Biology 2: Concepts in Genetics

Genetics Spring 2014 Examples of Questions for the Third Exam

Answers to study questions will not be provided by the instructor during Question and Answers discussions before the exam. During the “Q and A” class meeting, you’ll be able to discuss them with your classmates, with the instructor acting as a moderator of the discussion. There should be no complaints about this arrangement! (The reasonable alternative is that you see none of the questions before the exam.)

I encourage you to discuss these amongst yourselves, use your textbook, notes and class handouts (see the course website). Please do not ask the instructor to recite the answers. The goal here is learning and critical thinking, not whether you can recite what the teacher says. You may ask the instructor to clarify a question if it is unclear, or for guidance in understanding concepts you need to answer certain questions. Be certain that you understand this: the point here is not that you shouldn't ask for help, but instead that you bear the badge of effort. If you're lost, ask for help.

Be advised that you are expected to have completely read the syllabus by now, including information about the exams. One question on the exam will be based on your general understanding of the course syllabus.

Advice

You are obligated to cover completed answers. If you are observed not covering completed answers, you may receive a score of zero for the exam.

Be concise in answering the questions: about 1/3 to 1/2 a page is enough for any of them. Note well: being concise does not mean giving a minimal answer. You should give sufficient detail, and use appropriate terminology correctly.

For short-answer questions, show your work or support your conclusions. In other words, you should demonstrate that you understand how you reached your answer.

The exam is intended to be an approximate 90 minute exam, for students who are adequately prepared. However, you should be careful to pace yourself during the exam. In most cases you are better off answering all questions, even if some of them incompletely or incorrectly. Leaving short answer questions blank because you ran out of time is usually worse for your exam score.

What’s important? See the lecture notes, lab handouts, and assigned readings for important concepts. If we spent time with a concept in class or it appears in handouts, it’s fair game for the exam.

For questions that involve use of symbols, provide a key for any symbols that are not defined in the question itself. For example, if you use the symbols C and c to represent alleles of a gene, you should provide a description of the traits determined by each allele. (Note that the instructor is not a mind reader.)

Figures or tables may be appropriate for some questions. Figures must be large and neatly labeled. Tables must have labeled columns and rows.

Be prepared to use terminology, and use it correctly. For example, you must understand the meaning of the term double heterozygote to explain Mendel’s experiments demonstrating Independent Assortment. It’s too easy to veer off course when you don’t know the correct term for a concept and instead try to explain it in common language.

Questions:

These are examples of questions that represent the types of questions that could appear on the exam. It is not a comprehensive guide to what might appear on the exam. See the lecture notes, lab handouts, and assigned readings for other important concepts.

1. In a short paragraph or two, contrast each of the following pairs of concepts: a. Conservative replication vs. semiconservative replication b. Lagging strand vs. leading strand

2. In a short paragraph or two, contrast each of the following pairs of concepts: a. polymerase vs. ligase b. helicase vs. primase

3. In a short paragraph or two, discuss the significance of the following scientists’ experiments/findings: a. Franklin b. Hershey and Chase

4. In a short paragraph or two, discuss the significance of the following scientists’ experiments/findings: a. Watson and Crick b. Griffith

5. In a short paragraph or two, contrast each of the following pairs of concepts: a. RNA polymerase vs. DNA polymerase b. mRNA vs tRNA

6. In a short paragraph or two, contrast each of the following pairs of concepts: a. introns vs. exons b. codon vs anticodon

7. Describe nucleotide structure. Contrast differences between RNA and DNA nucleotides, include specific components and their attachment sites to one another.

8. In a paragraph and a supplementary labeled figure, briefly describe how the Meselson- Stahl experiment showed that DNA replication is semiconservative.

9. Sketch a labeled figure showing one replication fork and the synthesis of one leading strand and two lagging strand fragments of DNA in the replication bubble. Label the 5’ and 3’ ends of all DNA strands shown in your figure. Also label any DNA polymerases, DNA helicases, primases and primers. (For this question you may assume that lagging strands have not been joined.)

10. Describe the three mechanisms that help ensure DNA replicates accurately.

11. If DNA synthesis occurs without error, the resulting double-stranded DNA is an exact copy of the original double-stranded DNA (exact in that the base sequences are identical). Does this mean then that in DNA synthesis, the two single-stranded templates are identical? Explain. 12. List and briefly describe the three steps of PCR.

13. Pedro is no PCR prodigy, and unfortunately, he is your lab partner. The instructions you are given tell you to use ten 36-minute cycles of denaturation, annealing and extension, with each stage of a cycle being of equal duration (12, 12 and 12 minutes). Pedro suggests that you simplify the process, and instead use one long cycle totaling 360 minutes, with each stage of the cycle being 120 minutes in length. What would you say

to Pedro to convince him that his suggestion will not result in satisfactory PCR products?

14. Explain the 3 necessary components of a cloning vector.

15. You are interested in a particular segment of rhinoceros DNA and would like to clone it into a cloning plasmid. You have the following restriction map of the region that includes the DNA of interest and the plasmid (E = EcoRI, H = HindIII, X = XbaI, S = SphI, N = NotI). Which restriction enzymes would you choose to clone most easily the DNA of interest into the cloning vector? (and explain your answer) 16. You are handling a paternity lawsuit brought against five potential fathers by a woman. You isolated DNA from the mother, the child, and all the potential fathers. After using PCR to amplify specific polymorphic loci from each individual, you fractionate the amplified products on an agarose gel and stain with ethidium bromide to visualize the DNA fingerprints (shown below). Mo = mother; Ch = child; M1–M5 = potential fathers. Do these results confirm that any of the men are the child’s biological father? Explain your answer.

17. In DNA synthesis, all base pairs of a genome are replicated. In the production of RNA, only a selected portion of bases of DNA in a genome are transcribed. Explain how the process of transcription selectively results in a particular gene being transcribed into mRNA. Use appropriate terminology in your answer.

18. Compare and contrast rho-dependent and rho-independent termination.

19. Consider the following coding strand DNA sequence in the beginning of a transcription unit:

Promotor region

5ʹ AATGTCTAAAATGTTGACGAAACCTGACTCGTCATCGA… 3ʹ

Provide the RNA transcribed from this sequence (don’t forget polarity).

20. A RNA molecule has the following sequence: 5ʹ AUUGCAUUGCUAAGCGCGUCA 3ʹ

Provide the corresponding DNA sequence (both strands). Provide polarity of the strands, and indicate which is the template strand and which is the coding strand.