Accessible Morphological and Genetic Markers for Identification of Taioba and Taro, Two Forgotten Human Foods

Home , Colocasia, Eddoe, Xanthosoma sagittifolium

horticulturae

Short Note Accessible Morphological and Genetic Markers for Identiﬁcation of Taioba and Taro, Two Forgotten Human Foods

María Del Pilar Sepúlveda-Nieto 1,2, Fernando Bonifacio-Anacleto 2, Cairo Faleiros de Figueiredo 2,Rômulo M. de Moraes-Filho 2,3 and Ana Lilia Alzate-Marin 2,* ID 1 Centro de Estudios e Investigaciones en Biodiversidad y Biotecnologia Universidad del Quindío-CIBUQ, Armenia Q 630004, Colombia; [email protected] 2 Laboratório de Genética Vegetal, Programa de Pós-graduação do departamento de Genética da Faculdade de Medicina de Ribeirão Preto (FMRP-USP/RP), Ribeirão Preto, SP 14049-900, Brazil; [email protected] (F.B.-A.); [email protected] (C.F.d.F.); romulommﬁ[email protected] (R.M.d.M.-F.) 3 Programa de Pós-graduação em Melhoramento Genético de Plantas, Universidade Federal Rural de Pernambuco (UFRPE), Recife, PE 52171-900, Brazil * Correspondence: [email protected]; Tel.: +55-16-3315-3356

Academic Editor: Douglas D. Archbold Received: 6 September 2017; Accepted: 10 October 2017; Published: 13 October 2017

Abstract: Some tropical species—such as the domesticated Xanthosoma sagittifolium (L.) Schott (Taioba) and Colocasia esculenta (L.) Schott (Taro)—have similar phenotypic characteristics, especially in the shape and color of the leaves and petioles which generate uncertainty in their identification for use in human food. This study aimed to analyze the morphological and molecular characteristics of X. sagittifolium and C. esculenta that may help in the popular and scientific identification of these species. The principal morphological characteristics of X. sagittifolium were as follows: leaves with subcoriaceous textures, basal insertion of the petiole, green pseudo-stem in the basal portion with exudate being white and the presence of two collector veins. Distinctive morphological characteristics of C. esculenta were as follows: leaves with velvety textures, peltate insertion of the petiole, pink pseudo-stem in the basal portion with pink exudate and presence of one collector vein. The morphological characteristics that can be used to distinguish Taioba from Taro are the basal petiole insertion of the first, against the petiole insertion near the center of the blade of the latter. Molecular analyses using eight Inter-Simple Sequence Repeat (ISSR) molecular markers simultaneously showed distinctive fingerprints for each of the species. These results contribute to the proper identification of the species used as a food source.

Keywords: Araceae; plant genetic resources; tannia; cocoyam; ISSR markers; Xanthosoma sagittifolium (L.) Schott; Colocasia esculenta (L.) Schott

1. Introduction The Araceae is a family that consists of 109 genera and approximately 2830 species that are widely distributed, mostly in the tropical, subtropical, and temperate regions of the Northern Hemisphere [1]. The Araceae family is divided into several subfamilies based on the variation of habitats, disposition, and leaf morphology, the structure of the inﬂorescence and pollen, ﬂoral morphology, anatomy, and chromosome number [2]. Economically, the genera Alocasia, Colocasia, and Xanthosoma of this family are important due to their ornamental use or for the starch obtained from their corms [1]. The species Xanthosoma sagittigolium (L.) Schott is exclusively of Neotropical origin; however, it has been introduced in many tropical areas and cultivated as a food plant in developing countries, and it

Horticulturae 2017, 3, 49; doi:10.3390/horticulturae3040049 www.mdpi.com/journal/horticulturae Horticulturae 2017, 3, 49 2 of 8 is found naturalized in many places. Approximately 400 million people worldwide now consume its leaves or corms as a staple food [3,4]. On the other hand, Colocasia esculenta (L.) Schott is a cultivated species native to tropical Asia and naturalized throughout the tropics, and is valued as a rich source of easily digestible protein [3,5]. In Brazil, the leaves of the species X. sagittifolium (taioba) and the rhizomes of C. esculenta (taro), both cultivated by family farmers, are used as food in the states of Minas Gerais and Rio de Janeiro [6]. Despite their importance as an energy-rich food and its increased use, there are only a handful of efforts to market their products in the Americas and West and Central Africa, showing the marginalization of these cultivated species and therefore their status as two neglected crops [3,7]. C. esculenta has been traditionally grown in South and Southeast Asia and the Pacific region as a valuable staple food, where it is commonly known as taro, dasheen, eddoe [5,7], true cocoyam, old cocoyam [8], and poi [9]. X. sagittifolium is referred as yautia and tannia (Caribbean), malanga (Cuba), and cocoyam [9]. In sub-Saharan Africa, both species are known as cocoyam, where their staple root/tuber production ranks third in importance after yam and cassava [7]. There is little information regarding the taxonomy of the above-mentioned cultivated species [3]. Lately, a huge database has been developed aiming at improving the taxonomy of Araceae, including data on chromosome number, morphology, and molecular biology [10]. Molecular studies have been useful in establishing genetic differences between species. One mechanism that has had considerable success in helping to identify different taxa is the use of Inter-Simple Sequence Repeat (ISSR) markers [11]. X. sagittifolium (Taioba) and C. esculenta (Taro) are popularly mistaken for one another [5,7] because of their similar phenotypic characteristics, especially in the form and color of the leaves and petioles, which create uncertainty when they are collected for use as food by humans. The research hypothesis is that both species have enough morphological and molecular features that will aid in their characterization. Therefore, this study aimed at the following: (1) to analyze the morphological characteristics of X. sagittifolium and C. esculenta (Araceae) taxa and highlight those that allow easy differentiation in the field, (2) to evaluate and identify molecular ISSR markers that may help in the identification of these species, and (3) to compare these two species morphologically and molecularly with two additional taxa, Xanthosoma violaceum Schott and Xanthosoma undipes (K.Koch & C.D.Bouché) K.Koch.

2. Materials and Methods Samples of X. sagittifolium and C. esculenta species were obtained from urban (1, 8, 11–14), natural (6, 7), and cultivated (2–5) populations from the states of São Paulo and Minas Gerais (Brazil) (Table1, Figure1). Sample data included the sample number, location where they were collected, georeferenced data (GPS), and collection date (Table1). Additionally, X. violaceum and X. undipes species were also collected from two urban populations to compare morphology and the genetic proﬁle to the target species (Figure1). For molecular analysis, 150 mg of leaf tissue was sampled from each of the 14 specimens and stored at −20 ◦C. DNA was extracted following the protocol proposed by Alzate-Marin et al. [12]. Subsequently, plants were described morphologically according to Acevedo-Rodriguez and Strong [13] (data not shown) and prepared for herbarium material. The exsiccates were deposited in the reference collection of the Herbarium SPFR University of São Paulo, Ribeirão Preto, with the following labels: C. Faleiros, P. Sepulveda, and F. Bonifacio (Table1). Horticulturae 2017, 4, 49 3 of 8

Table 1. Data of specimens studied.

No. Description Herbarium Sample GPS Local/Brazil Collection Date Horticulturae 2017, 3, 49 20°33′21.38″ S 3 of 8 1 X. sagittifolium C. Faleiros 307 Franca/SP 28/05/2013 47°23′56.08″ O 20°34′13.91″ S 2 X. sagittifolium C. Faleiros 308 Abaeté-Franca/SP 03/06/2013 Table 1. Data of47° specimens 20′29.29″ O studied. 20°34′13.91″ S 3 X. sagittifolium - Abaeté-Franca/SP 03/06/2013 No. Description Herbarium Sample47° GPS20′29.29″ O Local/Brazil Collection Date 2020°37◦33021.38”′29.86 S ″ S 4 1X. sagittifoliumX. sagittifolium C. FaleirosC. Faleiros 309 307 Franca/SPItirapua/SP 28/05/201304/06/2013 4747°10◦23056.08”′54.44 O″ O 20◦34013.91” S 2 X. sagittifolium C. Faleiros 308 20°37′29.86″ S Abaeté-Franca/SP 03/06/2013 5 X. sagittifolium - 47◦ 20029.29” O Itirapua/SP 04/06/2013 2047°◦34 10013.91”′54.44 S ″ O 3 X. sagittifolium - Abaeté-Franca/SP 03/06/2013 47◦20°3720029.29”′16.58 O″ S 6 C. esculenta - 20◦37029.86” S Capetinga/MG 04/06/2013 4 X. sagittifolium C. Faleiros 309 47°04′27.15″ O Itirapua/SP 04/06/2013 47◦10054.44” O 2020°37◦37029.86”′16.58 S ″ S 7 5 C. esculentaX. sagittifolium C. Faleiros- 310 Itirapua/SPCapetinga/MG 04/06/201304/06/2013 4747°04◦ 10054.44”′27.15 O″ O 20◦37016.58” S 6 C. esculenta - 21°15′03.13″ S Capetinga/MG 04/06/2013 8 X. sagittifolium Sepúlveda P. 752 47◦04027.15” O Ribeirão Preto/SP 16/06/2013 2047°15◦37016.58”′58.28 S ″ O 7 C. esculenta C. Faleiros 310 Capetinga/MG 04/06/2013 4721°09◦04027.15”′54.85 O ″ S USP-Ribeirão 9 X. undipes - 21◦15003.13” S 17/06/2013 8 X. sagittifolium Sepúlveda P. 752 47°51′40.54″ O Ribeirão Preto/SP 16/06/2013 47◦15058.28” O 2121°09◦09054.85”′54.85 S ″ S USP-Ribeirão 10 9 X. violaceumX. undipes Sepúlveda P.- 749 USP-Ribeirão Preto/SP 17/06/201317/06/2013 4747°51◦51040.54”′40.54 O″ O Preto/SP 21◦09054.85” S 10 X. violaceum Sepúlveda P. 749 20°53′39.78″ S USP-RibeirSãoã Sebastiãoo Preto/SP do 17/06/2013 11 X. sagittifolium F. Bonifacio 110 47◦51040.54” O 16/06/2013 47°00′41.97″ O Paraíso/ MG 20◦53039.78” S 11 X. sagittifolium F. Bonifacio 110 20°53◦ 0 ′42.14″ SS ão SebastiSãoão do Sebastião Paraíso/ MGdo 16/06/2013 12 C. esculenta - 47 00 41.97” O 16/06/2013 2047°00◦53042.14”′28.10 S ″ O Paraíso /MG 12 C. esculenta - ◦ 0 São Sebastião do Paraíso /MG 16/06/2013 4720°5300 28.10”′50.14 O ″S São Sebastião do 20◦53050.14”S 13 13X. sagittifoliumX. sagittifolium - - São Sebastião do Paraíso/ MG 16/06/201316/06/2013 4747°00◦00026.73”′26.73 O″ O Paraíso/ MG 2020°53◦53051.83”′51.83 S ″ S São Sebastião do 14 14X. sagittifoliumX. sagittifolium F. BonifacioF. Bonifacio 111 111 ◦ 0 São Sebastião do Paraíso/MG 16/06/201316/06/2013 4747°0000 16.09”′16.09 O″ O Paraíso/MG

FigureFigure 1.1.Images Images of of populations populations of X.of sagittifoliumX. sagittifolium(A), (C.A), esculenta C. esculenta(B), X. (B violaceum), X. violaceum(C), and (CX.), undipesand X. (undipesD), which (D), correspondwhich correspond to samples to samples 11, 12, 11, 10 12, and 10 and 9, respectively 9, respectively (Source: (Source: Laboratory Laboratory of of PlantPlant Genetics/UniversityGenetics/University of São São Paulo, Campus of Ribeirão Ribeirão Preto, Brazil).

Horticulturae 2017, 3, 49 4 of 8

Horticulturae 2017, 4, 49 4 of 8 For the molecular analyses, 15 ISSR markers were evaluated (UBC 1, 2, 813, 820, 834, 845, 851, 858, 860,For 862, the 864, molecular 866, 885, analyses, 886, 897)15 ISSR according markers towere the evaluated official list(UBC published 1, 2, 813, 820, by the834, University845, 851, of British858, Columbia 860, 862, 864, in Canada 866, 885, (UCB). 886, 897) The according amplification to the productsofficial list werepublished separated by the by University electrophoresis of on 8%British polyacrylamide Columbia in Canada gel. The (UCB). results The wereamplification visualized products by staining were separated with silver by electrophoresis nitrate according on to the protocol8% polyacrylamide of Sanguinetti gel. The et al. results [14]. were Fragments visualized of differentby staining mobilities with silver were nitrate considered according asto differentthe alleles.protocol Estimates of Sanguinetti of the size et ofal. the[14]. resulting Fragments amplification of different mobiliti productses were considered performed as by different comparison alleles. Estimates of the size of the resulting amplification products were performed by comparison with a DNA ladder of 50 base pairs (GE Healthcare, Little Chalfont, UK). The polymorphism obtained with a DNA ladder of 50 base pairs (GE Healthcare, Little Chalfont, UK). The polymorphism by the ISSR technique was tabulated as binary according to the presence (1) or absence (0) of bands. obtained by the ISSR technique was tabulated as binary according to the presence (1) or absence (0) Eachof polymorphic bands. Each polymorphic ISSR band wasISSR considered band was considered a biallelic a locus,biallelic with locus, an with amplifiable an amplifiable allele andallele a null allele.and GenAlEx a null allele. 6.5 softwareGenAlEx [6.515 ]soft wasware used [15] to was generate used to a matrixgenerate of a geneticmatrix of distances genetic distances according to Nei [according16] and Nei’s to Nei genetic [16] and diversity Nei’s genetic (He).ˆ diversity MEGA ( 5Ĥ softwaree). MEGA [517 software] was used [17] towas generate used to generate a dendrogram a of geneticdendrogram similarity of genetic based similarity on the UPGMA based on algorithm.the UPGMA algorithm.

3. Results3. Results and and Discussion Discussion X. sagittifoliumX. sagittifoliumexhibited exhibited white white exudate exudate from from the vegetative the vegetative parts (Figureparts (Figure2A), green 2A), pseudostem green (Figurepseudostem2B), basal (Figure petioles 2B), (Figure basal2 petiolesC), leaves (Figure with 2C), a sagittate leaves with form a (Figure sagittate2D), form two (Figure collecting 2D), veinstwo at collecting veins at the leaf margin (Figure 2E), and subcoriaceus leaf blades. C. esculenta displayed the leaf margin (Figure2E), and subcoriaceus leaf blades. C. esculenta displayed pink or purple exudates pink or purple exudates from the vegetative parts (Figure 3A), pink pseudostem (Figure 3B), peltate from the vegetative parts (Figure3A), pink pseudostem (Figure3B), peltate petioles (Figure3C), velvety petioles (Figure 3C), velvety leaf blades (Figure 3D), and one collecting vein in the margin of the leaf leaf blades(Figure (Figure3E). 3D), and one collecting vein in the margin of the leaf (Figure3E).

FigureFigure 2. Images 2. Images of X. ofsagittifolium X. sagittifolium.(A. )(A The) The white white color color of of exudate exudate in in stem stem (arrow); (arrow); ((BB)) TheThe greengreen color color of the pseudostem (arrow); (C) The basal insertion of the petiole in leaf (arrow); (D) The upper of the pseudostem (arrow); (C) The basal insertion of the petiole in leaf (arrow); (D) The upper leaf and leaf and its sagittate form; (E) The two collecting veins at the leaf margin (arrow) (Source: Laboratory its sagittate form; (E) The two collecting veins at the leaf margin (arrow) (Source: Laboratory of Plant of Plant Genetics/University of São Paulo, Campus of Ribeirão Preto, Brazil). Genetics/University of São Paulo, Campus of Ribeirão Preto, Brazil).

Horticulturae 2017, 3, 49 5 of 8 Horticulturae 2017, 4, 49 5 of 8

Figure 3. Images of C. esculenta. (A) The pink color of exudate in stem (arrow); (B) The pink color of Figure 3. Images of C. esculenta.(A) The pink color of exudate in stem (arrow); (B) The pink color the pseudostem (arrow); (C) The position of the petiole near the center of the leaf blade (arrow); (D) of the pseudostem (arrow); (C) The position of the petiole near the center of the leaf blade (arrow); The upper leaf with a velvety texture; (E) the collecting vein (arrow). (Source: Laboratory of Plant (D) The upper leaf with a velvety texture; (E) the collecting vein (arrow). (Source: Laboratory of Plant Genetics/University of São Paulo, Campus of Ribeirão Preto, Brazil). Genetics/University of São Paulo, Campus of Ribeirão Preto, Brazil). Insertion of the petiole and the purple underside of the leaf blade, the leaves with revolute margins,Insertion purple of the petioles, petiole and and markedly the purple subtri undersideangular basal of thelobes leaf were blade, characteristics the leaves of withX. violaceum revolute margins,(Figure purple 1C). Leaves petioles, with and involute markedly margins, subtriangular the apex broadly basallobes obtuse were to mucron characteristicsate, and green of X. petioles violaceum (Figurewere1 C).features Leaves of X. with undipes involute (Figure margins, 1D). the apex broadly obtuse to mucronate, and green petioles were featuresFor folk of taxonomy,X. undipes the(Figure morphological1D). characteristics that can be used to distinguish Xanthosoma fromFor Colocasia folk taxonomy, species theare from morphological the appreciation characteristics of the basal that petiole can be insertion used to of distinguish the first (FigureXanthosoma 2C), fromagainstColocasia the petiolespecies insertion are from near the the appreciation center of the of theblade basal of the petiole latter insertion (Figure 3C). of the The first results (Figure of the2C), againstmolecular the petiole analyses insertion with the near 15 theISSR center markers of the show blade that of only the latterone primer (Figure 3didC). not The have results any of theamplification molecular analyses products with (UBC the 813), 15 while ISSR markerseight primers show (UBC that 2, only 834, one 845, primer 851, 858, did 860, not 864, have 866) any produced high-resolution profiles that were selected for the next stage (Figure 4A). From these amplification products (UBC 813), while eight primers (UBC 2, 834, 845, 851, 858, 860, 864, 866) amplifications, 334 loci were obtained, with an average of 41.75 loci, varying between 22 (UBC 866) produced high-resolution profiles that were selected for the next stage (Figure4A). From these and 73 (UBC 2) (Table 2). Of these, 321 (96.11%) exhibited polymorphism and 13 (3.89%) were amplifications, 334 loci were obtained, with an average of 41.75 loci, varying between 22 (UBC 866) monomorphic. The results indicated an average of 26.52% genetic diversity among the specimens and 73 (UBC 2) (Table2). Of these, 321 (96.11%) exhibited polymorphism and 13 (3.89%) were that were analyzed (Table 2). monomorphic. The results indicated an average of 26.52% genetic diversity among the specimens that were analyzed (Table2).

Horticulturae 2017, 3, 49 6 of 8 Horticulturae 2017, 4, 49 6 of 8

FigureFigure 4. 4.( A(A)) Non-denatured Non-denatured polyacrylamidepolyacrylamide gel gel (8%) (8%) showing showing the the amplification amplification products products related related to to thethe ISSR ISSR UBC2. UBC2. The The distinctive distinctive fingerprint fingerprint ofof eacheach speciesspecies studiedstudied is shown. Column Column M M corresponds corresponds to ato molecular a molecular weight weight marker marker (GE (GE Healthcare Healthcare 50 50 pb).pb). Lanes 1–5, 1–5, 8–14, 8–14, and and 11 11 (amplified (amplified in duplicate) in duplicate) correspondcorrespond to to the the taxon taxon X.X. sagittifoliumsagittifolium;; channel channel 9 9 corresponds corresponds to to X.X. undipes undipes (amplified(amplified in duplicate), in duplicate), channelchannel 10 10 corresponds corresponds to X. violaceum violaceum (amplified(amplified in induplicate). duplicate). Lanes Lanes 6, 7, 6,and 7, 12 and correspond 12 correspond to C. to C.esculenta esculenta. (Source:. (Source: Laboratory Laboratory of Plant of Plant Genetics/University Genetics/University of São Paulo, of São Campus Paulo, Campusof Ribeirão of Preto, Ribeir ão Brazil); (B) Dendrogram based on the UPGMA algorithm showing the genetic similarity of the Preto, Brazil); (B) Dendrogram based on the UPGMA algorithm showing the genetic similarity of the specimens of the four analyzed species. specimens of the four analyzed species.

Table 2. Characteristics and sequences of the inter-simple sequence repeat (ISSR) primers used in the Table 2. Characteristics and sequences of the inter-simple sequence repeat (ISSR) primers used in the genetic analysis of specimens of four species of Araceae. PL = polymorphic loci, ML = monomorphic genetic analysis of specimens of four species of Araceae. PL = polymorphic loci, ML = monomorphic loci. Ĥe = Nei Genetic Diversity. R = (A,G), Y = (C,T). loci. Heˆ = Nei Genetic Diversity. R = (A,G), Y = (C,T). Primer Sequence 5′–3′ N° of Loci PL ML Ĥe UBC#2Primer GAGAGAGAGAGAGAGATSequence 50–30 N◦ of Loci 73 PL 68 ML 5 He 0.305ˆ UBC#834UBC#2 AGAAGAAGAGAGAGAGYTGAGAGAGAGAGAGAGAT 73 47 68 47 5 0 0.305 0.270 UBC#845UBC#834 CTCTCTCTCTCTCTCTRGAGAAGAAGAGAGAGAGYT 47 36 47 36 0 0 0.270 0.237 UBC#851UBC#845 GTGTGTGTGTGTGTGTYGCTCTCTCTCTCTCTCTRG 36 37 36 36 0 1 0.237 0.301 UBC#851 GTGTGTGTGTGTGTGTYG 37 36 1 0.301 UBC#858UBC#858 TGTGTGTGTGTGTGTGRTTGTGTGTGTGTGTGTGRT 37 37 36 36 1 1 0.244 0.244 UBC#860UBC#860 TGTGTGTGTGTGTGTGRATGTGTGTGTGTGTGTGRA 49 49 45 45 4 4 0.240 0.240 UBC#864UBC#864 ATGATGATGATGATGATGATGATGATGATGATGATG 34 34 33 33 1 1 0.266 0.266 UBC#866 CTCCTCCTCCTCCTCCTC 22 21 1 0.259 UBC#866 CTCCTCCTCCTCCTCCTC 22 21 1 0.259 Total 334 321 (96,11%) 13 (3.89%) - TotalAverage 334 321 (96,11%) 13 (3.89%) 0.2652- Average 0.2652

AA UPGMA UPGMA dendrogram dendrogram was generated based based on on a agenetic genetic similarity similarity matrix matrix (data (data not not shown) shown) whichwhich showed showed groupings groupings ofof thethe differentdifferent species tested tested (Figure (Figure 4B).4B). The The analysis analysis by by ISSR ISSR molecular molecular markersmarkers showed showed lowlow polymorphismpolymorphism among specimens specimens of of X.X. sagittifolium, sagittifolium, whichwhich originated originated from from variousvarious collection collection sites,sites, suggestingsuggesting that these these individuals individuals have have a acommon common origin, origin, possibly possibly due due to to vegetative propagation by producers (Table 3). This result can be illustrated by observing specimens vegetative propagation by producers (Table3). This result can be illustrated by observing specimens 2–3 and 5–8, which came from different localities, (see Table 1, Figure 4A) but showed identical band 2–3 and 5–8, which came from different localities, (see Table1, Figure4A) but showed identical band profiles for all the primers used. Additionally, three specimens of C. esculenta appeared to have proﬁles for all the primers used. Additionally, three specimens of C. esculenta appeared to have higher higher polymorphism than the nine specimens of species X. sagittifolium (Table 3). X. undipes polymorphism than the nine specimens of species X. sagittifolium (Table3). X. undipes exhibited exhibited different electrophoretic profiles regarding the other individuals of the same gender. differentTherefore, electrophoretic it was grouped proﬁles separately regarding from X. the violaceum other individuals and X. sagittifolium of the same. gender. Therefore, it was grouped separately from X. violaceum and X. sagittifolium.

Horticulturae 2017, 3, 49 7 of 8

Table 3. Genetic diversity of specimens of X. sagittifolium and C. esculenta analyzed using ISSR molecular markers.

Species N PL PPL (%) Heˆ X. sagittifolium 9 14 4.19 0.014 C. esculenta 3 86 25.74 0.109 N = number of specimens, PL = number of polymorphic loci, PPL (%) = percent of polymorphic loci, Heˆ = Nei Genetic Diversity.

X. sagittifolium and C. esculenta are the most important species of Araceae, with a nutritional value similar to the potato, with exceptional value for food security [3,4,7,18,19]. The usable parts in both species are the subterranean tuberous stems and the young leaves, especially from X. sagittifolium [3,4,19]. While there are numerous reports with different molecular markers for C. esculenta (e.g., [20–23]), a smaller number were found for X. sagittifolium [24–27] and for both species [25,27]. In this work, we characterized for the first time eight ISSR markers that can be used simultaneously in the genetic analysis of X. sagittifolium and C. esculenta and other related taxa such as X. violaceum and X. undipes, which can aid in characterization and identification. C. esculenta has high genetic diversity with diploid and triploid genotypes spread throughout tropical regions [23,28]. As an allogamous and heterozygous species, natural pollination occurs between C. esculenta diploid plants; however, its asexual propagation by farmers generates clonal lineages [23]. Similarly, despite being an outcrossing species, X. sagittifolium is mostly cultivated by vegetative propagation due to the low viability of seeds produced from natural crosses [3]. Thus, our observations on the diversity of these species are according to their reproductive and cultivation characteristics (Table3). The morphologic and genetic characterization of X. sagittifolium and C. esculenta generated in this study can contribute to their proper identification in field and germplasm banks in Brazil and other places where these species are used as a food source.

Acknowledgments: This study was supported by the Provost for Research of São Paulo University (Ana Lilia Alzate-Marin) and CAPES-PROEX grants. Maria del Pilar Sepulveda Nieto was supported by Universidad del Quindio (Colombia). Romulo Maciel de Moraes-Filho was supported by a graduate and a post-doctoral fellowship from CAPES, and Fernando Bonifacio-Anacleto was supported by scientific initiation scholarship from CNPq (134699/2012-2). Ana Lilia Alzate-Marin was supported by a research assistantship from CNPq (PV 300140/2011-8). Author Contributions: All authors have contributed equally towards the research and the writing of the paper. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Judd, W.S.; Campbell, C.S.; Kellog, E.A.; Stevens, P.F.; Donoghue, M.J. Plant Systematics: A Phylogenetic Approach, 3rd ed.; Sinauer Associates: Sunderland, MA, USA, 2007; pp. 249–251. 2. Grayun, M.H. Evolution and phylogeny of the Araceae. Ann. Mo. Bot. Gard. 1990, 77, 628–697. [CrossRef] 3. Giacometti, D.C.; Leon, J. Tannia, Yautia. In Neglected Crops: 1492 from a Different Perspective; Hernando Bermejo, J.E., León, J., Eds.; Plant Production and Protection Series No. 26; Food and Agricultural Organization of the United Nations: Rome, Italy, 1994; pp. 253–258. 4. Onokpise, O.U.; Wutoh, J.G.; Ndzana, X.; Tambong, J.T.; Meboka, M.M.; Sama, A.E.; Nyochemberg, L.; Guecia, A.; Nzietchueng, S.; Wilson, J.G.; et al. Evaluation of Macabo cocoyam germplasm in Cameroon. In Perspectives on New Crops and New Uses; Janick, J., Ed.; ASHS Press: Alexandria, VA, USA, 1999; pp. 394–396. 5. Onwueme, I. Taro Cultivation in Asia and the Paciﬁc; FAO: Bangkok, Thailand, 1999. 6. MAPA—Ministério da Agricultura, Pecuária e Abastecimento. Manual de Hortaliças Não-Convencionais; Secretaria de Desenvolvimento Agropecuário e Cooperativismo: Brasília, Brasil, 2010. 7. Onyeka, J. Status of Cocoyam (Colocasia esculenta and Xanthosoma spp) in West and Central Africa: Production, Household Importance and the Threat from Leaf Blight. Lima (Peru); CGIAR Research Program on Roots, Tubers and Bananas (RTB): Lima, Peru, 2014. Horticulturae 2017, 3, 49 8 of 8

8. Obidiegwu, J.E.; Kendabie, P.; Obidiegwu, O.; Amadi, C. Towards an Enhanced Breeding in Cocoyam: A Review of Past and Future Research Perspectives. Res. Rev. J. Bot. Sci. 2016, 5, 22–33. 9. O’Hair, S.K. Tropical Root and Tuber Crops. In Advances in New Crops; Janick, J., Simon, J.E., Eds.; Timber Press: Portland, OR, USA, 1990; pp. 424–428. 10. Gonçalves, E.G. The Commonly Cultivated Species of Xanthosoma Schott (Araceae), including Four New Species. Aroideana 2011, 34, 3–23. 11. Zietkiewicz, E.; Rafalski, A.; Labuda, D. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics 1994, 20, 176–183. [CrossRef][PubMed] 12. Alzate-Marin, A.L.; Guidugli, M.C.; Soriani, H.H.; Martinez, C.A.H.; Mestriner, M.A.A. DNA minipreparation procedure suitable for PCR/SSR and RAPD analyses in tropical forest tree species. Braz. Arch. Biol. Technol. 2009, 52, 1217–1224. [CrossRef] 13. Acevedo-Rodriguez, P.; Strong, T.M. Monocotiledons and Gymnosperm of Puerto Rico and the Virgin Island; National Museum of Natural History: Washington, DC, USA, 2005; pp. 30–51. 14. Sanguinetti, C.J.; Dias, E.N.; Simpson, A.J.G. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques 1994, 17, 914–921. [PubMed] 15. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [CrossRef][PubMed] 16. Nei, M. Genetic distance between populations. Am. Nat. 1972, 106, 283–292. [CrossRef] 17. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S.; Nei, M.; Anil, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [CrossRef][PubMed] 18. Lebot, V. Tropical Root and Tuber Crops: Cassava, Sweet Potato, Yams, Aroids; Crop Production Science in Horticulture, 17; CABI: Oxfordshire, UK, 2009; p. 432. 19. Wada, E.; Asfaw, Z.; Feyissa, T.; Tesfaye, K. Farmers’ perception of agromorphological traits and uses of cocoyam (Xanthosoma sagittifolium (L.) Schott) grown in Ethiopia. Afr. J. Agric. Res. 2017, 12, 2681–2691. [CrossRef] 20. Ochiai, T.; Nguyen, V.X.; Tahara, M.; Yoshino, H. Geographical differentiation of Asian taro, Colacasia esculenta (L.) Schott, detected by RAPD and isozyme analyses. Euphytica 2001, 122, 219–234. [CrossRef] 21. Matthews, P.J. Genetic Diversity in Taro, and the Preservation of Culinary Knowledge. Ethnobot. Res. Appl. 2004, 2, 55–71. [CrossRef] 22. Singh, S.; Singh, D.R.; Faseela, F.; Kumar, N.; Damodaran, V.; Srivastava, R.C. Diversity of 21 taro (Colocasia esculenta (L.) Schott) accessions of Andaman Islands. Genet. Resour. Crop Evol. 2012, 59, 821–829. [CrossRef] 23. Chaïr, H.; Traore, R.E.; Duval, M.F.; Rivallan, R.; Mukherjee, A.; Aboagye, L.M.; van Rensburg, W.J.; Andrianavalona, V.; de Carvalho, M.A.A.P.; Saborio, F.; et al. Genetic Diversification and Dispersal of Taro (Colocasia esculenta (L.) Schott). PLoS ONE 2016, 11, e0157712. [CrossRef][PubMed] 24. Offei, S.K.; Asante, I.K.; Danquah, E.Y. Genetic structure of seventy cocoyam (Xanthosoma sagittifolium, Linn, Schott) accessions in Ghana based on RAPD. Hereditas 2004, 140, 123–128. [CrossRef][PubMed] 25. Osawaru, M.E.; Ogwu, M.C. Molecular Characterization of 36 Accessions of Two Genera of Cocoyam (Colocasia [Schott] and Xanthosoma [Schott], Araceae). Sci. Technol. Arts Res. J. 2015, 4, 27–33. [CrossRef] 26. Cathebras, C.; Traore, R.; Malapa, R.; Risterucci, A.M.; Chaïr, H. Characterization of microsatellites in Xanthosoma sagittifolium (Araceae) and cross-amplification in related species. Appl. Plant Sci. 2014, 2, 1400027. [CrossRef][PubMed] 27. Doungous, O.; Kalendar, R.; Adiobo, A.; Schulman, A.H. Retrotransposon molecular markers resolve cocoyam (Xanthosoma sagittifolium) and taro (Colocasia esculenta) by type and variety. Euphytica 2015, 206, 541–554. [CrossRef] 28. Coates, D.J.; Yen, D.E.; Gaffey, P.M. Chromosome variation in taro, Colocasia esculenta: Implications for origin in the Pacific. Cytologia 1988, 53, 551–560. [CrossRef]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).