General Genetics Exam 3 Multiple Choice

BioSc 231 General Genetics Exam 3 Name ______

Multiple Choice. (2 points each)

_____The base thymine is always paired with ___.

A. Adenine B. Guanine C. Cytosine D. Thymine

_____The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be

A. 5’ AGCTAG 3’ B. 5’ TCGATC 3’ C. 5’ CTAGCT 3’ D. 5’ GCTAGC 3’ E. 5’ GATCGA 3

_____ DNA polymerase III is thought to add nucleotides

A. to the 5' end of the RNA primer B. to the 3' end of the RNA primer C. in the place of the primer RNA after it is removed D. on single stranded templates without need for an RNA primer E. in the 3' to 5' direction

_____ DNA replication in vivo is discontinuous due to

A. polymerase slippage B. trinucleotide repeats C. being restricted to synthesis in the 5' to 3' direction D. topoisomerases cutting the DNA in a random fashion E. sister chromatid exchange

_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?

A. ionic B. covalent C. Van der Waals D. hydrogen E. hydrophobic and hydrophilic

_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains.

A. origin of replication B. restriction endonuclease C. palindrome D. primer E. promoter

_____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.

A. origin of replication B. convertase C. primase D. ligase E. topoisomerase ______is an enzyme that catalyzes the formation of a covalent bond between adjacent 5'-P and 3'-OH termini of separate fragments of DNA.

A. origin of replication B. convertase C. primase D. ligase E. topoisomerase

______are enzymes that introduce single strand breaks, change the relationship of the strands and then seal the break to remove underwinding or overwinding of the DNA helix.

A. helicases B. twistases C. shoutases D. topoisomerases E. ligases

_____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds.

A. phosphodiester B. hydrogen C. hydrophobic D. hydrophilic E. ionic

_____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material?

A. It must carry all of the information needed to direct the specific organization and metabolic activities of the cell B. It must replicate accurately so that the information it contains is precisely inherited by the daughter cells C. It must be capable of undergoing occasional mutations, such that the information it carries is altered in a heritable way D. It must have highly repetitive DNA sequences. E. All are essential attributes of useful genetic material.

_____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called

A. Nucleosomes B. Euchromatin C. Chromatids D. Heterochromatin E. 30 nm chromatin

_____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNA

A. Has a single centromere B. Has telomeres C. Is circular D. Does not undergo supercoiling

_____ A chromosome with its centromere in the terminal end is a

A. Submetacentric chromosome B. Metacentric chromosome C. Acrocentric chromosome D. Telocentric chromosome _____ Which of the following is true regarding RNA processing?

A. Spliceosomes are present in organelles and nuclei B. Involves removal of exons C. Involves removal of one or more introns. D. Occurs in prokaryotes E. None of the above

_____ Which of the following features is common to both DNA replication and transcription?

A. Nucleotides are added to the 5' end of the newly synthesized strand B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate C. Deoxyribonucleotides are incorporated into the growing sequence D. Both RNA and DNA polymerase require oligonucleotide priming E. Both RNA and DNA polymerase initiate at promoter sequences

_____ Normal self-termination of transcription occurs due to the presence of

A. stem-loop sequences in mRNA B. Termination proteins C. Multiple RNA polymerase molecules D. Polyribosome formation

_____ The four ribonucleotide triphosphates incorporated into mRNA are

A. Inosine, Guanine, Uracil, Thymine B. Adenine, Guanine, Cytosine, Thymine C. Cytosine, Uracil, Adenine, Guanine D. Thymine, Uracil, Guanine, Cytosine E. Inosine, Guanine, Adenine, Cytosine

_____ To describe the genetic code as degenerate indicates that

A. mRNA is rapidly degraded B. The code is not universal among organisms C. Some amino acids have more than one codon D. Frameshift mutations are tolerated E. Stop codons may have corresponding tRNA molecules

_____ Which of the following is unique to eukaryotic mRNA synthesis?

A. Polycistronic mRNA B. Coupled transcription-translation C. Removal of introns D. Polysomes

_____ Which of the following is unique to prokaryotic mRNA synthesis?

A. Coupled transcription-translation B. Exon processing C. 3' polyadenylation D. mRNA capping E. Promoter sequences

_____ Which of the following is true regarding the machinery of translation?

A. Initiation usually begins at an AUG codon B. Eukaryotes have nuclear ribosomes C. Polycistronic mRNA usually has a single ribosome binding site D. tRNAs released from the ribosome are degraded E. Termination is at inverted repeats _____ Nutritional mutants

A. Grow on minimal medium B. Lack an essential metabolic protein C. Are also called prototrophs D. Are the same as carbon-source mutants E. Are usually antibiotic resistant

_____ The process of producing a RNA polymer from a DNA template is called __.

A. replication B. transcription C. translation D. duplication

_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.

A. replication B. transcription C. translation D. duplication

_____ Which of the following is not true for histones?

A. They are rich in basic amino acids B. They are associated with the nucleosome. C. H1, H2, H3 and H4 form the nucleosome core. D. They are found in the nucleus. E. H1 functions as a monomer.

_____ Which of the following is not true about chromosome structure?

A. A telomere is always on the end of a eukaryotic chromosome. B. A centromere is always in the middle of a eukaryotic chromosome C. A chromatid is a chromosome that has been replicated but has not yet separated from its sister chromatid. D. The kinetichore is the site of attachment of the centromere to the nuclear spindle apparatus. E. Heterochromatin are primarily associated with the centromere and telomere regions.

Short Answer. (variable points)

The table to the right shows the results of a series of experiments Compound tested to determine the sequence of intermediates in a biochemical pathway. 5 independent auxotrophic mutants which all require compound G (an amino acid) as a nutritional supplement were M analyzed with 5 compounds that are precursors in the synthesis of A B C D E G compound G. Each mutant was grown on a minimal medium supplemented with each of the indicated compounds. + indicates u growth that is supported by the indicated precursor. What is the 1 - - - + - + order of the intermediates in the pathway and indicate which step t in the pathway is catalyzed by each mutant. a 2 - + - + - + n 3 - - - - - + t 4 - + + + - + 5 + + + + - + The following 5 questions refer to the numbers on this figure.

A. What end (5' or 3') of the molecule is indicated by arrow number 1?

B. What end (5' or 3') of the molecule is indicated by arrow number 8?

C. What kind of nucleic acid is indicated by arrow number 4?

D. What do you call the short DNA fragments indicated by arrow number 5?

E. What enzyme functions to join the short fragments indicated by arrow number 6?

F. Which enzyme is indicated by arrow number 2?

Translate the following mRNA

5’ GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU

GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’ Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication. Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form. The bacteria were then transferred to a medium that only contained the light form of nitrogen. At different time points, DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the experiment, after 1 generation, after 2 generations and after 4 generations.

Starting DNA.

1 Generation

2 Generations

4 Generations

Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group. Short Essay (6pts). Answer one of the following three questions.

1. List the enzymes and proteins involved in DNA replication. Describe the function of each.

2. Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells. Include all proteins involved in forming the structure and all intermediate structures

3. Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a prokaryote).

A) Promoter -10 and -35 B) AUG C) Ribosome binding site D) Coding sequence E) Transcriptional terminator F) Amino and carboxyl ends of the resulting protein. Bonus question. (4 pts)

One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. A nucleotide analog has a structure and function similar to a nucleotide. Some of the nucleotide analogs being used to treat HIV infections are called dideoxy nucleotides. Dideoxy nucleotides include a ribose sugar that lacks both a 2’ and 3’ hydroxyl group. Based on what you know about nucleic acid synthesis, what effect do you think these analogs have on viral nucleic acid synthesis.