Pleistocene Range Shifts, Refugia and the Origin of Widespread Species in Western Palaearctic Water Beetles ⇑ David García-Vázquez A, David T

Molecular Phylogenetics and Evolution 114 (2017) 122–136

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier.com/locate/ympev

Pleistocene range shifts, refugia and the origin of widespread species in western Palaearctic water beetles ⇑ David García-Vázquez a, David T. Bilton b, Garth N. Foster c, I. Ribera a, a Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra), Passeig Maritim de la Barceloneta 37, 08003 Barcelona, Spain b Marine Biology and Ecology Research Centre, Plymouth University, Drake Circus, Plymouth PL4 8AA, UK c Aquatic Coleoptera Conservation Trust, 3 Eglinton Terrace, Ayr KA7 1JJ, Scotland, UK article info abstract

Article history: Quaternary glacial cycles drove major shifts in both the extent and location of the geographical ranges of Received 30 January 2017 many organisms. During glacial maxima, large areas of central and northern Europe were inhospitable to Revised 2 June 2017 temperate species, and these areas are generally assumed to have been recolonized during interglacials Accepted 10 June 2017 by range expansions from Mediterranean refugia. An alternative is that this recolonization was from non- Available online 15 June 2017 Mediterranean refugia, in central Europe or western Asia, but data on the origin of widespread central and north European species remain fragmentary, especially for insects. We studied three widely dis- Keywords: tributed lineages of freshwater beetles (the Platambus maculatus complex, the Hydraena gracilis complex, Glacial refugia and the genus Oreodytes), all restricted to running waters and including both narrowly distributed south- Dytiscidae Hydraenidae ern endemics and widespread European species, some with distributions spanning the Palearctic. Our Quaternary glaciations main goal was to determine the role of the Pleistocene glaciations in shaping the diversiﬁcation and cur- Range expansion rent distribution of these lineages. We sequenced four mitochondrial and two nuclear genes in popula- Mediterranean Peninsulas tions drawn from across the ranges of these taxa, and used Bayesian probabilities and Maximum Central Asia Likelihood to reconstruct their phylogenetic relationships, age and geographical origin. Our results suggest that all extant species in these groups are of Pleistocene origin. In the H. gracilis complex, the widespread European H. gracilis has experienced a rapid, recent range expansion from northern Anatolia, to occupy almost the whole of Europe. However, in the other two groups widespread central and northern European taxa appear to originate from central Asia, rather than the Mediterranean. These widespread species of eastern origin typically have peripherally isolated forms in the southern Mediterranean peninsulas, which may be remnants of earlier expansion-diversiﬁcation cycles or result from incipient isolation of populations during the most recent Holocene expansion. The accumulation of narrow endemics of such lineages in the Mediterranean may result from successive cycles of range expansion, with subsequent speciation (and local extinction in glaciated areas) through multiple Pleistocene climatic cycles. Ó 2017 Elsevier Inc. All rights reserved.

1. Introduction conditions, with the repeated fragmentation of populations during glacials and interglacials, have long been hypothesised to have dri- The Quaternary was a period of drastic cyclical climatic ven the origin of most extant Holarctic species (e.g. Rand, 1948; changes, with multiple glacial–interglacial periods, ultimately dri- Mayr, 1970). ven by variations in the earth’s orbit known as Milankovitch cycles. Pleistocene climatic changes were especially drastic in northern Milankovitch–driven climate oscillations led to large changes in latitudes of the Palearctic region, since during the Last Glacial Max- the size and location of the geographic distribution of many spe- imum the European ice sheet covered most areas north of 52°N, cies, in some cases resulting in speciation due to the higher prob- with permafrost north of 47°N(Dawson, 1992). Large areas of cen- ability of isolation of small populations in areas under new tral and northern Europe therefore became inhospitable to temper- selection regimes (Dynesius and Jansson, 2000). These Pleistocene ate taxa during glacials; in stark contrast to the Mediterranean climatic oscillations and the subsequent shifts in ecological peninsulas, which retained more temperate climate and vegetation (e.g. Huntley, 1988; Bennett et al., 1991). However, despite the fact that most of central and northern Europe and regions of Asia at ⇑ Corresponding author. similar latitudes were exposed to extremely cold conditions E-mail address: [email protected] (I. Ribera). (Dawson, 1992), there were areas on the slopes of mountain ranges http://dx.doi.org/10.1016/j.ympev.2017.06.007 1055-7903/Ó 2017 Elsevier Inc. All rights reserved. D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 123 and along river valleys where moister conditions prevailed (Soffer, origin of the western Palaearctic species of these three widely dis- 1990), allowing the local survival of temperate biota in these tributed lineages, to better understand the effects of Quaternary northern/eastern refugia (e.g. Stewart et al., 2009; Schmitt and glacial cycles on their diversification and current distributions. Varga, 2012). Two main scenarios could account for the origin of the current 2. Material and methods central and northern European fauna. Firstly, there is the tradi- tional model of postglacial range expansion from Mediterranean 2.1. Taxonomic background and taxon sampling refugia (e.g. Hewitt, 2000), in which central and northern Europe were colonized by northward range expansions mainly from the 2.1.1. Hydraena gracilis complex Iberian, Italian, Balkan and Anatolian peninsulas at the end of the The genus Hydraena, currently with ca. 900 species distributed last glaciation. According to this model, populations of most Euro- worldwide (Trizzino et al., 2013) is the largest genus within the pean species were confined to refugial areas in southern Mediter- family Hydraenidae and probably the most diverse amongst ranean peninsulas during glacial maxima, from which they would the aquatic Coleoptera (Jäch and Balke, 2008). Within Hydraena, have re-colonized the continent during interglacials (although the ‘‘Haenydra” lineage includes ca. 90 species with a north Hewitt, 2000 also recognised the important role of the Carpathians Mediterranean distribution (Trizzino et al., 2013). They are usually as providing potential refugia). Whilst such a scenario is well found in clean, fast flowing waters, often in mountain streams, established for some taxa, it is not ubiquitous. A second possibility from the Iberian Peninsula to Iran and the Urals, but are absent is that the colonization of central and northern Europe at the end of from North Africa (Ribera et al., 2011; Trizzino et al., 2011, 2013; the Last Glacial was from non-Mediterranean source areas in east- Jäch, 2015). Many species of this lineage have very restricted distri- ern Europe and Asia (Bilton et al., 1998). According to this view, the butions, often limited to a single valley or mountain system, but isolation of the Mediterranean peninsulas during glacial cycles led there are also a few species with very wide geographical ranges. to speciation, preventing gene flow with the new colonisers of cen- In this work we focus on the most widespread species of tral and northern Europe during subsequent interglacials. For taxa ‘‘Haenydra”, Hydraena gracilis Germar and its closest relatives in conforming to this model, southern peninsulas are centres of ende- the H. gracilis complex sensu Jäch (1995), which includes seven mism rather than being a source of colonists (Bilton et al., 1998; recognised species and one subspecies (Trizzino et al., 2013). Schmitt and Varga, 2012). Hydraena gracilis is widely distributed across almost the whole of Such biogeographical isolation of Mediterranean peninsular Europe, ranging from southern France eastwards to Ukraine and populations has been suggested previously for small mammals northwards to Finland, including the British Isles (Fig. 1). Previous (Bilton et al., 1998) and some insects (e.g. Cooper et al., 1995). molecular studies, albeit on a limited number of specimens (Ribera Amongst aquatic Coleoptera, the absence of fossil remains of et al., 2011), suggested that despite its widespread distribution, southern species in the abundant central and northern European genetic differences across its geographic range were minimal. Quaternary subfossil record (Abellán et al., 2011) supports a view Jäch (1995), however, found morphological differences between of Mediterranean peninsulas as areas of endemism, rather than sig- specimens from the Balkans and the rest of Europe, supporting nificant sources of postglacial colonists. Data from extant species the recognition of the subspecies H. gracilis balcanica d’Orchymont. also suggest that current southern endemics have not contributed Hydraena gracilis is absent from the Iberian and Anatolian peninsu- to the diversity of northern areas (e.g. Hydrochus (Hydrochidae), las, where it is replaced by different species of the complex (Fig. 1). Hidalgo-Galiana and Ribera, 2011;orEnicocerus (Hydraenidae), Hydraena gracilidelphis Trizzino, Valladares, Garrido & Audisio is Ribera et al., 2010). Some central and northern European species the westernmost species of this group, endemic to the Iberian may have had their origin in Mediterranean peninsulas, but in such Peninsula (mainly in the north but with some records in the south- cases it appears that the taxa concerned were those whose refugia west) and the French Pyrenees (Trizzino et al., 2012). The Anatolian were located in the northernmost areas of the peninsulas, on the Peninsula and adjacent areas are occupied by three species: margins of deglaciated areas (e.g. Ribera et al., 2010 for Enicocerus, H. anatolica Janssens distributed in northern and eastern Anatolia and García-Vázquez and Ribera, 2016 for Deronectes), successful and parts of the Caucasus and northwestern Iran; H. graciloides expansion possibly being aided by physiological adaptations in Jäch in northern Turkey; and H. crepidoptera Jäch known only from such species (Calosi et al., 2010; Cioffi et al., 2016). two northern Turkish provinces (Kastamonu and Sinop). The other Despite increased understanding of the evolution of the Euro- two species of the complex, H. nike Jäch and H. elisabethae Jäch, pean insect fauna in recent decades, data on the origin of wide- are endemic to two Aegean islands; Samothraky and Thassos spread central and northern European species, which should respectively (Trizzino et al., 2013). have necessarily experienced recent expansions of their geograph- We studied a total of 48 specimens from five of the seven spe- ical ranges, remain severely limited. Here we study a suite of such cies of the H. gracilis complex (we could not obtain fresh specimens species, using molecular phylogeographic data to clarify their tem- of the two Aegean Island endemics) from 37 different localities, poral and geographic origin and to better understand the role of covering the full geographical range of the studied species the Pleistocene glacial cycles in driving their diversification. We (Fig. 1; Table S1). As outgroups we used three closely related spe- examined species groups from three genera of freshwater beetles, cies of the wider H. gracilis lineage within ‘‘Haenydra”(Trizzino in two different families, whose representatives colonized water et al., 2011; Table S1). independently: (1) the Hydraena gracilis complex (‘‘Haenydra” lineage, family Hydraenidae); (2) the Platambus maculatus complex (family Dytiscidae) and (3) Oreodytes sanmarkii (C.R. Sahlberg) 2.1.2. Platambus maculatus complex and O. davisii (Curtis) (family Dytiscidae). All taxa concerned are The genus Platambus contains 66 recognised species (Nilsson typical of running waters, and include both widespread European and Hájek, 2017a) and has a wide distribution, being present in and narrowly distributed southern endemic species (Trizzino the Palearctic, Nearctic, Neotropical and Oriental regions, and is et al., 2013; Nilsson and Hájek, 2017a,b). They do, however, differ currently divided into eight species-groups (Nilsson and Hájek, in functional traits and evolutionary histories (see below), facts 2017a). Amongst these the P. maculatus group - as defined by which contribute to the generality of our conclusions. Nilsson (2001) - is the largest, with 24 species distributed across Using a combination of mitochondrial and nuclear data we Asia and Europe. In a molecular phylogeny of Agabinae Ribera reconstruct the phylogenetic relationships, age and geographical et al. (2004) recovered a paraphyletic Platambus, with the 124 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136

Fig. 1. Distribution of studied species of the Hydraena gracilis complex. White circles, sampled localities.

P. maculatus group separated from other Asian and American elongate species (including O. davisii) versus smaller and rounder species. ones (including O. sanmarkii). Here we focus on the most widespread species of the group; Of the six European species of Oreodytes, the most widespread is P. maculatus (Linnaeus) and its closest relative, P. lunulatus (Fischer O. sanmarkii, distributed over large parts of the Palearctic from the von Waldheim), which we refer to as the Platambus maculatus Iberian Peninsula to the Russian Far East, and reaching the Nearctic complex. Platambus maculatus has a wide Palearctic distribution, in northern Canada (Larson et al., 2000; Nilsson and Hájek, 2017a, from western Iberia to northern Iran and Mongolia (including Italy, 2017b)(Fig. 3). In southern Europe, the species is known from the the Balkans and Anatolia), Scandinavia and the British Isles Iberian Peninsula, northern provinces of Italy and the Balkans (Nilsson and Hájek, 2017b; Fig. 2). The species has a very variable south to Bulgaria and Macedonia (Fery, 2015; Nilsson and Hájek, elytral pattern, which led to the description of many forms all of 2017b). The species shows a high level of variability in colouration which are currently considered synonyms of P. maculatus over its large distributional range (e.g. Larson, 1990) but only one (Nilsson and Hájek, 2017a,b). Most conspicuous amongst these is subspecies, O. sanmarkii alienus (Sharp), endemic to the Iberian P. maculatus ‘‘graellsi” (Gemminger & Harold) from the northwest Peninsula, is currently recognised (Balke, 1989; Nilsson and and centre of the Iberian Peninsula (Millán et al., 2014). The other Hájek, 2017a, 2017b). Also with a wide Palaearctic distribution is species of the complex, P. lunulatus, is distributed from the Anato- O. davisii, known from the British Isles to Ukraine and the Caucasus, lian Peninsula and parts of the Caucasus and Middle East to Egypt including Scandinavia, the Mediterranean peninsulas and Turkey (Karaman et al., 2008; Nilsson and Hájek, 2017b)(Fig. 2). (Nilsson and Hájek, 2017b)(Fig. 3). In the case of this species an We sequenced 106 specimens from 67 different localities of the Iberian form has also been recognised as a subspecies on morpho- two recognised species of the P. maculatus complex, including the logical grounds, O. davisii rhianae Carr (Carr, 2001; Nilsson and ‘‘graellsi” form (Fig. 2; Table S1). As outgroups we used seven spec- Hájek, 2017a,b). The other European species of Oreodytes are imens from different species of the Platambus maculatus group, as O. septentrionalis (Gyllenhal), distributed from the Iberian deﬁned in Nilsson and Hájek (2017b). Peninsula to eastern Siberia and Mongolia (Nilsson and Hájek, 2017b); O. alpinus (Paykull), with a northern Palearctic distribution, being present from lochs in northern Scotland (Foster, 1992) and 2.1.3. European species of the genus Oreodytes Scandinavia to Kamchatka in the Russian far East (Nilsson and The Holarctic genus Oreodytes Seidlitz contains 30 recognised Kholin, 1994); O. meridionalis Binaghi & Sanﬁlippo, endemic to the species, four of them split into two subspecies (Fery, 2015; southern Apennines (Rocchi, 2007; Nilsson and Hájek, 2017b); and Nilsson and Hájek, 2017a). Oreodytes species live in cold streams the recently described O. angelinii Fery from Greece (Fery, 2015). or lakes margins, generally at high altitude or latitude (Balfour- We studied 58 specimens from 35 different localities of all the Browne, 1940; Zack, 1992; Nilsson and Holmen, 1995). The genus European species of Oreodytes with the exception of the Italian is distributed in the Palearctic and Nearctic regions, with six spe- endemic O. meridionalis and the newly described O. angelinii, with cies occurring in Europe. In a previous study, Ribera (2003) recov- a focus on O. davisii and O. sanmarkii and the two Iberian sub- ered a paraphyletic Oreodytes, although with low bootstrap species (O. d. rhianae and O. s. alienus respectively). We also support. Oreodytes was divided into two lineages corresponding included in the analysis 16 specimens of different Asian and to the main distinction in body size and shape, i.e. larger and more American species of the genus as outgroups (Fig. 3; Table S1). D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 125

Fig. 2. Distribution of studied species of the Platambus maculatus complex. White circles, sampled localities.

Fig. 3. Distribution of Oreodytes sanmarkii and Oreodytes davisii in the Western Palearctic. Coloured circles, sampled localities for each species, including also Oreodytes alpinus and Oreodytes septentrionalis. Localities from Mongolia and Siberia for O. sanmarkii and O. alpinus respectively are not show. 126 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136

2.2. DNA extraction and sequencing COI-30 + nad1 and 16S partitions respectively, obtained for the related Leiodidae (Cieslak et al., 2014). Clock rates of H3 and Wg Specimens were collected and preserved in absolute ethanol were left with uniform priors due to the absence of any suitable directly in the field. We extracted the DNA non-destructively with estimations of the evolutionary rate for these nuclear genes. We commercial kits (mostly ‘‘DNeasy Tissue Kit”, Qiagen GmbH, Hil- executed two independent analyses with the same settings, run- den, Germany and ‘‘Charge Switch gDNA Tissue Mini Kit”, Invitro- ning 100 million generations (saving trees every 5000) or until gen, Carlsbad, CA, USA) following the manufacturers’ instructions. analyses converged and the number of trees was sufficient accord- Specimens and DNA extractions are deposited in the collections ing to Effective Sample Size (ESS) values, as measured with Tracer of the Institut de Biología Evolutiva, Barcelona (IBE), Museo Nacio- v1.6 (Rambaut et al., 2014). The maximum clade credibility tree of nal de Ciencias Naturales, Madrid (MNCN) and Natural History the two runs was compiled with Tree Anotator v1.8 (Drummond Museum, London (NHM). We obtained seven gene fragments from et al., 2012) and visualized with FigTree v.1.4.2 (http://tree.bio. six different genes (four mitochondrial and two nuclear) in five dif- ed.ac.uk/software/figtree/). For selection of the best molecular ferent amplification reactions (see Table S2 for primers and typical clock we used the modified Akaike Information Criterion (AICM) sequencing reactions): (1) 50end of the Cytochrome Oxidase Subu- with the moments estimator (Baele et al., 2012), as implemented nit 1 gene (the barcode fragment; Hebert et al., 2003, COI-50); (2) in Tracer v1.6, with 1000 bootstrap replicates. 30end of Cytochrome Oxidase Subunit 1 (COI-30); (3) 50end of 16S To test for potential topological discordances between mito- rRNA plus tRNA transfer of Leucine plus 30end of NADH subunit 1 chondrial and nuclear data we analysed the nuclear genes only, (nad1) (16S and nad1respectively); and internal fragments of the applying the best clock and the same settings as in the combined nuclear genes (4) Histone 3 (H3) and (5) Wingless (Wg). Due to (mitochondrial and nuclear) analysis. their lower variability, the nuclear markers were only sequenced We also analysed the combined matrix (mitochondrial and from representative specimens according to geographical and nuclear) using maximum likelihood (ML) methods. ML analyses topological criteria. For each amplification reaction we obtained were performed in RAxML v.7.4.2 (Stamatakis et al., 2008)as both forward and reverse sequences. In some specimens, due to implemented in RAxML GUI v 1.3.1 (Silvestro and Michalak, difficulties in amplification, we used internal primers for the COI- 2012). We selected the best tree out of 100 searches using the 30 sequence, obtaining two fragments of 400 bp each (Table S2). GTR + G as an evolutionary model with the same six partitions as PCR products were purified by standard ethanol precipitation and in the Bayesian analysis. Node support was estimated with 1000 sent to external facilities for sequencing. DNA sequences were bootstrap replicates. assembled and edited using the Geneious 6 software (Biomatters Ltd, Auckland, New Zealand). Ambiguous calls in the nuclear genes 2.4. Demographic analyses were coded as ‘‘N”s. New sequences (561) have been deposited in GenBank with accession numbers LT855666–LT856230 (Table S2). To study population history for each of the three groups separately we estimated the population coalescent model that best fit- 2.3. Phylogenetic and divergence time analyses ted the data. We used the mitochondrial sequences only and no outgroups. In the analysis for the H. gracilis complex we only Edited sequences were aligned with MAFFT v.6 using the G-INS included specimens of H. gracilis and H. anatolica, whilst only spec- algorithm and default values for other parameters (Katoh and Toh, imens of P. maculatus (including the ‘‘graellsi” form) and O. san- 2008). We included sequences obtained from the literature (Gen- markii were included in the analyses for Platambus and Oreodytes Bank and BOLD databases) in some analyses to increase geograph- respectively. The datasets were divided into four partitions, corre- ical coverage and possible genetic variation not covered by our sponding to each mitochondrial gene (COI-50, COI-30, 16S and nad1) sampling. and the same settings used as in the topological analyses, including In the phylogenetic analyses we employed six partitions, corre- 0 0 evolutionary models selected by Partition Finder and the best sponding to the gene fragments COI-5 , COI-3 , 16S, nad1, H3 and molecular clock for each group. To identify the best demographic Wg, and used Partition Finder 1.1.1 (Lanfear et al., 2012) to esti- model we ran four analyses including Constant Size, Exponential mate the best-fitting models of nucleotide substitution for each Growth, Logistic Growth and Expansion Growth coalescence mod- partition separately, using AIC (Akaike Information Criterion). We els. For model selection of the best coalescent analyses we used the considered the two fragments of the COI gene separately due to modified Akaike Information Criterion (AICM) with the moments the uneven taxonomic coverage (Table S1). To infer the phylogeny estimator as implemented in Tracer v1.6, with 1000 bootstrap of the three groups, and estimate divergence dates amongst spe- replicates. We also computed Bayesian skyline plots (Drummond cies, we used Bayesian methods implemented in Beast 1.8 et al., 2005) for each group, to reconstruct variation in effective (Drummond et al., 2012). For the analyses we included both mito- population sizes through time. chondrial and nuclear markers and implemented the closest available evolutionary model to those selected by Partition Finder. We used a Yule speciation model and ran two analyses to determine 3. Results which clock model (strict or lognormal relaxed) best fitted the data. As there are no fossils or unambiguous biogeographic events There were no length differences in protein coding genes, and that could be used to calibrate the phylogeny of the studied groups, the length of ribosomal genes in the ingroup ranged between we applied published estimations of a-priori rates for the same 784–786 bp in the H. gracilis complex and 796–797 bp in the genes in related groups of beetles. For the Platambus maculatus P. maculatus complex and the genus Oreodytes. The best evolution- complex and the genus Oreodytes (both Dytiscidae) we used a rate ary models, as selected by Partition Finder for each individual par- of 0.013 substitutions/site/MY (SD 0.002) for protein coding genes tition (Table S3), were implemented in the Bayesian analysis for and 0.0016 substitutions/site/MY (SD 0.0002) for 16S, obtained for the H. gracilis complex and the species of the genus Oreodytes. In the related family Carabidae for the same combination of mito- the P. maculatus complex, when the more complex models were chondrial protein coding and ribosomal genes (Andújar et al., applied the analyses did not converge adequately for both the 2012). For the Hydraena gracilis complex we used a rate of 0.015 relaxed lognormal and strict clocks, and in consequence we applied and 0.006 substitutions/site/MY (SDs 0.002 and 0.0002) for the an HKY + I + G model to each partition. D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 127

3.1. Hydraena gracilis complex plex was divided into two major clades, one included the Iberian H. gracilidelphis plus all specimens from the easternmost popula- The nucleotide alignment matrix showed no variability in the tions identified as H. anatolica (eastern Anatolia, the Caucasus two nuclear genes, which were therefore excluded from subse- and Iran), and the other was formed by two groups, one containing quent analyses. The analysis using a lognormal relaxed clock did specimens of H. anatolica and H. crepidoptera from northern Turkey not converge adequately so we applied a strict molecular clock and the other with the widespread European H. gracilis, including model. the subspecies H. gracilis balcanica and two Turkish specimens of The ultrametric tree obtained with the combined mitochondrial H. anatolica and H graciloides. In the latter clade, specimens from and nuclear data estimated a recent origin and diversification of the most southeasterly populations occupied basal positions, with the H. gracilis complex at ca. 0.3 Ma (95% confidence interval (c.i.) the more western and northern populations nested within them 0.4–0.2 Ma) (Fig. 4), with strongly supported monophyly. The com- (Fig. 4). The lineage with the eastern specimens of H. anatolica

gracilis AI349_AUS2 gracilis AI368_SUI gracilis AI401_AUS3 gracilis DV246_ALE2 gracilis DV269_ALE4 gracilis AI359_SLK2 gracilis AI332_LAT gracilis AH153_RCHE gracilis RA902_HOL gracilis DV245_SCO gracilis AI393_FRAALP3 H. gracilis gracilis AI1058_ALE2 gracilis RA1217_RUM gracilis AI695_FRAALP2 gracilis DV244_SLO1 gracilis DV270_ALE4 gracilis AI1154_FRAALP1 gracilis DV229_ALE3 gracilis AI403_FRAMC1 gracilis DV228_FRAMC2 gracilis AC25_SCO H. graciloides graciloides 139_TUR gracilis AI333_ENG gracilis RA903_BEL gracilis balcanica AI338_BUL 0.6 0.6 gracilis DV234_MON 1 gracilis DV231_SLO2 gracilis DV230_SLO1 1 anatolica DV282_TUR3 H. anatolica / H. crepidoptera 1 anatolica AI821_TUR3 0.9 anatolica DV281_TUR3 northern Turkey 0.9 crepidoptera 137_TUR anatolica RA720_TUR1 complex anatolica AI802_TUR2 H. gracilis anatolica DV279_TUR1 1 anatolica DV256_AZB1 0.95 H. anatolica anatolica DV280_TUR1 0.7 anatolica DV257_AZB1 East Turkey, Iran, Caucasus anatolica RA741_IRAN 0.8 anatolica DV259_AZB2 anatolica DV258_AZB2 gracilidelphis DV272_ESPGIR 1 gracilidelphis AI510_ESPCAN gracilidelphis AI1012_ESPGIP2 H. gracilidelphis 1 gracilidelphis AI905_ESPLE3 gracilidelphis RA798_FRAPIR gracilidelphis RA29_ESPNA1 gracilidelphis DV271_ESPGIR 1 exasperata AI506 exasperata AI315

Ma 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

Fig. 4. Phylogenetic tree of the Hydraena gracilis complex. Ultrametric tree obtained with BEAST with combined nuclear and mitochondrial sequences and a partition by gene. Numbers on nodes represent Bayesian posterior probabilities higher than 0.5. See Table S1 for details of specimens and localities. Habitus photograph, H. gracilis (Lech Borowiec). 128 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 had a poorly supported position between the two remaining main 3.3. European Oreodytes species clades of the complex, which differed between analyses. Bayesian analysis (Fig. 4) recovered the eastern lineage as sister to the Ibe- A relaxed lognormal clock was preferred over a strict molecular rian H. gracilidelphis, whilst ML analysis (Fig. S1) linked the eastern clock, and was implemented in the Bayesian analyses (Table 1). lineage to the other clade, as sister to H. gracilis and the Turkish Preliminary results showed the existence of two group of species, westernmost populations, but always with low support. one closely related to O. sanmarkii (the O. sanmarkii group) and In the coalescence analyses a constant size model was preferred the other to O. davisii (the O. davisii group), the later including over exponential growth (Table 1) (logistic and expansion models the European O. septentrionalis and O. alpinus. These two clades did not converge adequately). The Bayesian Skyline Plot showed were constrained as monophyletic in subsequent Bayesian analy- a continuous, slight increase in population size, with a marked ses without outgroups. Oreodytes alpinus was nested within increase at ca. 50,000 years BP and a slight decrease towards the O. davisii in the analysis using the combined mitochondrial and present (Fig. 5A). nuclear matrix (Fig. 7), forming a clade with the eastern Palaearctic O. mongolicus (Brinck). In the analysis using only nuclear data, 3.2. Platambus maculatus complex O. alpinus and O. mongolicus were also sisters, but both sister to O. davisii (Fig. S4) The relaxed lognormal was significantly better than the strict Divergence time analysis (Fig. 7) dated the separation between molecular clock, and was therefore implemented in the Bayesian the O. davisii and O. sanmarkii groups to the Oligocene (ca. 27 Ma, analyses (Table 1). The temporal origin of the P. maculatus complex c.i. 36–20 Ma) and diversification within them to the Lower was estimated to be in the Middle Miocene (ca. 12 Ma) (Fig. 6), Miocene (ca. 22 Ma, c.i. 30–15 Ma) for the O. sanmarkii group and although the split between the two extant species (P. maculatus the Middle Miocene for the O. davisii group (ca. 13 Ma, c.i. and P. lunulatus) occurred in the Messinian (ca. 6.5 Ma, c.i. 9.3– 18–10 Ma) (Fig. 7). The sister species of the clades O. davisii + 4.1 Ma). Extant intraspecific variability dates from the Pliocene- O. alpinus + O. mongolicus and O. sanmarkii were the North Pleistocene boundary (2.5–3.5 Ma). The ultrametric tree obtained American O. snoqualmie (Hatch) and O. obesus (LeConte), respec- from Bayesian analysis using the combined mitochondrial and tively. Intraspecific variation in both O. davisii and O. sanmarkii nuclear matrix strongly supported the monophyly of the two was of Pleistocene origin (1.5–2.0 Ma) (Fig. 7). recognised species (Fig. 6). We found no clear phylogeographical signal in O. davisii, irre- Platambus maculatus was divided into three clades, one with spective of the method of analysis (Bayesian or ML). In contrast, specimens with a predominantly western distribution (northern O. sanmarkii was divided into two clades with a clear geographical Spain, France and the British Isles, including specimens from some pattern, one including specimens with an eastern distribution, Scottish lochs, these forming a monophyletic lineage); a second from Mongolia to central Europe, and the other including mainly clade with specimens from easterly populations (central Europe, western specimens, from the Iberian Peninsula, Italy and the Scandinavia, the Balkans, Anatolia and the Middle East); and a British Isles, although also including some individuals from the third clade including specimens of the Iberian ‘‘graellsi” form plus Carpathians. Within the western clade, Iberian populations from P. maculatus from northern Italy and the two sampled specimens the Pyrenees were separated from those from Portugal and central from one of the localities in the Pyrenees (PIR11, Fig. 6; and northwestern Spain, the latter identified as the subspecies Table S1). The relationships between these three lineages were O. sanmarkii alienus. This difference was more pronounced in the not well supported, and varied between analyses. In the Bayesian ML analysis (Fig. S5; although with poor support) and in the anal- analysis using only nuclear markers (Fig. S2), all specimens of ysis using only nuclear data (Fig. S4), which recovered O. s. alienus P. maculatus ‘‘graellsi” plus the northern Italian and PIR11 as sister to remaining O. sanmarkii. P. maculatus were included within the western clade. In the ML In the case of other European species of the group, we found a analysis, on the contrary (Fig. S3), we recovered the northern deep divergence between Mongolian and European specimens of Italian specimens of P. maculatus as sister to all other specimens, O. septentrionalis, estimated to have occurred during the late which were split into three poorly supported groups (western Miocene (ca. 5.6 Ma, c.i. 8.3–3.5 Ma; Fig. 7). clade, eastern clade and the ‘‘graellsi” form plus the PIR11 The expansion growth coalescence model performed better P.maculatus referred to above). than logistic or exponential ones (Table 1); the constant size None of the four coalescence models converged adequately, but model failing to converge adequately. The Bayesian Skyline Plot the Bayesian Skyline Plot showed a nearly constant effective pop- showed that effective population size remained constant until ulation size until ca. 15,000 years BP, with a recent increase relatively recently, with a sharp increase ca. 10,000 years BP (Fig. 5B). (Fig. 5C).

Table 1 Clock and coalescent demographic model comparisons for each group, including AICM values and standard errors (SE). Best AICM value for each pair shown in bold; models that failed to converge adequately in brackets or represented by a dash. Differences <2 units were not considered signiﬁcant.

Group Clock AICM SE Coalescence AICM SE H. gracilis Relaxed [9076.7] [±0.11] Constant 6705.3 ±0.05 Strict 9385.8 ±0.24 Exponential 6717.2 ±0.24 Expansion [6708.5] ±0.26 Logistic – – P. maculatus Relaxed 18568.9 ±0.52 Constant – – Strict 18596.7 ±0.44 Exponential [11173.9] ±19.20 Expansion [9903.9] ±65.07 Logistic – – O. sanmarkii Relaxed 23948.4 ±0.87 Constant – – Strict 23952.8 ±0.56 Exponential 8204.6 ±0.01 Expansion 8200.2 ±0.15 Logistic 8202.3 ±0.13 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 129

Fig. 5. Coalescence Skyline plots of (A) H. gracilis; (B) P. maculatus; (C) Oreodytes sanmarkii. Blue lines represent 95% highest probability density; horizontal axis - time before present (Ma); vertical axis - effective population size (NeT).

4. Discussion such times, remaining populations would have been isolated in refuges, resulting in the divergence of H. gracilidelphis in the Ibe- Our results emphasise the fact that patterns of evolutionary rian Peninsula and H. anatolica, H. graciloides and H. crepidoptera diversification, biogeographical history and range expansion can in Turkey and the Middle East - a scenario consistent with the differ significantly, even when comparing taxa occupying the same model for diversification of this group proposed by Ribera et al. broad habitat type in the same region. The three groups of water (2011). beetles examined here have all diversified during the Plio- On current data it was not possible fully to resolve the relation- Pleistocene, and been subject to the same historical climatic shifts, ships of eastern Anatolian and Iranian populations of H. anatolica, but despite this their colonization history and demography differ which may be the remnants of earlier diversification cycles (as is considerably. the case for H. gracilidelphis in the west) or represent early isolates of the most recent range expansion. The separation between western and eastern populations in H. anatolica suggests that the Ana- 4.1. Hydraena gracilis complex tolian Diagonal, a mountain range running from north-eastern to south-western Anatolia, acts as an effective barrier to gene flow According to our results the H. gracilis complex has a recent, between western and eastern regions, a pattern observed in many Pleistocene origin, with the widespread H. gracilis showing Turkish taxa (Gündüz et al., 2007). The basal position of northern extreme genetic homogeneity throughout its range. This suggests and central Turkish populations of the H. gracilis group suggests a very recent expansion, in agreement with preliminary results a second range expansion from these areas, crossing the straits to for this and other species of the ‘‘Haenydra” lineage (Ribera et al., the Balkans and expanding to western and northern Europe, result- 2011). The existence of narrow endemics around the periphery of ing in the current widespread European H. gracilis. This pattern of the range of the complex, both in the far west (Iberian Peninsula) expansion has been observed in other taxa, including insects (e.g. and east (Anatolia, Azerbaijan and Iran) is consistent with succes- grasshoppers, Korkmaz et al., 2014) suggesting that Anatolia was sive cycles of range expansion within the complex, followed by an important glacial refugium, which contributed to the recolo- local extinctions, most likely during the glacial periods. During nization of Europe in some lineages (Ansell et al., 2011; Hewitt, 130 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136

P .maculatus (western clade)

maculatus RA940_MAC1 maculatus AI140_MON1 maculatus AH85_SLO1 maculatus AH86_POL1 maculatus AH84_CRO1 maculatus DV220_BIE1 maculatus AI1259_GRE1 maculatus AI1153_BUL2 maculatus RA905_BEL2 0.75 1 maculatus DV216_ALE1 maculatus DV219_BIE1 maculatus RA1211_RUM2 maculatus AI671_BUL1 maculatus RA1213_RUM3 1 maculatus RA570_RUM1 maculatus RA569_RUM1 P. maculatus maculatus AI1286_AUS3 maculatus AI318_POL2 (eastern clade) maculatus DV214_BUL1 maculatus RA906_HOL1 0.72 0.52 maculatus RA904_BEL1 maculatus IR708_AUS1 maculatus DV221_BIE1 maculatus DV283_TUR13 maculatus AI1287_AUS4 1 maculatus IR25b_SUE1 maculatus AH89_SUE1 maculatus RA495_TUR7 0.51 1 maculatus AF102_IRAN1 maculatus RA477_TUR7 P. maculatus complex 1 graellsi AI1041_ESPSC4 1 1 graellsi AH88_ESPSC5 graellsi ER28_ESPSC2 0.8 0.9 graellsi AI733_ESPSC1 1 graellsi AI1319_ESPN10 1 maculatus RA920_ESPPIR11 0.7 maculatus RA921_ESPPIR11 P. maculatus “graellsi” 1 maculatus RA541_ITA2 1 maculatus RA542_ITA2 north Italian and maculatus AH191_ITA1 Pyrenean P. maculatus lunulatus AI823_TUR12 lunulatus DV288_TUR15 lunulatus AI780_TUR11 lunulatus DV284_TUR13 1 lunulatus DV285_TUR13 lunulatus DV287_TUR15

1 lunulatus DV286_TUR14 0.52 lunulatus IR655_IRAN2 lunulatus AI890_IRAN2 P. lunulatus 0.52 lunulatus DV218_TUR2 0.98 lunulatus DV255_AZB1 0.77 lunulatus IR509_LIB1 lunulatus AI1045_LIB1 1 lunulatus RA808_TUR9 lunulatus RA36_TUR10 lunulatus RA810_TUR3 0.99 lunulatus DV217_TUR2 Platambus maculatus group lunulatus RA809_TUR6 Ma 12.5 10 7.5 5 2.5 0

Fig. 6. Phylogenetic tree of the Platambus maculatus complex. Ultrametric tree obtained with BEAST with combined nuclear and mitochondrial sequences and a partition by gene. Numbers on nodes represent Bayesian posterior probabilities higher than 0.5. See Table S1 for details of specimens and localities. Habitus photographs, from base to tip, north Italian from, P. maculatus ‘‘graellsi”, north-Scottish form, and typical P. maculatus (dotted lines mark the corresponding specimens). D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 131

maculatus DV241_ESPN1 maculatus DV243_ESPN4 maculatus IR25_ESPN1 maculatus RA619_ESPN3 0.61 maculatus RA618_ESPN3 maculatus AI1017_ESPN8 maculatus AI1046_ESPN4 maculatus DV251_ESPN1 maculatus RA480_ENG3 maculatus RA888_ESPPIR12

1 maculatus DV264_FRA4 0.9 maculatus DV265_FRA4

maculatus RA821_FRA2 0.8 1 maculatus DV226_FRA3 maculatus DV225_FRA3 maculatus AH83_FRA1 maculatus RA791_ESPN7

0.94 maculatus RA789_ESPN7

maculatus RA788_ESPN7 maculatus RA887_ESPPIR12 maculatus DV274_ESPPIR12

0.9 maculatus RA829_ESPN6 maculatus RA830_ESPN6 maculatus DV273_ESPPIR12

1 maculatus RA823_FRA2 maculatus RA822_FRA2 maculatus RA467_SCO4 maculatus RA481_ENG4 maculatus AH71_ESPPIR1 maculatus RA415_ENG1 P .maculatus (western clade) maculatus IR197_ENG1 maculatus RA475_ENG2

0.95 maculatus RA414_ENG1 maculatus RA886_ESPPIR12 maculatus AF138_ESPN1

0.6 maculatus RA465_SCO4 maculatus RA466_SCO4 maculatus DV215_ESPN5 1 maculatus RA828_ESPN6 1 maculatus AH87_ESPN9 maculatus RA600_SCO7 maculatus RA601_SCO7 maculatus RA602_SCO7 north Scottish group maculatus RA536_SCO5 maculatus RA557_SCO6 1 maculatus RA556_SCO6

1 maculatus AI975_SCO3 1 maculatus IR715_SCO3

P. maculatus (eastern clade)

Ma 12.5 10 7.5 5 2.5 0

Fig. 6 (continued)

1996; Rokas et al., 2003). Such expansion from Anatolia to the Bal- 4.2. Platambus maculatus complex kans may have been possible through a substantial decrease in sea level during glacial periods (Aksu et al., 1999; Ergin et al., 2007), Although the precise geographic origin of the P. maculatus com- which resulted in a large part of the Sea of Marmara becoming plex remains uncertain, their closest relatives are distributed in dry land through which terrestrial and freshwater taxa may have eastern and central Asia (Nilsson and Hájek, 2017b). Subsequent dispersed. to the western range expansion from central Asia, one lineage 132 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136

sanmarkii AI1013_ESPN10 sanmarkii AI746_FRAPIR sanmarkii DV222_FRAPIR 0.7 sanmarkii DV223_FRAPIR 1 sanmarkii IR734_FRAPIR sanmarkii DV249_ESPPIR3 sanmarkii AI976_SCO1 1 0.6 1 sanmarkii DV240_SCO2 sanmarkii IR464_WAL sanmarkii AI131_MON3 0.7 sanmarkii RA1209_RUM 1 0.6 sanmarkii DV253_RUM sanmarkii alienus AI1134_POR sanmarkii alienus AI958_ESPSC4 O. sanmarkii alienus sanmarkii alienus AI193_POR 0.8 sanmarkii alienus RA622_ESPN1 1 western clade sanmarkii alienus AI999_ESPN9 0.6 sanmarkii alienus IR735_ESPN6

1 sanmarkii DV236_ITA1 1 sanmarkii DV237_ITA1 sanmarkii IR306_FRAALP1 sanmarkii AI1057_ALE1

O. sanmarkii 1 sanmarkii DV248_ALE1 1 sanmarkii DV268_ALE2

1 sanmarkii DV266_ALE2 sanmarkii DV267_ALE2 sanmarkii DV227_FRAMC 1 sanmarkii DV247_MON1 1 sanmarkii AI1037_BUL sanmarkii DV233_MON1 eastern clade 1 0.8 sanmarkii DV235_MAC2 0.9 sanmarkii AH150_MAC1 sanmarkii AI1014_MONG2 0.9 1 sanmarkii AI973_MONG2 obesus IR452_CANALB O. sanmarkii 1 rhyacophilus IR368_USCAL5 1 rhyacophilus IR367_USCAL5 1 group 0.9 abbreviatus AI932_USCAL1 crassulus IR451_CANALB

1 congruus RA484_USCAL2 1 congruus IR399_USCAL4 1 1 congruus IR434_USWAS congruus IR440_CANBC1 0.9 0.5 congruus IR357_USCAL3 subrotundus RA485_USCAL2 okulovi RA1218_RUS2 davisii rhianae IR297_ESPN5 1 davisii RA1127_ESPN1

0.9 davisii RA621_ESPN1 davisii rhianae ER33_ESPSC3 0.9 davisii rhianae AI685_ESPSC1 davisii DV238_ITA2 0.6 O. alpinus alpinus IR713_SCO1 alpinus AI977_SCO1 1 O. mongolicus mongolicus AI972_MONG2 alpinus AF207_RUS1 1 davisii IR298_ENG 1 davisii DV250_ESPPIR2 davisii DV252_ESPPIR2 O. davisii 0.56 davisii AI283_ESPN9 davisii rhianae AI830_ESPSC2 1 1 1 davisii _DV254_MAC1 davisii AH148_MAC1 1 davisii DV232_MON1

1 davisii IR693_SCO3 0.7 davisii DV239_SCO1

1 davisii AI1127_ESPSUR 1 snoqualmie IR523_CANBC2 O. davisii group snoqualmie IR447_CANALB 1 shorti AI965_MONG1

1 septentrionalis IR695_SCO3 1 septentrionalis AI1062_FRAALP2 1 O. septentrionalis septentrionalis AI974_MONG2 scitulus IR448_CANALB

Ma 25 20 15 10 5 0

Fig. 7. Phylogenetic tree for studied Oreodytes species. Ultrametric tree obtained with BEAST with combined nuclear and mitochondrial sequences and a partition by gene. Numbers on nodes represent Bayesian posterior probabilities higher than 0.5. See Table S1 for details of specimens and localities. Habitus photographs, O. sanmarkii (L. Borowiec) and O. davisii (U. Schmidt). differentiated in Asia Minor and Anatolia, resulting in P. lunulatus, well-supported clades (Fig. 6). An exception here is the uncertain and the other Europe, resulting in P. maculatus. position of specimens from northern Italy and the Iberian ‘‘graellsi” Range expansion in P. maculatus followed a clear geographical form, both of which show appreciable morphological differences in pattern, with western and eastern populations falling into two elytral pattern and sculpture. Northern Italian specimens have long D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 133 been recognised as amongst the largest, most convex and shiny of and the Iberian Oreodytes (see below). In Platambus our data are, this species (Sharp, 1882; Balfour-Browne, 1940)(Figs. 6 and 8), however, inconclusive regarding the origin of these forms, which whilst populations from central Iberia were originally described could have been isolated in the Iberian and Italian Peninsulas as as a distinct species (Agabus glacialis Graells, subsequently changed remnants of an earlier range expansion in the complex, or result to A. graellsi), but then reduced to a variety and finally syn- from incipient isolation during the most recent expansion event. onymised with P. maculatus (Nilsson and Hájek, 2017a,b). They Within the western clade, specimens from some oligotrophic have a more reddish coloration than the typical forms of Scottish lochs, also at the periphery of the species main range, P. maculatus, with a poorly defined colour pattern and a very dense formed a monophyletic lineage. This is most remarkable, as they and deep microsculpture, giving their dorsal surface a dull, rough were, together with P. maculatus ‘‘graellsi” and the northern Italian appearance (Sharp, 1882)(Figs. 6 and 8). Both central Iberian and populations, the only forms highlighted in the monumental revi- north Italian populations are at the periphery of the main range sion of Sharp (1882). Scottish loch animals were described as being of the species, in a situation similar to that for H. gracilidelphis the smallest of the species, flatter in shape, with a duller surface

AB 2 mm

Fig. 8. Habitus of (A) Platambus maculatus, standard form (specimen voucher MNCN-AH71); (B) form ‘‘graellsi” (voucher MNCN-AI733); (C) specimen from north Italy (voucher MNCN-AH191); (D) specimen from the Scottish Lochs (voucher IBE-AI975). See Table S1 for details on the specimens, and Fig. 6, S2 and S3 for the phylogenetic relationships of the specimens. 134 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 and reduced yellow markings on the elytra (Sharp, 1882; Balfour- morphology. Similarly, O. angeliini, from northern Greece, has only Browne, 1940)(Figs. 6 and 8). However, three specimens from Loch been recently recognised as a distinct species by Fery (2015), hav- Eck, with a similar morphology (although with less marked differ- ing been considered within the morphological variability of O. san- ences) were not placed in this clade, but amongst other lineages markii by previous authors. within the wider western clade (Fig. 6; Table S1). We performed additional analyses, including sequences obtained from public 4.4. Concluding remarks: routes of recolonization databases, to identify specimens with similar haplotypes to those of Scottish lochs, and found a single northern Swedish sequence Our results show that for some water beetles, as in many other which nested within the Scottish clade (obtained from Bergsten groups, central and northern Europe were recolonized by range et al., 2012). The external morphology of this specimen was within expansions from peripheral refugia at the end of the last glaciation. the typical range of P. maculatus however, and other beetles from Northern areas of Iberia and Anatolia appear particularly relevant the same locality had similar morphology, and COI haplotypes for the taxa studied here, both as sources of recolonists and as cra- which nested within the western continental lineage. The nuclear dles for recent, narrow-range endemics. In addition to this classic markers used did not have enough resolution to determine if such pattern, however, we also show that some widespread central incongruences are the result of introgression, but in any case our and northern European species originated not around the Mediter- results suggest that some Scottish populations, and perhaps others ranean basin, but in central Asia, although such taxa still have in northern Europe, could be remnants of an early northward range peripherally isolated forms in the southern Mediterranean penin- expansion in P. maculatus. sulas that in some cases possess divergent haplotypes from those in central and northern Europe. Such species may have colonized 4.3. European species of the genus Oreodytes northern areas of the continent from cryptic refugia in central/ eastern Europe or western Asia during the Holocene. Of particular Most species of the genus Oreodytes, including the sister species interest is the possibility of peripheral refugia not only in the of both O. davisii and O. sanmarkii (O. snoqualmie and O. obesus Mediterranean region but also in some areas in the north, as sug- respectively) are distributed in the western United States and gested by the Scottish form of P. maculatus. Canada (Larson, 1990; Larson et al., 2000). The geographical origin Glacial refugia during cold episodes in Europe were not of European taxa therefore seems to have been via range expansion restricted to the three southern peninsulas, as shown by multiple through Beringia and Asia. In the case of O. davisii this expansion examples from the Carpathians (Willis et al., 2000; Deffontaine has not left any apparent phylogeographical structure in the stud- et al., 2005; Kotlík et al., 2006; Sommer and Nadachowski, 2006), ied markers. In the combined analyses (largely driven by mito- and other areas in north and central Europe (Kullman, 1998; chondrial data) O. alpinus and O. mongolicus were nested within Bilton et al., 1998; Stewart and Lister, 2001). Quaternary deposits O. davisii, despite considerable morphological differences between suggest that a woodland zone existed in the southern foothills of these species (Shaverdo and Fery, 2006; Foster and Friday, 2011). the Carpathian mountains and in sheltered valleys at mid eleva- In contrast, the analysis using only nuclear data clearly separated tions, even during the LGM (Lozek, 2006; Willis et al., 2000). More both species from O. davisii, consistent with past mitochondrial easterly areas could have also been involved in the colonization of introgression between populations of these closely related species Europe from Asia, including the Caucasus (Massilani et al., 2016). who are likely to have shared the same broad Pleistocene refugia. Other potential refugia may have been situated in the Urals, the Such a situation has been reported from a number of other taxa northern slopes of the Altai, or the Crimean Peninsula (Grichuk, (e.g. Berthier et al., 2006; Nicholls et al., 2012) including aquatic 1984; Hewitt, 1999; Soffer, 1990) as well parts of the Ukraine beetles (Hidalgo-Galiana et al., 2014; García-Vázquez et al., 2016). and European Russia (Tarnowska et al., 2016). In O. sanmarkii there is a more clearly defined phylogeographic In the case of the species studied here, as with other European structure, with extant western and eastern clades dating from the lotic water beetles (García-Vázquez and Ribera, 2016), interglacial middle Pleistocene. This suggests an early origin of European pop- range expansions did not result in the mixing and homogenisation ulations, with subsequent isolation of these in different eastern of gene pools, but instead drove the isolation and differentiation of and western refugia. Both O. davisii and O. sanmarkii are very cold populations at range edges. All the running water beetle lineages resistant (in the Pyrenees both can be active in winter in partly fro- studied here are relatively weak dispersers compared to most zen streams, I. Ribera unpublished observations), likely able to sur- standing water relatives (Ribera, 2008). All P. maculatus examined vive in relatively high northern latitudes during glacial cycles, by Jackson (1952, 1956) had reduced flight muscles and most stud- something which may have favoured local persistence in cryptic ied specimens of O. sanmarkii have reduced flight muscles, northern refugia (see below). although there is at least one record of a specimen with these fully Similarly to the P. maculatus and H. gracilis complexes, the only developed (Foster et al., 2016). O. davisii and H. gracilis are known recognised forms within O. davisii and O. sanmarkii are the Iberian to fly (Jäch, 1997; Foster et al., 2016) although have been recorded O. davisii rhianae and O. sanmarkii alienus respectively, both occur- doing so relatively rarely. It is interesting, however, that these two ring west and south of the Ebro valley (Balke, 1989; Carr, 2001). In species are the most genetically homogeneous of the species stud- the analysis of nuclear data, and also ML analysis of the combined ied here. This relatively poor dispersal ability begs the question as dataset, the sequenced specimens of O. sanmarkii alienus formed a to how some species are able to expand their ranges to continental monophyletic group, although in a relatively unsupported position scales? The relative genetic homogeneity of widespread species, with respect to other O. sanmarkii. Irrespective of its taxonomic with genetic differentiation only in peripheral isolates, together status it seems that O. sanmarkii alienus is relatively isolated genet- with our coalescence data, suggest rapid range expansions over ically from other European populations, reinforcing the pattern of short temporal windows which may have provided optimal eco- peripheral isolation across the ranges of widespread European logical conditions for movement between habitat patches. Recently taxa. Although difficult to assess without molecular data, the two deglaciated areas are likely to have supported a high density of missing European species of Oreodytes in our study, O. meridionalis lotic environments, something which may have facilitated the and O. angelinii, are also most likely recent peripheral isolates in expansion of these beetles. In the Massif Central, Ponel et al. Mediterranean peninsulas. Thus, O. meridionalis, from the central (2016) found an increase in fossil remains of lotic water beetle spe- and southern Apennines (Rocchi, 2007) was considered to be a syn- cies immediately after the Last Glacial, but also following the onymy of O. davisii by Franciscolo (1979) due to their close external Younger Dryas. This abundance of lotic species was associated with D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136 135 an increase in stream flow resulting from snow melt during the Carr, R., 2001. Oreodytes davisii rhianae subsp. nov. (Coleoptera: Dytiscidae): an rapid warming following these two cold periods. When soil forma- Iberian subspecies distinct from O. davisii davisii (Curtis, 1831). Entomol. Gaz. 52, 183–188. tion and sedimentation transformed the landscape, the abundance Cieslak, A., Fresneda, J., Ribera, I., 2014. Life-history specialization was not an of lotic species decreased in parallel with an increase in lentic taxa evolutionary dead-end in Pyrenean cave beetles. Proc. R. Soc. Lond. B Biol. Sci. (Ponel et al., 2016). If the same habitat succession happened at lar- 281, 20132978. Cioffi, R., Moody, A.J., Millán, A., Billington, R.A., Bilton, D.T., 2016. Physiological ger geographical scales across the continent, it would have facili- niche and geographical range in European diving beetles (Coleoptera: tated rapid range expansions in lotic species living close to the Dytiscidae). Biol. Let. 12, 20160130. margins of deglaciated areas, but only for a short time period. As Cooper, S.J.B., Ibrahim, K.M., Hewitt, G.M., 1995. Postglacial expansion and genome subdivision in the European grasshopper Chorthippus parallelus. Mol. Ecol. 4, conditions changed, many populations are likely to have become 49–60. locally extinct, precipitating the genetic isolation of the remainder Dawson, A.G., 1992. Ice Age Earth: Late Quaternary Geology and Climate. Routledge, and in some their eventual speciation (Ribera et al., 2011). The New York. Deffontaine, V., Libois, R., Kotlík, P., Sommer, R., Nieberding, C., Paradis, E., Searle, J. accumulation of narrowly endemic species in lotic lineages may B., Michaux, J.R., 2005. Beyond the Mediterranean peninsulas: evidence of result from successive cycles of range expansion with subsequent central European glacial refugia for a temperate forest mammal species, the speciation and local extinction in glaciated areas over multiple bank vole (Clethrionomys glareolus). Mol. Ecol. 14, 1727–1739. Pleistocene glacial cycles. Drummond, A.J., Rambaut, A., Shapiro, B., Pybus, O.G., 2005. Bayesian coalescent inference of past population dynamics from molecular sequences. Mol. Biol. Evol. 22, 1185–1192. Acknowledgements Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. Dynesius, M., Jansson, R., 2000. Evolutionary consequences of changes in species’ We thank all the collectors in Table S1 for allowing us to study geographical distributions driven by Milankovitch climate oscillations. Proc. their material, and Ana Izquierdo (MNCN) and Rocío Alonso (IBE) Natl. Acad. Sci. USA 97, 9115–9120. ß ß for laboratory work. We also thank J. Bergsten for providing vou- Ergin, M., Uluadam, E., Sarikavak, K., Keskin, S., Gökasan, E., Tur, H., 2007. Late Quaternary sedimentation and tectonics in the submarine Sßarköy Canyon, cher specimens of Swedish P. maculatus for study, U. Schmidt western Marmara Sea (Turkey). Geol. Soc. Lond. Spec. Publ. 291, 231–257. and L. Borowiec for some of the habitus photographs, and two Fery, H., 2015. Oreodytes angelinii, a new species from north-eastern Greece anonymous Referees for comments. DG-V had a FPI PhD grant from (Coleoptera: Dytiscidae: Hydroporinae). Klapalekiana 51, 39–47. Foster, G.N., 1992. Some aquatic Coleoptera from inner Hordaland, Norway. Fauna the Spanish Government. This work was partially funded by pro- Norv. Ser. B. 39, 63–67. jects CGL2010-15755 and CGL2013-48950-C2-1-P (AEI/FEDER, Foster, G.N., Bilton, D.T., Nelson, B.H., 2016. Atlas of the Predaceous Water Beetles UE) to IR, and the ‘‘Secretaria d’Universitats i Recerca del Departa- (Hydradephaga) of Britain and Ireland. FSC Publications, Telford, UK. Foster, G.N., Friday, L.E., 2011. Key to adults of the water beetles of Britain and ment d’Economia i Coneixement de la Generalitat de Catalunya’’ Ireland (Part 1). Handbook for the Identification of British Insects, vol. 4, Part 5. (project SGR1532). F. Stud. Counc. R. Entomol. Soc. London, London. Franciscolo, M.E., 1979. Fauna d’Italia, Vol. XIV: Coleoptera. Haliplidae, Hygrobiidae, Gyrinidae, Dytiscidae. Edicioni Calderini, Bologna. Appendix A. Supplementary material García-Vázquez, D., Bilton, D.T., Alonso, R., Benetti, C.J., Garrido, J., Valladares, L.F., Ribera, I., 2016. Reconstructing ancient Mediterranean crossroads in Deronectes diving beetles. J. Biogeogr. 43, 1533–1545. Supplementary data associated with this article can be found, in García-Vázquez, D., Ribera, I., 2016. The origin of widespread species in a poor the online version, at http://dx.doi.org/10.1016/j.ympev.2017.06. dispersing lineage (diving beetle genus Deronectes). PeerJ 4, e2514. 007. Grichuk, V.P., 1984. Late Pleistocene vegetation history. In: Velichko, A.A., Wright, H.E., Jr, Barnosky, C.W. (Eds.), Late Quaternary Environments of the Soviet Union. Longman, London, pp. 155–178. _ References Gündüz, I., Jaarola, M., Tez, C., Yeniyurt, C., Polly, P.D., Searle, J.B., 2007. Multigenic and morphometric differentiation of ground squirrels (Spermophilus, Scuiridae, Abellán, P., Benetti, C.J., Angus, R.B., Ribera, I., 2011. A review of Quaternary range Rodentia) in Turkey, with a description of a new species. Mol. Phylogenet. Evol. shifts in European aquatic Coleoptera. Glob. Ecol. Biogeogr. 20, 87–100. 43, 916–935. Aksu, A.E., Hiscott, R.N., Yasßar, D., 1999. Oscillating Quaternary water levels of the Hebert, P.D.N., Ratnasingham, S., de Waard, J.R., 2003. Barcoding animal life: Marmara Sea and vigorous outflow into the Aegean Sea from the Marmara Sea- cytochrome c oxidase subunit 1 divergences among closely related species. Black Sea drainage corridor. Mar. Geol. 153, 275–302. Proc. R. Soc. Lond. B Biol. Sci. 270, S96–S99. Andújar, C., Serrano, J., Gómez-Zurita, J., 2012. Winding up the molecular clock in Hewitt, G.M., 1996. Some genetic consequences of ice ages, and their role in the genus Carabus (Coleoptera: Carabidae): assessment of methodological divergence and speciation. Biol. J. Lin. Soc. 58, 247–276. decisions on rate and node age estimation. BMC Evol. Biol. 12, 1. Hewitt, G.M., 1999. Post-glacial re-colonization of European biota. Biol. J. Lin. Soc. Ansell, S.W., Stenøien, H.K., Grundmann, M., Russell, S.J., Koch, M.A., Schneider, H., 68, 87–112. Vogel, J.C., 2011. The importance of Anatolian mountains as the cradle of global Hewitt, G., 2000. The genetic legacy of the Quaternary ice ages. Nature 405, 907– diversity in Arabis alpina, a key arctic–alpine species. Ann. Bot. 108, 241–252. 913. Baele, G., Lemey, P., Bedford, T., Rambaut, A., Suchard, M.A., Alekseyenko, A.V., 2012. Hidalgo-Galiana, A., Ribera, I., 2011. Late Miocene diversification of the genus Improving the accuracy of demographic and molecular clock model comparison Hydrochus (Coleoptera, Hydrochidae) in the west Mediterranean area. J. while accommodating phylogenetic uncertainty. Mol. Biol. Evol. 29, 2157–2167. Biogeogr. 59, 377–385. Balfour-Browne, F., 1940. British Water Beetles, vol. 2. Ray Society, London. Hidalgo-Galiana, A., Sánchez-Fernández, D., Bilton, D.T., Cieslak, A., Ribera, I., 2014. Balke, M., 1989. Zur identität von Hydroporus alienus Sharp, 1872 (Coleoptera, Thermal niche evolution and geographical range expansion in a species Dytiscidae). Elytron 3, 113–114. complex of western Mediterranean diving beetles. BMC Evol. Biol. 14, 187. Bennett, K.D., Tzedakis, P.C., Willis, K.J., 1991. Quaternary refugia of north European Huntley, B., 1988. Glacial and Holocene vegetation history: Europe. Veg. Hist., 341– trees. J. Biogeogr. 18, 103–115. 383 Bergsten, J., Bilton, D.T., Fujisawa, T., Elliott, M., Monaghan, M.T., Balke, M., Jäch, M.A., 1995. The Hydraena (Haenydra) gracilis Germar species complex (Insecta: Hendrich, L., Geijer, J., Herrmann, J., Foster, G.N., Ribera, I., Nilsson, A.N., Coleoptera: Hydraenidae). Ann. Naturhist. Mus. Wien 97B, 177–190. Barraclough, T.G., Vogler, A.P., 2012. The effect of geographical scale of sampling Jäch, M.A., 1997. Daytime swarming of rheophilic water beetles in Austria on DNA barcoding. Syst. Biol. 61, 851–869. (Coleoptera: Elmidae, Hydraenidae, Haliplidae). Latissimus 9, 10–11. Berthier, P., Excoffier, L., Ruedi, M., 2006. Recurrent replacement of mtDNA and Jäch, M.A., 2015. Hydraenidae. In: Löbl, I., Löbl, D. (Eds.), Catalogue of Palaearctic cryptic hybridization between two sibling bat species Myotis myotis and Myotis Coleoptera, 2nd ed. vol. 2/1: Hydrophiloidea - Staphylinoidea. Brill, Leiden, pp. blythii. Proc. R. Soc. Lond. B Biol. Sci. 273, 3101–3123. 130–162. Bilton, D.T., Mirol, P.M., Mascheretti, S., Fredga, K., Zima, J., Searle, J.B., 1998. Jäch, M.A., Balke, M., 2008. Global diversity of water beetles (Coleoptera) in Mediterranean Europe as an area of endemism for small mammals rather than a freshwater. Hydrobiologia 595, 419–442. source for northwards postglacial colonization. Proc. R. Soc. Lond. B Biol. Sci. Jackson, D.J., 1952. Observations on the capacity for flight of water beetles. Proc. R. 265, 1219–1226. Ent. Soc. Lond. 27, 57–70. Calosi, P., Bilton, D.T., Spicer, J.I., Votier, S.C., Atfield, A., 2010. What determines a Jackson, D.J., 1956. The capacity for flight of certain water beetles and its bearing on species’ geographical range? Thermal biology and latitudinal range size their origin in the western Scottish isles. Proc. Linn. Soc. Lond. 167, 76–96. relationships in European diving beetles (Coleoptera: Dytiscidae). J. Anim. Karaman, B., Kıyak, S., Darılmaz, M.C., 2008. Faunistic study of the aquatic beetles Ecol. 79, 194–204. (Coleoptera) of Trabzon province (Turkey). Mun. Ent. Zool 3, 437–446. 136 D. García-Vázquez et al. / Molecular Phylogenetics and Evolution 114 (2017) 122–136

Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequence Ribera, I., 2008. Chapter 15: Habitat constraints and the generation of diversity in alignment program. Brief. Bioinform. 9, 286–298. freshwater macroinvertebrates. In: Lancaster, J., Briers, R.A. (Eds.), Aquatic Korkmaz, E.M., Lunt, D.H., Çıplak, B., Deg˘erli, N., Basßıbüyük, H.H., 2014. The Insects: Challenges to Populations. CAB International, UK, pp. 289–311. contribution of Anatolia to European phylogeography: the centre of origin of Ribera, I., Castro, A., Díaz, J.A., Garrido, J., Izquierdo, A., Jach, M.A., Valladares, L.F., the meadow grasshopper, Chorthippus parallelus. J. Biogeogr. 41, 1793–1805. 2011. The geography of speciation in narrow-range endemics of the ‘‘Haenydra” Kotlík, P., Deffontaine, V., Mascheretti, S., Zima, J., Michaux, J.R., Searle, J.B., 2006. A lineage (Coleoptera, Hydraenidae, Hydraena). J. Biogeogr. 38, 502–516. northern glacial refugium for bank voles (Clethrionomys glareolus). Proc. Natl. Ribera, I., Castro, A., Hernando, C., 2010. Ochthebius (Enicocerus) aguilerai sp. n. from Acad. Sci. USA 103, 14860–14864. central Spain, with a molecular phylogeny of the Western Palaearctic species of Kullman, L., 1998. Non-analogous tree flora in the Scandes Mountains, Sweden, Enicocerus (Coleoptera, Hydraenidae). Zootaxa 2351, 1–13. during the early Holocene-macrofossil evidence of rapid geographic spread and Ribera, I., Nilsson, A.N., Vogler, A.P., 2004. Phylogeny and historical biogeography of response to palaeoclimate. Boreas 27, 153–161. Agabinae diving beetles (Coleoptera) inferred from mitochondrial DNA Lanfear, R., Calcott, B., Ho, S.Y.W., Guindon, S., 2012. PartitionFinder: combined sequences. Mol. Phylogenet. Evol. 30, 545–562. selection of partitioning schemes and substitution models for phylogenetic Rocchi, S., 2007. Il genere Oreodytes Seidlitz, 1887 negli Appennini. Onychium 5, 29– analyses. Mol. Biol. Evol. 29, 1695–1701. 33. Larson, D.J., 1990. Oreodytes obesus (Leconte) and O. sanmarkii (CR Sahlberg) Rokas, A., Atkinson, R.J., Webster, L., Csóka, G., Stone, G.N., 2003. Out of Anatolia: (Coleoptera: Dytiscidae) in North America. Coleopt. Bull. 44, 295–303. longitudinal gradients in genetic diversity support an eastern origin for a Larson, D.J., Alarie, Y., Roughley, R.E., 2000. Predaceous Diving Beetles (Coleoptera: circum-Mediterranean oak gallwasp Andricus quercustozae. Mol. Ecol. 12, 2153– Dytiscidae) of the Nearctic Region, With Emphasis on the Fauna of Canada and 2174. Alaska. NRC Research Press, Ottawa. Schmitt, T., Varga, Z., 2012. Extra-Mediterranean refugia: the rule and not the Lozek, V., 2006. Last Glacial paleoenvironments of the West Carpathians in the light exception? Front. Zool. 9, 22. of fossil malacofauna. J. Geol. Sci. Anthropozoic 26, 73–84. Sharp, D., 1882. On aquatic carnivorous Coleoptera or Dytiscidae. Sci. Trans. R. Massilani, D., Guimaraes, S., Brugal, J.P., Bennett, E.A., Tokarska, M., Arbogast, R.M., Dublin Soc. 2, 17–1003. Baryshnikov, G., Boeskorov, G., Castel, J.C., Davydov, S., 2016. Past climate Shaverdo, H.V., Fery, H., 2006. Oreodytes shorti sp.n. from Mongolia (Coleoptera, changes, population dynamics and the origin of Bison in Europe. BMC Biol. 14, Dytiscidae). Koleopterol. Rundschau 76, 35–42. 93. Silvestro, D., Michalak, I., 2012. RAxMLGUI: a graphical front-end for RAxML. Org. Mayr, E., 1970. Populations, Species, and Evolution: An Abridgment of Animal Divers. Evol. 12, 335–337. Species and Evolution. Harvard University Press, Harvard, MA. Soffer, O., 1990. The Russian Plain at the last glacial maximum. In: Soffer, O., Millán, A., Sánchez-Fernández, D., Abellán, P., Picazo, F., Carbonell, J.A., Lobo, J.M., Gamble, C. (Eds.), The World at 18000 BP, High latitudes, vol. 1. Unwin Hyman, Ribera, I., 2014. Atlas De Los Coleópteros Acuáticos En La España Peninsular. London, pp. 228–252. Ministerio de Agricultura, Alimentación y Medio Ambiente, Centro de Sommer, R.S., Nadachowski, A., 2006. Glacial refugia of mammals in Europe: Publicaciones, Madrid. evidence from fossil records. Mamm. Rev. 36, 251–265. Nicholls, J.A., Challis, R.J., Mutun, S., Stone, G.N., 2012. Mitochondrial barcodes are Stamatakis, A., Hoover, P., Rougemont, J., 2008. A rapid bootstrap algorithm for the diagnostic of shared refugia but not species in hybridizing oak gallwasps. Mol. RAxML web-servers. Syst. Biol. 57, 758–771. Ecol. 21, 4051–4062. Stewart, J.R., Lister, A.M., 2001. Cryptic northern refugia and the origins of the Nilsson, A.N., 2001. World catalogue of insects. Volume 3: Dytiscidae (Coleoptera). modern biota. Trends Ecol. Evol. 16, 608–613. Apollo Books, Stenstrup, DK. Stewart, J.R., Lister, A.M., Barnes, I., Dalén, L., 2009. Refugia revisited: individualistic Nilsson, A.N., Hájek, J., 2017a. A World Catalogue of the Family Dytiscidae, or the responses of species in space and time. Proc. R. Soc. Lond. B Biol. Sci. 277, 661– Diving Beetles (Coleoptera, Adephaga). Update distributed as a PDF file via 671. Internet; version 31.I.2017; Available at: . Tarnowska, E., Niedziałkowska, M., Gerc, J., Korbut, Z., Górny, M., Je˛drzejewska, B., Nilsson, A.N., Hájek, J., 2017b. Catalogue of Palearctic Dytiscidae (Coleoptera). 2016. Spatial distribution of the Carpathian and Eastern mtDNA lineages of the Update distributed as a PDF file via Internet; version 1. I. 2017. Available at: bank vole in their contact zone relates to environmental conditions. Biol. J. Lin. . Soc. 119, 732–744. Nilsson, A.N., Holmen, M., 1995. Fauna Entomol. Scandinaviaca V. 32. The Aquatic Trizzino, M., Audisio, P.A., Antonini, G., Mancini, E., Ribera, I., 2011. Molecular Adephaga (Coleoptera) of Fennoscandia and Denmark. II. Dytiscidae. Brill, phylogeny and diversification of the ‘‘Haenydra” lineage (Hydraenidae, genus Leiden. Hydraena), a north-Mediterranean endemic-rich group of rheophilic Coleoptera. Nilsson, A.N., Kholin, S., 1994. The diving beetles (Coleoptera, Dytiscidae) of Mol. Phylogenet. Evol. 61, 772–783. Sakhalin-an annotated checklist. Entomol. Tidskr. 115, 143–156. Trizzino, M., Carnevali, L., De Felici, S., Audisio, P., 2013. A revision of Hydraena Ponel, P., Guiter, F., Gandouin, E., Pailles, C., Rioual, P., Djamali, M., Andrieu-Ponel, V., species of the ‘‘Haenydra” lineage (Coleoptera, Hydraenidae). Zootaxa 3607, 1– Leydet, M., Van der Putten, N., de Beaulieu, J.L., 2016. Novel insights from 173. coleopteran and pollen evidence into the Lateglacial/Holocene transition in Trizzino, M., Valladares, L.F., Garrido, J., Audisio, P., 2012. Morphological reply to a Aubrac, French Massif Central. Palaeogeogr. Palaeoclimatol. Palaeoecol. 463, DNA call: a new cryptic species of Hydraena from western Europe, with a 83–102. complete overview of the Hydraena gracilis complex (Coleoptera: Hydraenidae: Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2014. Tracer v1. 6. 2014. ‘‘Haenydra” lineage). J. Nat. Hist. 46, 1065–1078. Available at . Willis, K.J., Rudner, E., Sümegi, P., 2000. The full-glacial forests of central and Rand, A.L., 1948. Glaciation, an isolating factor in speciation. Evolution 2, 314–321. southeastern Europe. Quat. Res. 53, 203–213. Ribera, I., 2003. Are Iberian endemics Iberian? A case-study using water beetles of Zack, R.S., 1992. Notes on the Genus Oreodytes (Coleoptera: Dytiscidae) in the Pacific family Dytiscidae (Coleoptera). Graellsia 59, 475–502. Northwest. Coleopt. Bull. 46, 151–154. Pleistocene range shifts, refugia and the origin of widespread species in Western Palaearctic water beetles

David García-Vázquez, David T. Bilton, Garth N. Foster & I. Ribera

SUPPLEMENTARY MATERIALS

Supplementary Tables

Table S1. List of the specimens included in the study, with specimen voucher, locality, collector and Genbank accession numbers. In grey, species used as outgroups; in bold, species newly obtained for this study.

Table S2. (A) Primers used for the amplification and sequencing. In brackets, length of the amplified fragment; (B) Standard PCR conditions for the amplification of the studied fragments.

Table S3. Best evolutionary model for each gene as selected by Partition Finder. In square brackets, models that failed to converge and were discarded (see Results).

Supplementary Figures

Figure S1. Phylogenetic tree of the studied species of the Hydraena gracilis complex obtained with RAxML with the combined nuclear and mitochondrial sequences and a partition by gene. Numbers in nodes, Bootstrap support values (when > 50%). See Table S1 for details on the specimens and localities.

Figure S2. Ultrametric tree of the studied species of the Platambus maculatus complex obtained with BEAST using only the nuclear sequence data. Numbers in nodes, Bayesian posterior probabilities (when > 0.5). See Table S1 for details on the specimens and localities.

Figure S3. Phylogenetic tree of the studied species of the Platambus maculatus complex obtained with RAxML with the combined nuclear and mitochondrial sequences and a partition by gene. Numbers in nodes, Bootstrap support values (when > 50). See Table S1 for details on the specimens and localities.

Figure S4. Ultrametric tree of the studied species of Oreodytes obtained with BEAST using only the nuclear sequence data. Numbers in nodes, Bayesian posterior probabilities (when > 0.5). See Table S1 for details on the specimens and localities.

Figure S5. Phylogenetic tree of the studied species of the Oreodytes obtained with RAxML with the combined nuclear and mitochondrial sequences and a partition by gene. Numbers in nodes, Bootstrap support values (when > 50). See Table S1 for details on the specimens and localities.

Pleistocene range shifts, refugia and the origin of widespread species in Western Palaearctic water beetles David García-Vázquez, David T. Bilton, Garth N. Foster, I. Ribera Appendix S1: Additional materials. Table S1.List of the specimens included in the study, with specimen voucher, locality, collector and Genbank accession numbers. In grey, species used as outgroups. In bold, sequences newly obtained for this study. Genes No Species Voucher Country Locality Locality code Coordinates Collector COI-5' COI-3' 16S H3 Wingless 1 Hydraena anatolica IBE-DV256 Azerbaijan Ismayilli, Green House AZB1 40°55'49.9"N 48°3'55.1"E A. Faille, J. Fresneda, I. Ribera& A. Rudoy LT855666 LT855687 LT856113 LT855964 LT855985 2 Hydraena anatolica IBE-DV257 Azerbaijan Ismayilli, Green House AZB1 40°55'49.9"N 48°3'55.1"E A. Faille, J. Fresneda, I. Ribera& A. Rudoy LT855688 3 Hydraena anatolica IBE-DV258 Azerbaijan Lerik AZB2 38°44'2.05"N 48°37'44.28"E A. Faille, J. Fresneda, I. Ribera& A. Rudoy LT855667 LT855689 LT856114 LT855965 4 Hydraena anatolica IBE-DV259 Azerbaijan Lerik AZB2 38°44'2.05"N 48°37'44.28"E A. Faille, J. Fresneda, I. Ribera& A. Rudoy LT855690 5 Hydraena anatolica IBE-DV279 Turkey Erzincan province, Yurtbaşi TUR1 N39º52'25" E38º57'5" I. Ribera LT855691 6 Hydraena anatolica IBE-DV280 Turkey Erzincan province, Yurtbaşi TUR2 N39º52'25" E38º57'5" I. Ribera LT855692 7 Hydraena anatolica IBE-DV281 Turkey Kastamonu province, Agli TUR3 N41º42’41.5” E33º30’47” I.Ribera LT855693 8 Hydraena anatolica IBE-DV282 Turkey Kastamonu province, Agli TUR3 N41º42’41.5” E33º30’47” I.Ribera LT855694 9 Hydraena anatolica IBE-RA720 Turkey Erzincan province, Yurtbaşi TUR3 N39º52'25" E38º57'5" I. Ribera LT855668 LT855695 LT856115 LT855966 LT855986 10 Hydraena anatolica IBE-RA741 Iran Mazandaran province, Kheiroud Kenar IRAN 36º31'38'N, 51º38'46"E A. Skale LT855669 LT855696 LT856116 LT855967 LT855987 11 Hydraena anatolica MNCN-AI802 Turkey Kastamonu province, Senpazar TUR2 N41º49’38” E33º25’03” I.Ribera LT855670 LT855697 LT856117 LT855968 LT855988 12 Hydraena anatolica MNCN-AI821 Turkey Kastamonu province, Agli TUR3 N41º42’41.5” E33º30’47” I.Ribera LT855698 13 Hydraena crepidoptera MZUR–137 Turkey Kastamonu province, Arpalikbasi TUR4 N41º 53’ 24” E34º 05’ 16” M. Trizzino, A. Biscaccianti & P. Audisio HQ425794 HQ425840 14 Hydraena exasperata MNCN-AI315 Spain Andalucia, Cádiz province, Facinas I. Ribera LT855671 FR773515 FR773520 15 Hydraena exasperata MNCN-AI506 Spain Casatilla y León, Leon, Puerto de Panderrueda L.F. Valladares LT855672 HM588382 HM588526 16 Hydraena gracilidelphis IBE-DV271 Spain Cataluña, Girona province, St. Hilari ESPGIR 41°54'55.5"N 2°30'48.1"E I. Ribera & A. Cieslak LT855673 LT855700 LT856119 LT855969 17 Hydraena gracilidelphis IBE-DV272 Spain Cataluña, Girona province, St. Hilari ESPGIR 41°54'55.5"N 2°30'48.1"E I. Ribera & A. Cieslak LT855701 18 Hydraena gracilidelphis IBE-RA29 Spain Navarra, Goizueta ESPNA1 43º14'04''N, 1º47'51''W A. Castro LT855674 LT855702 19 Hydraena gracilidelphis IBE-RA798 France Languedoc-Rousillon, Pyrenees Orientales, L´Albera FRAPIR N42º27’53.9” E2º54’02.0” I. Ribera & A. Cieslak LT855675 LT855703 LT856120 LT855970 20 Hydraena gracilidelphis MNCN-AI510 Spain Cantabria, Bejes ESPCAN ca. 43°14'28.54"N 4°38'45.02"W L. F. Valladares LT855676 LT855704 LT856121 LT855971 LT855989 21 Hydraena gracilidelphis MNCN-AI905 Spain Castilla y Leon, León province, Pto. de Panderrueda ESPLE3 ca. 43°8'22.62"N 4°56'28.17"W L. F. Valladares LT855677 LT855705 22 Hydraena gracilidelphis MNCN-AI1012 Spain Euskadi, Guipuzcoa province, Oiartzun ESPGIP1 N43º16’10.2” W1º48’20.5” I. Ribera & A. Cieslak LT855678 LT855706 23 Hydraena gracilis IBE-DV228 France Auvergne, Cantal, Laveissière FRAMC2 45°6'55.3"N 2°48'47.4"E I. Ribera & A. Cieslak LT855707 24 Hydraena gracilis IBE-DV229 Germany Sachsen-Anhalt, Harz mountains ALE3 51º43’59.4”N 11º1’56.7”E I. Ribera LT855708 25 Hydraena gracilis IBE-DV230 Slovenia Carniola SLO1 N45º45’57.5” E14º21’40.0” I. Ribera, C. Hernando & A. Cieslak LT855709 26 Hydraena gracilis IBE-DV231 Slovenia Goriška SLO2 N45º54’14.4” E13º54’43.8” I. Ribera, C. Hernando & A. Cieslak LT855710 27 Hydraena gracilis IBE-DV234 Montenegro Savnik MON ca. 42°57'32"N 19°5'31"E D.T. Bilton LT855711 LT856122 LT855972 28 Hydraena gracilis IBE-DV244 Slovenia Carniola SLO1 N45º45’57.5” E14º21’40.0” I. Ribera, C. Hernando & A. Cieslak LT855679 LT855712 LT856123 LT855973 29 Hydraena gracilis IBE-DV245 Scotland Outer hebrides, Barra island SCO ca. 57°0'5.00"N 7°25'57"W D.T. Bilton LT855680 LT855713 LT856124 LT855974 LT855990 30 Hydraena gracilis IBE-DV246 Germany Sachsen-Anhalt, Harz mountains ALE2 N51º48’06.6” E10º43’55.4” I. Ribera & A. Cieslak LT855714 31 Hydraena gracilis IBE-DV269 Germany Baden Württemberg, Eyachmühle ALE4 48°48'30.8"N 8°33'27.1"E I. Ribera & A. Cieslak LT855715 32 Hydraena gracilis IBE-DV270 Germany Baden Württemberg, Eyachmühle ALE4 48°48'30.8"N 8°33'27.1"E I. Ribera & A. Cieslak LT855716 33 Hydraena gracilis IBE-RA902 Netherlands Limburg, Vijlen HOL ca. 50°47'23"N 5°58'13"E G.N. Foster LT855717 LT856125 LT855975 34 Hydraena gracilis IBE-RA903 Belgium Liège province, Heppenbach BEL ca. 50°21'45"N6°13'2"E G.N. Foster LT855718 35 Hydraena gracilis IBE-RA1217 Romania Bacău county, Sălătruc RUM 46.3248N 26.3370E H. Fery LT855719 LT856126 LT855976 36 Hydraena gracilis MNCN-AC25 Scotland Outer hebrides, Barra island SCO ca. 57°0'5.00"N 7°25'57"W D.T. Bilton LT855720 LT856127 37 Hydraena gracilis MNCN-AH153 Czech Republic Bohemia, Podmocky RCHE ca. 49°56'16"N 13°49'57"E J. Statszny LT855721 38 Hydraena gracilis MNCN-AI332 Latvia Gaujas National Park LAT ca. 57°17'56"N 25°1'46"E D.T. Bilton LT855722 LT856128 LT855977 LT855991 39 Hydraena gracilis MNCN-AI333 England (UK) Cumbria, river Irthing ENG ca. 55°1'41"N 2°38'56"W D.T. Bilton LT855681 LT855723 LT856129 LT855978 40 Hydraena gracilis MNCN-AI349 Austria Nieder Österreich, Schwarzenbach AUS2 N48º04’42.4” E15º40’42.9” I. Ribera & A. Cieslak LT855682 LT855724 LT856130 LT855979 41 Hydraena gracilis MNCN-AI359 Slovakia Nizke Tatry Mts., Mahnina river SLK2 ca. 48°57'2"N 19°30'11"E F. Ciampor LT855683 LT855725 LT856131 LT855980 42 Hydraena gracilis MNCN-AI368 Switzerland Oberegg, St. Anton to Wald SUI N47º24’32.2” E9º31’20.6” I. Ribera & A. Cieslak LT855684 LT855726 LT856132 LT855981 43 Hydraena gracilis MNCN-AI393 France Rhone-Alps, Isére, Les Valaises FRAALP3 ca. 45°28'1"N 5° 5'55"E G.N. Foster LT855727 44 Hydraena gracilis MNCN-AI401 Austria Nieder Österreich, Pulkau AUS3 N4842’25.8” E15º47’11.8” I. Ribera & A. Cieslak LT855728 45 Hydraena gracilis MNCN-AI403 France Limousin, Correze, Ambrugeat FRAMC1 ca. 45°25'55"N 2°1'11"E P. Queney LT855685 LT855729 LT856133 LT855982 LT855992 46 Hydraena gracilis MNCN-AI695 France Rhone-Alps, Ain, La Valserine FRAALP2 ca. 46° 7'5"N 5°49'31"E P. Queney LT855730 47 Hydraena gracilis MNCN-AI1058 Germany Sachsen-Anhalt, Harz mountains ALE2 N51º48’06.6” E10º43’55.4” I. Ribera & A. Cieslak LT855686 LT855731 LT856134 LT855983 48 Hydraena gracilis MNCN-AI1154 France Rhone-Alps, Loire, Pavesin FRAALP1 ca. 45°28'34"N 4°39'4"E G.N. Foster LT855732 49 Hydraena gracilis balcanica MNCN-AI338 Bulgaria Rhodope Mountains BUL ca. 41°34'39"N 23°41'35"E D.T. Bilton LT855733 LT856135 LT855984 LT855993 50 Hydraena graciloides MZUR–139 Turkey Bolu province, Yedigöller N.P TUR5 N40º59' 09'' E31º 38'26" M. Trizzino, A. Biscaccianti & P. Audisio HQ425791 HQ425837 51 Oreodytes abbreviatus MNCN-AI932 California (US) El Dorado Co., Placerville USCAL1 A.I. Cognato HF931243 HF931477 LT855994 52 Oreodytes alpinus MNCN-AI977 Scotland (UK) Sutherland, Loch Brora SCO1 ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855735 HF931257 HF931493 LT855995 LT856023 53 Oreodytes alpinus NHM-IR713 Scotland (UK) Sutherland, Loch Brora SCO1 ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855760 LT856137 54 Oreodytes congruus NHM-IR357 California (US) Shasta co., Lake McCumber USCAL3 I. Ribera & A. Cieslak LT855761 LT856138 55 Oreodytes congruus NHM-IR399 California (US) Marin co., Olema Creek USCAL4 I. Ribera & A. Cieslak LT855762 LT856139 56 Oreodytes congruus NHM-IR434 Washington (US) Skagit co., Burlington USWAS I. Ribera & A. Cieslak LT855763 LT856140 57 Oreodytes congruus NHM-IR440 British Columbia (CAN) Rock Creek CANBC1 I. Ribera & A. Cieslak AJ850599 AJ850347 EF670146 58 Oreodytes crassulus NHM-IR451 Alberta (CAN) Lund Breck CANALB I. Ribera & A. Cieslak AJ850600 AJ850348 EF670147 59 Oreodytes davisii IBE-DV232 Montenegro Savnik MON1 ca. 42°57'32"N 19°5'31"E D.T. Bilton LT855736 LT855764 LT856141 LT855996 60 Oreodytes davisii IBE-DV238 Italy Emilia Romagna, Parma province, Bosco-Mucino ITA2 N44º27’18.0” E10º02’25.8” I. Ribera LT855737 LT855765 LT856142 LT855997 61 Oreodytes davisii IBE-DV239 Scotland (UK) Sutherland, Loch Brora SCO1 ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855738 LT855766 LT856143 LT855998 LT856024 62 Oreodytes davisii IBE-DV250 Spain Aragón, Huesca province, Ansó ESPPIR2 ca. 42°45'46"N 0°44'39"W I. Esteban LT855739 LT855767 LT856144 LT855999 LT856025 63 Oreodytes davisii IBE-DV252 Spain Aragón, Huesca province, Ansó ESPPIR2 ca. 42°45'46"N 0°44'39"W I. Esteban LT855768 64 Oreodytes davisii IBE-DV254 Macedonia Mavrovo district, Gari MAC1 ca. 41°29'33"N 20°40'40"E D.T. Bilton LT855740 LT855769 LT856145 LT856000 65 Oreodytes davisii IBE-RA621 Spain Cantabria, Vada ESPN1 43°5'21"N 4°40'31"W L.F. Valladares LT855770 66 Oreodytes davisii IBE-RA1127 Spain Cantabria, Vada ESPN1 43°5'21"N 4°40'31"W L.F. Valladares & D. García LT855741 LT855771 LT856146 LT856001 67 Oreodytes davisii MNCN-AH148 Macedonia Mavrovo district, Gari MAC1 ca. 41°29'33"N 20°40'40"E D.T. Bilton LT855772 68 Oreodytes davisii MNCN-AI283 Spain La Rioja, Posadas ESPN9 N 42º12’36.0” W 3º4’27.8” I. Ribera LT855742 LT855773 LT856147 LT856002 LT856026 69 Oreodytes davisii MNCN-AI1127 Spain Andalucia, Granada province, Sierra Nevada ESPSUR ca. 37°0'30"N 3°15'29"W F.M. Cabezas LT855743 LT855774 LT856148 LT856003 LT856027 70 Oreodytes davisii NHM-IR298 England (UK) Yorkshire, Wheeldale Gill ENG ca. 54°22'53"N 0°46'28"W R. Carr LT855775 LT856149 71 Oreodytes davisii NHM-IR693 Scotland (UK) Easterness, River Druie SCO3 ca. 57°10'28"N 3°49'45"W G.N. Foster LT855776 LT856150 72 Oreodytes davisii rhianae MNCN-AI685 Spain Castilla y León, Avila province, Hoyos del Espino ESPSC1 ca. 40°20'27"N 5°10'18"W H. Fery LT855744 LT855777 LT856151 LT856004 73 Oreodytes davisii rhianae MNCN-AI830 Spain Castilla y León, Avila province, Piedrahita ESPSC2 ca. 40°26'58"N 5°20'19"W H. Fery LT855745 LT855778 74 Oreodytes davisii rhianae NHM-ER33 Spain Castilla y León, Avila province, Gredos ESPSC3 ca. 40°22'6"N 5°6'54"W H. Fery AF309301 AF309244 EF670148 75 Oreodytes davisii rhianae NHM-IR297 Spain Castilla y Leon, León province, river Yuso ESPN5 ca. 43°2'47"N 4°51'1"W R. Carr LT855779 LT856152 76 Oreodytes okulovi IBE-RA1218 Russia 03.09.06 Russia, Tyva, Ungesh River, stream, roiled RUS2 via H. Fery LT855780 LT856005 77 Oreodytes mongolicus MNCN-AI972 Mongolia Ovorhangay, Orkhon's Waterfall MONG2 N46.78742 E101.96022 A.E.Z. Short HF931255 HF931491 LT856006 78 Oreodytes rhyacophilus NHM-IR367 California (US) Trinity co., Rattlesnake Creek USCAL5 I. Ribera & A. Cieslak AJ850604 AJ850352 EF670152 79 Oreodytes rhyacophilus NHM-IR368 California (US) Trinity co., Rattlesnake Creek USCAL5 I. Ribera & A. Cieslak LT855781 LT856153 80 Oreodytes obesus cordillerensis NHM-IR452 Alberta (CAN) Lund Breck, Crownsnest CANALB I. Ribera & A. Cieslak HF931279 HF931516 81 Oreodytes sanmarkii IBE-DV222 France Pyrenees Orientales, Prats de Molló FRAPIR 42°24'34.60"N 2°22'52.10"E Fresneda, Ribera & Cieslak LT855746 LT855782 LT856154 LT856007 LT856028 82 Oreodytes sanmarkii IBE-DV223 France Pyrenees Orientales, Prats de Molló FRAPIR 42°24'34.60"N 2°22'52.10"E Fresneda, Ribera & Cieslak LT855783 83 Oreodytes sanmarkii IBE-DV227 France Auvergne, Cantal, Laveissière FRAMC 45°6'55.3"N 2°48'47.4"E I. Ribera & A. Cieslak LT855747 LT855784 LT856155 LT856008 LT856029 84 Oreodytes sanmarkii IBE-DV233 Montenegro Savnik MON1 ca. 42°57'32"N 19°5'31"E D.T. Bilton LT855785 85 Oreodytes sanmarkii IBE-DV235 Macedonia Tetovo district, Vratnica MAC2 ca. 42°8'1"N 21°7'47"E D.T. Bilton LT855786 86 Oreodytes sanmarkii IBE-DV236 Italy Lombardia, Brescia, val Trompia ITA1 45°39'34"N 9°46'54"E I. Ribera, A. Cieslak & M.Toledo LT855748 LT855787 LT856156 LT856009 LT856030 87 Oreodytes sanmarkii IBE-DV237 Italy Lombardia, Brescia, val Trompia ITA1 45°39'34"N 9°46'54"E I. Ribera, A. Cieslak & M.Toledo LT855788 88 Oreodytes sanmarkii IBE-DV240 Scotland (UK) Sutherland, River Brora SCO2 ca. ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855789 89 Oreodytes sanmarkii IBE-DV247 Montenegro Savnik MON1 ca. 42°57'32"N 19°5'31"E D.T. Bilton LT855790 90 Oreodytes sanmarkii IBE-DV248 Germany Sachsen-Anhalt, Harz mtn, Wernigerode ALE1 N51º48’06.6” E10º43’55.4” I. Ribera & A. Cieslak LT855749 LT855791 LT856157 LT856010 LT856031 91 Oreodytes sanmarkii IBE-DV249 Spain Cataluña, Lleida province, S.J.Torán ESPPIR3 N42º49'33.9" E0º46'44.2" I. Ribera & A. Cieslak LT855792 92 Oreodytes sanmarkii IBE-DV253 Romania Bacău county, Mănăstirea Caşin RUM 46.09319N 26.57051E H. Fery LT855750 LT855793 LT856158 LT856011 LT856032 93 Oreodytes sanmarkii IBE-DV266 Germany Baden Württemberg, Buhlbach ALE2 48°31'58.9"N 8°16'35.4"E I. Ribera & A. Cieslak LT855751 LT855794 LT856159 LT856012 LT856033 94 Oreodytes sanmarkii IBE-DV267 Germany Baden Württemberg, Buhlbach ALE2 48°31'58.9"N 8°16'35.4"E I. Ribera & A. Cieslak LT855795 95 Oreodytes sanmarkii IBE-DV268 Germany Baden Württemberg, Buhlbach ALE2 48°31'58.9"N 8°16'35.4"E I. Ribera & A. Cieslak LT855796 96 Oreodytes sanmarkii IBE-RA1209 Romania Bacău county, Mănăstirea Caşin RUM 46.09319N 26.57051E H. Fery LT855797 97 Oreodytes sanmarkii MNCN-AH150 Macedonia Mavrovo district, Gari MAC1 ca. 41°29'33"N 20°40'40"E D.T. Bilton LT855798 98 Oreodytes sanmarkii MNCN-AI131 Montenegro Crkvine, stream Bistrica MON3 ca. 42°47'18"N 19°26'36"E V. Pesic LT855752 LT855799 LT856160 LT856013 LT856034 99 Oreodytes sanmarkii MNCN-AI746 France Pyrenees Orientales, Prats de Molló FRAPIR 42°24'34.60"N 2°22'52.10"E H. Fery LT855800 100 Oreodytes sanmarkii MNCN-AI973 Mongolia Ovorhangay, Orkhon's Waterfall MONG2 N46.78742 E101.96022 A.E.Z. Short LT855753 LT855801 LT856161 LT856014 LT856035 101 Oreodytes sanmarkii MNCN-AI976 Scotland (UK) Sutherland, Loch Brora SCO1 ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855754 LT855802 LT856162 LT856015 LT856036 102 Oreodytes sanmarkii MNCN-AI1013 Spain Euskadi, Guipuzkoa province, Oiartzun ESPN10 N43º16’10.2” W1º48’20.5” I. Ribera & A. Cieslak LT855803 103 Oreodytes sanmarkii MNCN-AI1014 Mongolia Ovorhangay, Orkhon's Waterfall MONG2 N46.78742 E101.96022 A.E.Z. Short LT855804 104 Oreodytes sanmarkii MNCN-AI1037 Bulgaria Rila mts., Rila village. BUL ca. 42°6'40"N 23°33'9"E D.T. Bilton LT855805 105 Oreodytes sanmarkii MNCN-AI1057 Germany Sachsen-Anhalt, Harz mtn, Wernigerode ALE1 N51º48’06.6” E10º43’55.4” I. Ribera & A. Cieslak LT855806 106 Oreodytes sanmarkii NHM-IR306 France Alpes Maritimes, Moulinet FRAALP1 ca. 43°57'0"N 7°24'58"E I. Ribera & A. Cieslak LT855807 LT856163 107 Oreodytes sanmarkii NHM-IR464 Wales (UK) Pentre-Llyn-Cymmer WAL 53°3'58"N 3°31'54"W I. Ribera LT855808 LT856164 108 Oreodytes sanmarkii NHM-IR734 France Pyrenees Orientales, Prats de Molló FRAPIR 42°24'34.60"N 2°22'52.10"E H. Fery HF931287 HF931524 109 Oreodytes sanmarkii alienus IBE-RA622 Spain Cantabria, Vada ESPN1 43°5'21"N 4°40'31"W L.F. Valladares LT855809 110 Oreodytes sanmarkii alienus MNCN-AI193 Portugal Manteigas, river Zezere POR ca. 40°21'45"N 7°33'17"W I. Ribera LT855810 LT856165 111 Oreodytes sanmarkii alienus MNCN-AI958 Spain Madrid, Puerto de los Cotos ESPSC4 N40º49’59” W3º56’09” I. Ribera & A. Cieslak LT855755 LT855811 LT856166 LT856016 LT856037 112 Oreodytes sanmarkii alienus MNCN-AI999 Spain La Rioja, Posadas ESPN9 N 42º12’36.0” W 3º4’27.8” I. Ribera & G.N. Foster LT855756 LT855812 LT856167 LT856017 LT856038 113 Oreodytes sanmarkii alienus MNCN-AI1134 Portugal Manteigas, river Zezere POR ca. 40°21'45"N 7°33'17"W I. Ribera LT855757 LT855813 LT856168 LT856018 LT856039 114 Oreodytes sanmarkii alienus NHM-IR735 Spain Asturias, Llanes ESPN6 ca. 43°23'34"N 4°56'44"W H. Fery HG915304 LT856169 115 Oreodytes scitulus NHM-IR448 Alberta (CAN) Lund Breck, Crownsnest CANALB I. Ribera & A. Cieslak HF931278 HF931515 116 Oreodytes septentrionalis MNCN-AI974 Mongolia Ovorhangay, Orkhon's Waterfall MONG2 N46.78742 E101.96022 A.E.Z. Short HF931256 HF931492 LT856019 117 Oreodytes septentrionalis MNCN-AI1062 France Alpes Maritimes, Le Suquet FRAALP2 N43º56’29.4”E7º16’57.6” I. Ribera & A. Cieslak LT855758 LT855814 LT856170 LT856020 LT856040 118 Oreodytes septentrionalis NHM-IR695 Scotland (UK) Easterness, River Druie SCO3 ca. 57°10'28"N 3°49'45"W G.N. Foster LT855815 LT856171 119 Oreodytes shorti MNCN-AI965 Mongolia Arkhangay, Bulgan MONG1 N47.11192 E101.01048 A.E.Z. Short HF931252 HF931488 LT856021 120 Oreodytes snoqualmie NHM-IR447 Alberta (CAN) Lund Breck, Crownsnest CANALB I. Ribera & A. Cieslak LT855816 LT856172 121 Oreodytes snoqualmie NHM-IR523 British Columbia (CAN) Hope CANBC2 I. Ribera & A. Cieslak HF931282 HF931519 122 Oreodytes subrotundus IBE-RA485 California (US) Mendocino County, Chadbourne USCAL2 D. Post LT855759 LT855817 LT856173 LT856022 123 Platambus maculatus "graellsi" MNCN-AH88 Spain Castilla La Mancha, Guadalajara province, Cardoso de la Sierra ESPSC4 N41º05'34.3" W3º25'32.1" I. Ribera & A. Cieslak LT855818 HF931142/LM654921 HF931360/LM654809 LM655142 LT856076 124 Platambus maculatus "graellsi" MNCN-AI733 Spain Castilla y León, Ávila province, Sierra de Gredos ESPSC2 N40º20’14” W5º00’48” I. Ribera LT855819 LT855863 125 Platambus maculatus "graellsi" MNCN-AI1041 Spain Madrid, Lozoya ESPSC3 N40º58'9.3"W3º48'00" I. Ribera & A. Cieslak LT855820 LT855864 126 Platambus maculatus "graellsi" MNCN-AI1319 Spain Galicia, Ourense province, Reigada ESPN10 N42º14’39.3” W7º10’57.2” I. Ribera & A. Cieslak LT855821 LT855865 LT856174 LT856041 LT856077 127 Platambus maculatus "graellsi" NHM-ER28 Spain Castilla y León, Ávila province, Sierra de Gredos ESPSC1 ca. 40°21'58"N 5°8'22.48"W H. Fery LT855866 128 Platambus lunulatus IBE-DV217 Turkey Rize province, Ikizdere TUR2 ca. 40°46'28"N 40°33'45"E Ö.K. Erman LT855867 129 Platambus lunulatus IBE-DV218 Turkey Rize province, Ikizdere TUR2 ca. 40°46'28"N 40°33'45"E Ö.K. Erman LT855868 130 Platambus lunulatus IBE-DV255 Azerbaijan Ismayilli, Green House AZB1 40°55'49.9"N 48°3'55.1"E A. Faille, J. Fresneda, I. Ribera& A. Rudoy LT855822 LT855869 LT856175 LT856042 LT856078 131 Platambus lunulatus IBE-DV284 Turkey Balikesir province, Kürendere TUR13 39°18'46.4"N 28°31'56.7"E I. Ribera & A. Cieslak LT855823 LT855870 LT856176 LT856043 LT856079 132 Platambus lunulatus IBE-DV285 Turkey Balikesir province, Kürendere TUR13 39°18'46.4"N 28°31'56.7"E I. Ribera & A. Cieslak LT855871 133 Platambus lunulatus IBE-DV286 Turkey Balikesir province, Asagigöcek TUR14 39°23'46.3"N 28°24'19.8"E I. Ribera & A. Cieslak LT855872 134 Platambus lunulatus IBE-DV287 Turkey Afyonkarahisar province, Kiziloren TUR15 ca. 38°15'39"N 30°7'30"E D.T. Bilton LT855824 LT855873 LT856177 LT856044 LT856080 135 Platambus lunulatus IBE-DV288 Turkey Afyonkarahisar province, Kiziloren TUR15 ca. 38°15'39"N 30°7'30"E D.T. Bilton LT855874 136 Platambus lunulatus IBE-RA36 Turkey Sivas-Tokat provinces border, Çamlibel pass TUR10 ca. 39°57'56"N 36°31'35"E Ö.K. Erman LT855875 LT856178 LT856045 LT856081 137 Platambus lunulatus IBE-RA808 Turkey Erzincan province, Refahiye TUR9 ca. 39°53'42"N 38°46'9"E Ö.K. Erman LT855876 138 Platambus lunulatus IBE-RA809 Turkey Erzurum province, Hamzalar village TUR6 ca. 39°28'2"N 41°15'59"E Ö.K. Erman LT855877 139 Platambus lunulatus IBE-RA810 Turkey Rize province, Rüzgarli village TUR3 ca. 40°46'28"N 40°33'45"E Ö.K. Erman LT855878 LT856179 LT856082 140 Platambus lunulatus MNCN-AI780 Turkey Bolu province,Yeniçaga TUR11 N40º50’49” E32º03’47.5” I. Ribera LT855825 LT855879 LT856180 LT856046 LT856083 141 Platambus lunulatus MNCN-AI823 Turkey Karabuk province, Cayorenguney TUR12 N40º48’23” E32º16’00.5” I. Ribera LT855880 LT856181 142 Platambus lunulatus MNCN-AI890 Iran Fars, Sepidan IRAN2 ca. 30°14'8"N 51°59'46"E K. Elmi & H. Fery LM654922 LM654810 LM655143 LT856084 143 Platambus lunulatus MNCN-AI1045 Lebanon Aral Qadichi LIB1 ca. 33°49'31"N 35°49'2"E A. Dia HF931150 HF931369 LT856085 144 Platambus lunulatus NHM-IR509 Lebanon Aral Qadichi LIB2 ca. 33°49'31"N 35°49'2"E A. Dia LT856182 145 Platambus lunulatus NHM-IR655 Iran Fars province, Sepidan IRAN2 ca. 30°14'8"N 51°59'46"E K. Elmi & H. Fery AY138761 AY138674 146 Platambus maculatus IBE-AF102 Iran Guilan province, Siyahkal IRAN1 ca. 37°8'47"N 49°38'21"E Reza Vafaei via H. Fery LT855881 LT856183 147 Platambus maculatus IBE-AF138 Spain Castilla y León, Burgos province, Pineda de la Sierra ESPN1 ca. 42°13'24"N 3°17'49"W I. Ribera LT855882 148 Platambus maculatus IBE-DV214 Bulgaria Bacevo, Rila mts. BUL1 ca. 41°58'2"N 23°26'21"E D.T. Bilton LT855883 LT856184 LT856047 LT856086 149 Platambus maculatus IBE-DV215 Spain Euskadi, Alava province, Murua ESPN5 ca. 42°58'1"N 2°44'20"W G.N. Foster LT855826 LT855884 150 Platambus maculatus IBE-DV216 Germany Nordrhein-Westfalen, Wrexen ALE1 51º30'42.28"N 8º59'43.50"E R. Müller LT855827 LT855885 LT856185 LT856048 LT856087 151 Platambus maculatus IBE-DV219 Belarus Vitebsk Province, Berezinskiy Biosphere Reserve BIE1 54°41'54.86"N 28°18'1.01"E I. Ribera LT855828 LT855886 LT856186 LT856049 LT856088 152 Platambus maculatus IBE-DV220 Belarus Vitebsk Province, Berezinskiy Biosphere Reserve BIE1 54°41'54.86"N 28°18'1.01"E I. Ribera LT855887 153 Platambus maculatus IBE-DV221 Belarus Vitebsk Province, Berezinskiy Biosphere Reserve BIE1 54°41'54.86"N 28°18'1.01"E I. Ribera LT855888 154 Platambus maculatus IBE-DV225 France Auvergne, Cantal, Laveissière FRA3 45°6'55.3"N 2°48'47.4"E I. Ribera & A. Cieslak LT855829 LT855889 LT856187 LT856089 155 Platambus maculatus IBE-DV226 France Auvergne, Cantal, Laveissière FRA3 45°6'55.3"N 2°48'47.4"E I. Ribera & A. Cieslak LT855890 156 Platambus maculatus IBE-DV241 Spain Castilla y León, Burgos province, Pineda de la Sierra ESPN1 ca. 42°13'24"N 3°17'49"W I. Ribera LT855891 LT856188 LT856050 LT856090 157 Platambus maculatus IBE-DV243 Spain La Rioja, Posadas ESPN4 N 42º12’36.0” W 3º4’27.8” I. Ribera & G.N. Foster LT855892 158 Platambus maculatus IBE-DV251 Spain Castilla y León, Burgos province, Pineda de la Sierra ESPN1 ca. 42°13'24"N 3°17'49"W I. Ribera LT855830 LT855893 LT856189 LT856051 LT856091 159 Platambus maculatus IBE-DV264 France Lorraine, PN Regional Vosgues, Rolbing FRA4 49°10'22.7"N 7°26'29.7"E I. Ribera & A. Cieslak LT855894 160 Platambus maculatus IBE-DV265 France Lorraine, PN Regional Vosgues, Rolbing FRA4 49°10'22.7"N 7°26'29.7"E I. Ribera & A. Cieslak LT855895 161 Platambus maculatus IBE-DV273 Spain Cataluña, Gerona province, St. Hilari ESPPIR12 41°54'55.5"N 2°30'48.1"E I. Ribera & A. Cieslak LT855896 162 Platambus maculatus IBE-DV274 Spain Cataluña, Gerona province, St. Hilari ESPPIR12 41°54'55.5"N 2°30'48.1"E I. Ribera & A. Cieslak LT855897 163 Platambus maculatus IBE-DV283 Turkey Balikesir province, Kürendere TUR13 39°18'46.4"N 28°31'56.7"E I. Ribera & A. Cieslak LT855831 LT855898 LT856190 LT856052 LT856092 164 Platambus maculatus IBE-RA414 England (UK) Hampshire, New Forest ENG1 ca. 51°15'14"N 1°13'8"W I. Ribera LT855832 LT855899 LT856191 LT856053 LT856093 165 Platambus maculatus IBE-RA415 England (UK) Hampshire, New Forest ENG1 ca. 51°15'14"N 1°13'8"W I. Ribera LT855900 LT856192 166 Platambus maculatus IBE-RA465 Scotland (UK) Argyll, Loch Eck SCO4 ca. 56°5'6"N 4°59'5"W G.N. Foster LT855901 LT856193 LT856054 LT856094 167 Platambus maculatus IBE-RA466 Scotland (UK) Argyll, Loch Eck SCO4 ca. 56°5'6"N 4°59'5"W G.N. Foster LT855902 LT856194 168 Platambus maculatus IBE-RA467 Scotland (UK) Argyll, Loch Eck SCO4 ca. 56°5'6"N 4°59'5"W G.N. Foster LT855903 169 Platambus maculatus IBE-RA475 England (UK) Yorkshire, River Skell ENG2 ca. 54°18'18"N 56°5'6"N 4°59"W G.N. Foster LT855904 LT856195 170 Platambus maculatus IBE-RA477 Turkey Erzincan province, Yurtbaşi TUR7 N39 52 25.2 E38 57 04.7 I. Ribera LT855833 LT855905 LT856196 LT856055 LT856095 171 Platambus maculatus IBE-RA480 England (UK) Westmorland, Ullswater ENG3 ca. 54°35'38"N 2°50'32"W G.N. Foster LT855906 172 Platambus maculatus IBE-RA481 England (UK) Cumberland,Crummock Water ENG4 ca. 54°32'52"N 3°17'28"W G.N. Foster LT855907 173 Platambus maculatus IBE-RA495 Turkey Erzincan province, Yurtbaşi TUR7 N39 52 25.2 E38 57 04.7 I. Ribera LT855908 LT856197 174 Platambus maculatus IBE-RA536 Scotland (UK) Scotland, Loch Doon SCO5 ca. 55°15'33"N 4°21'39"W G.N. Foster LT855834 LT855909 LT856198 LT856056 LT856096 175 Platambus maculatus IBE-RA541 Italy Piamonte, Torino, Bianca, forest stream ITA2 45º30'09"N 7º53'02"E I. Ribera & A. Cieslak LT855835 LT855910 LT856199 176 Platambus maculatus IBE-RA542 Italy Piamonte, Torino, Bianca, forest stream ITA2 45º30'09"N 7º53'02"E I. Ribera & A. Cieslak LT855836 LT855911 LT856200 177 Platambus maculatus IBE-RA556 Scotland (UK) Dumfriesshire, Loch Skene SCO6 ca. 57°11'15"N 2°19'50"W G.N. Foster LT855837 LT855912 LT856201 LT856057 LT856097 178 Platambus maculatus IBE-RA557 Scotland (UK) Dumfriesshire, Loch Skene SCO6 ca. 57°11'15"N 2°19'50"W G.N. Foster LT855913 LT856202 179 Platambus maculatus IBE-RA569 Romania Maramures, Calinesti RUM1 ca. 47°28'12"N 23°34'2"E J. Fresneda LT855838 LT855914 LT856203 180 Platambus maculatus IBE-RA570 Romania Maramures, Calinesti RUM1 ca. 47°28'12"N 23°34'2"E J. Fresneda LT855839 LT855915 LT856204 LT856058 LT856098 181 Platambus maculatus IBE-RA600 Scotland (UK) Easterness, Glen Urquhart SCO7 ca. 57°18'25"N 4°20'30"W G.N. Foster LT855840 LT855916 182 Platambus maculatus IBE-RA601 Scotland (UK) Easterness, Glen Urquhart SCO7 ca. 57°18'25"N 4°20'30"W G.N. Foster LT855917 183 Platambus maculatus IBE-RA602 Scotland (UK) Easterness, Glen Urquhart SCO7 ca. 57°18'25"N 4°20'30"W G.N. Foster LT855841 LT855918 184 Platambus maculatus IBE-RA618 Spain Cantabria, Vada ESPN3 43°5'21"N 4°40'31"W L.F. Valladares LT855842 LT855919 LT856205 LT856099 185 Platambus maculatus IBE-RA619 Spain Cantabria, Vada ESPN3 43°5'21"N 4°40'31"W L.F. Valladares LT855843 LT855920 LT856206 186 Platambus maculatus IBE-RA788 Spain Euskadi, Guipuzkoa province, Zaldibia ESPN7 ca. 43°0'26"N 2° 9'15"W I. Ribera & C. Hernando LT855844 LT855921 187 Platambus maculatus IBE-RA789 Spain Euskadi, Guipuzkoa province, Zaldibia ESPN7 ca. 43°0'26"N 2° 9'15"W I. Ribera & C. Hernando LT855845 LT855922 188 Platambus maculatus IBE-RA791 Spain Euskadi, Guipuzkoa province, Zaldibia ESPN7 ca. 43°0'26"N 2° 9'15"W I. Ribera & C. Hernando LT855923 189 Platambus maculatus IBE-RA821 France Picardia, Aisne, Venilly-la-Poteria FRA2 ca. 49°5'14"N 3°12'45"E P. Queney LT855924 190 Platambus maculatus IBE-RA822 France Picardia, Aisne, Venilly-la-Poteria FRA2 ca. 49°5'14"N 3°12'45"E P. Queney LT855846 LT855925 LT856207 LT856059 LT856100 191 Platambus maculatus IBE-RA823 France Picardia, Aisne, Venilly-la-Poteria FRA2 ca. 49°5'14"N 3°12'45"E P. Queney LT855926 192 Platambus maculatus IBE-RA828 Spain Euskadi, Guipuzcoa province, Zubialde ESPN6 ca. 43°15'21"N 2°13'55"W G.N. Foster LT855927 193 Platambus maculatus IBE-RA829 Spain Euskadi, Guipuzcoa province, Zubialde ESPN6 ca. 43°15'21"N 2°13'55"W G.N. Foster LT855928 194 Platambus maculatus IBE-RA830 Spain Euskadi, Guipuzcoa province, Zubialde ESPN6 ca. 43°15'21"N 2°13'55"W G.N. Foster LT855929 195 Platambus maculatus IBE-RA886 Spain Aragón, Huesca province, Villanua ESPPIR12 ca. 42°40'31"N 0°32'11"W I. Esteban LT855930 196 Platambus maculatus IBE-RA887 Spain Aragón, Huesca province, Villanua ESPPIR12 ca. 42°40'31"N 0°32'11"W I. Esteban LT855931 197 Platambus maculatus IBE-RA888 Spain Aragón, Huesca province, Villanua ESPPIR12 ca. 42°40'31"N 0°32'11"W I. Esteban LT855847 LT855932 198 Platambus maculatus IBE-RA904 Belgium Namur province, Le Moulin de Lisogne BEL1 ca. 50°28'45"N 6°6'16"E G.N. Foster LT855848 LT855933 199 Platambus maculatus IBE-RA905 Belgium Liège province, Sourbrodt BEL2 ca. 50°16'24"N 4°57'35"E G.N. Foster LT855849 LT855934 LT856208 LT856060 LT856101 200 Platambus maculatus IBE-RA906 Netherlands Limburg, Vijlen HOL1 ca. 50°46'57"N 5°57'50"E G.N. Foster LT855850 LT855935 201 Platambus maculatus IBE-RA920 Spain Cataluña, Lleida province, Llesp ESPPIR11 42°27'48.2"N 0°46'12.5"E I. Ribera & A. Cieslak LT855851 LT855936 LT856209 LT856061 LT856102 202 Platambus maculatus IBE-RA921 Spain Cataluña, Lleida province, Llesp ESPPIR11 42°27'48.2"N 0°46'12.5"E I. Ribera & A. Cieslak LT855852 LT855937 203 Platambus maculatus IBE-RA940 Macedonia Mavrovo district, Gari MAC1 ca. 41°29'33"N 20°40'40"E D.T. Bilton LT855853 LT855938 LT856210 LT856062 LT856103 204 Platambus maculatus IBE-RA1211 Romania Bacău county, Mănăstirea Caşin RUM2 46.09319N 26.57051E H. Fery LT855939 LT856211 205 Platambus maculatus IBE-RA1213 Romania Hargita county, Jacobeni RUM3 46.1885N 26.1405E H. Fery LT855940 LT856212 206 Platambus maculatus MNCN-AH71 Spain Cataluña, Barcelona province, Guardiola del Berguedà ESPPIR1 N 42º15’05.9” E1º55”20.1” I. Ribera & P. Aguilera & C. Hernando LT855941 LT856213 207 Platambus maculatus MNCN-AH83 France Alpes Maritimes, Malamaire, river Artuby FRA1 N43º47’32.6” E6º39’45.6” I. Ribera & A. Cieslak LT855942 LT856214 208 Platambus maculatus MNCN-AH84 Croatia Istria, Momjan CRO1 N45º26’30.8” E13º42’37.8” I. Ribera & A. Cieslak LT855854 LT855943 LT856215 LT856063 LT856104 209 Platambus maculatus MNCN-AH85 Slovenia Carniola, river Dula SLO1 N45º32’07.5” E14º15’01.0” I. Ribera & A. Cieslak LT855944 LT856216 210 Platambus maculatus MNCN-AH86 Poland Zachodniopomorsky, Parseta river POL1 N54º05’32” E15º42’48” I. Ribera & A. Cieslak LT855855 LT855945 LT856217 LT856064 LT856105 211 Platambus maculatus MNCN-AH87 Spain Navarra, Barindano ESPN9 42°45’34“N 2°07‘04“ W I. Ribera & A. Cieslak LT855856 LT855946 LT856218 LT856065 LT856106 212 Platambus maculatus MNCN-AH89 Sweden Ore river SUE1 ca. 63°43'18"N 20°6'22"E A.N. Nilsson LT855947 213 Platambus maculatus MNCN-AH191 Italy Emilia-Romagna, Vigoleno, Parco dello Stirone ITA1 N44º48’41.6” E9º54’21.8” I. Ribera LT855857 LT855948 LT856219 LT856066 LT856107 214 Platambus maculatus MNCN-AI140 Montenegro Virpazar, Orahovska river MON1 ca. 42°14'20"N 19°5'27"E V. Pesic LT855858 LT855949 LT856220 LT856067 LT856108 215 Platambus maculatus MNCN-AI318 Poland Zachodniopomorsky, Pyszka POL2 N54º07’16.5” E15º46’03” I. Ribera & A. Cieslak LT855950 216 Platambus maculatus MNCN-AI671 Bulgaria Bacevo, Rila mts. BUL1 ca. 41°58'2"N 23°26'21"E D.T. Bilton LT855951 217 Platambus maculatus MNCN-AI975 Scotland (UK) Sutherland, Loch Brora SCO3 ca. 58°1'0"N 3°55'9"W I. Ribera & G.N. Foster LT855859 LT855952 LT856221 LT856068 LT856109 218 Platambus maculatus MNCN-AI1017 Spain Euskadi, Guipuzkoa province, Aia ESPN8 N43º14’50.8” W2º9’11.3” I. Ribera & A. Cieslak LT855953 219 Platambus maculatus MNCN-AI1046 Spain La Rioja, Posadas ESPN4 N 42º12’36.0” W 3º4’27.8” I. Ribera & G.N. Foster LT855860 LT855954 LT856222 LT856069 LT856110 220 Platambus maculatus MNCN-AI1153 Bulgaria Gorno, Pirin mts. BUL2 ca. 41°31'30"N 23°31'23"E D.T. Bilton LT855955 221 Platambus maculatus MNCN-AI1259 Greece Makedonia, Mt Vitsi GRE1 N40°37'21.0", E021°22'20.1" P. & V. Ponel LT855861 LT855956 LT856223 LT856070 LT856111 222 Platambus maculatus MNCN-AI1286 Austria Nieder Österreich, Pressbauch AUS3 N48º11’42.8” E16º00’50.0” I. Ribera & A. Cieslak LT855862 LT855957 LT856224 LT856071 LT856112 223 Platambus maculatus MNCN-AI1287 Austria Nieder Österreich, Schwarzenbach AUS4 N48º04’42.4” E15º40’42.9” I. Ribera & A. Cieslak LT855958 224 Platambus maculatus NHM-IR25 Spain Castilla y León, Burgos province, Pineda de la Sierra ESPN1 ca. 42°13'24"N 3°17'49"W I. Ribera AF309330 LM654811 LM655144 225 Platambus maculatus NHM-IR25b Sweden Ore river SUE1 ca. 63°43'18"N 20°6'22"E A.N. Nilsson LT855959 LT856225 226 Platambus maculatus NHM-IR197 England (UK) Hampshire, New Forest ENG1 ca. 51°15'14"N 1°13'8"W I. Ribera LT856226 227 Platambus maculatus NHM-IR708 Austria Arte Rütenen, Gisingen AUS1 ca. 47°15'21"N 9°34'54"E I. Ribera LT855960 LT856227 228 Platambus maculatus NHM-IR715 Scotland (UK) Sutherland, Loch Brora SCO3 ca. 58°1'0"N 3°55'9"W I. Ribera LT855961 LT856228 229 Platambus princeps cplx IBE-RA195 Laos Attapeu prov., Annam Highlands Mts. 15º05.9'N 107º25.6'E LT855962 LT856229 230 Platambus princeps IBE-RA774 China Yunnan, Mo Pan shan N23.95210 E101.95096 LT855963 LT856230 LT856072 231 Platambus semivittatus NHM-IR189 New York (US) New York, Tompkins Co., Ithaca AY138765 AY138678 LT856073 232 Platambus princeps NHM-IR466 China Yunnan, Shizeng AY138764 AY138677 233 Platambus stygius NHM-IR475 Japan Hokkaido, Fujiami, Rubeshibe Town AY138766 AY138679 234 Platambus stagninus NHM-IR560 Maryland (US) Talbot co., Wittman 38.48N,76.17W AY138721 AY138631 LT856074 235 Platambus obtusatus NHM-IR595 Pennsylvania (US) Pennsylvania, Fowlers Hollow AY138762 AY138675 LT856075 Table S2:

A) Primers used for the amplification and sequencing. In brackets, length of the amplified fragment. gene primer sequence ref. cox1-3’ Jerry (5') CAACATTTATTTTGATTTTTTGG (4) (826) Pat (3') TCCAATGCACTAATCTGCCATATTA (4) Chy (5') T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT (3) Tom (3') AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A (3) barcode LCO 1490 (5') GGTCAACAAATCATAAAGATATTGG (2) (658) HCO 2198 (3') TAAACTTCAGGGTGACCAAAAAATCA (2) rrnL+trnL+nad1 16SaR (5') CGCCTGTTTAACAAAAACAT (4) (784-797) ND1 (3') GGTCCCTTACGAATTTGAATATATCCT (4) H3 H3aF (5') ATGGCTCGTACCAAGCAGACRCG (1) (330) H3aR (3') ATATCCTTRGGCATRATRGTGAC (1) Wingless WG550F (5') ATGCGTCAGGARTGYAARTGYCAYGGYATGTC (5) (472-478) WGAbrZ (3') CACTTNACYTCRCARCACCARTG (5)

B) Standard PCR conditions for the amplification of the studied fragments. step time temperature 1 3’ 96º 2 30” 94º 3 30”-1’ 47-50º * 4 1’ 72º 5 Go to step 2 and repeat 34-40 x 6 10’ 72º

* Depending on the annealing temperatures of the primers pair used

References

1. Colgan, D. J., McLauchlan, A., Wilson, G. D. F., Livingston, S. P., Edgecombe, G. D., Macaranas, J., Cassis, G. & Gray, M. R. (1998). Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology, 46: 419-437. 2. Folmer, 0., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3: 294-299. 3. Ribera, I., Fresneda, J., Bucur, R., Izquierdo, A., Vogler, A.P., Salgado, J.M. & Cieslak, A. (2010). Ancient origin of a Western Mediterranean radiation of subterranean beetles. BMC Evolutionary Biology, 10: 29. 4. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., & Flook, P. (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the entomological Society of America, 87: 651-701. 5. Wild, A. L., & Maddison, D. R. (2008). Evaluating nuclear protein-coding genes for phylogenetic utility in beetles. Molecular Phylogenetics and Evolution, 48: 877-891.

Table S3: Best evolutionary model for each gene as selected by Partition Finder. In the P. maculatus complex selected models failed to converge and were not performed. Instead, an HKY+I+G model to each partition was applied (see Results).

H. gracilis complex P. maculatus complex Oreodytes COI-5’ HKY+I+G (1) TrN+I+G (2) GTR+I+G (3) COI-3’ HKY+I+G (1) GTR+G (3) GTR+I+G (3) rrnL+trnL TrN (2) GTR+I+G (3) GTR+I (3) Nad1 HKY (1) GTR+G (3) HKY (1) H3 - HKY (1) TrN+I+G (2) Wingless - TrN+I+G (2) GTR+G (3)

References

1. Hasegawa, M., Kishino, H., & Yano, T. A. (1985). Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of molecular evolution, 22: 160-174. 2. Tamura, K., & Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular biology and evolution, 10: 512-526. 3. Tavaré, S. (1986). Some probabilistic and statistical problems in the analysis of DNA sequences. Lectures on mathematics in the life sciences, 17: 57-86.

gracilis AC25_SCO gracilis AH153_RCHE gracilis DV229_ALE3 gracilis DV245_SCO gracilis DV270_ALE4 gracilis DV228_FRAMC2 gracilis RA903_BEL gracilis DV246_ALE2 gracilis AI695_FRAALP2 gracilis AI393_FRAALP3 gracilis AI401_AUS3 gracilis AI1154_FRAALP1 gracilis DV269_ALE4 graciloides 139 TUR 79 gracilis DV230_SLO1 gracilis DV231_SLO2 56 gracilis DV234_MON gracilis balcanica AI338_BUL gracilis AI332_LAT gracilis AI333_ENG gracilis AI403_FRAMC1 gracilis DV244_SLO1 gracilis AI349_AUS2 gracilis AI359_SLK2 H. gracilis gracilis AI368_SUI gracilis AI1058_ALE2 gracilis RA902_HOL gracilis RA1217_RUM Hydanato_DV282_TUR3 anatolica DV281_TUR3 92 72 50 anatolica AI821_TUR3 59 crepidoptera 137_TUR 53 graciloides RA720_TUR1 north Turkey anatolica AI802_TUR2 63 anatolica DV256_AZB1 60 graciloides DV280_TUR1 east turkey graciloides DV279_TUR1 complex anatolica DV257_AZB1 H. gracilis anatolica DV258_AZB2 Caucasus/ Iran 61 61 anatolica RA741_IRAN 100 anatolica DV259_AZB2 gracilidelphis AI1012_ESPGIP2 gracilidelphis AI905_ESPLE3 gracilidelphis AI510_ESPCAN gracilidelphis DV272_ESPGIR 59 gracilidelphis DV271_ESPGIR gracilidelphis RA798_FRAPIR H. gracilidelphis gracilidelphis RA29_ESPNA1 exasperata AI315 100 exasperata AI506

maculatus RA465_SCO4 0.86 maculatus RA822_FRA2 0.85 maculatus RA556_SCO6 0,86 graellsi AI1319_ESPN10 0.85 maculatus RA536_SCO5 0.86 maculatus AI975_SCO3 0.86 0.84maculatus RA414_ENG1 maculatus RA618_ESPN3 0.86 maculatus DV251_ESPN1 0.87 maculatus AH87_ESPN9 0.85 maculatus DV241_ESPN1 0.88 0.85 maculatus RA920_ESPPIR11 0.85 graellsi AH88_ESPSC5 0.88 maculatus AI1046_ESPN4 maculatus DV219_BIE1 0.88 0.98 maculatus AH84_CRO1 maculatus AH191_ITA1 maculatus AI1286_AUS3 0.88 maculatus AH86_POL1 0.88 maculatus DV214_BUL1 0.93 0.87 0.87 maculatus RA940_MAC1 0,87 maculatus AI1259_GRE1 maculatus RA570_RUM1 0.87 maculatus RA905_BEL2 0.95 0.88 maculatus DV216_ALE1 P. maculatus complex 0.89

0.84 maculatus DV225_FRA3 1 0.85 maculatus AI140_MON1 maculatus_RA477_TUR7 0.93 maculatus_DV283_TUR13 lunulatus AI780_TUR11 0.89 lunulatus AI890_IRAN2 0.87 1 1 lunulatus DV255_AZB1 lunulatus DV284_TUR13 0,89 0.97 lunulatus DV287_TUR15 lunulatus RA36_TUR10 princeps RA774 0.86 0.86 obtusatus IR595 1 semivittatus IR189 stygius IR560

sanmarkii AI973_MONG2 sanmarkii DV253_RUM sanmarkii DV248_ALE1 sanmarkii DV222_FRAPIR sanmarkii DV227_FRAMC sanmarkii DV266_ALE2 0.84 sanmarkii DV236_ITA1 sanmarkii AI131_MON3 sanmarkii AI976_SCO1 0.79 sanmarkii alienus AI958_ESPSC4 0.98 sanmarkii alienus AI1134_POR 0.94 0.99 sanmarkii alienus AI999_ESPN9 group rhyacophilus IR367_USCAL5 O. sanmarkii 1 0.77 abbreviatus AI932_USCAL1 1 crassulatus IR451_CANALB subrotundus RA485_USCAL2 congruus IR440_CANBC1 okulovi RA1218_RUS2 davisii DV239_SCO1 davisii AI1127_ESPSUR davisii DV250_ESPPIR2 davisii AI283_ESPN9 1 davisii rhianae AI685_ESPSC1 davisii rhianae ER33_ESPSC3 davisii DV238_ITA2 davisii RA1127_ESPN1 0.97 davisii DV254_MAC1 davisii DV232_MON1 group 0.98 mongolicus AI972_MONG2 O. davisii 0,81 alpinus AI977_SCO1 1 shorti AI965_MONG1 septentrionalis AI974_MONG2 0.99 septentrionalis AI1062_FRAALP2

sanmarkii DV248_ALE1 sanmarkii DV268_ALE2 sanmarkii AI1057_ALE1 9 3 sanmarkii DV266_ALE2 6 4 sanmarkii DV267_ALE2 sanmarkii DV227_FRAMC sanmarkii AI1037_BUL O. sanmarkii 8 8 sanmarkii AH150_MAC1 eastern clade 7 1 sanmarkii DV235_MAC2 5 7 9 1 sanmarkii DV247_MON1 7 1 sanmarkii DV233_MON1 sanmarkii AI973_MONG2 9 7 sanmarkii AI1014_MONG2 5 2 sanmarkii DV236_ITA1 100 sanmarkii DV237_ITA1 8 1 sanmarkii IR306_FRAALP1 sanmarkii DV240_SCO2 7 5 5 4 sanmarkii AI976_SCO1 7 5 sanmarkii IR464_WAL 5 1 sanmarkii AI131_MON3 sanmarkii RA1209_RUM O. sanmarkii 8 4 western clade sanmarkii DV253_RUM sanmarkii AI746_FRAPIR 6 6 9 3 sanmarkii AI1013_ESPN10 O. sanmarkii group 5 2 sanmarkii DV223_FRAPIR 6 4 sanmarkii DV222_FRAPIR 5 7 9 8 sanmarkii IR734_FRAPIR sanmarkii DV249_ESPPIR3 sanmarkii alienus IR735_ESPN6 sanmarkii alienus AI1134_POR 9 9 sanmarkii alienusAI193_POR O. s. alienus sanmarkii alienus AI958_ESPSC4 6 8 sanmarkii alienus RA622_ESPN1 sanmarkii alienus AI999_ESPN9 obesus IR452_CANALB 5 0 rhyacophilus IR367_USCAL5 9 9 100 rhyacophilus IR368_USCAL5

7 8 abbreviatus AI932_USCAL1 crassulus IR451_CANALB 7 1 congruus RA484_USCAL2 9 8 congruus IR399_USCAL4 9 9 6 1 congruus IR434_USWAS 100 congruus IR357_USCAL3 100 6 2 congruus IR440_CANBC1 subrotundus RA485_USCAL2 okulovi RA1218_RUS2 davisii AI283_ESPN9 davisii DV252_ESPPIR2 davisii DV250_ESPPIR2 davisii rhianae AI830_ESPSC2 davisii AH148_MAC1 8 4 davisii DV254_MAC1 7 5 O. davisii davisii DV232_MON1 5 0 davisii DV239_SCO1 davisii IR693_SCO3 davisii IR298_ENG davisii AI1127_ESPSUR O. davisii group davisii DV238_ITA2 davisii rhianae ER33_ESPSC3 alpinus AI977_SCO1 mongolicus AI972_MONG2 O. alpinus / O. mongolicus alpinus IR713_SCO1 alpinus AF207_RUS1 davisii rhianae AI685_ESPSC1 8 9 davisii rhianae IR297_ESPN5 davisii RA1127_ESPN1 O. davisii 9 6 5 6 davisii RA621_ESPN1

9 6 snoqualmie IR447_CANALB 100 snoqualmie IR523_CANBC2 shorti AI965_MONG1 100 septentrionalis IR695_SCO3 100 9 8 septentrionalis AI1062_FRAALP2 O. septentrionalis 5 3 septentrionalis AI974_MONG2 scitulus IR448_CANALB