Biosci. Biotechnol. Biochem., 67 (12), 2524–2532, 2003

TransaldolaseWGlucose­6­phosphate Isomerase Bifunctional Enzyme and Ribulokinase as Factors to Increase Xylitol Production from D­Arabitol in Gluconobacter oxydans

Masakazu SUGIYAMA,õ Shun­ichi SUZUKI,NaotoTONOUCHI,andKenzoYOKOZEKI

AminoScience Laboratories, Ajinomoto Co., Inc., Suzuki­cho, Kawasaki­ku, Kawasaki­shi 210­8681, Japan

Received May 20, 2003; Accepted September 8, 2003

Xylitol production from D­arabitol by the membrane and soluble fractions of Gluconobacter oxydans was investigated. Two proteins in the soluble fraction were found to have the ability to increase xylitol production. Both of these xylitol­increasing factors were puriˆed, and on the basis of their NH2­terminal amino acid sequences the genes encoding both of the factors were cloned. Expression of the cloned genes in Escherichia Fig. 1. Schematic Representation of Xylitol Production from coli showed that one of the xylitol­increasing factors D­Arabitol by G. oxydans. is the bifunctional enzyme transaldolaseWglucose­ AraDH, membrane­bound D­arabitol dehydrogenase; XDH, 6­phosphate isomerase, and the other is ribulokinase. soluble NADH­dependent xylitol dehydrogenase. Using membrane and soluble fractions of G. oxydans, 3.8 gWl of xylitol were produced from 10 gWl D­arabitol after incubation for 40 h, and addition of puriˆed for producing xylitol from D­arabitol, thereby lower­ recombinant transaldolaseWglucose­6­phosphate isom­ ing manufacturing costs by allowing xylitol to be erase or ribulokinase increased xylitol to 5.4 gWl respec­ produced from D­glucose, is an attractive proposi­ tively, conˆrming the identity of the xylitol­increasing tion. factors. In a previous study, we found that Gluconobacter oxydans ATCC 621 was able to produce xylitol from Key words: xylitol; Gluconobacter; pentose phos­ D­arabitol.8) The conversion of D­arabitol to xylitol phate pathway; NADH regeneration involves successive enzymatic reactions: oxidation of D­arabitol to D­xylulose by D­arabitol dehydrogenase Xylitol is a naturally occurring pentahydroxy sugar (AraDH), followed by reduction of the D­xylulose to alcohol. It has a similar degree of sweetness to su­ xylitol by xylitol dehydrogenase (XDH) (Fig. 1). G. crose, and is used as an alternative natural sweetener. oxydans has a membrane­bound AraDH and irrever­ In addition, xylitol has the useful property of sibly converts D­arabitol to D­xylulose.8,9) Neverthe­ preventing dental caries and is used in oral health less, some D­xylulose still remained in the reaction care. Because of these properties, xylitol has mixture, even using recombinant strains of G. oxyd­ numerous applications in the food and pharmaceuti­ ans that had 11­fold higher XDH activity than the cal industries.1–6) wild­type strain.10) From a practical point of view, Xylitol is produced commercially by chemical increasing the conversion rate of D­xylulose to xylitol reduction (hydrogenation) of D­xylose, which is in would improve the yield of xylitol and reˆne the turn derived from hemicellulose­xylan hydrolysates manufacturing process. of substrates such as birchwood or corn.1,6) Microbial We have also screened for eŠective additives on conversion of D­arabitol (the 2­epimer of xylitol) to xylitol yield from D­arabitol, and found that the xylitol is an alternative synthetic route that avoids addition of ethanol increased xylitol production. It any requirement for D­xylose. Since we have screened was suggested that the ethanol was oxidized by an and isolated some osmophilic yeast strains that NAD­dependent soluble alcohol dehydrogenase, produce D­arabitol e‹ciently from D­glucose by fer­ resulting in the regeneration of NADH.8,10) Since mentation,7) the development of a microbial method XDH is highly speciˆc for NADH, it requires a sup­

õ To whom correspondence should be addressed. Fax: {81­44­244­6581; E­mail: masakazuäsugiyama—ajinomoto.com Abbreviations: XIF, xylitol­increasing factor; TAL, transaldolase; PGI, glucose­6­phosphate isomerase; AraDH, D­arabitol dehydrogenase; XDH, xylitol dehydrogenase; KPB, potassium phosphate buŠer TransaldolaseWGlucose­6­phosphate Isomerase Complex and Ribulokinase of G. oxydans 2525 ply of NADH for the e‹cient conversion of D­xylu­ trifugation and washed with 50 mM potassium phos­ lose to xylitol. phate buŠer (KPB; pH 6.0). Cells were suspended in In many other bacterial strains, NADH can be 50 mM KPB (pH 6.0) and disrupted by ultrasonic regenerated through glycolysis (the Embden­ treatment. Cell debris was removed by centrifugation Meyerhof pathway) and the TCA cycle during at 3,000~g for 10 min at 49C, followed by separa­ metabolism. However, Gluconobacter has been tion of membrane and soluble fractions by ultracen­ reported to lack phosphofructokinase, an essential trifugation at 100,000~g for 30 min at 49C. The enzyme in the Embden­Meyerhof pathway, and supernatants were used as the soluble fraction. The succinate dehydrogenase, an essential enzyme in the pellets were resuspended in 50 mM KPB (pH 6.0) and TCA cycle.11–15) The NADH generation mechanism in used as the membrane fraction. The in vitro xylitol G. oxydans thus remains unclear. Since xylitol was production assay was performed with 10 gWlof produced from D­arabitol by G. oxydans,suggesting D­arabitol in the presence of the soluble and mem­ the existence of an NADH generation pathway from brane fractions. The reaction mixture contained D­arabitol, and ethanol cannot be used in a commer­ 50 mM KPB (pH 6.0), 10 gWl D­arabitol, 10 mM NAD, cial scale process, our chosen approach to developing 1mgproteinWml soluble fraction, 1 mg proteinWml an improved xylitol production process was therefore membrane fraction, and 1 mM CoCl2. The reaction to identify the rate­limiting factor in the NADH was performed at a ˆnal volume of 150 mlasa regeneration pathway from D­arabitol in G. oxydans standard condition. The reaction mixtures were incu­ in order to construct a strain with increased NADH bated for 16 h at 309C and the reaction was stopped regeneration ability. by the addition of 1W10 volume of 100z (wWv) TCA. In this paper, we report the investigation of the Proteins were precipitated by centrifugation at NADH generation mechanism during xylitol produc­ 15,000~g for 10 min at 49C, and the supernatants tion from D­arabitol by G. oxydans.Weˆrstcon­ were neutralized by the addition of 6 M KOH. Fifty structed an in vitro xylitol production assay system. microliters of the thus­obtained supernatants were Next, using the assay system, we searched for factors dilutedwith200ml of distilled water, and xylitol, that improved xylitol production in G. oxydans.Two D­xylulose, and D­arabitol were measured by HPLC protein factors were detected and puriˆed. Cloning analysis. and expression of the genes showed that these factors were transaldolaseWglucose­6­phosphate isomerase Measurement of xylitol, D­arabitol, and D­xylu­ bifunctional enzyme (TAL­PGI) and ribulokinase. lose. Xylitol, D­arabitol, and D­xylulose were Increased activities of these enzymes in G. oxydans measured with a high­performance liquid chro­ resulted in improved xylitol production from matography (HPLC) system (Hitachi, Japan) with a D­arabitol in vitro. Shodex SC1211 column (Showa Denko, Japan). The column temperature was 609C, and 50z acetonitrile Materials and Methods in 50 mgWl Ca­EDTA solution was used as the mobile phase at a ‰ow rate of 0.8 mlWmin, and the sample Strains. Gluconobacter oxydans ATCC 621 was volume was 50 ml. used in this study. Escherichia coli JM 109 (Takara Shuzo, Japan) was used in the cloning and expression Puriˆcation of xylitol­increasing factors (XIFs) of tal­pgi and ribulokinase. from the soluble fraction. Xylitol­increasing factors (XIFs) were puriˆed from the soluble fraction of Media and culture conditions. Sugar­rich (SR) G. oxydans as follows. Ten grams of wet cells were medium, containing glucose 5 gWl, glycerol 3 gWl, resuspended in 45 ml of BuŠer A containing 20 mM sodium gluconate 20 gWl, Bacto yeast extract 3 gWl, Tris­HCl (pH 7.6), and cell­free extracts were and peptone 2 gWl (pH 6.5), and YPG medium, prepared by ultrasonic treatment followed by containing Bacto yeast extract 5 gWl, Bacto peptone ultracentrifugation at 100,000~g for 30 min at 49C. 3gWl, and glucose 30 gWl(pH6.5),wereusedforthe The soluble fraction thus obtained was put onto a cultivation of G. oxydans. G. oxydans ATCC 621 Q­Sepharose Fast Flow 26W10 column (Amersham was initially cultured on YPG­agar at 309C for 24 h, Biosciences, USA) that had previously been then inoculated into 50 ml of SR medium in a 500­ml equilibrated with BuŠer A. After any unbound ‰ask and cultured at 309C for 24 h with shaking. A proteins were washed out with BuŠer A, XIFs were 2.5­ml portion of the broth was then inoculated into eluted with a linear 0–700 mM gradient of KCl. The 50 ml of fresh SR medium in a 500­ml ‰ask and xylitol­increasing activities of each fraction were cultured at 309C for 24 h with shaking. examined by addition at 1W10 (vWv) into the in vitro xylitol production assay. The fractions containing In vitro xylitol production by G. oxydans cell the XIFs were collected. The fractions were dialyzed extracts. The soluble and membrane fractions were overnight against BuŠer B containing 20 mM Tris­ prepared as follows. The cells were collected by cen­ HCl and 100 mM KCl (pH 7.6), concentrated by 2526 M. SUGIYAMA et al. ultraˆltration with Centriprep 10 (Amicon, USA) region of the xif1 gene and a 4.8­kbp XhoI­BamHI and put onto a gel ˆltration column (Sephadex 200 fragment containing the 3?­region of the xif1 gene HP 16W60; Amersham Biosciences)that had previ­ were obtained (Fig. 6). ously been equilibrated with BuŠer B. XIFs were eluted with BuŠer B at a ‰ow rate of 1 mlWmin. As Cloning of the xif2 gene. BasedontheNH2­termi­ the third step, each of the XIFs was collected and nal amino acid sequence, two sets of antisense put onto a Mono­Q HR 5W5column(Amersham primers were synthesized as follows: S1, 5?­GCYTT­ Biosciences)that had previously been equilibrated YTTXARXCCYTCXARXGTRAAXARXCCXGC­ with BuŠer A. After any unbound proteins were 3?(corresponding to the amino acid sequence 16Ala­ washed out with BuŠer A, XIFs were eluted with a 17Gly­18Leu­19Phe­20Thr­21Leu­22Glu­23Gly­24Leu­ linear 0–700 mM gradient of KCl. The fractions 25Lys­26Lys­27Ala); S2, 5?­CCXGTXCCXACRTCD­ showing XIF activity were dialyzed overnight against ATXCC­3? (corresponding to the amino acid se­ BuŠer C containing 20 mM Tris­HCl and 1 M ammo­ quence 6Gly­7Ile­8Asp­9Val­10Gly­11Thr­12Gly). A part nium sulfate (pH 7.6), and put onto a Phenyl of the 5?­region of the xif2 gene and its upstream Superose HP HR 5W5 column (Amersham Biosci­ region was cloned by cassette PCR using these two ences)that had previously been equilibrated with primers. A 1.5­kbp fragment was ampliˆed from the BuŠer C. XIFs were adsorbed onto the column, and EcoRI cassette library, and the nucleotide sequence after any unbound proteins were washed out with identiˆed contained a sequence corresponding to the

BuŠer C, they were eluted with a 1–0 M gradient of NH2­terminal amino acid sequence of XIF2, conˆrm­ ammonium sulfate. Each of the XIFs was then ing that this fragment contained a part of the 5?­ collected and dialyzed overnight against BuŠer A. region of the xif2 gene and its upstream region. A part of the 5?­region of the xif2 gene and its upstream

NH2­terminal amino acid sequence analysis. XIF1 region were ampliˆed with these primers: 5?­CAG­ and XIF2 puriˆed from G. oxydans were put through AACCAGATCCATAGAATCACACC­3? (corre­ SDS­PAGE and transferred to a polyvinylidene sponding to positions |11 to 15)and 5 ?­CCGCCTC­

‰uoride membrane. The NH2­terminal amino acid GAACCCGGACTGCGC­3? (corresponding to posi­ sequences were identiˆed with a protein sequencer tions |455 to |434). Using the ampliˆed 470­bp (model 476A; Applied Biosystems, USA). fragment as a probe, a 4.2­kbp EcoRI fragment showed positive hybridization. This 4.2­kbp DNA Cloning of the xif1 gene. Chromosomal DNA fragment was ligated into the EcoRI site of pUC18, from G. oxydans ATCC 621 was prepared as de­ and a clone was obtained by colony hybridization. scribed by Okumura et al.16) Southern hybridization and colony hybridization were performed on a posi­ Expression of the His­tagged xif1 and xif2 genes in tively charged nylon membrane (Roche Diagnostics). E. coli and puriˆcation of the His­tagged XIFs. An DNA probes were prepared using DIG High Prime expression vector for xif1 was constructed as follows. (Roche Diagnostics)and detection was performed A 2.9­kbp fragment that included the coding region with the DIG nucleotide detection kit (Roche Diag­ and the 5?­region of the xif1 gene was ampliˆed from nostics). The xif1 and xif2 genes were partially cloned the chromosomal DNA of G. oxydans ATCC 621 using a cassette PCR method (LA PCR in vitro Clon­ with the following primers: 5?­GCCGTCGACCGC­ ing Kit; Takara Shuzo, Japan)as described in the GGCAAGTAAGGGAGAGATCCTATGGCAGA­ manufacturer's manual. CAC­3? (corresponding to positions |24 to 11, The xif1 gene was cloned as follows. Based on the changing the original start codon of GTG to ATG),

NH2­terminal amino acid sequence, two sets of and 5?­GCCGCATGCGACTTAGTGGTGGTGG­ oligonucleotide primers were synthesized as follows: TGGTGGTGTGCTCCTGCCAGTGC­3? (corre­ S1, 5?­GCNGAYACNAARWSBAAYACVGG­3? sponding to positions 2857 to 2871 and 6~His­tag). (corresponding to the amino acid sequence 2Ala­ The ampliˆed fragment was digested with Sal Iand 3Asp­4Thr­5Lys­6Ser­7Asn­8Thr­9Gly); S2, 5?­AAYA­ SphI and ligated into the corresponding sites of the CVGGBCTBAAYGARGTBGG­3? (corresponding vector pUC18 to give pUCXIF1. E. coli JM109 was to the amino acid sequence 7Asn­8Thr­9Gly­10Leu­ then transformed with pUCXIF1, inoculated into 11Asn­12Glu­13Val­14Gly). Part of the xif1 gene was 3 ml of LB­amp medium and cultured at 379Cfor cloned by cassette PCR using these two primers. A 16 h. A 1­ml portion of the broth was then inoculated 2.2­kbp fragment was ampliˆed from the HindIII into 50 ml of fresh LB­amp medium and cultured at cassette library, and this fragment, containing the 379C. After 3 h, IPTG was added to the broth to a nucleotide sequence corresponding to the NH2­termi­ ˆnal concentration of 1 mM, and culturing was nal amino acid sequence of XIF1, was used as the continued for a further 4 h. The cells were then probe for isolation of the full­length xif1 gene by harvested by centrifugation and washed with 20 mM Southern hybridization and colony hybridization. A Tris­HCl buŠer (pH 7.6). The cells thus obtained 3.6­kbp EcoRI­XhoI fragment containing the 5?­ were resuspended in 1 ml of 20 mM Tris­HCl (pH 7.6) TransaldolaseWGlucose­6­phosphate Isomerase Complex and Ribulokinase of G. oxydans 2527 and disrupted by ultrasonic treatment. The debris Enzyme assays. One enzyme unit was deˆned as was removed by centrifugation at 10,000~g for 10 the amount of enzyme catalyzing conversion of min and the His­tagged protein was puriˆed by using 1 mmol of substrate per min. Transaldolase (TAL) a HiTrap Kit and HiTrap Chelating Column (bed activity was measured spectrophotometrically at volume 5 ml; Amersham Biosciences) as described in 309C by following the substrate­dependent decrease the manufacturer's manual. The eluted fraction was of NADH at 340 nm. The reaction mixture contained then collected and dialyzed overnight against BuŠer 50 mM KPB (pH 7.0), and 0.5 mM NADH, 5 mM A. The expression vector for xif2 was also construct­ ed. A 1.9­kbp fragment that included the coding region and the 5?­region of the xif2 gene was ampli­ ˆed from the chromosomal DNA of G. oxydans with the following primers: 5?­GCCGAATTCACAAGT­ CCGCGTGCGCATCGC­3? (corresponding to posi­ tions |221 to |201), and 5?­GCCGGATCCTCAG­ TGGTGGTGGTGGTGGTGGGCGGTGTTCTCC­ TTTTCCAGAAAGTC­3? (corresponding to posi­ tions 1618 to 1644 and 6~His­tag). The ampliˆed fragment was digested with EcoRI and BamHI and cloned into the corresponding sites of the vector pUC18 to give pUCXIF2. His­tagged XIF2 was expressed in E. coli JM109 and puriˆed as described Fig. 2. Construction of the in Vitro Xylitol Production Assay above. System.

({)CoCl2, addition of 1 mM CoCl2;(|)CoCl2, no addition

of CoCl2.

Fig. 3. Identiˆcation of the Xylitol­increasing Factors in the Soluble Fraction of G. oxydans. A, Chromatogram of the G. oxydans soluble fraction on a Q­Sepharose column; B, in vitro xylitol production assay. 2528 M. SUGIYAMA et al. fructose­6­phosphate, 5 mM erythrose­4­phosphate, 2UWml glycerol­3­phosphate dehydrogenase and triose phosphate isomerase (Sigma, USA). Glucose­ 6­phosphate isomerase (PGI) activity was measured at 309C by following the substrate­dependent forma­ tion of NADPH at 340 nm. The reaction mixture contained 50 mM KPB (pH 7.0), and 1 mM NADP, 5mM fructose­6­phosphate, and 5 UWml glucose­ 6­phosphate dehydrogenase (Sigma, USA). Sugar kinase activities were measured spectrophotometri­ cally at 309C by following the substrate­dependent decrease of NADH at 340 nm. The reaction mixture contained 50 mM Tris­HCl buŠer (pH 7.0), 5 mM

MgCl2,1mM ATP, 8.3 UWml lactate dehydrogenase (Oriental Yeast Co., Japan), 8.3 UWml pyruvate kinase (Oriental Yeast Co.), 0.3 mM NADH, and 5mM substrate. The substrate speciˆcity of XIF2 was examined with the following sugars and sugar alco­ hols as substrates: D­ribulose, D­xylulose, D­xylose, D­arabitol, xylitol, ribitol, D­glucose, D­fructose, Fig. 4. SDS­PAGE Analysis of Puriˆed XIF1 and XIF2. D­ribose, D­glycerol, and D­sorbitol. Lanes 1, 3, molecular weight markers; Lane 2, XIF1; Lane 4, XIF2. Results

Construction of an in vitro xylitol production assay system We constructed an assay system for in vitro xylitol production in G. oxydans by combining the mem­ brane fraction and soluble fraction. After 16 h of incubation, 1.5 gWl of xylitol was produced from 10 gWl D­arabitol in this system (Fig. 2). Addition of

CoCl2 to the reaction mixture was found to be essen­ tial for this in vitro xylitol production system. Fur­ thermore, the addition of 3 mgWml of the soluble fraction increased xylitol production to 5.9 gWl, sug­ gesting that some factors increasing xylitol produc­ tion might exist in the soluble fraction of G. oxydans.

Puriˆcation of xylitol­increasing factors from the soluble fraction of G. oxydans The xylitol­increasing factors (XIFs) were puriˆed from the soluble fraction of G. oxydans as described in Material and Methods. By anion exchange column chromatography with Q­Sepharose, two factors were found with xylitol­increasing activity that were eluted at around 400 and 550 mM KCl (Fig. 3). The elution Fig. 5. Deduced Amino Acid Sequence of xif1 (tal­pgi ). proˆle of XDH activity was not identical to the pro­ The NH2­terminal amino acid sequence found in the puriˆed ˆles of these xylitol­increasing activities (data not protein is boxed. The putative transaldolase domain is under­ lined. The putative glucose­6­phosphate isomerase domain is shown), indicating that these xylitol­increasing fac­ wave­underlined. tors are not XDH. We named these factors XIF1 and XIF2, and further puriˆed them. The puriˆed XIF1 and XIF2 appeared as almost single bands on SDS­ Asp­Leu­Val­Leu­Gly­Ile­Asp­Val­Gly­Thr­Gly­Ser­ PAGE, at positions corresponding to 100 kDa and Ala­Arg­Ala­Gly­Leu­Phe­Thr­Leu­Glu­Gly­Leu­

60 kDa, respectively (Fig. 4). The NH2­terminal Lys­Lys­Ala­Ser­Ser­Val. amino acid sequences of the puriˆed XIF1 and XIF2 were found to be as follows: XIF1, Ala­Asp­Thr­ Cloning of the xif1 gene from G. oxydans

Lys­Ser­Asn­Thr­Gly­Leu­Asn­Glu­Val­Gly­Ser­Val­ On the basis of the identiˆed NH2­terminal amino Leu­Arg­Asp­Leu­Glu­Lys­Tyr­Gly; XIF2, Met­ acid sequence, the xif1 gene was cloned. The nucleo­ TransaldolaseWGlucose­6­phosphate Isomerase Complex and Ribulokinase of G. oxydans 2529 tide sequence revealed the presence of a 2871­bp quence of XIF1 (from 17 to 381) showed homology open reading frame encoding a polypeptide of 957 (46z identity) with transaldolase (TAL) from amino acid residues (Fig. 5; DDBJ accession no. Nostoc punctiforme.17) In addition, the C­terminal AB106333). The estimated molecular mass was aminoacidsequenceofXIF1(from434to769) 103 kDa. A computer­aided homology search using showed homology (27z identity) with glucose­6­ BLAST found that the N­terminal amino acid se­ phosphate isomerase (PGI) from Thermotoga mari­ time.18) Extended sequence analysis showed that the tal­pgi gene exists as an operon with two other genes, transketolase (tkt ) and 6­phosphogluconate de­ hydrogenase ( gnd ). (Fig. 6) Further investigation of gnd is described in the accompanying paper.19)

Fig. 6. Structure of the G. oxydans tkt­tal­pgi­gnd Operon. Cloning of the xif2 gene from G. oxydans tkt,transketolase;tal­pgi, transaldolaseWglucose­6­phosphate The xif2 gene was cloned by the same procedure as isomerase bifunctional enzyme; gnd, 6­phosphogluconate for xif1. The nucleotide sequence showed the dehydrogenase. presence of a 1644­bp open reading frame encoding a

Fig. 7. Nucleotide and Deduced Amino Acid Sequences of the xif2 (Ribulokinase) Gene.

The NH2­terminal amino acid sequence found in the puriˆed protein is boxed. A potential ribosome­binding sequence is underlined. 2530 M. SUGIYAMA et al.

Fig. 9. EŠects of His­tagged XIF1 (TAL­PGI) and XIF2 (Ribulokinase) on the in Vitro Xylitol Production Assay. The reaction mixture contained 50 mM KPB (pH 6.0), 10 gWl D­arabitol, 10 mM NAD, 0.5 mg protein Wml soluble fraction,

1mgproteinWml membrane fraction, and 1 mM CoCl2.Theas­ says were done at a ˆnal volume of 300 ml. ä, control; ~, addi­ tion of soluble fraction at a ˆnal concentration of 1.5 mg protein Wml; $, addition of His­tagged XIF1 (TAL­PGI) at a ˆnal concentration of 0.1 mg proteinWml; å, addition of His­tagged XIF2 (ribulokinase) at a ˆnal concentration of 0.05 mg proteinW Fig. 8. Expression and Puriˆcation of His­tagged XIF1 and ml. XIF2 in E. coli. Lane 1, molecular weight marker; Lanes 2, 5, cell­free ex­ tracts of the strain harboring pUC18 (control); Lane 3, cell­free Enzymatic activities of recombinant XIF1 and extract of the strain harboring pUCXIF1; Lane 4, puriˆed His­ XIF2 tagged XIF1; Lane 6, cell­free extract of the strain harboring The catalytic activities of the XIFs were identiˆed. pUCXIF2; Lane 7, puriˆed His­tagged XIF2. Since XIF1 had homology with transaldolase (TAL) and glucose­6­phosphate isomerase (PGI), the TAL polypeptide of 548 amino acid residues (Fig. 7; and PGI activities of the recombinant XIF1 were DDBJ accession no. AB106334). The estimated examined. The recombinant XIF1 had both TAL molecular mass was 59 kDa. A computer­aided activity (10.1 UWmg) and PGI activity (8.6 UWmg), homology search found that the amino acid sequence conˆrming that XIF1 is a TAL­PGI bifunctional of XIF2 had homology (44z identity) witha ribitol enzyme. On the other hand, XIF2 showed homology kinase from E. coli,20) as well as withsome other withsugar kinases. Therefore, sugar kinase activity enzymes belonging to the sugar kinase family. was examined withvarious sugars and sugar alcohols as substrates. Among the substrates tested, XIF2 Conˆrmation of the xylitol­increasing activities of showed 5.1 UWmg D­ribulokinase activity. No activity the puriˆed His­tagged XIFs was observed for other substrates, suggesting that The xif genes were expressed in E. coli as His­ XIF2 is a ribulokinase. tagged proteins, and the His­tagged proteins were puriˆed by using Ni 2{ a‹nity chromatography. Discussion Figure 8 shows SDS­PAGE of the puriˆed recom­ binant XIF1 and XIF2. A band corresponding to In this paper, we found and identiˆed the xylitol­ 100 kDa appeared in the eluate of XIF1 (lane 4), and increasing factors in G. oxydans. Our previous stu­ a 60­kDa band appeared in the eluate of XIF2 (lane dies suggested that enhancement of NADH supply 7). The xylitol­increasing activities of the recom­ was essential for increasing the yield of xylitol from binant XIF1 and XIF2 were conˆrmed in the assay D­arabitol in G. oxydans,8,10) but the NADH genera­ system for in vitro xylitol production. Puriˆed tion mechanism of G. oxydans remained unclear.11–15) recombinant XIF1 and XIF2 were added to the Therefore, in order to investigate the NADH genera­ reaction mixture at 0.1 mg proteinWml and 0.05 mg tion pathway of G. oxydans, we constructed an assay proteinWml, respectively. By the assay system for in system for in vitro xylitol production from D­arabitol vitro xylitol production, 3.8 gWl of xylitol were using the membrane and soluble fractions. Although produced from 10 gWl D­arabitol after incubation for the reason is unclear, the addition of Co 2{ was found 40 h. (Fig. 9) Addition of the puriˆed recombinant to be essential for this assay system. Using this assay XIF1 or XIF2 increased xylitol production to 5.4 gWl system, we found two factors in the soluble fraction respectively. Thus each of the recombinant XIFs of G. oxydans that increased xylitol production in increased xylitol production, showing that the cloned vitro. These two proteins, named XIF1 and XIF2, xif1 and xif2 gene products had xylitol­increasing were puriˆed, and the corresponding genes were activity. isolated and expressed in E. coli. It was found TransaldolaseWGlucose­6­phosphate Isomerase Complex and Ribulokinase of G. oxydans 2531

increase of ‰ux into the PPP from D­arabitol, en­ hancing NADH regeneration. Hahn­H äagerdal et al. reported that TAL and xylulokinase are bottlenecks for the metabolism of D­xylulose through the PPP in Saccharomyces cerevisiae.21,22) They also constructed an in vitro assay system using cell extracts of S. cerevisiae for the analysis of D­xylulose metabolism, and using the in vitro system, they suggested that the increase of TAL activity promoted the carbon ‰ow through the oxida­ tive PPP from D­xylulose, rather than through glycolysis.23) Concerning the D­arabitol methabolism Fig. 10. Putative Scheme of the G. oxydans Pentose Phosphate in G. oxydans, although it is well known that Pathway. Gluconobacter has a membrane­bound AraDH that Enzymes studied in this report are indicated by bold arrows. irreversibly converts D­arabitol to D­xylulose, it TAL, transaldolase; PGI, glucose­6­phosphate isomerase; RK, was also reported that an NAD­dependent soluble ribulokinase; ZWF, glucose­6­phosphate dehydrogenase; GND, 6­phosphogluconate dehydrogenase; TKT, transketolase; D­mannitol dehydrogenase exists in Gluconobacter 24,25) AraDH, membrane­bound D­arabitol dehydrogenase; XDH, that converts D­arabitol to D­ribulose. The in­ xylitol dehydrogenase; MDH, D­mannitol dehydrogenase; PFK, crease in xylitol production by the addition of TAL­ phosphofructokinase; RPE, ribulose­5­phosphate epimerase; PGIor ribulokinase raised the possibility that some RPI, ribose­5­phosphate isomerase; GK, glucokinase; F6P, portion of the substrate D­arabitol was converted to fructose­6­phosphate; S7P, sedoheptulose­7­phosphate; G3P, glyceraldehyde­3­phosphate; E4P, erythrose­4­phosphate. D­ribulose by the system for in vitro xylitol produc­ tion, and further metabolized in the PPP. Further investigation using TAL­PGIand ribulokinase may that XIF1 is a transaldolaseWglucose­6­phosphate clarify the mechanism of these exogenously added isomerase bifunctional enzyme and that XIF2 is a enzymes on the D­arabitol metabolism in the PPP. ribulokinase. In conclusion, we found that the addition of TAL­ To our knowledge, this is the ˆrst report of a single PGIand ribulokinase led to increased xylitol produc­ protein with both transaldolase (TAL) and glucose­ tion from D­arabitol in vitro. Strains with enhanced 6­phosphate isomerase (PGI) activities. Homology TAL­PGIand ribulokinase activities may increase search of the XIF1 amino acid sequence indicated the supply of NADH for improved xylitol production that the NH2­terminal part of XIF1 is the TAL by G. oxydans. domain and the COOH­terminal part is the PGI domain. TAL catalyzes the conversion of sedohep­ References tulose­7­phosphate and glyceraldehyde­3­phosphate to erythrose­4­phosphate and fructose­6­phosphate, 1) Nigam, P., and Singh, D., Processes for fermentative and PGIconverts fructose­6­phosphate to glucose­ production of xylitol. Process Biochem., 30, 117–124 6­phosphate, suggesting that XIF1 could generate (1995). erythrose­4­phosphate and glucose­6­phosphate di­ 2) Emodi, A., Xylitol, its properties and food applica­ rectly from sedoheptulose­7­phosphate and glyceral­ tions. Food Technol., 32, 20–32 (1978). dehyde­3­phosphate. The addition of ribulokinase 3) Pepper, T., and Olinger, P. M., Xylitol in sugar­free confections. Food Technol., 10, 98–106 (1988). also increased xylitol production in vitro. 4) Amaechi, B. T., Higham, S. M., and Edgar, W. M., Ribulokinase catalyzes the phosphorylation of D­ The in‰uence of xylitol and ‰uoride on dental erosion ribulose to D­ribulose­5­phosphate, which is involved in vitro. Arch. Oral Biol., 43, 157–161 (1998). in the pentose phosphate pathway (PPP). All three 5) Makinen, K. K., The rocky road of xylitol to its clini­ oftheseenzymaticactivities,TAL,PGI,and cal application. J. Dent. Res., 79, 1352–1355 (2000). ribulokinase, can be related to the PPP (Fig. 10). 6) Winkelhausen, E., and Kuzmanova, S., Microbial It has been reported that glucose or other carbohy­ conversion of D­xylose to xylitol. J. Ferment. drates in the cytoplasm are metabolized mainly Bioeng., 86, 1–14 (1998). through the PPP in Gluconobacter.11–15) We also 7) Nozaki, H., Suzuki, S., Tsuyoshi, N., and Yokozeki, report in an accompanying paper that both the K., Production of D­arabitol by Metschnikowia glucose­6­phosphate dehydrogenase and 6­phospho­ reukauˆi AJ14787. Biosci. Biotechnol. Biochem., 67, 1923–1929 (2003). gluconate dehydrogenase of G. oxydans can use 8) Suzuki, S., Sugiyama, M., Mihara, Y., Hashi­guchi, both NAD and NADP as coenzymes, indicating that K., and Yokozeki, K., Novel enzymatic method NADH could be regenerated through the PPP in for the production of xylitol from D­arabitol G. oxydans.19) So, the increase of xylitol production by Gluconobacter oxydans. Biosci. Biotechnol. from D­arabitol in vitro by the increase of TAL­PGI Biochem., 66, 2614–2620 (2002). or ribulokinase activities can be explained by the 9) Adachi,O.,Fujii,Y.,Ghaly,M.F.,Toyama,H., 2532 M. SUGIYAMA et al. Shinagawa, E., and Matsushita, K., Membrane­ Richardson, D., Heidelberg, J., Sutton, G. G., bound quinoprotein D­arabitol dehydrogenase of Fleischmann, R. D., Eisen, J. A., and Fraser, C. M., Gluconobacter suboxydans IFO 3257: a versatile Evidence for lateral gene transfer between Archaea enzyme for the oxidative fermentation of various and bacteria from genome sequence of Thermotoga ketoses. Biosci. Biotechnol. Biochem., 65, 2755–2762 maritime. Nature, 399, 323–329 (1999). (2001). 19) Tonouchi, N., Sugiyama, M., and Yokozeki, K., 10) Sugiyama, M., Suzuki, S., Tonouchi, N., and Coenzyme speciˆcity of enzymes in the oxidative pen­ Yokozeki, K., Cloning of the xylitol dehydrogenase tose phosphate pathway of Gluconobacter oxydans. gene from Gluconobacter oxydans and improved Biosci. Biotechnol. Biochem., 67, 2648–2651 (2003). production of xylitol from D­arabitol. Biosci. 20) LaFayette, P. R., and Parrott, W. A., A non­ Biotechnol. Biochem., 67, 584–591 (2003). antibiotic marker for ampliˆcation of plant transfor­ 11) Deppenmeier, U., HoŠmeister, M., and Prust, C., mation vectors in E.coli. Plant Cell Rep., 20, Biochemistry and biotechnological applications of 338–342 (2001). Gluconobacter strains. Appl. Microbial. Biotechnol., 21) Walfridsson, M., Hallborn, J., Penttila, M., 60, 233–242 (2002). Ker äanen, S., and Hahn­H äagerdal, B., Xylose­ 12) Matsushita, K., Toyama, H., and Adachi, O., metabolizing Saccharomyces cerevisiae strain overex­ Respiratory chains and bioenergetics of acetic acid pressing the TKT1 and TAL1 genes encoding the bacteria. Adv. Microb. Physiol., 36, 247–301 (1994). pentose phosphate pathway enzymes transketolase 13) Goodwin, P. M., and Anthony, C., The biochemis­ and transaldolase. Appl. Environ. Microbiol., 61, try, physiology and genetics of PQQ and PQQ­ 4184–4190 (1995). containing enzymes. Adv. Microb. Physiol., 40, 1–80 22) Jeppsson, M., Johansson, B., Hahn­H äagerdal, B., (1998). and Gorwa­Grauslund, M. F., Reduced oxidative 14) Gupta, A., Singh, V., Qazi, G. N., and Kumar, A., pentose phosphate pathway ‰ux in recombinant Gluconobacter oxydans: its biotechnological applica­ xylose­utilizing Saccharomyces cerevisiae strain im­ tions. J. Mol. Microbiol. Biotechnol., 3, 445–456 proves the ethanol yield from xylose. Appl. Environ. (2001). Microbiol., 68, 1604–1609 (2002). 15) Ross, P., Mayer, R., and Benziman, M., Cellulose 23) Senac, T., and Hahn­H äagerdal, B., EŠects of in­ biosynthesis and function in bacteria. Microbial. creased transaldolase activity on D­xylulose and D­ Rev., 55, 35–58 (1991). glucose metabolism in Saccharomyces cerevisiae cell 16) Okumura, H., Uozumi, T., and Beppu, T., Construc­ extracts. Appl. Environ. Microbiol., 57, 1701–1706 tion of plasmid vector and genetic transformation (1991). system for Acetobacter aceti. Agric. Biol. Chem., 49, 24) Adachi, O., Toyama, H., and Matsushita, K., Crys­ 1011–1017 (1985). talline NADP­dependent D­mannitol dehydrogenase 17) Summers, M. L., Meeks, J. C., Chu, S., and Wolf, from Gluconobacter suboxydans IFO 12528. Biosci. R. E. Jr., Nucleotide sequence of an operon in Biotechnol. Biochem., 63, 402–407 (1999). Nostoc sp. strain ATCC 29133 encoding four genes of 25) Adachi, O., Fujii, Y., Ano, Y., Moonmangmee, D., the oxidative pentose phosphate cycle. Plant Physiol., Toyama, H., Shinagawa, E., Theeragool, G., 107, 267–268 (1995). Lotong, N., and Matsushita, K., Membrane­bound 18) Nelson, K. E., Clayton, R. A., Gill, S. R., Gwinn, M. sugar alcohol dehydrogenase in acetic acid bacteria L., Dodson, R. J., Haft, D. H., Hickey, E. K., catalyzes L­ribulose formation and NAD­dependent Peterson, J. D., Nelson, W. C., Ketchum, K. A., ribitol dehydrogenase is independent of the oxidative McDonald, L., Utterback, T. R., Malek, J. A., fermentation. Biosci. Biotechnol. Biochem., 65, Linher, K. D., Garrett, M. M., Stewart, A. M., 115–125 (2001). Cotton, M. D., Pratt, M. S., Phillips, C. A.,