US 20140018338A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0018338A1 Chandran et al. (43) Pub. Date: Jan. 16, 2014
(54) METHODS AND ASSAYS FORTREATING CI2O 1/70 (2006.01) FLOVRIDAE INFECTIONS GOIN33/569 (2006.01) (52) U.S. Cl. (76) Inventors: Kartik Chandran, Brooklyn, NY (US); CPC ...... G0IN33/5035 (2013.01); C12O 1/70 Sean Whelan, Cambridge, MA (US); (2013.01); G0IN33/56983 (2013.01); A61 K Thijn Brummelkamp, Amsterdam 31/566 (2013.01); A61 K3I/55 (2013.01) (NL); Jan Carette, Palo Alto, CA (US); USPC ...... 514/178; 514/44. A 435/6.13:435/11; Matthijs Raaben, De Belt (NL) 435/7.92; 43.5/5: 514/217 (21) Appl. No.: 13/979,179 (57) ABSTRACT Methods and assays for treating a subject with a filovirus (22) PCT Filed: Jan. 24, 2012 infection using an agent that inhibits Niemann-Pick CI (NPCI), VPSII, VPSI6, VPSI8, VPS33A, VPS39, VPS41, (86) PCT NO.: PCT/US12A22349 BLOCISI, BLOCIS2, GNPTAB, PIKFYVE, ARHGAP23 or S371 (c)(1), FIG4. Methods for screening for an agent that treats and/or (2), (4) Date: Sep. 25, 2013 prevents infection of a subject with a filovirus, where the methods comprise determining whether the agent inhibits one Related U.S. Application Data or more of Niemann-Pick CI (NPCI), VPSII, VPSI6, VPSI8, VPS33A, VPS39, VPS41. BLOCISI, BLOCIS2, GNPTAB, (60) Provisional application No. 61/435,858, filed on Jan. PIKFYVE, ARHGAP23 or FIG4, wherein an agent that 25, 2011. inhibits one or more of NPCI, VPSII, VPSI6, VPSI8, VPS33A, VPS39, VPS41, BLOCISI, BLOCIS2, GNPTAB, Publication Classification PIKFYVE, ARHGAP23 or FIG4 is a candidate for treating and/or preventing an infection with a filovirus and wherein an (51) Int. C. agent that does not inhibit NPCI, VPSII, VPSI6, VPSI8, GOIN33/50 (2006.01) VPS33A. VPS39, VPS41, BLOCISI, BLOCIS2, GNPTAB, A6 IK3I/55 (2006.01) PIKFYVE, ARHGAP23 or FIG4 is not a candidate for treat A6 IK3I/566 (2006.01) ing and/or preventing an infection with a filovirus.
Critical entry factors: & CTSB
a HOPS complex
NPC
Patent Application Publication Jan. 16, 2014 Sheet 2 of 34 US 2014/0018338A1
b C
8 3.s s2 ------AP CeS e 7 Control NPC 3 a Š VPS 116t g 5 VPS33AG
VPS33A NPC167 4 : NPC1 GT2 ACTB is 3
WT VPS11GT VPS33A NPC G NPC GT2 .
FIGURE 1 B-1D Patent Application Publication Jan. 16, 2014 Sheet 3 of 34 US 2014/0018338A1
Filipin Staining Virus infections rVSV-G rVSV-GP-EbOW
Control
FIGURE 2A Patent Application Publication Jan. 16, 2014 Sheet 4 of 34 US 2014/0018338A1
b s 7 2 Fibroblasts 5 WT 4 S NPC nut NPC2nut ... 3 S. 21.
C 100 - - - s e- s ) rWSW-G sŠ rVSV-GP-Ebov i. "- O. O U18666A (uM)
FIGURE 2B-2D Patent Application Publication Jan. 16, 2014 Sheet 5 of 34 US 2014/0018338A1
s 8 AP Cels a 7. Control S. 6 Š VRS1&T 5. $ WPS33AG NPC1&T 4 NPCGT2 $ 3. X t EBOV G cleaved)
FIGURE 3A-3B Patent Application Publication Jan. 16, 2014 Sheet 6 of 34 US 2014/0018338A1
C ji" 3888& WSG WS33A'it NFO: Gi: 5
38 ''
FIGURE 3C-3D Patent Application Publication Jan. 16, 2014 Sheet 7 of 34 US 2014/0018338A1
-- 234. 29 -o
- - 24 as 72 96 i2O O 24 48 2 96 20 Hours post-infection Hours post-infection O. Ebow (Control) via:W (Control) O. Ebov (to drug) Marv (no drug) O Ebow (NPC) Marv (NPC1) O Ebov (U18666A) Marv (U18666A)
FIGURE 4A-4B Patent Application Publication Jan. 16, 2014 Sheet 8 of 34 US 2014/0018338A1
Critical entry factors: CTSB
HOPS complex
NPC
FIGURE 4C Patent Application Publication Jan. 16, 2014 Sheet 9 of 34 US 2014/0018338A1
FIGURE 5A Patent Application Publication Jan. 16, 2014 Sheet 10 of 34 US 2014/0018338A1
1a : 8 in '- 40 as 2 8, iOO S2 883 g 80 5 30 20 C.
O s
C
O SO CO SO 100 virus concentration (MOI)
FIGURE 5B-5C Patent Application Publication Jan. 16, 2014 Sheet 11 of 34 US 2014/0018338A1
HAP1 cells mutagenized with gene trap (complexity - 100x 106)
unselected selected with Control - rWSW-GP-Ebola
( Y deep sequence deep sequence isolate insertion Sites insertion Sites cona derivatives l Count independent count independent functional insertions per gene insertions per gene Studies
Control experimental dataSet dataSet -430,000 w -700 insertions insetors
calculate per gene the significance of enrichment in experimental dataset gene with multiple insertions
and high significance of Expected Observed enrichment (based on control)
Genes in experimental dataset FIGURE 6 Patent Application Publication Jan. 16, 2014 Sheet 12 of 34 US 2014/0018338A1
pose WS
syS s WS33Ak SNossos orSeŠsessessssssssssssssSssssssssssssssssssssssssssssssssssssssssssss S
WPS1 endogenous locus
PS11 gene trap ocus PS33 endogenous locus PS33 gene trap locus
FIGURE 7A-7B Patent Application Publication Jan. 16, 2014 Sheet 13 of 34 US 2014/0018338A1
FIGURE 7C Patent Application Publication Jan. 16, 2014 Sheet 14 of 34 US 2014/0018338A1
8 b ii iss c
--&N x\\ S 8 f 8 : & Ko S 7 C CHO cells d 6 NC g 5 W s 4. NPC10 g " 3 st CKai. S 2 J
FIGURE 8A-8B Patent Application Publication Jan. 16, 2014 Sheet 15 of 34 US 2014/0018338A1
7.
6 $ $ $ $ Fibroblasts 5 Control 4. NPC2 muta
CS& CX& cSS S.is
FIGURE 9 Patent Application Publication Jan. 16, 2014 Sheet 16 of 34 US 2014/0018338A1
a. CHO-NPC10/vec CHO-NPC10/NPC1-flag S
FIGURE 10A-10B Patent Application Publication Jan. 16, 2014 Sheet 17 of 34 US 2014/0018338A1
a. b
g s 200 S 2 50 se 3 No drug SD 100 . g E-64 se < 50 e O s O SN && cS CN Š
C V S (S NY N Q SksS CN S3 C
C. S. C. S. CCatB hCatB- - CCat SC hCat on CCat C
Š- Contoloadin
FIGURE 11 A-11C Patent Application Publication Jan. 16, 2014 Sheet 18 of 34 US 2014/0018338A1
nOck BafA NHC
FIGURE 12 Patent Application Publication Jan. 16, 2014 Sheet 19 of 34 US 2014/0018338A1
NPC GT2
FIGURE 13 Patent Application Publication Jan. 16, 2014 Sheet 20 of 34 US 2014/0018338A1
OO ::::::::: 10
:::::::: 8O n 8
60 m 6 No drug : CD 40 k As a A aS2 4 U18666A S S 20 2
h pi: 48 72 96 48 72 96 48 E.OV MarV MarV HUWEC OC
FIGURE 14A-14B Patent Application Publication Jan. 16, 2014 Sheet 21 of 34 US 2014/0018338A1
6 DMSO vehicle 5 S. a was Š U 8666A
3 3 2 O Time of pretreatment (h)
OO
O
so to so Time of U18666A addition (min)
FIGURE 15A-15B Patent Application Publication Jan. 16, 2014 Sheet 22 of 34 US 2014/0018338A1
S Untreatedirriprattire (88. s in
* :
S s wa se cy. S 30
. - - - - - is
as hrs fairs 38 is irs Niarburg Cit? Exia airs SS
FIGURE 16 Patent Application Publication Jan. 16, 2014 Sheet 23 of 34 US 2014/0018338A1
{} so EbOW 80 or ... 8 O 8 S ({} 3. 28 O { 2 3 4 S 8 8 & 3 : S.
Of 3. 80 7 S SO 48 38
{ 3 & S S 8 {} 2 3 4 Days post-chaenge
Wid-type mice (NPC -f- O Knockout mice (NPC -f--)
FIGURE 17A-17B Patent Application Publication Jan. 16, 2014 Sheet 24 of 34 US 2014/0018338A1
100 90 80 f &s is 60 8 st s imipramine 25 mg/kg s 40 & 8 . s imipramine 15 mg/kg 30 2 * PBS in 8 innipramie (35 mgsg PBS to imipramine (25 mg/kg) kas S. s * imipramine (15 mg/kg) imipramine 35 mg/kg 2 i s 8 2 is S Days Post infection
FIGURE 18 Patent Application Publication Jan. 16, 2014 Sheet 25 of 34 US 2014/0018338A1
Steroi-binding NPC2-binding Cysteine-rich dorrain dorai tioai Erics a M finger
(yopias sterol-sensing Flag contain tag
FIGURE 19 Patent Application Publication Jan. 16, 2014 Sheet 26 of 34 US 2014/0018338A1
Filipin GP-EBOV GP-MARV staining
None
NPC1-flag
s ; : . . . . . NPC1 AA-flag
NPC AC-flag
2%
NPC -A-flag
FIGURE 20A-2OC Patent Application Publication Jan. 16, 2014 Sheet 27 of 34 US 2014/0018338A1
3. NPC1-Flag lysate
WSV: q s C. C.
NPC -Flag P: kg &s B: is S&S NPC -Flag
b
O 2 4. 6 8 Lysate (1x10 celled./well)
FIGURE 21 A-21B Patent Application Publication Jan. 16, 2014 Sheet 28 of 34 US 2014/0018338A1
d 3 sa Š Š-ŠŠ & Š 2 Š Š rVSV-GP S rVSV-GP
O 20 40 60 80 OO NPC1-flag (ng/well)
FIGURE 21 C-21D Patent Application Publication Jan. 16, 2014 Sheet 29 of 34 US 2014/0018338A1
al Side b ex do air C
S Sibie
5 s -Š s
...-- s ce ser S
t
rVSV-GP SECa C 3. O.5 S rVSV-GP.
i. Soluble O.O Domain C O O 2O 30 40 Soluble domain C (ig/mL)
s
s rVSV-GP E 50- Š rVSV-GP. S s y y O &c....access assoor-Š do so Soluble domain C-flag (ug/ml)
FIGURE 22A-22C Patent Application Publication Jan. 16, 2014 Sheet 30 of 34 US 2014/0018338A1
FIGURE 23A-23B Patent Application Publication Jan. 16, 2014 Sheet 31 of 34 US 2014/0018338A1
Erdosora liter
Cytoplasm
FIGURE 24A-24B Patent Application Publication Jan. 16, 2014 Sheet 32 of 34 US 2014/0018338A1
Compound 3
FIGURE 24C-24D Patent Application Publication Jan. 16, 2014 Sheet 33 of 34 US 2014/0018338A1
TPA
2 Ru(bpy),3. Ru(bpy). TPA TPA +
GP e
working s w COer electroce dielectric electrode
FIGURE 25
US 2014/0018338A1 Jan. 16, 2014
METHODS AND ASSAYS FORTREATING BRIEF DESCRIPTION OF THE DRAWINGS FLOVRIDAE INFECTIONS 0008 FIG. 1A-1D. Genome-wide haploid genetic screen CROSS-REFERENCE TO RELATED identifies the HOPS complex and NPC1 as host factors for APPLICATION filovirus entry. a) Genes significantly enriched for gene-trap insertion event in the rVSV-GP-EboV-selected cell popula 0001. This application claims priority of U.S. Provisional tion as compared to the non-selected mutagenized cell popu Patent Application No. 61/435,858, filed on Jan. 25, 2011, the lation. Circles represent genes and their size corresponds to content of which is incorporated by reference. the number of insertions identified in that gene in the rVSV GP-EboV selected population. Significantly enriched genes STATEMENT OF GOVERNMENT SUPPORT (p-values0.01) are labeled with gene name. The number of 0002 This invention was made with government support independent insertions is indicated in parentheses. Genes are under grant numbers AIO88027, AIO81842, AIO57159 and ranked on the X-axis based on their chromosomal position. b) HG004938 awarded by the National Institutes of Health. The RT-PCR analysis of the expression levels of NPC1, VPS33A government has certain rights in the invention. and VPS11 in clones that contain gene trap insertions in the corresponding genes.c) Infectivity of VSV pseudotyped with BACKGROUND OF THE INVENTION the indicated filovirus glycoproteins in WT and mutant HAP1 clones. Meansistandard deviation (SD) are shown. EboV. 0003. Throughout this application various publications Ebola virus (Zaire), SunV. Sudan virus, MarV. Marburg virus. are referred to in superscripts. Full citations for these refer Asterisks indicate that infectivity was below the limit of ences may be found at the end of the specification. The dis detection. d) The indicated HAP1 clones were exposed to a closures of these publications are hereby incorporated by set of unrelated enveloped and nonenveloped viruses includ reference in their entirety into the subject application to more ing recombinant VSV viruses carrying Rabies or Borna dis fully describe the art to which the subject invention pertains. ease virus glycoproteins. Surviving adherent cells were 0004 Infections by the Ebola (EboV) and Marburg stained with crystal violet. (MarV) filoviruses cause a rapidly fatal hemorrhagic fever in 0009 FIG. 2A-2D. Viral infection mediated by filovirus humans for which no approved vaccines or antivirals are glycoproteins requires NPC1 but not NPC2. a) Skin fibro available'. Filovirus entry into cells is mediated by the viral blasts from an apparently normal individual (control) and spike glycoprotein (GP), which attaches viral particles to the from patients carrying homozygous mutations in NPC1 or cell Surface, delivers them to endosomes, and catalyzes fusion NPC2 were stained with filipinto visualize intracellular cho between viral and endosomal membranes. Additional host lesterol, or challenged with rVSV-G or rVSV-GP-EboV. Fil factors in the endosomal compartment, including a putative ipin-stained and infected cells were visualized by fluores entry receptor, are likely required for viral membrane fusion. cence microscopy. Filipin-stained images were inverted for However, despite considerable efforts, these critical host fac clarity. Hoechst 33342 nuclear counterstain. b) Infectivity of tors have defied molecular identification. VSV pseudotyped with the indicated viral glycoproteins in 0005. The present invention addresses the need for meth control and Niemann-Pick fibroblasts. Asterisks indicate that ods and assays for treating Subjects infected with filoviruses infectivity was below the limit of detection. c) NPC1 patient or who are at risk for infection with filoviruses. fibroblasts stably expressing an empty vector control or human NPC1 were stained with filipin or challenged with SUMMARY OF THE INVENTION rVSV-GP-EboV. d) Infectivity of rVSV-G and rVSV-GP 0006. The present invention provides methods for treating EboV in Vero cells preincubated for 30 min with the indicated a subject infected with a filovirus or for preventing an infec concentrations of U18666A. Scale bars, 200 um (a, c). tion with a filovirus in a subject at risk for infection with a Meansistandard deviation (SD) are shown (b. d). filovirus, where the methods comprise administering to the (0010 FIG. 3A-3D. Ebola virus entry is arrested at a late subject an agent that inhibits one or more of Niemann-Pick step in cells deficient for the HOPS complex and NPC1. a) C1 (NPC1), VPS11, VPS16, VPS18, VPS33A, VPS39, Viral particles attach and internalize into HOPS- and NPC1 VPS41, BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, deficient cells. The indicated HAP1 clones were inoculated ARHGAP23 or FIG4 in an amount effective to treat and/or with rVSV-GP-EboV and examined by transmission electron prevent infection with the filovirus. microscopy. Representative images of early steps in entry are 0007. The present invention also provides methods for shown.b. In vitro-cleaved rVSV-GP-EboV cannot bypass the screening for an agent that treats and/or prevents infection of block to infection observed in VPS11, VPS33A' and a subject with a filovirus, where the methods comprise deter NPC1' cells. Infectivity of mock- or thermolysin-cleaved mining whether or not the agent inhibits one or more of rVSV-GP-EboV in the indicated mutant HAP1 clones. c) Niemann-Pick C1 (NPC1), VPS11, VPS16, VPS18, Viral escape into the cytoplasm is blocked in HOPS complex VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, and NPC1-deficient cells. Wild type HAP1 cells were treated PIKFYVE, ARHGAP23 or FIG4, wherein an agent that with U18666A (10 ug/ml), and the indicated mutant HAP1 inhibits one or more of NPC1, VPS11, VPS16, VPS18, clones were exposed to VSV or rVSV-GP-EboV virus for 3 h VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, and processed for VSV M staining. Diffuse M staining indi PIKFYVE, ARHGAP23 or FIG4 is a candidate for treating cates Successful release of viral nucleocapsids into the cyto and/or preventing an infection with a filovirus and wherein an plasm. Punctuate staining, indicating viral particles trapped agent that does not inhibit NPC1, VPS11, VPS16, VPS18, within endosomes and lysosomes, is shown by the arrows. d) VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, Electron micrographs of rVSV-GP-EboV-infected VPS33A PIKFYVE, ARHGAP23 or FIG4 is not a candidate for treat and NPC1-deficient HAP1 cells and NPC1-deficient fibro ing and/or preventing an infection with a filovirus. blasts showing agglomerations of bullet-shaped VSV par US 2014/0018338A1 Jan. 16, 2014 ticles in Vesicular compartments. All images were taken at 3 with the NPC1-expressing retrovirus. CDK4 was used a load h post-inoculation. Asterisks highlight rVSV-GP-EboV par ing control. b) Wild type or NPC1-deficient CHO cells were ticles in cross-section. challenged with VSV pseudotyped with the indicated viral 0011 FIG. 4A-4C. NPC1 function is required for infec glycoproteins, and viral infectivity was measured 24h later. tion by authentic Ebola and Marburg viruses. a) Fibroblasts 0016 FIG. 9. NPC2-mutant fibroblasts derived from a from a healthy individual oran NPC1 patient were exposed to second Niemann-Pick type C patient are susceptible to viral EboV or MarV. Cell supernatants were harvested at the indi infection mediated by the Ebola virus glycoprotein. Fibro cated times post-infection and yields of infectious virus were blasts from an apparently normal individual and a Niemann measured. Meansistandard deviation (SD) are shown. Aster Pick disease patient carrying homozygous mutations in isks indicate that infectivity was below the limit of detection. NPC2 were infected with VSV pseudotypes bearing the indi b) Vero cells treated with DMSO vehicle (no drug) or cated viral glycoproteins, and viral infectivity was measured U18666A (20 uM) were exposed to EboV or MarV. Cell 24h later. Meansistandard deviation (SD) are shown Supernatants were harvested at the indicated times post-in 0017 FIG. 10A-10B. Clearance of accumulated choles fection and yields of infectious virus were measured. terol does not render NPC1-deficient cells susceptible to Meansistandard deviation (SD) are shown. c) A speculative infection by rVSV-GP-EboV. Wildtype and NPC1-null CHO model for the roles of CatB, the HOPS complex, and NPC1 in cells were cultivated either in normal growth medium (con Ebola virus entry. trol) or in growth medium containing lipoprotein-depleted 0012 FIG. 5A-5C. Generation of HAP1 cells and suscep fetal bovine serum (depleted) for 6 days. Cells were then tibility to rVSV-GP-EboV.a) Near-haploid KBM7 cells were stained with filipin to visualize accumulated cholesterol (A) coinfected with retroviral vectors expressing OCT4/SOX2/c- orexposed to rVSV-GP-EboV (B). Filipin-stained or infected MYC and KLF4 and an adherently growing subclone was cells were visualized by fluorescence microscopy. In each of identified (HAP1 cells). Karyotypic analysis of HAP1 cells (A) and (B), top panels are control and bottom panels are indicates that the majority of cells (27 out of 39 analyzed) is depleted. haploid for all chromosomes b) Staining of KBM7 cells and 0018 FIG. 11A-11C. The activities of endosomalcysteine HAP1 cells with pan-hematopoietic markers CD43 and cathepsins B and L are not inhibited in NPC1-defective cells. CD45. Stained cells were examined by flow-cytometry. The a) In vitro cleaved rVSV-GP-EboV bypasses the intracellular unstained control is indicated in grey. c) Susceptibility of requirement for cathepsin B (CatB). Infectivity of mock- or HAP1 and KBM7 cells to cell-killing by rVSV-GP-EboV. thermolysin-cleaved rVSV-GP-EboV in Vero cells treated 0013 FIG. 6. Outline of the haploid genetic screen to with the CatBinhibitor CA074. b) Fibroblasts from an appar identify host factors for Ebola virus entry. 100 million early ently normal individual (control) and a Niemann-Pick patient passage HAP1 cells were infected with gene-trap virus and carrying homozygous mutations in NPC1 were lysed at acid further expanded. A subset of cells was used to characterize pH, and the capacity of these acidic extracts to cleave a the distribution of gene-trap insertion across the human fluorogenic peptide substrate for CatB and Cat was mea genome. Sequences flanking the gene-traps were amplified, sured. Pretreatment of cell extracts with the pan-cysteine sequenced in parallel and aligned to the human genome. protease inhibitor E-64 abolished substrate cleavage, con Independent insertion events into annotated genes were firming that only cysteine cathepsin activities were being counted. 100 million cells were exposed to rVSV-GP-EboV measured. c) Intact control and NPC1-deficient fibroblasts virus and resistant clones were pooled and expanded. Most of and CHO cells were incubated with a fluorophore-tagged these cells were used to amplify sequences flanking the gene suicide substrate for CatB/CatL. Cells were then lysed and traps, sequence the insertion sites in parallel, and align these fluorophore-labeled CatB and CatL proteins were detected by sequences to the human genome. A Subset of the cells were SDS-polyacrylamide gel electrophoresis and fluorescence used to obtain NPC and VPS' cells through subcloning. imaging. hCatB and hCatL, human enzymes. cQatB and Gene disruption events in the selected population were com cCatL. CHO enzymes. Sc and hc, single chain and heavy pared to the unselected cell population and genes that were chain forms of CatL. significantly enriched for mutations were identified. (0019 FIG. 12. Viral membrane fusion is required for VSV 0014 FIG. 7A-7C. Identification and characterization of M release into the cytoplasm of infected cells. Wild type HAP1 cells carrying gene-trap insertions in the NPC1, HAP1 cells were treated with puromycin (5ug/ml) and inocu VPS11 and VPS33A loci. a) Schematic outline of the posi lated with rVSV-GP-EboV in the presence or absence of tions of gene-trap insertions in the corresponding genes. Gene bafilomycin A1 (bafA1; 100 nM) or ammonium chloride traps were located in the sense orientation in intronic (NHCl; 20 g/ml). Cells were fixed 3 hpost inoculation and sequences of the 5'-end of the gene and are therefore predicted stained with VSV Mantibody 23H12. Successful fusion leads to disrupt gene function. b) Clonal cell lines carrying the to the diffuse Mstaining throughout the cytoplasm. Failure to gene-trap insertions in the corresponding loci were identified fuse leads to discrete punctuate of M staining as shown by through Subcloning. Genotyping indicates the absence of bafA1 and NHC1. wild type genomic loci and the presence of gene-trap loci. c) 0020 FIG. 13. Accumulation of rVSV-GP-EboV viral Cells carrying gene-trap insertions in the corresponding loci particles in vesicular compartments in NPC1-deficient cells. and wild type HAP1 cells were inoculated with rVSV-GP Electron micrograph of a second NPC1-deficient HAP1 clone EboV, and infected cells were visualized by fluorescence exposed to rVSV-GP-EboV. A large agglomeration of bullet microscopy 12 h later. shaped VSV particles is visible within a vesicular (endoso 0.015 FIG. 8A-8B. NPC1 deficiency of HAP1 and CHO mal) compartment. All images were taken at 3 h post-infec cells confers resistance to viral infection mediated by Ebola tion. and Marburg virus glycoproteins.a) Immunoblot blot analy (0021 FIG. 14A-14B. NPC1 pathway inhibitor U18666A sis of NPC1 in HAP1 cells, HAP1 cells carrying a gene-trap blocks authentic EboV and MarV infection of primary human insertion in the NPC1 locus and the same cell line infected cells. Human peripheral blood monocyte-derived dendritic US 2014/0018338A1 Jan. 16, 2014
cells (DC) (b) and umbilical-vein endothelial cells (HUVEC) ELISA. Plates coated with rVSV-GP or rVSV-GP, were (a) were infected in the presence or absence of U18666A (10 incubated with cell extracts containing NPC1-flag, and bound uM) at an MOI of 3 and the percentage of infected cells was flag-tagged proteins were detected with an anti-flag antibody. determined by immunostaining. (c-d) GP, but not GP captures affinity-purified NPC1-flag in 0022 FIG. 15A-15B. U18666A acts rapidly to inhibit an ELISA. (c) NPC1-flag was purified from CT43 CHO cell Ebola virus GP-dependent entry. (a) Time-of-pretreatment lysates by flag affinity chromatography and visualized by experiment: Vero cells were left untreated or treated with SDS-PAGE and staining with Krypton infrared protein stain. U18666A (20 uM) for the indicated times and then exposed to (d) ELISA plates coated with rVSV-GP or rVSV-GP were rVSV-GP-EboV. After 1 h, viral entry was terminated by incubated with NPC1-flag purified in (c), and bound flag addition of NHCl (20 mM). Viral infectivity was measured tagged proteins were detected with an anti-flag antibody. 14 h later. Meansistandard deviation (SD) are shown. (b) 0029 FIG. 22A-22C. Soluble forms of NPC1 domain C Time-of-escape experiment: Vero cells were first exposed to bind directly to GP and selectively neutralize infection by rVSV-GP-EboV and then left untreated or treated with viral particles containing cleaved glycoproteins. (a) The U18666A for 1 h at 37° C. After 1 h, viral entry was termi capacity of rVSV-GP and rVSV-GP to capture a purified, nated by addition of NHCl (20 mM). Viral infectivity was soluble form of domain C containing flag and hexahistidine determined as above. tags was determined in an ELISA. (b) The capacity of a 0023 FIG. 16. NPC1 pathway inhibitor imipramine purified, soluble form of GP lacking the transmembrane blocks authentic EboV and MarV infection. Vero cells were domain (GPATM) to associate with purified, soluble domain infected in the presence or absence of U18666A (10 uM) at an C was determined by co-immunoprecipitation. (c) rVSV-GP MOI of 3 and the percentage of infected cells at each time and rVSV-GP were preincubated with soluble domain C, point was determined by immunostaining. and virus-protein mixtures were exposed to Vero cells. Viral 0024 FIG. 17A-17B. NPC1 is required for in vivo infec infection was enumerated by fluorescence microscopy. tion and pathogenesis by EboV (a) and MarV (b). Survival of 0030 FIG. 23A-23B. A synthetic single-pass membrane NPC1' and NPC1' mice (n=10 for each group) inoculated protein containing NPC1 domain C can mediate EboV and intraperitoneally (i.p.) with ~1000 pful of mouse-adapted MarVentry. CT43 cells expressing synthetic membrane pro EbOV or MarV. teins containing individual NPC1 luminal domains were 0025 FIG. 18. NPC1 pathway inhibitor imipramine par exposed to rVSVs bearing uncleaved or cleaved Filovirus tially protects mice from EboV. Balb/c mice (n=10 for each glycoproteins. Infected cells were visualized (a) and enumer group) were inoculated intraperitoneally (i.p.) with ~1000 ated (b) by fluorescence microscopy. Asterisks in panel b pful of mouse-adapted EboV or MarV together with vehicle indicate values below the limit of detection. (PBS) or imipramine at the indicated dose. 0031 FIG. 24A-24D. Some possible modes of action of 0026 FIG. 19. Topological model of NPC1. Domain A small molecule antivirals targeting NPC1. (a) Binding of contains asterol-binding domain, but the specific functions of EboV and MarV GP to domain C in NPC1 within endosomes domains C and I are unknown. In the present studies, a flag or lysosomes is required for viral entry and infection. (b) A epitope tag was appended to the C-terminus of NPC1. compound may direct inhibit GP-NPC1 interaction by bind 0027 FIG. 20A-20C. NPC1 luminal loop domain C is ing to either protein. (c) A compound may indirectly inhibit required for filovirus entry, but full-length NPC1 is dispens GP-NPC1 interaction by binding to NPC1 (in domain C or able. (a) NPC1-null CHO CT43 cells were engineered to elsewhere) or to an associated protein or lipid, thereby induc express mutant forms of human NPC1-flag lacking domains ing a conformational change in NPC1. (d) A compound may A, C, or I. Capacity of mutant NPC1 proteins to rescue viral induce misfolding of NPC1 or otherwise cause reduction of entry and transport lysosomal cholesterol was determined. NPC1 levels within the endo/lysosomal compartment. Note (Left) Infection of NPC1-null CHO CT43 cells expressing that this figure only illustrate a few possible modes of action. mutant NPC1-flag proteins by recombinant VSVs bearing 0032 FIG. 25. A homogeneous electrochemilumines VSVG or filovirus glycoproteins. Infected cells were visual cence assay to screen for inhibitors of the GP-NPC1 interac ized by fluorescence microscopy. (Right) Cholesterol clear tion. Binding of a GP ectodomain labeled with a SULFO ance by mutant NPC1-flag proteins in CT43 cells was deter tagTM (MesoScale Discovery Systems) to NPC1 in mined by filipin staining and fluorescence microscopy. immobilized membranes is detected by the emission of light Images were inverted for clarity. Scale bars, 20 um. (b-c) by *Ru(bpy)". This activated species is electrochemically Infectivity of VSV pseudotypes bearing VSV or filovirus generated at the bottom of the microplate well. glycoproteins (b) and wild type MARV (c) in CT43 cells 0033 FIG. 26. A homogeneous AlphascreenTMassay (Per expressing mutant NPC-flag proteins. SUDV, Sudan virus. kin-Elmer) to screen for inhibitors of the GP-NPC1 interac Error bars indicate SD. Asterisks indicate values below the tion. Binding of purified NPC1 domain C tethered to Donor limit of detection. beads and GP ectodomain tethered to Acceptor beads is 0028 FIG. 21A-21D. NPC1 binds specifically to a detected as follows. When Donor and Acceptor beads are cleaved form of the Ebola virus glycoprotein. (a) Co-immu brought into close proximity by the GP-NPC1 interaction, the noprecipitation (IP) of NPC1 by EBOV GP Magnetic beads excitation of the Donor beads provokes the release of singlet coated with GP-specific monoclonal antibody KZ52 were oxygen ("O.), triggering a cascade of energy transfer to the incubated with detergent extracts containing no virus (None), Acceptor beads and resulting in blue-shifted emission. uncleaved rVSV-GP, or cleaved rVSV-GP. The resulting control or glycoprotein-decorated beads were mixed with cell DETAILED DESCRIPTION OF THE INVENTION lysates containing human NPC1-flag at pH 7.5 or pH 5.1 and 0034. The present invention provides a method for treating 4°C. Beads were then retrieved and NPC1-flag in the immune a subject infected with a filovirus or for preventing an infec pellets and Supernatants was detected by immunoblotting tion with a filovirus in a subject at risk for infection with a (IB) with an anti-flag antibody. (b) GP captures NPC1 in an filovirus comprising administering to the Subject an agent that US 2014/0018338A1 Jan. 16, 2014
inhibits one or more of Niemann-Pick C1 (NPC1), VPS11, occurrence offiloviruses, there is the potential for exposure to VPS16, VPS18, VPS33A, VPS39, VPS41, BLOC1S1, these pathogens if they are used as agents of bioterrorism or BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 or FIG4 in an biological warfare. amount effective to treat and/or prevent infection with the 0038. The NPC1 gene encodes NPC1 protein, which is filovirus. located in the membrane of endoSomes and lysosomes and mediates intracellular cholesterol trafficking, in part viabind 0035. The family Filoviridae is a family of viruses includ ing of cholesterol to its N-terminal domain. NPC1 pro ing genera Ebolavirus and Marburgvirus. tein has a cytoplasmic C-terminus, 13 transmembrane 0036. To treat a subject with a filovirus infection means to domains, and 3 large loops in the lumen of the endosome reduce or stop the spread of filovirus in the subject, or to (see FIG. 19). Defects in the NPC1 gene cause Niemann-Pick eliminate the filovirus from the subject, or to reduce or elimi type C disease, a rare autosomal recessive neurodegenera nate a sign or symptom of filovirus infection in the Subject. tive disorder characterized by over accumulation of choles Filovirus infection is characterized by hemorrhagic fever, terol and glycosphingolipids in endosomal/lysosomal com including abnormalities in blood coagulation. partments. 0037. Subjects who are at risk for infection with filovi 0039 Human NPC1 protein has the amino acid sequence ruses include subjects who have been exposed to filovirus or (SEQ ID NO: 1) (NCBI Reference Sequence: NM 000271. are at risk of exposure to filovirus. In addition to the natural 4):
MTARGLALGL LLLLLCPAOW FSQSCVWYGE CGIAYGDKRY NCEYSGPPKP LPKDGYDLVO 6 O
ELCPGFFFGN VSLCCDWROL OTLKDNLOLP LOFLSRCPSC FYNLLNLFCE LTCSPROSOF 12 O
LNWTATEDYV DPVTNOTKTN WKELOYYVGO SFANAMYNAC RDWEAPSSND KALGLLCGKD 18O
ADACNATNWI EYMFNKDNGO APFTITPVFS DFPVHGMEPM NNATKGCDES WDEVTAPCSC 24 O
ODCSIWCGPK POPPPPPAPW TILGLDAMYW IMWITYMAFL LVFFGAFFAV WCYRKRYFWS 3OO
EYTPIDSNIA FSWNASDKGE ASCCDPWSAA FEGCLRRLFT RWGSFCWRNP GCWIFFSLWF 360
ITACSSGLVF WRVTTNPVDL WSAPSSOARL EKEYFDOHFG PFFRTEOLII RAPLTDKHIY 42O
OPYPSGADVP FGPPLDIOIL, HOVLDLOIAI ENITASYDNE TVTLODICLA PLSPYNTNCT 48O
ILSWLNYFON SHSVLDHKKG DDFFWYADYH THFLYCVRAP ASLNDTSLLH DPCLGTFGGP 54 O
VFPWLVLGGY DDONYNNATA LVITFPVINNY YNDTEKLORA. OAWEKEFINF WKNYKNPNLT 6OO
ISFTAERSIE DELNRESDSD WFTWWISYAI MFLYISLALG HMKSCRRLLW DSKWSLGIAG 660
ILIVLSSWAC SLGVFSYIGL PLTLIVIEVI PFLVLAVGVD NIFILVOAYO RDERLOGETL 72 O
DOOLGRVLGE WAPSMFLSS SETWAFFLGA. LSWMPAVHTF SLFAGLAVFI DFLLOITCFV 78O
SLLGLDIKRO EKNRLDIFCC VRGAEDGTSV OASESCLFRF FKNSYSPLLL KDWMRPIVIA 84 O
IFVGVLSFSI AVLNKVDIGL DOSLSMPDDS YMVDYFKSIS OYLHAGPPVY FVLEEGHDYT 9 OO
SSKGONMVCG GMGCNNDSLV OOIFNAAOLD NYTRIGFAPS SWIDDYFDWV KPOSSCCRVD 96.O
NITDOFCNAS VVDPACVRCR PLTPEGKORP OGGDFMRFLP MFLSDNPNPK CGKGGHAAYS 1 O2O
SAVNILLGHG TRVGATYFMT YHTVLOTSAD FIDALKKARL IASNVTETMG INGSAYRVFP 108O
NLGWSLGAIF LWTMWLLGCE LWSAWIMCAT IAMWLWNMFG 114 O
WMWLWGISLN AWSLWNLWMS CGISWEFCSH ITRAFTWSMK GSRWERAEEA. LAHMGSSWFS 12 OO
GITLTKFGGI WWLAFAKSOI FOIFYFRMYL AMVLLGATHG LIFLPVLLSY IGPSVNKAKS 126 O
CATEERYKGT ERERLLNF 1278
0040. Nucleic acid (mRNA) encoding human NPC1 pro tein has the nucleotide sequence (SEQ ID NO:2) (NCBI Reference Sequence: NM 000271.4):
1 galagggcaac acggggacct taa.gcgggg togcggcggc gCCCC agcCC gggcc aggga 61 gtc.ccggcag C9gcacct co cagaaagggc ggagc.cgacg acgc.ct tctt CCttic ctgac 121 cq9c.gc.gc.gc agcctgctgc cqcggt cagc gcctgct cct gct cotcc.gc. tcct cctg.cg
US 2014/0018338A1 Jan. 16, 2014 19
- Continued 3 O61 tdtgtcatca act atggitta toctictaaat aggcatttaa tdaaacattg tacaaattgt 3121 cact catttg atgacacct g ggaataa.cat taggaggct g atgtc.ctgca cc attatgtt 3181 tactaat cac atgttctgtg tdctgttgacg actgtcaaag agtatctggc catggcggac 3241 acticago att togttgattga ataaatgtta gct cittctica ttgttgaagga ct cacttitta 3301 ctgggataala caaatgcagt talaga attct ggcacccttg taaggaagaa aagagagttc 3361 aac acct tcg agt ctgagcg Cttgttggct a gagtttgcca ggagggagga aaccagtgac 3.421 cctgaaaact gagggtgcct caggagcagt gggaccacct gatgctgaag gacggactaa 3 481 tdatgtttcc ticttgcc titc. tctggtgcct coattgc cct catggaacag agcatat cat 3541 agagggagaa aagtcaaact totaattgttgtc.ttacagtt actggct tca tott cottgg 36O1 gatatatggit catcct citaa tigagtgtaaa agtgcgcaaa acacatcctt attgttcctg 3 661 atctottagt cccataaatg ggaacaaata cagotttctg. cittctitt citt tttggggaaa 3721 gga cagggtg Ctagtgagta ctgacagcat gccagct acc galagt caccc agcc attcCC 3781 atgagcago a gttcatttaa ttgtcacagc git cqc cagga agaagatctgataa acctag 3841 gtttacagat aaagaaag.ca aaatgtagag atgttgttga gg.tcacagag gtgactgcct 3901 aactt cagag cagggct tct gatcc ctitta agaaattaca gggc.ca.gc.cg ggcatggtgg 3961 ct cacgc.ccg taatccCagg gCtttgggag gCCttggcag gtggat Cacc tagat.cgca 4 O21 cqttcgagac cagcc tigacic aacatggaga aacco catct ctactaaaaa cacaaattag 4081 C cagg.cgtgg tagg tacatgc ctgta at CCC agctact cag gaggctgagg caggagaatc 4141 acttgaccc.c aggagacgta ggttgttggtg agctgagat C gcgc.cattgc actic cagcct 42O1 ggcaacaag agcaaaactic ct ct caaaa aagaaaagaa aagaaaagaa at Catagggc 4261 caagttcaaa gogaaatgcac agaacatatic tt cacattag agittaagaat totc taggaa 4321 acaacagatt ttitttgttgt tdttagt cac aaatact tag aactggaagg ct citttgtta 4381 ttattgaatg taccc ct cag cct tcticago atttic ctitat cocaagact a gtgtgctitt c 4441 togctacact g c tagttittca gttttgttct tacccaattig titttittctitt to aa cattac 45O1 caatttacag attcagttta ttacatttac attaatcct c actitatgatt tdagcaa.gct 4561 cattt coaga aaagtttact ttalagat cat caataggatt togctaatttic agtgaagttca 4621 titttgct tca ggggtaaatt atcct agitta ccaagtic ct a tittggacata aagaaaatcc 4 681 tacttataga aaaggagaaa ataattaaac agt citt catt tttalagtaac tdatttaaaa 4741 goaaaataat aaaatatgtt cqttitat cat tt cagaaatt gotgtaacac actggaaaat 4801 toctdaacaa tatagattitt atcgittaata aaaaacact a gotttcqttic cittagaatgt 4861 ctitttcttitt gaataaacag tattgggtga titta
0053 Human BLOC1S1 protein has the amino acid sequence (SEQ ID NO:15) (NCBI Reference Sequence: NM 001487.3):
MAPGSRGERS SFRSRRGPGV PSPOPDWTML SRLLKEHOAK ONERKELOEK RRREAITAAT 60
CLTEALWDHL NWGVAQAYMN QRKLDHEWKT LOVOAAOFAK QTGQWIGMVE NFNOALKEIG 120
DVENWARSIE LDMRTIATAL EYWYKGOLOS APS 153
0054) Nucleic acid (mRNA) encoding human BLOC1S1 protein has the nucleotide sequence (SEQID NO:16) (NCBI Reference Sequence: NM 001487.3):
US 2014/0018338A1 Jan. 16, 2014 35
- Continued 5581 cqt citat cag tocticttgtt titatgcaaag atttact.gta aagtagattit citt toccitcc
56.41 ctic ccc.catt cittittattgt aaatattgtc. tctaaatgtg taaCatatta taaagaattit 5701 ataaggattt ttaaagatgt tittgct catt tacaaaagtg ttgtaac agt gttggacaaa 5761 gcc titccacc ccatgtc.cgc atggctic citt to actgtgtc cittgacacac ct citctggca 5821 acaactaaaa titt cotgctt ctdaaaagtic ct gtc.ttaaa agtacagtict at at cittgga 5881 aataaatago ttt cotcaag goatgaaaaa aaa
0065. The invention also encompasses splice variants of DNA (or analog) aptamers can be used. Aptamers that bind to NPC1, VPS11, VPS16, VPS18, VPS33A, VPS39, VPS41, virtually any particular target can be selected using an itera BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 tive process called SELEX, which stands for Systematic Evo and/or FIG4. lution of Ligands by EXponential enrichment. 0066. Known inhibitors of NPC1 include U18666A 0072 Possible modes of action of antiviral compounds (3-3-2-(diethylamino)ethoxyandrost-5-en-17-one) and the antidepressant imipramine' (a tricyclic antidepressant). include those illustrated, for example, in FIG. 24A-24D. 0067 VPS11, VPS16, VPS18, VPS33A, VPS39, and (0073 Rapidly acting small molecule inhibitors of NPC1, VPS41 are subunits of the homotypic fusion and vacuole VPS11, VPS16, VPS18, VPS33A, VPS39, VPS41, protein sorting (HOPS) complex. The mammalian HOPS BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 complex plays a critical role in fusion of endosomes and or FIG4 protein may be preferred for treatment of viral infec lysosomes. One or more inhibitors may be used, for tions due to the rapid speed of viral replication. example, to inhibit one or more subunits of HOPS. 0074. It is envisioned that administration of the agent to 0068 PIKFYVE is involved in the biogenesis of endo the subject would normally be limited to periods when the somes.''' and BLOC1S1 and BLOC1S2 are involved in the subject either has a filovirus infection or when the subject has biogenesis of lysosomes.' GNPTAB is involved in targeting been exposed to filovirus or is at risk of exposure to filovirus, of luminal cargo to the endocytic pathway.'" in order to minimize any deleterious effect of administration 0069. Inhibition of NPC1, VPS11, VPS16, VPS18, of the agent. Ebola/marburgvirus infections are typically VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, acute in nature, so drug treatment of infection for only a short PIKFYVE, ARHGAP23 or FIG4 can occur at the level of the period of time is appropriate. protein or at the level of nucleic acid (DNA or RNA) encoding 0075. The agent can be administered to the subject in a the protein. pharmaceutical composition comprising a pharmaceutically 0070 For example, the agent can be an antisense mol acceptable carrier. Examples of acceptable pharmaceutical ecule, a ribozyme, or a RNA interference (RNAi) molecule, carriers include, but are not limited to, additive solution-3 such as a small interfering RNA (siRNA) molecule, that spe (AS-3), saline, phosphate buffered saline, Ringer's solution, cifically inhibits expression of NPC1, VPS11, VPS16, lactated Ringer's Solution, Locke-Ringer's solution, Krebs VPS18, VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, Ringer's Solution, Hartmann's balanced saline solution, and GNPTAB, PIKFYVE, ARHGAP23 or FIG4 protein. The heparinized sodium citrate acid dextrose solution. The phar agent can be comprised of nucleic acid (e.g., DNA or RNA) or maceutically acceptable carrier used can depend on the route nucleic acid mimetics (e.g., phosphorothionate mimetics) of administration. The pharmaceutical composition can be Such as those known in the art. formulated for administration by any method known in the 0071. The agent can also be, for example, an antibody, art, including but not limited to, oral administration, antibody fragment, aptamer or Small molecule that specifi parenteral administration, intravenous administration, trans cally binds to NPC1, VPS11, VPS16, VPS18, VPS33A, dermal administration, intranasal administration, and admin VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, PIK istration through an osmotic mini-pump. The compounds can FYVE, ARHGAP23 or FIG4 and reduces its activity or inter be applied to the skin, for example, in compositions formu feres with its normal function. Antibody fragments include, lated as skin creams, or as Sustained release formulations or but are not limited to, F(ab') and Fab' fragments and single patches. chain antibodies. F(ab') is an antigenbinding fragment of an 0076. The present invention also provides a method for antibody molecule with deleted crystallizable fragment (Fc) screening for an agent that treats and/or prevents infection of region and preserved binding region. Fab' is /2 of the F(ab') a subject with a filovirus, the method comprising determining molecule possessing only /2 of the binding region. The term whether or not the agent inhibits one or more of Niemann antibody is further meant to encompass polyclonal antibodies Pick C1 (NPC1), VPS11, VPS16, VPS18, VPS33A, VPS39, and monoclonal antibodies. The antibody can be a human VPS41, BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, antibody or a non-human antibody Such as a goatantibody or ARHGAP23 or FIG4, wherein an agent that inhibits NPC1, amouse antibody. Antibodies can be “humanized using stan VPS11, VPS16, VPS18, VPS33A, VPS39, VPS41, dard recombinant DNA techniques. Aptamers are single BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 Stranded oligonucleotides or oligonucleotide analogs that or FIG4 is a candidate for treating and/or preventing an infec bind to a particular target molecule. Such as a protein. Thus, tion with a filovirus and wherein an agent that does not inhibit aptamers are the oligonucleotide analogy to antibodies. How NPC1, VPS11, VPS16, VPS18, VPS33A, VPS39, VPS41, ever, aptamers are Smaller than antibodies. Their binding is BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 highly dependent on the secondary structure formed by the or FIG4 is not a candidate for treating and/or preventing an aptamer oligonucleotide. Both RNA and single stranded infection with a filovirus. US 2014/0018338A1 Jan. 16, 2014 36
0077. The agent used for treatment or in screening can be, ment were shown to require the NPC1 protein, independent of for example, an agent that targets domain C of NPC1 or its known function in cholesterol transport. The findings nucleic acid encoding domain C of NPC1. Domain C of uncover unique features of the entry pathway used by filovi NPC1 (FIG. 19) is a 248-amino acid domain from residue 373 ruses and indicate antiviral strategies to combat these deadly to residue 620 of SEQID NO:1. agents. 0078. The method can be carried out with respect to NPC1, for example, by measuring cholesterol transport, Methods where a decrease in cholesterol transport in the presence of I0085 Summary: Adherent HAP1 cells were generated by the agent indicates that the agent inhibits NPC1. The assay the introduction of OCT4/SOX2/c-Myc and KLF4 transcrip can be carried out using a cell line that expresses NPC1. tion factors. 100 million cells were mutagenized using a pro 0079 NPC1's cholesterol transport function is separable motor-less retroviral gene-trap vector carrying a GFP from its viral host factor function. Preferably, the agent selec reporter. Cells were not selected for reporter gene expression, tively targets NPC1's viral host factor function, without and insertion sites were mapped for approximately 1% of the blocking NPC1's cholesterol transport function. unselected population using parallel sequencing. Cells were 0080. The method can also be carried out, for example, by exposed to rVSV-GP-EboV and the resistant cell population measuring binding between NPC1, VPS11, VPS16, VPS18, was expanded and used to sequence insertion sites. Genes that VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, were statistically enriched for mutation events in the selected PIKFYVE, ARHGAP23 or FIG4, and the filovirus or a filovi population were identified, and the roles of selected genes in rus glycoprotein (GP), where a decrease in binding in the filovirus entry were characterized. presence of the agent indicates that the agent inhibits NPC1, 0086 Cells: KBM7 cells and derivatives were maintained VPS11, VPS16, VPS18, VPS33A, VPS39, VPS41, in IMDM supplemented with 10% FCS, L-glutamine, and BLOC1S1, BLOC1S2, GNPTAB, PIKFYVE, ARHGAP23 penicillin-streptomycin. Vero grivet monkey cells and human or FIG4. The method can be carried out, for example, using a dermal fibroblasts (Coriell Institute for Medical Research) enzyme-linked-immunosorbent assay (ELISA). The method were maintained in DMEM supplemented with 10% FCS, can be carried out, for example, using a electrochemilumi L-glutamine, and penicillin-streptomycin. Wild type and nescence (ECL) assay. NPC1-null (CT43) Chinese hamster ovary (CHO) fibroblasts 0081. The method can also be carried out, for example, by were maintained in DMEM-Ham's F-12 medium (50-50 measuring filovirus infection in tissue culture, where a reduc mix) supplemented with 10% FCS, L-glutamine, and peni tion infilovirus infection in the presence of the agent indicates cillin-streptomycin. that the agent inhibits NPC1, VPS11, VPS16, VPS18, I0087 Viruses: A recombinant VSV expressing eGFP and VPS33A, VPS39, VPS41, BLOC1S1, BLOC1S2, GNPTAB, EboV GP lacking the mucin domain (A309-489) (rVSV-GP PIKFYVE, ARHGAP23 and/or FIG4. EboV) was recovered and amplified as described previ 0082. The invention also provides an agent for treating ously''. Recombinant rVSV-BDV was generously provided and/or preventing infection of a subject with a filovirus iden by Juan Carlos de la Torre. rVSV-GP-Rabies was generated tified by any of the methods disclosed herein for screening for by replacement of the VSVG ORF in VSV-egFP (REF PMC an agent that treats and/or prevents infection of a Subject with 116335) with that of the SAD-B19 strain of Rabies virus, and a filovirus. The invention further provides a pharmaceutical recombinant virus was recovered and amplified as composition for treating and/or preventing infection of a Sub described. ject with a filovirus comprising a pharmaceutically accept I0088. The following non-recombinant viruses were used: able carrier and an agent identified by any of the methods Adenovirus type 5 (ATCC), Coxsackievirus B1 (ATCC), disclosed herein for screening for an agent that treats and/or Poliovirus 1 Mahoney (generously provided by Christian prevents infection of a subject with a filovirus. Schlieker), HSV-1 KOS (generously provided by Hidde 0083. This invention will be better understood from the Ploegh), Influenza A PR8 (Charles Rivers) and Rift valley Experimental Details, which follow. However, one skilled in fever virus MP-12 (generously provided by Jason the art will readily appreciate that the specific methods and Wojcechowsky). results discussed are merely illustrative of the invention as I0089 Generation of HAP1 cells: Retroviruses encoding described more fully in the claims that follow thereafter. SOX2, C-MYC, OCT4 and KLF4 were produced as described earlier'. Concentrated virus was used to infect Experimental Details near haploid KBM7 cells in three consecutive rounds of spin infection with an interval of 12 hours. Conditions were used Introduction that resulted in an infection percentage of >95% of pDIB 0084. A genome-wide haploid genetic screen in human EGFP (Clontech) that was taken along in a separate infection cells is described for identifying host factors required for as a control. Cells were plated at low density in regular EboVentry. The screen uncovered 67 mutations disrupting all medium (IMDM 10% FCS, L-glutamine, and penicillin six members of the HOPS multisubunit tethering complex, streptomycin). Expression of the four transcription factors which is involved in fusion of endosomes to lysosomes, and markedly changed morphology of the KBM7 cells from 39 independent mutations that disrupt the endo/lysosomal round, non-adherent cells typical for CML cells, to more cholesterol transporter protein Niemann-Pick C1 (NPC1)7. flattened and adherent cells. Colonies were picked and tested Cells defective for the HOPS complex or NPC1 function, for ploidy. One clonally derived cell line (referred to as including primary fibroblasts derived from human Niemann HAP1) with a haploid DNA content as determined using Pick type C1 disease patients, are resistant to infection by DNA staining and flow cytometry was further grown and EboV and MarV, but remain fully susceptible to a suite of characterized. Karyotyping of this line demonstrated that the unrelated viruses. Membrane fusion mediated by filovirus majority of the analyzed cells (27/39) were fully haploid, a glycoproteins and viral escape from the vesicular compart smaller population (9/39) was haploid for all chromosomes US 2014/0018338A1 Jan. 16, 2014 37 except chromosome 8, like the parental KBM7 cells. Less - Continued than 10% (3/39) was diploid for all chromosomes except for (SEQ ID NO: 30) chromosome 8 that was tetraploid. All cells carried the Phila VPS33A-R1, 5'- CTGTACACTTTGCTCAGTTTCC-3' delphia chromosome present in the parental KBM7 cells. (SEQ ID NO: 31) 0090 Haploid genetic screen: Gene trap virus was pro WPS11-F1, 5 - GAAGGAGCCGCTGAGCAATGATG-3"; duced by transfection of 293T cells in T175 dishes using (SEQ ID NO: 32) turbofectin 8 (origene) with a mixture of pCT-GFP. pGT WPS11-R1, 5 - GGCCAGAATTTAGTAGCAGCAAC-3". GFP+1 and pGT-GFP+2 (6.7 ug) combined with 1.7 ugp Ad vantage, 2.6 ug CMV-VSVG and 4 ug Gag-pol. The virus To confirm the correct insertion of the gene trap at the differ containing Supernatant was concentrated using ent loci a PCR was performed using the reverse (R1) primers ultracentrifugation for 1.5 h at 25,000 rp.m. in a Beckman of NPC1, VPS11 and VPS33A in combination with a primer SW28 rotor. To create a mutagenized cell population ~100 specific for the gene trap vector: PGT-F1; 5'-TCTC million HAP1 cells were infected with the gene-trap virus. CAAATCTCGGTGGAAC-3' (SEQ ID NO:33). To deter After expansion for 7 days, a proportion of the cells was mine RNA expression levels of NPC1, VPS11 and VPS33A harvested for genomic DNA isolation to create a control in the respective mutants, total RNA was extracted using dataset containing sequences flanking the gene-trap inser RNeasy (Qiagen), reverse transcribed using Superscript III tions in unselected cells. For the screen, hundred million (Invitrogen) and PCR amplified using gene specific primers: mutagenized cells were exposed to rVSV-GP-EboV at an MOI ~100. The resistant colonies that grew out were (SEQ ID NO: 34) expanded and ~30 million cells were used for genomic DNA WPS11 : " - CTGCTTCCAAGTTCCTTTGC-3' isolation. and 0091 Sequence analysis of genetrap insertion sites: Inser (SEO ID NO : 35) tion sites were identifieden masse by sequencing the genomic 5'-AAGATTCGAGTGCAGAGTGG-3"; DNA flanking gene trap proviral DNA as described before. (SEQ ID NO: 36) In short, a control dataset was generated containing insertion NPC1 : 5 - CCACAGCATGACCGCTC-3' sites in mutagenized HAP1 cells before selection with rVSV and GP-EboV. For this purpose genomic DNA was isolated from ~40 million cells and subjected to a linear PCR followed by (SEO ID NO : 37) linker ligation, PCR and sequencing using the Genome Ana 5'- CAGCTCACAAAACAGGTTCAG-3"; lyzer platform (Illumina). The insertions sites were mapped (SEQ ID NO: 38) on the human genome and insertion sites were identified that WPS33A is " - TTAACAC CTCTTGCCACTCAG-3' were located in genomic regions annotated to contain genes. and The insertions in this control dataset comprise of ~400,000 (SEO ID NO. 39) independent insertions that meet this criteria. To generate the 5'-TGTGTCTTTCCTCGAATGCTG-3 '' . experimental dataset, insertions in the mutagenized HAP1 cells after Selection with rVSV-GP-EboV were identified (0093 NPC1 constructs: Human NPC1 cDNA was ligated using an inverse PCR protocol followed by sequencing using in-frame to a triple flag sequence, and the resulting gene the Genome Analyzer. The number of inactivating mutations encoding C-terminally FLAG-tagged NPC1 was subcloned (Sense orientation or present in exon) per individual gene into the BamHI and SalI restriction sites of the pBABE-puro was counted as well as the total number of inactivating inser retroviral vector'. Constructs encoding flag-tagged NPC1 tions for all genes. Enrichment of a gene in the screen was loop-minus mutants in pBABE-puro AA, lacking NPC1 calculated by comparing how often that gene was mutated in amino acid residues 24-252): AC, lacking residues 381-611): the screen compared to how often the genes carries an inser AI, (lacking residues 865-1088) were generated by replacing tion in the control dataset. For each gene a p-value (corrected the indicated sequence with a BglII restriction site. To engi for false discovery rate) was calculated using the one-sided neer the individual loop domain constructs, a cassette vector Fisher exact test. encoding the following sequence elements was first gener ated and cloned into the BamHI and SalI sites of pHABE 0092 Characterization of the HAP1 mutant lines: Clonal puro: NPC1 signal peptide (encoding NPC1 amino acid resi cell lines with gene trap insertion in NPC1, VPS11 and dues 1-24), Mlul restriction site, the first NPC1 VPS33A were derived and genomic DNA was isolated using transmembrane domain (residues 267-295), NPC1 C-tail Qiamp DNA minikit (Qiagen). To confirm that the cells were (residues 1252-1278), gly-gly-gly-ser linker, and triple flag truly clonal and to confirm the absence of the wild type DNA tag. Each loop domain (A, residues 25-266: C, residues 373 locus, a PCR was performed with primers flanking the inser 620; I, residues 854-1098) was cloned into the Mlul site of tion site using the following primers: this cassette vector. All constructs were verified by automated DNA sequencing. 0094 CT43 cell populations stably expressing NPC1 pro (SEO ID NO: 27) teins: For transduction of VH-2 cells, the full-length human NPC-F1, 5'- GAAGTTGGTCTGGCGATGGAG-3"; NPC1 c)NA (Origene) was cloned into the retroviral vector (SEQ ID NO: 28) pMXslRESblasti-FLAG'. Fortransduction of CHOWT and NPC1-R2, 5'-AAGGTCCTGATCTAAAACTCTAG-3"; CT43 cells, the pBABE-puro-based retroviral vectors (SEQ ID NO: 29) described above were used. Retroviruses packaging the trans WPS33A-F1, 5'-TGTCCTACGGCCGAGTGAACC-3'; genes were produced by triple transfection in 293T cells, and target cells were directly exposed to sterile-filtered retrovirus laden Supernatants in the presence of polybrene (6 g/mL). US 2014/0018338A1 Jan. 16, 2014
Transduced cell populations were selected with blasticidin 2 h incubation at 37° C. and an acid wash to remove surface (20 ug/mL, for pMX) or puromycin (10 ug/mL, for p3ABE bound virus. The cellular plasma membrane was labeled by puro). incubation of cells with 1 ug/mL Alexa Fluor 594 wheat germ 0095 Cell viability assays for virus treatments: KBM7 agglutinin (Molecular Probes, Invitrogen) in PBS for 15 min. and HAP1 cells were seeded at 10,000 cells per well in a at RT. External virus particles were detected using a 1:2000 96-well tissue culture plate and treated with the indicated dilution of antibody 265.1, a mouse monoclonal specific for concentrations of rVSV-GP-EboV or left untreated. Three Ebola GP. The GP antibodies were detected by Alexa 488 days after treatment the cell viability was measured using an conjugated goat anti-mouse secondary antibody (Molecular XTT colorimetric assay (Roche) according to manufacturers Probes, Invitrogen). After washing with PBS, cells were protocol. Viability is plotted as percentage viability compared mounted onto glass slides using Prolong Antifade Reagent to untreated control. To compare susceptibility of the HAP1 (Invitrogen, Molecular Probes). Fluorescence was monitored mutants to different viruses, they were seeded at 10,000 cells with a epifluorescence microscope (Axiovert 200M; Carl per well and treated with different cytolytic viruses at a con Zeiss, Inc.; Thornwood, N.Y.) and representative images centration that in pilot experiments was the lowest concen were acquired using Slidebook 4.2 software (Intelligent tration to produce extensive cytopathic effects. Three days Imaging Innovations; Denver, Colo.). after treatment, viable, adherent cells were fixed with 4% 0101 VSV M protein-release assay: Cells grown on 12 formaldehyde in phosphate-buffered saline (PBS) followed mm coverslips coated with poly-D-lysine (Sigma-Aldrich) by staining with 0.5% crystal violet dye in 70% ethanol for 30 were pre-treated with 5 lug/ml puromycin for 30 min. and min. After three gentle washes with water, air-dried plates inoculated with rVSV at an MOI of 200-500 in the presence were scanned. of puromycin. After 3 h, cells were washed once with PBS 0096 Viral infectivity measurements: Infectivities of and fixed with 2% paraformaldehyde in PBS for 15 min. at VSV pseudotypes were measured by manual counting of RT. To detectVSVM protein, fixed cells were incubated with eGFP-positive cells using fluorescence microscopy at 16-26h a 1:7500 dilution of monoclonal antibody 23H12 (kind gift of post-infection, as described previously. rVSV-GP-EboV Doug Lyles), in PBS containing 1% BSA and 0.1% Triton infectivity was measured by fluorescent-focus assay (FFA), X-100 for 30 min. at RT. Cells were washed three times with as described previously''. PBS, and the anti-Mantibodies were detected using a 1:750 0097 Filipin staining: Filipin staining to visualize intrac dilution of Alexa 594-conjugated goat anti-mouse secondary ellular cholesterol was done essentially as described. antibodies. In addition, cells were counter-stained with DAPI Briefly, cells were fixed with paraformaldehyde (3%) for 15 to visualize nuclei. Cells were washed three times and min at room temperature. After three PBS washes, cells were mounted onto glass slides after which M localization images incubated with filipin complex from Streptomyces filipinensis were acquired using a Nikon TE2000-U inverted epifluores (Sigma-Aldrich) (50 ug/mL) in the dark for 1 hat room temp. cence microscope (Nikon Instruments, Inc.; Melville, N.Y.). After three PBS washes, cells were visualized by fluores Representative images were acquired with Metamorph soft cence microscopy in the DAPI channel. ware (Molecular Devices). 0098. Measurements of cysteine cathepsin activity: The 0102 Electron microscopy: Confluent cell monolayers in enzymatic activities of CatB and CatL in acidified post 6-well plates were inoculated with rVSV-GP-EboV at a MOI nuclear extracts of Vero cells, human fibroblasts, and CHO of 200-500 for 3 h. Subsequently, cells were fixed for at least lines were assayed with fluorogenic peptide Substrates 1 h at RT in a mixture of 2.5% glutaraldehyde, 1.25% Z-Arg-Arg-AMC (Bachem Inc., Torrance, Calif.) and paraformaldehyde and 0.03% picric acid in 0.1 M sodium (Z-Phe-Arg)2-R110 (Invitrogen), respectively, as described cacodylate buffer (pH 7.4). Samples were washed extensively previously. As a control for assay specificity, enzyme in 0.1 M sodium cacodylate buffer (pH 7.4) after which they activities were also assessed in extracts pretreated with E-64 were treated with 1% osmiumtetroxide and 1.5% potassium (10 uM), a broad-spectrum cysteine protease inhibitor, as ferrocyanide in water for 30 min. at RT. Treated samples were previously described'. Active CatB and Catl within intact washed in water, stained in 1% aqueous uranyl acetate for 30 cells were labeled with the fluorescently-labeled activity min., and dehydrated in grades of alcohol (70%, 90%, based probe GB111 (1 uM) and visualized by gel electro 2x100%) for 5 min. each. Cells were removed from the dish phoresis and fluorimaging, as described previously. with propyleneoxide and pelleted at 3,000 rpm for 3 min. 0099 Purification and dye conjugation of rVSV-GP Samples were infiltrated with Epon mixed with propyleneox EboV: rVSV-GP-EboV was propagated, purified and labeled ide (1:1) for 2 hat RT. Samples were embedded in fresh Epon with Alexa Fluor 647 (Molecular Probes, Invitrogen Corpo and left to polymerize for 24-48 hat 65°C. Ultrathin sections ration) as described previously with minor modifications. (about 60-80 nm) were cut on a Reichert Ultracut-S micro Briefly, Alexa Fluor 647 (Molecular Probes, Invitrogen Cor tome and placed onto copper grids. Images were acquired poration) was solubilized in DMSO at 10 mg/mL and incu using a Technai G2 Spirit BioTWIN (Fei, Hillsboro, Oreg.) bated at a final concentration of 31.25 ug/ml with purified transmission electron microscope. rVSV-GP-EboV (0.5 mg/ml) in 0.1 M NaHCO3 (pH 8.3) for (0103) Authentic filoviruses and infections: Cells were 90 min. at RT. Virus was separated from free dye by ultracen exposed to EBOV-Zaire 1995 or MARV-Ció7 at an MOI of 3 trifugation. Labeled viruses were resuspended in NTE (10 for 1 h. Viral inoculum was then removed and fresh culture mM Tris pH 7.4, 100 mM. NaCl, 1 mM EDTA) and stored at media was added. At 48 h post-infection, cells were fixed with -80° C. formalin, and blocked with 1% bovine serum albumin. 0100 Virus binding/internalization assay: Cells were EBOV-infected cells and uninfected controls were incubated inoculated with an MOI of 200-500 of Alexa 647-labeled with EBOV GP-specific monoclonal antibodies 13F6 or rVSV-GP-EboV at 4°C. for 30 min. to allow binding of virus KZ52. MARV-infected cells and uninfected controls were particles to the cell surface. Cells were subsequent fixed in 2% incubated with MARV GP-specific monoclonal antibody paraformaldehyde (to examine virus binding) or following a 9G4. Cells were washed with PBS prior to incubation with US 2014/0018338A1 Jan. 16, 2014 39 either goat anti-mouse IgG or goat anti-human IgG conju 0.5% CHAPS (PBSA-CHAPS). Uncleaved or in vitro gated to Alexa 488. Cells were counterstained with Hoechst cleaved rVSV-GP or VSV-GP particles solubilized in PBSA stain (Invitrogen), washed with PBS and stored at 4° C. CHAPS buffer were added to the blocked plates, and GP Infected cells were quantitated by fluorescence microscopy capture was allowed to proceed for 1 hat 37°C. After washing and automated image analysis. Images were acquired at 9 to remove unbound GP serial dilutions of NPC1-flag partially fields/well with a 10x objective lens on a Discovery-1 high purified from CT43 cells (0-100 ng/well), crude detergent content imager (Molecular Devices) or at 6 fields/well with a extracts of 293T cells expressing flag-tagged NPC1 or 20x objective lens on an Operetta (Perkin-Elmer) high con NPC1L1 proteins (0-2x10 cell-equivalents), or purified, tent device. Discovery-1 images were analyzed with the “live/ soluble domain C (0-40 ug/mL) were added to the wells. After dead module in MetaXpress software. Operetta images were an overnight incubation at 4° C., plates were extensively analyzed with a customized scheme built from image analysis washed, and bound flag-tagged proteins were detected with functions present in Harmony Software. an anti-flag antibody-horseradish peroxidase conjugate and 0104 Animals and filovirus challenge experiments: Ultra-TMB substrate (Thermo). Mouse-adapted MarV Ci67 was provided by Sina Bavari'. 0107 Affinity purification of NPC1-flag: CT43 cells Female and male BALB/c NPC1" mice and BALB/c expressing NPC1-flag (2x10 cells) were harvested and lysed NPC1" mice (5 to 8 week old) were obtained from Jackson as above, and the extracts were incubated with magnetic Laboratory (Bar Harbor, Me...). Mice were housed under spe beads coated with anti-flag antibody (0.25 mL) at 4°C. with cific-pathogen-free conditions. Research was conducted in mixing for 12-16h. Beads were then extensively washed with compliance with the Animal Welfare Act and other federal NTE-CHAPS, and bound proteins were eluted with 10 statutes and regulations relating to animals and experiments packed-bead volumes of triple flag peptide (5 mg/mL, involving animals and adhered to principles stated in the Sigma). The eluate was concentrated and buffer-exchanged Guide for the Care and Use of Laboratory Animals (National using a centrifugal concentrator (100 kDa molecular weight Research Council, 1996). The facility where this research was cutoff: Pall Biosciences), and NPC1-flag purity was assessed conducted is fully accredited by the Association for the by SDS-PAGE and staining with the Krypton infrared pro Assessment and Accreditation of Laboratory Animal Care tein-binding dye (Thermo). International. For infection, mice were inoculated intraperi 0.108 Generation and purification of soluble domain C toneally (i.p.) with a target dose of 1000 pfu (30,000xthe 50% and GPATM proteins: A construct engineered to encode lethal dose) of mouse-adapted EboV or mouse-adapted MarV NPC1 domain C (residues 372-622) flanked by sequences Ció7 virus in a biosafety level 4 laboratory. Mice were that form a stable, antiparallel coiled coil, and fused to a observed for 28 days after challenge by study personnel and preprotrypsin signal sequence and flag and hexahistidine tags by an impartial third party. Daily observations included at its N-terminus. A plasmid encoding EBOV GPATM (resi evaluation of mice for clinical symptoms Such as reduced dues 1-650) fused to a hexahistidine tag at the C-terminus was grooming, ruffled fur, hunched posture, Subdued response to kindly provided by G. G. Olinger (USAMRIID). Soluble stimulation, nasal discharge, and bleeding. Serum was col domain C was expressed in human 293-Freestyle cells (Invit lected from Surviving mice to confirm virus clearance. Back rogen) and purified from conditioned Supernatants by nickel titration of the challenge dose by plaque assay determined affinity chromatography. GPATM was expressed in 293 that EboV-infected mice received 900 pfu/mouse and MarV EBNA cells (ATCC) and purified from conditioned superna infected mice received 700 pfu/mouse. tants in a similar manner. 0105 GP-NPC1 co-immunoprecipitation (co-IP) assays: 0109 Neutralization of rVSV-GP-EBOV by soluble Protein G-coated magnetic beads (20 uL/reaction: Sphero domain C: Uncleaved or cleaved rVSV-GP-EBOV particles tech) were incubated with the GP-specific monoclonal anti were mixed with soluble domain C for 1 h at room temp. body KZ52 (5ug) for 1 h, washed to remove unbound anti Subsequently, the virus mixtures were diluted and exposed to body, and then added to uncleaved or in vitro-cleaved rVSV Vero cell monolayers for 1 h at 37°C., at which time NHCl GP-EBOV or VSV-GP-EBOV particles (5 uL concentrated (20 mM) was added to block additional entry events and virus; 107-10 infectious units), or to purified EBOV GPATM cell-to-cell spread. Viral infectivity was determined at 12-16 (9 pig) in NTE-CHAPS buffer (10 mM Tris.C1 pH 7.5, 140 h post-infection by enumerating eGFP-positive cells. mM NaCl, 1 mM EDTA, 0.5% vol/vol CHAPS (3-(3-chola midopropyl)dimethylammonio-1-propanesulfonate)). Results Bead-virus mixtures were incubated for 2 hat room tempera 0110 Haploid genetic screens have previously been used ture, and then added to crude detergent extracts of CHOCT43 to gain insight into a variety of biological processes relevant cells expressing a flag-tagged NPC1 protein (NPC1-flag) to human disease'. Here this approach was used to explore (2x10 cell-equivalents in 150 uL), or to purified, soluble the cell entry pathway used by filoviruses at an unprecedented NPC1 domain C (5ug/mL). After overnight incubation with level of detail. To interrogate millions of independent gene mixing at 4°C., beads were retrieved with a magnet, exten disruption events in human cells for associated defects in sively washed with NTE-CHAPS, and heated in Laemmli EboV entry, a replication-competent vesicular stomatitis sample buffer to elute bound proteins. Solubilized proteins virus bearing the EboV glycoprotein (rVSV-GP-EboV)'' was were subjected to SDS-polyacrylamide gel electrophoresis, used to select for resistant cells. Although this recombinant and NPC1 and GP were detected by immunoblotting with virus multiplies in and kills most cultured cell lines, it grew anti-flag (Sigma-Aldrich) and anti-GP1 antibodies, respec poorly in near-haploid KBM7 cell cultures (FIG. 5C). To tively. obtain a system Suitable for a haploid genetic screen using 010.6 GP-NPC1 capture ELISA: 96-well high-binding rVSV-GP-EboV, experiments were undertaken to alter the ELISA plates (Corning) were coated with the GP-specific differentiation state of KBM7 cells'. In an unsuccessful monoclonal antibody KZ52 (2 ug/mL in PBS), and then attempt to induce pluripotency in KBM7 cells through the blocked with PBS containing 3% bovine serum albumin and expression of OCT4, SOX-2, c-MYC and KLF4', a cell line US 2014/0018338A1 Jan. 16, 2014 40 was obtained that was termed HAP1 (FIG. 5A). HAP1 cells recombinant VSVs bearing the Rabies and Borna disease grow adherently, can be clonally expanded, and no longer virus glycoproteins' (FIG.1D). These mutant cells also fully express markers associated with hematopoietic cells (FIG. supported infection by influenza A virus, which enters cells 5B). The majority of cells in early passage cultures of HAP1 via late endosomes' (FIG. 1D). Therefore, deficiency of cells are haploid for all chromosomes, including chromo VPS11, VPS33A, or NPC1 causes resistance specifically to some 8 (which is present in two copies in KBM7 cells). viral entry mediated by filovirus glycoproteins. Unlike KBM7 cells, HAP1 cells did support robust multipli 0113 Loss of NPC1 function causes Niemann-Pick dis cation of rVSV-GP-EboV and were rapidly killed by it (FIG. ease, a hereditary neurovisceral disorder characterized by the 5C), thus allowing mutagenesis-based screens for essential accumulation of cholesterol and sphingolipids within lysos Filovirus host factors. omes''. Tests were conducted of the susceptibility of I0111. A retroviral promoter-less gene trap vector' was patient fibroblasts carrying homozygous mutations in NPC1 used to perform insertional mutagenesis on early-passage to filovirus GP-dependent infection. As expected, control HAP1 cells, creating a library of cells with single-gene dis cells derived from a healthy individual were readily infected ruptions. To generate a control dataset, -800,000 insertion by rVSV-GP-EboV and VSV pseudotyped with GP proteins events were mapped in unselected cells using deep sequenc derived from EboV, Sudan virus, or MarV, whereas NPC1 ing. Next, ~100 million mutagenized cells were exposed to mutant cells were infected poorly or not at all (FIGS. 2A, B). rVSV-GP-EboV. Cells resistant to killing by this virus were By contrast, both types of cells were efficiently infected by expanded as a pool, and insertion sites were mapped using native VSV. The susceptibility of NPC1-deficient fibroblasts parallel sequencing. Enrichment for mutations in a particular to rVSV-GP-EboV infection was restored by retroviral gene was calculated by comparing the gene's mutation fre expression of wild type NPC1, confirming that loss of the quency in resistant cells to that observed in the unselected NPC1 protein is responsible for the infection defect (FIG. control dataset (FIG. 6). Similar experiments in KBM7 cells 2C). have linked numerous genes to a variety of phenotypes with 0114 Mutations in a second gene, NPC2, cause identical high confidence. Using this approach, a set of genes enriched clinical symptoms and phenocopy the defects in cellular lipid for mutations in the rVSV-GP-EboV-resistant cell population transport". Surprisingly, NPC2-mutant fibroblasts derived were identified (FIGS. 1A and 4C). Nearly all of the candidate from two different patients were susceptible to filovirus GP host factors encoded by these genes are involved in the archi dependent infection, despite similar capacities of the NPC2 tecture and trafficking of endo/lysosomal compartments, and NPC1-mutant cells to accumulate cholesterol in lysos highlighting the central importance of this pathway for EboV omes (FIGS. 2A, 2B and 9). Furthermore, clearance of accu GP-dependent infection. The screen identified the endosomal mulated cholesterol from NPC1-null cells by prolonged cul cysteine protease cathepsin B (CatB), the only host factor tivation in lipoprotein-depleted growth medium did not whose genetic deletion was previously demonstrated to confer susceptibility to rVSV-GP-EboV infection (FIG. 10A, inhibit EboV GP-dependent entry. Further inspection 10B). Thus, resistance of NPC1-deficient cells to rVSV-GP showed that mutations were highly enriched in all 6 subunits EboV is not caused by defects in lipid transport per se, con of the homotypic fusion and vacuole protein sorting (HOPS) sistent with the results of the screen, which did not identify complex (VPS11, VPS16, VPS18, VPS33A, VPS39 and NPC2 as a host factor for EboVentry (FIG. 1A). VPS41), for which a total of 67 independent mutations were 0115 Filoviruses display broad mammalian host and tis identified. Like its well-studied yeast counterpart, the mam Sue tropism and can infect a wide variety of cell types in malian HOPS complex plays a critical role infusion of endo culture’. To determine if NPC1 is generally required for somes and lysosomes. The identification of all 6 members of filovirus GP-mediated infection, rVSV-GP-EboV infection the HOPS complex demonstrates the high, and possibly satu was measured in NPC1-null Chinese hamster ovary (CHO) rating, coverage of the mutagenesis screen. A number of cells. Loss of NPC1 conferred complete resistance to viral additional genes were also identified whose products are infection (FIGS. 8B and 10B) that could be reversed by involved in the biogenesis of endosomes (PIKFYVE)''' expression of human NPC1 (FIG. 10B). Therefore, NPC1 and lysosomes (BLOC1S1, BLOC1S2)", and in targeting of plays a critical role in entry mediated by filovirus glycopro luminal cargo to the endocytic pathway (GNPTAB)''. teins that is conserved in mammals. Finally, the single strongest hit obtained, with 39 independent 0116 Filovirus particles can probably bind to a diverse set gene-trap insertions, was the Niemann-Pick disease locus of cell-surface molecules'', upon which they undergo inter NPC1, which encodes an endo/lysosomal cholesterol trans nalization by a macropinocytosis-like mechanism’, and porters. traffic to late endosomal compartment(s) where GP is cleaved 0112 Neither the HOPS complex nor NPC1 has previ by endosomal cysteine proteases. Cleaved GP then mediates ously been implicated in the entry of any type of virus. To fusion of viral and endosomal membranes, thereby releasing investigate their roles in filovirus entry, the resistant cell the viral nucleocapsid into the cytoplasm. To determine population was subcloned to obtain clones deficient for the which step(s) in filovirus entry require the HOPS complex HOPS subunits VPS11 and VPS33A, and for NPC1 (FIG.7A, and NPC1, an assessment was conducted of possible defects 7B). Expression of the corresponding gene products was no in attachment and internalization of rVSV-GP-EboV in longer detected in these clones (FIG. 8A). NPC1-, VPS11 VPS33A- and NPC1-null HAP1 cells. No significant differ and VPS33A-null cells displayed marked resistance to infec ence were observed in binding of Alexa 647 fluorophore tion by rVSV-GP-EboV and VSV pseudotypes bearing EboV labeled rVSV-GP-EboV to wildtype and mutant cells at 4°C. or MarV GP (FIGS. 1C, and 7C). NPC1-deficient cells were (not shown). Cells with bound virus were then warmed to 37° completely refractory to infection by these viruses. Cells that C. to promote endocytosis and acid-washed to strip non lack a functional HOPS complex or NPC1 were nonetheless internalized viral particles from the cell surface. Fluorescent fully susceptible to infection by a large panel of other envel microscopy showed similar levels of internalized rVSV-GP oped and nonenveloped viruses, including native VSV and EboV in wild type and mutant cells (not shown). Consistent US 2014/0018338A1 Jan. 16, 2014 with these findings, bullet-shaped VSV particles were readily infection of human peripheral blood monocyte-derived den observed by electron microscopy at the cell periphery and dritic cells and umbilical-vein endothelial cells (HUVEC) within plasma membrane invaginations resembling nascent (FIG. 14A, 14B), without affecting cell number or morphol macropinosomes (FIG.3A). Therefore, GP-mediated entry is ogy. These findings indicate that filovirus entry and infection not inhibited at binding or internalization steps in NPC1- or is sensitive to perturbation by small-molecule inhibitors of HOPS-defective cells, suggesting a downstream block. NPC1. 0117 Cleavage of EboV GP by CatB and/or cathepsin L 0.122 The effect of NPC1 mutation in lethal mouse mod (CatL) is a prerequisite for viral membrane fusion. Mutant els of EboV and MarV infection was assessed. Heterozygous HAP1 cells possess normal levels of CatB/CatL enzyme NPC1 (NPC1') knockout mice and their wild type litter activity (FIG. 11B, 11C) and remained refractory to infection mates were challenged with mouse-adapted EboV or MarV by in vitro-cleaved rVSV-GP-EboV particles (FIG. 3C) that and monitored for 28 days. Whereas NPC1" mice rapidly no longer required CatB/CatL activity within Vero cells (FIG. succumbed to infection with either filovirus, NPC1" mice 11A). Therefore, the HOPS complex and NPC1 are likely were largely protected (FIG. 17A, 17B). Therefore, NPC1 is required at Step(s) downstream of GP proteolytic processing. critically required for filovirus in vivo pathogenesis. 0118. The intracellular distribution of the internal VSV M I0123 Given its efficacy in tissue culture, the protective (matrix) protein was used as a marker for Successful mem capacity of imipramine was examined in the lethal mouse brane fusion in VPS33A- and NPC1-null HAP1 cells (FIG. model of of EboV infection. Mice administered a single dose 3D). Cells were exposed to native VSV or rVSV-GP-EboV in of imipramine 2 h before EboV challenge were substantially the presence of puromycin to block protein synthesis, and protected from filovirus challenge. Although the efficacy of then fixed and immunostained to visualize the incoming M imipramine at interrupting NPC1 function in vivo was not protein. Productive entry into wild type HAP1 cells caused examined, these findings provide the first evidence that phar redistribution of the incoming viral M throughout the cyto macological inhibition of NPC1 in vivo can confer protection plasm (FIG. 3C), whereas a membrane fusion block imposed against filovirus infection. by agents that elevate endosomal pH resulted in punctate M 0.124. To determine if filovirus entry requires the entire staining (FIG. 12). Diffuse M staining was also observed for NPC1 protein or can instead be attributed to a discrete region VSV in U18666A-treated wild type cells, and in HOPS com within it, NPC1 deletion mutants individually lacking the plex- and NPC1-null cells (FIG. 3C), consistent with the large luminal loop domains A, C, and I (FIG. 19) were capacity of VSV to productively infect these cells (FIG. 1D). expressed in an NPC1-null cell line (Chinese hamster ovary By contrast, only punctate M staining was obtained in drug CHOICT43°), and their capacity to mediate lysosomal treated and mutant cells exposed to rVSV-GP-EboV (FIG. cholesterol transport and viral infection was examined (FIG. 3C). Electron micrographs of mutant cells revealed agglom 20). CT43 cells accumulated lysosomal cholesterol', and erations of viral particles within vesicular compartments they were completely resistant to infection by wild type (FIGS. 3D and 13), reinforcing the conclusion that fusion and EBOV/MARV and rVSV-GP-EBOV/MARV'. As shown uncoating of the incoming rVSV-GP-EboV is arrested. previously', expression of flag epitope-tagged WT NPC1 Therefore, NPC1 and a functional HOPS complex are (NPC1-flag) in these cells not only corrected their cholesterol required for late step(s) in filovirus entry leading to viral transport defect but also rendered them highly susceptible to membrane fusion. infection by wildtype filoviruses and rVSVs bearing filovirus 0119 The above experiments were done with recombi glycoproteins. All three loop-minus NPC1 mutants were nant or pseudotyped VSV particles bearing filovirus glyco inactive at lysosomal cholesterol transport (FIG. 20A). proteins. Because these Surrogate systems may not faithfully despite their significant localization to LAMP1-positive late represent all aspects of filovirus infection, it was tested if endosomal/lysosomal compartments (not shown), confirm infection and multiplication by authentic EboV and MarV are ing that this cellular activity of NPC1 requires all three lumi affected in NPC1-mutant patient fibroblasts. Consistent with nal domains A, C, and I. However, the mutants differed in the findings with VSV particles, yields of infectious viral their capacity to support filovirus GP-mediated entry. Both progeny were profoundly reduced for both viruses in the NPC1-AA-flag and NPC-AI-flag could mediate entry, albeit mutant cells, relative to control fibroblasts (FIG. 4A). There at reduced levels relative to WTNPC1-flag. In striking con fore, NPC1 is essential for authentic filovirus infection. trast, NPC1-AC-flag was unable to rescue viral entry (FIG. 0120 Certain small molecules such as U18666A and the 20) even though it resembled the other mutants in expression antidepressant imipramine are known to cause a cellular level and intracellular distribution (not shown). Similar phenotype similar to that observed in Niemann-Pick disease, results were obtained in infection assays with wild type in part by targeting the NPC1 protein’’. Both com MARV (FIG. 20O). These findings unequivocally separate pounds potently inhibited viral infection mediated by EboV NPC1's functions in lysosomal cholesterol transport and GP but not VSV in Vero grivet monkey cells (FIG. 2D for filovirus entry. More importantly, they demonstrate that a U18666A, imipramine not shown). U18666A inhibited viral discrete region within NPC1, the luminal domain C, is essen infection almost immediately after its addition to Vero cells tial for EBOV and MARV entry. (<10 min) (FIG. 15A) and before significant intracellular 0.125. The preceding experiment raised the possibility that accumulation of cholesterol could be observed (>4 h) (data filovirus GP uses NPC1 to enter cells by interacting directly not shown)". Moreover, sensitivity of viral infection to with this protein without regard to its normal cellular func U18666A was lost by ~2 h post-infection, indicating that tions. To examine this hypothesis, it was first tested if EBOV U18666A inhibits infection at the entry step (FIG. 15B). GP could bind to NPC1 in a cell- and membrane-free system. 0121 The effect of U18666A and imipramine on infection Concentrated rVSV-GP-EBOV particles were solubilized in by authentic EboV and MarV was examined Stark reductions a nonionic detergent-containing buffer, and the GP protein in in viral yield were obtained in Vero cells treated with either these extracts was captured by magnetic beads coated with drug (FIGS. 4B and 16). Moreover U18666A greatly reduced the GP-specific monoclonal antibody KZ52. These GP-deco US 2014/0018338A1 Jan. 16, 2014 42 rated beads did not retrieve NPC1-flag from CT43 detergent these antivirals are envisioned, only some of which are extracts in a co-immunoprecipitation (co-IP) assay (FIG. detailed here. For example, these molecules may (1) directly 21A). Next rVSV-GP-EBOV was incubated with the bacte inhibit the GP-NPC1 virus-receptor interaction during entry rial metalloprotease thermolysin to generate a GP intermedi (FIG.24A) by blocking the binding site in either protein (FIG. ate (GP) that resembles the product of endo/lysosomal GP 24B); (2) indirectly inhibit the GP-NPC1 virus-receptorinter cleavage. GP could capture NPC1-flag at both neutral action during entry by binding to NPC1 and inducing a con and acid pH (FIG. 21A). Similar results were obtained in a formational change in this protein (FIG. 24C); (3) indirectly reciprocal co-IP experiment: magnetic beads displaying inhibit the GP-NPC1 virus-receptor interaction during entry NPC1-flag captured GP, but not GP (not shown). by binding to an associated cellular component (e.g., protein 0126 To confirm these findings, the capacity of rVSV or lipid) and inducing a conformational change in this protein derived GP and GP to capture NPC1-flag from 293Thuman (not pictured); and/or (4) reduce levels of the NPC1 protein embryonic kidney cell extracts was examined using an by causing it to misfold, or otherwise targeting it for degra enzyme-linked immunosorbent assay (ELISA). GP and GP dation within cells (FIG.24D). were captured onto antibody KZ52-coated ELISA plates, and 0.130. The current work enables the development of assays then incubated with CT43 extracts containing NPC1-flag. for identification of small molecule inhibitors of the GP NPC1-flag bound saturably to wells coated with GP, but not NPC1 interaction by high-throughput screening. For with GP, consistent with the results from the co-IP assay (FIG. example, results are provided with an enzyme-linked immu 21B). Affinity-purified NPC1-flag (FIG. 21C) bound satura nosorbent assay (ELISA) to detect the binding of GP to intact bly to wells coated with GP, but not GP in the ELISA, NPC1 or NPC1 domain C-containing fragment (FIGS. 21B, providing evidence that GP, directly interacts with NPC1 21D, 22A), which may be adapted to high-throughput screen (FIG. 21D). Cumulatively, these findings demonstrate that ing. One possible embodiment of Such a screening assay is a the proteolytic priming of EBOV GP creates, or unmasks, a homogeneous electrochemiluminescence (ECL) assay to specific and direct binding site for NPC1. measure the binding of purified GP to immobilized endoso 0127. It was next tested if NPC1 domain C is not only mal membrane fragments containing the complete NPC1 pro necessary but also sufficient to mediate EBOV GP-NPC1 tein (FIG. 25). A second possible embodiment of such a binding. To examine the GP-NPC1 interaction with screening assay is a homogeneous assay in which interaction soluble proteins in the absence of detergent, a soluble, of GP and NPC1 domain C brings two distinct functionalized secreted, and biologically-active form of domain C" was beads into proximity, resulting in the emission of light at a engineered and its binding to GP was tested. Cleaved specific wavelength that can be measured with the appropri rVSV-GP, but not uncleaved rVSV-GP captured purified ate instrumentation. The current work also enables other domain C in an ELISA (FIG. 22A). Even more stringently, types of GP-NPC1 interaction assays. GP derived from a purified, soluble GP protein lacking the I0131 Global disruption of nonessential human genes as transmembrane domain (GPATM) co-precipitated purified described here has provided a solid genetic framework for domain C, whereas uncleaved GPATM did not (FIG. 22B). understanding the unusual entry pathway used by the Ebola Consistent with its capacity to bind directly and stably to and Marburg viruses. Most of the genes that were identified GP, soluble domain C neutralized infection by rVSV-GP affect different aspects of lysosome function, Suggesting that but not rVSV-GP in a dose-dependent manner (FIG. 22C). filoviruses exploit this organelle in a manner distinct from Therefore, NPC1 domain C directly and specifically binds to other viruses. By uncovering unanticipated roles for these a cleaved form of the EboV glycoprotein. cellular genes and their products in EboV and MarVentry 0128 Finally, it was asked if a synthetic single-pass mem into host cells, the present work opens new avenues for Sorely brane protein containing only NPC1 domain C could mediate needed anti-filovirus therapeutics. filovirus entry. Accordingly, NPC1 luminal domains A, C, and I were separately fused to the first transmembrane REFERENCES domain of NPC1, the NPC1 cytoplasmic tail, and a flag tag, and expressed in CT43 cells. All three proteins were (0132) Feldmann, H and Geisbert, T. W. Ebola haemor expressed to similar levels, and domain A-flag and domain rhagic fever. Lancet (2010). C-flag localized significantly to late endosomes and/or lyso I0133) Lee, J E and Saphire, EO, Ebolavirus glycoprotein Somes (not shown). The capacity of these engineered single structure and mechanism of entry. Future Virol. 4 (6), 621 domain transmembrane proteins to mediate viral entry was (2009). tested in CT43 cells (FIG. 23A, 23B). Remarkably, only domain C-flag afforded measurable, although incomplete, I0134) Chandran, Kartik et al., Endosomal proteolysis of rescue offilovirus GP-dependent entry, in full agreement with the Ebola virus glycoprotein is necessary for infection. the GP-binding activity of domain C (FIG. 22). Taken Science. 308 (5728), 1643 (2005). together, these results indicate that sequences essential for I0135 “Kuhn, Jens H. et al., Conserved receptor-binding both the EboV GP binding and entry host factor activities of domains of Lake Victoria marburgvirus and Zaire ebolavi NPC1 reside within domain C, a 248-amino acid domain of rus bind a common receptor. The Journal of biological this 1278-amino acid protein that protrudes into the endoso chemistry 281 (23), 15951 (2006). mal lumen. These findings, together with other functional 10136) Schomberg, Kathryn et al., Role of endosomal data presented herein, also indicate that NPC1 is a critical cathepsins in entry mediated by the Ebola virus glycopro endosomal receptor for cell entry by the Ebola and Marburg tein. Journal of virology 80 (8), 4174 (2006). viruses. 0.137 Nickerson, Daniel P. Brett, Christopher L., and 0129. The current work enables the development of small Merz, Alexey J., Vps-C complexes: gatekeepers of endoly molecule antivirals targeting the NPC1 protein in cells and sosomal traffic. Current opinion in cell biology 21 (4), 543 hosts (FIG. 24). A number of possible modes of action for (2009). US 2014/0018338A1 Jan. 16, 2014
0138 Naureckiene, S. et al., Identification of HE1 as the ing of low density lipoprotein-derived cholesterol. The second gene of Niemann-Pick C disease. Science (New Journal of biological chemistry 275 (6), 4013 (2000). York, N.Y.) 290 (5500), 2298 (2000). 0153 Liscum, L. and Faust, J. R. The intracellular 0139 Carstea, E. D. et al., Niemann-Pick C1 disease transport of low density lipoprotein-derived cholesterol is gene: homology to mediators of cholesterol homeostasis. inhibited in Chinese hamster ovary cells cultured with Science (New York, N.Y.) 277 (5323), 228 (1997). 3-beta-2-(diethylamino)ethoxyandrost-5-en-17-one. 0140 Carette et al., J E (submitted). The Journal of biological chemistry 264 (20), 11796 I0141 'Carette, Jan E. et al., Haploid genetic screens in (1989). human cells identify host factors used by pathogens. Sci I0154) Rodriguez-Lafrasse, C. et al., Abnormal choles ence (New York, N.Y.) 326 (5957), 1231 (2009). terol metabolism in imipramine-treated fibroblast cultures. 0142) 'Wong, Anthony C. et al. A forward genetic strat Similarities with Niemann-Pick type C disease. Bio egy reveals destabilizing mutations in the Ebolavirus gly chimica et biophysica acta 1043 (2), 123 (1990). coprotein that alter its protease dependence during cell (O155 'Lange, Y.Ye. J. Rigney, M. and Steck, T., Choles entry. Journal of virology 84 (1), 163 (2010). terol movement in Niemann-Pick type C cells and in cells 0143 °Carette, Jan E. et al., Generation of iPSCs from treated with amphiphiles. The Journal of biological chem cultured human malignant cells. Blood 115 (20), 4039 istry 275 (23), 17468 (2000); Liu, Ronghua, Lu, Peihua, (2010). Chu, Joseph W. K., and Sharom, Frances J. Characteriza I0144) Takahashi, Kazutoshi et al., Induction of pluripo tion of fluorescent sterol binding to purified human NPC1. tent stem cells from adult human fibroblasts by defined The Journal of biological chemistry 284 (3), 1840 (2009); factors. Cell 131 (5), 861 (2007). Cenedella, Richard J., Cholesterol synthesis inhibitor (0145 ''Sbrissa, Diego et al., Core protein machinery for U18666A and the role of sterol metabolism and trafficking mammalian phosphatidylinositol 3.5-bisphosphate syn in numerous pathophysiological processes. Lipids 44 (6), thesis and turnover that regulates the progression of endo somal transport. Novel Sac phosphatase joins the ArPIK 477 (2009). fyve-PIKfyve complex. The Journal of biological I0156 Lloyd-Evans, Emyr et al., Niemann-Pick disease chemistry 282 (33), 23878 (2007): Ikonomov, Ognian C. et type C1 is a sphingosine storage disease that causes al., PIKfyve controls fluid phase endocytosis but not recy deregulation of lysosomal calcium. Nature medicine 14 cling/degradation of endocytosed receptors or sorting of (11), 1247 (2008). procathepsin D by regulating multivesicular body morpho O157 Marzi, Andrea et al., DC-SIGN and DC-SIGNR genesis. Molecular biology of the cell 14 (11), 4581 (2003). interact with the glycoprotein of Marburg virus and the S 0146 'Dell’Angelica, Esteban C. The building BLOC protein of severe acute respiratory syndrome coronavirus. (k)s of lysosomes and related organelles. Current opinion Journal of virology 78 (21), 12090 (2004). in cell biology 16 (4), 458 (2004). I0158 Nanbo, Asuka et al., Ebolavirus is internalized 0147 ''Tiede, Stephan et al. Mucolipidosis II is caused into host cells via macropinocytosis in a viral glycoprotein by mutations in GNPTA encoding the alpha/beta GlcNAc dependent manner. PLOS pathogens 6 (9) (2010); Saeed, 1-phosphotransferase. Nature medicine 11 (10), 1109 Mohammad F., Kolokoltsov, Andrey A., Albrecht, Tho (2005). mas, and Davey, Robert A. Cellular entry of ebola virus 0148 'Perez, Maret al., Generation and characterization involves uptake by a macropinocytosis-like mechanism of a recombinant vesicular stomatitis virus expressing the and Subsequent trafficking through early and late endo glycoprotein of Borna disease virus. Journal of virology 81 somes. PLoS pathogens 6 (9) (2010). (11), 5527 (2007). 0159 Weissenhorn, W. et al., The central structural fea 0149 Sieczkarski, Sara B. and Whittaker, Gary R. Dif ture of the membrane fusion protein subunit from the Ebola ferential requirements of Rab5 and Rab7 for endocytosis of virus glycoprotein is a long triple-Stranded coiled coil. influenza and other enveloped viruses. Traffic (Copen Proceedings of the National Academy of Sciences of the hagen, Denmark) 4 (5), 333 (2003). United States of America 95 (11), 6032 (1998). 0150 Pentchev, P. G. etal. A defectincholesterolesteri (0160. Whelan, S.P., Ball, L.A., Barr, J. N., and Wertz, G. fication in Niemann-Pick disease (type C) patients. Pro T. Efficient recovery of infectious vesicular stomatitis ceedings of the National Academy of Sciences of the United virus entirely from cDNA clones. Proceedings of the States of America. 82 (23), 8247 (1985); Blanchette National Academy of Sciences of the United States of Mackie, E. J. et al., Type-C Niemann-Pick disease: low density lipoprotein uptake is associated with premature America 92 (18), 8388 (1995). cholesterol accumulation in the Golgi complex and exces (0161 "Morgenstern, J. P. and Land, H., Advanced mam sive cholesterol storage in lysosomes. Proceedings of the malian gene transfer: high titre retroviral vectors with mul National Academy of Sciences of the United States of tiple drug selection markers and a complementary helper America 85 (21), 8022 (1988). free packaging cell line. Nucleic acids research 18 (12), 0151. Wool-Lewis, R.J. and Bates, P., Characterization 3587 (1990). of Ebola virus entry by using pseudotyped viruses: identi (0162 'Pentchev, P. G. et al., The cholesterol storage dis fication of receptor-deficient cell lines. Journal of virology order of the mutant BALB/c mouse. A primary genetic 72 (4), 3155 (1998); Takada, A. et al. A system for func lesion closely linked to defective esterification of exog tional analysis of Ebola virus glycoprotein. Proceedings of enously derived cholesterol and its relationship to human the National Academy of Sciences of the United States of type C Niemann-Pick disease. The Journal of biological America 94 (26), 14764 (1997). chemistry 261 (6), 2772 (1986). 0152 'Cruz, J.C., Sugii, S.Yu, C., and Chang, T.Y., Role (0163 °Ebert, Daniel H., Deussing, Jan, Peters, Chris of Niemann-Pick type C1 protein in intracellular traffick toph, and Dermody, Terence S., Cathepsin L and cathepsin US 2014/0018338A1 Jan. 16, 2014 44
B mediate reovirus disassembly in murine fibroblast cells. ebolavirus glycoprotein (19-kilodalton GP12): sequence The Journal of biological chemistry 277 (27), 24609 and residues critical for host cell binding. J Virol. 2009 (2002). April; 83 (7):2883-91. Epub 2009 Jan. 14. (0164 Blum, Galia et al., Dynamic imaging of protease (0169. Davies J P IoannouY A. Topological analysis of activity with fluorescently quenched activity-based probes. Niemann-Pick C1 protein reveals that the membrane ori Nature chemical biology 1 (4), 203 (2005). entation of the putative sterol-sensing domain is identical (0165 Cureton, David K. et al., Vesicular stomatitis virus to those of 3-hydroxy-3-methylglutaryl-CoA reductase enters cells through vesicles incompletely coated with and sterol regulatory element binding protein cleavage clathrin that depend upon actin for internalization. PLOS activating protein. J Biol Chem. 2000 Aug. 11; 275(32): pathogens 5(4), e1000394 (2009). 24367-74. (0166 Ehrlich, Marcelo et al., Endocytosis by random (0170 Kwon H.J. Abi-Mosleh L. Wang ML, Deisenhofer initiation and stabilization of clathrin-coated pits. Cell 118 J. Goldstein J. L. Brown MS, Infante R E. Structure of (5), 591 (2004). N-terminal domain of NPC1 reveals distinct subdomains (0167 Lefrancois, L. and Lyles, D. S. The interaction of for binding and transfer of cholesterol. Cell. 2009 Jun. 26: antibody with the major Surface glycoprotein of vesicular 137(7): 1213-24. stomatitis virus. I. Analysis of neutralizing epitopes with (0171 'Deffieu, M. and Pfeffer, S. R. Niemann-Pick type monoclonal antibodies. Virology 121 (1), 157 (1982). C1 function requires lumenal domain residues that mediate (0168 7Dube D, Brecher MB, Delos SE, Rose SC, Park cholesterol-dependent NPC2 binding. Proc Natl Acad Sci E. W. Schornberg K L. Kuhn J. H. White J. M. The primed USA. 2011. 108, 18932-36.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 39
<21 Os SEQ ID NO 1 &211s LENGTH: 1278 212s. TYPE: PRT <213> ORGANISM: Homo sapiens
<4 OOs SEQUENCE: 1.
Met Thr Ala Arg Gly Luell Ala Lell Gly Lell Luell Luell Luell Tell Lell Cys 1. 5 1O 15
Pro Ala Glin Wall Phe Ser Glin Ser Cys Wall Trp Gly Glu Gly 2O 25 3 O
Ile Ala Tyr Gly Asp Arg Tyr Asn Glu Tyr Ser Gly Pro Pro 35 4 O 45
Llys Pro Lell Pro Asp Gly Tyr Asp Lell Wall Glin Glu Tell Pro SO 55 60
Gly Phe Phe Phe Gly Asn Wall Ser Lell Cys Asp Wall Arg Glin Lell 70
Glin. Thir Lell Asp Asn Luell Glin Lell Pro Luell Glin Phe Tell Ser Arg 85 90 95
Cys Pro Ser Cys Phe ASn Lell Lell Asn Luell Phe Glu Lell Thir 1OO 105 110
Cys Ser Pro Arg Glin Ser Glin Phe Lell Asn Wall Thir Ala Thir Glu Asp 115 12O 125
Tyr Val Asp Pro Wall Thir ASn Glin Thir Thir Asn Wall Lys Glu Lell 13 O 135 14 O
Gln Tyr Wall Gly Glin Ser Phe Ala Asn Ala Met Tyr ASn Ala Cys 145 15 O 155 16 O
Arg Asp Wall Glu Ala Pro Ser Ser Asn Asp Ala Luell Gly Lell Lell 1.65 17 O 17s
Asp Ala Asp Ala Asn Ala Thir Asn Trp le Glu Tyr 18O 185 190
Met Phe Asn Lys Asp Asn Gly Glin Ala Pro Phe Thir Ile Thir Pro Wall 195 2 OO
Phe Ser Asp Phe Pro Wall His Gly Met Glu Pro Met Asn ASn Ala Thir US 2014/0018338A1 Jan. 16, 2014 45
- Continued
21 O 215 22O Lys Gly Cys Asp Glu Ser Val Asp Glu Val Thr Ala Pro Cys Ser Cys 225 23 O 235 24 O Gln Asp Cys Ser Ile Val Cys Gly Pro Llys Pro Gln Pro Pro Pro Pro 245 250 255 Pro Ala Pro Trp Thr Ile Leu Gly Lieu. Asp Ala Met Tyr Val Ile Met 26 O 265 27 O Trp Ile Thr Tyr Met Ala Phe Lieu. Leu Val Phe Phe Gly Ala Phe Phe 27s 28O 285 Ala Val Trp Cys Tyr Arg Lys Arg Tyr Phe Val Ser Glu Tyr Thr Pro 29 O 295 3 OO Ile Asp Ser Asn. Ile Ala Phe Ser Val Asn Ala Ser Asp Llys Gly Glu 3. OS 310 315 32O Ala Ser Cys Cys Asp Pro Val Ser Ala Ala Phe Glu Gly Cys Lieu. Arg 3.25 330 335 Arg Lieu. Phe Thr Arg Trp Gly Ser Phe Cys Val Arg Asn Pro Gly Cys 34 O 345 35. O Val Ile Phe Phe Ser Lieu Val Phe Ile Thr Ala Cys Ser Ser Gly Lieu. 355 360 365 Val Phe Val Arg Val Thr Thr Asn Pro Val Asp Leu Trp Ser Ala Pro 37 O 375 38O Ser Ser Glin Ala Arg Lieu. Glu Lys Glu Tyr Phe Asp Gln His Phe Gly 385 390 395 4 OO Pro Phe Phe Arg Thr Glu Gln Lieu. Ile Ile Arg Ala Pro Leu. Thir Asp 4 OS 41O 415 Lys His Ile Tyr Glin Pro Tyr Pro Ser Gly Ala Asp Val Pro Phe Gly 42O 425 43 O Pro Pro Lieu. Asp Ile Glin Ile Lieu. His Glin Val Lieu. Asp Lieu. Glin Ile 435 44 O 445 Ala Ile Glu Asn. Ile Thr Ala Ser Tyr Asp Asn. Glu Thr Val Thir Lieu 450 45.5 460 Gln Asp Ile Cys Lieu Ala Pro Leu Ser Pro Tyr Asn Thr Asn Cys Thr 465 470 47s 48O Ile Lieu. Ser Val Lieu. Asn Tyr Phe Glin Asn. Ser His Ser Val Lieu. Asp 485 490 495 His Llys Lys Gly Asp Asp Phe Phe Val Tyr Ala Asp Tyr His Thr His SOO 505 51O Phe Lieu. Tyr Cys Val Arg Ala Pro Ala Ser Lieu. Asn Asp Thir Ser Lieu. 515 52O 525 Lieu. His Asp Pro Cys Lieu. Gly Thr Phe Gly Gly Pro Val Phe Pro Trp 53 O 535 54 O Lieu Val Lieu. Gly Gly Tyr Asp Asp Glin Asn Tyr Asn. Asn Ala Thr Ala 5.45 550 555 560 Leu Val Ile Thr Phe Pro Val Asn Asn Tyr Tyr Asn Asp Thr Glu Lys 565 st O sts Lieu. Glin Arg Ala Glin Ala Trp Glu Lys Glu Phe Ile Asn. Phe Wall Lys 58O 585 59 O Asn Tyr Lys Asn Pro Asn Lieu. Thir Ile Ser Phe Thr Ala Glu Arg Ser 595 6OO 605 Ile Glu Asp Glu Lieu. Asn Arg Glu Ser Asp Ser Asp Val Phe Thr Val 610 615 62O US 2014/0018338A1 Jan. 16, 2014 46
- Continued Val Ile Ser Tyr Ala Ile Met Phe Leu Tyr Ile Ser Leu Ala Leu Gly 625 630 635 64 O His Met Lys Ser Cys Arg Arg Lieu. Lieu Val Asp Ser Llys Val Ser Lieu. 645 650 655 Gly Ile Ala Gly Ile Lieu. Ile Val Lieu. Ser Ser Val Ala Cys Ser Lieu. 660 665 67 O Gly Val Phe Ser Tyr Ile Gly Lieu Pro Leu. Thir Lieu. Ile Val Ile Glu 675 68O 685 Val Ile Pro Phe Lieu Val Lieu Ala Val Gly Val Asp Asn. Ile Phe Ile 69 O. 695 7 OO Lieu Val Glin Ala Tyr Glin Arg Asp Glu Arg Lieu. Glin Gly Glu Thir Lieu. 7 Os 71O 71s 72O Asp Glin Glin Lieu. Gly Arg Val Lieu. Gly Glu Val Ala Pro Ser Met Phe 72 73 O 73 Lieu. Ser Ser Phe Ser Glu Thr Val Ala Phe Phe Leu Gly Ala Leu Ser 740 74. 7 O Val Met Pro Ala Val His Thr Phe Ser Leu Phe Ala Gly Lieu Ala Val 7ss 760 765 Phe Ile Asp Phe Lieu. Leu Glin Ile Thr Cys Phe Val Ser Lieu. Leu Gly 770 775 78O Lieu. Asp Ile Lys Arg Glin Glu Lys Asn Arg Lieu. Asp Ile Phe Cys Cys 78s 79 O 79. 8OO Val Arg Gly Ala Glu Asp Gly. Thir Ser Val Glin Ala Ser Glu Ser Cys 805 810 815 Lieu. Phe Arg Phe Phe Lys Asn. Ser Tyr Ser Pro Lieu Lleu Lieu Lys Asp 82O 825 83 O Trp Met Arg Pro Ile Val Ile Ala Ile Phe Val Gly Val Lieu. Ser Phe 835 84 O 845 Ser Ile Ala Val Lieu. Asn Llys Val Asp Ile Gly Lieu. Asp Glin Ser Lieu. 850 855 860 Ser Met Pro Asp Asp Ser Tyr Met Val Asp Tyr Phe Lys Ser Ile Ser 865 87O 87s 88O Gln Tyr Lieu. His Ala Gly Pro Pro Val Tyr Phe Val Lieu. Glu Glu Gly 885 890 895 His Asp Tyr Thr Ser Ser Lys Gly Glin Asn Met Val Cys Gly Gly Met 9 OO 905 91 O Gly Cys Asn. Asn Asp Ser Lieu Val Glin Glin Ile Phe Asn Ala Ala Glin 915 92 O 925 Lieu. Asp Asn Tyr Thr Arg Ile Gly Phe Ala Pro Ser Ser Trp Ile Asp 93 O 935 94 O Asp Tyr Phe Asp Trp Val Llys Pro Glin Ser Ser Cys Cys Arg Val Asp 945 950 955 96.O Asn. Ile Thir Asp Glin Phe Cys Asn Ala Ser Val Val Asp Pro Ala Cys 965 97O 97. Val Arg Cys Arg Pro Lieu. Thr Pro Glu Gly Lys Glin Arg Pro Glin Gly 98O 985 99 O Gly Asp Phe Met Arg Phe Leu Pro Met Phe Leu Ser Asp Asn Pro Asn 995 1OOO 1005 Pro Llys Cys Gly Lys Gly Gly His Ala Ala Tyr Ser Ser Ala Val 1010 1015 1 O2O Asn Ile Leu Lleu. Gly His Gly Thr Arg Val Gly Ala Thr Tyr Phe 1025 1O3 O 1035 US 2014/0018338A1 Jan. 16, 2014 47
- Continued
Met Thr Tyr His Thr Val Lieu Gln Thr Ser Ala Asp Phe Ile Asp O4 O O45 OSO Ala Lieu Lys Lys Ala Arg Lieu. Ile Ala Ser Asn Val Thr Glu Thr O55 O6 O O65 Met Gly Ile Asn Gly Ser Ala Tyr Arg Val Phe Pro Tyr Ser Val Of O O7 O8O Phe Tyr Val Phe Tyr Glu Gln Tyr Lieu. Thir Ile e Asp Asp Thr O85 O9 O O95 Ile Phe Asn Lieu. Gly Val Ser Leu Gly Ala Ile Phe Leu Val Thr OO O5 10 Met Val Lieu. Lieu. Gly Cys Glu Lieu. Trp Ser Ala Val Ile Met Cys
Ala Thr Ile Ala Met Val Lieu Val Asn Met Phe Gly Val Met Trp
Lieu. Trp Gly Ile Ser Lieu. Asn Ala Val Ser Lieu Val Asn Lieu Val
Met Ser Cys Gly Ile Ser Val Glu Phe Cys Ser His Ile Thr Arg
Ala Phe Thr Val Ser Met Lys Gly Ser Arg Val Glu Arg Ala Glu
Glu Ala Leu Ala His Met Gly Ser Ser Val Phe Ser Gly Ile Thr
Lieu. Thir Lys Phe Gly Gly e Val Val Lieu Ala Phe Ala Lys Ser 2O5 21 O 215 Glin Ile Phe Glin Ile Phe Tyr Phe Arg Met Tyr Lieu Ala Met Val 22O 225 23 O Lieu. Lieu. Gly Ala Thr His Gly Lieu. Ile Phe Lieu Pro Val Lieu. Lieu. 235 24 O 245 Ser Tyr Ile Gly Pro Ser Val Asn Lys Ala Lys Ser Cys Ala Thr 250 255 26 O Glu Glu Arg Tyr Lys Gly Thr Glu Arg Glu Arg Lieu. Lieu. Asn. Phe 265 27 O 27s
<210s, SEQ ID NO 2 &211s LENGTH: 4827 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 2 galagggcaac acggggacct talag.cgggg. tcgcggcggc gCCCC agcCC grgcCaggga 6 O gtc.ccggcag cqgcacct Co. Cagaaagggc ggagc.cgacg acgc.ctt Ctt cct tcctgac 12 O cggcgc.gc.gc agcctgctgc cgcggit cagc gcc tect cot gct cotcc.gc. tcct cct gcg 18O cggggtgctgaaa.ca.gc.ccg gggaagtaga gcc.gc.ct cog gggagcc cala C cagc.cgaac 24 O gcc.gc.cggcg tcagcago: ct tcgcggc.ca cagcatgacc gct cqcggcc tigcc cttgg 3OO
Cctic ct cotg Ctgctact.gt gtc.ca.gc.gca ggtgtttitca cagtic ctgtg tittgg tatgg 360 agagtgtgga attgcatatggggacaagag gtaca attgc gaat attctg gcc caccaaa 42O accattgc.ca aaggatggat atgacttagt gcaggaactic titcCaggat ticttctttgg 48O caatgtcagt citctgttgtg atgttcggca gcttcagaca citaaaagaca acctgcagot 54 O gcct ctacag tittctgtcca gatgtc.catc ctdtttittat aacct actga acctgttittg 6OO
US 2014/0018338A1 Jan. 16, 2014 50
- Continued
2O 25 3O Pro Ala Ser Gly Ser Ala Ala Ser Llys Phe Lieu. Cys Lieu Pro Pro Gly 35 4 O 45 Ile Thr Val Cys Asp Ser Gly Arg Gly Ser Lieu Val Phe Gly Asp Met SO 55 6 O Glu Gly Glin Ile Trp Phe Leu Pro Arg Ser Leu Gln Lieu. Thr Gly Phe 65 70 7s 8O Glin Ala Tyr Lys Lieu. Arg Val Thr His Lieu. Tyr Glin Lieu Lys Gln His 85 90 95 Asn. Ile Lieu Ala Ser Val Gly Glu Asp Glu Glu Gly Ile Asn Pro Lieu 1OO 105 11 O Val Lys Ile Trp Asn Lieu. Glu Lys Arg Asp Gly Gly Asn. Pro Lieu. Cys 115 12 O 125 Thr Arg Ile Phe Pro Ala Ile Pro Gly Thr Glu Pro Thr Val Val Ser 13 O 135 14 O Cys Lieu. Thr Val His Glu Asn Lieu. Asn Phe Met Ala Ile Gly Phe Thr 145 150 155 160 Asp Gly Ser Val Thir Lieu. Asn Lys Gly Asp Ile Thr Arg Asp Arg His 1.65 17O 17s Ser Lys Thr Glin Ile Lieu. His Lys Gly Asn Tyr Pro Val Thr Gly Lieu. 18O 185 19 O Ala Phe Arg Glin Ala Gly Lys Thr Thr His Leu Phe Val Val Thir Thr 195 2OO 2O5 Glu Asn Val Glin Ser Tyr Ile Val Ser Gly Lys Asp Tyr Pro Arg Val 21 O 215 22O Glu Lieu. Asp Thr His Gly Cys Gly Lieu. Arg Cys Ser Ala Lieu. Ser Asp 225 23 O 235 24 O Pro Ser Glin Asp Lieu. Glin Phe Ile Val Ala Gly Asp Glu. CyS Val Tyr 245 250 255 Lieu. Tyr Glin Pro Asp Glu Arg Gly Pro Cys Phe Ala Phe Glu Gly His 26 O 265 27 O Llys Lieu. Ile Ala His Trp Phe Arg Gly Tyr Lieu. Ile Ile Val Ser Arg 27s 28O 285 Asp Arg Llys Val Ser Pro Llys Ser Glu Phe Thir Ser Arg Asp Ser Glin 29 O 295 3 OO Ser Ser Asp Llys Glin Ile Lieu. Asn. Ile Tyr Asp Lieu. Cys Asn Llys Phe 3. OS 310 315 32O Ile Ala Tyr Ser Thr Val Phe Glu Asp Val Val Asp Val Lieu Ala Glu 3.25 330 335 Trp Gly Ser Lieu. Tyr Val Lieu. Thir Arg Asp Gly Arg Val His Ala Lieu. 34 O 345 35. O Glin Glu Lys Asp Thr Glin Thr Lys Lieu. Glu Met Lieu. Phe Llys Lys Asn 355 360 365 Lieu. Phe Glu Met Ala Ile Asn Lieu Ala Lys Ser Glin His Lieu. Asp Ser 37 O 375 38O Asp Gly Lieu Ala Glin Ile Phe Met Glin Tyr Gly Asp His Lieu. Tyr Ser 385 390 395 4 OO Lys Gly Asn His Asp Gly Ala Val Glin Glin Tyr Ile Arg Thir Ile Gly 4 OS 41O 415 Llys Lieu. Glu Pro Ser Tyr Val Ile Arg Llys Phe Lieu. Asp Ala Glin Arg 42O 425 43 O US 2014/0018338A1 Jan. 16, 2014 51
- Continued Ile His Asn Lieu. Thir Ala Tyr Lieu. Glin Thr Lieu. His Arg Glin Ser Lieu. 435 44 O 445 Ala Asn Ala Asp His Thir Thr Lieu. Lieu. Lieu. Asn. Cys Tyr Thr Lys Lieu 450 45.5 460 Lys Asp Ser Ser Llys Lieu. Glu Glu Phe Ile Llys Llys Llys Ser Glu Ser 465 470 47s 48O Glu Val His Phe Asp Val Glu Thir Ala Ile Llys Val Lieu. Arg Glin Ala 485 490 495 Gly Tyr Tyr Ser His Ala Lieu. Tyr Lieu Ala Glu Asn His Ala His His SOO 505 51O Glu Trp Tyr Lieu Lys Ile Glin Lieu. Glu Asp Ile Lys Asn Tyr Glin Glu 515 52O 525 Ala Lieu. Arg Tyr Ile Gly Llys Lieu Pro Phe Glu Glin Ala Glu Ser Asn 53 O 535 54 O Met Lys Arg Tyr Gly Lys Ile Leu Met His His Ile Pro Glu Glin Thr 5.45 550 555 560 Thr Glin Lieu. Lieu Lys Gly Lieu. Cys Thr Asp Tyr Arg Pro Ser Lieu. Glu 565 st O sts Gly Arg Ser Asp Arg Glu Ala Pro Gly Cys Arg Ala Asn. Ser Glu Glu 58O 585 59 O Phe Ile Pro Ile Phe Ala Asn. Asn Pro Arg Glu Lieu Lys Ala Phe Lieu. 595 6OO 605 Glu. His Met Ser Glu Val Glin Pro Asp Ser Pro Gln Gly Ile Tyr Asp 610 615 62O Thir Lieu. Lieu. Glu Lieu. Arg Lieu. Glin Asn Trp Ala His Glu Lys Asp Pro 625 630 635 64 O Glin Val Lys Glu Lys Lieu. His Ala Glu Ala Ile Ser Lieu. Lieu Lys Ser 645 650 655 Gly Arg Phe Cys Asp Val Phe Asp Lys Ala Lieu Val Lieu. Cys Gln Met 660 665 67 O His Asp Phe Glin Asp Gly Val Lieu. Tyr Lieu. Tyr Glu Glin Gly Llys Lieu. 675 68O 685 Phe Glin Glin Ile Met His Tyr His Met Gln His Glu Gln Tyr Arg Glin 69 O. 695 7 OO Val Ile Ser Val Cys Glu Arg His Gly Glu Glin Asp Pro Ser Lieu. Trip 7 Os 71O 71s 72O Glu Glin Ala Lieu. Ser Tyr Phe Ala Arg Lys Glu Glu Asp Cys Lys Glu 72 73 O 73 Tyr Val Ala Ala Val Lieu Lys His Ile Glu Asn Lys Asn Lieu Met Pro 740 74. 7 O
Pro Leu Lleu. Wal Wall Glin Thir Lieu. Ala His ASn Ser Thir Ala Thir Lieu. 7ss 760 765 Ser Val Ile Arg Asp Tyr Lieu Val Glin Llys Lieu. Glin Lys Glin Ser Glin 770 775 78O Glin Ile Ala Glin Asp Glu Lieu. Arg Val Arg Arg Tyr Arg Glu Glu Thir 78s 79 O 79. 8OO Thir Arg Ile Arg Glin Glu Ile Glin Glu Lieu Lys Ala Ser Pro Lys Ile 805 810 815 Phe Glin Llys Thir Lys Cys Ser Ile Cys Asn. Ser Ala Lieu. Glu Lieu Pro 82O 825 83 O Ser Val His Phe Lieu. Cys Gly His Ser Phe His Gln His Cys Phe Glu 835 84 O 845
US 2014/0018338A1 Jan. 16, 2014 54
- Continued Lieu. Lieu. Arg Asn. Pro Trp Arg Lys Glu Lys Ala Ala Ser Val Arg Pro SO 55 6 O Val Lieu. Asp Ile Tyr Ser Ala Ser Gly Met Pro Lieu Ala Ser Lieu. Lieu 65 70 7s 8O Trp Llys Ser Gly Pro Val Val Ser Lieu. Gly Trp Ser Ala Glu Glu Glu 85 90 95 Lieu. Lieu. Cys Val Glin Glu Asp Gly Ala Val Lieu Val Tyr Gly Lieu. His 1OO 105 11 O Gly Asp Phe Arg Arg His Phe Ser Met Gly Asn. Glu Val Lieu. Glin Asn 115 12 O 125 Arg Val Lieu. Asp Ala Arg Ile Phe His Thr Glu Phe Gly Ser Gly Val 13 O 135 14 O Ala Ile Lieu. Thr Gly Ala His Arg Phe Thr Lieu. Ser Ala Asn Val Gly 145 150 155 160 Asp Lieu Lys Lieu. Arg Arg Met Pro Glu Val Pro Gly Lieu. Glin Ser Ala 1.65 17O 17s Pro Ser Cys Trp Thr Val Lieu. Cys Glin Asp Arg Val Ala His Ile Lieu. 18O 185 19 O Lieu Ala Val Gly Pro Asp Lieu. Tyr Lieu. Lieu. Asp His Ala Ala Cys Ser 195 2OO 2O5 Ala Val Thr Pro Pro Gly Lieu Ala Pro Gly Val Ser Ser Phe Leu Gln 21 O 215 22O Met Ala Val Ser Phe Thr Tyr Arg His Leu Ala Lieu Phe Thr Asp Thr 225 23 O 235 24 O Gly Tyr Ile Trp Met Gly. Thir Ala Ser Lieu Lys Glu Lys Lieu. Cys Glu 245 250 255 Phe Asn Cys Asn Ile Arg Ala Pro Pro Lys Gln Met Val Trp Cys Ser 26 O 265 27 O Arg Pro Arg Ser Lys Glu Arg Ala Val Val Val Ala Trp Glu Arg Arg 27s 28O 285 Lieu Met Val Val Gly Asp Ala Pro Glu Ser Ile Glin Phe Val Lieu. Asp 29 O 295 3 OO Glu Asp Ser Tyr Lieu Val Pro Glu Lieu. Asp Gly Val Arg Ile Phe Ser 3. OS 310 315 32O Arg Ser Thr His Glu Phe Lieu. His Glu Val Pro Ala Ala Ser Glu Glu 3.25 330 335 Ile Phe Lys Ile Ala Ser Met Ala Pro Gly Ala Lieu Lleu Lieu. Glu Ala 34 O 345 35. O Glin Lys Glu Tyr Glu Lys Glu Ser Glin Lys Ala Asp Glu Tyr Lieu. Arg 355 360 365 Glu Ile Glin Glu Lieu. Gly Glin Lieu. Thr Glin Ala Val Glin Glin Cys Ile 37 O 375 38O Glu Ala Ala Gly His Glu. His Glin Pro Asp Met Glin Llys Ser Lieu. Lieu. 385 390 395 4 OO Arg Ala Ala Ser Phe Gly Lys Cys Phe Lieu. Asp Arg Phe Pro Pro Asp 4 OS 41O 415 Ser Phe Wal His Met Cys Glin Asp Lieu. Arg Val Lieu. Asn Ala Val Arg 42O 425 43 O Asp Tyr His Ile Gly Ile Pro Leu. Thr Tyr Ser Glin Tyr Lys Glin Leu 435 44 O 445
Thir Ile Glin Val Lieu. Lieu. Asp Arg Lieu Val Lieu. Arg Arg Lieu. Tyr Pro 450 45.5 460 US 2014/0018338A1 Jan. 16, 2014 55
- Continued
Lieu Ala Ile Glin Ile Cys Glu Tyr Lieu. Arg Lieu Pro Glu Val Glin Gly 465 470 47s 48O Val Ser Arg Ile Lieu Ala His Trp Ala Cys Tyr Llys Val Glin Gln Lys 485 490 495 Asp Wal Ser Asp Glu Asp Wall Ala Arg Ala Ile Asn Gln Lys Lieu. Gly SOO 505 51O Asp Thr Pro Gly Val Ser Tyr Ser Asp Ile Ala Ala Arg Ala Tyr Gly 515 52O 525 Cys Gly Arg Thr Glu Lieu Ala Ile Llys Lieu. Lieu. Glu Tyr Glu Pro Arg 53 O 535 54 O Ser Gly Glu Glin Val Pro Lieu. Lieu. Lieu Lys Met Lys Arg Ser Lys Lieu. 5.45 550 555 560 Ala Lieu. Ser Lys Ala Ile Glu Ser Gly Asp Thr Asp Lieu Val Phe Thr 565 st O sts Val Lieu. Lieu. His Lieu Lys Asn. Glu Lieu. Asn Arg Gly Asp Phe Phe Met 58O 585 59 O Thir Lieu. Arg Asn. Glin Pro Met Ala Lieu. Ser Lieu. Tyr Arg Glin Phe Cys 595 6OO 605 Llys His Glin Glu Lieu. Glu Thir Lieu Lys Asp Lieu. Tyr Asn Glin Asp Asp 610 615 62O Asn His Glin Glu Lieu. Gly Ser Phe His Ile Arg Ala Ser Tyr Ala Ala 625 630 635 64 O Glu Glu Arg Ile Glu Gly Arg Val Ala Ala Lieu. Glin Thr Ala Ala Asp 645 650 655 Ala Phe Tyr Lys Ala Lys Asn. Glu Phe Ala Ala Lys Ala Thr Glu Asp 660 665 67 O Glin Met Arg Lieu. Lieu. Arg Lieu. Glin Arg Arg Lieu. Glu Asp Glu Lieu. Gly 675 68O 685 Gly Glin Phe Lieu. Asp Leu Ser Lieu. His Asp Thr Val Thr Thr Lieu. Ile 69 O. 695 7 OO Lieu. Gly Gly. His Asn Lys Arg Ala Glu Gln Lieu Ala Arg Asp Phe Arg 7 Os 71O 71s 72O Ile Pro Asp Lys Arg Lieu. Trp Trp Lieu Lys Lieu. Thir Ala Lieu Ala Asp 72 73 O 73 Lieu. Glu Asp Trp Glu Glu Lieu. Glu Lys Phe Ser Lys Ser Lys Llys Ser 740 74. 7 O Pro Ile Gly Tyr Lieu Pro Phe Val Glu Ile Cys Met Lys Glin His Asn 7ss 760 765 Llys Tyr Glu Ala Lys Llys Tyr Ala Ser Arg Val Gly Pro Glu Glin Lys 770 775 78O Val Lys Ala Lieu Lleu Lieu Val Gly Asp Wall Ala Glin Ala Ala Asp Wall 78s 79 O 79. 8OO Ala Ile Glu. His Arg Asn. Glu Ala Glu Lieu. Ser Lieu Val Lieu. Ser His 805 810 815 Cys Thr Gly Ala Thr Asp Gly Ala Thr Ala Asp Llys Ile Glin Arg Ala 82O 825 83 O Arg Ala Glin Ala Glin Llys Llys
<210s, SEQ ID NO 6 &211s LENGTH: 2769 &212s. TYPE: DNA
US 2014/0018338A1 Jan. 16, 2014 57
- Continued aggctctggt ggctgaagct gactg.ccctg gCagatttgg aagattggga agagctagag 228O aagtttitcca agagcaagaa at cacccatt ggctacctgc ctitttgtgga gatctgcatg 234 O aaacaa.cata acaaatacga agccaagaag tatgctt coc gogtgggtcc cagcagaag 24 OO gtcaaggctt tott Cttgt togatgtg gct Caggctg. Cagatgtggc catcgaacac 246 O cggaatgagg Ctgagctgag cct cqtattg tcc cactgca C9ggagccac agatggggcc 252O acagctgaca agattcaacg ggc.cagggca caa.gc.ccaga agaagtgagg agt ccatcct 2580 gtacatctica agcaaggggit toctic cccta gCacctgggc titggcagaag ggc catagitt 264 O catc.ca.gctic ctic ccctaga gcaatgctgaggagcggggg catgg tagca gggctgtctg 27 OO gttittaaata aagttggaac acttcaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 276 O aaaaaaaaa. 2769
<210s, SEQ ID NO 7 &211s LENGTH: 973 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OO > SEQUENCE: 7 Met Ala Ser Ile Lieu. Asp Glu Tyr Glu Asn. Ser Lieu. Ser Arg Ser Ala 1. 5 1O 15 Val Lieu Gln Pro Gly Cys Pro Ser Val Gly Ile Pro His Ser Gly Tyr 2O 25 3O Val Asn Ala Glin Lieu. Glu Lys Glu Val Pro Ile Phe Thr Lys Glin Arg 35 4 O 45 Ile Asp Phe Thr Pro Ser Glu Arg Ile Thir Ser Lieu Val Val Ser Ser SO 55 6 O Asn Glin Lieu. Cys Met Ser Lieu. Gly Lys Asp Thir Lieu. Lieu. Arg Ile Asp 65 70 7s 8O Lieu. Gly Lys Ala Asn. Glu Pro Asn His Val Glu Lieu. Gly Arg Lys Asp 85 90 95 Asp Ala Lys Val His Llys Met Phe Lieu. Asp His Thr Gly Ser His Lieu 1OO 105 11 O Lieu. Ile Ala Lieu. Ser Ser Thr Glu Val Lieu. Tyr Val Asn Arg Asn Gly 115 12 O 125 Glin Llys Val Arg Pro Lieu Ala Arg Trp Llys Gly Glin Lieu Val Glu Ser 13 O 135 14 O Val Gly Trp Asn Lys Ala Lieu. Gly Thr Glu Ser Ser Thr Gly Pro Ile 145 150 155 160 Lieu Val Gly. Thir Ala Glin Gly His Ile Phe Glu Ala Glu Lieu. Ser Ala 1.65 17O 17s Ser Glu Gly Gly Lieu. Phe Gly Pro Ala Pro Asp Leu Tyr Phe Arg Pro 18O 185 19 O Lieu. Tyr Val Lieu. Asn. Glu Glu Gly Gly Pro Ala Pro Val Cys Ser Lieu. 195 2OO 2O5 Glu Ala Glu Arg Gly Pro Asp Gly Arg Ser Phe Val Ile Ala Thir Thr 21 O 215 22O Arg Glin Arg Lieu. Phe Glin Phe Ile Gly Arg Ala Ala Glu Gly Ala Glu 225 23 O 235 24 O Ala Glin Gly Phe Ser Gly Lieu Phe Ala Ala Tyr Thr Asp His Pro Pro 245 250 255 US 2014/0018338A1 Jan. 16, 2014 58
- Continued Pro Phe Arg Glu Phe Pro Ser Asn Lieu. Gly Tyr Ser Glu Lieu. Ala Phe 26 O 265 27 O Tyr Thr Pro Llys Lieu. Arg Ser Ala Pro Arg Ala Phe Ala Trp Met Met 27s 28O 285 Gly Asp Gly Val Lieu. Tyr Gly Ala Lieu. Asp Cys Gly Arg Pro Asp Ser 29 O 295 3 OO Lieu. Leu Ser Glu Glu Arg Val Trp Glu Tyr Pro Glu Gly Val Gly Pro 3. OS 310 315 32O Gly Ala Ser Pro Pro Leu Ala Ile Val Lieu. Thr Glin Phe His Phe Leu 3.25 330 335 Lieu. Lieu. Lieu Ala Asp Arg Val Glu Ala Val Cys Thr Lieu. Thr Gly Glin 34 O 345 35. O Val Val Lieu. Arg Asp His Phe Lieu. Glu Lys Phe Gly Pro Lieu Lys His 355 360 365 Met Val Lys Asp Ser Ser Thr Gly Glin Leu Trp Ala Tyr Thr Glu Arg 37 O 375 38O Ala Val Phe Arg Tyr His Val Glin Arg Glu Ala Arg Asp Val Trp Arg 385 390 395 4 OO Thir Tyr Lieu. Asp Met Asn Arg Phe Asp Lieu Ala Lys Glu Tyr Cys Arg 4 OS 41O 415 Glu Arg Pro Asp Cys Lieu. Asp Thr Val Lieu Ala Arg Glu Ala Asp Phe 42O 425 43 O Cys Phe Arg Glin Arg Arg Tyr Lieu. Glu Ser Ala Arg Cys Tyr Ala Lieu. 435 44 O 445 Thr Glin Ser Tyr Phe Glu Glu Ile Ala Lieu Lys Phe Lieu. Glu Ala Arg 450 45.5 460 Glin Glu Glu Ala Lieu Ala Glu Phe Lieu. Glin Arg Llys Lieu Ala Ser Lieu. 465 470 47s 48O Llys Pro Ala Glu Arg Thr Glin Ala Thr Lieu. Lieu. Thir Thr Trp Lieu. Thr 485 490 495 Glu Lieu. Tyr Lieu. Ser Arg Lieu. Gly Ala Lieu. Glin Gly Asp Pro Glu Ala SOO 505 51O Lieu. Thir Lieu. Tyr Arg Glu Thir Lys Glu. Cys Phe Arg Thr Phe Leu Ser 515 52O 525 Ser Pro Arg His Lys Glu Trp Lieu. Phe Ala Ser Arg Ala Ser Ile His 53 O 535 54 O Glu Lieu. Leu Ala Ser His Gly Asp Thr Glu. His Met Val Tyr Phe Ala 5.45 550 555 560 Val Ile Met Glin Asp Tyr Glu Arg Val Val Ala Tyr His Cys Glin His 565 st O sts Glu Ala Tyr Glu Glu Ala Lieu Ala Val Lieu Ala Arg His Arg Asp Pro 58O 585 59 O Gln Leu Phe Tyr Lys Phe Ser Pro Ile Lieu. Ile Arg His Ile Pro Arg 595 6OO 605 Glin Lieu Val Asp Ala Trp Ile Glu Met Gly Ser Arg Lieu. Asp Ala Arg 610 615 62O Glin Lieu. Ile Pro Ala Lieu Val Asn Tyr Ser Glin Gly Gly Glu Val Glin 625 630 635 64 O Glin Val Ser Glin Ala Ile Arg Tyr Met Glu Phe Cys Val Asn Val Lieu. 645 650 655 Gly Glu Thr Glu Glin Ala Ile His Asn Tyr Lieu Lleu Ser Lieu. Tyr Ala 660 665 67 O US 2014/0018338A1 Jan. 16, 2014 59
- Continued
Arg Gly Arg Pro Asp Ser Lieu. Lieu Ala Tyr Lieu. Glu Glin Ala Gly Ala 675 68O 685 Ser Pro His Arg Val His Tyr Asp Lieu Lys Tyr Ala Lieu. Arg Lieu. Cys 69 O. 695 7 OO Ala Glu. His Gly His His Arg Ala Cys Val His Val Tyr Llys Val Lieu 7 Os 71O 71s 72O Glu Lieu. Tyr Glu Glu Ala Val Asp Lieu Ala Lieu. Glin Val Asp Wall Asp 72 73 O 73 Lieu Ala Lys Glin Cys Ala Asp Lieu Pro Glu Glu Asp Glu Glu Lieu. Arg 740 74. 7 O Llys Llys Lieu. Trp Lieu Lys Ile Ala Arg His Val Val Glin Glu Glu Glu 7ss 760 765 Asp Val Glin Thr Ala Met Ala Cys Lieu Ala Ser Cys Pro Lieu. Lieu Lys 770 775 78O Ile Glu Asp Val Lieu Pro Phe Phe Pro Asp Phe Val Thr Ile Asp His 78s 79 O 79. 8OO Phe Lys Glu Ala Ile Cys Ser Ser Lieu Lys Ala Tyr Asn His His Ile 805 810 815 Glin Glu Lieu. Glin Arg Glu Met Glu Glu Ala Thr Ala Ser Ala Glin Arg 82O 825 83 O Ile Arg Arg Asp Lieu. Glin Glu Lieu. Arg Gly Arg Tyr Gly Thr Val Glu 835 84 O 845 Pro Glin Asp Llys Cys Ala Thr Cys Asp Phe Pro Lieu. Lieu. Asn Arg Pro 850 855 860 Phe Tyr Lieu Phe Lieu. Cys Gly His Met Phe His Ala Asp Cys Lieu. Leu 865 87O 87s 88O Glin Ala Val Arg Pro Gly Lieu Pro Ala Tyr Lys Glin Ala Arg Lieu. Glu 885 890 895 Glu Lieu. Glin Arg Llys Lieu. Gly Ala Ala Pro Pro Pro Ala Lys Gly Ser 9 OO 905 91 O Ala Arg Ala Lys Glu Ala Glu Gly Gly Ala Ala Thr Ala Gly Pro Ser 915 92 O 925 Arg Glu Gln Lieu Lys Ala Asp Lieu. Asp Glu Lieu Val Ala Ala Glu. Cys 93 O 935 94 O Val Tyr Cys Gly Glu Lieu Met Ile Arg Ser Ile Asp Arg Pro Phe Ile 945 950 955 96.O Asp Pro Glin Arg Tyr Glu Glu Glu Gln Lieu. Ser Trp Lieu. 965 97O
<210s, SEQ ID NO 8 &211s LENGTH: 3922 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 8 gcc.cgcgt.ca C9gggg.cggg agt cagctga gctg.ccgggg C9aggttggg at Cacct gC 6 O accggctgaa gggagcctgt gatttittittg tagcgggggc ggggagtaag gtgcaagact 12 O gcgc.ca.gatt Caaggacgag ggctgc.ccga ttatctogct gcatalaggca agagcaa.gag 18O gatcct Cagg attittaaaga ggaggcgacg gctgcaggtt CCC aggat.ct gtcagaggct 24 O ggggagttac agcttic catt Ctggggggac ggggaccc.cg ggggggtagc cct tttgtaa 3OO t cccCaggcc ccggacaaag agcc.cagagg ccgggcacca tog to cat cctggatgag 360
US 2014/0018338A1 Jan. 16, 2014 62
- Continued
13 O 135 14 O
Ile Pro Phe Asp Gly Asp Lell Luell Ser Met Glu Ser Glu Gly Ala Phe 145 150 155 160
Glu Lell Glu Gly Asp Glin Thir Ser Lell Tyr His Ala Ala 1.65 17s
Gly Luell Met Thir Lell Glin Ala Luell Tyr Gly Thir Ile Pro Glin Ile 18O 185 19 O
Phe Gly Lys Gly Glu Ala Arg Glin Wall Ala Asn Met Met Ile Arg 195
Met Lys Arg Glu Phe Thir Gly Ser Glin Asn Ser Ile Phe Pro Wall Phe 21 O 215
Asp Asn Luell Luell Lell Lell Asp Arg Asn Wall Asp Lell Lell Thir Pro Luell 225 23 O 235 24 O
Ala Thir Glin Luell Thir Glu Gly Luell Ile Asp Glu Ile Gly Ile 245 250 255
Glin Asn Ser Tyr Wall Lell Pro Pro Glu Lys Phe Ala Pro 26 O 265 27 O
Glin Gly Asp Gly Gly Asp Luell Pro Thir Glu Ala Lys Luell Glin 27s 285
Lell Asn Ser Ala Glu Glu Lell Tyr Ala Glu Ile Arg Asp Asn Phe 29 O 295 3 OO
Asn Ala Wall Gly Ser Wall Lell Ser Ala Ile Ile Ser Ala 3. OS 310 315
Ala Phe Glu Glu Arg His Asn Ala Thir Wall Gly Glu Ile Lys Glin 3.25 330 335
Phe Wall Ser Glin Lell Pro His Met Glin Ala Ala Arg Gly Ser Luell Ala 34 O 345 35. O
Asn His Thir Ser Ile Ala Glu Luell Ile Asp Wall Thir Thir Ser Glu 355 360 365
Asp Phe Phe Asp Lell Thir Wall Glu Glin Glu Phe Met Ser Gly Ile 37 O 375
Asp Thir Asp Wall Asn Asn Tyr Ile Glu Asp Ile Ala Glin Lys 385 390 395 4 OO
His Ser Luell Ile Lys Wall Lell Arg Luell Wall Lell Glin Ser Wall 4 OS 415
Asn Ser Gly Luell Glin Wall Luell Asp Arg Glu Ile 425 43 O
Lell Glin Thir Gly Glu His Ile Luell Thir Lell His Asn Luell Glu 435 44 O 445
Ala Gly Luell Lell Pro Glin Thir Gly Gly Arg Asn Asn Pro 450 45.5 460
Thir Ile Arg Thir Lell Arg Luell Trp Met Asp Asp Wall Asn Glu Glin 465 470
Asn Pro Thir Asp Ile Ser Wall Ser Gly Tyr Ala Pro Luell Ser 485 490 495
Wall Arg Luell Ala Glin Lell Lell Ser Arg Pro Gly Trp Arg Ser Ile Glu SOO 505
Glu Wall Luell Arg Ile Lell Pro Gly Pro His Phe Glu Glu Arg Glin Pro 515 52O 525
Lell Pro Thir Gly Lell Glin Lys Arg Glin Pro Gly Glu Asn Arg Wall 53 O 535 54 O
US 2014/0018338A1 Jan. 16, 2014 64
- Continued gagtgactict gat atttitt C Cttggggg.cg talacctt.cgc tigaaattgct gcc ctg.cgat 18OO ttct ct coca gttggaagat ggagg tacag aatatgtcat togccaccact aaactaatga 1860 atggalaccag ttggatagag gctctgatgg aaaaacctitt Ctaggatgtt cagaggagac 1920 ttaacaagtg tactgcagaa taalactacct ctittgaagaa attgctgaaa goaagtaaaa 198O c cccatagaa gaalacatggg aatacagaat at attctggg gtcagcttct taaattatac 2O4. O tactgtttac togctitt ct co gttct cittittg tatt coctitt tttitttitt.cc tittgagacgg 21OO agtc.ttgctic tdt cacccag act agagtgc agtggcacgg tot cacctica citgcaac ct c 216 O cacctic ctag gttcaa.gcaa ttct cotgcc ticago ct cott gagtagctgg gactacaggc 222 O atgcaccacc acacccggct aattitttgta tttittagtag ccatggtgtt tolaccatgtt 228O ggcc aggctg gtc.tcaaact cct gacct ca ggtgatccac Ctgcct cq9C Ctc.ccacagt 234 O gctgggatta Caggcctgag ccaccgtgcc tigcc cctaa t ctgctgaag aaagaagaat 24 OO agaagaaaat Caacctgagt aaaag cagca Ctggttittga gttittctaag Ctcagggit ct 246 O t cattagaga cct Ctggaaa tacattalagg atggtggggg tagataatcc attcagc.ca.g 252O acaaacgggg C cagotctta aaataagaaa gotgagactg aggaggtgaa actgaaaata 2580 aaaagagaaa gttcatcc to taaaaaaaaa aaaaaaaaaa aaaaaaaa 2628
<210s, SEQ ID NO 11 &211s LENGTH: 875 212. TYPE: PRT <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 11 Met His Asp Ala Phe Glu Pro Val Pro Ile Lieu. Glu Lys Lieu Pro Lieu. 1. 5 1O 15 Glin Ile Asp Cys Lieu Ala Ala Trp Glu Glu Trp Lieu. Lieu Val Gly. Thir 2O 25 3O Lys Glin Gly. His Lieu Lleu Lieu. Tyr Arg Ile Arg Lys Asp Val Gly Cys 35 4 O 45 Asn Arg Phe Glu Val Thr Lieu. Glu Lys Ser Asn Lys Asn. Phe Ser Lys SO 55 6 O Lys Ile Glin Glin Ile His Val Val Ser Glin Phe Lys Ile Leu Val Ser 65 70 7s 8O Lieu. Lieu. Glu Asn. Asn. Ile Tyr Val His Asp Lieu. Lieu. Thir Phe Glin Glin 85 90 95 Ile Thir Thr Val Ser Lys Ala Lys Gly Ala Ser Leu Phe Thr Cys Asp 1OO 105 11 O Lieu Gln His Thr Glu Thr Gly Glu Glu Val Lieu. Arg Met Cys Val Ala 115 12 O 125 Val Llys Llys Llys Lieu. Glin Lieu. Tyr Phe Trp Lys Asp Arg Glu Phe His 13 O 135 14 O Glu Lieu. Glin Gly Asp Phe Ser Val Pro Asp Val Pro Llys Ser Met Ala 145 150 155 160 Trp. Cys Glu Asn. Ser Ile Cys Val Gly Phe Lys Arg Asp Tyr Tyr Lieu. 1.65 17O 17s Ile Arg Val Asp Gly Lys Gly Ser Ile Lys Glu Lieu. Phe Pro Thr Gly 18O 185 19 O
Lys Glin Lieu. Glu Pro Lieu Val Ala Pro Lieu Ala Asp Gly Llys Val Ala 195 2OO 2O5 US 2014/0018338A1 Jan. 16, 2014 65
- Continued
Val Gly Glin Asp Asp Lieu. Thr Val Val Lieu. Asn. Glu Glu Gly Ile Cys 21 O 215 22O Thr Glin Lys Cys Ala Lieu. Asn Trp Thr Asp Ile Pro Val Ala Met Glu 225 23 O 235 24 O His Glin Pro Pro Tyr Ile Ile Ala Val Lieu Pro Arg Tyr Val Glu Ile 245 250 255 Arg Thr Phe Glu Pro Arg Lieu. Lieu Val Glin Ser Ile Glu Lieu. Glin Arg 26 O 265 27 O Pro Arg Phe Ile Thr Ser Gly Gly Ser Asn Ile Ile Tyr Val Ala Ser 27s 28O 285 Asn His Phe Val Trp Arg Lieu. Ile Pro Val Pro Met Ala Thr Glin Ile 29 O 295 3 OO Glin Glin Lieu. Lieu. Glin Asp Llys Glin Phe Glu Lieu Ala Lieu. Glin Lieu Ala 3. OS 310 315 32O Glu Met Lys Asp Asp Ser Asp Ser Glu Lys Glin Glin Glin Ile His His 3.25 330 335 Ile Lys Asn Lieu. Tyr Ala Phe Asn Lieu. Phe Cys Gln Lys Arg Phe Asp 34 O 345 35. O Glu Ser Met Glin Val Phe Ala Lys Lieu. Gly Thr Asp Pro Thr His Val 355 360 365 Met Gly Lieu. Tyr Pro Asp Lieu. Lieu Pro Thir Asp Tyr Arg Lys Glin Lieu. 37 O 375 38O Glin Tyr Pro Asn Pro Lieu Pro Val Lieu. Ser Gly Ala Glu Lieu. Glu Lys 385 390 395 4 OO Ala His Lieu Ala Lieu. Ile Asp Tyr Lieu. Thr Glin Lys Arg Ser Glin Lieu 4 OS 41O 415 Val Llys Llys Lieu. Asn Asp Ser Asp His Glin Ser Ser Thir Ser Pro Lieu 42O 425 43 O Met Glu Gly Thr Pro Thir Ile Llys Ser Lys Llys Llys Lieu. Lieu. Glin Ile 435 44 O 445 Ile Asp Thir Thr Lieu Lleu Lys Cys Tyr Lieu. His Thr Asn. Wall Ala Lieu. 450 45.5 460 Val Ala Pro Lieu. Lieu. Arg Lieu. Glu Asn. Asn His Cys His Ile Glu Glu 465 470 47s 48O Ser Glu. His Val Lieu Lys Lys Ala His Llys Tyr Ser Glu Lieu. Ile Ile 485 490 495 Lieu. Tyr Glu Lys Lys Gly Lieu. His Glu Lys Ala Lieu. Glin Val Lieu Val SOO 505 51O Asp Glin Ser Lys Lys Ala Asn. Ser Pro Lieu Lys Gly. His Glu Arg Thr 515 52O 525 Val Glin Tyr Lieu Gln His Leu Gly Thr Glu Asn Lieu. His Lieu. Ile Phe 53 O 535 54 O Ser Tyr Ser Val Trp Val Lieu. Arg Asp Phe Pro Glu Asp Gly Lieu Lys 5.45 550 555 560 Ile Phe Thr Glu Asp Lieu Pro Glu Val Glu Ser Lieu Pro Arg Asp Arg 565 st O sts Val Lieu. Gly Phe Lieu. Ile Glu Asn. Phe Lys Gly Lieu Ala Ile Pro Tyr 58O 585 59 O Lieu. Glu. His Ile Ile His Val Trp Glu Glu Thr Gly Ser Arg Phe His 595 6OO 605
Asn. Cys Lieu. Ile Glin Lieu. Tyr Cys Glu Lys Val Glin Gly Lieu Met Lys