As a Potential Target to Inhibit Survival and DNA Damage Response and Repair Pathways in Cancer Cells Adam J

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Molecular Pathways Clinical Cancer Research Molecular Pathways: Emergence of Protein Kinase CK2 (CSNK2) as a Potential Target to Inhibit Survival and DNA Damage Response and Repair Pathways in Cancer Cells Adam J. Rabalski1, Laszlo Gyenis1, and David W. Litchfield1,2 Abstract Protein kinase CK2 (designated CSNK2) is a constitutively pant in many processes related to cancer, its potential to active protein kinase with a vast repertoire of putative sub- modulate caspase action may be particularly pertinent to its strates that has been implicated in several human cancers, emergence as a therapeutic target. Because the substrate rec- including cancer of the breast, lung, colon, and prostate, as ognition motifs for CSNK2 and caspases are remarkably sim- well as hematologic malignancies. On the basis of these ilar, CSNK2 can block the cleavage of many caspase substrates observations, CSNK2 has emerged as a candidate for targeted through the phosphorylation of sites adjacent to cleavage sites. therapy, with two CSNK2 inhibitors in ongoing clinical trials. Phosphoproteomic strategies have also revealed previously CX-4945 is a bioavailable small-molecule ATP-competitive underappreciated roles for CSNK2 in the phosphorylation of inhibitor targeting its active site, and CIGB-300 is a cell-per- several key constituents of DNA damage and DNA repair meable cyclic peptide that prevents phosphorylation of the E7 pathways. Going forward, applications of proteomic strategies protein of HPV16 by CSNK2. In preclinical models, either of to interrogate responses to CSNK2 inhibitors are expected to these inhibitors exhibit antitumor efficacy.Furthermore,in reveal signatures for CSNK2 inhibition and molecular insights combinations with chemotherapeutics such as cisplatin or to guide new strategies to interfere with its potential to inhibit gemcitabine, either CX-4945 or CIGB-300 promote synergistic caspase action or enhance the susceptibility of cancer cells to induction of apoptosis. While CSNK2 is a regulatory partici- DNA damage. Clin Cancer Res; 22(12); 2840–7. Ó2016 AACR. Disclosure of Potential Conflicts of Interest No potential conflicts of interest were disclosed. Editor's Disclosures The following editor(s) reported relevant financial relationships: P.S. Steeg reports receiving commercial research grants from Genentech. CME Staff Planners' Disclosures The members of the planning committee have no real or apparent conflicts of interest to disclose. Learning Objectives Upon completion of this activity, the participant should have a better understanding of the role of protein kinase CK2 (CSNK2) in cellular processes that underlie malignancy, including its capacity to interfere with caspase action and involvement in DNA repair pathways, and the biological rationale of CSNK2 inhibitors as promising candidates for novel therapeutic strategies. Acknowledgment of Financial or Other Support This activity does not receive commercial support. 1Department of Biochemistry, Schulich School of Medicine & Dentis- Background try, University of Western Ontario, London, Ontario, Canada. 2Depart- ment of Oncology, Schulich School of Medicine & Dentistry, University Protein kinase CK2 (designated CSNK2) represents one small of Western Ontario, London, Ontario, Canada. protein kinase family that has recently emerged as a potential Note: Supplementary data for this article are available at Clinical Cancer therapeutic target based on alterations in its expression or activity in Research Online (http://clincancerres.aacrjournals.org/). a number of cancers (Fig. 1; ref. 1). CSNK2 is composed of Corresponding Author: David W. Litchfield, Department of Biochemistry, two closely related catalytic isoforms (CSNK2A1 or CSNK2A2) Schulich School of Medicine & Dentistry, University of Western Ontario, London, that both display catalytic activity in the presence or absence of its Ontario N6A 5C1, Canada. Phone: 519-661-4186; Fax: 519-661-3175; E-mail: regulatory CSNK2B; subunit (see Supplementary Table S1 for litchfi@uwo.ca definitions of the acronyms that appear throughout this article). doi: 10.1158/1078-0432.CCR-15-1314 The regulatory CSNK2B subunit is not essential for activity but can Ó2016 American Association for Cancer Research. affect the ability of the catalytic subunits to phosphorylate certain 2840 Clin Cancer Res; 22(12) June 15, 2016 Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2016 American Association for Cancer Research. Targeting Protein Kinase CK2 (CSNK2) in Cancer DNA damage Circadian rhythm response ARNTL MDC1 DBP TCOF1 XRCC4 PER2 Apoptosis Chaperone-mediatedprotein folding CDC37 XRCC1 CRY2 RAD51 OTUB1 HSPA HSP90 TP53BP1 HSPH1 CASP3 FKBP4 PTEN CANX AKT1 NOL3 Figure 1. EIF5 MAX BID CSNK2 has been implicated in a diverse EEF1D EEF1B2 HCLS1 array of biologic processes. This figure EIF3C illustrates a selection of the biological EIF4G2 EIF3D HDAC1 processes in which CSNK2 has been Translation EEF1E1 CSNK2 EIF2S2 CDC34 CDK5 implicated with examples of putative CDK1 substrates or interacting proteins TP53 CDK2 CDC25C involved in each of these processes. SSRP1 FOXK1 EAPP CDK19 These proteins were identified and TFE3 HSF1 ETV6 analyzed using the following databases: Transcription BUB1B SUPT16H TCEB3 CENPF CDC16 GO: biological processes according to CTCF Cell cycle regulation UniProt (52), Reactome (53), PHOSIDA CTNNB1 ESPL1 TP53BP1 CDC34 UBE2 NEK9 (54), and PubMed (55). FOXM1 DVL2 TP53 DVL3 MEN1 IGF2R MYC APC MAP2K2 DCP1A WNT signaling pathway regulation Mitoticcheckpoint spindle wth and Cell gro proliferation © 2016 American Association for Cancer Research substrates (2). A recent analysis of transcript expression profiles the presence of second messengers to be catalytically active), for CSNK2A1, CSNK2A2, and CSNK2B in neoplastic tissues versus which is expressed at higher levels in many forms of human normal tissues deposited in the Oncomine database revealed cancer(1,3,7,8).CSNK2hasalsobeenshowntobeessential varying degrees of altered expression of individual CSNK2 sub- for viability and to enhance cancer cell survival associated units, suggesting that deregulation of CSNK2 subunit expression with inhibition of apoptosis. These observations are partic- profiles promotes cancer (3). To this point, the CSNK2-dependent ularly intriguing when considering the remarkable resem- phosphoproteome has not yet been fully elucidated, and the blance of the consensus recognition motif of CSNK2 with impact of alterations in CSNK2 on the phosphoproteome has not that of caspases (Fig. 2A) that cleave substrates at aspartic yet been systematically investigated. Nevertheless, it is evident both acid residues during the progression of apoptosis. In fact, from an extensive body of literature and computational predictions several published examples (Fig. 2A) show that caspase sub- of its substrates based on its consensus recognition motif (S/T-X-X- strates, including Bid, which promotes apoptotic progression D/E/pS/pY) that CSNK2 is involved in a vast landscape of biolog- when it is cleaved, can be phosphorylated by CSNK2 at sites ical processes (Fig. 1), with more than 2,000 putative phosphor- adjacent to caspase cleavage sites. Because phosphorylation ylation sites in the human proteome (4). While more comprehen- adjacent to caspase cleavage sites blocks cleavage, these sivediscussionsofCSNK2canbefoundelsewhere(5,6),wehigh- observations suggest that increased phosphorylation by light the involvement of CSNK2 in specific cellular processes, CSNK2 could promote cell survival by inhibiting caspase including its convergence with caspase pathways and its roles in action (9–14). DNA response and repair pathways, which have inspired ongoing Building on these observations, a combined computational efforts to exploit CSNK2 as a therapeutic target. and biochemical approach revealed an extensive repertoire of proteins with overlapping CSNK2 and caspase recognition Convergence of CSNK2 with caspase pathways motifs suggesting that CSNK2 could have widespread impact CSNK2 is generally considered to be a constitutively active on caspase action (15). In addition to the identification of enzyme (i.e., its catalytic subunits do not require activating many proteins known to be caspase substrates, these studies phosphorylation, association with its regulatory subunit, or also demonstrated that CSNK2 could phosphorylate CASP3 www.aacrjournals.org Clin Cancer Res; 22(12) June 15, 2016 2841 Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2016 American Association for Cancer Research. Rabalski et al. A Caspase motif CSNK2 motif Overlapping motif –(S/T)–X–X–D/E– –E–X–D– –E–S/T–D–X–D/E– CSNK2 CASPASE P Phosphorylation blocks –E–S/T–D–X–D/E– –E–S/T–D X–D/E– cleavage CSNK2 active CSNK2 inhibited Figure 2. Protein kinase CSNK2 plays pivotal roles in the control of cell survival and Extrinsic Apoptosis Intrinsic Extrinsic Apoptosis Intrinsic responses to DNA damage. A, on the basis of the remarkable similarity of Chemicals UV Chemicals UV Fas Fas the consensus recognition motifs for phosphorylation by CSNK2 (S/T-D-X- X-D/E) and cleavage by caspases (E- X-D), it is evident that there are many P CASP 8 cellular proteins where CSNK2 FADD FADD BID phosphorylation could occur adjacent CSNK2 CASP 8 BID CASP 8 to caspase cleavage sites to block their cleavage by caspases (15). As SMAC/ SMAC/ described in the text, the proteins CYTOCHROME C CYTOCHROME C DIABLO DIABLO shown here represent caspase APAF-1 substrates including Bid, which CASP 9 promotes apoptotic progression when
Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells

    Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells

    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Fine Mapping Chromosome 16Q12 in a Collection of 231 Systemic Lupus Erythematosus Sibpair and Multiplex Families

    Fine Mapping Chromosome 16Q12 in a Collection of 231 Systemic Lupus Erythematosus Sibpair and Multiplex Families

    Genes and Immunity (2005) 6, 19–23 & 2005 Nature Publishing Group All rights reserved 1466-4879/05 $30.00 www.nature.com/gene FULL PAPER Fine mapping chromosome 16q12 in a collection of 231 systemic lupus erythematosus sibpair and multiplex families CD Gillett1,2, CD Langefeld3, AH Williams3, WA Ortmann2, RR Graham4, PR Rodine2, SA Selby2, PM Gaffney1,2, TW Behrens1,2 and KL Moser1,2 1Department of Molecular, Cellular, Developmental Biology and Genetics, University of Minnesota, Minneapolis, MN, USA; 2Department of Medicine and the Center for Lupus Research, University of Minnesota, Minneapolis, MN, USA; 3Department of Public Health Sciences, Wake Forest University Health Sciences, Winston-Salem, NC, USA; 4Department of Medicine, Massachusetts General Hospital, Boston, MA, USA Systemic lupus erythematosus (SLE) is a chronic, autoimmune disorder influenced by multiple genetic and environmental factors. Linkage of SLE to chromosome 16q12–13 (LOD score ¼ 3.85) was first identified in pedigrees collected at the University of Minnesota, and has been replicated in several independent SLE collections. We performed fine mapping using microsatellites to further refine the susceptibility region(s), and the best evidence for linkage was identified at marker D16S3396 (LOD ¼ 2.28, P ¼ 0.0006). Evidence of association was suggested in the analysis of all families (D16S3094, P ¼ 0.0516) and improved to the level of significance (P ¼ 0.0106) when only the Caucasian families were analyzed. Subsets of pedigrees were then selected on the basis of clinical manifestations, and these subsets showed evidence for association with several markers: GATA143D05 (renal, P ¼ 0.0064), D16S3035 (renal, P ¼ 0.0418), D16S3117 (renal, P ¼ 0.0366), D16S3071 (malar rash, P ¼ 0.03638; neuropsychiatric, P ¼ 0.0349; oral ulcers, P ¼ 0.0459), D16S3094 (hematologic, P ¼ 0.0226), and D16S3089 (arthritis, P ¼ 0.0141).
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk

    A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk

    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2014 A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk Nancy L. Maas University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biology Commons, Cell Biology Commons, and the Molecular Biology Commons Recommended Citation Maas, Nancy L., "A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk" (2014). Publicly Accessible Penn Dissertations. 1354. https://repository.upenn.edu/edissertations/1354 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1354 For more information, please contact [email protected]. A Chemical-Genetic Screen for Identifying Substrates of the Er Kinase Perk Abstract Cells constantly encounter changing environments that challenge the ability to adapt and survive. Signal transduction networks enable cells to appropriately sense and respond to these changes, and are often mediated through the activity of protein kinases. Protein kinases are a class of enzyme responsible for regulating a broad spectrum of cellular functions by transferring phosphate groups from ATP to substrate proteins, thereby altering substrate activity and function. PERK is a resident kinase of the endoplasmic reticulum, and is responsible for sensing perturbations in the protein folding capacity of the ER. When the influx of unfolded, nascent proteins exceeds the folding capacity of the ER, PERK initiates a cascade of signaling events that enable cell adaptation and ER stress resolution. These signaling pathways are not only essential for the survival of normal cells undergoing ER stress, but are also co-opted by tumor cells in order to survive the oxygen and nutrient-restricted conditions of the tumor microenvironment.
  • CSNK2B Monoclonal Antibody Catalog Number:67866-1-Ig

    CSNK2B Monoclonal Antibody Catalog Number:67866-1-Ig

    For Research Use Only CSNK2B Monoclonal antibody www.ptgcn.com Catalog Number:67866-1-Ig Catalog Number: GenBank Accession Number: CloneNo.: Basic Information 67866-1-Ig BC112017 1B5A6 Size: GeneID (NCBI): Recommended Dilutions: 1000 μg/ml 1460 WB 1:5000-1:20000 Source: Full Name: IF 1:200-1:800 Mouse casein kinase 2, beta polypeptide Isotype: Calculated MW: IgG1 215 aa, 25 kDa Purification Method: Observed MW: Protein G purification 27 kDa Immunogen Catalog Number: AG19180 Applications Tested Applications: Positive Controls: IF, WB,ELISA WB : A549 cells; LNCaP cells, HeLa cells, Jurkat cells, Species Specificity: pig brain tissue, rat brain tissue, mouse brain tissue Human, mouse, rat, pig IF : HeLa cells; CSNK2B is a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, Background Information translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. It participates in Wnt signaling, and plays a complex role in regulating the basal catalytic activity of the alpha subunit. Storage: Storage Store at -20ºC. Stable for one year after shipment. Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Aliquoting is unnecessary for -20ºC storage For technical support and original validation data for this product please contact: This product is exclusively available under Proteintech T: 4006900926 E: [email protected] W: ptgcn.com Group brand and is not available to purchase from any other manufacturer.
  • Protein Kinase CK2: Intricate Relationships Within Regulatory Cellular Networks

    Protein Kinase CK2: Intricate Relationships Within Regulatory Cellular Networks

    pharmaceuticals Review Protein Kinase CK2: Intricate Relationships within Regulatory Cellular Networks Teresa Nuñez de Villavicencio-Diaz 1, Adam J. Rabalski 1 and David W. Litchfield 1,2,* 1 Department of Biochemistry, Schulich School of Medicine & Dentistry, University of Western Ontario, London, ON N6A 5C1, Canada; [email protected] (T.N.d.V.D.); [email protected] (A.J.R.) 2 Department of Oncology, Schulich School of Medicine & Dentistry, University of Western Ontario, London, ON N6A 5C1, Canada * Correspondence: litchfi@uwo.ca; Tel.: +1-519-661-4186 Academic Editor: Joachim Jose Received: 14 January 2017; Accepted: 2 March 2017; Published: 5 March 2017 Abstract: Protein kinase CK2 is a small family of protein kinases that has been implicated in an expanding array of biological processes. While it is widely accepted that CK2 is a regulatory participant in a multitude of fundamental cellular processes, CK2 is often considered to be a constitutively active enzyme which raises questions about how it can be a regulatory participant in intricately controlled cellular processes. To resolve this apparent paradox, we have performed a systematic analysis of the published literature using text mining as well as mining of proteomic databases together with computational assembly of networks that involve CK2. These analyses reinforce the notion that CK2 is involved in a broad variety of biological processes and also reveal an extensive interplay between CK2 phosphorylation and other post-translational modifications. The interplay between CK2 and other post-translational modifications suggests that CK2 does have intricate roles in orchestrating cellular events. In this respect, phosphorylation of specific substrates by CK2 could be regulated by other post-translational modifications and CK2 could also have roles in modulating other post-translational modifications.
  • CSNK2A2 (NM 001896) Human Tagged ORF Clone Product Data

    CSNK2A2 (NM 001896) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG202435 CSNK2A2 (NM_001896) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: CSNK2A2 (NM_001896) Human Tagged ORF Clone Tag: TurboGFP Symbol: CSNK2A2 Synonyms: CK2A2; CK2alpha'; CSNK2A1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG202435 representing NM_001896 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGGAGCCGCGAGT ACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGG TCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATCACCAACAATGAGAGAGTGGTTGTAAAAATC CTGAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAA ATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATAT CAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAA CTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCA TGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCA GGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTAT GATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCT TCCATGGACAGGACAACTATGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGG GTATCTGAAGAAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAA
  • Eukaryotic Translation Initiation Factor 3 Plays Distinct Roles at The

    Eukaryotic Translation Initiation Factor 3 Plays Distinct Roles at The

    RESEARCH ARTICLE Eukaryotic translation initiation factor 3 plays distinct roles at the mRNA entry and exit channels of the ribosomal preinitiation complex Colin Echeverrı´aAitken1, Petra Beznoskova´ 2, Vladislava Vlcˇkova2, Wen-Ling Chiu3†, Fujun Zhou1, Leosˇ Shivaya Vala´ sˇek2*, Alan G Hinnebusch3*, Jon R Lorsch1* 1Laboratory on the Mechanism and Regulation of Protein Synthesis, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, United States; 2Laboratory of Regulation of Gene Expression, Institute of Microbiology ASCR, Prague, Czech Republic; 3Laboratory of Gene Regulation and Development, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, United States Abstract Eukaryotic translation initiation factor 3 (eIF3) is a central player in recruitment of the pre-initiation complex (PIC) to mRNA. We probed the effects on mRNA recruitment of a library of S. cerevisiae eIF3 functional variants spanning its 5 essential subunits using an in vitro-reconstituted *For correspondence: valasekl@ system. Mutations throughout eIF3 disrupt its interaction with the PIC and diminish its ability to biomed.cas.cz (LSV); [email protected] (AGH); jon. accelerate recruitment to a native yeast mRNA. Alterations to the eIF3a CTD and eIF3b/i/g . [email protected] (JRL) significantly slow mRNA recruitment, and mutations within eIF3b/i/g destabilize eIF2 GTP Met- tRNAi binding to the PIC. Using model mRNAs lacking contacts with the 40S entry or exit channels, Present address: we uncovered a critical role for eIF3 requiring the eIF3a NTD, in stabilizing mRNA interactions at †PharmaEssentia Corp., Taipei, the exit channel, and an ancillary role at the entry channel requiring residues of the eIF3a CTD.
  • Palmitic Acid Effects on Hypothalamic Neurons

    Palmitic Acid Effects on Hypothalamic Neurons

    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.03.454666; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Running title: Oleic and palmitic acid effects on hypothalamic neurons Concentration-dependent change in hypothalamic neuronal transcriptome by the dietary fatty acids: oleic and palmitic acids Fabiola Pacheco Valencia1^, Amanda F. Marino1^, Christos Noutsos1, Kinning Poon1* 1Department of Biological Sciences, SUNY Old Westbury, Old Westbury NY, United States ^Authors contributed equally to this work *Corresponding Author: Kinning Poon 223 Store Hill Rd Old Westbury, NY 11568, USA 1-516-876-2735 [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.03.454666; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Prenatal high-fat diet exposure increases hypothalamic neurogenesis events in embryos and programs offspring to be obesity-prone. The molecular mechanism involved in these dietary effects of neurogenesis are unknown. This study investigated the effects of oleic and palmitic acids, which are abundant in a high-fat diet, on the hypothalamic neuronal transcriptome and how these changes impact neurogenesis events. The results show differential effects of low and high concentrations of oleic or palmitic acid treatment on differential gene transcription.
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals

    Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals

    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
  • Supplementary Table 1. Genes Mapped in Core Cancer

    Supplementary Table 1. Genes Mapped in Core Cancer

    Supplementary Table 1. Genes mapped in core cancer pathways annotated by KEGG (Kyoto Encyclopedia of Genes and Genomes), MIPS (The Munich Information Center for Protein Sequences), BIOCARTA, PID (Pathway Interaction Database), and REACTOME databases. EP300,MAP2K1,APC,MAP3K7,ZFYVE9,TGFB2,TGFB1,CREBBP,MAP BIOCARTA TGFB PATHWAY K3,TAB1,SMAD3,SMAD4,TGFBR2,SKIL,TGFBR1,SMAD7,TGFB3,CD H1,SMAD2 TFDP1,NOG,TNF,GDF7,INHBB,INHBC,COMP,INHBA,THBS4,RHOA,C REBBP,ROCK1,ID1,ID2,RPS6KB1,RPS6KB2,CUL1,LOC728622,ID4,SM AD3,MAPK3,RBL2,SMAD4,RBL1,NODAL,SMAD1,MYC,SMAD2,MAP K1,SMURF2,SMURF1,EP300,BMP8A,GDF5,SKP1,CHRD,TGFB2,TGFB 1,IFNG,CDKN2B,PPP2CB,PPP2CA,PPP2R1A,ID3,SMAD5,RBX1,FST,PI KEGG TGF BETA SIGNALING PATHWAY TX2,PPP2R1B,TGFBR2,AMHR2,LTBP1,LEFTY1,AMH,TGFBR1,SMAD 9,LEFTY2,SMAD7,ROCK2,TGFB3,SMAD6,BMPR2,GDF6,BMPR1A,B MPR1B,ACVRL1,ACVR2B,ACVR2A,ACVR1,BMP4,E2F5,BMP2,ACVR 1C,E2F4,SP1,BMP7,BMP8B,ZFYVE9,BMP5,BMP6,ZFYVE16,THBS3,IN HBE,THBS2,DCN,THBS1, JUN,LRP5,LRP6,PPP3R2,SFRP2,SFRP1,PPP3CC,VANGL1,PPP3R1,FZD 1,FZD4,APC2,FZD6,FZD7,SENP2,FZD8,LEF1,CREBBP,FZD9,PRICKLE 1,CTBP2,ROCK1,CTBP1,WNT9B,WNT9A,CTNNBIP1,DAAM2,TBL1X R1,MMP7,CER1,MAP3K7,VANGL2,WNT2B,WNT11,WNT10B,DKK2,L OC728622,CHP2,AXIN1,AXIN2,DKK4,NFAT5,MYC,SOX17,CSNK2A1, CSNK2A2,NFATC4,CSNK1A1,NFATC3,CSNK1E,BTRC,PRKX,SKP1,FB XW11,RBX1,CSNK2B,SIAH1,TBL1Y,WNT5B,CCND1,CAMK2A,NLK, CAMK2B,CAMK2D,CAMK2G,PRKACA,APC,PRKACB,PRKACG,WNT 16,DAAM1,CHD8,FRAT1,CACYBP,CCND2,NFATC2,NFATC1,CCND3,P KEGG WNT SIGNALING PATHWAY LCB2,PLCB1,CSNK1A1L,PRKCB,PLCB3,PRKCA,PLCB4,WIF1,PRICK LE2,PORCN,RHOA,FRAT2,PRKCG,MAPK9,MAPK10,WNT3A,DVL3,R