and BA) under native conditions. Up to 500

ng of each antigen in PBS buffer (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 2 mM

KH2PO4, pH 7.2) was applied to Maxisorp 96 well plates (Nunc, Denmark) and coated

overnight at 4 °C. Wells were blocked with 1% (w/w) bovine serum albumin in PBS-T (PBS

containing 0.05% Tween-20) for 1h at RT, and appropriate concentrations of mAbs were

added and incubated under agitation for 1 hour at RT. Bound recombinant antibodies were

detected with 1:10,000 secondary anti-mouse IgG HRP conjugated antibody (Sigma-Aldrich,

John Wiley & Sons

Page 19 of 56 Protein Science

USA) and TMB substrate (TestLine, Czech Republic). The absorbances were measured by

PowerWave 340 ELISA reader instrument (BioTek, USA) at 450 nm.

Western blot assay

Recombinant OspC proteins (BRZ_31, BG, BB) and corresponding Bbsl lysates (100 ng)

were separated by SDS-PAGE and electroblotted onto Immobilon-P Transfer membrane

(Merck-Millipore, Germany) under custom set conditions (1A/30V/35 min.) using

TransblotTurbo (Bio-Rad, USA). After blocking (1% BSA in PBS for 1 hour), the membrane

was incubated with the corresponding mAb overnight at 4 °C, washed three times with PBS-T

and detected with secondary anti-mouse IgG alkaline phosphatase conjugated antibody

(Sigma). The membrane was equilibrated for 15 minutes in detection buffer (100 mM Tris pH

9.5; 100 mM NaCl; 5 mM MgCl2) preceding the membrane development.

Prediction of mAbs binding sites

For theoretical prediction of the possible binding sites the overlaps of identical regions in

antigens used were evaluated. The multiple sequence alignment of BRZ_31, BG, BB, BV and

BA was prepared using Clustal Omega algorithm 31,32 in the default setup and minor manual

adjustments based on the published OspC coordinates were done 33. Subsequently, positions

of buried amino acids where the low probability of involvement in the antigen-antibody

interface can be suspected were determined using NetSurfP ver. 1.1 34 (SAS – solvent

accessible surface) and OspC protein structural data 15. The evaluation of conserved amino

John Wiley & Sons

Protein Science Page 20 of 56

acid positions corresponding to the results of ELISA assays (binding pattern) was done

manually. Each amino acid position in the alignment was scored based on the similarity to

cross-reactivity data formulated in “binding pattern”. Positions identical to the binding

patterns were scored by three points. When the identity was supported by adjacent amino acid

(either corresponding to the binding pattern or complete identity) the score was increased by

one for each of the surrounding amino acids with the maximal possible score 5. When the

surrounding amino acid did not support the binding pattern or it was predicted as buried the

score was decreased by one point for each amino acid.

MALDI-TOF assisted epitope mapping

Immunoextraction coupled with MALDI-TOF (matrix-assisted laser desorption/ionisation

time of flight) mass spectrometry was used for analysis of epitope-containing peptides. The

method is based on immunoaffinity extraction of specific peptides on immobilised mAb

followed by MS 35.

30 µg of OspC_BRZ31 was digested with trypsin or pepsin (1:50), and the reaction was

terminated after 30 minutes. The digest was diluted in PBS, and 100 µg mAb was added to

final volume 500 µl and incubated for 1 hour under gentle agitation at RT. 100 µl of Protein-

G Sepharose (GE Healthcare, USA) was added subsequently and the suspension was

incubated for next 12 hours under mild agitation at 4 °C. The final mixture was centrifuged

for 2 min (2000 g/4 °C), the supernatant has been discarded and replaced by 500 µl of

immunoprecipitation buffer (25 mM Tris-HCl pH 7.2; 150 mM NaCl). The wash step was

repeated four times before the elution was achieved by adding 20 µl of elution buffer (100

mM glycine – HCl pH 2.7). In the last step, the Sepharose beads were pelleted by

centrifugation (2500 g for 5 min.) and the supernatant was carefully collected and analysed by

John Wiley & Sons

Page 21 of 56 Protein Science

MALDI-TOF MS on a fee for service bases (Proteomics Core Facility, CEITEC, Czech

Republic).

Supplementary material

1. Stability test of OspC protein in different concentration of urea - Supplement_1.tiff

2. Epitope variability analysis - Supplement_2.tiff

3. Multiple sequence alignment of 125 unique OspC - Supplement_3.doc

4. Multiple sequence alignment of 3F4 epitope - Supplement_4.doc

5. Multiple sequence alignment of 2A9 epitope - Supplement_5.doc

6. Multiple sequence alignment of 2D1 epitope - Supplement_6.doc

Acknowledgment

This research was carried out under the project CEITEC 2020 (LQ1601) with financial

support from the Ministry of Education, Youth and Sports of the

Czech Republic under the National Sustainability Programme II., supported by the project

“CEITEC–Central European Institute of Technology” (CZ.1.05/1.1.00/02.0068)

John Wiley & Sons

Protein Science Page 22 of 56

References

1. Lagal V, Portnoï D, Faure G, Postic D, Baranton G (2006) Borrelia burgdorferi sensu

stricto invasiveness is correlated with OspC-plasminogen affinity. Microbes Infect. Inst.

Pasteur 8:645–652.

2. Seemanapalli SV, Xu Q, McShan K, Liang FT (2010) Outer surface protein C is a

dissemination-facilitating factor of Borrelia burgdorferi during mammalian infection. PloS

One 5:e15830.

3. Xu Q, McShan K, Liang FT (2008) Essential protective role attributed to the surface

lipoproteins of Borrelia burgdorferi against innate defences. Mol. Microbiol. 69:15–29.

4. Carrasco SE, Troxell B, Yang Y, Brandt SL, Li H, Sandusky GE, Condon KW, Serezani

CH, Yang XF (2015) Outer Surface Protein OspC is an anti-phagocytic factor that protects

Borrelia burgdorferi from phagocytosis by macrophages. Infect. Immun. 83:4848–4860.

5. Wilske B, Preac-Mursic V, Jauris S, Hofmann A, Pradel I, Soutschek E, Schwab E, Will G,

Wanner G (1993) Immunological and molecular polymorphisms of OspC, an

immunodominant major outer surface protein of Borrelia burgdorferi. Infect. Immun.

61:2182–2191.

6. Arnaboldi PM, Seedarnee R, Sambir M, Callister SM, Imparato JA, Dattwyler RJ (2013)

Outer surface protein C peptide derived from Borrelia burgdorferi sensu stricto as a target for

serodiagnosis of early lyme disease. Clin. Vaccine Immunol. CVI 20:474–481.

7. Baum E, Randall AZ, Zeller M, Barbour AG (2013) Inferring epitopes of a polymorphic

antigen amidst broadly cross-reactive antibodies using protein microarrays: a study of OspC

proteins of Borrelia burgdorferi. PloS One 8:e67445.

John Wiley & Sons

Page 23 of 56 Protein Science

8. Dessau RB, Møller JK, Kolmos B, Henningsson AJ (2015) Multiplex assay (Mikrogen

recomBead) for detection of serum IgG and IgM antibodies to 13 recombinant antigens of

Borrelia burgdorferi sensu lato in patients with neuroborreliosis: the more the better? J. Med.

Microbiol. 64:224–231.

9. Earnhart CG, Marconi RT (2007) An octavalent lyme disease vaccine induces antibodies

that recognize all incorporated OspC type-specific sequences. Hum. Vaccin. 3:281–289.

10. Gilmore RD Jr, Mbow ML (1999) Conformational nature of the Borrelia burgdorferi B31

outer surface protein C protective epitope. Infect. Immun. 67:5463–5469.

11. Nassal M, Skamel C, Vogel M, Kratz PA, Stehle T, Wallich R, Simon MM (2008)

Development of hepatitis B virus capsids into a whole-chain protein antigen display platform:

new particulate Lyme disease vaccines. Int. J. Med. Microbiol. IJMM 298:135–142.

12. Mathiesen MJ, Holm A, Christiansen M, Blom J, Hansen K, Ostergaard S, Theisen M

(1998) The dominant epitope of Borrelia garinii outer surface protein C recognized by sera

from patients with neuroborreliosis has a surface-exposed conserved structural motif. Infect.

Immun. 66:4073–4079.

13. Skamel C, Ploss M, Böttcher B, Stehle T, Wallich R, Simon MM, Nassal M (2006)

Hepatitis B virus capsid-like particles can display the complete, dimeric outer surface protein

C and stimulate production of protective antibody responses against Borrelia burgdorferi

infection. J. Biol. Chem. 281:17474–17481.

14. Yang X, Li Y, Dunn JJ, Luft BJ (2006) Characterization of a unique borreliacidal epitope

on the outer surface protein C of Borrelia burgdorferi. FEMS Immunol. Med. Microbiol.

48:64–74.

John Wiley & Sons

Protein Science Page 24 of 56

15. Eicken C, Sharma V, Klabunde T, Owens RT, Pikas DS, Höök M, Sacchettini JC (2001)

Crystal structure of Lyme disease antigen outer surface protein C from Borrelia burgdorferi. J.

Biol. Chem. 276:10010–10015.

16. Fuchs R, Jauris S, Lottspeich F, Preac-Mursic V, Wilske B, Soutschek E (1992)

Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein

(pC) in Escherichia coli. Mol. Microbiol. 6:503–509.

17. Mbow ML, Gilmore RD Jr, Titus RG (1999) An OspC-specific monoclonal antibody

passively protects mice from tick-transmitted infection by Borrelia burgdorferi B31. Infect.

Immun. 67:5470–5472.

18. Fleury MJJ, Touzé A, Maurel M-C, Moreau T, Coursaget P (2009) Identification of

neutralizing conformational epitopes on the human papillomavirus type 31 major capsid

protein and functional implications. Protein Sci. Publ. Protein Soc. 18:1425–1438.

19. Zhong W, Gern L, Stehle T, Museteanu C, Kramer M, Wallich R, Simon MM (1999)

Resolution of experimental and tick-borne Borrelia burgdorferi infection in mice by passive,

but not active immunization using recombinant OspC. Eur. J. Immunol. 29:946–957.

20. Earnhart CG, Marconi RT (2007) Construction and analysis of variants of a polyvalent

Lyme disease vaccine: approaches for improving the immune response to chimeric

vaccinogens. Vaccine 25:3419–3427.

21. Probst C, Ott A, Scheper T, Meyer W, Stöcker W, Komorowski L (2012) N-terminal

disulfide-bridging of Borrelia outer surface protein C increases its diagnostic and vaccine

potentials. Ticks Tick-Borne Dis. 3:1–7.

John Wiley & Sons

Page 25 of 56 Protein Science

22. Earnhart CG, Leblanc DV, Alix KE, Desrosiers DC, Radolf JD, Marconi RT (2010)

Identification of residues within ligand-binding domain 1 (LBD1) of the Borrelia burgdorferi

OspC protein required for function in the mammalian environment. Mol. Microbiol. 76:393–

408.

23. Lovrich SD, Jobe DA, Schell RF, Callister SM (2005) Borreliacidal OspC antibodies

specific for a highly conserved epitope are immunodominant in human lyme disease and do

not occur in mice or hamsters. Clin. Diagn. Lab. Immunol. 12:746–751.

24. Baranton G, Seinost G, Theodore G, Postic D, Dykhuizen D (2001) Distinct levels of

genetic diversity of Borrelia burgdorferi are associated with different aspects of pathogenicity.

Res. Microbiol. 152:149–156.

25. Earnhart CG, Marconi RT (2007) OspC phylogenetic analyses support the feasibility of a

broadly protective polyvalent chimeric Lyme disease vaccine. Clin. Vaccine Immunol. CVI

14:628–634.

26. Lagal V, Postic D, Baranton G (2002) Molecular diversity of the ospC gene in Borrelia.

Impact on phylogeny, epidemiology and pathology. Wien. Klin. Wochenschr. 114:562–567.

27. Qiu W-G, Bruno JF, McCaig WD, Xu Y, Livey I, Schriefer ME, Luft BJ (2008) Wide

distribution of a high-virulence Borrelia burgdorferi clone in Europe and North America.

Emerg. Infect. Dis. 14:1097–1104.

28. Rudenko N, Golovchenko M, Hönig V, Mallátová N, Krbková L, Mikulásek P, Fedorova

N, Belfiore NM, Grubhoffer L, Lane RS, et al. (2013) Detection of Borrelia burgdorferi sensu

stricto ospC alleles associated with human lyme borreliosis worldwide in non-human-biting

tick Ixodes affinis and rodent hosts in Southeastern United States. Appl. Environ. Microbiol.

79:1444–1453. 25

John Wiley & Sons

Protein Science Page 26 of 56

29. Huang X, Link K, Koide A, Dunn JJ, Luft BJ, Koide S (1999) 1H, 13C, and 15N NMR

backbone assignments of 37 kDa surface antigen OspC from Borrelia burgdorferi. J. Biomol.

NMR 14:283–284.

30. Rogov VV, Rozenknop A, Rogova NY, Löhr F, Tikole S, Jaravine V, Güntert P, Dikic I,

Dötsch V (2012) A universal expression tag for structural and functional studies of proteins.

Chembiochem Eur. J. Chem. Biol. 13:959–963.

31. Goujon M, McWilliam H, Li W, Valentin F, Squizzato S, Paern J, Lopez R (2010) A new

bioinformatics analysis tools framework at EMBL-EBI. Nucleic Acids Res. 38:W695-699.

32. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H,

Remmert M, Söding J, et al. (2011) Fast, scalable generation of high-quality protein multiple

sequence alignments using Clustal Omega. Mol. Syst. Biol. 7:539.

33. Kumaran D, Eswaramoorthy S, Dunn JJ, Swaminathan S (2001) Crystallization and

preliminary X-ray analysis of Borrelia burgdorferi outer surface protein C (OspC). Acta

Crystallogr. D Biol. Crystallogr. 57:298–300.

34. Petersen B, Petersen TN, Andersen P, Nielsen M, Lundegaard C (2009) A generic method

for assignment of reliability scores applied to solvent accessibility predictions. BMC Struct.

Biol. 9:51.

35. Legros V, Jolivet-Reynaud C, Battail-Poirot N, Saint-Pierre C, Forest E (2000)

Characterization of an anti-Borrelia burgdorferi OspA conformational epitope by limited

proteolysis of monoclonal antibody-bound antigen and mass spectrometric peptide mapping.

Protein Sci. Publ. Protein Soc. 9:1002–1010

John Wiley & Sons

Page 27 of 56 Protein Science

John Wiley & Sons

Protein Science Page 28 of 56

Tables

mAb/Ag BRZ31 BG BB BV BA

3F4 +++ +++ + - -

2D1 +++ +++ +++ + ++

2A9 ++ ++ ++ - -

Table 1: Summary of cross-reactivity data. +++ - designate strong interaction, + - designate weak interaction, - - designate no interaction.

John Wiley & Sons

Page 29 of 56 Protein Science

Figure captions

Figure 1: A) SDS-PAGE of major fractions obtained during affinity purification (OspCEX),

and reverse affinity chromatography after TEV cleavage (OspC cleaved); B) Native-PAGE of

OspC cleaved by TEV with a sample prepared under denaturing (Dn) or non-denaturing

conditions (Na); C) SDS-PAGE of OspC variants after TEV processing used in epitope

mapping experiments. M denotes molecular weight marker.

Figure 2: 1H nuclear magnetic resonance measurement of OspC after TEV processing. The

broad dispersion of peaks of amide protons in a region from 6 to 10 ppm confirmed compact

folding of the protein.

Figure 3: A) SDS-PAGE of the major fraction obtained during affinity purification of the 3F4

mAb with light chain (L. Ch) and heavy chain (H.Ch) marked B) WB affinity test of purified

mAb to recombinant OspC (100 ng) and whole cell lysate (100 ng, amount of OspC was not

detectable by the Coomassie blue staining) from B. garinii (BG), B. afzelii (BA) and B.

burgdorferi s. s. (BS). M denotes molecular weight marker.

Figure 4: The specificity of tested monoclonal antibodies against different variants of OspC

proteins as detected by ELISA assay. The antibodies were diluted to final concentration of 0,1

ng/l (1:10000).

John Wiley & Sons

Protein Science Page 30 of 56

Figure 5: The affinity of 3F4, 2D1 and 2A9 mAb to OspC_BRZ31 and OspC_BG. The initial

concentration of antibodies prior to dilution was 1 g/l.

Figure 6: Prediction of interaction areas. The multiple sequence alignment of OspC antigens

used in ELISA assays. Antibodies able to bind each of antigens are given on the right side of

the alignment. The positions of amino acids corresponding to cross-reactivity data in

recognised variants of OspC for each antibody are highlighted under the alignment. Buried

amino acids are labelled by symbol “b”. The completely buried regions are labelled by “B”

and highlighted in grey colour.

Figure 7: Digested peptides enriched by immunoextraction were subjected to MS analysis to

confirm the presence of specific peptides corresponding to predicted regions recognised by

mAb.

Figure 8: Determined localization of epitopes mapped into the OspC dimer structure.

John Wiley & Sons

Page 31 of 56 Protein Science

mAb/Ag BRZ31 BG BB BV BA 3F4 +++ +++ + - - 2D1 +++ +++ +++ + ++ 2A9 ++ ++ ++ - -

John Wiley & Sons

Protein Science Page 32 of 56

Figure 1: A) SDS-PAGE of major fractions obtained during affinity purification (OspCEX), and reverse affinity chromatography after TEV cleavage (OspC cleaved); B) Native-PAGE of OspC cleaved by TEV with a sample prepared under denaturing (Dn) or non-denaturing conditions (Na); C) SDS-PAGE of OspC variants after TEV processing used in epitope mapping experiments. M denotes molecular weight marker.

70x82mm (300 x 300 DPI)

John Wiley & Sons

Page 33 of 56 Protein Science

Figure 2: 1H nuclear magnetic resonance measurement of OspC after TEV processing. The broad dispersion of peaks of amide protons in a region from 6 to 10 ppm confirmed compact folding of the protein.

199x141mm (300 x 300 DPI)

John Wiley & Sons

Protein Science Page 34 of 56

Figure 3: A) SDS-PAGE of the major fraction obtained during affinity purification of the 3F4 mAb with light chain (L. Ch) and heavy chain (H.Ch) marked B) WB affinity test of purified mAb to recombinant OspC (100 ng) and whole cell lysate (100 ng, amount of OspC was not detectable by the Coomassie blue staining) from B. garinii (BG), B. afzelii (BA) and B. burgdorferi s. s. (BS). M denotes molecular weight marker.

53x28mm (300 x 300 DPI)

John Wiley & Sons

Page 35 of 56 Protein Science

Figure 4: The specificity of tested monoclonal antibodies against different variants of OspC proteins as detected by ELISA assay. The antibodies were diluted to final concentration of 0,1 ng/µl (1:10000).

98x65mm (300 x 300 DPI)

John Wiley & Sons

Protein Science Page 36 of 56

Figure 5: The affinity of 3F4, 2D1 and 2A9 mAb to OspC_BRZ31 and OspC_BG. The initial concentration of antibodies prior to dilution was 1 µg/µl.

50x18mm (300 x 300 DPI)

John Wiley & Sons

Page 37 of 56 Protein Science

Figure 6: Prediction of interaction areas. The multiple sequence alignment of OspC antigens used in ELISA assays. Antibodies able to bind each of antigens are given on the right side of the alignment. The positions of amino acids corresponding to cross-reactivity data in recognised variants of OspC for each antibody are highlighted under the alignment. Buried amino acids are labelled by symbol “b”. The completely buried regions are labelled by “B” and highlighted in grey colour.

145x120mm (300 x 300 DPI)

John Wiley & Sons

Protein Science Page 38 of 56

Figure 7: Digested peptides enriched by immunoextraction were subjected to MS analysis to confirm the presence of specific peptides corresponding to predicted regions recognised by mAb.

85x49mm (300 x 300 DPI)

John Wiley & Sons

Page 39 of 56 Protein Science

Figure 8: Determined localization of epitopes mapped into the OspC dimer structure.

77x39mm (300 x 300 DPI)

John Wiley & Sons

Protein Science Page 40 of 56

99x141mm (300 x 300 DPI)

John Wiley & Sons

Page 41 of 56 Protein Science

141x200mm (300 x 300 DPI)

John Wiley & Sons

97 ZÁVĚR

Výsledky předložené práce potvrzují schopnost Bbsl adaptace v celé řadě hostitelských organismů včetně parazitických a komenzálních členovců vyskytujících se na tělním pokryvu rezervoárových obratlovců. Ačkoliv přímá účast těchto živočichů v životním cyklu Bbsl nebyla doposud prokázána, je z námi publikovaných výsledků i studií jiných autorů zřejmé, že Bbsl může minimálně dočasně kolonizovat jejich tkáně a po nějakou dobu v nich přežívat. To potvrzují i poslední studie na komárech (Culicidae) s rozdílnou preferencí k savčím, ptačím a lidským hostitelů u nichž byly zaznamenány rozdíly ve výčtu detekovaných genospecies a z tohoto pohledu lze vyloučit náhodnou infekci [11].

Schopnost adaptace je do určité míry spojená s preferencí k hostitelskému organismu, která se projevuje v zastoupení specifických genospecies na geograficky ohraničených územních celcích. Tento efekt je znatelný nejen na úrovni genospecies, ale také na úrovni kmenů, jež jsou odlišovány například s využitím ospC fylogenetických typů. To bylo prokázáno i na námi studované lokalitě (Brno-Pisárky, Česká republika), kde bylo s využitím analýzy tohoto genu prokázáno minimálně sedm OspC specifických typů s odlišným infekčním potenciálem.

I přes vysokou míru variability v ospC lokusu, bylo možné ve variabilních oblastech tohoto proteinu identifikovat místa s určitou mírou konzervovanosti, které by mohly být východiskem pro vylepšení současných imunodiagnostických testů a mohou mít potenciál i v profylaxi Lymeské borreliózy.

98 Seznam použité literatury

[1] A.C. Steere, S.E. Malawista, D.R. Snydman, R.E. Shope, W.A. Andiman, M.R. Ross, F.M. Steele, Lyme arthritis: an epidemic of oligoarticular arthritis in children and adults in three connecticut communities, Arthritis Rheum. 20 (1977) 7–17. [2] A.C. Steere, R.L. Grodzicki, A.N. Kornblatt, J.E. Craft, A.G. Barbour, W. Burgdorfer, G.P. Schmid, E. Johnson, S.E. Malawista, The spirochetal etiology of Lyme disease, N. Engl. J. Med. 308 (1983) 733–740. doi:10.1056/NEJM198303313081301. [3] W. Burgdorfer, A.G. Barbour, S.F. Hayes, J.L. Benach, E. Grunwaldt, J.P. Davis, Lyme disease-a tick-borne spirochetosis?, Science. 216 (1982) 1317–1319. [4] J. Piesman, L. Gern, Lyme borreliosis in Europe and North America, Parasitology. 129 Suppl (2004) S191-220. [5] E. Gómez-Díaz, T. Boulinier, N. Sertour, M. Cornet, E. Ferquel, K.D. McCoy, Genetic structure of marine Borrelia garinii and population admixture with the terrestrial cycle of Lyme borreliosis, Environ. Microbiol. 13 (2011) 2453–2467. doi:10.1111/j.1462-2920.2011.02515.x. [6] B. Olsen, D.C. Duffy, T.G. Jaenson, A. Gylfe, J. Bonnedahl, S. Bergström, Transhemispheric exchange of Lyme disease spirochetes by seabirds, J. Clin. Microbiol. 33 (1995) 3270–3274. [7] M. Jacquot, D. Abrial, P. Gasqui, S. Bord, M. Marsot, S. Masseglia, A. Pion, V. Poux, L. Zilliox, J.-L. Chapuis, G. Vourc’h, X. Bailly, Multiple independent transmission cycles of a tick-borne pathogen within a local host community, Sci. Rep. 6 (2016) 31273. doi:10.1038/srep31273. [8] D. Richter, F.-R. Matuschka, Perpetuation of the Lyme disease spirochete Borrelia lusitaniae by lizards, Appl. Environ. Microbiol. 72 (2006) 4627– 4632. doi:10.1128/AEM.00285-06. [9] A. Zákovská, L. Capková, O. Serý, J. Halouzka, M. Dendis, Isolation of Borrelia afzelii from overwintering Culex pipiens biotype molestus mosquitoes, Ann. Agric. Environ. Med. AAEM. 13 (2006) 345–348. [10] Z. Hubálek, J. Halouzka, Z. Juricová, Investigation of haematophagous arthropods for borreliae--summarized data, 1988-1996, Folia Parasitol. (Praha). 45 (1998) 67–72. [11] C. Melaun, S. Zotzmann, V.G. Santaella, A. Werblow, H. Zumkowski- Xylander, P. Kraiczy, S. Klimpel, Occurrence of Borrelia burgdorferi s.l. in different genera of mosquitoes (Culicidae) in Central Europe, Ticks Tick- Borne Dis. 7 (2016) 256–263. doi:10.1016/j.ttbdis.2015.10.018. [12] D. Kosik-Bogacka, W. Kuźna-Grygiel, K. Bukowska, The prevalence of spirochete Borrelia burgdorferi sensu lato in ticks Ixodes ricinus and mosquitoes Aedes spp. within a selected recreational area in the city of Szczecin, Ann. Agric. Environ. Med. AAEM. 11 (2004) 105–108. [13] C.M. Fraser, S. Casjens, W.M. Huang, G.G. Sutton, R. Clayton, R. Lathigra, O. White, K.A. Ketchum, R. Dodson, E.K. Hickey, M. Gwinn, B. Dougherty, J.F. Tomb, R.D. Fleischmann, D. Richardson, J. Peterson, A.R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M.D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C.

99 Bowman, S. Garland, C. Fuji, M.D. Cotton, K. Horst, K. Roberts, B. Hatch, H.O. Smith, J.C. Venter, Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi, Nature. 390 (1997) 580–586. doi:10.1038/37551. [14] M.H. Saier, I.T. Paulsen, Whole genome analyses of transporters in spirochetes: Borrelia burgdorferi and Treponema pallidum, J. Mol. Microbiol. Biotechnol. 2 (2000) 393–399. [15] A. Corona, I. Schwartz, Borrelia burgdorferi: Carbon Metabolism and the Tick-Mammal Enzootic Cycle, Microbiol. Spectr. 3 (2015). doi:10.1128/microbiolspec.MBP-0011-2014. [16] X.F. Yang, M.C. Lybecker, U. Pal, S.M. Alani, J. Blevins, A.T. Revel, D.S. Samuels, M.V. Norgard, Analysis of the ospC regulatory element controlled by the RpoN-RpoS regulatory pathway in Borrelia burgdorferi, J. Bacteriol. 187 (2005) 4822–4829. doi:10.1128/JB.187.14.4822-4829.2005. [17] X. Yang, M.S. Goldberg, T.G. Popova, G.B. Schoeler, S.K. Wikel, K.E. Hagman, M.V. Norgard, Interdependence of environmental factors influencing reciprocal patterns of gene expression in virulent Borrelia burgdorferi, Mol. Microbiol. 37 (2000) 1470–1479. [18] B. Stevenson, T.G. Schwan, P.A. Rosa, Temperature-related differential expression of antigens in the Lyme disease spirochete, Borrelia burgdorferi, Infect. Immun. 63 (1995) 4535–4539. [19] J. Alverson, S.F. Bundle, C.D. Sohaskey, M.C. Lybecker, D.S. Samuels, Transcriptional regulation of the ospAB and ospC promoters from Borrelia burgdorferi, Mol. Microbiol. 48 (2003) 1665–1677. [20] A. Kersten, C. Poitschek, S. Rauch, E. Aberer, Effects of penicillin, ceftriaxone, and doxycycline on morphology of Borrelia burgdorferi, Antimicrob. Agents Chemother. 39 (1995) 1127–1133. [21] O. Brorson, S.H. Brorson, Transformation of cystic forms of Borrelia burgdorferi to normal, mobile spirochetes, Infection. 25 (1997) 240–246. [22] R. Murgia, M. Cinco, Induction of cystic forms by different stress conditions in Borrelia burgdorferi, APMIS Acta Pathol. Microbiol. Immunol. Scand. 112 (2004) 57–62. [23] A. de Oliveira, A.H. Fonseca, C.M. da Costa, E. Mantovani, N.H. Yoshinari, Growth, cysts and kinetics of Borrelia garinii (Spirochaetales: Spirochaetacea) in different culture media, Mem. Inst. Oswaldo Cruz. 105 (2010) 717–719. [24] D. Kumar, L.C. Ristow, M. Shi, P. Mukherjee, J.A. Caine, W.-Y. Lee, P. Kubes, J. Coburn, G. Chaconas, Intravital Imaging of Vascular Transmigration by the Lyme Spirochete: Requirement for the Integrin Binding Residues of the B. burgdorferi P66 Protein, PLoS Pathog. 11 (2015) e1005333. doi:10.1371/journal.ppat.1005333. [25] E.F. Mongodin, S.R. Casjens, J.F. Bruno, Y. Xu, E.F. Drabek, D.R. Riley, B.L. Cantarel, P.E. Pagan, Y.A. Hernandez, L.C. Vargas, J.J. Dunn, S.E. Schutzer, C.M. Fraser, W.-G. Qiu, B.J. Luft, Inter- and intra-specific pan-genomes of Borrelia burgdorferi sensu lato: genome stability and adaptive radiation, BMC Genomics. 14 (2013) 693. doi:10.1186/1471-2164-14-693. [26] J. Coburn, J. Leong, G. Chaconas, Illuminating the roles of the Borrelia burgdorferi adhesins, Trends Microbiol. 21 (2013) 372–379. doi:10.1016/j.tim.2013.06.005.

100 [27] K. Tilly, A. Bestor, P.A. Rosa, Functional Equivalence of OspA and OspB, but Not OspC, in Tick Colonization by Borrelia burgdorferi, Infect. Immun. 84 (2016) 1565–1573. doi:10.1128/IAI.00063-16. [28] M.W. Jewett, R. Byram, A. Bestor, K. Tilly, K. Lawrence, M.N. Burtnick, F. Gherardini, P.A. Rosa, Genetic basis for retention of a critical virulence plasmid of Borrelia burgdorferi, Mol. Microbiol. 66 (2007) 975–990. doi:10.1111/j.1365-2958.2007.05969.x. [29] T. Hallström, C. Siegel, M. Mörgelin, P. Kraiczy, C. Skerka, P.F. Zipfel, CspA from Borrelia burgdorferi inhibits the terminal complement pathway, mBio. 4 (2013). doi:10.1128/mBio.00481-13. [30] P. Kraiczy, B. Stevenson, Complement regulator-acquiring surface proteins of Borrelia burgdorferi: Structure, function and regulation of gene expression, Ticks Tick-Borne Dis. 4 (2013) 26–34. doi:10.1016/j.ttbdis.2012.10.039. [31] L. Lemgruber, C. Sant’Anna, C. Griffths, Y. Abud, M. Mhlanga, R. Wallich, F. Frischknecht, Nanoscopic Localization of Surface-Exposed Antigens of Borrelia burgdorferi, Microsc. Microanal. Off. J. Microsc. Soc. Am. Microbeam Anal. Soc. Microsc. Soc. Can. 21 (2015) 680–688. doi:10.1017/S1431927615000318. [32] S. Antonara, L. Ristow, J. McCarthy, J. Coburn, Effect of Borrelia burgdorferi OspC at the site of inoculation in mouse skin, Infect. Immun. 78 (2010) 4723–4733. doi:10.1128/IAI.00464-10. [33] V. Lagal, D. Portnoï, G. Faure, D. Postic, G. Baranton, Borrelia burgdorferi sensu stricto invasiveness is correlated with OspC-plasminogen affinity, Microbes Infect. Inst. Pasteur. 8 (2006) 645–652. doi:10.1016/j.micinf.2005.08.017. [34] S.E. Carrasco, B. Troxell, Y. Yang, S.L. Brandt, H. Li, G.E. Sandusky, K.W. Condon, C.H. Serezani, X.F. Yang, Outer Surface Protein OspC is an anti- phagocytic factor that protects Borrelia burgdorferi from phagocytosis by macrophages, Infect. Immun. 83 (2015) 4848–4860. doi:10.1128/IAI.01215-15. [35] T.J. Schuijt, J.W.R. Hovius, N.D. van Burgel, N. Ramamoorthi, E. Fikrig, A.P. van Dam, The tick salivary protein Salp15 inhibits the killing of serum- sensitive Borrelia burgdorferi sensu lato isolates, Infect. Immun. 76 (2008) 2888–2894. doi:10.1128/IAI.00232-08. [36] V. Lagal, D. Postic, G. Baranton, Molecular diversity of the ospC gene in Borrelia. Impact on phylogeny, epidemiology and pathology, Wien. Klin. Wochenschr. 114 (2002) 562–567. [37] N. Rudenko, M. Golovchenko, V. Hönig, N. Mallátová, L. Krbková, P. Mikulásek, N. Fedorova, N.M. Belfiore, L. Grubhoffer, R.S. Lane, J.H. Oliver, Detection of Borrelia burgdorferi sensu stricto ospC alleles associated with human lyme borreliosis worldwide in non-human-biting tick Ixodes affinis and rodent hosts in Southeastern United States, Appl. Environ. Microbiol. 79 (2013) 1444–1453. doi:10.1128/AEM.02749-12. [38] C.G. Earnhart, R.T. Marconi, OspC phylogenetic analyses support the feasibility of a broadly protective polyvalent chimeric Lyme disease vaccine, Clin. Vaccine Immunol. CVI. 14 (2007) 628–634. doi:10.1128/CVI.00409-06.

101 [39] P.M. Arnaboldi, R. Seedarnee, M. Sambir, S.M. Callister, J.A. Imparato, R.J. Dattwyler, Outer surface protein C peptide derived from Borrelia burgdorferi sensu stricto as a target for serodiagnosis of early lyme disease, Clin. Vaccine Immunol. CVI. 20 (2013) 474–481. doi:10.1128/CVI.00608-12. [40] E. Baranova, P. Solov Ev, E. Panfertsev, A. Baranova, G. Feduykina, L. Kolombet, M.G. Morshed, S. Biketov, Rational design of antigens to improve the serodiagnosis of tick-borne borreliosis in central regions of Russia, Adv. Exp. Med. Biol. 807 (2014) 9–21. doi:10.1007/978-81-322-1777-0_2. [41] L. Ivanova, I. Christova, V. Neves, M. Aroso, L. Meirelles, D. Brisson, M. Gomes-Solecki, Comprehensive seroprofiling of sixteen B. burgdorferi OspC: implications for Lyme disease diagnostics design, Clin. Immunol. Orlando Fla. 132 (2009) 393–400. doi:10.1016/j.clim.2009.05.017. [42] C.G. Earnhart, R.T. Marconi, An octavalent lyme disease vaccine induces antibodies that recognize all incorporated OspC type-specific sequences, Hum. Vaccin. 3 (2007) 281–289. [43] M. Krupka, J. Masek, L. Barkocziova, P. Turanek Knotigova, P. Kulich, J. Plockova, R. Lukac, E. Bartheldyova, S. Koudelka, R. Chaloupkova, M. Sebela, D. Zyka, L. Droz, R. Effenberg, M. Ledvina, A.D. Miller, J. Turanek, M. Raska, The Position of His-Tag in Recombinant OspC and Application of Various Adjuvants Affects the Intensity and Quality of Specific Antibody Response after Immunization of Experimental Mice, PloS One. 11 (2016) e0148497. doi:10.1371/journal.pone.0148497. [44] G. Baranton, D. Postic, I. Saint Girons, P. Boerlin, J.C. Piffaretti, M. Assous, P.A. Grimont, Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis, Int. J. Syst. Bacteriol. 42 (1992) 378–383. doi:10.1099/00207713-42-3-378. [45] M. Derdáková, L. Beati, B. Pet’ko, M. Stanko, D. Fish, Genetic variability within Borrelia burgdorferi sensu lato genospecies established by PCR- single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacer in ixodes ricinus ticks from the Czech Republic, Appl. Environ. Microbiol. 69 (2003) 509–516. [46] H. Kawabata, T. Masuzawa, Y. Yanagihara, Genomic analysis of Borrelia japonica sp. nov. isolated from Ixodes ovatus in Japan, Microbiol. Immunol. 37 (1993) 843–848. [47] G. Wang, A.P. van Dam, A. Le Fleche, D. Postic, O. Peter, G. Baranton, R. de Boer, L. Spanjaard, J. Dankert, Genetic and phenotypic analysis of Borrelia valaisiana sp. nov. (Borrelia genomic groups VS116 and M19), Int. J. Syst. Bacteriol. 47 (1997) 926–932. doi:10.1099/00207713-47-4-926. [48] G. Margos, S.A. Vollmer, N.H. Ogden, D. Fish, Population genetics, taxonomy, phylogeny and evolution of Borrelia burgdorferi sensu lato, Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 11 (2011) 1545–1563. doi:10.1016/j.meegid.2011.07.022. [49] G. Stanek, G.P. Wormser, J. Gray, F. Strle, Lyme borreliosis, Lancet. 379 (2012) 461–473. doi:10.1016/S0140-6736(11)60103-7. [50] M. Jacquot, M. Gonnet, E. Ferquel, D. Abrial, A. Claude, P. Gasqui, V. Choumet, M. Charras-Garrido, M. Garnier, B. Faure, N. Sertour, N. Dorr, J. De Goër, G. Vourc’h, X. Bailly, Comparative population genomics of the Borrelia burgdorferi species complex reveals high degree of genetic

102 isolation among species and underscores benefits and constraints to studying intra-specific epidemiological processes, PloS One. 9 (2014) e94384. doi:10.1371/journal.pone.0094384. [51] M.M. Canica, F. Nato, L. du Merle, J.C. Mazie, G. Baranton, D. Postic, Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis, Scand. J. Infect. Dis. 25 (1993) 441–448. [52] N. Rudenko, M. Golovchenko, T. Lin, L. Gao, L. Grubhoffer, J.H. Oliver, Delineation of a new species of the Borrelia burgdorferi Sensu Lato Complex, Borrelia americana sp. nov, J. Clin. Microbiol. 47 (2009) 3875– 3880. doi:10.1128/JCM.01050-09. [53] R.T. Marconi, D. Liveris, I. Schwartz, Identification of novel insertion elements, restriction fragment length polymorphism patterns, and discontinuous 23S rRNA in Lyme disease spirochetes: phylogenetic analyses of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates, J. Clin. Microbiol. 33 (1995) 2427–2434. [54] G. Margos, S.A. Vollmer, M. Cornet, M. Garnier, V. Fingerle, B. Wilske, A. Bormane, L. Vitorino, M. Collares-Pereira, M. Drancourt, K. Kurtenbach, A new Borrelia species defined by multilocus sequence analysis of housekeeping genes, Appl. Environ. Microbiol. 75 (2009) 5410–5416. doi:10.1128/AEM.00116-09. [55] D. Postic, N.M. Ras, R.S. Lane, M. Hendson, G. Baranton, Expanded diversity among Californian borrelia isolates and description of Borrelia bissettii sp. nov. (formerly Borrelia group DN127), J. Clin. Microbiol. 36 (1998) 3497– 3504. [56] D. Postic, M. Garnier, G. Baranton, Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates--description of Borrelia californiensis sp. nov., and genomospecies 1 and 2, Int. J. Med. Microbiol. IJMM. 297 (2007) 263–271. doi:10.1016/j.ijmm.2007.01.006. [57] N. Rudenko, M. Golovchenko, L. Grubhoffer, J.H. Oliver, Borrelia carolinensis sp. nov., a novel species of the Borrelia burgdorferi sensu lato complex isolated from rodents and a tick from the south-eastern USA, Int. J. Syst. Evol. Microbiol. 61 (2011) 381–383. doi:10.1099/ijs.0.021436-0. [58] L.B. Ivanova, A. Tomova, D. González-Acuña, R. Murúa, C.X. Moreno, C. Hernández, J. Cabello, C. Cabello, T.J. Daniels, H.P. Godfrey, F.C. Cabello, Borrelia chilensis, a new member of the Borrelia burgdorferi sensu lato complex that extends the range of this genospecies in the Southern Hemisphere, Environ. Microbiol. 16 (2014) 1069–1080. doi:10.1111/1462-2920.12310. [59] S.R. Casjens, C.M. Fraser-Liggett, E.F. Mongodin, W.-G. Qiu, J.J. Dunn, B.J. Luft, S.E. Schutzer, Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate, J. Bacteriol. 193 (2011) 1489–1490. doi:10.1128/JB.01521-10. [60] G. Margos, A. Hojgaard, R.S. Lane, M. Cornet, V. Fingerle, N. Rudenko, N. Ogden, D.M. Aanensen, D. Fish, J. Piesman, Multilocus sequence analysis of Borrelia bissettii strains from North America reveals a new Borrelia species, Borrelia kurtenbachii, Ticks Tick-Borne Dis. 1 (2010) 151–158. doi:10.1016/j.ttbdis.2010.09.002.

103 [61] A. Le Fleche, D. Postic, K. Girardet, O. Peter, G. Baranton, Characterization of Borrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis, Int. J. Syst. Bacteriol. 47 (1997) 921–925. doi:10.1099/00207713-47-4-921. [62] T. Masuzawa, N. Takada, M. Kudeken, T. Fukui, Y. Yano, F. Ishiguro, Y. Kawamura, Y. Imai, T. Ezaki, Borrelia sinica sp. nov., a lyme disease-related Borrelia species isolated in China, Int. J. Syst. Evol. Microbiol. 51 (2001) 1817–1824. doi:10.1099/00207713-51-5-1817. [63] D. Richter, D. Postic, N. Sertour, I. Livey, F.-R. Matuschka, G. Baranton, Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov, Int. J. Syst. Evol. Microbiol. 56 (2006) 873–881. doi:10.1099/ijs.0.64050-0. [64] M. Fukunaga, A. Hamase, K. Okada, M. Nakao, Borrelia tanukii sp. nov. and Borrelia turdae sp. nov. found from ixodid ticks in Japan: rapid species identification by 16S rRNA gene-targeted PCR analysis, Microbiol. Immunol. 40 (1996) 877–881. [65] C.-Y. Chu, W. Liu, B.-G. Jiang, D.-M. Wang, W.-J. Jiang, Q.-M. Zhao, P.-H. Zhang, Z.-X. Wang, G.-P. Tang, H. Yang, W.-C. Cao, Novel genospecies of Borrelia burgdorferi sensu lato from rodents and ticks in southwestern China, J. Clin. Microbiol. 46 (2008) 3130–3133. doi:10.1128/JCM.01195- 08. [66] A.N. Alekseev, H.V. Dubinina, I. Van De Pol, L.M. Schouls, Identification of Ehrlichia spp. and Borrelia burgdorferi in Ixodes ticks in the Baltic regions of Russia, J. Clin. Microbiol. 39 (2001) 2237–2242. doi:10.1128/JCM.39.6.2237-2242.2001. [67] B.S. Pritt, L.B. Respicio-Kingry, L.M. Sloan, M.E. Schriefer, A.J. Replogle, J. Bjork, G. Liu, L.C. Kingry, P.S. Mead, D.F. Neitzel, E. Schiffman, D.K. Hoang Johnson, J.P. Davis, S.M. Paskewitz, D. Boxrud, A. Deedon, X. Lee, T.K. Miller, M.A. Feist, C.R. Steward, E.S. Theel, R. Patel, C.L. Irish, J.M. Petersen, Borrelia mayonii sp. nov., a member of the Borrelia burgdorferi sensu lato complex, detected in patients and ticks in the upper midwestern United States, Int. J. Syst. Evol. Microbiol. (2016). doi:10.1099/ijsem.0.001445. [68] Q. Hao, P. Du, W. Zhang, X. Hou, L. Zhang, Y. Zhang, H. Liu, W. Liu, C. Chen, K. Wan, Genomic Characteristics of Chinese Borrelia burgdorferi Isolates, PloS One. 11 (2016) e0153149. doi:10.1371/journal.pone.0153149. [69] Q. Hao, X. Hou, Z. Geng, K. Wan, Distribution of Borrelia burgdorferi sensu lato in China, J. Clin. Microbiol. 49 (2011) 647–650. doi:10.1128/JCM.00725-10. [70] K. Hovind-Hougen, A morphological characterization of Borrelia anserina, Microbiol. Read. Engl. 141 ( Pt 1) (1995) 79–83. doi:10.1099/00221287- 141-1-79. [71] S.F. Goldstein, N.W. Charon, J.A. Kreiling, Borrelia burgdorferi swims with a planar waveform similar to that of eukaryotic flagella, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 3433–3437. [72] S.C. Holt, Anatomy and chemistry of spirochetes, Microbiol. Rev. 42 (1978) 114–160. [73] S.Z. Sultan, P. Sekar, X. Zhao, A. Manne, J. Liu, R.M. Wooten, M.A. Motaleb, Motor rotation is essential for the formation of the periplasmic flagellar ribbon, cellular morphology, and Borrelia burgdorferi persistence within

104 Ixodes scapularis tick and murine hosts, Infect. Immun. 83 (2015) 1765– 1777. doi:10.1128/IAI.03097-14. [74] S.Z. Sultan, A. Manne, P.E. Stewart, A. Bestor, P.A. Rosa, N.W. Charon, M.A. Motaleb, Motility is crucial for the infectious life cycle of Borrelia burgdorferi, Infect. Immun. 81 (2013) 2012–2021. doi:10.1128/IAI.01228- 12. [75] D.K. Vig, C.W. Wolgemuth, Swimming dynamics of the lyme disease spirochete, Phys. Rev. Lett. 109 (2012) 218104. doi:10.1103/PhysRevLett.109.218104. [76] W. Schüler, I. Bunikis, J. Weber-Lehman, P. Comstedt, S. Kutschan-Bunikis, G. Stanek, J. Huber, A. Meinke, S. Bergström, U. Lundberg, Complete genome sequence of Borrelia afzelii K78 and comparative genome analysis, PloS One. 10 (2015) e0120548. doi:10.1371/journal.pone.0120548. [77] P.E. Stewart, R. Byram, D. Grimm, K. Tilly, P.A. Rosa, The plasmids of Borrelia burgdorferi: essential genetic elements of a pathogen, Plasmid. 53 (2005) 1–13. doi:10.1016/j.plasmid.2004.10.006. [78] W.M. Huang, M. Robertson, J. Aron, S. Casjens, Telomere exchange between linear replicons of Borrelia burgdorferi, J. Bacteriol. 186 (2004) 4134– 4141. doi:10.1128/JB.186.13.4134-4141.2004. [79] S.R. Casjens, E.F. Mongodin, W.-G. Qiu, B.J. Luft, S.E. Schutzer, E.B. Gilcrease, W.M. Huang, M. Vujadinovic, J.K. Aron, L.C. Vargas, S. Freeman, D. Radune, J.F. Weidman, G.I. Dimitrov, H.M. Khouri, J.E. Sosa, R.A. Halpin, J.J. Dunn, C.M. Fraser, Genome stability of Lyme disease spirochetes: comparative genomics of Borrelia burgdorferi plasmids, PloS One. 7 (2012) e33280. doi:10.1371/journal.pone.0033280. [80] Y. Xu, R.C. Johnson, Analysis and comparison of plasmid profiles of Borrelia burgdorferi sensu lato strains, J. Clin. Microbiol. 33 (1995) 2679–2685. [81] K. Chan, S. Casjens, N. Parveen, Detection of established virulence genes and plasmids to differentiate Borrelia burgdorferi strains, Infect. Immun. 80 (2012) 1519–1529. doi:10.1128/IAI.06326-11. [82] A.T. Revel, J.S. Blevins, C. Almazán, L. Neil, K.M. Kocan, J. de la Fuente, K.E. Hagman, M.V. Norgard, bptA (bbe16) is essential for the persistence of the Lyme disease spirochete, Borrelia burgdorferi, in its natural tick vector, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 6972–6977. doi:10.1073/pnas.0502565102. [83] K.O. Strother, A. de Silva, Role of Borrelia burgdorferi linear plasmid 25 in infection of Ixodes scapularis ticks, J. Bacteriol. 187 (2005) 5776–5781. doi:10.1128/JB.187.16.5776-5781.2005. [84] S. Casjens, N. Palmer, R. van Vugt, W.M. Huang, B. Stevenson, P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R.J. Dodson, D. Haft, E. Hickey, M. Gwinn, O. White, C.M. Fraser, A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi, Mol. Microbiol. 35 (2000) 490– 516. [85] S. Bergström, V.G. Bundoc, A.G. Barbour, Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi, Mol. Microbiol. 3 (1989) 479– 486.

105 [86] G. Neelakanta, X. Li, U. Pal, X. Liu, D.S. Beck, K. DePonte, D. Fish, F.S. Kantor, E. Fikrig, Outer surface protein B is critical for Borrelia burgdorferi adherence and survival within Ixodes ticks, PLoS Pathog. 3 (2007) e33. doi:10.1371/journal.ppat.0030033. [87] A.G. Barbour, Plasmid analysis of Borrelia burgdorferi, the Lyme disease agent, J. Clin. Microbiol. 26 (1988) 475–478. [88] A.J. Nowalk, C. Nolder, D.R. Clifton, J.A. Carroll, Comparative proteome analysis of subcellular fractions from Borrelia burgdorferi by NEPHGE and IPG, Proteomics. 6 (2006) 2121–2134. doi:10.1002/pmic.200500187. [89] C.S. Brooks, S.R. Vuppala, A.M. Jett, D.R. Akins, Identification of Borrelia burgdorferi outer surface proteins, Infect. Immun. 74 (2006) 296–304. doi:10.1128/IAI.74.1.296-304.2006. [90] J. Farlow, D. Postic, K.L. Smith, Z. Jay, G. Baranton, P. Keim, Strain typing of Borrelia burgdorferi, Borrelia afzelii, and Borrelia garinii by using multiple-locus variable-number tandem repeat analysis, J. Clin. Microbiol. 40 (2002) 4612–4618. [91] R. Iyer, O. Kalu, J. Purser, S. Norris, B. Stevenson, I. Schwartz, Linear and circular plasmid content in Borrelia burgdorferi clinical isolates, Infect. Immun. 71 (2003) 3699–3706. [92] C.H. Eggers, D.S. Samuels, Molecular evidence for a new bacteriophage of Borrelia burgdorferi, J. Bacteriol. 181 (1999) 7308–7313. [93] C.H. Eggers, B.J. Kimmel, J.L. Bono, A.F. Elias, P. Rosa, D.S. Samuels, Transduction by phiBB-1, a bacteriophage of Borrelia burgdorferi, J. Bacteriol. 183 (2001) 4771–4778. doi:10.1128/JB.183.16.4771- 4778.2001. [94] H. Zhang, R.T. Marconi, Demonstration of cotranscription and 1-methyl-3- nitroso-nitroguanidine induction of a 30-gene operon of Borrelia burgdorferi: evidence that the 32-kilobase circular plasmids are prophages, J. Bacteriol. 187 (2005) 7985–7995. doi:10.1128/JB.187.23.7985-7995.2005. [95] D. Terekhova, R. Iyer, G.P. Wormser, I. Schwartz, Comparative genome hybridization reveals substantial variation among clinical isolates of Borrelia burgdorferi sensu stricto with different pathogenic properties, J. Bacteriol. 188 (2006) 6124–6134. doi:10.1128/JB.00459-06. [96] K. Tilly, S. Casjens, B. Stevenson, J.L. Bono, D.S. Samuels, D. Hogan, P. Rosa, The Borrelia burgdorferi circular plasmid cp26: conservation of plasmid structure and targeted inactivation of the ospC gene, Mol. Microbiol. 25 (1997) 361–373. [97] Y. Tourand, K. Kobryn, G. Chaconas, Sequence-specific recognition but position-dependent cleavage of two distinct telomeres by the Borrelia burgdorferi telomere resolvase, ResT, Mol. Microbiol. 48 (2003) 901–911. [98] N. Margolis, D. Hogan, K. Tilly, P.A. Rosa, Plasmid location of Borrelia purine biosynthesis gene homologs, J. Bacteriol. 176 (1994) 6427–6432. [99] O. Attie, J.F. Bruno, Y. Xu, D. Qiu, B.J. Luft, W.-G. Qiu, Co-evolution of the outer surface protein C gene (ospC) and intraspecific lineages of Borrelia burgdorferi sensu stricto in the northeastern United States, Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 7 (2007) 1–12. doi:10.1016/j.meegid.2006.02.008.

106 [100] R.T. Marconi, D.S. Samuels, C.F. Garon, Transcriptional analyses and mapping of the ospC gene in Lyme disease spirochetes, J. Bacteriol. 175 (1993) 926–932. [101] J.R. Zhang, J.M. Hardham, A.G. Barbour, S.J. Norris, Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes, Cell. 89 (1997) 275–285. [102] J.R. Zhang, S.J. Norris, Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion, Infect. Immun. 66 (1998) 3698–3704. [103] K. Tilly, A. Bestor, P.A. Rosa, Lipoprotein succession in Borrelia burgdorferi: similar but distinct roles for OspC and VlsE at different stages of mammalian infection, Mol. Microbiol. 89 (2013) 216–227. doi:10.1111/mmi.12271. [104] A. Sadziene, D.D. Thomas, A.G. Barbour, Borrelia burgdorferi mutant lacking Osp: biological and immunological characterization, Infect. Immun. 63 (1995) 1573–1580. [105] T.G. Schwan, J. Piesman, W.T. Golde, M.C. Dolan, P.A. Rosa, Induction of an outer surface protein on Borrelia burgdorferi during tick feeding, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 2909–2913. [106] J.T. Skare, E.S. Shang, D.M. Foley, D.R. Blanco, C.I. Champion, T. Mirzabekov, Y. Sokolov, B.L. Kagan, J.N. Miller, M.A. Lovett, Virulent strain associated outer membrane proteins of Borrelia burgdorferi, J. Clin. Invest. 96 (1995) 2380–2392. doi:10.1172/JCI118295. [107] M. Thein, M. Bonde, I. Bunikis, K. Denker, A. Sickmann, S. Bergström, R. Benz, DipA, a pore-forming protein in the outer membrane of Lyme disease spirochetes exhibits specificity for the permeation of dicarboxylates, PloS One. 7 (2012) e36523. doi:10.1371/journal.pone.0036523. [108] L.F. Erdile, M.A. Brandt, D.J. Warakomski, G.J. Westrack, A. Sadziene, A.G. Barbour, J.P. Mays, Role of attached lipid in immunogenicity of Borrelia burgdorferi OspA, Infect. Immun. 61 (1993) 81–90. [109] F.T. Liang, F.K. Nelson, E. Fikrig, Molecular adaptation of Borrelia burgdorferi in the murine host, J. Exp. Med. 196 (2002) 275–280. [110] M.R. Kenedy, E.J. Scott, B. Shrestha, A. Anand, H. Iqbal, J.D. Radolf, D.W. Dyer, D.R. Akins, Consensus computational network analysis for identifying candidate outer membrane proteins from Borrelia spirochetes, BMC Microbiol. 16 (2016) 141. doi:10.1186/s12866-016-0762-z. [111] M.R. Kenedy, T.R. Lenhart, D.R. Akins, The role of Borrelia burgdorferi outer surface proteins, FEMS Immunol. Med. Microbiol. 66 (2012) 1–19. doi:10.1111/j.1574-695X.2012.00980.x. [112] M.N. Burtnick, J.S. Downey, P.J. Brett, J.A. Boylan, J.G. Frye, T.R. Hoover, F.C. Gherardini, Insights into the complex regulation of rpoS in Borrelia burgdorferi, Mol. Microbiol. 65 (2007) 277–293. doi:10.1111/j.1365- 2958.2007.05813.x. [113] H. Xu, M.J. Caimano, T. Lin, M. He, J.D. Radolf, S.J. Norris, F. Gherardini, F. Gheradini, A.J. Wolfe, X.F. Yang, Role of acetyl-phosphate in activation of the Rrp2-RpoN-RpoS pathway in Borrelia burgdorferi, PLoS Pathog. 6 (2010) e1001104. doi:10.1371/journal.ppat.1001104. [114] M. Pinne, K. Denker, E. Nilsson, R. Benz, S. Bergström, The BBA01 protein, a member of paralog family 48 from Borrelia burgdorferi, is potentially

107 interchangeable with the channel-forming protein P13, J. Bacteriol. 188 (2006) 4207–4217. doi:10.1128/JB.00302-06. [115] J.T. Skare, T.A. Mirzabekov, E.S. Shang, D.R. Blanco, H. Erdjument-Bromage, J. Bunikis, S. Bergström, P. Tempst, B.L. Kagan, J.N. Miller, M.A. Lovett, The Oms66 (p66) protein is a Borrelia burgdorferi porin, Infect. Immun. 65 (1997) 3654–3661. [116] T.R. Lenhart, D.R. Akins, Borrelia burgdorferi locus BB0795 encodes a BamA orthologue required for growth and efficient localization of outer membrane proteins, Mol. Microbiol. 75 (2010) 692–709. doi:10.1111/j.1365-2958.2009.07015.x. [117] H. Iqbal, M.R. Kenedy, M. Lybecker, D.R. Akins, The TamB ortholog of Borrelia burgdorferi interacts with the β-barrel assembly machine (BAM) complex protein BamA, Mol. Microbiol. 102 (2016) 757–774. doi:10.1111/mmi.13492. [118] I. Bunikis, K. Denker, Y. Ostberg, C. Andersen, R. Benz, S. Bergström, An RND-type efflux system in Borrelia burgdorferi is involved in virulence and resistance to antimicrobial compounds, PLoS Pathog. 4 (2008) e1000009. doi:10.1371/journal.ppat.1000009. [119] L. Noppa, Y. Ostberg, M. Lavrinovicha, S. Bergström, P13, an integral membrane protein of Borrelia burgdorferi, is C-terminally processed and contains surface-exposed domains, Infect. Immun. 69 (2001) 3323–3334. doi:10.1128/IAI.69.5.3323-3334.2001. [120] M. Pinne, Y. Ostberg, P. Comstedt, S. Bergström, Molecular analysis of the channel-forming protein P13 and its paralogue family 48 from different Lyme disease Borrelia species, Microbiol. Read. Engl. 150 (2004) 549–559. doi:10.1099/mic.0.26728-0. [121] I. Bárcena-Uribarri, M. Thein, M. Barbot, E. Sans-Serramitjana, M. Bonde, R. Mentele, F. Lottspeich, S. Bergström, R. Benz, Study of the protein complex, pore diameter, and pore-forming activity of the Borrelia burgdorferi P13 porin, J. Biol. Chem. 289 (2014) 18614–18624. doi:10.1074/jbc.M113.539528. [122] U. Pal, X. Li, T. Wang, R.R. Montgomery, N. Ramamoorthi, A.M. Desilva, F. Bao, X. Yang, M. Pypaert, D. Pradhan, F.S. Kantor, S. Telford, J.F. Anderson, E. Fikrig, TROSPA, an Ixodes scapularis receptor for Borrelia burgdorferi, Cell. 119 (2004) 457–468. doi:10.1016/j.cell.2004.10.027. [123] S.J. Norris, C.J. Carter, J.K. Howell, A.G. Barbour, Low-passage-associated proteins of Borrelia burgdorferi B31: characterization and molecular cloning of OspD, a surface-exposed, plasmid-encoded lipoprotein, Infect. Immun. 60 (1992) 4662–4672. [124] W.S. Probert, R.B. LeFebvre, Protection of C3H/HeN mice from challenge with Borrelia burgdorferi through active immunization with OspA, OspB, or OspC, but not with OspD or the 83-kilodalton antigen, Infect. Immun. 62 (1994) 1920–1926. [125] R.D. Gilmore, K.S. Brandt, J.A. Hyde, pncA and bptA are not sufficient to complement Ixodes scapularis colonization and persistence by Borrelia burgdorferi in a linear plasmid lp25-deficient background, Infect. Immun. 82 (2014) 5110–5116. doi:10.1128/IAI.02613-14.

108 [126] E. Fikrig, S.W. Barthold, W. Sun, W. Feng, S.R. Telford, R.A. Flavell, Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity, Immunity. 6 (1997) 531–539. [127] K.J. Indest, M.T. Philipp, DNA-Binding proteins possibly involved in regulation of the post-logarithmic-phase expression of lipoprotein P35 in Borrelia burgdorferi, J. Bacteriol. 182 (2000) 522–525. [128] A. Gautam, M. Hathaway, N. McClain, G. Ramesh, R. Ramamoorthy, Analysis of the determinants of bba64 (P35) gene expression in Borrelia burgdorferi using a gfp reporter, Microbiol. Read. Engl. 154 (2008) 275– 285. doi:10.1099/mic.0.2007/011676-0. [129] K.E. Hagman, P. Lahdenne, T.G. Popova, S.F. Porcella, D.R. Akins, J.D. Radolf, M.V. Norgard, Decorin-binding protein of Borrelia burgdorferi is encoded within a two-gene operon and is protective in the murine model of Lyme borreliosis, Infect. Immun. 66 (1998) 2674–2683. [130] J.S. Blevins, K.E. Hagman, M.V. Norgard, Assessment of decorin-binding protein A to the infectivity of Borrelia burgdorferi in the murine models of needle and tick infection, BMC Microbiol. 8 (2008) 82. doi:10.1186/1471- 2180-8-82. [131] A. Morgan, X. Wang, The novel heparin-binding motif in decorin-binding protein A from strain B31 of Borrelia burgdorferi explains the higher binding affinity, Biochemistry (Mosc.). 52 (2013) 8237–8245. doi:10.1021/bi401376u. [132] W. Feng, X. Wang, Structure of decorin binding protein B from Borrelia burgdorferi and its interactions with glycosaminoglycans, Biochim. Biophys. Acta. 1854 (2015) 1823–1832. doi:10.1016/j.bbapap.2015.08.003. [133] E. Fikrig, W. Feng, S.W. Barthold, S.R. Telford, R.A. Flavell, Arthropod- and host-specific Borrelia burgdorferi bbk32 expression and the inhibition of spirochete transmission, J. Immunol. Baltim. Md 1950. 164 (2000) 5344– 5351. [134] W.S. Probert, J.H. Kim, M. Höök, B.J. Johnson, Mapping the ligand-binding region of Borrelia burgdorferi fibronectin-binding protein BBK32, Infect. Immun. 69 (2001) 4129–4133. doi:10.1128/IAI.69.6.4129-4133.2001. [135] J.A. Hyde, E.H. Weening, M. Chang, J.P. Trzeciakowski, M. Höök, J.D. Cirillo, J.T. Skare, Bioluminescent imaging of Borrelia burgdorferi in vivo demonstrates that the fibronectin-binding protein BBK32 is required for optimal infectivity, Mol. Microbiol. 82 (2011) 99–113. doi:10.1111/j.1365- 2958.2011.07801.x. [136] Y.-P. Lin, Q. Chen, J.A. Ritchie, N.P. Dufour, J.R. Fischer, J. Coburn, J.M. Leong, Glycosaminoglycan binding by Borrelia burgdorferi adhesin BBK32 specifically and uniquely promotes joint colonization, Cell. Microbiol. 17 (2015) 860–875. doi:10.1111/cmi.12407. [137] B.L. Garcia, H. Zhi, B. Wager, M. Höök, J.T. Skare, Borrelia burgdorferi BBK32 Inhibits the Classical Pathway by Blocking Activation of the C1 Complement Complex, PLoS Pathog. 12 (2016) e1005404. doi:10.1371/journal.ppat.1005404. [138] T. Lin, L. Gao, C. Zhang, E. Odeh, M.B. Jacobs, L. Coutte, G. Chaconas, M.T. Philipp, S.J. Norris, Analysis of an ordered, comprehensive STM mutant library in infectious Borrelia burgdorferi: insights into the genes required

109 for mouse infectivity, PloS One. 7 (2012) e47532. doi:10.1371/journal.pone.0047532. [139] Y.-P. Lin, R. Bhowmick, J. Coburn, J.M. Leong, Host cell heparan sulfate glycosaminoglycans are ligands for OspF-related proteins of the Lyme disease spirochete, Cell. Microbiol. 17 (2015) 1464–1476. doi:10.1111/cmi.12448. [140] T. Bykowski, K. Babb, K. von Lackum, S.P. Riley, S.J. Norris, B. Stevenson, Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein, J. Bacteriol. 188 (2006) 4879–4889. doi:10.1128/JB.00229-06. [141] L.K. Nosbisch, A.M. de Silva, Lack of detectable variation at Borrelia burgdorferi vlsE locus in ticks, J. Med. Entomol. 44 (2007) 168–170. [142] L. Coutte, D.J. Botkin, L. Gao, S.J. Norris, Detailed analysis of sequence changes occurring during vlsE antigenic variation in the mouse model of Borrelia burgdorferi infection, PLoS Pathog. 5 (2009) e1000293. doi:10.1371/journal.ppat.1000293. [143] A.S. Rogovskyy, T. Casselli, Y. Tourand, C.R. Jones, J.P. Owen, K.L. Mason, G.A. Scoles, T. Bankhead, Evaluation of the Importance of VlsE Antigenic Variation for the Enzootic Cycle of Borrelia burgdorferi, PloS One. 10 (2015) e0124268. doi:10.1371/journal.pone.0124268. [144] S.J. Norris, vls Antigenic Variation Systems of Lyme Disease Borrelia: Eluding Host Immunity through both Random, Segmental Gene Conversion and Framework Heterogeneity, Microbiol. Spectr. 2 (2014). doi:10.1128/microbiolspec.MDNA3-0038-2014. [145] M.R. Kenedy, D.R. Akins, The OspE-related proteins inhibit complement deposition and enhance serum resistance of Borrelia burgdorferi, the lyme disease spirochete, Infect. Immun. 79 (2011) 1451–1457. doi:10.1128/IAI.01274-10. [146] P. Kraiczy, J. Hellwage, C. Skerka, H. Becker, M. Kirschfink, M.M. Simon, V. Brade, P.F. Zipfel, R. Wallich, Complement resistance of Borrelia burgdorferi correlates with the expression of BbCRASP-1, a novel linear plasmid-encoded surface protein that interacts with human factor H and FHL-1 and is unrelated to Erp proteins, J. Biol. Chem. 279 (2004) 2421– 2429. doi:10.1074/jbc.M308343200. [147] B. Stevenson, K. Tilly, P.A. Rosa, A family of genes located on four separate 32-kilobase circular plasmids in Borrelia burgdorferi B31, J. Bacteriol. 178 (1996) 3508–3516. [148] B. Stevenson, N. El-Hage, M.A. Hines, J.C. Miller, K. Babb, Differential binding of host complement inhibitor factor H by Borrelia burgdorferi Erp surface proteins: a possible mechanism underlying the expansive host range of Lyme disease spirochetes, Infect. Immun. 70 (2002) 491–497. [149] L.A. Magnarelli, J.F. Anderson, A.G. Barbour, The etiologic agent of Lyme disease in deer flies, horse flies, and mosquitoes, J. Infect. Dis. 154 (1986) 355–358. [150] R.S. Lane, J. Piesman, W. Burgdorfer, Lyme borreliosis: relation of its causative agent to its vectors and hosts in North America and Europe, Annu. Rev. Entomol. 36 (1991) 587–609. doi:10.1146/annurev.en.36.010191.003103.

110 [151] A.M. De Silva, E. Fikrig, Growth and migration of Borrelia burgdorferi in Ixodes ticks during blood feeding, Am. J. Trop. Med. Hyg. 53 (1995) 397– 404. [152] A.C. Steere, J. Coburn, L. Glickstein, The emergence of Lyme disease, J. Clin. Invest. 113 (2004) 1093–1101. doi:10.1172/JCI21681. [153] R.S. Lane, J.E. Loye, Lyme disease in California: interrelationship of ixodid ticks (Acari), rodents, and Borrelia burgdorferi, J. Med. Entomol. 28 (1991) 719–725. [154] P. Wilhelmsson, L. Fryland, S. Börjesson, J. Nordgren, S. Bergström, J. Ernerudh, P. Forsberg, P.-E. Lindgren, Prevalence and diversity of Borrelia species in ticks that have bitten humans in Sweden, J. Clin. Microbiol. 48 (2010) 4169–4176. doi:10.1128/JCM.01061-10. [155] M. Crippa, O. Rais, L. Gern, Investigations on the mode and dynamics of transmission and infectivity of Borrelia burgdorferi sensu stricto and Borrelia afzelii in Ixodes ricinus ticks, Vector Borne Zoonotic Dis. Larchmt. N. 2 (2002) 3–9. doi:10.1089/153036602760260724. [156] M. Schulz, M. Mahling, K. Pfister, Abundance and seasonal activity of questing Ixodes ricinus ticks in their natural habitats in southern Germany in 2011, J. Vector Ecol. J. Soc. Vector Ecol. 39 (2014) 56–65. doi:10.1111/j.1948-7134.2014.12070.x. [157] M. Daniel, V. Danielová, B. Kříž, D. Růžek, A. Fialová, M. Malý, J. Materna, M. Pejčoch, J. Erhart, The occurrence of Ixodes ricinus ticks and important tick-borne pathogens in areas with high tick-borne encephalitis prevalence in different altitudinal levels of the Czech Republic Part I. Ixodes ricinus ticks and tick-borne encephalitis virus, Epidemiol. Mikrobiol. Imunol. Cas. Spolecnosti Epidemiol. Mikrobiol. Ceske Lek. Spolecnosti JE Purkyne. 65 (2016) 118–128. [158] D. Pérez, Y. Kneubühler, O. Rais, L. Gern, Seasonality of Ixodes ricinus ticks on vegetation and on rodents and Borrelia burgdorferi sensu lato genospecies diversity in two Lyme borreliosis-endemic areas in Switzerland, Vector Borne Zoonotic Dis. Larchmt. N. 12 (2012) 633–644. doi:10.1089/vbz.2011.0763. [159] J.F. Anderson, Epizootiology of Lyme borreliosis, Scand. J. Infect. Dis. Suppl. 77 (1991) 23–34. [160] T. Masuzawa, Terrestrial distribution of the Lyme borreliosis agent Borrelia burgdorferi sensu lato in East Asia, Jpn. J. Infect. Dis. 57 (2004) 229–235. [161] I. Literak, A.A. Stekolnikov, O. Sychra, L. Dubska, V. Taragelova, Larvae of chigger mites Neotrombicula spp. (Acari: Trombiculidae) exhibited Borrelia but no Anaplasma infections: a field study including birds from the Czech Carpathians as hosts of chiggers, Exp. Appl. Acarol. 44 (2008) 307–314. doi:10.1007/s10493-008-9150-1. [162] H. Kampen, A. Schöler, M. Metzen, R. Oehme, K. Hartelt, P. Kimmig, W.A. Maier, Neotrombicula autumnalis (Acari, Trombiculidae) as a vector for Borrelia burgdorferi sensu lato?, Exp. Appl. Acarol. 33 (2004) 93–102. [163] S. Hornok, G. Földvári, K. Rigó, M.L. Meli, E. Gönczi, A. Répási, R. Farkas, I. Papp, J. Kontschán, R. Hofmann-Lehmann, Synanthropic rodents and their ectoparasites as carriers of a novel haemoplasma and vector-borne,

111 zoonotic pathogens indoors, Parasit. Vectors. 8 (2015) 27. doi:10.1186/s13071-014-0630-3. [164] A. Zákovská, P. Nejedla, A. Holíková, M. Dendis, Positive findings of Borrelia burgdorferi in Culex (Culex) pipiens pipiens larvae in the surrounding of Brno city determined by the PCR method, Ann. Agric. Environ. Med. AAEM. 9 (2002) 257–259. [165] P. Nejedla, A. Norek, K. Vostal, A. Zakovska, What is the percentage of pathogenic borreliae in spirochaetal findings of mosquito larvae?, Ann. Agric. Environ. Med. AAEM. 16 (2009) 273–276. [166] G. Devevey, T. Dang, C.J. Graves, S. Murray, D. Brisson, First arrived takes all: inhibitory priority effects dominate competition between co-infecting Borrelia burgdorferi strains, BMC Microbiol. 15 (2015) 61. doi:10.1186/s12866-015-0381-0. [167] K. Kurtenbach, H.S. Sewell, N.H. Ogden, S.E. Randolph, P.A. Nuttall, Serum complement sensitivity as a key factor in Lyme disease ecology, Infect. Immun. 66 (1998) 1248–1251. [168] K. Kurtenbach, S.M. Schäfer, H.-S. Sewell, M. Peacey, A. Hoodless, P.A. Nuttall, S.E. Randolph, Differential survival of Lyme borreliosis spirochetes in ticks that feed on birds, Infect. Immun. 70 (2002) 5893–5895. [169] A.G. Barbour, J. Bunikis, D. Fish, K. Hanincová, Association between body size and reservoir competence of mammals bearing Borrelia burgdorferi at an endemic site in the northeastern United States, Parasit. Vectors. 8 (2015) 299. doi:10.1186/s13071-015-0903-5. [170] P.F. Humair, O. Rais, L. Gern, Transmission of Borrelia afzelii from Apodemus mice and Clethrionomys voles to Ixodes ricinus ticks: differential transmission pattern and overwintering maintenance, Parasitology. 118 ( Pt 1) (1999) 33–42. [171] D. Richter, B. Klug, A. Spielman, F.-R. Matuschka, Adaptation of diverse lyme disease spirochetes in a natural rodent reservoir host, Infect. Immun. 72 (2004) 2442–2444. [172] K. Kurtenbach, S. De Michelis, S. Etti, S.M. Schäfer, H.-S. Sewell, V. Brade, P. Kraiczy, Host association of Borrelia burgdorferi sensu lato--the key role of host complement, Trends Microbiol. 10 (2002) 74–79. [173] L. Gern, M. Siegenthaler, C.M. Hu, S. Leuba-Garcia, P.F. Humair, J. Moret, Borrelia burgdorferi in rodents (Apodemus flavicollis and A. sylvaticus): duration and enhancement of infectivity for Ixodes ricinus ticks, Eur. J. Epidemiol. 10 (1994) 75–80. [174] K. Kurtenbach, M. Peacey, S.G. Rijpkema, A.N. Hoodless, P.A. Nuttall, S.E. Randolph, Differential transmission of the genospecies of Borrelia burgdorferi sensu lato by game birds and small rodents in England, Appl. Environ. Microbiol. 64 (1998) 1169–1174. [175] A. Stefancíková, M. Derdáková, D. Lencáková, R. Ivanová, M. Stanko, L. Cisláková, B. Petko, Serological and molecular detection of Borrelia burgdorferi sensu lato and Anaplasmataceae in rodents, Folia Microbiol. (Praha). 53 (2008) 493–499. doi:10.1007/s12223-008-0077-z. [176] J.S. Gray, O. Kahl, C. Janetzki-Mittman, J. Stein, E. Guy, Acquisition of Borrelia burgdorferi by Ixodes ricinus ticks fed on the European hedgehog, Erinaceus europaeus L, Exp. Appl. Acarol. 18 (1994) 485–491.

112 [177] F.R. Matuschka, S. Endepols, D. Richter, A. Spielman, Competence of urban rats as reservoir hosts for Lyme disease spirochetes, J. Med. Entomol. 34 (1997) 489–493. [178] M. Trávnicek, A. Stefancíková, D. Nadzamová, M. Stanko, L. Cisláková, B. Pet’ko, S. Mardzinová, M. Bhide, Immunoglobulin G antibodies to Borrelia burgdorferi in game animals and small mammals in eastern Slovakia, Rev. Sci. Tech. Int. Off. Epizoot. 22 (2003) 1035–1041. [179] G.G. Duscher, M. Leschnik, H.-P. Fuehrer, A. Joachim, Wildlife reservoirs for vector-borne canine, feline and zoonotic infections in Austria, Int. J. Parasitol. Parasites Wildl. 4 (2015) 88–96. doi:10.1016/j.ijppaw.2014.12.001. [180] K. Hanincová, V. Taragelová, J. Koci, S.M. Schäfer, R. Hails, A.J. Ullmann, J. Piesman, M. Labuda, K. Kurtenbach, Association of Borrelia garinii and B. valaisiana with songbirds in Slovakia, Appl. Environ. Microbiol. 69 (2003) 2825–2830. [181] B. Olsén, T.G. Jaenson, S. Bergström, Prevalence of Borrelia burgdorferi sensu lato-infected ticks on migrating birds, Appl. Environ. Microbiol. 61 (1995) 3082–3087. [182] V. Cotté, S. Bonnet, M. Cote, M. Vayssier-Taussat, Prevalence of five pathogenic agents in questing Ixodes ricinus ticks from western France, Vector Borne Zoonotic Dis. Larchmt. N. 10 (2010) 723–730. doi:10.1089/vbz.2009.0066. [183] D. Richter, B. Schröder, N.K. Hartmann, F.-R. Matuschka, Spatial stratification of various Lyme disease spirochetes in a Central European site, FEMS Microbiol. Ecol. 83 (2013) 738–744. doi:10.1111/1574- 6941.12029. [184] R. Fuchs, S. Jauris, F. Lottspeich, V. Preac-Mursic, B. Wilske, E. Soutschek, Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein (pC) in Escherichia coli, Mol. Microbiol. 6 (1992) 503– 509. [185] C.J. Carter, S. Bergström, S.J. Norris, A.G. Barbour, A family of surface- exposed proteins of 20 kilodaltons in the genus Borrelia, Infect. Immun. 62 (1994) 2792–2799. [186] T. Masuzawa, T. Kurita, H. Kawabata, Y. Yanagihara, Relationship between infectivity and OspC expression in Lyme disease Borrelia, FEMS Microbiol. Lett. 123 (1994) 319–324. [187] B. Wilske, V. Preac-Mursic, S. Jauris, A. Hofmann, I. Pradel, E. Soutschek, E. Schwab, G. Will, G. Wanner, Immunological and molecular polymorphisms of OspC, an immunodominant major outer surface protein of Borrelia burgdorferi, Infect. Immun. 61 (1993) 2182–2191. [188] M.J. Mathiesen, K. Hansen, N. Axelsen, L. Halkier-Sørensen, M. Theisen, Analysis of the human antibody response to outer surface protein C (OspC) of Borrelia burgdorferi sensu stricto, B. garinii, and B. afzelii, Med. Microbiol. Immunol. (Berl.). 185 (1996) 121–129. [189] M.L. Mbow, R.D. Gilmore Jr, R.G. Titus, An OspC-specific monoclonal antibody passively protects mice from tick-transmitted infection by Borrelia burgdorferi B31, Infect. Immun. 67 (1999) 5470–5472.

113 [190] I.N. Wang, D.E. Dykhuizen, W. Qiu, J.J. Dunn, E.M. Bosler, B.J. Luft, Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto, Genetics. 151 (1999) 15–30. [191] J. Seshu, J.A. Boylan, F.C. Gherardini, J.T. Skare, Dissolved oxygen levels alter gene expression and antigen profiles in Borrelia burgdorferi, Infect. Immun. 72 (2004) 1580–1586. [192] J.A. Hyde, J.P. Trzeciakowski, J.T. Skare, Borrelia burgdorferi alters its gene expression and antigenic profile in response to CO2 levels, J. Bacteriol. 189 (2007) 437–445. doi:10.1128/JB.01109-06. [193] D. Grimm, K. Tilly, R. Byram, P.E. Stewart, J.G. Krum, D.M. Bueschel, T.G. Schwan, P.F. Policastro, A.F. Elias, P.A. Rosa, Outer-surface protein C of the Lyme disease spirochete: a protein induced in ticks for infection of mammals, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 3142–3147. doi:10.1073/pnas.0306845101. [194] M.C. Lybecker, D.S. Samuels, Temperature-induced regulation of RpoS by a small RNA in Borrelia burgdorferi, Mol. Microbiol. 64 (2007) 1075–1089. doi:10.1111/j.1365-2958.2007.05716.x. [195] L. Archambault, J. Linscott, N. Swerdlow, K. Boyland, E. Riley, P. Schlax, Translational efficiency of rpoS mRNA from Borrelia burgdorferi: effects of the length and sequence of the mRNA leader region, Biochem. Biophys. Res. Commun. 433 (2013) 73–78. doi:10.1016/j.bbrc.2013.02.063. [196] D. Drecktrah, L.S. Hall, L.L. Hoon-Hanks, D.S. Samuels, An inverted repeat in the ospC operator is required for induction in Borrelia burgdorferi, PloS One. 8 (2013) e68799. doi:10.1371/journal.pone.0068799. [197] S.E. Schutzer, P.K. Coyle, L.B. Krupp, Z. Deng, A.L. Belman, R. Dattwyler, B.J. Luft, Simultaneous expression of Borrelia OspA and OspC and IgM response in cerebrospinal fluid in early neurologic Lyme disease, J. Clin. Invest. 100 (1997) 763–767. doi:10.1172/JCI119589. [198] J.T. Skare, D.K. Shaw, J.P. Trzeciakowski, J.A. Hyde, In Vivo Imaging Demonstrates That Borrelia burgdorferi ospC Is Uniquely Expressed Temporally and Spatially throughout Experimental Infection, PloS One. 11 (2016) e0162501. doi:10.1371/journal.pone.0162501. [199] D.E. Dykhuizen, G. Baranton, The implications of a low rate of horizontal transfer in Borrelia, Trends Microbiol. 9 (2001) 344–350. [200] A.G. Barbour, B. Travinsky, Evolution and distribution of the ospC Gene, a transferable serotype determinant of Borrelia burgdorferi, mBio. 1 (2010). doi:10.1128/mBio.00153-10. [201] D. Brisson, N. Baxamusa, I. Schwartz, G.P. Wormser, Biodiversity of Borrelia burgdorferi strains in tissues of Lyme disease patients, PloS One. 6 (2011) e22926. doi:10.1371/journal.pone.0022926. [202] D.E. Dykhuizen, D. Brisson, S. Sandigursky, G.P. Wormser, J. Nowakowski, R.B. Nadelman, I. Schwartz, The propensity of different Borrelia burgdorferi sensu stricto genotypes to cause disseminated infections in humans, Am. J. Trop. Med. Hyg. 78 (2008) 806–810. [203] I. Livey, C.P. Gibbs, R. Schuster, F. Dorner, Evidence for lateral transfer and recombination in OspC variation in Lyme disease Borrelia, Mol. Microbiol. 18 (1995) 257–269. [204] T. Masuzawa, T. Komikado, K. Kaneda, T. Fukui, K. Sawaki, Y. Yanagihara, Homogeneity of Borrelia japonica and heterogeneity of Borrelia afzelii and

114 “Borrelia tanukii” isolated in Japan, determined from ospC gene sequences, FEMS Microbiol. Lett. 153 (1997) 287–293. [205] H.B. Vuong, C.D. Canham, D.M. Fonseca, D. Brisson, P.J. Morin, P.E. Smouse, R.S. Ostfeld, Occurrence and transmission efficiencies of Borrelia burgdorferi ospC types in avian and mammalian wildlife, Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 27 (2013) 594–600. doi:10.1016/j.meegid.2013.12.011. [206] D. Brisson, D.E. Dykhuizen, ospC diversity in Borrelia burgdorferi: different hosts are different niches, Genetics. 168 (2004) 713–722. doi:10.1534/genetics.104.028738. [207] G.P. Wormser, D. Brisson, D. Liveris, K. Hanincová, S. Sandigursky, J. Nowakowski, R.B. Nadelman, S. Ludin, I. Schwartz, Borrelia burgdorferi genotype predicts the capacity for hematogenous dissemination during early Lyme disease, J. Infect. Dis. 198 (2008) 1358–1364. doi:10.1086/592279. [208] G. Seinost, D.E. Dykhuizen, R.J. Dattwyler, W.T. Golde, J.J. Dunn, I.N. Wang, G.P. Wormser, M.E. Schriefer, B.J. Luft, Four clones of Borrelia burgdorferi sensu stricto cause invasive infection in humans, Infect. Immun. 67 (1999) 3518–3524. [209] N. Tonetti, M.J. Voordouw, J. Durand, S. Monnier, L. Gern, Genetic variation in transmission success of the Lyme borreliosis pathogen Borrelia afzelii, Ticks Tick-Borne Dis. 6 (2015) 334–343. doi:10.1016/j.ttbdis.2015.02.007. [210] S. Chen, W.R. Zückert, Probing the Borrelia burgdorferi surface lipoprotein secretion pathway using a conditionally folding protein domain, J. Bacteriol. 193 (2011) 6724–6732. doi:10.1128/JB.06042-11. [211] W.R. Zückert, Secretion of bacterial lipoproteins: through the cytoplasmic membrane, the periplasm and beyond, Biochim. Biophys. Acta. 1843 (2014) 1509–1516. doi:10.1016/j.bbamcr.2014.04.022. [212] R.J. Schulze, W.R. Zückert, Borrelia burgdorferi lipoproteins are secreted to the outer surface by default, Mol. Microbiol. 59 (2006) 1473–1484. doi:10.1111/j.1365-2958.2006.05039.x. [213] O.S. Kumru, R.J. Schulze, M.V. Rodnin, A.S. Ladokhin, W.R. Zückert, Surface localization determinants of Borrelia OspC/Vsp family lipoproteins, J. Bacteriol. 193 (2011) 2814–2825. doi:10.1128/JB.00015-11. [214] D. Kumaran, S. Eswaramoorthy, J.J. Dunn, S. Swaminathan, Crystallization and preliminary X-ray analysis of Borrelia burgdorferi outer surface protein C (OspC), Acta Crystallogr. D Biol. Crystallogr. 57 (2001) 298–300. [215] C. Eicken, V. Sharma, T. Klabunde, R.T. Owens, D.S. Pikas, M. Höök, J.C. Sacchettini, Crystal structure of Lyme disease antigen outer surface protein C from Borrelia burgdorferi, J. Biol. Chem. 276 (2001) 10010– 10015. doi:10.1074/jbc.M010062200. [216] M.J. Mathiesen, A. Holm, M. Christiansen, J. Blom, K. Hansen, S. Ostergaard, M. Theisen, The dominant epitope of Borrelia garinii outer surface protein C recognized by sera from patients with neuroborreliosis has a surface- exposed conserved structural motif, Infect. Immun. 66 (1998) 4073–4079. [217] C.G. Earnhart, D.V. Leblanc, K.E. Alix, D.C. Desrosiers, J.D. Radolf, R.T. Marconi, Identification of residues within ligand-binding domain 1 (LBD1) of the Borrelia burgdorferi OspC protein required for function in the

115 mammalian environment, Mol. Microbiol. 76 (2010) 393–408. doi:10.1111/j.1365-2958.2010.07103.x. [218] V. Fingerle, G. Goettner, L. Gern, B. Wilske, U. Schulte-Spechtel, Complementation of a Borrelia afzelii OspC mutant highlights the crucial role of OspC for dissemination of Borrelia afzelii in Ixodes ricinus, Int. J. Med. Microbiol. IJMM. 297 (2007) 97–107. doi:10.1016/j.ijmm.2006.11.003. [219] S.V. Seemanapalli, Q. Xu, K. McShan, F.T. Liang, Outer surface protein C is a dissemination-facilitating factor of Borrelia burgdorferi during mammalian infection, PloS One. 5 (2010) e15830. doi:10.1371/journal.pone.0015830. [220] N. Ramamoorthi, S. Narasimhan, U. Pal, F. Bao, X.F. Yang, D. Fish, J. Anguita, M.V. Norgard, F.S. Kantor, J.F. Anderson, R.A. Koski, E. Fikrig, The Lyme disease agent exploits a tick protein to infect the mammalian host, Nature. 436 (2005) 573–577. doi:10.1038/nature03812. [221] J.L. Coleman, J.A. Gebbia, J. Piesman, J.L. Degen, T.H. Bugge, J.L. Benach, Plasminogen is required for efficient dissemination of B. burgdorferi in ticks and for enhancement of spirochetemia in mice, Cell. 89 (1997) 1111– 1119. [222] J.L. Coleman, T.J. Sellati, J.E. Testa, R.R. Kew, M.B. Furie, J.L. Benach, Borrelia burgdorferi binds plasminogen, resulting in enhanced penetration of endothelial monolayers, Infect. Immun. 63 (1995) 2478–2484. [223] J.L. Coleman, E.J. Roemer, J.L. Benach, Plasmin-coated borrelia Burgdorferi degrades soluble and insoluble components of the mammalian extracellular matrix, Infect. Immun. 67 (1999) 3929–3936. [224] W.B. Haile, J.L. Coleman, J.L. Benach, Reciprocal upregulation of urokinase plasminogen activator and its inhibitor, PAI-2, by Borrelia burgdorferi affects bacterial penetration and host-inflammatory response, Cell. Microbiol. 8 (2006) 1349–1360. doi:10.1111/j.1462-5822.2006.00717.x. [225] Y. Murase, S. Konnai, S. Yamada, N. Githaka, M. Isezaki, T. Ito, A. Takano, S. Ando, H. Kawabata, S. Murata, K. Ohashi, An investigation of binding ability of Ixodes persulcatus Schulze Salp15 with Lyme disease spirochetes, Insect Biochem. Mol. Biol. 60 (2015) 59–67. doi:10.1016/j.ibmb.2015.01.010. [226] I.J. Juncadella, R. Garg, S.K. Ananthnarayanan, C.M. Yengo, J. Anguita, T-cell signaling pathways inhibited by the tick saliva immunosuppressor, Salp15, FEMS Immunol. Med. Microbiol. 49 (2007) 433–438. doi:10.1111/j.1574- 695X.2007.00223.x. [227] H. Fuchs, R. Wallich, M.M. Simon, M.D. Kramer, The outer surface protein A of the spirochete Borrelia burgdorferi is a plasmin(ogen) receptor, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 12594–12598. [228] C.A. Brissette, K. Haupt, D. Barthel, A.E. Cooley, A. Bowman, C. Skerka, R. Wallich, P.F. Zipfel, P. Kraiczy, B. Stevenson, Borrelia burgdorferi infection- associated surface proteins ErpP, ErpA, and ErpC bind human plasminogen, Infect. Immun. 77 (2009) 300–306. doi:10.1128/IAI.01133- 08. [229] A. Seling, C. Siegel, V. Fingerle, B.L. Jutras, C.A. Brissette, C. Skerka, R. Wallich, P.F. Zipfel, B. Stevenson, P. Kraiczy, Functional characterization of Borrelia spielmanii outer surface proteins that interact with distinct

116 members of the human factor H protein family and with plasminogen, Infect. Immun. 78 (2010) 39–48. doi:10.1128/IAI.00691-09. [230] R. Kaiser, S. Rauer, Analysis of the intrathecal immune response in neuroborreliosis to a sonicate antigen and three recombinant antigens of Borrelia burgdorferi sensu stricto, Eur. J. Clin. Microbiol. Infect. Dis. Off. Publ. Eur. Soc. Clin. Microbiol. 17 (1998) 159–166. [231] R. Kaiser, S. Rauer, Advantage of recombinant borrelial proteins for serodiagnosis of neuroborreliosis, J. Med. Microbiol. 48 (1999) 5–10. [232] R.B. Dessau, J.K. Møller, B. Kolmos, A.J. Henningsson, Multiplex assay (Mikrogen recomBead) for detection of serum IgG and IgM antibodies to 13 recombinant antigens of Borrelia burgdorferi sensu lato in patients with neuroborreliosis: the more the better?, J. Med. Microbiol. 64 (2015) 224–231. doi:10.1099/jmm.0.000009. [233] C.G. Earnhart, R.T. Marconi, Construction and analysis of variants of a polyvalent Lyme disease vaccine: approaches for improving the immune response to chimeric vaccinogens, Vaccine. 25 (2007) 3419–3427. doi:10.1016/j.vaccine.2006.12.051. [234] R.D. Gilmore Jr, K.J. Kappel, M.C. Dolan, T.R. Burkot, B.J. Johnson, Outer surface protein C (OspC), but not P39, is a protective immunogen against a tick-transmitted Borrelia burgdorferi challenge: evidence for a conformational protective epitope in OspC, Infect. Immun. 64 (1996) 2234–2239. [235] R.D. Gilmore Jr, M.L. Mbow, Conformational nature of the Borrelia burgdorferi B31 outer surface protein C protective epitope, Infect. Immun. 67 (1999) 5463–5469. [236] E. Baum, A.Z. Randall, M. Zeller, A.G. Barbour, Inferring epitopes of a polymorphic antigen amidst broadly cross-reactive antibodies using protein microarrays: a study of OspC proteins of Borrelia burgdorferi, PloS One. 8 (2013) e67445. doi:10.1371/journal.pone.0067445.

117