Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations
2007 Genome rearrangement at reversed-ends Ds element in Arabidopsis Lakshminarasimhan Krishnaswamy Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Genetics and Genomics Commons, and the Molecular Biology Commons
Recommended Citation Krishnaswamy, Lakshminarasimhan, "Genome rearrangement at reversed-ends Ds element in Arabidopsis" (2007). Retrospective Theses and Dissertations. 15969. https://lib.dr.iastate.edu/rtd/15969
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Genome rearrangement at reversed-ends Ds element in Arabidopsis by Lakshminarasimhan Krishnaswamy A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Plant Physiology Program of Study Committee: Thomas Peterson, Major Professor Jack Girton Martin Spalding Daniel Voytas Steven Whitham Iowa State University Ames, Iowa 2007 Copyright © Lakshminarasimhan Krishnaswamy, 2007. All rights reserved. UMI Number: 3259493
UMI Microform 3259493 Copyright 2007 by ProQuest Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, MI 48106-1346 ii
TABLE OF CONTENTS
ABSTRACT iv
CHAPTER 1: TRANSPOSON BIOLOGY – A HISTORICAL PERSPECTIVE 1
Introduction 1
McClintock’s discovery 1
New transposable elements 2
Controlling elements or gene disruption by insertion? 3
Molecular studies on Transposons – the new era 3
The 1990s – Molecular era and Genomics era synergy 4
Transposon Diversity 5
Role of transposons in genome rearrangement 7
Effects of transposons on the host 8
Transposons as tools in functional genomics 9
Future Prospects 9
Significance of this thesis 10
References 11
CHAPTER 2: REVERSED END DS ELEMENT: A NOVEL TOOL FOR CHROMOSOME ENGINEERING IN ARABIDOPSIS 17
Abstract 17
Introduction 17
Materials and Methods 19
Results 20
Discussion 23
Figure Legends 30
References 43
CHAPTER 3: ‘FUSED-ENDS’ REARRANGEMENT AT REVERSED-ENDS DS ELEMENT IN ARABIDOPSIS: IMPLICATIONS FOR THE FATE OF FREE TRANSPOSON ENDS FOLLOWING EXCISION 48
iii
Abstract 48
Introduction 48
Results and Discussion 49
Table and Figure Legends 55
References 61 CHAPTER 4: AN ALTERNATE HYPOTHESIS TO EXPLAIN THE HIGH FREQUENCY OF ‘REVERTANTS’ IN HOTHEAD MUTANTS IN ARABIDOPSIS 64
Preface 64
Abstract 64
Introduction 65
Hypothesis 65
References 67 ACKNOWLEDGEMENTS 69
iv
ABSTRACT In course of McClintock’s study on radiation induced chromosome breakage, she observed frequent chromosome break generated at a specific locus on chromosome 9. The precision of frequent breaks at this particular locus led to the discovery of Ac/Ds elements. In recent years, molecular characterization of Ac/Ds induced chromosome breaks reveal that when multiple transposon ends are in proximity, the transposase could recognize non canonical transposon ends resulting in various kinds of chromosomal rearrangements including deletion, inversion, translocation, duplication and, sometimes, chromosome breaks. Previous studies in our lab show that in the maize P1 rr11 allele of the P1 gene, a 5’end and a 3’end of Ds element are in reversed orientation with reference to each other. Transposition involving these two ends resulted in deletions and inversions in the flanking DNA. In this thesis we present our study on the efficacy of a synthetic reversed ends Ds element, modeled after the configuration found in P1 rr11 , to cause deletions and inversions in Arabidopsis genome. Our study revealed that the reversed ends Ds element is efficient in generating both deletions and inversions in the genome. The sizes of the rearrangements range from 2kb to several megabases. Analysis of the DNA sequences at the transposon insertion sites suggests that transposition at the reversed ends element could be linear (participating TIRs on same chromatid) or non linear (participating TIRs on sister chromatids) Ac/Ds insertion in maize is characterized by 8bp duplication at the target site. In contrast, we find that insertion of the reversed ends Ds element is flush or it is associated with 8bp or 1bp target site duplication. In some of the transposition events, the sequences at the rearrangement junctions suggest that the excised transposon ends formed a hairpin between the two strands. The significant contributions of our study are: It validates the utility of the reversed ends Ds element as a genomics tool to cause chromosomal rearrangements It addresses certain fundamental questions such as the size of target site duplication upon Ds insertion and, formation of hairpin structure at the transposon ends. These observations highlight possible difference in the transposition mechanism of Ds element in maize and Arabidopsis.
1
CHAPTER 1: TRANSPOSON BIOLOGY – A HISTORICAL PERSPECTIVE
Introduction Ever since Gregor Mendel postulated his laws of Genetics, the field of Biology has made immense progress. Beginning in the early 1900s there was a boom period in Genetics research for over half a century. The discovery of the structure of DNA by Watson and Crick in 1953 sowed the seeds for Molecular Biology, and in less than 50 years Biology has evolved into the Genomics era. Through this steady but quick progression in this field, different areas of research have been of foremost interest at various times. Interestingly, ever since the discovery of Transposons by Barbara McClintock in the 1940s, the study of transposon biology has undergone a parallel progression through these years. In this article, we try to trace the history of transposon research through the Genetics, Molecular Biology and Genomics era.
McClintock’s discovery Barbara McClintock is possibly the most enigmatic of modern scientists. Though she is well known for her discovery of transposable elements in maize, her research interest has spanned several aspects of maize genetics. In the 1920s during her graduate studies at Rollins Emerson’s lab at Cornell, she was part of a team that established the discipline of maize cytogenetics, and she characterized the 10 maize chromosomes. In collaboration with Harriet Creighton she observed the cytological correlation for the phenomenon of crossing over. Between 1935 and 1941, at University of Missouri, Columbia, she studied X ray irradiated maize to map genes. Here she observed ring chromosomes and her studies on deletion of chromosome ends contributed to the early understanding of telomere biology. In one of her strains she observed spontaneous breakage and fusion of chromosome arms, which repeated over somatic and germinal cell divisions, and she described the ‘breakage fusion bridge’ cycle. She moved to Cold Spring Harbor in 1942 and continued to use the ‘breakage fusion bridge’ strains to map genes. She identified two interesting loci – ‘ Dissociation ’ (Ds ) and ‘ Activator ’ ( Ac ), which could transpose or change positions on the chromosome
2
(McClintock, 1948). In one case, she observed frequent chromosome break occurring at the Ds locus on chromosome 9 in Ac dependent manner. Interestingly, this Ds element could move in the genome even to different chromosomes. In another case, the Ds locus seemed to regulate the expression of neighboring genes. The change in position of the Ds element correlated with the expression of the C gene, and resulted in variegation of the kernel color. Based on her observations McClintock proposed that Ac and Ds were ‘controlling elements’ that regulated the expression of other genes. At a time when the true nature of the gene was yet unclear, and genes were thought to be static structures in the nucleus, McClintock’s discovery of mobile genetic elements was revolutionary. Though some scientists understood the significance of her observations, McClintock’s emphasis on the role of transposable elements as regulators of gene expression drew indifferent reaction from the scientific community.
New transposable elements In the wake of discovery of Ac/Ds , several other transposable element systems were identified in maize. In 1936 Marcus Rhoades observed frequent mutability of anthocyanin pigmentation in the aleurone of the endosperm in Mexican Black corn, giving a dotted phenotype (Rhoades, 1936). He determined that the unstable phenotype of the a1 gene that was responsible for the aleurone pigmentation was controlled by the ‘Dotted ’ ( Dt ) gene (Rhoades, 1938). Barbara McClintock proposed that Dt was a controlling element analogous to the Ac/Ds system (McClintock, 1950), and Nuffer established that the dotted phenotype observed in Rhoades’ plants as caused by the activity of the Dt transposable element (Nuffer, 1955). Similarly, study of the mutability phenomenon in the maize leaf, kernel, anther and husk by Peterson PA identified the Enhancer Inhibitor (En/I ) element at the ‘ pale green mutable ’ ( pg m) locus (Peterson, 1953). Almost simultaneously McClintock identified the Suppressor mutator ( Spm/dSpm ) element (McClintock, 1954). Later it was shown that these two systems, En/I and Spm/dSpm , are closely related and possibly identical (Peterson, 1965).
3
Controlling elements or gene disruption by insertion? The years following the discovery of the Ac/Ds elements were marked by genetic characterization of newer transposons in maize. However, there was an uncertainty among biologists whether transposons caused alterations in gene expression by their ‘controlling’ influence or by disruption of the genes by insertion. When the limitations of maize genetics to resolve this puzzle was clearly felt, research in bacterial genetics was breaking new ground. In 1961 Jacob and Monod proposed the operon model for regulation of expression of the β− galactosidase gene in E.coli (Jacob and Monod, 1961). Here the Lac I gene regulates the expression of the Lac operon in trans. Based on this observation McClintock suggested a parallel between regulation of gene expression in bacteria and the effect of the ‘controlling elements’ in maize (McClintock, 1961). However, two other papers in the following years seemed to add credence to the ‘disruption of gene expression by insertion of the transposon’ model as advocated by Peterson (1967, 1970). First is a study on bacteriophage induced mutations in E.coli , where Taylor demonstrated that the viral episome caused frequent mutations by inserting into the bacterial genome (Taylor, 1963). Even greater support was from the discovery of the IS2 insertion sequences element causing mutation by insertion into the gal operon in E.coli (Jordan et al., 1968). In the following decade, more transposable elements including IS elements (reviewed by Iida et al., 1983) and Tn elements in bacteria (reviewed by Heffron et al., 1983), Ty elements in yeast (reviewed by Roeder and Fink, 1983) and copia like elements, Foldback elements and P elements in Drosophila (reviewed by Rubin, 1983) were identified, mainly due to their ability to cause mutations, rearrange the genome, and regulate or modify the expression of other genes. The power of genetics in these systems, their simplicity and small size of genome, coupled with the advantage of emerging molecular techniques enabled characterization of many transposable elements at the genetic and molecular level.
Molecular studies on Transposons – the new era Though evidence from transposable elements from other systems supported the insertion model of mutagenesis and gene regulation, the maize elements were still
4 considered to be ‘controlling elements’ in the absence of direct molecular evidence contrary to the controlling element hypothesis. The early 1980s was a significant period for transposon biology. In 1983 came the first evidence that insertion of a Ds element caused a mutation in the Adh1 gene in maize (Sachs et al., 1983). This was followed by the cloning of the Ac and then a Ds element from the maize waxy gene (Fedoroff et al., 1983). The same year Barbara McClintock was recognized with the Nobel Prize for the discovery of transposable elements about 40 years earlier. The cloning and molecular studies on the maize Ac/Ds transposon were followed by characterization of several transposons from various organisms. A significant breakthrough that boosted transposon research at this juncture is the identification of retrotransposons in yeast. For a long time now, the similarity between the copia elements of Drosophila and retroviruses was well known. Flavell isolated extrachromosomal linear copia elements (Flavell, 1984), and Boeke et al. proved that the TyH3 element transposition in yeast passes through an RNA intermediate (Boeke et al., 1985). These two papers established that a class of transposons called retrotransposons transposed via an RNA intermediate. Soon retrotransposons were reported in other organisms including plants. Towards the end of the 1980s transposon biology was not limited to ‘molecular stamp collecting’ of transposable elements, but opened up newer avenues of research. The advancements in molecular techniques and the emerging genomics tools enriched our understanding of the function and complexity of the genomes of eukaryotes, and the effects of transposons on genome complexity.
The 1990s – Molecular era and Genomics era synergy Transposon biology has seen tremendous advances in the past 15 years. Researchers have identified new transposons, understood the mechanisms of transposition at the molecular level to some extent, studied the effect of transposition on the host genome stability and dynamics, and also gathered knowledge on how in certain instances the transposon sequences contribute to some cellular functions. In addition, transposons have been modified to serve as tools in functional genomics research. The
5 vastness of the knowledge accumulated makes it difficult either to place it in a chronological order or to dwell in detail in any topic. Therefore, the diversity of transposable elements, and a summary of our understanding and utility of transposons gathered in this period is presented briefly in the following passages. The reader is requested to refer to specialized literature for detailed discussion on these topics.
Transposon Diversity During the early days of transposon biology, transposons were placed into two classes – autonoumous and non autonomous elements. Autonomous elements are those that encode functional transposase and other factors essential for transposition, whereas non autonomous elements lack one or more of the molecules required for transposition and therefore can not transpose independent of the corresponding autonomous element. In the early 1980s, the advent of molecular techniques enabled identification of newer transposons, which required classification on different parameters. Eukaryotic transposons are now classified into two classes based on whether transposition involves an RNA intermediate or not.
Class 1 In Class 1 transposons, the transposon is transcribed into RNA which is reverse transcribed by a transposable element encoded reverse transcriptase. The resulting cDNA are inserted at different loci by an integrase. Class 1 elements are also called Retrotransposons, and include both autonomous and non autonomous elements. Retrotransposons are further classified as LTR elements and Non LTR elements, based on their transposition mechanism and structure. LTRs are named after the ‘Long Terminal Repeats’ in direct orientation at either end of the transposon. The LTRs bear structural similarity to retroviruses. The autonomous elements encode at least 2 genes: gag gene encodes a capsid like protein; pol gene encodes a polyprotein with various activities including protease, reverse transcriptase, RNaseH and integrase. LTR elements are further classified into copia like and gypsy like elements. The Non LTR retrotransposons lack the long terminal repeats and instead terminate with a simple sequence repeat. They are divided into two classes: ‘Long interspersed nuclear elements’
6
(LINES) and ‘Short interspersed nuclear elements’ (SINES). Their coding regions include a gag like protein, an endonuclease and reverse transcriptase. All SINES described yet have an internal RNA polIII promoter near the 5’ end. Some of the SINE elements share homology with certain LINES at the 3’ tail sequence, and could parasitize on their transposition machinery.
Class 2 The prokaryotic Insertion Sequences (IS elements) and eukaryotic DNA transposons transpose by cut and paste or replicative mechanism without any RNA intermediate. In cut and paste transposition, the transposase recognizes the terminal inverted repeat sequences (TIRs) on either ends of the transposable element, cuts it out and inserts at a new site. In order to insert the transposon, a staggered cut is made at the target site which causes duplication of a few bases – “Target site duplication” (TSD), which now flank the inserted element. When the transposon is excised, the flanking direct repeats are joined to leave a ‘footprint’. DNA transposons are grouped into several superfamilies and families based on sequence similarity, length of the TIRs, and length of the TSD. hAT , CACTA , Mutator , PIF/Harbinger , Tc1/mariner are well characterized class 2 transposable element groups in eukaryotes.
Newer transposons The advent of the genomics era has introduced several new transposon families. MITES: Miniature inverted repeat transposable elements (MITES) were first identified a decade ago through computer assisted searches for repeated sequences in the grass genome (Bureau et al., 1996; Jiang et al., 2003). These elements are characterized by their very small size (less than 600bp) and terminal inverted repeats. MITES are abundantly represented in the genomes of plants and animals, and are mostly inactive, although active MITES have been reported in rice (Kikuchi et al., 2003). Helitrons and Polintons: These DNA transposons were identified by computational analysis of genome sequence of different organisms (Kapitonov and Jurka, 2001). Helitrons are presumed to
7 transpose by rolling circle replicon, similar to some plasmids, bacterial Insertion Sequences, single stranded bacteriophage, and plant geminiviruses. Polintons are yet another type of DNA transposon discovered recently by computational analysis of genome sequences (Kapitonov and Jurka, 2006). Polinton sequences are widely found in several invertebrate and vertebrate genome sequences, and even protists and fungi, but are not found in mammalian genome sequence. The predicted mechanism of polinton transposition is the most complex known for any eukaryotic DNA transposon, where a single strand of the transposon is excised, the second strand synthesized and the transposon is inserted in the host genome. Because of the novelty of the mechanism of transposition, Helitrons and Polintons can not be clearly placed in any of the above mentioned classes.
Role of transposons in genome rearrangement The role of transposons as insertional mutagenic agents is well documented. In addition, transposons play a significant role in various kinds of genome rearrangements. It has been shown that the repair mechanism following double strand break caused by transposon excision could lead to intrachromosomal (Athma and Peterson, 1991) or ectopic (Shalev and Levy, 1997) homologous recombination. In addition, transposon sequences distributed throughout the genome could provide sequence homology for ectopic recombination (Montgomery et al., 1991). In a normal transposon, the transposase recognizes the terminal inverted repeats at either end of the element. If the transposase recognizes two TIRs that are reversed or in direct orientation in reference to each other, such non standard or aberrant transposition reaction could lead to chromosome breakage, inversions or deletions in the genome (Zhang and Peterson, 2004). In fact, chromosome breakage caused by an aberrant transposition of a Ds element on chromosome 9 in maize led to the identification of Ac/Ds elements by McClintock. Such rearrangements could have considerable impact in restructuring the genome. Non standard transposition reaction at reversed transposon ends has been shown to result in the formation of chimeric gene in maize (Zhang et al., 2006).
8
Effects of transposons on the host Transposon activity results in increased mutation rates and can enhance the adaptation of the organism to changing environments (Kidwell and Lisch, 1997). Transposons can inactivate or alter the expression of genes when they insert into the coding region or the regulatory elements of genes, and thereby act as a source of genetic variation (Schwarz Sommer et al., 1987). Transposable elements could contribute to epigenetic silencing of flanking genes when they are targeted for methylation by the host defense mechanism (Zilberman and Henikoff, 2004). Transposon insertions result in duplication of a short sequence at the target site which is seen as a ‘footprint’ after excision of the element. Such footprint could modify the gene coding sequence as shown in the case of the Ascot transposon from A. immersus (Colot et al., 1998). Here, integration of the transposon into the b2 spore color gene led to colorless spores. The type of footprint produced upon excision varied and different types of revertants were obtained with ‘speckled’, ‘banded’, ‘spread’, ‘blotchy’ or ‘double belted’ spore phenotypes. There are also examples where transposons are directly involved in the host cell functions. The retroposons HeT A and TART in Drosophila have been implicated in rescue of damaged telomeres and chromosome end maintenance (Pardue, 1996). Transposons sometimes contribute to formation of introns (Wessler et al., 1987), or promote exon shuffling (Morgante, 2005). In Arabidopsis, it appears that the transposon DAYSLEEPER has been domesticated by the host to regulate global gene expression and is essential for normal plant development (Bundock and Hooykaas, 2005). Retrotransposition of an engineered human retrotransposon Line1 in rat neuronal precursor cells has been shown to influence the expression of neuronal genes and affect neuronal cell fate (Muotri et al., 2005). In primates, fusion of the transposase domain of a mobile element to a histone methyl transferase gene is supposed to have given rise to SETMAR, a chimeric gene (Cordaux et al, 2006). Transposons sometimes seem to be beneficial to the host and are considered as ‘pacemakers of evolution’; while in other instances they are likely parasitic or ‘selfish DNA’. The debate whether transposons are ‘angels’ or ‘imp’ has been going on for over 25 years. But of late, a synthetic view of mutualistic relationship between the host
9 genome and transposable elements, tipping towards parasitic relation in some cases is suggested (Jordan, 2006).
Transposons as tools in functional genomics Fundamental research often leads to applications that fuel advancement of science and technology. This has certainly been true with transposon biology. Transposons have been widely used to cause mutations in genes by insertion, which has enabled gene identification and characterization. For instance, the Ac/Ds transposon system from maize has been used in several heterologous systems including Arabidopsis to generate libraries of insertional mutants (eg. Parinov and Sundaresan, 2000), thereby simplifying gene mapping. Transposons have also been used in enhancer trap and promoter trap constructs to help identify enhancer and promoter elements in the genome (Acosta Garcia et al., 2004). Aberrant transposition reactions cause genome rearrangements such as deletion, inversion and translocation. The deletions caused by such transposition could be useful in knocking out few genes, and in studying the effects of alterations in gene dosage. Such rearrangements are also useful in studying the function of chromosomal elements like centromeres and neocentromeres. Further, transposons have been used as gene therapy vectors in mammalian cells (Ivics et al., 2006).
Future Prospects One key feature of progress in that science is it is unpredictable. However, it is tempting to project certain outcomes based on current trends in the field. In fact, research is ongoing in some of these aspects and the results could be realized in just a few years. As the whole genome sequences from more organisms become available, it will lead to discovery of new transposons. How many of these will be active is an open question. However, with the success in resurrection of two transposons – Sleeping beauty (Ivics, 1997) and Frog prince (Miskey et al., 2003), reconstructed from inactive transposons in the fish and frog genomes respectively, it is likely that more inactive transposons could possibly be engineered to activity. These newer transposons will enrich the geneticists’ tool kit for functional genomics. Deeper insight into the mechanisms of transposition could help us engineer precise deletions, inversions and other
10 rearrangements in the genome. One significant application would be precise integration of the transposon at a defined target sequence. Current techniques for generating transgenic plants suffer from poor gene targeting efficiencies. Similarly, efforts for efficient delivery and integration of gene therapy constructs in mammals are also plagued with problems. Viral vectors are fairly efficient gene therapy vectors, but they often lead to immunological complications, or genotoxic effects due to non specific integration. Recent success in the use of the transposons Sleeping beauty , Frog prince , Tol 1 and piggyBack in mammalian gene transfer (Wu et al., 2006) suggests that transposons could some day be used for precise integration of transgene at specific target site, in both plants and animals. Evidently, transposon biology holds a great deal of promise for the years to come
Significance of this thesis In course of McClintock’s study on radiation induced chromosome breakage, she observed frequent chromosome break generated at a specific locus on chromosome 9. The precision of frequent breaks at this particular locus led to the discovery of Ac/Ds elements. In recent years, molecular characterization of Ac/Ds induced chromosome breaks reveal that when multiple transposon ends are in proximity, the transposase could recognize non canonical transposon ends resulting in various kinds of chromosomal rearrangements including deletion, inversion, translocation, duplication and, sometimes, chromosome breaks (Courage Tebbe et al., 1983; Weck et al., 1984; Ralston et al., 1989, Weil and Wessler, 1993; English et al., 1995; Martinez Ferez and Dooner, 1997; Zhang and Peterson, 1999 ). In the maize P1 rr11 allele of the P1 gene, a 5’end and a 3’end of Ds element are in reversed orientation with reference to each other. Zhang and Peterson (2004) observed that transposition involving these two ends resulted in deletions and inversions in the flanking DNA. In this thesis we report on the efficacy of a synthetic reversed ends Ds element (Figure 2, Chapter 2), modeled after the configuration found in P1 rr11 , to cause deletions and inversions in Arabidopsis genome. Our study revealed that the reversed ends Ds element is efficient in generating both deletions and inversions in the genome.
11
The sizes of the rearrangements range from 2kb to several megabases. Analysis of the DNA sequences at the transposon insertion sites suggests that transposition at the reversed ends element could be linear (participating TIRs on same chromatid) or non linear (participating TIRs on sister chromatids) Ac/Ds insertion in maize is characterized by 8bp duplication at the target site. In contrast, we find that insertion of the reversed ends Ds element is flush or it is associated with 8bp or 1bp target site duplication. In some of the transposition events, the sequences at the rearrangement junctions suggest that the excised transposon ends formed a hairpin between the two strands. The significant contributions of our study are: It validates the utility of the reversed ends Ds element as a genomics tool to cause chromosomal rearrangements It addresses certain fundamental questions such as the size of target site duplication upon Ds insertion and, formation of hairpin structure at the transposon ends. These observations highlight possible difference in the transposition mechanism of Ds element in maize and Arabidopsis. An anomalous observation in one of the Arabidopsis lines inspired us to propose a testable model to explain the non Mendelian inheritance reported in hothead mutants (Krishnaswamy and Peterson, 2007). This paper forms the last chapter in this thesis.
References
Acosta Garcia G, Autran D, Vielle Calzada JP., Enhancer detection and gene trapping as
tools for functional genomics in plants, Methods Mol Biol. 2004, 267, 397 41.
Athma P, Peterson T., Ac induces homologous recombination at the maize P locus, Genetics. 1991 May, 128(1):163 17.
Boeke JD, Garfinkel DJ, Styles CA, Fink GR., Ty elements transpose through an RNA
intermediate, Cell, 1985, 40(3), 491 50.
12
Bundock P, Hooykaas P., An Arabidopsis hAT like transposase is essential for plant development, Nature, 2005, 436(7048), 282 28.
Bureau TE, Ronald PC, Wessler SR., A computer based systematic survey reveals the
predominance of small inverted repeat elements in wild type rice genes, Proc Natl
Acad Sci U S A. 1996, 93(16), 8524 852. Colot V, Haedens V, Rossignol JL., Extensive, nonrandom diversity of excision
footprints generated by Ds like transposon Ascot 1 suggests new parallels with
V(D)J recombination, Mol Cell Biol. 1998, 18(7):4337 434. Cordaux R, Udit S, Batzer MA, Feschotte C., Birth of a chimeric primate gene by capture of the transposase gene from a mobile element, Proc Natl Acad Sci U S A. 2006, 103(21), 8101 810. Courage Tebbe U, Doring HP, Fedoroff N, Starlinger P. The controlling element Ds at the Shrunken locus in Zea mays : structure of the unstable sh m5933 allele and several revertants, Cell. 1983 Sep; 34(2):383 393. English JJ, Harrison K, Jones J. Aberrant Transpositions of Maize Double Ds Like Elements Usually Involve Ds Ends on Sister Chromatids, Plant Cell. 1995 Aug; 7(8):1235 1247. Fedoroff N, Wessler S, Shure M., Isolation of the transposable maize controlling elements Ac and Ds , Cell. 1983, 35(1), 235 24.
Flavell A. J., Role of reverse transcription in the generation of extrachromosomal copia
mobile genetic elements, Nature, 1984, 310, 514 51. Heffron F., Tn3 and its Relatives, In Mobile Genetic Elements (ed. Shapiro JA.),
Academic Press, Inc., 1983, pp. 223 26.
Iida S., Meyer J., Arber W., Prokaryotic IS Elements, In Mobile Genetic Elements (ed.
Shapiro JA.), Academic Press, Inc., 1983, pp. 159 22.
13
Ivics Z, Hackett PB, Plasterk RH, Izsvak Z., Molecular reconstruction of Sleeping Beauty , a Tc1 like transposon from fish, and its transposition in human cells, Cell, 1997,
91(4), 501 51.
Ivics Z, Izsvak Z., Transposons for gene therapy!, Curr Gene Ther. 2006, 6(5), 593 60.
Jacob F., Monod J., On the regulation of gene activity, Cold Spring Harbor Symposium Quantitative Biology, 1961, 16, 193 21.
Jiang N, Bao Z, Zhang X, Hirochika H, Eddy SR, McCouch SR, Wessler SR., An active
DNA transposon family in rice, Nature, 2003, 421(6919), 163 16.
Jordan E., Sadler H., Starlinger P., Oo and strong polar mutations in the gal operon are insertions. , Mol Gen Genet. 1968, 102, 353 36.
Jordan I.K., Evolutionary tinkering with transposable elements, Proc Natl Acad Sci U S
A. 2006, 103(21), 7941 794. Kapitonov VV, Jurka J., Rolling circle transposons in eukaryotes, Proc Natl Acad Sci U
S A. 2001, 98(15):8714 871.
Kapitonov VV, Jurka J., Self synthesizing DNA transposons in eukaryotes, Proc Natl
Acad Sci U S A. 2006, 103(12):4540 454. Kidwell MG, Lisch D., Transposable elements as sources of variation in animals and
plants, Proc Natl Acad Sci U S A. 1997, 94, 7704 771. Kikuchi K, Terauchi K, Wada M, Hirano HY., The plant MITE mPing is mobilized in anther culture, Nature, 2003, 421(6919):167 17. Krishnaswamy L, Peterson T., An alternate hypothesis to explain the high frequency of "revertants" in hothead mutants in Arabidopsis, Plant Biol (Stuttg). 2007 Jan;9(1):30 31. Martinez Ferez IM, Dooner HK. Sesqui Ds , the chromosome breaking insertion at bz m1 ,
links double Ds to the original Ds element, Mol Gen Genet. 1997 Aug;
255(6):580 586.
14
McClintock B., Mutable Loci in Maize, Carnegie Inst. Washington yearbook. 1948; 47, 155 16.
McClintock B., Mutable Loci in Maize, Carnegie Inst. Washington yearbook. 1950; 50,
174 18.
McClintock B., Mutations in maize and chromosomal aberrations in Neurospora, Carnegie Inst. Washington yearbook. 1954, 53, 254 26.
McClintock B., Some parallels between gene control systems in maize and in bacteria,
Am Nat. 1961, 95, 265 27.
Miskey C, Izsvak Z, Plasterk RH, Ivics Z., The Frog Prince : a reconstructed transposon from Rana pipiens with high transpositional activity in vertebrate cells, Nucleic
Acids Res. 2003, 31(23), 6873 688.
Montgomery EA, Huang SM, Langley CH, Judd BH., Chromosome rearrangement by ectopic recombination in Drosophila melanogaster : genome structure and
evolution, Genetics. 1991, 129(4), 1085 109.
Morgante M, Brunner S, Pea G, Fengler K, Zuccolo A, Rafalski A., Gene duplication and
exon shuffling by helitron like transposons generate intraspecies diversity in maize, Nature Genetics. 2005, 37(9):997 100.
Muotri AR, Chu VT, Marchetto MC, Deng W, Moran JV, Gage FH, Somatic mosaicism
in neuronal precursor cells mediated by L1 retrotransposition, Nature. 2005,
435(7044), 903 91. Nuffer M.G., Dosage effect of multiple Dt loci on mutation of a in the maize endosperm,
Science. 1955, 121, 399 40.
Pardue ML, Danilevskaya ON, Lowenhaupt K, Slot F, Traverse KL., Drosophila
telomeres: new views on chromosome evolution, Trends Genet. 1996, 12(2),48 5.
15
Parinov S, Sundaresan V, Functional genomics in Arabidopsis: large scale insertional mutagenesis complements the genome sequencing project, Curr Opin Biotechnol.
2000, 11(2), 157 16.
Peterson P.A., A mutable pale green locus in maize, Genetics.1953, 38, 682 68.
Peterson P.A., Relationship between the Sp , and En Control Systems in Maize, Am Nat. 1965, 99, 391 39.
Peterson P.A., A comparision of the action of regulatory systems in maize and bacteria,
Genetics.1967, 56, 8. Peterson P.A., Controlling elements and mutable loci in maize: their relationship to bacterial episomes, Genetica.1970, 21, 33 5. Ralston E, English J, Dooner HK. Chromosome breaking structure in maize involving a
fractured Ac element, Proc Natl Acad Sci U S A. 1989 Dec; 86(23):9451 9455.
Rhoades, M.M., The Effect of varying gene dosage on aleurone colour in maize, Journal
of Genetics.1936, 33, 347 35. Rhoades, M.M., Effect of the Dt gene on the mutability of the a1 allele in maize,
Genetics.1938, 23, 377 39.
Roeder G.S., Fink G.G., Transposobale Elements in Yeast, In Mobile Genetic Elements
(ed. Shapiro JA.), Academic Press, Inc., 1983, pp. 300 32. Rubin G.M., Dispersed Repetitive DNAs in Drosophila, In Mobile Genetic Elements (ed.
Shapiro JA.), Academic Press, Inc., 1983, pp. 329 36.
Sachs M.M., Peacock W.J., Dennis E.S., Gerlach W.L., Maize Ac/Ds controlling elements: a molecular viewpoint, MAYDICA.1983, 28, 289 30.
Schwarz Sommer Z, Shepherd N, Tacke E, Gierl A, Rohde W, Leclercq L, Mattes M,
Berndtgen R, Peterson PA, Saedler H., Influence of transposable elements on the
structure and function of the A1 gene of Zea mays , EMBO Journal.1987, 6(2), 287 29.
16
Shalev G, Levy AA., The maize transposable element Ac induces recombination between the donor site and a homologous ectopic sequence, Genetics.1997, 146(3):1143
115. Taylor A.L, Bacteriophage induced mutation in E.coli , Proc Natl Acad Sci U S A. 1963, 50, 1043 105. Weck E, Courage U, Doring HP, Fedoroff N, Starlinger P. Analysis of sh m6233 , a mutation induced by the transposable element Ds in the sucrose synthase gene of Zea mays , EMBO J. 1984 Aug; 3(8):1713 1716. Weil CF, Wessler SR. Molecular evidence that chromosome breakage by Ds elements is
caused by aberrant transposition, Plant Cell. 1993 May; 5(5):515 522.
Wessler SR, Baran G, Varagona M., The maize transposable element Ds is spliced from RNA, Science, 1987, 237(4817):916 91.
Wu SC, Meir YJ, Coates CJ, Handler AM, Pelczar P, Moisyadi S, Kaminski JM.,
piggyBac is a flexible and highly active transposon as compared to Sleeping Beauty , Tol2 , and Mos1 in mammalian cells, Proc Natl Acad Sci U S A. 2006,
103(41), 15008 1501.
Zhang J, Peterson T. Genome rearrangements by nonlinear transposons in maize,
Genetics. 1999 Nov; 153(3):1403 1410. Zhang J, Peterson T., Transposition of reversed Ac element ends generates chromosome
rearrangements in maize, Genetics, 2004, 167(4):1929 193.
Zhang J, Zhang F, Peterson T., Transposition of reversed Ac Element ends generates
novel chimeric genes in maize, PLoS Genetics, 2006, 2(10): e16. Zilberman D, Henikoff S., Silencing of transposons in plant genomes: kick them when
they're down, Genome Biology, 2004, 5(12), 24.
17
CHAPTER 2: REVERSED END Ds ELEMENT: A NOVEL TOOL FOR CHROMOSOME ENGINEERING IN ARABIDOPSIS
Abstract The maize Ac/Ds transposable element (TE) transposes by the “cut and paste” mechanism. Previous studies in maize from our lab show that when the TE ends are in reversed orientation with respect to each other, alternative transposition reactions can occur resulting in large scale genome rearrangements including deletions and inversions (Zhang and Peterson, 2004). We studied the efficacy of such alternative transposition mediated genome rearranagements in Arabidopsis. Here we present our analysis of 33 independent chromosome rearrangements. Transposition at the reversed ends Ds element can cause deletions over 1Mbp, and inversions up to 2.4Mbp. We identified additional rearrangements including a reciprocal translocation and a putative ring chromosome. Some of the deletions and inversions are germinally transmitted.
Introduction Barbara McClintock’s study on the Ac/Ds transposable system is marked by two observations (reviewed by Jones, 2005). One, the Dissociation ( Ds ) element at the ‘standard’ location proximal to the waxy locus on the short arm of chromosome 9 caused frequent, precise chromosome breakage as observed during the pachytene stage of meiosis. Two, the Ds element could transpose from the standard locus to other loci such as C, Wx and Bz , giving rise to new alleles including cm 1, wx m 1 and bz m 1, respectively. She described two different ‘states’ of the Ds element: state I Ds elements caused chromosome breakage frequently but underwent transposition rarely. On the other hand, the state II elements transposed frequently but seldom caused chromosome breakage. Molecular analysis of several Ds elements in the past two decades reveals that the state II elements correspond to simple transposons (eg. Fedoroff et al., 1983) whereas the state I elements are complex structures of the transposable element which often undergo aberrant transposition reactions (Courage Tebbe et al., 1983; Weck et al., 1984; Ralston et al., 1989, Weil and Wessler, 1993; English et al., 1995; Martinez Ferez and Dooner,
18
1997; Zhang and Peterson, 1999 ). A few of the shrunken alleles generated by McClintock have been studied at the molecular level (Courage Tebbe et al., 1983; Burr and Burr, 1982; Chaleff et al., 1981; Doring et al., 1981, Weck et al., 1984). The lines which show frequent chromosome breakage at the shrunken locus carry a double Ds element – one Ds inserted into another. When multiple Ds termini (11bp Terminal Inverted Repeats (TIRs), plus about 250bp subterminal sequence) are present in close proximity, then a 3’ end and a 5’ end in non standard orientation with reference to each other could serve as substrate for the transposase and result in aberrant transposition (Weil and Wessler, 1993). English et al (1995) demonstrated that in aberrant transposition reactions at double Ds elements that cause chromosome breakage, the transposase recognized the 3’ and 5’ ends on sister chromatids. This is believed to occur immediately after DNA replication. In addition to chromosome breakage, such complex transposon structures cause other kinds of genome rearrangements including deletions, duplication and inversions. The maize p1 vv9D9A allele carries a similar configuration of transposon ends: an intact Ac element and a fractured Ac ( fAc ) (the 5’ terminus is deleted) that have their 5’ and 3’ ends in direct orientation. Zhang and Peterson (1999) observed that transposition can involve the Ds ends on the sister chromatids. Analysis of a twin sector in the ear of one such plant revealed a deletion and a corresponding duplication. Rearrangement at this allele generates ‘nested deletions’ – a series of deletions extending from one of the TIRs to a flanking chromosomal site representing insertion of the TIR (Zhang and Peterson, 2005). In a screen for mutants defective in female gametogenesis, Page et al. (2004) identified large genomic deletions flanking normal Ds elements at a frequency of 5 10%; they proposed that these deletions are a product of transposition of a hybrid element involving the one TIR of a newly transposed element and another TIR from the donor element. Complex genome rearrangements can occur also when the transposon ends are in reversed orientation (Figure 1). In the maize P1 rr11 allele, a full length Ac element and a fractured Ac element are 13 kb apart in such a manner that the 5’TIR of the Ac element and the 3’TIR of the fAc element are oriented towards each other (Zhang and Peterson, 2004). In this configuration, alternative transposition reactions involving the reversed ends in the maize P1 rr11 allele could generate deletions and inversions in the genome. It
19 was proposed that engineered transposons with the transposon ends in reversed orientation could be useful in chromosome manipulation. In this paper the efficacy of reversed Ac ends to cause chromosome rearrangements in Arabidopsis is examined. We report here that transposition at reversed Ac ends can generate both deletions and inversions. These rearrangements range from 2 kb to several megabases. In addition, the two transposon ends fused with each other in several instances, reflecting aborted transposition.
Materials and Methods
Plant Growth conditions Seeds sown on MS media and appropriate selection were cold stratified for 2 3 days and moved to the growth room with the following conditions: 24 hour light, 25°C. After 10 12 days, the selected plants were transplanted to soil and moved to growth chamber: 16 hour light, 18°C. Upon bolting, the bolts were supported with a bamboo stake and enclosed in a sandwich wrapper to facilitate seed harvest and minimize pollen and seed contamination.
DNA gel blot hybridization Southern blot analysis was carried out according to Sambrook et al. (1989). Genomic DNA isolated from 2 8mg of leaves was digested with Eco RI. The digested DNA was separated by 0.8 % agarose (SeaKem LE) gel electrophoresis and transferred onto nylon membrane (Zeta probe GT, BioRad). Southern hybridization was performed using [α 32 P] radioactively labeled probe DNA. The membrane was washed at high stringency washing conditions in a buffer consisting of 0.1 × SSC and 0.5 % SDS at 65 °C and exposed to X ray film.
Plasmid rescue For plasmid rescue, genomic DNA was digested with Eco RI or Xba I restriction enzyme in a volume of 50 l in an overnight reaction. The digested DNA was cleaned using QIAprep spin column (Qiagen), and eluted in 180 l of water. The DNA was self ligated by T4 DNA ligase (Promega) in a volume of 200 l at 16°C overnight. Then the
20
DNA was ethanol precipitated and resuspended in 30 l of water. 4 5 l of the ligation mixture was electroporated into twenty microlitres of Escherichia coli DH10B (Invitrogen, Carlsbad, CA, USA). Transformed E. coli was cultured on LB Amp agar medium. After overnight culture at 37°C, the colonies were inoculated into LB Amp liquid medium. Plasmids containing the genomic DNA were sequenced using the Ac5 2 primer 5' GTATATCCCGTTTCCGTTCCGTT 3', which is complementary to the 5’subterminal sequence. The sequence of the site of insertion obtained from the rescued plasmid was compared to the Arabidopsis genome sequence available with Plant Genomes Central, using BLAST program and the site of insertion determined.
Results
NIPB3 - The reversed Ds ends construct Coupland et al (1989) showed that 209bp of the Ac 3’ end and 238bp of the 5’ end are sufficient for Ds excision comparable to fully functional 3’ and 5’ TIRs, in tobacco. Therefore, we included 217 base pairs of the Ac 3’ end and 255bp of Ac 5’ end in the pNIPB3 construct (Figure 2). In this construct the TIRs are reversed and therefore face each other. The TIRs are separated by the gene iaaH ( indole acetamide hydroxylase ) (Schroder et al., 1984), a negative selection marker gene, under the transcriptional control of 2' promoter. Indole acetamide hydroxylase converts naphthalene acetamide (NAM) to naphthalene acetic acid (NAA), which is an auxin. When plants carrying the iaaH gene are grown on media containing NAM, the NAA produced by indole acetamide hydroxylase will affect plant development and the plants show a predominant hairy or knotted root phenotype. This selection serves as a screen for plants in which transposition of the reversed Ds ends has resulted in loss of functional iaaH gene. A bacterial origin of replication ( ori ) and the β lactamase ( bla ) gene are included between the T DNA borders of pNIPB3 to facilitate plasmid rescue of the T DNA insertion locus in the plant genome. Plant selection marker genes — npt II (resistance to kanamycin) and bar (resistance to bialaphos) — are included on either side of the reversed Ds ends. When one of the selection marker genes is deleted by a rearrangement the other could be used to select plants in the following generation.
21
Generation of Arabidopsis lines containing a single copy of the reversed ends Ds construct Arabidopsis ( NoO ) plants carrying rbcS :Ac 1017 3 (obtained from Candace Waddell) (Honma et al., 1993) were transformed by floral dip method (Clough et al.,
1998) using Agrobacterium (GV1303) carrying the pNIPB3 construct. The T 1 seeds were selected on bialaphos media, and DNA blot hybridization performed to identify single copy insertion lines. Three single copy insertion lines – C15, C17 & C42 – were identified and plasmid rescue was used to determine the locus of T DNA insertion in these plants (Figure 3). Sometimes the T DNA insertion process introduces some genome rearrangement flanking the T DNA borders (Nacry et al., 1998; Laufs et al., 1999; Tax and Vernon, 2001). In the C15 line, the right border of the T DNA is associated with one such rearrangement where a large segment of chromosome 2 is copied onto chromosome 1. Limited molecular analysis suggests that the segment of chromosome 2 sequence located adjacent to the T DNA is about 3.5Mb; however, the precise junction of chromosome 1 chromosome 2 could not be determined. Southern hybridization and PCR results show that this sequence is also present at its normal location on chromosome 2 (data not shown).
Screening for rearrangements in the single copy insertion lines
The T 2 seeds were sown on media containing NAM in combination with bialaphos or kanamycin. The resistant plants carrying putative rearrangements were transferred to soil. Most selections were done using bialaphos plus NAM because we could identify lines which retained the ori/bla sequence for plasmid rescue. In our experiment we observed that the NAM selection is not a reliable negative selection. Therefore, the NAM selection served only to enrich for plants with rearrangements, and we relied on DNA blot hybridization to confirm loss of the iaaH gene from apparently ‘NAM resistant’ plants. Southern blot analysis of these plants confirmed the presence or absence of the ori/bla , nptII and iaaH fragments respectively. Figure 4 shows a representative autoradiogram. The unrearranged transgene gives EcoRI fragments of 3.2 kb when probed with ori/bla . Most of the plants tested show a clear alteration in the size of the ori/bla hybridizing fragment, indicating the presence of rearranged DNA in that
22 sample. The iaaH probe should hybridize to a 1.5 kb and 3.2 kb fragments; absence of this fragment on the Southern indicates rearrangement at the reversed ends Ds and subsequent loss of the iaaH fragment. Similarly, absence of the nptII hybridizing fragment indicates deletion of that fragment as a result of rearrangement. The site of insertion of the 5’ TIR in plants carrying genome rearrangements was determined using plasmid rescue.
Deletion, duplication, inversion, translocation and local rearrangement are formed by reversed ends transposition The various rearrangements (Figure 5) derived from the NIPB3 carrying plants are listed in Table 1. Most of the rearrangements (19/33) identified are deletions, however ten insertions were also identified. In addition to deletions and inversions, other kinds of rearrangements were observed at the reversed ends Ds element. These include one local rearrangement, where the transposon ends insert into the iaaH gene, a chromosome 1 – chromosome 2 translocation, and a putative ring chromosome. The translocation and the ring chromosome were detected only in the somatic tissue, whereas the local rearrangement was germinally transmitted. In 50% of plants that were selected to be NAM resistant, by a PCR based screen we detected a rearrangement in which the 5’ and the 3’ ends ligated together with concomitant deletion of the iaaH gene.
The TIRs could insert flush or generate an 8bp or 1bp Target Site Duplication In ten plants, plasmid rescue of the rearrangement and sequencing of the rescued plasmid with a primer on the 5’end indicated the presence of an inversion. PCR analysis of the 3’ end insertion was used to confirm that the rearrangements are indeed inversions. All the PCR products sequenced confirmed an inversion as predicted based on the 5’TIR insertion site. Further, we noticed that, of the 9 inversions that were characterized for both 5’TIR and 3’TIR insertions, three inversions carried a duplication of 8bp flanking the 5’ and 3’ TIR. Whereas, 2 inversions had only 1bp target site duplication and the other 4 lacked any target site duplication, i.e.were flush insertions (Table 2).
23
Ac transposase can use 5’- and 3’-Ds ends on the same chromatid or sister- chromatids to effect transposition In the line C17, the T DNA is inserted in chromosome 1 in such a way that the ori/bla sequence and the bar gene are proximal (i.e. closer to the centromere) to the 5’ terminus of the reversed ends transposon. In two of the rearrangement events derived from C17 (#13 and #14, Table 1), the 5’ TIR had inserted proximal to the T DNA insertion site and the sequence reads towards the T DNA. One possible mechanism that could result in such an insertion is ‘same chromatid transposition’: the transposase excises the 5’ and 3’ TIR on the same chromatid, and inserts the transposon at a proximal site, deleting the circular DNA formed by insertion of the 5’TIR (see iv in Figure 1). This would imply that the rescued plasmid in this rearrangement event is derived from the deleted acentric circular DNA, which is probably unlikely considering the limitations of plasmid rescue technique to detect a single, rare circular molecule. Therefore we considered an alternative ‘sister chromatid transposition’ mechanism wherein the 5’ TIR of one chromatid inserts proximal to the T DNA in the sister chromatid (Figure 7). Such insertion would result in reciprocal deletion and duplication of the DNA proximal to the T DNA. Also, in the chromatid carrying duplication of the chromosomal DNA, the iaaH segment of the transgene will be present as tandem duplication. To determine whether the rearrangement of interest is formed by same or sister chromatid transposition, we tested for presence of tandem duplication of the iaaH gene in C17I genomic DNA (#13 in Table 1) by PCR. The 1.7kb PCR product corresponding to the junction of iaaH tandem duplication was sequenced and the sequence result confirms the predicted tandem duplication of the iaaH gene.
Discussion In order to evaluate the possibility and efficacy of generating genome rearrangements in Arabidopsis by using a Ds element with the TIRs engineered to face each other, we generated transgenic Arabidopsis lines carrying the NIPB3 construct and screened the progeny for genome rearrangements in the genome. Our results clearly indicate that reversed ends Ds elements can efficiently generate deletions and inversions.
24
In addition, this system is also capable of generating chromosomal translocations and ring chromosomes.
Deletions and inversions are common Of the 33 rearrangements we have characterized, 19 are deletions and 10 are inversions. The deletions generated from a line form a sequential deletion series; for example, the deletions generated from the C17 line vary over a range 338bp, 742bp, 3.9kb, 8.8kb, 11.6kb, 15.4 kb, 17.5kb, 23kb, 61kb, 236kb, 405kb, 435kb, 1.13MB (Figure 6). (These numbers indicate the bases deleted from the genome. The total length of deleted DNA includes 2kb from within the T DNA.) This clearly demonstrates the potential of the reversed ends transposon system to cause chromosomal deletions. Likewise, the inversions also vary over a range of 17.5kb to 2.4Mb, and the rearrangement in these lines may be useful as balancer chromosomes for the region inverted. The main interest in studying rearrangements at the reversed transposon ends is the generation of nested deletions. Deletions are highly useful tools in genetic studies for mapping genes and for dissection of complex loci. Targeted deletions could be used to remove one or few copies of tandem repeats of genes and study dosage effect. In mutant screens to identify non lethal recessive mutations, when a deletion heterozygote is used as a starting material, the mutants can be identified in just one generation. Gamma irradiation has been used as a tool to generate deletions. Because irradiation is a random process it is tedious to screen for deletions in the desired locus. In addition, irradiation could also introduce rearrangements and mutations at other loci and therefore complicate recovery and analysis of such plants. Tools that can generate targeted deletions can overcome these drawbacks. The cre/lox recombination system has been successfully used in mice (Ramirez Solis et al., 1995; Li et al., 1996; Wagner et al., 1997; Zeh at al., 1998), tobacco (Dale and Ow, 1990; Bayley et al., 1992; Russell et al., 1992; Medberry et al., 1995) and Arabidopsis (Russell et al., 1992; Osborne et al., 1995) to generate locus specific genome rearrangements. A combination of the cre/lox recombination system and Ds transposable element ( Ds lox /cre) has been used in chromosome engineering as follows (Osborne et al.,
25
1995): transgenic plants are generated with a construct carrying two lox sites, one within a Ds element and one outside the Ds element. As a first step, an Ac encoded transposase effects a transposition of the Ds lox element preferably to a nearby site. In the following generation the CRE recombinase expression is turned on or introduced to the plant. CRE mediated recombination between the 2 lox sites will result in deletion or inversion of the intervening DNA segment. A collection of over ten thousand Arabidopsis T DNA insertion lines carrying a Ds lox element has been generated by Woody et al. (2007). Each of these lines could be used as a Ds launch pad for local saturation mutagenesis, by introducing Ac transposase expression in the lines. Further, once the Ds element has transposed, a cre expressing line could be crossed into this system. CRE mediated recombination between the lox sites (one on the T DNA and the other on the transposed Ds element) could generate deletions in the genome. The reversed Ds ends transposition system described here has certain distinct advantages over the Ds lox /Cre system discussed above. First, to generate a series of sequential deletions using the Ds lox system, several lines of Ds transposed lines have to be generated, and each such line can give rise to only one deletion or inversion depending on the relative orientation of the lox sites. In contrast, the reversed Ds ends system can generate a series of deletions and inversions from a single line. Further, in Arabidopsis, many of the germinal excision events occur late in the development (Bancroft and Dean, 1993), likely after the determination of cell lines leading to the formation of the pollen and ova. As a result a majority of the germinal events observed are independent events. Therefore, it is possible to generate a series of nested deletions or inversions even from a single plant. Second, the Ds lox system involved several steps of crossing in/crossing out or inducing/silencing the expression of the Ac transposase and cre recombinase genes. Whereas, the reversed end Ds system is a single step process, and once the transgene insertion locus is identified, one can screen for rearrangements within one generation.
Mechanistic variation in Ds insertion in Arabidopsis During transposon insertion, the transposase makes a staggered cut at the target site, which is repaired to form direct repeats flanking the transposon. The size of this stagger, and therefore the flanking direct repeat, is characteristic of each family of
26 transposon. The Ac/Ds elements in maize are flanked by 8 bp target site duplications (Muller Neumann et al., 1984; Pohlman et al., 1984). Insertion of the Ac/Ds element in the tobacco genome is also accompanied by 8 bp target site duplications (Hehl et al, 1990). However it is not evident whether the generation of an 8 bp target site duplication is a property of the transposase or that of other factors that could be involved in the transposition reaction. Recent high throughput studies on Ds flanking sequence in Arabidopsis by Kuromori et al (2004) and Ito et al (2005) indicate that only about 40% of Ds insertions are flanked by 8 bp target site duplications. However, these two studies did not report the nature of the Ds element flanking sequence in the remaining 60% of insertions. In our lines, of the nine inversions generated by transposition at the reversed Ds ends, three of the events bear an 8 bp duplication and another two have just one base pair duplication flanking the TIRs, while the other four are flush insertions. This suggests that the mechanism and/or host factors involved in Ac/Ds insertion in Arabidopsis could be different from maize in some ways which could result in higher frequency of insertions without the typical 8 bp target site duplication. One possible explanation for the flush and single nucleotide duplication at the transposon target site is a non homologous end joining (NHEJ) repair mechanism between the excised transposon ends and the target site. However, a NHEJ repair would sometimes involve loss of a few nucleotides at the broken ends. Absence of such deletions at the target site in the inversions does not favor this model.
Both sister-chromatid rearrangement and same-chromatid rearrangement are observed Genetic studies in maize have shown that Ac elements commonly transpose during or immediately after the S phase of the cell cycle, and that one of the two replicated elements is more competent to transpose (Greenblatt and Brink, 1962; Greenblatt, 1984; Chen et al., 1987, 1992). This phenomenon is called chromatid selectivity and is thought to be controlled by the methylation state of the transposon ends. According to the model proposed by Wang et al. (1996), following DNA replication, the 5’ ends on both sister chromatids are equally transposition competent, whereas, only one
27 of the two 3’ ends are transposition competent based on the strand specific methylation pattern. In a standard transposition reaction at a state II Ds element, although it is theoretically possible for a transposition competent 3’ end on one chromatid to engage in a transposition complex with the 5’ end on the sister chromatid, no such event has been reported. According to this model, when the transposon ends are present as direct repeats, the transposition reaction would involve the ends on sister chromatids. English et al (1995) observed that transposition at a “half double Ds ” element (a 5’ end and a 3’ end present as direct repeats) predominantly used the transposon ends on sister chromatids as substrate. In contrast, when the Ds ends are in reversed orientation, the methylation pattern of the DNA strands is likely to be similar to the methylation pattern on a standard transposon and therefore it is expected that transposition at reversed ends would also involve only the ends on the same chromatid. In a study on transposition at reversed Ds ends at the P locus in maize, Zhang and Peterson (2004) observed that transposition involved the two reversed ends on the same chromatid. In this study, we observed a proximal deletion in the C17 line and molecular analysis suggests that transposition at the reversed ends Ds in Arabidopsis could involve the ends on sister chromatids (Figure 7). However, sequence analysis of the inversions and the local rearrangement we have generated show that these are product of same chromatid rearrangement. Therefore, our results indicate the possibility of both same chromatid transposition and sister chromatid transposition at reversed ends Ds element in Arabidopsis. Because the methylation pattern of the termini in reversed ends Ds element is similar to the methylation pattern of the termini in a standard transposon, we suggest that sister chromatid transposition may also be possible at standard Ds elements in Arabidopsis.
Both somatic and germinal rearrangements are observed Of the thirty three rearrangements we have characterized, only ten rearrangements were shown to be heritable based on their detection from more than one plant (sibling or progeny). There are several possible reasons that the other rearrangements were not detected in multiple progeny. One possibility is that many of the rearrangements occurred in the somatic tissue from which genomic DNA was isolated, and that these
28 rearrangements were not included in the cells that gave rise to gametophytes. It is also likely that some of these rearrangements occurred late during the development of the gametophyte and therefore contribute to a very small fraction of the seed pool. Because our screen did not include all the seeds from a plant, we might not have detected rearrangements that occurred infrequently in the sibling plants. Thirdly, if the rearrangement deletes or alters the expression of a gene critical for gametophyte development such rearrangements will not be transmitted through the germ line. However it is worth noting that a low germinal transmission of reversed ends Ds element mediated genome rearrangements is not a limitation of this system per se . In Arabidopsis, the germinal transmission of Ds transposition depends on several factors including but not limited to the promoter driving the expression of the transposase, the position of the Ac gene in the genome and the position of the Ds element in the genome. Swineburne et al compared the frequency of Ac excision in Arabidopsis when the transposase is expressed under ocs , nos and 35S promoters (Swinburne at al., 1992). They demonstrated that, in Arabidopsis, both germinal and somatic excision frequencies increase with increased Ac transposase transcript level. However, even genetically identical plants show varying somatic and germinal excision frequencies . Honma et al. (1993) studied high frequency germinal transposition of Ds ALS in Arabidopsis. They compared the frequency of Ds excision when the Ac transposase ( Ac st ) expression is driven by 35S, rbcS , or CHS promoter. CHS Ac st resulted in low germinal excision frequencies of 0.4% and 0.9%. Although they observed a maximal germinal excision frequency of 64% in the F2 generation of 35S Ac st lines, and 28% and 67% in the F2 and F3 generations respectively of rbcS Ac st lines, there is high variability not only between different lines but also between the F2 plants derived from the same cross. For example, many of the plants showed a <2% germinal excision frequency. In a study on the influence of various factors that might affect the frequency of germinal and somatic excision of maize Ds element in Arabidopsis (Bancroft and Dean, 1993), five different Ds lines (all single locus, single copy) showed significant differences in the germinal and somatic excision frequencies between the different lines, indicating that the position of the element in the genome has an influence on the excision frequency. Additionally, environmental factors could influence the germinal frequency of
29
Ds transposition. Bancroft and Dean observed a three fold difference in the germinal excision frequency between plants grown in green house and those grown under sterile conditions. This implies one or more environmental factors such as intensity, duration and quality of light, temperature and humidity might affect the germinal transmission of Ds mediated rearrangements in Arabidopsis. In our experiments we used the rbcS Ac C 1017 6 line generated by Honma et al. The exact germinal frequency of Ds excision by this line is not available. However, it appears that the germinal Ds excision frequency is not as high as 28% as observed by Honma et al with the rbcS Ac st B1056 line. Therefore, a low rate of germinal transmission of the deletion and inversions observed in our experiment may not be a limitation of the reversed ends Ds nested deletion tool. Possibly, introducing the NIPB3 construct into a line that exhibits a high frequency of germinal Ds excision would enable generation of a wider range of germinal rearrangements. Our study confirms the efficacy of this system as a functional genomics tool to generate a wide variety of informative rearrangements.
30
Figure Legends Figure 1 Transposition at reversed-ends Ds element: The transposase makes a cut (arrows in i) at the ends of the TIRs (red and green triangles). The intervening DNA is presumably lost as a circle (ii). Insertion of the transposon at a new site can result in a variety of rearrangements. Deletion and inversion are two prominent rearrangements. Insertion of the transposon ends as shown in (iii) results in deletion of the ‘B’ region (iv). Insertion of the transposon ends as shown in (v) results in inversion of the ‘B’ region (vi). Figure 2 The pNIPB3 construct: The green and red triangles represent the 3’ and 5’ ends of Ds element, respectively. The iaaH gene is the negative selection marker that confers sensitivity to naphthalene acetamide. NPTII gene confers resistance to kanamycin. BAR gene confers resistance to bialaphos. The ori/bla segment (bacterial origin of replication and beta lactamase gene conferring resistance to ampicillin) is useful for plasmid rescue of the T DNA insertion locus. LB and RB are the left and right border T DNA sequence. Figure 3 pNIPB3 insertion sites in the three lines – C15, C17 and C42: The number refers to the position of insertion of left border and right borders of T DNA, as determined by plasmid rescue. The red and green triangles are 5’ end and 3’ end respectively. ‘B’ indicates the position of the bialaphos resistance gene and ‘N’ indicates the position of the neomycin phosphotransferase gene. The RB of the T DNA in C15 is flanked by a duplication of part of chromosome 2. (chromosome and T DNA lengths are not drawn to scale) Figure 4 Southern hybridization to identify T2 plants carrying rearrangement at the reversed-ends Ds : A, B and C are autoradiograms of the same blot probed with ori/bla , npt II and iaaH DNA fragments respectively. λ HinD III DNA ladder was used as a size marker on the gel. Plants carrying rearrangement(s) are
31 identified by the absence of the iaaH band. Multiple bands when probed with ori/bla indicate hemizygosity and/or independent somatic rearrangements. Figure 5 The different types of genome rearrangements observed at the reversed ends Ds element: i. The NIPB3 construct inserted in the Arabidopsis genome. ii. A segment of Arabidopsis genome distal to the transgene is deleted along with the NPTII gene (N). iii. A segment of Arabidopsis genome proximal to the transgene is inverted along with the BAR gene (B). iv. Following excision at the TIRs, the TIRs fail to insert elsewhere in the genome, but the broken ends are joined to each other. v. The two TIRs insert into the sequence that lies in between them, resulting in a local rearranagement. vi. A pericentric insertion of one of the TIRs forms a ring chromosome. A complementary acentric chromosome is predicted, but not detected in our experiment. vii. Insertion of the transposon ends into a non homologous chromosome results in a reciprocal translocation. Figure 6 Deletion series in the C17 line: Rearrangement at the reversed ends Ds can form a series of nested deletions. Here the distal nested deletions detected in the line C17 are represented. The upper part shows all insertions; in the lower part the region of 24kb from the T DNA is enlarged. The red arrow heads represent the site of insertion of the 5’ TIR in these rearrangements. The sizes of deletions depicted here are 338bp, 742bp, 3.9kb 8.8kb, 11.6kb, 15.4 kb, 17.5kb 23kb, 61kb, 113kb, 116kb, 236kb, 405kb, 435kb, 1.13MB Figure 7 Sister chromatid transposition at reversed-ends Ds : When the transposase (blue circles) recognize the 5’ and 3’ ends (red and green triangles respectively) on sister chromatids, a variety of rearrangements are possible depending on
32 the site of insertion. The rearrangement depicted here contains a deletion in one chromatid, and a corresponding duplication in the other chromatid. One characteristic of this rearrangement is the formation of tandem duplication of the iaaH gene, which can be detected by PCR using oligos represented by the arrows in the bottom illustration. The predicted sequence of the junction of tandem iaaH and the sequence from the PCR product are given below.
33
Figure 1 Transposition at reversed-ends Ds element
34
Figure 2 The pNIPB3 Construct
35
Figure 3 pNIPB3 T-DNA insertion sites in the three lines – C15, C17 and C42
36
Figure 4 Southern hybridization on T2 generation plants of C15 and C17 lines
EcoR1 digested and ori/bla probed 23.1 A 9.4 6.5 .
3.2 2.3 2.0
λH3 15F 15G 17F 17G 17H 17i 17J 17K 17L 17M 17N 17O 17P 17Q 17R 17S 17T
23.1 EcoR1 digested and NPT II probed B
9.4 6.5
2.3 2.0 2.1
λH3 15F 15G 17F 17G 17H 17i 17J 17K 17L 17M 17N 17O 17P 17Q 17R 17S 17T
23.1 EcoR1 digested and iaaH probed C 9.4 6.5
3.2
2.3 2.0 1.5 λH3 15F 15G 17F 17G 17H 17i 17J 17K 17L 17M 17N 17O 17P 17Q 17R 17S 17T
37
Figure 5 The different types of genome rearrangements observed at the reversed- ends Ds element
38
Figure 6 Deletion series in the C17 line
39
Figure 7 Sister chromatid transposition at reversed-ends Ds
40
Table1: Various rearrangements generated by the reversed ends Ds construct Parent line 5’ TIR insertion site Nature of Size of the # of genes and Plant ID rearrangement rearrangement in the region 1 C15 13459814 + deletion 157bp 0 Ecl1 chr.2 (germinal) 2 C15 13459948 + deletion 290bp 0 RER137 chr.2 (germinal) 3 C17 24572418 + deletion 338bp 0 PH89cl2 chr.1 (germinal) 4 C17 24573498 + deletion 742bp 0 PRJcl1 chr.1 (germinal) 5 C17 24576671 + deletion 3.9kb 1 NK13cl4 chr. (germinal) 6 C17 24581566 + deletion 8.8kb 4 PRKcl1 chr.1 (germinal) 7 C17 24584359 + deletion 11.6kb 4 Rcl2 chr.1 8 C42 25575593 deletion 14.5kb 5 chr.1 9 C17 24588238 + deletion 15.5 kb 6 NK6cl6 chr.1 10 C17 24593885 + deletion 17.5kb 8 K chr.1
11 C17 24595755 + deletion 23kb 8 Icl2 and chr.1 (germinal) I4cl1 12 C17 24634219 + deletion 61.4kb 18 PROh1cl1 chr.1 13 C17 24458978 + deletion 113kb 27 Qcl3 chr.1 14 C17 24456006 + deletion 116kb 28 Icl4 chr.1 15 C17 24809216 + deletion 236kb 54 Rcl1 chr.1 16 C17 24977350 + deletion 404.6kb 105 RER237 chr.1 17 C17 25008039 + chr.1 deletion 435kb or 404kb 111 RER277cl1 or 24976576 + chr.1 18 C17 23441421 chr.1 deletion 1.13MB 305 19 C15 24581185 + chr.1 deletion 2.5Mb 637 PH65
41
Table 1 (continued) Parent line 5’ TIR insertion site Nature of Size of # of and Plant ID rearrangement rearrangement genes in the region 20 C17 24590304 Inversion 17.5kb 8 PH89cl3 chr.1 (germinal) and PH95cl2 21 C17 24511173 inversion. 61.5kb 12 PRIi3cl1 chr.1 22 C17 24720311 Inversion 147.5kb 36 Qcl2 chr.1 23 C15 24777089 Inversion 2.3Mb 47 PH65colG chr.1 24 C17 24806015 Inversion 233kb 54 Qcl6 chr.1 (germinal) 25 C17 24127891 Inversion 444.8kb 114 PH95cl3 chr.1 26 C17 23567105 Inversion 1Mb 270 PROh6cl1 chr.1 27 C15 14459689 Inversion or 999kb 289 RER43cl3 chr.2 reciprocal translocation 28 C15 24806015 Inversion 2.3Mb 586 RER108cl3 chr.1 29 C15 24669513 Inversion 2.4Mb 616 RER108cl3 chr.1
30 C15 Insertion into the ‘local 1.4kb 0 RER151 iaaH gene rearrangement’ 31 Several Fused ends Fused ends Fused ends 0
32 C17 540311 + Ring 24Mb chr.1 chromosome 33 C17 16122026 Reciprocal chr1 chr.2 Ohcl2 chr.2 translocation chimera (The number refers to the position on the chromosome. + or – refers to the + and – strand of chromosome 1, respectively, as inferred from Arabidopsis genome sequence database.)
42
Table 2: Reversed ends Ds element generated inversions: the Target Site Duplication could be 8bp or 1bp long. But in 4/9 cases, the insertion is flush. Parent line 5’TIR 3’TIR Target site Size of # of genes and Plant ID insertion site insertion duplication inversion in the region (p. rescue) site (PCR) C17, 24806015 24806016 Flush 233 kbp 54 Qcl6 and chr.1 + chr.1 insertion (germinal) Ii4cl1 C17 24590304 24590305 Flush 17548 bp 8 (germinal) PH89cl3 and chr.1 + chr.1 insertion PH95cl2 C15Q 24669513 24669506 8bp 2.4 Mbp 616 RER108cl3 chr.1 + chr1 C15Q 24806015 24806016 Flush 2.3 Mbp 586 RER108cl4 chr.1 + chr1 insertion C15Q 14459689 14459689 1bp 999 kbp 289 RER43 3 chr.2 + chr2 C17 24127891 24127891 1bp 444 kbp 114 PH95col3 chr.1 + chr.1 C17 24511173 24511166 8bp 60.5 kbp 12 PRIi3cl1 chr.1 + chr.1 C17 23567105 23567098 8bp 1 Mbp 281 PROh6cl1 chr.1 + chr1 C17 24777089 24777091 Flush 205.5 kbp 48 PH65colG chr.1 + chr1 insertion (The number refers to the position on the chromosome. + or – refers to the + and – strand of chromosome 1, respectively, as inferred from Arabidopsis genome sequence database.)
43
References Bancroft I, Dean C. Factors affecting the excision frequency of maize transposable element Ds in Arabidopsis thaliana , Mol. Gen Genet (1993) 240: 65 72. Bayley CC, Morgan M, Dale EC, Ow DW. Exchange of gene activity in transgenic plants catalyzed by the Cre lox site specific recombination system, Plant Mol Biol. 1992 Jan; 18(2):353 361. Bhave MR, Lawrence S, Barton C, Hannah LC. Identification and molecular characterization of shrunken 2 cDNA clones of maize, Plant Cell. 1990 Jun; 2(6):581 588. Burr B, Burr FA. Ds controlling elements of maize at the shrunken locus are large and dissimilar insertions, Cell. 1982 Jul; 29(3):977 986. Chaleff D, Mauvais J, McCormick S, Shure M, Wessler S, Fedoroff N. Controlling elements in maize, Carnegie Inst. Wash. Yearbook. 1981, 80, 158 174. Chen J, Greenblatt IM, Dellaporta SL. Transposition of Ac from the P locus of maize into unreplicated chromosomal sites, Genetics. 1987 Sep;117(1):109 116. Chen J, Greenblatt IM, Dellaporta SL. Molecular analysis of Ac transposition and DNA replication, Genetics. 1992 Mar;130(3):665 676. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana , Plant J. 1998 Dec; 16(6):735 743. Coupland G, Plum C, Chatterjee S, Post A, Starlinger P. Sequences near the termini are required for transposition of the maize transposon Ac in transgenic tobacco plants, Proc Natl Acad Sci U S A. 1989 Dec; 86(23):9385 9388. Courage Tebbe U, Doring HP, Fedoroff N, Starlinger P. The controlling element Ds at the Shrunken locus in Zea mays : structure of the unstable sh m5933 allele and several revertants, Cell. 1983 Sep; 34(2):383 393. Dale EC, Ow DW. Intra and intermolecular site specific recombination in plant cells mediated by bacteriophage P1 recombinase, Gene. 1990 Jul 2; 91(1):79 85. Doring HP, Nelsen Salz B, Garber R, Tillman E. Double Ds elements are involved in specific chromosome breakage, Mol. Gen. Genet. 1981 219, 299 305.
44
Doring HP, Pahl I, Durany M. Chromosomal rearrangements caused by the aberrant transposition of double Ds elements are formed by Ds and adjacent non Ds sequences, Mol Gen Genet. 1990 Oct; 224(1):40 48. English JJ, Harrison K, Jones J. Aberrant Transpositions of Maize Double Ds Like Elements Usually Involve Ds Ends on Sister Chromatids, Plant Cell. 1995 Aug; 7(8):1235 1247. Fedoroff N, Mauvais J, Chaleff D. Molecular studies on mutations at the Shrunken locus in maize caused by the controlling element Ds , J Mol Appl Genet. 1983; 2(1):11 29. Greenblatt IM. A Chromosome Replication Pattern Deduced from Pericarp Phenotypes Resulting from Movements of the Transposable Element, Modulator, in Maize, Genetics. 1984 Oct;108(2):471 485 Greenblatt IM, Brink RA. Twin Mutations in Medium Variegated Pericarp Maize, Genetics. 1962 Apr;47(4):489 501. Hehl R, Baker B. Properties of the maize transposable element Activator in transgenic tobacco plants: a versatile inter species genetic tool, Plant Cell. 1990 Aug; 2(8):709 721. Honma MA, Baker BJ, Waddell CS. High frequency germinal transposition of Ds ALS in Arabidopsis, Proc Natl Acad Sci U S A. 1993 Jul 1; 90(13):6242 6246. Ito T, Motohashi R, Kuromori T, Noutoshi Y, Seki M, Kamiya A, Mizukado S, Sakurai T, Shinozaki K. A resource of 5,814 dissociation transposon tagged and sequence indexed lines of Arabidopsis transposed from start loci on chromosome 5, Plant Cell Physiol. 2005 Jul; 46(7):1149 1153. Epub 2005 Apr 19. Jones RN. McClintock's controlling elements: the full story, Cytogenet Genome Res. 2005; 109(1 3):90 103. Kuromori T, Hirayama T, Kiyosue Y, Takabe H, Mizukado S, Sakurai T, Akiyama K, Kamiya A, Ito T, Shinozaki K. A collection of 11 800 single copy Ds transposon insertion lines in Arabidopsis, Plant J. 2004 Mar; 37(6):897 905. Laufs P, Autran D, Traas J. A chromosomal paracentric inversion associated with T DNA integration in Arabidopsis, Plant J. 1999 Apr; 18(2):131 139.
45
Li ZW, Stark G, Gotz J, Rulicke T, Gschwind M, Huber G, Muller U, Weissmann C. Generation of mice with a 200 kb amyloid precursor protein gene deletion by Cre recombinase mediated site specific recombination in embryonic stem cells, Proc Natl Acad Sci U S A. 1996 Jun 11; 93(12):6158 6162. Martinez Ferez IM, Dooner HK. Sesqui Ds , the chromosome breaking insertion at bz m1 , links double Ds to the original Ds element, Mol Gen Genet. 1997 Aug; 255(6):580 586. Medberry SL, Dale E, Qin M, Ow DW. Intra chromosomal rearrangements generated by Cre lox site specific recombination, Nucleic Acids Res. 1995 Feb 11; 23(3):485 490. Müller Neumann, M., Yoder, J.I., and Starlinger, P. (1984). The DNA sequence of the transposable element Ac of Zea mays L., Mol. Gen. Genet. 1984 198, 19 24. Nacry P, Camilleri C, Courtial B, Caboche M, Bouchez D. Major chromosomal rearrangements induced by T DNA transformation in Arabidopsis, Genetics. 1998 Jun; 149(2):641 650. Odell JT, Hoopes JL, Vermerris W. Seed specific gene activation mediated by the Cre/lox site specific recombination system, Plant Physiol. 1994 Oct; 106(2):447 458. Osborne BI, Wirtz U, Baker B. A system for insertional mutagenesis and chromosomal rearrangement using the Ds transposon and Cre lox , Plant J. 1995 Apr; 7(4):687 701. Pohlman RF, Fedoroff NV, Messing J. The nucleotide sequence of the maize controlling element Activator , Cell. 1984 Jun; 37(2):635 643. Ralston E, English J, Dooner HK. Chromosome breaking structure in maize involving a fractured Ac element, Proc Natl Acad Sci U S A. 1989 Dec; 86(23):9451 9455. Ramirez Solis R, Liu P, Bradley A. Chromosome engineering in mice, Nature. 1995 Dec 14; 378(6558):720 724. Russell SH, Hoopes JL, Odell JT. Directed excision of a transgene from the plant genome, Mol Gen Genet. 1992 Jul; 234(1):49 59.
46
Schroder G, Waffenschmidt S, Weiler EW, Schroder J. The T region of Ti plasmids codes for an enzyme synthesizing indole 3 acetic acid, Eur J Biochem. 1984 Jan 16;138(2):387 391. Swinburne J, Balcells L, Scofield SR, Jones JD, Coupland G. Elevated levels of Activator transposase mRNA are associated with high frequencies of Dissociation excision in Arabidopsis, Plant Cell. 1992 May; 4(5):583 595. Tax FE, Vernon DM. T DNA associated duplication/translocations in Arabidopsis. Implications for mutant analysis and functional genomics, Plant Physiol. 2001 Aug; 126(4):1527 1538. Wagner KU, Wall RJ, St Onge L, Gruss P, Wynshaw Boris A, Garrett L, Li M, Furth PA, Hennighausen L. Cre mediated gene deletion in the mammary gland, Nucleic Acids Res. 1997 Nov 1; 25(21):4323 4330. Wang L, Heinlein M, Kunze R. Methylation pattern of Activator transposase binding sites in maize endosperm, Plant Cell. 1996 Apr; 8(4):747 758. Weck E, Courage U, Doring HP, Fedoroff N, Starlinger P. Analysis of sh m6233 , a mutation induced by the transposable element Ds in the sucrose synthase gene of Zea mays , EMBO J. 1984 Aug; 3(8):1713 1716. Weil CF, Wessler SR. Molecular evidence that chromosome breakage by Ds elements is caused by aberrant transposition, Plant Cell. 1993 May; 5(5):515 522. Werr W, Frommer WB, Maas C, Starlinger P. Structure of the sucrose synthase gene on chromosome 9 of Zea mays L., EMBO J. 1985 Jun; 4(6):1373 1380. Woody ST, Austin Phillips S, Amasino RM, Krysan PJ. The WiscDsLox T DNA collection: an arabidopsis community resource generated by using an improved high throughput T DNA sequencing pipeline, J Plant Res. 2007 Jan;120(1):157 65. Epub 2006 Dec 21. Zeh K, Andahazy M, O'Gorman S, Baribault H. Selection of primary cell cultures with cre recombinase induced somatic mutations from transgenic mice, Nucleic Acids Res. 1998 Sep 15; 26(18):4301 4303. Zhang J, Peterson T. Genome rearrangements by nonlinear transposons in maize, Genetics. 1999 Nov; 153(3):1403 1410.
47
Zhang J, Peterson T. Transposition of reversed Ac element ends generates chromosome rearrangements in maize, Genetics. 2004 Aug; 167(4):1929 1937. Zhang J, Peterson T. A segmental deletion series generated by sister chromatid transposition of Ac transposable elements in maize, Genetics. 2005 Sep; 171(1):333 344. Epub 2005 Jun 18.
48
CHAPTER 3: ‘FUSED-ENDS’ REARRANGEMENT AT REVERSED-ENDS DS ELEMENT IN ARABIDOPSIS: IMPLICATIONS FOR THE FATE OF FREE TRANSPOSON ENDS FOLLOWING EXCISION
Abstract Transposition of transposable elements involves several biochemical steps. For many transposons, the molecular details of the reaction intermediates in this process are not evident. We studied transposition at reversed Ds ends in Arabidopsis. We observed that in about 50% of the plants carrying a rearrangement at the reversed ends Ds element, the transposon termini were ligated together. Analysis of the sequences at these putative aborted transposition reactions suggests that the excised ends of the transposon form covalently closed hairpin structures between the two strands. Based on our observations we also propose a novel method to remove selection marker genes from transgenic plants.
Introduction The maize Ac/Ds transposable elements are members of the hAT transposon superfamily which also includes the hobo element of Drosophila and the Tam3 element of Antirrhinum majus . The hAT elements transpose by a cut and paste mechanism. Transposition is believed to occur in a sequential manner (Robbins et al., 1989): one of the two ends of the transposon is excised first and ligated to the target site, followed by excision of the other transposon end and insertion at the recipient site. Repair of the gap at the donor site leaves a small sequence change known as a footprint. While repair of broken ends at the donor site has been studied in some detail, little is known about the fate of the Ac transposon ends following excision. Recently we reported that reversed ends Ds in Arabidopsis can give rise to various genome rearrangements (Krishnaswamy et al., 2007). In addition, we observed several cases in which the transposon ends were ligated together. Here we present detailed sequence analysis of the fused Ds ends junction, and compare our results to the observations of Gorbunova and Levy (1997, 2000) in tobacco protoplasts. We also discuss the
49 implications of these findings in terms of differences in DNA repair machinery between different species.
Results and Discussion
The fused-ends rearrangement mimics circularized Ds elements We studied transposition mediated genome rearrangement at reversed Ds termini in Arabidopsis lines carrying a single copy of the pNIPB3 construct (Figure 1). pNIPB3 has 217bp of the 3’ and 255bp of the 5’ Ac termini cloned in reverse orientation, with the 11bp terminal inverted repeats (TIRs) facing each other. The negative selection marker gene indole acetamide hydroxylase ( iaaH ) under the transcriptional regulation of the 2’ promoter is cloned between the reversed Ds ends. The construct has phosphinothricin acetyltransferase (bar, confers resistance to bialaphos) and neomycin phosphotransferase (npt II , confers resistance to kanamycin) cloned on either side of the transposon sequences. A bacterial origin of replication and beta lactamase gene are also included in the T DNA to facilitate plasmid rescue of the T DNA insertion site and rearrangement breakpoints. This construct was introduced into Arabidopsis ( NoO ) plants carrying rbcS :Ac 1017 3 (obtained from Candace Waddell) (Honma et al., 1993) by floral dip method (Clough and Bent, 1998). We identified three single copy insertion lines – C15, C17 and C42 – by Southern hybridization. We screened the seeds from these lines on media containing naphthalene acetamide (NAM), and seedlings resistant to NAM were transferred to soil. We carried out molecular characterization of these plants by Southern hybridization, plasmid rescue and PCR (as described in Krishnaswamy et al., 2007) to determine the nature of transposition mediated rearrangement. Transposition at the reversed Ds ends results in a variety of rearrangements including deletion, duplication, inversion and translocation (Krishnaswamy et al., 2007). In addition, 37/74 of the plants (as determined by PCR; data not shown) which were NAM resistant had the two Ds termini fused head. We sequenced the fused ends junctions from both PCR amplified products and plasmid rescued clones. Many of the fused ends had several bases deleted from both the TIRs (Table 1), while in others, in
50 addition to deletion of a few bases, one or more nucleotides were inserted between the TIRs (Table 2). Gorbunova and Levy (1997) identified extrachromosomal Ac/Ds elements circularized by fusion of the 5’ and 3’ ends in tobacco protoplasts and suggested that the extrachromosomal circles are products of aborted transposition. Sequence analysis of the circularized elements revealed that the fused junctions contained both deletions and insertions (Gorbunova and Levy 2000). Our results in Arabidopsis are similar to those observed in tobacco protoplast. The deletions observed in Arabidopsis are usually smaller than those reported in tobacco (0 to 12 bp in Arabidopsis vs.0 to 41 bp in tobacco). One case in Arabidopsis exhibited a 168bp deletion from the 3’end. Similarly, while the insertions at the repair junctions in Arabidopsis were 0 – 5bp, the insertions at the fused ends in tobacco included up to 1kb. None of the fused ends observed in Arabidopsis has both the TIRs intact. In contrast, over 50% of the fused Ac ends reported in tobacco has both the TIRs intact without any deletion. In both Arabidopsis and tobacco the double strand break is caused by Ac transposase; therefore it seems likely that the differences observed are due to differences in the repair machinery between the two plants. Consistent with this view, Orel and Puchta (2003) observed that broken DNA ends are more stable in tobacco than in Arabidopsis due to lower DNA exonuclease activity and/or due to better protection of the broken ends. Based on this observation it was hypothesized that in organisms with smaller genomes, such as Arabidopsis, a higher exonucleolytic activity at broken DNA ends could have contributed to a decrease in genome size over evolutionary time scale. Our results support this view, and also suggest that less extensive copying of filler DNA at the broken ends could have also limited the growth of the Arabidopsis genome. In maize, McClintock observed that inheritance of an excised Ac was not 100% complete, and sometimes reinsertion of an excised Ac remained undetected. Loss of an excised element was also reported for the Modulator element (an allele of Ac ) at the maize P locus (Greenblatt, 1984), and the Ac element at the maize bronze locus (Dooner and Belachew, 1989). Similar phenomena of Ac loss were reported in tobacco (Jones et al., 1990) and Arabidopsis (Altmann et al., 1992, Dean et al., 1992). Though transposition to sister chromatids and meiotic segregation are possible reasons for not
51 detecting an excised element in the next generation, an alternative explanation is failure of the excised element to reinsert, although the excision mechanism is unclear. We suggest that the fused ends rearrangement observed at the reversed ends Ds element in Arabidopsis are also likely to be aborted transposition reactions.
Fused-ends rearrangement not detected in Maize genome: We searched the maize genome database at plantGDB 1 for the 5’ and 3’ Ac ends in tandem. In Arabidopsis we observe that the 11bp terminal sequence of the TIRs is often altered when the ends fuse. Therefore, in our search we used an E value cutoff of 1e 10 in order to detect fusions with sequence alterations. We scanned 2031 BAC sequences (315,295,023 bases in total) available at plantGDB, but detected no fused ends. However a case of apparently fused Ds ends in Arabidopsis was reported previously (Yang et al., 2004). This case involved an unusual Ds element ( Ds mmd1 ) in which the 5’ and 3’ Ds element termini are internal, whereas sequences that are internal to the element in the progenitor now form the termini. It was suggested that Ds mmd1 was formed by integration of a circular Ds element produced by abortive transposition. In molecular studies on maize in our lab, fused ends rearrangement are observed when the length of Ds ends are same as studied in Arabidopsis (217bp 3’ , and 255bp 5’ Ac termini). However, when 239 bp of the 3’ and 307bp of the 5’ Ac termini are included in the construct, then fused ends rearrangement is not detected (Zhang J et al., unpublished). This suggests that, though the shorter versions of the Ac termini are sufficient for excision of the transposon, reinsertion is less efficient compared to longer Ac termini resulting in abortive transposition.
The transposon ends may form hairpin structure Four of the fused ends sequences generated at the reversed ends Ds element in Arabidopsis include short insertions between the TIRs (Table 2). One of the fused ends contains a 5bp filler sequence between the TIRs. The five nucleotides are an inverted duplication of the last five bases on the 5’TIR [ CATCC-GGATG ], forming a palindrome.
1 http://www.plantgdb.org/ZmGDB/
52
In addition, three other events show single nucleotide filler sequences, where the filler base is complementary to the last base on the TIR. Coen et al. (1989) studied Tam3 excision footprints in Antirrhinum majus and proposed that following transposon excision, the donor site gap is repaired by formation of a hairpin structure between the two exposed strands of the DNA. Similarly, biochemical studies on the insect hAT element Hermes show that the donor site is repaired by formation of hairpin structure between the two strands (Zhou et al., 2004). Ac/Ds element transposition in yeast also involves formation of hairpin structure at the donor site (Weil and Kunze, 2000). A similar mechanism of joining broken DNA ends occurs during V(D)J recombination in antibody diversity and T cell receptor diversity generation in the vertebrate immune system (Roth et al., 1992). However, such hairpin formation at the excised transposon ends has not been reported for transposons from any higher organism. In case of the bacterial transposons Tn5 (Bhasin et al., 1999) and Tn10 (Kennedy et al., 1998), the excised transposon ends form a covalently closed hairpin between the two strands. We propose that the Ac transposon ends may also form covalently closed hairpin intermediates (Figure 2). According to our model, the transposase recognizes the 5’ and 3’ TIR and makes a double strand break (sequentially or simultaneously). This could be followed by exonucleolytic deletion of a few bases from the ends. The 3’ OH of the free end attacks the free 5’ phosphate of the complementary strand in a transesterification reaction and forms a covalently closed hairpin at the end of the TIR. One or both TIRs could form this hairpin. The hairpin structure is resolved by endonucleolytic nick on the strand forming the hairpin; depending on where the nick is made, an inverse duplication generates a palindrome. The DNA repair machinery joins the TIRs thereby fusing the two ends. This model is supported by our observations of palindromic sequences at the fused ends junctions, which may represent abortive transpositions. Whether hairpin structures are formed during normal transposition remains unclear. In the case of hermes transposable element, a hairpin intermediate could be detected at the donor site by an in vitro assay (Zhou et al., 2004), where the hairpin formed at the transposition donor site was confirmed by sequencing the hairpin forming strands. However, the Ac element system has not been
53 shown to transpose in vitro, and therefore a similar experiment is not feasible with the Ac element as yet.
Reversed-ends Ds element as a tool to remove marker genes from transgenes: In the NIPB3 construct with the reversed Ds ends, the ends are separated by 2.6kb which include the 2’ iaaH gene, a negative selection marker. In PCR analysis of DNA from vegetative tissues of T 2 plants, 50% of the plants have fused ends rearrangement with the loss of the 2’iaaH gene. Of the seventeen fused ends sequence listed in Table 1 and 2, five are detected in a sibling or a progeny plant; in several additional cases inheritance of the fused ends rearrangement was detected by PCR. This shows that the fused ends rearrangement can be germinally transmitted. We suggest that this reaction could be used for removal of marker genes from transgenic plants. In plant transformations, selection marker genes are included in the transgene construct to select for transformed plants/cells. The selection marker genes usually confer resistance to specific antibiotics or herbicides. However, once the gene for a desired trait is integrated in the transgenic plant, it is often desirable to remove the selection marker gene because of possible ecological risks and social concerns. There are several strategies devised to develop selection marker gene free transgenic plants (for detailed discussion, see review by Darbani et al., 2007). Based on our study of rearrangement at reversed Ds ends, we propose that the fused ends formation could be used to remove selection marker genes from transgenic plants (Figure 3). In addition to the gene(s) for desired trait(s) the transgene construct could carry a pair of reversed Ds ends that generate fused ends upon transposase mediated excision. A positive selection marker gene, a negative selection marker gene and a stabilized Ac transposase gene under the transcriptional control of an inducible promoter can be cloned between the Ds TIRs. The transformed plants could be screened for the expression of the positive selection marker gene. Once plant lines with desired traits are developed, the Ac transposase could be induced to express. The progeny plants could be selected for absence of the negative selection marker gene, and molecular characterization could be performed to confirm the formation of fused ends and deletion of the marker gene.
54
Acknowledgement: We thank Yuanbin Ru for his assistance with searching the maize genome database for fused Ds ends sequence.
55
Table and Figure Legends Table 1: Fused Ds TIRs with deletions: The fused ends shown here have lost several bases from both the TIRs. The number of bases lost from the 5’ and 3’ TIR are listed in the last two columns. The sequences in red are from the 5’TIR and sequences in green are from the 3’ TIR. Table 2: Fused Ds TIRs with deletions and insertions: Some of the fused ends have additional bases inserted between the fused ends. The sequences in red are from the 5’TIR; sequences in green are from the 3’ TIR; the ‘inserted’ bases are in black. Figure 1: The pNIPB3 construct: The green and red triangles represent the 3’ and 5’ ends of Ds element, respectively. The iaaH gene is the negative selection marker that makes the plant sensitive to naphthalene acetamide. NPTII gene confers resistance to kanamycin, and Bar gene confers resistance to bialaphos. The ori/bla sequence (bacterial origin of replication and beta lactamase gene conferring resistance to ampicillin) is useful for plasmid rescue of the T DNA insertion locus. LB and RB are the left and right border T DNA sequence. Figure 2: Model for hairpin formation at the ends of excised transposon: i. The transposase cuts at the end of the TIRs. ii. Exonuclease activity removes some of the bases from one or both TIRs. This is followed by formation of a hairpin between the two strands at one or both TIRs. iii. The hairpin is resolved by nicking one strand. Depending on where the nick occurs, it could result in the formation of an inverse repeat sequence. iv. DNA synthesis fills in the recessed 3’ end. v. The two TIRs are ligated together. The resulting 5bp palindrome is indicated by the arrows. Figure 3: A construct design for deleting selection marker genes from transgenic plants: ‘ind.P: Ac st ’ – stabilized Ac transposase under transcriptional regulation of an inducible promoter; ‘+ SMG’ – positive selection marker gene; ‘– SMG’ – negative selection marker gene; ‘DTG’ – desired trait gene; ‘RB’ and ‘LB’ – right border and left border of the T DNA.
56
Table 1Fused Ds TIRs with deletions
57
Table 2 Fused Ds TIRs with deletions and insertions
58
Figure 1 The pNIPB3 construct
59
Figure 2 Hairpin formation at the ends of excised transposon
60
Figure 3 A reversed-ends Ds element construct to remove selection marker gene from transgenic plants
61
References
Altmann T, Schmidt R, Willmitzer L. Establishment of a gene tagging system in
Arabidopsis thaliana based on the maize transposable element Ac , Theor Appl
Genet. 1992, 84 (3/4): 371 383.
Bhasin A, Goryshin IY, Reznikoff WS. Hairpin formation in Tn5 transposition, J Biol Chem. 1999 Dec 24; 274(52):37021 37029.
Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium mediated
transformation of Arabidopsis thaliana , Plant J. 1998 Dec; 16(6):735 743.
Coen ES, Robbins TP, Almeida J, Hudson A, Carpenter R. Consequences and mechanisms of transposition in Antirrhinum majus , Mobile DNA , edited by Berg
DE and Howe MH., 1989, 413–436.
Darbani B, Eimanifar A, Stewart CN Jr, Camargo WN. Methods to produce marker free
transgenic plants, Biotechnol J. 2007 Jan;2(1):83 90. Dean C, Sjodin C, Page T, Jones J, Lister C. Behaviour of the maize transposable element
Ac in Arabidopsis thaliana , Plant J. 1992 2:69 81.
Dooner HK, Belachew A. Transposition Pattern of the Maize Element Ac from the Bz M2(ac) Allele, Genetics. 1989 Jun; 122(2):447 457.
Gorbunova V, Levy AA. Circularized Ac/Ds transposons: formation, structure and fate,
Genetics. 1997 Apr; 145(4):1161 1169.
Gorbunova V, Levy AA. Analysis of extrachromosomal Ac/Ds transposable elements, Genetics. 2000 May; 155(1):349 359.
Greenblatt IM. A Chromosome Replication Pattern Deduced from Pericarp Phenotypes
Resulting from Movements of the Transposable Element, Modulator , in Maize,
Genetics. 1984 Oct; 108(2):471 485.
62
Honma MA, Baker BJ, Waddell CS. High frequency germinal transposition of Ds ALS in Arabidopsis, Proc Natl Acad Sci U S A. 1993 Jul 1; 90(13):6242 6246.
Jones JD, Carland F, Lim E, Ralston E, Dooner HK. Preferential transposition of the
maize element Activator to linked chromosomal locations in tobacco, Plant Cell.
1990 Aug;2(8):701 707. Kennedy AK, Guhathakurta A, Kleckner N, Haniford DB. Tn10 transposition via a DNA
hairpin intermediate, Cell. 1998 Oct 2; 95(1):125 134.
Kunze R, Weil CF. hAT and CACTA plant transposons, Mobile DNA II, ed. Craig NL,
Craigie R, Gellert M, Lambowitz AM., 2002, 565 – 610. Orel N, Puchta H. Differences in the processing of DNA ends in Arabidopsis thaliana
and tobacco: possible implications for genome evolution, Plant Mol Biol. 2003
Mar;51(4):523 531. Robbins TP, Carpenter R, Coen ES. A chromosome rearrangement suggests that donor
and recipient sites are associated during Tam3 transposition in Antirrhinum majus ,
EMBO J. 1989 Jan;8(1):5 13.
Roth DB, Menetski JP, Nakajima PB, Bosma MJ, Gellert M. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid
mouse thymocytes, Cell. 1992 Sep 18; 70(6):983 991.
Saedler H, Nevers P. Transposition in plants: a molecular model, EMBO J. 1985
Mar;4(3):585 590. Weil CF, Kunze R. Transposition of maize Ac/Ds transposable elements in the yeast
Saccharomyces cerevisiae , Nat Genet. 2000 Oct;26(2):187 190.
Yang X, Ma H, Makaroff CA., Characterization of an unusual Ds transposable element in
Arabidopsis thaliana : insertion of an abortive circular transposition intermediate. Plant Mol Biol. 2004 Aug; 55(6):905 17.
63
Zhou L, Mitra R, Atkinson PW, Hickman AB, Dyda F, Craig NL., Transposition of hAT elements links transposable elements and V(D)J recombination, Nature. 2004 Dec
23; 432(7020):995 1001.
64
CHAPTER 4: AN ALTERNATE HYPOTHESIS TO EXPLAIN THE HIGH FREQUENCY OF ‘REVERTANTS’ IN Hothead MUTANTS IN ARABIDOPSIS (An article published in the Plant Biology 2)
Preface In our study on chromosomal rearrangement at reversed ends Ds in Arabidopsis described in chapter 2 and chapter 3, some of the plants in the C15 line seemed to exhibit non Mendelian inheritance of the chromosomal rearrangements. This was similar to what was reported for the hothead mutants in Arabidopsis. In the C15 line, several T2 plants germinally inherited a 2kb deletion. Surprisingly, a small number of these plants seemed to give rise to several T 3 plants that reverted back to intact reversed ends element. When the experiment was repeated with stringent control for pollen and seed contamination, the reversion phenomenon was not observed. Nevertheless, this observation inspired us to propose a testable model to explain the non Mendelian inheritance in hothead mutants. This hypothesis, which was published in Plant Biol, 2007; 9(1):30 31, is presented here.
Abstract Lolle et al. reported a high frequency of genomic changes in Arabidopsis plants carrying the hothead mutation and proposed that the changes observed were the result of a gene correction system mediated by a hypothetical RNA cache. Here, we propose a very different hypothesis to explain the data reported by Lolle et al. Our hypothesis is based on a relatively straightforward developmental aberration in which maternal cells ("Legacy cells") fuse with the developing embryo, resulting in a chimera, which could then give rise to the aberrant genetic segregations reported by Lolle et al.
2 Reprinted with permission of the Plant Biology, 2007, 9(1):30 31.
65
Introduction Lolle et al (2005) reported non Mendelian inheritance in Arabidopsis plants of hth /hth ( hothead) genotype. When hth /hth plants were self pollinated, they observed 4.0 to 8.2% reversion of hth to HTH , the progeny inheriting a genotype found in the grandparent but not detected in the parent. The reversion to ancestral sequence was not limited to the HTH locus but also occurred at other molecular marker sequences tested. Lolle et al proposed a RNA template mediated editing mechanism. According to this model, a yet undetected cache of RNA templates are passed on from generation to generation, and are used as template for ‘correcting’ changes to the genome sequence. This mechanism may occur normally at a very low frequency in non mutant plants, and at elevated frequencies in the hth /hth mutant background. Since the original publication by Lolle et al., at least three alternative explanations have been advanced. Chaudhury (2005) proposed a mechanism in which the hth DNA sequence is restored by a gene conversion mechanism using homologous genomic sequences as templates. In addition, it was suggested that hth mutant cuticles may have increased permeability and so the embryo sac could be more porous to DNA fragments arising from the degraded spores, facilitating the homology based sequence editing. Similarly, a model proposed by Ray (2005) involves gene conversion based on chromatin fragments originating from the degenerating non functional megaspores which could be taken up by the egg cell and archived in a way that is inaccessible to detection by PCR or DNA hybridization. The supernumerary chromatin fragments could propagate within the meristem and serve as template for conversion of the altered genome sequences. Finally, Comai and Cartwright (2005) proposed a biochemical mechanism of mutagenesis and selection to explain the hth reversion phenomena. According to this model, hth mutant plants may accumulate a mutagenic and toxic metabolite; the mutagenicity could enhance the rate of reversion, while the toxicity may lead to selection for the Hth revertant genotype.
Hypothesis The four hypotheses proposed previously to explain the observations by Lolle et al are not mechanistically related to the hothead mutant phenotype and the known
66 function of the Hothead gene. Here, we propose an alternative mechanism that is based on the phenotypic alteration in hothead mutant plants. HOTHEAD is involved in the formation of extracellular matrix and the biosynthesis of long chain alpha , omega dicarboxylic fatty acids (Kurdyukov, S. et al, 2006). These fatty acids are required for the cross linking that ensures the integrity of the outer epidermal cell wall. Hothead mutants are defective in epidermal cell interaction, leading to fusion of the floral organs (Krolikowski, K.A. et al, 2003). We propose that in both hth /hth and hth /HTH plants, some of the maternal diploid cells may fuse with the developing embryo and become incorporated into the meristematic zone. The number of these ‘ Latent Legacy Cells ’ that become incorporated into the developing meristem may be very few, and thus would escape detection by DNA hybridization or PCR of the progeny somatic tissue. However, when the floral meristem forms gametes, the latent legacy cells may pass on their allele to the next generation. Depending on the proportion of latent legacy cells in the floral meristem, the numbers of progeny exhibiting the grandparental genotype may range from 0 to 10%. A key prediction of our model is that progeny plants that exhibit “genomic instability” of hth or other markers should contain the entire genome derived from the ancestral legacy cell; whereas, models involving stochastic molecular changes at individual loci would be expected to generate plants in which the genotype of different loci are not necessarily correlated. Pertinent to this point, Lolle et al. reported that the progeny of a cross of hth /hth (Ler.) X HTH /HTH (Col.), exhibited “genomic instability’ at six different molecular markers including AG, GAPC, GL1, HTH, RGA, and UFO (Table 3 in Lolle et al.), although it was not stated whether changes at different loci were correlated. Our model is based on the observation that hth mutants are defective in epidermal cell interaction and exhibit inappropriate cell fusions. The origin of the hypothetical legacy cells that undergo fusion with the developing embryo in hothead plants is unclear. It is tempting to speculate that these cells could be derived from the integuments, which are epidermal in origin. Another possible candidate is a megaspore mother cell (MMC); Grossniklaus U and Schneitz K (1998) have observed that about 5% of wildtype
67
Arabidopsis ovules contain 2 megaspore mother cells (MMCs), of which only one matures. The major disadvantage of our model is that it proposes two biological phenomena with little or no precedence: First, the fusion of a “legacy cell” of unknown origin with the developing embryo; Second, the persistence of the “legacy cell” in a latent state within the meristem from which it can contribute to the gametes giving rise to the next generation. On the other hand, our model is mechanistically less complicated than the alternative hypotheses, and it makes straightforward, testable predictions regarding the genotypes of hothead progeny plants that exhibit “reversion” to grandparental genotypes. Acknowledgement : We thank Drs. Phil Becraft and Erik Vollbrecht for helpful discussions.
References
Chaudhury A., Plant genetics: hothead healer and extragenomic information, Nature,
2005, 437, E1 E2, Comai, and Cartwright, R. A., A toxic mutator and selection alternative to the non
Mendelian RNA cache hypothesis for hothead reversion, Plant Cell, 2005,
17(11):2856 2858. Grossniklaus U & Schneitz K., The molecular and genetic basis of ovule and
megagametophyte development, Seminars in cell & developmental biology, 1998,
9(2):227 238.
Krolikowski, K.A., Victor, J.L., Wagler, T.N., Lolle, S.J.& Pruitt, R.E., Isolation and characterization of the Arabidopsis organ fusion gene HOTHEAD, Plant Journal,
2003, 35(4), 501 511.
Kurdyukov S, Faust A, Trenkamp S, Bar S, Franke R, Efremova N, Tietjen K, Schreiber
L, Saedler H, Yephremov A., Genetic and biochemical evidence for involvement
68
of HOTHEAD in the biosynthesis of long chain alpha , omega dicarboxylic fatty
acids and formation of extracellular matrix, Planta, 2006, 224(2):315 29 .
Lolle, S. J., Victor, J. L., Young, J. M. & Pruitt, R. E., Genome wide non mendelian
inheritance of extra genomic information in Arabidopsis, Nature, 2005, 434, 505–
509. Ray, A., Plant genetics: RNA cache or genome trash?, Nature, 2005, 437, E1 –E2.
69
ACKNOWLEDGEMENTS I would like to place on record my thanks to some of the people who have facilitated my Ph.D. research, and made my stay at Ames a wonderful experience Dr.Peterson has been an ideal mentor. He takes mentoring not as a task, but as commitment close to heart. I really appreciate the fact that he makes it a point to meet every member of the group individually every week and discusses progress in research. In these meetings, he patiently listens to the mentees and provides deep insights (just give him an autoradiogram and watch him look for bands and decipher details from the dark bands!). He does not directly put forward his suggestions; rather, he poses questions that will make the student think in the right direction. His attention to details is one quality I would like to cultivate. Dr.Girton, Dr.Spalding, Dr.Voytas and Dr.Whitham: It is my fortune that I had an excellent group of scientists on my POS committee. My formal meetings with the committee occurred only three times: 1. the first meeting, 2. preliminary examination, 3. final defense examination. However, I have met with each member several times in between and discussed my research with them. They have always been very encouraging, especially at times when bench work was shooting lot of troubles. Dr. Jianbo Zhang’s knowledge on transposition has always amazed me. He has helped me understand this science. Dr. Erica Unger Wallace has been a walking google: if you are in need for trouble shooting in experiments, or want a piece of information immediately, she has the solution or at least she knows where to look for! Xianyan (Justin), Chuanhe and Feng have been wonderful friends in the lab. Terry is a very helpful person and his witty comments are unforgettable. Ever since he left the lab, we miss him and his WOI! Brian, Tanya, Lisa and Nikki have helped me with several genomic DNA extractions. Diane has been very kind in taking care of my plants during my visits to India. She is always quick to write an e mail and update me on my plants. Zhuying’s meticulosity impresses me.
70
Antony, Anjan, Parijat, Darshana, Jyothi, Ramesh, and many other friends have made life at Ames very warm. My extended family back in India has been very encouraging, supportive and patient through the past six and half years of my Ph.D. My sincere thanks to all the people mentioned above, and a lot more. It is not practically possible for me to list everyone to whom I like to express my gratitude. For instance, I would like to thank all my teachers right from childhood. But for the ‘Teacher’ I would have continued to be in darkness. I am very grateful for everything I have received. Sincerely, Lakshminarasimhan. Ames, Iowa.